Science.gov

Sample records for activates cyclic-amp response

  1. Fibroblast growth factor and cyclic AMP (cAMP) synergistically activate gene expression at a cAMP response element.

    PubMed Central

    Tan, Y; Low, K G; Boccia, C; Grossman, J; Comb, M J

    1994-01-01

    Growth factors and cyclic AMP (cAMP) are known to activate distinct intracellular signaling pathways. Fibroblast growth factor (FGF) activates ras-dependent kinase cascades, resulting in the activation of MAP kinases, whereas cAMP activates protein kinase A. In this study, we report that growth factors and cAMP act synergistically to stimulate proenkephalin gene expression. Positive synergy between growth factor- and cAMP-activated signaling pathways on gene expression has not been previously reported, and we suggest that these synergistic interactions represent a useful model for analyzing interactions between these pathways. Transfection and mutational studies indicate that both FGF-dependent gene activation and cAMP-dependent gene activation require cAMP response element 2 (CRE-2), a previously characterized cAMP-dependent regulatory element. Furthermore, multiple copies of this element are sufficient to confer FGF regulation upon a minimal promoter, indicating that FGF and cAMP signaling converge upon transcription factors acting at CRE-2. Among many different ATF/AP-1 factors tested, two factors, ATF-3 and c-Jun, stimulate proenkephalin transcription in an FGF- or Ras-dependent fashion. Finally, we show that ATF-3 and c-Jun form heterodimeric complexes in SK-N-MC cells and that the levels of both proteins are increased in response to FGF but not cAMP. Together, these results indicate that growth factor- and cAMP-dependent signaling pathways converge at CRE-2 to synergistically stimulate gene expression and that ATF-3 and c-Jun regulate proenkephalin transcription in response to both growth factor- and cAMP-dependent intracellular signaling pathways. Images PMID:7935470

  2. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  3. The Interplay between Cyclic AMP, MAPK, and NF-?B Pathways in Response to Proinflammatory Signals in Microglia

    PubMed Central

    Ghosh, Mousumi; Aguirre, Vladimir; Wai, Khine; Felfly, Hady; Dietrich, W. Dalton; Pearse, Damien D.

    2015-01-01

    Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-? and IL-1?, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-? stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-? produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-?B in this regulation. Following TNF-? there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-?B-p65, I?B degradation, and NF-?B p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-?B activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease. PMID:25722974

  4. Mutants of PC12 cells with altered cyclic AMP responses

    SciTech Connect

    Block, T.; Kon, C.; Breckenridge, B.M.

    1984-10-01

    PCl2 cells, derived from a rat pheochromocytoma, were mutagenized and selected in media containing agents known to elevate intracellular concentrations of cyclic AMP (cAMP). More than 40 clones were isolated by selection with cholera toxin or 2-chloroadenosine or both. The variants that were deficient in accumulating cAMP were obtained by using a protocol in which 1 ..mu..m 8-bromo-cAMP was included in addition to the agonist. Certain of these variants were partially characterized with respect to the site of altered cAMP metabolism. The profiles of adenylate cyclase activity responsiveness of certain variants to guanosine-5'-(BETA,..gamma..-imido) triphosphate and to forskolin resembled those of UNC and cyc phenotypes of S49 lymphoma cells, which are functionally deficient in the GTP-sensitive coupling protein, N/sub s/. Other variants were characterized by increased cyclic nucleotide phosphodiesterase activity at low substrate concentration. Diverse morphological traits were observed among the variants, but it was not possible to assign them to a particular cAMP phenotype. Two revertants of a PCl2 mutant were isolated and observed to have regained a cellular cAMP response to 2-chloroadenosine and to forskolin. It is hoped that these PCl2 mutants will have utility for defining cAMP-mediated functions, including any links to the action of nerve growth factor, in cells derived from the neural crest.

  5. Thromboxane A2 promotes interleukin-6 biosynthesis mediated by an activation of cyclic AMP-response element-binding protein in 1321N1 human astrocytoma cells.

    PubMed

    Obara, Yutaro; Kurose, Hitoshi; Nakahata, Norimichi

    2005-09-01

    1321N1 human astrocytoma cells express thromboxane A2 (TXA2) receptors (TP). However, physiological consequences of TXA2 signaling in glial cells remain unclear. Herein, we show that TXA2 promotes interleukin-6 (IL-6) biosynthesis in glial cells. A TP agonist, 9,11-dideoxy-9alpha,11alpha-methanoepoxy-prosta-5Z,13E-dien-1-oic acid (U46619), enhanced IL-6 production in both 1321N1 cells and cultured mouse astrocytes. It has been shown that IL-6 gene expression is regulated by various transcription factors. Among them, we found a significant increase in cyclic AMP-response element-binding protein (CREB) activity with its phosphorylation at Ser133 by U46619 in 1321N1 cells. Although U46619 increased IL-6 promoter activity, a mutation at cyclic AMP-response element (CRE) on the promoter clearly suppressed the effect, suggesting that CRE is involved in U46619-induced IL-6 expression. Furthermore, both CREB and IL-6 promoter activities were suppressed by SB203580 [4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)-1H-imidazole], a p38 mitogen-activated protein kinase (MAPK) inhibitor, and H89 [N-[2-(4-bromocinnamylamino)-ethyl]-5-isoquinoline], a protein kinase A (PKA) inhibitor, indicating involvements of p38 MAPK and PKA in CREB activation and IL-6 expression. To determine which G-proteins are implicated in the U46619-induced IL-6 synthesis, the interfering mutants of Galpha(q), Galpha12, or Galpha13 by were overexpressed in 1321N1 cells adenoviral approach. It is noteworthy that the Galpha(q) or Galpha13 mutant blocked the IL-6 production by U46619. The constitutively active mutant of Galpha(q), Galpha12, or Galpha13 enhanced IL-6 production, indicating that Galpha(q) and Galpha13 were involved in U46619-induced IL-6 production. In conclusion, TXA2 enhances the IL-6 biosynthesis via the PKA p38 MAPK/CREB pathway in 1321N1 cells. IL-6 induction depends on Galpha(q) and Galpha13 as well. This is the first report showing TP-mediated IL-6 production in glial cells. PMID:15967875

  6. Induction of cyclooxygenase-2 by ginsenoside Rd via activation of CCAAT-enhancer binding proteins and cyclic AMP response binding protein

    SciTech Connect

    Jeong, Hye Gwang; Pokharel, Yuba Raj; Han, Eun Hee; Kang, Keon Wook . E-mail: kwkang@chosun.ac.kr

    2007-07-20

    Panax ginseng is a widely used herbal medicine in East Asia and is reported to have a variety of pharmacological effects against cardiovascular diseases and cancers. Here we show a unique effect of ginsenoside Rd (Rd) on cyclooxygenase-2 (COX-2) expression in RAW264.7 macrophages. Rd (100 {mu}g/ml), but not other ginsenosides induced COX-2 and increased prostaglandin E{sub 2} production. Gel shift and Western blot analyses using nuclear fractions revealed that Rd increased both the DNA binding of and the nuclear levels of CCAAT/enhancer binding protein (C/EBP){alpha}/{beta} and cyclic AMP response element binding protein (CREB), but not of p65, in RAW264.7 cells. Moreover, Rd increased the luciferase reporter gene activity in cells transfected with a 574-bp mouse COX-2 promoter construct. Site-specific mutation analyses confirmed that Rd-mediated transcriptional activation of COX-2 gene was regulated by C/EBP and CREB. These results provide evidence that Rd activated C/EBP and CREB, and that the activation of C/EBP and CREB appears to be essential for induction of COX-2 in RAW264.7 cells.

  7. Temporal Effect of Adrenocorticotrophic Hormone on Adrenal Glucocorticoid Steroidogenesis: Involvement of the Transducer of Regulated Cyclic AMP-Response Element-Binding Protein Activity

    PubMed Central

    Spiga, F; Liu, Y; Aguilera, G; Lightman, S L

    2011-01-01

    The availability of active steroidogenic acute regulatory protein (StAR) and side-chain cleavage cytochrome P450 (P450scc) are rate-limiting steps for steroidogenesis. Transcription of StAR and P450scc genes depends on cyclic AMP-response element-binding protein (CREB) phosphorylation and CREB co-activator, transducer of regulated CREB activity (TORC), which is regulated by salt-inducible kinase 1 (SIK1). In the present study, we investigated the relationship between TORC activation and adrenocorticotrophic hormone (ACTH)-induced steroidogenesis in vivo, by examining the time-course of the effect of ACTH injection (4 ng, i.v.) on the transcriptional activity of StAR and P450scc genes and the nuclear accumulation of transducer of regulated CREB activity 2 (TORC2) in rat adrenal cortex. ACTH produced rapid and transient increases in plasma corticosterone, with maximal responses between 5 and 15 min, and a decrease to almost basal values at 30 min. StAR and P450scc hnRNA levels increased 15 min following ACTH and decreased toward basal values at 30 min. Concomitant with an increase in nuclear phospho-CREB, ACTH injection induced nuclear accumulation of TORC2, with maximal levels at 5 min and a return to basal values by 30 min. The decline of nuclear TORC2 was paralleled by increases in SIK1 hnRNA and mRNA 15 and 30 min after injection, respectively. The early rises in plasma corticosterone preceding StAR and P450scc gene transcription suggest that post-transcriptional and post-translational changes in StAR protein mediate the early steroidogenic responses. Furthermore, the direct temporal relationship between nuclear accumulation of TORC2 and the increase in transcription of steroidogenic proteins, implicates TORC2 in the physiological regulation of steroidogenesis in the adrenal cortex. The delayed induction of SIK1 suggests a role for SIK1 in the declining phase of steroidogenesis. PMID:21083631

  8. The response induced by intracellular cyclic AMP in isolated olfactory receptor cells of the newt.

    PubMed Central

    Kurahashi, T

    1990-01-01

    1. Responses induced by intracellular cyclic nucleotides were analysed in isolated olfactory receptor cells of the newt under a voltage-clamp condition by using the patch pipette in a whole-cell recording configuration. Cyclic nucleotides were applied by diffusion from the patch pipette. 2. Introduction of either cyclic AMP or cyclic GMP caused a transient inward current in cells held at -50 mV. The response amplitude was dose-dependent with the Hill coefficient of 3 and half-saturating concentration of 300 microM (concentration in the pipette) for both cyclic AMP and cyclic GMP. Cyclic CMP was less effective than those two nucleotides. 3. The response to intracellular cyclic AMP was seen in all cilia-bearing cells, but not in cells which lost the cilia during dissociation. The response latency was shorter when cyclic AMP was introduced into the ciliated terminal swelling (ca 0.2 s) rather than into the cell body (ca 1.4 s). These results suggest that the sensitivity to intracellular cyclic AMP is confined to the cilia. 4. The cyclic AMP-induced current was transient (half decay time, ca 2.3s) despite the fact that cyclic AMP was continuously loaded from the patch pipette. The response time course was controlled by Ca2+; the reduction of external Ca2+ concentration (replaced with Mg2+) or loading the cell with 50 mM-EGTA prolonged the cyclic AMP-induced responses. The Ca2(+)-induced suppression was reversible. 5. The reversal potential of the cyclic AMP-induced transient current was -4.8 +/- 3.8 mV, and that of the current re-induced by Ca2+ removal was 1.5 +/- 2.1 mV, suggesting that both currents flowed through the same ionic channel. The channel permeates all alkali metal ions with the permeability ratios of PLi:PNa:PK:PRb:PCs = 0.93:1:0.93:0.91:0.72, but not Cl- or choline ions. 6. These results demonstrate that the cyclic AMP-induced response and the odorant-induced response of the isolated olfactory cell have nearly identical characteristics. The present study supports the notion that cyclic AMP is the internal messenger mediating olfactory transduction. PMID:1707967

  9. Repeated predictable or unpredictable stress: effects on cocaine-induced locomotion and cyclic AMP-dependent protein kinase activity.

    PubMed

    Araujo, Ana Paula N; DeLucia, Roberto; Scavone, Cristoforo; Planeta, Cleopatra S

    2003-02-17

    Stressful experiences appear to have a strong influence on susceptibility to drug taking behavior. Cross-sensitization between stress and drug-induced locomotor response has been found. Locomotor response to novelty or cocaine (10 mg/kg, i.p.), cyclic AMP-dependent protein kinase (PKA) activity in the nucleus accumbens and basal corticosterone levels were evaluated in male adult rats exposed to acute and chronic predictable or unpredictable stress. Rats exposed to a 14-day predictable stress showed increased locomotor response to novelty and to cocaine, whereas rats exposed to chronic unpredictable stress demonstrated increased cyclic AMP-dependent PKA activity in the nucleus accumbens. Both predictable and unpredictable stress increased basal corticosterone plasma levels. These experiments demonstrated that stress-induced early cocaine sensitization depends on the stress regime and is apparently dissociated from stress-induced changes in cyclic AMP-dependent PKA activity and corticosterone levels. PMID:12642178

  10. Cyclic AMP.

    PubMed Central

    Steer, M L

    1976-01-01

    Cyclic AMP is believed to be the intracellular agent which mediates the action of many hormones on their target cell. The mechanisms by which the nucleotide controls glycogen metabolism in liver and skeletal muscle seem to be firmly established. Data relevant to this area of research are selectively reviewed. In addition, the evidence is reviewed for and against a role for cyclic AMP in the regulation of a variety of other cellular functions including: cardiac contractility, smooth muscle relaxation, platelet aggregation, salivary gland amylase secretion, pancreatic exocrine secretion, and gastric acid secretion. PMID:180915

  11. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  12. Protein O-N-acetylglucosaminylation modulates promoter activities of cyclic AMP response element and activator protein 1 and enhances E-selectin expression on HuH-7 human hepatoma cells.

    PubMed

    Azuma, Yutaro; Miura, Kana; Higai, Koji; Matsumoto, Kojiro

    2007-12-01

    High glucose accelerates O-N-acetylglucosaminylation (O-GlcNAcylation) of proteins and causes diabetic complications. In the present study, we found that treatment of HuH-7 human hepatoma cells with high glucose or the protein O-N-acetylglucosaminidase (O-GlcNAcase) inhibitor O-(2-acetoamide-2-deoxy-D-glucopyranosylidene)amino-N-phenylcarbamate (PUGNAc) increased the cell surface expression of E-selectin. A dual luciferase reporter assay indicated that high glucose and PUGNAc suppressed promoter activities of the cyclic AMP response element (CRE) and enhanced those of activator protein 1 (AP-1). Enhanced CRE promoter activities in HuH-7 cells treated with dibutyryl cAMP or co-transfected with a protein kinase A expression vector pFC-PKA that enhances the phosphorylation of CRE binding protein (CREB) were suppressed by PUGNAc. In contrast, PUGNAc further increased the enhanced AP-1 promoter activity in cells transfected with a mitogen-activated protein kinase kinase kinase expression vector pFC-MEKK that enhances c-Jun phosphorylation. Immuno-blotting using an anti-O-GlcNAc antibody revealed that high glucose and PUGNAc accelerated protein O-GlcNAcylation and that there were substantial differences in the O-GlcNAcylated proteins in the cytoplasmic and nuclear fractions. In addition, PUGNAc increased the nuclear import of O-GlcNAcylated CREB. These results suggest that protein O-GlcNAcylation modulates the promoter activities of E-selectin gene, suppression of CRE and enhancement of AP-1, and enhances E-selectin protein expression on hepatocytes. PMID:18057713

  13. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    ERIC Educational Resources Information Center

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the

  14. Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus

    ERIC Educational Resources Information Center

    Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

    2008-01-01

    We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

  15. TauCstF-64 Mediates Correct mRNA Polyadenylation and Splicing of Activator and Repressor Isoforms of the Cyclic AMP-Responsive Element Modulator (CREM) in Mouse Testis.

    PubMed

    Grozdanov, Petar N; Amatullah, Atia; Graber, Joel H; MacDonald, Clinton C

    2016-02-01

    Spermatogenesis is coordinated by the spatial and temporal expression of many transcriptional and posttranscriptional factors. The cyclic AMP-responsive element modulator (CREM) gene encodes both activator and repressor isoforms that act as transcription factors to regulate spermiogenesis. We found that the testis-expressed paralog of CstF-64, tauCstF-64 (gene symbol Cstf2t), is involved in a polyadenylation site choice switch of Crem mRNA and leads to an overall decrease of the Crem mRNAs that are generated from internal promoters in Cstf2t(-/-) mice. More surprisingly, loss of tauCstF-64 also leads to alternative splicing of Crem exon 4, which contains an important activation domain. Thus, testis-specific CREMtau2 isoform protein levels are reduced in Cstf2t(-/-) mice. Consequently, expression of 15 CREM-regulated genes is decreased in testes of Cstf2t(-/-) mice at 25 days postpartum. These effects might further contribute to the infertility phenotype of these animals. This demonstrates that tauCstF-64 is an important stage-specific regulator of Crem mRNA processing that modulates the spatial and temporal expression of downstream stage-specific genes necessary for the proper development of sperm in mice. PMID:26700942

  16. Bacterial Cyclic AMP-Phosphodiesterase Activity Coordinates Biofilm Formation

    PubMed Central

    Kalivoda, Eric J.; Brothers, Kimberly M.; Stella, Nicholas A.; Schmitt, Matthew J.; Shanks, Robert M. Q.

    2013-01-01

    Biofilm-related infections are a major contributor to human disease, and the capacity for surface attachment and biofilm formation are key attributes for the pathogenesis of microbes. Serratia marcescens type I fimbriae-dependent biofilms are coordinated by the adenylate cyclase, CyaA, and the cyclic 3′,5′-adenosine monophosphate (cAMP)-cAMP receptor protein (CRP) complex. This study uses S. marcescens as a model system to test the role of cAMP-phosphodiesterase activity in controlling biofilm formation. Herein we describe the characterization of a putative S. marcescens cAMP-phosphodiesterase gene (SMA3506), designated as cpdS, and demonstrated to be a functional cAMP-phosphodiesterase both in vitro and in vivo. Deletion of cpdS resulted in defective biofilm formation and reduced type I fimbriae production, whereas multicopy expression of cpdS conferred a type I fimbriae-dependent hyper-biofilm. Together, these results support a model in which bacterial cAMP-phosphodiesterase activity modulates biofilm formation. PMID:23923059

  17. Cyclic AMP stimulates Mrp2 translocation by activating p38? MAPK in hepatic cells

    PubMed Central

    Schonhoff, Christopher M.; Webster, Cynthia R. L.

    2010-01-01

    Cyclic AMP (cAMP) induces translocation of multidrug resistant protein 2 (Mrp2) to the canalicular membrane and activates p38 MAPK in rat hepatocytes. In this study, we tested the hypothesis that cAMP-induced Mrp2 translocation may be mediated via p38 MAPK. Studies were conducted in rat hepatocytes and in a human hepatoma cell line, HuH-7. In rat hepatocytes, cAMP increased Mrp2 translocation and p38 MAPK activity. These effects of cAMP were inhibited by SB203580, an inhibitor of p38 MAPK. Wortmannin, a specific inhibitor of phosphoinositide-3-kinase (PI3K), did not inhibit cAMP induced activation of p38 MAPK, indicating PI3K-independent activation of p38 MAPK by cAMP. To further define the role of p38 MAPK, molecular approaches were used to up- or downregulate p38 MAPK activity in HuH-7 cells using constitutively active (CA) and dominant-negative (DN) MAPK kinase 3 and 6 (MKK3/6). MKK3/6 are upstream kinases responsible for the activation of p38 MAPK. Cells transfected with CAMKK6 showed increased p38 MAPK activity and MRP2 translocation compared with empty vector. cAMP-induced activation of p38 MAPK was inhibited in cells transfected with DNMKK3/6 and DNMKK3, but not with DNMKK6. DNMKK3/6 and DNMKK3 also inhibited cAMP-induced MRP2 translocation. cAMP selectively activated p38? MAPK in HuH-7 cells. Knockdown of p38? MAPK by short heterodimer RNA resulted in decreased level of p38 MAPK and failure of cAMP to stimulate MRP2 translocation. Taken together, these results suggest that cAMP-induced MRP2 translocation in hepatic cells is mediated via PI3K-independent and MKK3-mediated activation of p38? MAPK. PMID:20203059

  18. Effect of cyclic AMP-dependent protein kinase on insulin receptor tyrosine kinase activity.

    PubMed Central

    Tanti, J F; Grémeaux, T; Rochet, N; Van Obberghen, E; Le Marchand-Brustel, Y

    1987-01-01

    To explain the insulin resistance induced by catecholamines, we studied the tyrosine kinase activity of insulin receptors in a state characterized by elevated noradrenaline concentrations in vivo, i.e. cold-acclimation. Insulin receptors were partially purified from brown adipose tissue of 3-week- or 48 h-cold-acclimated mice. Insulin-stimulated receptor autophosphorylation and tyrosine kinase activity of insulin receptors prepared from cold-acclimated mice were decreased. Since the effect of noradrenaline is mediated by cyclic AMP and cyclic AMP-dependent protein kinase, we tested the effect of the purified catalytic subunit of this enzyme on insulin receptors purified by wheat-germ agglutinin chromatography. The catalytic subunit had no effect on basal phosphorylation, but completely inhibited the insulin-stimulated receptor phosphorylation. Similarly, receptor kinase activity towards exogenous substrates such as histone or a tyrosine-containing copolymer was abolished. This inhibitory effect was observed with receptors prepared from brown adipose tissue, isolated hepatocytes and skeletal muscle. The same results were obtained on epidermal-growth-factor receptors. Further, the catalytic subunit exerted a comparable effect on the phosphorylation of highly purified insulin receptors. To explain this inhibition, we were able to rule out the following phenomena: a change in insulin binding, a change in the Km of the enzyme for ATP, activation of a phosphatase activity present in the insulin-receptor preparation, depletion of ATP, and phosphorylation of a serine residue of the receptor. These results suggest that the alteration in the insulin-receptor tyrosine kinase activity induced by cyclic AMP-dependent protein kinase could contribute to the insulin resistance produced by catecholamines. Images Fig. 1. Fig. 3. Fig. 4. Fig. 7. PMID:2822014

  19. TGF-beta 1 induces phosphorylation of the cyclic AMP responsive element binding protein in ML-CCl64 cells.

    PubMed Central

    Kramer, I M; Koornneef, I; de Laat, S W; van den Eijnden-van Raaij, A J

    1991-01-01

    Type beta transforming growth factors represent a family of polypeptides that modulate growth and differentiation. TGF-beta exerts its effects on target cells through interaction with specific cell surface receptors, but the signal transduction pathways are largely unresolved as yet. In this study we report that TGF-beta 1 induces a rapid phosphorylation of the cyclic AMP responsive element binding protein (CREB) in mink lung CCl64 cells. Phosphorylation induced by TGF-beta 1 is not mediated by the cAMP-dependent protein kinase. Parallel to the increase in phosphorylation of CREB, an increase in binding to the collagenase TPA responsive element was observed. CREB participates in the binding to this element, probably as a heterodimer with another as yet unknown protein. The modification imposed on CREB and its involvement in an enhanced TRE-binding could be a mechanism by which TGF-beta 1 induces the TRE-mediated transcriptional activation. Images PMID:1850693

  20. Glucocorticoids activate somatostatin gene transcription through co-operative interaction with the cyclic AMP signalling pathway.

    PubMed Central

    Liu, J L; Papachristou, D N; Patel, Y C

    1994-01-01

    The somatostatin (SS) gene is transcriptionally regulated via the cyclic AMP (cAMP) response element (CRE), located in the proximal promoter (-41 to -48 bp). We have previously reported that glucocorticoids induce dose-dependent cell-specific alterations in the steady-state SS mRNA level. Here we have investigated direct transcriptional control of the SS gene by glucocorticoids. We have examined transcriptional interaction between glucocorticoids and the cAMP signalling pathway and mapped the 5' upstream regulatory region of the SS gene involved in glucocorticoid transactivation. Transcriptional regulation was determined by analysis of chloramphenicol acetyltransferase (CAT) activity in PC12 rat pheochromocytoma cells and A126-1B2 (protein kinase A-deficient mutant PC12) cells, by acute transfection of 5' flanking SS DNA (- 750, -250 and -71 bp) ligated to the reporter (CAT) gene. Dexamethasone (DEX) induced a dose-dependent 2.2-fold stimulation of SS gene transcription in PC12 cells, but not in A126-1B2 cells. Other steroid and thyroid hormones tested, and retinoic acid, were ineffective, while cAMP and forskolin stimulated gene transcription 4-5-fold in PC12 cells but not in A126-1B2 cells. DEX exerted an additive effect on cAMP-induced gene transcription. Deletion of the promoter from -750 to -71 bp (but not from -750 to -250 bp) abolished all stimulatory effects of DEX without affecting cAMP responsiveness. Mutation of the CRE abrogated both DEX- and cAMP-dependent gene enhancement. Gel electrophoretic mobility shift assays confirmed that the -250 to -71 bp region of the SS promoter (but not the -71 to +55 bp domain) binds specifically to a glucocorticoid response element-sensitive nuclear protein(s) from PC12 cells, suggesting a putative glucocorticoid receptor interaction with SS promoter DNA. We conclude that glucocorticoids regulate SS gene transcription positively. Glucocorticoid-induced transactivation shows dependence on protein kinase. A activity, and may be mediated via protein-protein interaction between the glucocorticoid receptor and the CRE binding protein. DNA sequences upstream from the CRE between -250 and -71 bp in the SS promoter appear to be the target of glucocorticoid action. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7914402

  1. Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

    PubMed

    Aung, Htin Lin; Berney, Michael; Cook, Gregory M

    2014-09-01

    Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator. PMID:24936051

  2. Hypoxia-Activated Cytochrome bd Expression in Mycobacterium smegmatis Is Cyclic AMP Receptor Protein Dependent

    PubMed Central

    Aung, Htin Lin; Berney, Michael

    2014-01-01

    Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator. PMID:24936051

  3. Schwann cells stimulated by axolemma-enriched fractions express cyclic AMP responsive element binding protein.

    PubMed

    Lee, M M; Sato-Bigbee, C; De Vries, G H

    1996-10-15

    Both axolemma-enriched fractions (AEF) and cyclic AMP have been shown to regulate the proliferation and differentiation of cultured primary Schwann cells (SC). We have evaluated the role of CREB, a transcription factor that binds to the cAMP-responsive element, in mediating the AEF-stimulated SC proliferation and differentiation. We detected CREB in nuclear extracts derived from SC stimulated with 40 micrograms/ml of AEF for 16, 24, 48, 72, and 96 hr, using a DNA-electrophoretic mobility shift assay. Unstimulated quiescent SC contained low levels of CREB which increased to a maximal level after 48 hr of AEF treatment. Using anti-CREB antibodies and Western blot analysis, after 24 hr of AEF treatment we first detected CREB as a 45 kDa protein which reached a maximal level of expression after 72 hr. Double labeled immunocytochemistry using anti-CREB and anti-5-bromo-2'-deoxy-uridine antibodies demonstrated maximal CREB expression after 72 hr of AEF treatment, closely coinciding with the temporal expression of SC proliferation. At all times examined, all AEF-treated SC labeled by anti-CREB antibodies were also labeled with anti-BrdU antibodies. These observations are consistent with the view that CREB could play an important role in the induction of SC proliferation by AEF. PMID:8915897

  4. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi; Hashimoto, Naohiro

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  5. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity.

    PubMed

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to ?-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to ?-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to ?-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from ?-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. PMID:26655813

  6. Regulation of Cox-2 by cyclic AMP response element binding protein in prostate cancer: potential role for nexrutine.

    PubMed

    Ghosh, Rita; Garcia, Gretchen E; Crosby, Katherine; Inoue, Hiroyasu; Thompson, Ian M; Troyer, Dean A; Kumar, Addanki P

    2007-11-01

    We recently showed that Nexrutine, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP) model. Our data also indicate that the anti-proliferative effects of Nexrutine are emediated in part by Akt and Cyclic AMP response element binding protein (CREB). Cyclooxygenase (Cox-2), a pro-inflammatory mediator, is a CREB target that induces prostaglandin E(2) (PGE(2)) and suppresses apoptosis. Treatment of LNCaP cells with Nexrutine reduced tumor necrosis factor alpha-induced enzymatic as well as promoter activities of Cox-2. Nexrutine also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating Nexrutine response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01). We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like Nexrutine, demonstrating a prospective for development of Nexrutine for prostate cancer management. PMID:18030357

  7. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  8. Microgravity changes in heart structure and cyclic-AMP metabolism

    NASA Technical Reports Server (NTRS)

    Philpott, D. E.; Fine, A.; Kato, K.; Egnor, R.; Cheng, L.

    1985-01-01

    The effects of microgravity on cardiac ultrastructure and cyclic AMP metabolism in tissues of rats flown on Spacelab 3 are reported. Light and electron microscope studies of cell structure, measurements of low and high Km phosphodiesterase activity, cyclic AMP-dependent protein kinase activity, and regulatory subunit compartmentation show significant deviations in flight animals when compared to ground controls. The results indicate that some changes have occurred in cellular responses associated with catecholamine receptor interactions and intracellular signal processing.

  9. Cyclic AMP signalling in Dictyostelium: G-proteins activate separate Ras pathways using specific RasGEFs

    PubMed Central

    Kae, Helmut; Kortholt, Arjan; Rehmann, Holger; Insall, Robert H; Van Haastert, Peter J M; Spiegelman, George B; Weeks, Gerald

    2007-01-01

    In general, mammalian Ras guanine nucleotide exchange factors (RasGEFs) show little substrate specificity, although they are often thought to regulate specific pathways. Here, we provide in vitro and in vivo evidence that two RasGEFs can each act on specific Ras proteins. During Dictyostelium development, RasC and RasG are activated in response to cyclic AMP, with each regulating different downstream functions: RasG regulates chemotaxis and RasC is responsible for adenylyl cyclase activation. RasC activation was abolished in a gefA? mutant, whereas RasG activation was normal in this strain, indicating that RasGEFA activates RasC but not RasG. Conversely, RasC activation was normal in a gefR? mutant, whereas RasG activation was greatly reduced, indicating that RasGEFR activates RasG. These results were confirmed by the finding that RasGEFA and RasGEFR specifically released GDP from RasC and RasG, respectively, in vitro. This RasGEF target specificity provides a mechanism for one upstream signal to regulate two downstream processes using independent pathways. PMID:17380187

  10. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    SciTech Connect

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li . E-mail: lfang@utmb.edu; Li Junfa . E-mail: junfali@cpums.edu.cn

    2006-02-10

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

  11. Lipopeptides activate Gi-proteins in dibutyryl cyclic AMP-differentiated HL-60 cells.

    PubMed Central

    Klinker, J F; Höer, A; Schwaner, I; Offermanns, S; Wenzel-Seifert, K; Seifert, R

    1993-01-01

    Synthetic lipopeptides activate superoxide-anion (O2-) formation in human neutrophils in a pertussis-toxin (PTX)-sensitive manner, suggesting the involvement of G-proteins of the Gi family in the signal-transduction pathway. We compared G-protein activation by lipopeptides and the chemotactic peptide N-formylmethionyl-leucyl-phenylalanine (fMLP) in dibutyryl-cyclic-AMP-differentiated HL-60 cells. The lipopeptide (2S)-2-palmitoylamino-6-palmitoyloxymethyl-7-palmitoyloxy heptanoyl-SK4 (Pam3AhhSK4) and fMLP activated high-affinity GTPase, i.e. the enzymic activity of G-protein alpha-subunits, in HL-60 membranes in a time- and protein-dependent manner, but they had no effect on Mg(2+)-ATPase and Na+/K(+)-ATPase. Pam3AhhSK4 and fMLP increased Vmax. of GTP hydrolysis. Pam3AhhSK4 activated GTP hydrolysis with half-maximal and maximal effects at about 2 microM and 10 microM respectively. Other lipopeptides activated GTP hydrolysis as well. Lipopeptides were less effective than fMLP to activate GTPase. In membranes from PTX-treated cells, the stimulatory effects of lipopeptides and fMLP on GTPase were abolished. In N-ethylmaleimide-treated membranes, the relative stimulatory effect of Pam3AhhSK4 on GTP hydrolysis was enhanced, whereas that of fMLP was diminished. fMLP and Pam3AhhSK4 activated GTPase in an over-additive manner in N-ethylmaleimide-treated membranes. Unlike fMLP, Pam3AhhSK4 did not enhance incorporation of GTP azidoanilide into, and cholera-toxin-catalysed ADP-ribosylation of Gi-protein alpha-subunits in, HL-60 membranes and did not induce rises in cytosolic Ca2+ concentration. Pam3AhhSK4 and fMLP stimulated phosphatidic acid formation in a PTX-sensitive manner. Pam3AhhSK4 itself did not activate O2- formation, but potentiated the stimulatory effects of fMLP. Our data suggest that (i) lipopeptides activate the GTPase of Gi-proteins, (ii) lipopeptides and fMLP activate Gi-proteins differently, (iii) lipopeptides stimulate phospholipase D via Gi-proteins, and (iv) phosphatidic acid formation is not sufficient for activation of O2- formation. Images Figure 4 PMID:8250850

  12. Activation of the adenylyl cyclase/cyclic AMP/protein kinase A pathway in endothelial cells exposed to cyclic strain

    NASA Technical Reports Server (NTRS)

    Cohen, C. R.; Mills, I.; Du, W.; Kamal, K.; Sumpio, B. E.

    1997-01-01

    The aim of this study was to assess the involvement of the adenylyl cyclase/cyclic AMP/protein kinase A pathway (AC) in endothelial cells (EC) exposed to different levels of mechanical strain. Bovine aortic EC were seeded to confluence on flexible membrane-bottom wells. The membranes were deformed with either 150 mm Hg (average 10% strain) or 37.5 mm Hg (average 6% strain) vacuum at 60 cycles per minute (0.5 s strain; 0.5 s relaxation) for 0-60 min. The results demonstrate that at 10% average strain (but not 6% average strain) there was a 1.5- to 2.2-fold increase in AC, cAMP, and PKA activity by 15 min when compared to unstretched controls. Further studies revealed an increase in cAMP response element binding protein in EC subjected to the 10% average strain (but not 6% average strain). These data support the hypothesis that cyclic strain activates the AC/cAMP/PKA signal transduction pathway in EC which may occur by exceeding a strain threshold and suggest that cyclic strain may stimulate the expression of genes containing cAMP-responsive promoter elements.

  13. Glial potassium channels activated by neuronal firing or intracellular cyclic AMP in Helix.

    PubMed Central

    Gommerat, I; Gola, M

    1996-01-01

    1. Cell-attached and whole cell patch clamp experiments were performed on satellite glial cells adhering to the cell body of neurones in situ within the nervous system of the snail Helix pomatia. The underlying neurone was under current or voltage-clamp control. 2. Neuronal firing induced a delayed (20-30 s) persistent (3-4 min) increase in the opening probability of glial K+ channels. The channels were also activated by perfusing the ganglion with a depolarizing high-K+ saline, except when the underlying neurone was prevented from depolarizing under voltage-clamp conditions. 3. Two K(+)-selective channels were detected in the glial membrane. The channel responding to neuronal firing was present in 95% of the patches (n = 393). It had a unitary conductance of 56 pS, a Na+ :K+ permeability ratio < 0.02 and displayed slight inward rectification in symmetrical [K+] conditions. It was sensitive to TEA, Ba2+ and Cs+. The following results refer to this channel as studied in the cell-attached configuration. 4. The glial K+ channel was activated by bath application of the membrane-permeant cyclic AMP derivatives 8-bromo-cAMP and dibutyryl-cAMP, the adenylyl cyclase activator forskolin and the diesterase inhibitors IBMX, theophylline and caffeine. It was insensitive to cyclic GMP activators and to conditions that might alter the intracellular [Ca2+] (ionomycin, low-Ca2+ saline and Ca2+ channel blockers). 5. The forskolin-induced changes in channel behaviour (open and closed time distributions, burst duration, short and long gaps within bursts) could be accounted for by a four-state model (3 closed states, 1 open state) by simply changing one of the six rate parameters. 6. The present results suggest that the signal sent by an active neurone to satellite glial cells is confined to the glial cells round that neurone. The effect of this signal on the class of glial K+ channels studied can be mimicked by an increase in glial cAMP concentration. The subsequent delayed opening of the glial K+ channels does not appear to play a role in siphoning the excess K+ released by active neurones. It is hypothesized that the cAMP-gated glial K+ channels may be involved in the control of glial cell proliferation. PMID:8887773

  14. Identification of a silencer module which selectively represses cyclic AMP-responsive element-dependent gene expression.

    PubMed Central

    Chung, K C; Huang, D; Chen, Y; Short, S; Short, M L; Zhang, Z; Jungmann, R A

    1995-01-01

    The cyclic AMP (cAMP)-inducible promoter from the rat lactate dehydrogenase A subunit gene (LDH A) is associated with a distal negative regulatory element (LDH-NRE) that represses inherent basal and cAMP-inducible promoter activity. The element is of dyad symmetry, consisting of a palindromic sequence with two half-sites, 5'-TCTTG-3'. It represses the expression of an LDH A/chloramphenicol acetyltransferase (CAT) reporter gene in a dose-dependent, orientation- and position-independent fashion, suggesting that it is a true silencer element. Uniquely, it selectively represses cAMP-responsive element (CRE)-dependent transcription but has no effect on promoters lacking a CRE sequence. The repressing action of LDH-NRE could be overcome by cotransfection with LDH A/CAT vector oligonucleotides containing either the LDH-NRE or CRE sequence. This suggests that the reversal of repression was caused by the removal of functional active, limiting transacting factors which associate with LDH-NRE as well as with CRE. Gel mobility shift, footprinting, and Southwestern blotting assays demonstrated the presence of a 69-kDa protein with specific binding activity for LDH-NRE. Additionally, gel supershift assays with anti-CREB and anti-Fos antibodies indicate the presence of CREB and Fos or antigenically closely related proteins with the LDH-NRE/protein complex. We suggest that the LDH-NRE and CRE modules functionally interact to achieve negative modulation of cAMP-responsive LDH A transcriptional activity. PMID:7565766

  15. Evolution of developmental cyclic AMP signalling in the Dictyostelia from an amoebozoan stress response

    PubMed Central

    Schaap, Pauline

    2014-01-01

    The Dictyostelid social amoebas represent one of nature’s several inventions of multicellularity. Though normally feeding as single cells, nutrient stress triggers collection of amoebas into colonies that form delicately shaped fruiting structures in which the cells differentiate into spores and up to three cell types to support the spore mass. Cyclic AMP (cAMP) plays a very dominant role in controlling morphogenesis and cell differentiation in the model species D. discoideum. As a secreted chemoattractant cAMP coordinates cell movement during aggregation and fruiting body morphogenesis. Secreted cAMP also controls gene expression at different developmental stages, while intracellular cAMP is extensively used to transduce the effect of other stimuli that control the developmental programme. In this review, I present an overview of the different roles of cAMP in the model D. discoideum and I summarize studies aimed to resolve how these roles emerged during Dictyostelid evolution. PMID:21585352

  16. Repression of protein kinase C and stimulation of cyclic AMP response elements by fumonisin, a fungal encoded toxin which is a carcinogen.

    PubMed

    Huang, C; Dickman, M; Henderson, G; Jones, C

    1995-04-15

    Fusarium moniliforme (FM) is a major fungal pathogen of corn and is involved with stalk rot disease. FM is widely spread throughout the world, including the United States. Most strains of FM produce several mycotoxins, the most prominent of which is called fumonisin. Recent epidemiological studies indicated that ingestion of fumonisin correlates with a higher incidence of esophageal cancer in Southern and Northern Africa and China. Furthermore, fumonisin causes a neurodegenerative disease in horses, induces hepatic cancer in rats, and induces pulmonary edema in swine. Considering that high levels of fumonisin have been detected in healthy and diseased corn grown in the United States, fumonisin may pose a health threat to humans and livestock animals. Structurally, fumonisin resembles sphingolipids which are present in the membranes of animal and plant cells. At the present time, very little is known concerning the mechanism by which fumonisin elicits its carcinogenic effect. Our studies indicate that fumonisin represses expression of protein kinase C and AP-1-dependent transcription. In contrast, fumonisin stimulated a simple promoter containing a single cyclic AMP response element. Since fumonisin did not alter protein kinase A activity, it appears that cyclic AMP response element activation was independent of protein kinase A. It is hypothesized that the ability of fumonisin to alter signal transduction pathways plays a role in carcinogenesis. PMID:7712470

  17. Involvement of the cyclic AMP-responsive element binding protein in bovine leukemia virus expression in vivo.

    PubMed Central

    Adam, E; Kerkhofs, P; Mammerickx, M; Kettmann, R; Burny, A; Droogmans, L; Willems, L

    1994-01-01

    The TAR element (Tax-responsive element; also called TxRE) is a major determinant of the regulation of bovine leukemia virus (BLV) expression. In order to gain insight into the mechanisms of viral expression, complexes formed between proteins and the TAR enhancer DNA were analyzed by gel retardation assays. We report here that nuclear lysates from ex vivo-isolated B lymphocytes contain proteins that specifically bind to TAR. An antibody directed toward the cyclic AMP-responsive element binding (CREB) protein supershifted a complex (C1) present only in BLV-infected B lymphocytes. The CREB protein thus appears to be a major transcription factor involved in BLV expression in vivo. Images PMID:8057465

  18. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  19. Decreased arterial responsiveness to multiple cyclic AMP-generating receptor agonists in spontaneously hypertensive rats.

    PubMed Central

    Masuzawa, K.; Matsuda, T.; Asano, M.

    1989-01-01

    1. Arterial relaxant responses via beta-adrenoceptors are decreased in spontaneously hypertensive rats (SHR) when compared with normotensive Wistar-Kyoto rats (WKY). Recent studies from this laboratory proposed that a reduced function of stimulatory guanosine 5'-triphosphate (GTP)-binding protein (Gs) is responsible for the decreased beta-adrenoceptor responsiveness in the SHR femoral artery. Since the Gs is common to all tissues, as opposed to receptors, which are tissue specific, the reduced function of Gs should lead to resistance to multiple receptors that act by activating adenylate cyclase (AC). To test this hypothesis, relaxant responses via beta-adrenoceptors, A2-adenosine, H2-histamine and D1-dopamine receptors were compared between arterial strips from 13 week-old WKY and age-matched SHR. 2. The relaxant responses to noradrenaline (NA) via beta-adrenoceptors in femoral, mesenteric, renal and carotid arteries were significantly decreased in the SHR, when compared with the respective arteries from WKY. 3. However, under the same conditions arterial relaxant responses to forskolin, an activator of AC, were not significantly different between the WKY and SHR. 4. The relaxant responses due to activation of A2-adenosine. H2-histamine and D1-dopamine receptors were significantly decreased in the SHR arteries. 5. Nitroprusside and nifedipine, agents which are independent of the Gs.AC system, produced similar arterial relaxations in the WKY and SHR. 6. These results support the hypothesis that a reduced function of Gs in the SHR is responsible for the decreased arterial responsiveness to a variety of receptor agonists whose mechanism of action involves AC activation. PMID:2538181

  20. The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi.

    PubMed Central

    Reverchon, S; Expert, D; Robert-Baudouy, J; Nasser, W

    1997-01-01

    The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi. PMID:9171393

  1. Cyclic AMP as a possible mediator of dopamine stimulation of cockroach gland cells.

    PubMed

    Gray, D C; Ginsborg, B L; House, C R

    1984-01-01

    Isolated salivary glands of the cockroach Nauphoeta cinerea Olivier secrete fluid in response to nerve stimulation or application of dopamine, the acinar cells undergoing a hyperpolarization during secretion. The aim of the present work was to examine whether cyclic AMP acts as a second messenger in the acinar cells to cause the secretory and electrical responses to the transmitter dopamine. Cyclic AMP (10-500 microM) in the bathing solution of isolated glands caused a dose-dependent secretory response but no change in the membrane potential of acinar cells. The time courses and magnitudes of the secretory responses to cyclic AMP resembled those features of responses to dopamine. Forskolin, an adenylate cyclase activator, caused fluid secretion but the responses were small and irregular. The phosphodiesterase inhibitor, 3-isobutyl-l-methylxanthine (IBMX)(1-1000 microM) produced fluid secretion in a dose-dependent manner, the maximal response being equal to that of dopamine. Maintained responses to cyclic AMP or IBMX required the presence of extracellular calcium ions. An inhibitor (MDL 12,330A) of adenylate cyclase suppressed the secretory responses to dopamine, cyclic AMP, IBMX, the ionophore A23817 or the readmission of calcium ions to the bathing solution; this inhibitor did not block the acinar hyperpolarization caused by nerve stimulation. Cyclic AMP stimulation of glands, bathed in chloride-free solution to prevent fluid secretion, produced a change in the gland cells which outlasted the period of exogenous cyclic AMP stimulation and expressed itself as a transient secretion upon return of the normal bathing solution. It was concluded that stimulus-secretion coupling in this gland involves a calcium-dependent second messenger system and that cyclic AMP is probably the second messenger. The evidence did not support the idea that cyclic AMP is also a second messenger for the acinar cell hyperpolarization evoked by nerve stimulation. PMID:6201944

  2. Regulation of cyclic AMP response element-binding protein during neuroglial interactions.

    PubMed

    Qin, LiMei; Bouchard, Ron; Pugazhenthi, Subbiah

    2016-03-01

    Communications between neurons and glial cells play an important role in regulating homeostasis in the central nervous system. cAMP response element-binding protein (CREB), a transcription factor, is down-regulated by neurotoxins, which are known to be released by activated glial cells. To determine the role of CREB signaling in neuroglial interactions, we used three neuroglial coculture models consisting of human neuroprogenitor cell (NPC)-derived neurons and human microglia. Conditioned medium from the Abeta (Aβ)-activated microglia decreased CREB phosphorylation and brain-derived neurotrophic factor promoter activity (47%), whereas the same medium induced (p < 0.01) the promoter of CXCL10, a chemokine, in NPC-derived neuron-rich cultures. These effects were reversed when microglia were exposed to Aβ in the presence of minocycline, an anti-inflammatory agent. The expression of CREB targets, including brain-derived neurotrophic factor, synapsin-1, and BIRC3 decreased by 50-65% (p < 0.01) in neurons isolated by laser capture microdissection in close proximity of microglia in neuroglial mixed cultures. Neuronal survival actively modulated microglial behavior when neurons and microglia were cocultured side-by-side on semicircles of ACLAR membrane. Neuronal injury, caused by the over-expression of dominant negative form of CREB, exacerbated Aβ-mediated microglial activation, whereas CREB over-expression resulted in decreased microglial activation. Decreases in the levels of neuronal markers were observed when NPCs were differentiated in the presence of proinflammatory cytokines IL-1β, tumor necrosis factor α, or IL-6. Instead, the NPCs differentiated into a glial phenotype, and these effects were more pronounced in the presence of tumor necrosis factor α. Our findings suggest that CREB down-regulation is an important component of defective neuroglial communications in the brain during neuroinflammation. Neuroglial interactions were examined using coculture models of human neuroprogenitor cell-derived neurons and microglia isolated from human fetal brain. A novel coculture model of neurons and microglia cultured on ACLAR membranes in the same dish was also included. In this model, over-expression of the dominant negative mutant form of the transcription factor CREB in neurons induced neuronal apoptosis and microglial activation whereas expression of the wild type form of CREB resulted in protection of neurons and suppressed microglial activity, thereby suggesting that neurons play an active role in neuroglial interactions. PMID:26677139

  3. Development of melatonin synthesis in chicken retina: regulation of serotonin N-acetyltransferase activity by light, circadian oscillators, and cyclic AMP.

    PubMed

    Iuvone, P M

    1990-05-01

    In chicken retinas, melatonin levels and the activity of serotonin N-acetyltransferase (NAT), a key regulatory enzyme of melatonin biosynthesis, are expressed as circadian rhythms with peaks of levels and activity occurring at night. In the present study, NAT activity was examined in retinas of embryonic and posthatch chicks to assess the ontogenic development of regulation of the enzyme by light, circadian oscillators, and the second messenger cyclic AMP. During embryonic development, NAT activity was consistently detectable by embryonic day 6 (E6). Significant light-dark differences were first observed on E20, and increased to a maximum amplitude of sixfold by posthatch day 3 (PH3). Circadian rhythmicity of NAT activity appears to develop at or prior to hatching, as evidenced by day-night differences of activity in constant darkness observed in PH1 chicks that had been exposed to a light-dark cycle in ovo only. NAT activity is regulated by a cyclic AMP-dependent mechanism. Activity was significantly increased by incubating retinas with forskolin or dibutyryl cyclic AMP as early as E7, and seven- to ninefold increases were observed following treatment with these agents on E14. Thus, development of the cyclic AMP-dependent mechanism for increasing NAT activity significantly precedes that of rhythmicity, suggesting that the onset of rhythmicity may be related to the onset of photoreception or development of the circadian oscillator in chick retina. PMID:2157813

  4. Cyclic AMP Enhances TGFβ Responses of Breast Cancer Cells by Upregulating TGFβ Receptor I Expression

    PubMed Central

    Oerlecke, Ilka; Bauer, Elke; Dittmer, Angela; Leyh, Benjamin; Dittmer, Jürgen

    2013-01-01

    Cellular functions are regulated by complex networks of many different signaling pathways. The TGFβ and cAMP pathways are of particular importance in tumor progression. We analyzed the cross-talk between these pathways in breast cancer cells in 2D and 3D cultures. We found that cAMP potentiated TGFβ-dependent gene expression by enhancing Smad3 phosphorylation. Higher levels of total Smad3, as observed in 3D-cultured cells, blocked this effect. Two Smad3 regulating proteins, YAP (Yes-associated protein) and TβRI (TGFβ receptor 1), were responsive to cAMP. While YAP had little effect on TGFβ-dependent expression and Smad3 phosphorylation, a constitutively active form of TβRI mimicked the cAMP effect on TGFβ signaling. In 3D-cultured cells, which show much higher levels of TβRI and cAMP, TβRI was unresponsive to cAMP. Upregulation of TβRI expression by cAMP was dependent on transcription. A proximal TβRI promoter fragment was moderately, but significantly activated by cAMP suggesting that cAMP increases TβRI expression at least partially by activating TβRI transcription. Neither the cAMP-responsive element binding protein (CREB) nor the TβRI-regulating transcription factor Six1 was required for the cAMP effect. An inhibitor of histone deacetylases alone or together with cAMP increased TβRI expression by a similar extent as cAMP alone suggesting that cAMP may exert its effect by interfering with histone acetylation. Along with an additive stimulatory effect of cAMP and TGFβ on p21 expression an additive inhibitory effect of these agents on proliferation was observed. Finally, we show that mesenchymal stem cells that interact with breast cancer cells can simultaneously activate the cAMP and TGFβ pathways. In summary, these data suggest that combined effects of cAMP and TGFβ, as e.g. induced by mesenchymal stem cells, involve the upregulation of TβRI expression on the transcriptional level, likely due to changes in histone acetylation. As a consequence, cancer cell functions such as proliferation are affected. PMID:23349840

  5. Chronic ethanol administration decreases phosphorylation of cyclic AMP response element-binding protein in granule cells of rat cerebellum.

    PubMed

    Yang, X; Horn, K; Baraban, J M; Wand, G S

    1998-01-01

    To help define the molecular basis of ethanol's actions on the nervous system, we have in previous studies demonstrated that ethanol administration triggers a robust increase in cyclic AMP-response element-binding protein (CREB) phosphorylation in the cerebellum. The purpose of the present study was to compare the effects of acute and chronic ethanol exposure on the phosphorylation of CREB in rat cerebellum and to determine which cell types in the cerebellum display this response to ethanol. An acute ethanol challenge (3.0 g/kg of body weight) induced a rapid increase in content of the phosphorylated form of CREB, peaking at 30 min and declining to basal levels within 2 h. Immunocytochemical studies revealed prominent ethanol-induced changes in phosphoCREB in the granule cell layer, with little phosphoCREB apparent in Purkinje cells. Following chronic ethanol exposure (5 weeks), induction of CREB phosphorylation by a subsequent acute ethanol challenge was markedly attenuated. The attenuation in CREB phosphorylation was associated with a significant reduction in the levels of the catalytic unit of protein kinase A and calcium/calmodulin-dependent protein kinase IV. In summary, induction of CREB phosphorylation in cerebellum is most prominent in the granule cell layer. Neuroadaptation to chronic ethanol exposure includes a reduction in nuclear protein kinase A and calcium/calmodulin-dependent protein kinase IV levels, an event associated with impaired CREB phosphorylation. PMID:9422366

  6. Cyclic AMP-mediated cytoskeletal effects in adrenal cells are modified by serum, insulin, insulin-like growth factor-I, and an antibody against urokinase plasminogen activator.

    PubMed

    Hornsby, P J; Maghsoudlou, S S; Cheng, V; Cheng, C Y

    1989-12-01

    In adrenocortical cells in culture, increased intracellular cyclic AMP resulting from exposure to agents such as ACTH and cholera toxin causes a change in cell morphology termed 'retraction' or 'rounding'. The breakdown of actin-containing stress fibers in rounding suggested a role for microfilaments in steroidogenesis. Previously, we showed that cultured bovine adrenal cells under standard conditions (medium with 10% fetal bovine serum) do not round in response to intracellular cyclic AMP. Here, we show that these cells do round in defined, serum-free medium. Rounding was maximal within 1 h of addition of 1 nM cholera toxin and after 10 h most cells remained rounded. Cycloheximide at 100 micrograms/ml did not inhibit the response to cholera toxin. The rounding response was abolished when 10% fetal bovine serum, horse serum, or ether-extracted fetal bovine serum was included in the medium. The inhibitory effect of serum was not mimicked by growth factors with the exception that insulin and insulin-like growth factor-I (IGF-I), while not preventing rounding, accelerated the return of cells to a flattened morphology. A monoclonal antibody against urokinase plasminogen activator completely prevented rounding whereas a monoclonal antibody against tissue plasminogen activator had only a slight effect. Fluorescence visualization of F-actin with N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-phallacidin showed that rounding in cultured bovine adrenocortical cells resembles that defined earlier for human and rat adrenocortical cells and includes depolymerization of actin microfilaments. These cytoskeletal changes in adrenal cells are unlikely to play a role in steroidogenesis; however, they may be involved in tissue remodeling occurring as part of the indirect mitogenic effects of ACTH. PMID:2558936

  7. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    PubMed Central

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J.G.; Meeuwsen-de Boer, Tiny G.J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S.J.M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric leukemias. In this study, we determined CREB phosphorylation and mRNA levels showing that CREB expression was significantly higher in ALL compared to normal bone marrow (phosphorylation: P < 0.0001, mRNA: P = 0.004). High CREB and phospho-CREB expression was correlated with a lower median overall survival in a cohort of 140 adult ALL patients. ShRNA mediated knockdown of CREB in ALL cell lines blocked leukemic cell growth by inducing cell cycle arrest and apoptosis. Gene expression array analysis showed downregulation of CREB target genes regulating cell proliferation and glucose metabolism and upregulation of apoptosis inducing genes. Similar to CREB knockdown, the CREB inhibitor KG-501 decreased leukemic cell viability and induced apoptosis in ALL cell lines, as well as primary T-ALL samples, with cases showing high phospho-CREB levels being more sensitive than those with lower phospho-CREB levels. Together, these in vitro findings support an important role for CREB in the survival of ALL cells and identify this transcription factor as a potential target for treatment. PMID:26008971

  8. Alternative exon splicing of cyclic AMP response element-binding protein in peripheral sensory and sympathetic ganglia of the rat.

    PubMed

    Pietruck, C; Xie, G X; Sharma, M; Meuser, T; Palmer, P P

    1999-01-01

    Alternative splicing patterns of cyclic AMP response element-binding protein (CREB) in dorsal root ganglia, lumbar sympathetic ganglia and several peripheral tissues of the rat have been investigated by an exon-flanking polymerase chain reaction strategy. A series of RT-PCR with primer pairs flanking all possible alternative splicing sites (corresponding to a genomic region with at least one full exon and two flanking introns) has revealed multiple tissue specific splice variants. These include some novel transcripts that lack the phosphorylation site and part of the leucine zipper region which is crucial for dimerization and DNA binding. Some isoforms previously reported as testis-specific were also detected in rat peripheral ganglia and other tissues. Notably, splicing patterns are specific for some regions. Some of the splice variants indicate inhibitory functions due to lacking phosphorylation sites or partially missing DNA-binding or leucine zipper domains. These findings suggest a complex expression and functional regulation of CREB in peripheral tissues including dorsal root and sympathetic ganglia. PMID:10576592

  9. AMPK antagonizes hepatic glucagon-stimulated cyclic AMP signalling via phosphorylation-induced activation of cyclic nucleotide phosphodiesterase 4B.

    PubMed

    Johanns, M; Lai, Y-C; Hsu, M-F; Jacobs, R; Vertommen, D; Van Sande, J; Dumont, J E; Woods, A; Carling, D; Hue, L; Viollet, B; Foretz, M; Rider, M H

    2016-01-01

    Biguanides such as metformin have previously been shown to antagonize hepatic glucagon-stimulated cyclic AMP (cAMP) signalling independently of AMP-activated protein kinase (AMPK) via direct inhibition of adenylate cyclase by AMP. Here we show that incubation of hepatocytes with the small-molecule AMPK activator 991 decreases glucagon-stimulated cAMP accumulation, cAMP-dependent protein kinase (PKA) activity and downstream PKA target phosphorylation. Moreover, incubation of hepatocytes with 991 increases the Vmax of cyclic nucleotide phosphodiesterase 4B (PDE4B) without affecting intracellular adenine nucleotide concentrations. The effects of 991 to decrease glucagon-stimulated cAMP concentrations and activate PDE4B are lost in hepatocytes deleted for both catalytic subunits of AMPK. PDE4B is phosphorylated by AMPK at three sites, and by site-directed mutagenesis, Ser304 phosphorylation is important for activation. In conclusion, we provide a new mechanism by which AMPK antagonizes hepatic glucagon signalling via phosphorylation-induced PDE4B activation. PMID:26952277

  10. AMPK antagonizes hepatic glucagon-stimulated cyclic AMP signalling via phosphorylation-induced activation of cyclic nucleotide phosphodiesterase 4B

    PubMed Central

    Johanns, M.; Lai, Y.-C.; Hsu, M.-F.; Jacobs, R.; Vertommen, D.; Van Sande, J.; Dumont, J. E.; Woods, A.; Carling, D.; Hue, L.; Viollet, B.; Foretz, M; Rider, M H

    2016-01-01

    Biguanides such as metformin have previously been shown to antagonize hepatic glucagon-stimulated cyclic AMP (cAMP) signalling independently of AMP-activated protein kinase (AMPK) via direct inhibition of adenylate cyclase by AMP. Here we show that incubation of hepatocytes with the small-molecule AMPK activator 991 decreases glucagon-stimulated cAMP accumulation, cAMP-dependent protein kinase (PKA) activity and downstream PKA target phosphorylation. Moreover, incubation of hepatocytes with 991 increases the Vmax of cyclic nucleotide phosphodiesterase 4B (PDE4B) without affecting intracellular adenine nucleotide concentrations. The effects of 991 to decrease glucagon-stimulated cAMP concentrations and activate PDE4B are lost in hepatocytes deleted for both catalytic subunits of AMPK. PDE4B is phosphorylated by AMPK at three sites, and by site-directed mutagenesis, Ser304 phosphorylation is important for activation. In conclusion, we provide a new mechanism by which AMPK antagonizes hepatic glucagon signalling via phosphorylation-induced PDE4B activation. PMID:26952277

  11. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi; Kwon, Shi-Nae; Kang, Ju-Il; Lee, Song Hee; Jang, Sung Key; Ahn, Byung-Yoon; Kim, Yoon Ki . E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  12. Mechanisms of tyrosine hydroxylase regulation in striatal synaptosomes: effects of activation of cyclic AMP-dependent protein kinase

    SciTech Connect

    Colby, K.A.

    1987-01-01

    The regulation of tyrosine hydroxylase (TH), the rate-limiting enzyme of catecholamine biosynthesis, was examined in synaptosomes prepared from rat corpus striatum. Exposure of striatal synaptosomes to dibutyryl-cyclic AMP (dbcAMP) causes an increase in the maximal velocity of TH, but does not change the K/sub m/ of the enzyme for the synthetic cofactor, 2-amino-4-hydroxy-6-methyl-tetrahydropterin. Activation of TH by synaptosomal exposure to dbcAMP also causes a decrease in the pH sensitivity and an increase in the thermolability of the enzyme. Striatal synaptosomes were used to examine the in vitro phosphorylation of TH. Under the protocol developed as part of this work, TH in synaptosomes can be labelled with /sup 32/P. This is the first report of in vitro labelling of TH in a biochemically intact CNS preparation. Under certain protocols, treatment of synaptosomes with dbcAMP causes an increase in the /sup 32/P labelling of TH. These results are consistent with the notion that dbcAMP produces changes in the physical properties of TH by activating cAMP-dependent protein kinase which subsequently phosphorylates TH. In vivo electrical stimulation of the rat medial forebrain bundle causes an activation of striatal TH as well as an decrease in the pH sensitivity of the enzyme. Since similar changes are produced upon activation of snaptosomal TH by dbcAMP, it is likely that phosphorylation of TH is involved in the increase in TH activity that is associated with neuronal depolarization.

  13. Identification and Function of Exchange Proteins Activated Directly by Cyclic AMP (Epac) in Mammalian Spermatozoa

    PubMed Central

    Miro-Moran, Alvaro; Jardin, Isaac; Ortega-Ferrusola, Cristina; Salido, Gines M.; Pea, Fernando J.; Tapia, Jose A.; Aparicio, Ines M.

    2012-01-01

    The role of cAMP in spermatic functions was classically thought to be mediated exclusively through the activation of Protein Kinase A (PKA). However, it has recently been shown that cAMP also exerts its effects through a PKA-independent pathway activating a family of proteins known as Epac proteins. Therefore, many of the spermatic functions thought to be regulated by cAMP through the activation of PKA are again under study. We aimed to identify and to investigate the role of Epac proteins in spermatozoa using a specific permeable analog (8-Br-2?-O-Me-cAMP). Also, we aimed to study its relationship with E-cadherin, an adhesion protein involved in fertility. Our results demonstrate the presence and sub-cellular distribution of Epac 1 and Epac 2 in mammalian spermatozoa. Capacitation and the acrosome reaction induced a change in the localization of Epac proteins in sperm. Moreover, incubation with 8-Br-2?-O-Me-cAMP prompted an increase in Rap1 activation, in the scrambling of plasma membrane phospholipids (necessary for the capacitation process), the acrosome reaction, motility, and calcium mobilization, when spermatozoa were incubated in acrosome reaction conditions. Finally, the activation of Epac proteins induced a change in the distribution of E-cadherin. Therefore, the increase in the acrosome reaction, together with the increase in calcium (which is known to be essential for fertilization) and the Epac nteraction with E-cadherin, might indicate that Epac proteins have an important role in gamete recognition and fertilization. PMID:22662198

  14. The Role of Angiotensin II and Cyclic AMP in Alveolar Active Sodium Transport

    PubMed Central

    Ismael-Badarneh, Reem; Guetta, Julia; Klorin, Geula; Berger, Gidon; Abu-saleh, Niroz; Abassi, Zaid; Azzam, Zaher S.

    2015-01-01

    Active alveolar fluid clearance is important in keeping airspaces free of edema. Angiotensin II plays a role in the pathogenesis of hypertension, heart failure and others. However, little is known about its contribution to alveolar fluid clearance. Angiotensin II effects are mediated by two specific receptors; AT1 and AT2. The localization of these two receptors in the lung, specifically in alveolar epithelial cells type II, was recently reported. We hypothesize that Angiotensin II may have a role in the regulation of alveolar fluid clearance. We investigated the effect of Angiotensin II on alveolar fluid clearance in rats using the isolated perfused lung model and isolated rat alveolar epithelial cells. The rate of alveolar fluid clearance in control rats was 8.6% ± 0.1 clearance of the initial volume and decreased by 22.5%, 28.6%, 41.6%, 48.7% and 39% in rats treated with 10-10 M, 10-9 M, 10-8 M, 10-7 M or 10-6 M of Ang II respectively (P < 0.003). The inhibitory effect of Angiotensin II was restored in losartan, an AT1 specific antagonist, pretreated rats, indicating an AT1 mediated effect of Ang II on alveolar fluid clearance. The expression of Na,K-ATPase proteins and cAMP levels in alveolar epithelial cells were down-regulated following the administration of Angiotensin II; suggesting that cAMP may be involved in AngII-induced reduced Na,K-ATPase expression, though the contribution of additional factors could not be excluded. We herein suggest a novel mechanism of clinical relevance by which angiotensin adversely impairs the ability of the lungs to clear edema. PMID:26230832

  15. Type I adenylyl cyclase functions as a coincidence detector for control of cyclic AMP response element-mediated transcription: synergistic regulation of transcription by Ca2+ and isoproterenol.

    PubMed Central

    Impey, S; Wayman, G; Wu, Z; Storm, D R

    1994-01-01

    Studies carried out with mammals and invertebrates suggest that Ca(2+)-sensitive adenylyl cyclases may be important for neuroplasticity. Long-term potentiation in the hippocampus requires increases in intracellular Ca2+ which are accompanied by elevated cyclic AMP (cAMP). Furthermore, activation of cAMP-dependent protein kinase is required for the late stage of long-term potentiation in the CA1 region of the hippocampus, which is also sensitive to inhibitors of transcription. Therefore, some forms of synaptic plasticity may require coordinate regulation of transcription by Ca2+ and cAMP. In this study, we demonstrate that the expression of type I adenylyl cyclase in HEK-293 cells allows Ca2+ to stimulate reporter gene activity mediated through the cAMP response element. Furthermore, simultaneous activation by Ca2+ and isoproterenol caused synergistic stimulation of transcription in HEK-293 cells and cultured neurons. We propose that Ca2+ and neurotransmitter stimulation of type I adenylyl cyclase may play a role in synaptic plasticity by generating optimal cAMP signals for regulation of transcription. PMID:7969163

  16. Kinetics of activation of the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein.

    PubMed Central

    Hoggett, J G; Brierley, I

    1992-01-01

    The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid. PMID:1445251

  17. Kinetics of activation of the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein.

    PubMed

    Hoggett, J G; Brierley, I

    1992-11-01

    The activation of transcription initiation from the P4 promoter of pBR322 by the Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex on the linear P4 promoter was to increase the initial binding (KB) of RNA polymerase to the promoter by about a factor of 10, but the rate of isomerization of closed to open complex (kf) was unaffected. One molecule of CRP per promoter was required for activation, and the concentration of cyclic AMP producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a 2-3-fold increase in the rate of isomerization of the CRP-activated promoter, but weakened the initial binding of polymerase by about one order of magnitude. The unactivated supercoiled promoter was too weak to allow reliable assessment of kinetic parameters against the high background rate originating from the rest of the plasmid. PMID:1445251

  18. Role of the cyclic AMP response element in the bcl-2 promoter in the regulation of endogenous Bcl-2 expression and apoptosis in murine B cells.

    PubMed

    Xiang, Hong; Wang, Jinghong; Boxer, Linda M

    2006-11-01

    We have previously shown for B-cell lines that the cyclic AMP response element (CRE) is a major positive regulatory site in the bcl-2 promoter. However, the role of the CRE in the regulation of endogenous bcl-2 expression in vivo has not been characterized. We used gene targeting to generate knock-in mice in which a mutated CRE was introduced into the bcl-2 promoter region (mutCRE-bcl2 mice). Quantitative chromatin immunoprecipitation assays revealed that mutation of the CRE abolished the binding of CREB/ATF and CBP transcription factors to the bcl-2 promoter and greatly diminished the binding of NF-kappaB factors. The mutant CRE significantly reduced the expression of Bcl-2 in B cells and rendered them susceptible to surface immunoglobulin- and chemotherapeutic agent-induced apoptosis. The low levels of Bcl-2 were not changed with activation of the cells. The numbers of pre-B, immature B, and mature B cells in the bone marrow were decreased, as were the numbers of splenic B cells in mutCRE-bcl2 mice. Our findings indicate that the CRE in the bcl-2 promoter has an important functional role in the regulation of endogenous Bcl-2 expression and plays a critical role in the coordination of signals that regulate B-cell survival. PMID:16982684

  19. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    PubMed

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-01

    Presenilins, the catalytic components of the ?-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using ?-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature ?-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known ?-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  20. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    PubMed Central

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  1. Opposite Transcriptional Effects of Cyclic AMP-Responsive Elements in Confluent or p27KIP-Overexpressing Cells versus Serum-Starved or Growing Cells

    PubMed Central

    Deleu, Laurent; Fuks, Franois; Spitkovsky, Dimitry; Hrlein, Rita; Faisst, Steffen; Rommelaere, Jean

    1998-01-01

    The minute virus of mice, an autonomous parvovirus, requires entry of host cells into the S phase of the cell cycle for its DNA to be amplified and its genes expressed. This work focuses on the P4 promoter of this parvovirus, which directs expression of the transcription unit encoding the parvoviral nonstructural polypeptides. These notably include protein NS1, necessary for the S-phase-dependent burst of parvoviral DNA amplification and gene expression. The activity of the P4 promoter is shown to be regulated in a cell cycle-dependent manner. At the G1/S-phase transition, the promoter is activated via a cis-acting DNA element which interacts with phase-specific complexes containing the cellular transcription factor E2F. It is inhibited, on the other hand, in cells arrested in G1 due to contact inhibition. This inhibitory effect is not observed in serum-starved cells. It is mediated in cis by cyclic AMP response elements (CREs). Unlike serum-starved cells, confluent cells accumulate the cyclin-dependent kinase inhibitor p27, suggesting that the switch from CRE-mediated activation to CRE-mediated repression involves the p27 protein. Accordingly, plasmid-driven overexpression of p27 causes down-modulation of promoter P4 in growing cells, depending on the presence of at least two functional CREs. No such effect is observed with two other cyclin-dependent kinase inhibitors, p16 and p21. Given the importance of P4-driven synthesis of protein NS1 in parvoviral DNA amplification and gene expression, the stringent S-phase dependency of promoter P4 is likely a major determinant of the absolute requirement of the minute virus of mice for host cell proliferation. PMID:9418888

  2. Mlc Is a Transcriptional Activator with a Key Role in Integrating Cyclic AMP Receptor Protein and Integration Host Factor Regulation of Leukotoxin RNA Synthesis in Aggregatibacter actinomycetemcomitans

    PubMed Central

    Childress, Catherine; Feuerbacher, Leigh A.; Phillips, Linda; Burgum, Alex

    2013-01-01

    Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cyclic AMP (cAMP) receptor protein (CRP) indirectly increases ltxA expression, but the intermediary regulator is unknown. Integration host factor (IHF) binds to and represses the leukotoxin promoter, but neither CRP nor IHF is responsible for the anaerobic induction of ltxA RNA synthesis. Thus, we have undertaken studies to identify other regulators of leukotoxin transcription and to demonstrate how these proteins work together to modulate leukotoxin synthesis. First, analyses of ltxA RNA expression from defined leukotoxin promoter mutations in the chromosome identify positions ?69 to ?35 as the key control region and indicate that an activator protein modulates leukotoxin transcription. We show that Mlc, which is a repressor in Escherichia coli, functions as a direct transcriptional activator in A. actinomycetemcomitans; an mlc deletion mutant reduces leukotoxin RNA synthesis, and recombinant Mlc protein binds specifically at the ?68 to ?40 region of the leukotoxin promoter. Furthermore, we show that CRP activates ltxA expression indirectly by increasing the levels of Mlc. Analyses of ?mlc, ?ihf, and ?ihf ?mlc strains demonstrate that Mlc can increase RNA polymerase (RNAP) activity directly and that IHF represses ltxA RNA synthesis mainly by blocking Mlc binding. Finally, a ?ihf ?mlc mutant still induces ltxA during anaerobic growth, indicating that there are additional factors involved in leukotoxin transcriptional regulation. A model for the coordinated regulation of leukotoxin transcription is presented. PMID:23475968

  3. Cyclic AMP in the sublingual glands of the mouse.

    PubMed Central

    Amerongen, A V; Roukema, P A; Vreugdenhil, A P

    1980-01-01

    1. The cyclic AMP levels in the sublingual glands of the mouse has been determined in relation to mucin secretion under the influence of several agonists in vivo and in vitro. 2. Isoprenaline increased the cyclic AMP level in these glands only in the presence of a phosphodiesterase inhibitor, indicating the presence of an active cyclic AMP phosphodiesterase. 3. Inhibition of phosphodiesterase results in an increase of the cyclic AMP levels. EGTA prolonged the effect of the PDE-inhibitors, indicating that Ca2+-ions may be involved in the maintenance of the cyclic AMP concentration in the sublingual glands. 4. NaF is able to induce both a slight increase of the cyclic AMP level and a significant mucin secretion by the sublingual glands. However, other secretagogues do not significantly influence the cyclic AMP concentration in these glands, and compounds which do not elevate its level, do not significantly stimulate sublingual mucin secretion. 5. These data suggest that there is no direct relationship between cyclic AMP and sublingual mucin secretion. PMID:6107381

  4. Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements

    PubMed Central

    Yuan, Jinxiang; Li, Ming; Torres, Yasaira Rodriguez; Galle, Courtney S.

    2015-01-01

    ABSTRACT Triggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation. IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of primitive neural stem cells carrying resting cytomegalovirus genomes, we show that costimulation of protein kinase A and C-delta signaling cascades in conjunction with retinoic acid-induced neuronal differentiation brings about progeny virus propagation. Iterated DNA binding sites for retinoic acid receptor, CREB, and NF-κB family members in the cytomegalovirus major enhancer are at the crux in the pathway to HCMV activation. The stimulated CREB and NF-κB binding site combination vigorously initiates and amplifies the active cytomegalovirus infection and cooperates with activated retinoic acid receptor binding sites to further promote viral proliferation and spread between differentiated cells. These results support a paradigm in which a specific combination of stimuli coupled with cellular differentiation satisfies a core cis-activating code that unlocks enhancer silence to repower the cycle of cytomegalovirus propagation. PMID:26423948

  5. A Ric8/Synembryn Homolog Promotes Gpa1 and Gpa2 Activation To Respectively Regulate Cyclic AMP and Pheromone Signaling in Cryptococcus neoformans

    PubMed Central

    Gong, Jinjun; Grodsky, Jacob D.; Zhang, Zhengguang

    2014-01-01

    The G protein α subunits Gpa1, Gpa2, and Gpa3 mediate signal transduction and are important in the growth and virulence of Cryptococcus neoformans. To understand how Gpa1 functions without a conventional Gβ subunit, we characterized a resistance to inhibitors of cholinesterase 8 (Ric8) homolog from C. neoformans, which shares amino acid sequence homology with other Ric8 proteins that exhibit guanine nucleotide exchange factor (GEF) activity toward Gα. We found that the ric8 mutant was reduced in capsule size and melanin formation, which could be suppressed by cyclic AMP (cAMP) supplementation or by introducing the activated GPA1Q284L allele. Consistent with the fact that Ric8 participates in cAMP signaling to regulate virulence, the ric8 mutant was attenuated in virulence toward mice. Interestingly, disruption of RIC8 also resulted in opposing effects on pheromone signaling, as the ric8 mutant showed reduced mating but an enhanced ability to induce the pheromone response in the mating partner. To identify Ric8 functional mechanisms, we examined the interactions between Ric8 and the three Gα proteins. Ric8 interacted with Gpa1 and Gpa2, but not Gpa3. The presence of Gpa1Q284L negatively affected its interaction with Ric8, whereas the activated Gpa2Q203L allele abolished the interaction. Collectively, these findings suggest that Ric8 functions as a GEF to facilitate the activation of Gpa1-cAMP signaling and to promote Gpa2, affecting mating efficiency. Our study highlights the distinct and conserved characteristics associated with G protein signaling and contributes to our overall understanding of how G protein α subunits function with or without a canonical Gβ partner in C. neoformans. PMID:25084863

  6. The response of the immature rat ovary to gonadotrophins: acute changes in cyclic AMP, progesteron, testosteron, androstenedione and oestradiol after treatment with PMS or FSH + LH.

    PubMed

    Sashida, T; Johnson, D C

    1976-06-01

    Radioimmunoassays were used to measure changes in progesterone, testosterone, androstenedione, oestradiol, gonadotrophin and ovarian cyclic AMP in immature female rats during the first 24 h after exposure to slowly (PMS) or rapidly (FSH + LH) disappearing gonadotrophins. Cyclic AMP was increased 30 min after injection of either kind of gonadotrophin but it had returned to control level within 4 h. Serum and ovarian testosterone and androstenedione also increased to a peak at 30 min but decreased to base line by the 4th h. Multiple injections of FSH + LH maintained an elevated serum testosterone level but they had little effect upon the secretion of androstenedione. Serum and ovarian progesterone increased quickly after treatment with gonadotrophin. With PMS the peak in the serum was reached at 8 h, it remained high for 4 h and then fell precipitously between the 12th and 16th h. FSH + LH produced a prompt increase in serum progesterone but the level could be maintained only by repeated doses given every 4 h. Oestradiol was not increased in the serum or the ovot produce an increase in oestrogen but a transient increase was found with 3 doses; 4 doses kept an elevated level of oestradiol for 12 h. These results indicate that the aromatizing system of the immature rat ovary is relatively inactive and that continual stimulation by gonadotrophin for about 10-12 h is necessary to bring about increased function. In contrast, the mechanisms for the synthesis and secretion of progesterone and androgens are vary active and can be immediately stimulated by exposure to gonadotrophins. PMID:179259

  7. Enhanced Leptin Sensitivity, Reduced Adiposity, and Improved Glucose Homeostasis in Mice Lacking Exchange Protein Directly Activated by Cyclic AMP Isoform 1

    PubMed Central

    Yan, Jingbo; Mei, Fang C.; Cheng, Hongqiang; Lao, Dieu Hung; Hu, Yaohua; Wei, Jingna; Patrikeev, Igor; Hao, Dapeng; Stutz, Sonja J.; Dineley, Kelly T.; Motamedi, Massoud; Hommel, Jonathan D.; Cunningham, Kathryn A.

    2013-01-01

    The prototypic second messenger cyclic AMP (cAMP) is essential for controlling cellular metabolism, including glucose and lipid homeostasis. In mammals, the majority of cAMP functions are mediated by cAMP-dependent protein kinase (PKA) and exchange proteins directly activated by cAMP (Epacs). To explore the physiological functions of Epac1, we generated Epac1 knockout mice. Here we report that Epac1 null mutants have reduced white adipose tissue and reduced plasma leptin levels but display heightened leptin sensitivity. Epac1-deficient mice are more resistant to high-fat diet-induced obesity, hyperleptinemia, and glucose intolerance. Furthermore, pharmacological inhibition of Epac by use of an Epac-specific inhibitor reduces plasma leptin levels in vivo and enhances leptin signaling in organotypic hypothalamic slices. Taken together, our results demonstrate that Epac1 plays an important role in regulating adiposity and energy balance. PMID:23263987

  8. Cyclic AMP Response Element Binding Protein Mediates Pathological Retinal Neovascularization via Modulating DLL4-NOTCH1 Signaling

    PubMed Central

    Singh, Nikhlesh K.; Kotla, Sivareddy; Kumar, Raj; Rao, Gadiparthi N.

    2015-01-01

    Retinal neovascularization is the most common cause of moderate to severe vision loss in all age groups. Despite the use of anti-VEGFA therapies, this complication continues to cause blindness, suggesting a role for additional molecules in retinal neovascularization. Besides VEGFA and VEGFB, hypoxia induced VEGFC expression robustly. Based on this finding, we tested the role of VEGFC in pathological retinal angiogenesis. VEGFC induced proliferation, migration, sprouting and tube formation of human retinal microvascular endothelial cells (HRMVECs) and these responses require CREB-mediated DLL4 expression and NOTCH1 activation. Furthermore, down regulation of VEGFC levels substantially reduced tip cell formation and retinal neovascularization in vivo. In addition, we observed that CREB via modulating the DLL4-NOTCH1 signaling mediates VEGFC-induced tip cell formation and retinal neovascularization. In regard to upstream mechanism, we found that down regulation of p38β levels inhibited hypoxia-induced CREB-DLL4-NOTCH1 activation, tip cell formation, sprouting and retinal neovascularization. Based on these findings, it may be suggested that VEGFC besides its role in the regulation of lymphangiogenesis also plays a role in pathological retinal angiogenesis and this effect depends on p38β and CREB-mediated activation of DLL4-NOTCH1 signaling. PMID:26870802

  9. Rapid non-genomic activation of cytosolic cyclic AMP-dependent protein kinase activity and [Ca2+]i by 17β-oestradiol in female rat distal colon

    PubMed Central

    Doolan, Christina M; Condliffe, Steven B; Harvey, Brian J

    2000-01-01

    In this study, the effect of 17β-oestradiol on adenosine 3′ : 5′-cyclic monophosphate (cyclic AMP)-dependent protein kinase (PKA) activity was investigated. Rapid (within 15 min) activation of basal PKA activity was observed in cytosolic fractions by 17β-oestradiol but not by 17α-oestradiol, progesterone or testosterone. This stimulation was abolished by the specific PKA inhibitor PKI but not by the classical oestrogen receptor antagonist tamoxifen. 17β-Oestradiol did not stimulate basal PKA activity in membrane fractions or in cytosolic fractions from male rats. The increase in cytosolic PKA activity was indirect as (i) it was inhibited by the adenylyl cyclase inhibitor SQ22536, (ii) it was mimicked by forskolin and (iii) 17β-oestradiol did not cause a stimulation of basal PKA activity in either type I or type II commercially available PKA holoenzymes. Protein kinase Cδ (PKCδ) was directly activated by 17β-oestradiol. The specific PKC inhibitor, bisindolylmaleimide I (GF 109203X), abolished the 17β-oestradiol-induced PKA activation. 17β-Oestradiol stimulated an increase in free intracellular calcium ion concentration ([Ca2+]i) in isolated female but not male rat colonic crypts. This was inhibited by verapamil, nifedipine and zero extracellular [Ca2+] but unaffected by tamoxifen. 17α-Oestradiol, testosterone and progesterone failed to increase [Ca2+]i. PKC and PKA inhibitors abolished the 17β-oestradiol-induced increase in [Ca2+]i. These results demonstrate the existence of a novel 17β-oestradiol-specific PKA and Ca2+ signalling pathway, which is both sex steroid- and gender-specific, in rat distal colonic epithelium. PMID:10742293

  10. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term

  11. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  12. Activation of exchange protein activated by cyclic-AMP enhances long-lasting synaptic potentiation in the hippocampus

    PubMed Central

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term potentiation (LTP) of synaptic strength. However, cAMP may also initiate signaling via a guanine nucleotide exchange protein directly activated by cAMP (Epac). The role of Epac in hippocampal synaptic plasticity is unknown. We found that in area CA1 of mouse hippocampal slices, activation of Epac enhances maintenance of LTP without affecting basal synaptic transmission. The persistence of this form of LTP requires extracellular signal-regulated protein kinase (ERK) and new protein synthesis, but not transcription. Because ERK is involved in translational control of long-lasting plasticity and memory, our data suggest that Epac is a crucial link between cAMP and ERK during some forms of protein synthesis-dependent LTP. Activation of Epac represents a novel signaling pathway for rapid regulation of the stability of enduring forms of LTP and, perhaps, of hippocampus- dependent long-term memories. PMID:18509114

  13. The plasma cyclic-AMP response to noise in humans and rats—short-term exposure to various noise levels

    NASA Astrophysics Data System (ADS)

    Iwamoto, M.; Dodo, H.; Ishii, F.; Yoneda, J.; Yamazaki, S.; Goto, H.

    1988-12-01

    Rats were exposed to short-term noise which was found to activate the hypothalamohypophyseal-adrenal system and result in a decrease of adrenal ascorbic acid (AAA) and an increase of serum corticosterone (SCS). The threshold limit value lay between 60 and 70 dB(A). To characterize better the effect of noise on the human hypothalamo-hypophyseal-adrenal system, a large group of subjects was exposed to short-term noise at 85 dB(A) and higher, and tested for levels of adrenocortical steroid (cortisol) and anterior pituitary hormones such as ACTH, growth hormone (GH) and prolactin (PRL). Results in humans showed hyperfunction of the hypothalamo-pituitary system. However, as the responses in rats and humans differed, a further experiment was performed using C-AMP, a second messenger mediating many of the effects of a variety of hormones. Plasma C-AMP in humans and rats increased significantly after exposure to noise greater than 70 dB(A). We suggest that plasma C-AMP could be useful as a sensitive index for noise-related stress in the daily living environment of humans and rats.

  14. Transcription activation at Escherichia coli promoters dependent on the cyclic AMP receptor protein: effects of binding sequences for the RNA polymerase alpha-subunit.

    PubMed Central

    Savery, N J; Rhodius, V A; Wing, H J; Busby, S J

    1995-01-01

    Transcription activation at two semi-synthetic Escherichia coli promoters, CC(-41.5) and CC(-72.5), is dependent on the cyclic AMP receptor protein (CRP) that binds to sites centred 41.5 and 72.5 bp upstream from the respective transcription startpoints. An UP-element that can bind the C-terminal domain of the RNA polymerase (RNAP) alpha-subunit was cloned upstream of the DNA site for CRP at CC(-41.5) and downstream of the DNA site for CRP at CC(-72.5). In both cases CRP-dependent promoter activity was increased by the UP-element, but CRP-independent activity was not increased. DNase I footprinting was exploited to investigate the juxtaposition of bound CRP and RNAP alpha-subunits. In both cases, CRP and RNAP alpha-subunits occupy their cognate binding sites in ternary CRP-RNAP promoter complexes. RNAP alpha-subunits can occupy the UP-element in the absence of CRP, but this is not sufficient for open complex formation. The positive effects of binding RNAP alpha-subunits upstream of the DNA site for CRP at -41.5 are suppressed if the UP-element is incorrectly positioned. Images Figure 1 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7619086

  15. Phosphorylation of CREB, a cyclic AMP responsive element binding protein, contributes partially to lysophosphatidic acid-induced fibroblast cell proliferation

    SciTech Connect

    Kwon, Yong-Jun; Sun, Yuanjie; Kim, Nam-Ho; Huh, Sung-Oh

    2009-03-13

    Lysophospholipids regulate a wide array of biological processes including cell survival and proliferation. In our previous studies, we found that in addition to SRE, CRE is required for maximal c-fos promoter activation triggered by lysophosphatidic acid (LPA). c-fos is an early indicator of various cells into the cell cycle after mitogenic stimulation. However, role of CREB activation in LPA-stimulated proliferation has not been elucidated yet. Here, we investigate how LPA induces proliferation in Rat-2 fibroblast cell via CREB activation. We found that total cell number and BrdU-positive cells were increased by LPA. Moreover, levels of c-fos mRNA and cyclin D1 protein were increased via LPA-induced CREB phosphorylation. Furthermore, LPA-induced Rat-2 cell proliferation was decreased markedly by ERK inhibitor (U0126) and partially by MSK inhibitor (H89). Taken together, these results suggest that CREB activation could partially up-regulate accumulation of cyclin D1 protein level and proliferation of LPA-stimulated Rat-2 fibroblast cells.

  16. 4-Phenylbutyrate attenuates the ER stress response and cyclic AMP accumulation in DYT1 dystonia cell models.

    PubMed

    Cho, Jin A; Zhang, Xuan; Miller, Gregory M; Lencer, Wayne I; Nery, Flavia C

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3', 5'-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3', 5'-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  17. 4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models

    PubMed Central

    Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3′, 5′-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3′, 5′-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  18. Cyclic AMP-related and cation-affected human platelet chloride transport regulation.

    PubMed

    Agam, G; Aviram, M; Zilberman-Kaufman, M; Rothstein, A; Livne, A A

    1995-06-01

    Cystic fibrosis has been characterized as a defect in the regulation of cyclic AMP-dependent transepithelial chloride transport. The activation of cyclic AMP-dependent protein kinase A by cyclic AMP occurs normally in cystic fibrosis cells, but they fail to transport chloride ions in response to protein kinase A stimulation. Defective chloride secretion and abnormal electrolyte transport occurs in several organs including the lung, sweat glands, intestine and pancreas. The present work was aimed at exploring whether the same or similar regulatory systems are functional in platelets, and if they are altered or deficient in individuals with cystic fibrosis. Chloride transport in platelets from normal subjects and from cystic fibrosis patients was measured by cell sizing techniques where chloride permeability is the limiting factor. In platelets from healthy volunteers, the chloride channel blocker, 5-nitro-2-(3-phenylpropylamino) benzoic acid, inhibits the transport in a dose-dependent manner. The preservation of chloride transport capability is shown to be dependent upon the presence of either Ca2+ or two divalent cation substitutes, Cd2+ or Cu2+. It is also shown that in normal subjects 0.1 mumol/l prostaglandin E1, which elevates cyclic AMP 6 times and abolishes platelet aggregation, significantly enhances the rate constant of the transport. Furthermore, in five out of nine cystic fibrosis patients studied, platelet chloride transport did not respond to stimulation by prostaglandin E1. PMID:7578613

  19. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    2003-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate CAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of CAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of CAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of CAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of CAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of CAMP by either epinephrine or isoproterenol.

  20. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Cureri, Peter A. (Technical Monitor)

    2002-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of cAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of cAMP by either epinephrine or isoproterenol.

  1. Cyclic AMP, the microtubule-microfilament system, and cancer.

    PubMed Central

    Puck, T T

    1977-01-01

    Additional evidence is presented for the previously proposed existence in normal fibroblasts of a cyclic AMP-dependent network of microtubules and microfilaments, which is connected with cell membrane elements on one end and with nuclear structures on the other and whose disorganization leads to malignant transformation. In the presence of cyclic AMP derivatives sufficient to promote integrity of this network, cell growth limitation in suspension, increased transport of alpha-[14C]aminobutyrate, and the relatively tranquilized membrane of the normal fibroblast are also achieved. A pattern of distribution of actin and tubulin has been demonstrated showing aggregated actin deposits which are presumably responsible for the oscillatory knob activity of cells with the transformed habitus. Specific orientations of microtubular and filamentous elements with respect to the nucleus can be demonstrated. The hypothesis that the microtubular-microfilamentous structure conveys growth-regulatory information from the cell membrane to the nucleus and that its disorganization can lead to malignancy has been extended to explain various cellular manifestations. Images PMID:200918

  2. Differential regulation of prohormone convertase 1/3, prohormone convertase 2 and phosphorylated cyclic-AMP-response element binding protein by short-term and long-term morphine treatment: implications for understanding the "switch" to opiate addiction.

    PubMed

    Espinosa, V Paez; Liu, Y; Ferrini, M; Anghel, A; Nie, Y; Tripathi, P V; Porche, R; Jansen, E; Stuart, R C; Nillni, E A; Lutfy, K; Friedman, T C

    2008-10-15

    Drug addiction is a state of altered brain reward and self-regulation mediated by both neurotransmitter and hormonal systems. Although an organism's internal system attempts to maintain homeostasis when challenged by exogenous opiates and other drugs of abuse, it eventually fails, resulting in the transition from drug use to drug abuse. We propose that the attempted maintenance of hormonal homeostasis is achieved, in part, through alterations in levels of processing enzymes that control the ratio of active hormone to pro-hormone. Two pro-hormone convertases, PC1/3 and PC2 are believed to be responsible for the activation of many neurohormones and expression of these enzymes is dependent on the presence of a cyclic-AMP response element (CRE) in their promoters. Therefore, we studied the effects of short-term (24-h) and long-term (7-day) morphine treatment on the expression of hypothalamic PC1/3 and PC2 and levels of phosphorylated cyclic-AMP-response element binding protein (P-CREB). While short-term morphine exposure down-regulated, long-term morphine exposure up-regulated P-CREB, PC1/3 and PC2 protein levels in the rat hypothalamus as determined by Western blot analysis. Quantitative immunofluorescence studies confirmed these regulatory actions of morphine in the paraventricular and dorsomedial nucleus of the hypothalamus. Specific radioimmunoassays demonstrated that the increase in PC1/3 and PC2 levels following long-term morphine led to increased TRH biosynthesis as evidence by increased TRH/5.4 kDa C-terminal proTRH-derived peptide ratios in the median eminence. Promoter activity experiments in rat somatomammotrope GH3 cells containing the mu-opioid receptor demonstrated that the CRE(s) in the promoter of PC1/3 and PC2 is required for morphine-induced regulation of PC1/3 and PC2. Our data suggest that the regulation of the prohormone processing system by morphine may lead to alterations in the levels of multiple bioactive hormones and may be a compensatory mechanism whereby the organism tries to restore its homeostatic hormonal milieu. The down-regulation of PC1/3, PC2 and P-CREB by short-term morphine and up-regulation by long-term morphine treatment may be a signal mediating the switch from drug use to drug abuse. PMID:18771713

  3. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  4. Prostaglandin E2 Inhibits NLRP3 Inflammasome Activation through EP4 Receptor and Intracellular Cyclic AMP in Human Macrophages.

    PubMed

    Sokolowska, Milena; Chen, Li-Yuan; Liu, Yueqin; Martinez-Anton, Asuncion; Qi, Hai-Yan; Logun, Carolea; Alsaaty, Sara; Park, Yong Hwan; Kastner, Daniel L; Chae, Jae Jin; Shelhamer, James H

    2015-06-01

    PGE2 is a potent lipid mediator involved in maintaining homeostasis but also promotion of acute inflammation or immune suppression in chronic inflammation and cancer. Nucleotide-binding domain, leucine-rich repeat-containing protein (NLR)P3 inflammasome plays an important role in host defense. Uncontrolled activation of the NLRP3 inflammasome, owing to mutations in the NLRP3 gene, causes cryopyrin-associated periodic syndromes. In this study, we showed that NLRP3 inflammasome activation is inhibited by PGE2 in human primary monocyte-derived macrophages. This effect was mediated through PGE2 receptor subtype 4 (EP4) and an increase in intracellular cAMP, independently of protein kinase A or exchange protein directly activated by cAMP. A specific agonist of EP4 mimicked, whereas its antagonist or EP4 knockdown reversed, PGE2-mediated NLRP3 inhibition. PGE2 caused an increase in intracellular cAMP. Blockade of adenylate cyclase by its inhibitor reversed PGE2-mediated NLRP3 inhibition. Increase of intracellular cAMP by an activator of adenylate cyclase or an analog of cAMP, or a blockade of cAMP degradation by phosphodiesterase inhibitor decreased NLRP3 activation. Protein kinase A or exchange protein directly activated by cAMP agonists did not mimic, and their antagonists did not reverse, PGE2-mediated NLRP3 inhibition. Additionally, constitutive IL-1? secretion from LPS-primed PBMCs of cryopyrin-associated periodic fever syndromes patients was substantially reduced by high doses of PGE2. Moreover, blocking cytosolic phospholipase A2? by its inhibitor or small interfering RNA or inhibiting cyclooxygenase 2, resulting in inhibition of endogenous PGE2 production, caused an increase in NLRP3 inflammasome activation. Our results suggest that PGE2 might play a role in maintaining homeostasis during the resolution phase of inflammation and might serve as an autocrine and paracrine regulator. PMID:25917098

  5. Dopamine- and cyclic AMP-regulated phosphoprotein-immunoreactive neurons activated by acute stress are innervated by fiber terminals immunopositive for pituitary adenylate cyclase-activating polypeptide in the extended amygdala in the rat.

    PubMed

    Kozicz, Tams; Arimura, Akira

    2002-11-15

    The bed nuclei of the stria terminalis (BST) and the central nucleus of the amygdala are highly heterogeneous structures, which form one functional unit, the so-called extended amygdala. Several studies described increased c-fos expression following acute stress in this brain area, confirming its central role in the modulation/regulation of stress responses. The oval nucleus of the BST and the central amygdala exhibit a dense network of pituitary adenylate cyclase-activating polypeptide (PACAP)-immunoreactive (ir) fiber terminals. In addition, several dopamine- and cyclic AMP-regulated phosphoprotein (DARPP-32)-immunoreactive neurons were also observed here. Because the extended amygdala plays an important role in the central autonomic regulation during stress and the distribution of PACAP-ir and that of DARPP-32-ir nervous structures overlap, the aims of this study were to investigate the possible activation of DARPP-32-ir neurons following acute systemic stress and to demonstrate synaptic interactions between DARPP-32-ir neurons and fiber terminals immunopositive for PACAP.In summary, this study provided morphological evidence that acute stress resulted in the activation of DARPP-32 neurons, which were innervated by PACAP-ir neuronal structures in the extended amygdala. Furthermore, interaction between neuropeptides/neurotransmitters and phosphoproteins was also demonstrated. PMID:12409216

  6. Molecular cloning and expression of a cyclic AMP-activated chloride conductance regulator: a novel ATP-binding cassette transporter.

    PubMed Central

    van Kuijck, M A; van Aubel, R A; Busch, A E; Lang, F; Russel, F G; Bindels, R J; van Os, C H; Deen, P M

    1996-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP-regulated, cAMP-activated chloride channel located in the apical membrane of many epithelial secretory cells. Here we report cloning of a cAMP-activated epithelial basolateral chloride conductance regulator (EBCR) that appears to be a basolateral CFTR counterpart. This novel chloride channel or regulator shows 49% identity with multidrug resistance-associated protein (MRP) and 29% identity with CFTR. On expression in Xenopus oocytes, EBCR confers a cAMP-activated chloride conductance that is inhibited by the chloride channel blockers niflumic acid, 5-nitro-2-(3-phenylpropylamine)benzoic acid, and 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid. Northern blot analysis reveals high expression in small intestine, kidney, and liver. In kidney, immunohistochemistry shows a conspicuous basolateral localization mainly in the thick ascending limb of Henle's loop, distal convoluted tubules and to a lesser extent connecting tubules. These data suggest that in the kidney EBCR is involved in hormone-regulated chloride reabsorption. Images Fig. 2 PMID:8643587

  7. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  8. Equivalence between Pfr and Cyclic AMP in the Induction of d-Usnic Acid Dehydrogenase in the Lichen Evernia prunastri.

    PubMed

    Avalos, A; Vicente, C

    1987-07-01

    d-Usnic acid dehydrogenase is induced in Evernia prunastri thalli by a supply of exogenous d-usnic acid in light. This effect is enhanced by red light pulses through a two step way: a very rapid increase of activity after the first 10 minutes of red light, which is not reversed by far-red light, and a slow enhancement following successive red light pulses at the beginning of each hour of incubation. The last response is completely reversed by far-red following red light. Although induction of the enzyme is not achieved in the dark, 0.1 and 0.5 millimolar cyclic AMP, or 0.1 millimolar dibutyryl cyclic AMP substitutes light action and, then, the enzyme is produced. In addition, phytochrome-far red-absorbing form-increases the amount of endogenously produced cyclic AMP and this effect is shown to be photoreversible when ethylenediaminetetraacetic acid is inhibiting adenylate cyclase. PMID:16665525

  9. Ephedrine induced thioredoxin-1 expression through ?-adrenergic receptor/cyclic AMP/protein kinase A/dopamine- and cyclic AMP-regulated phosphoprotein signaling pathway.

    PubMed

    Jia, Jin-Jing; Zeng, Xian-Si; Li, Ye; Ma, Sha; Bai, Jie

    2013-05-01

    Ephedrine (Eph) is one of alkaloids that has been isolated from the ancient herb ephedra (ma huang) and is used as the treatment of asthma, hypotension and fatigue. However, its molecular mechanism remains unknown. Thioredoxin-1 (Trx-1) is a redox regulating protein, which has various biological activities, including regulating transcription factor DNA binding activity and neuroprotection. In this study, we found that Eph induced Trx-1 expression, which was inhibited by propranolol (?-adrenergic receptor inhibitor), but not by phenoxybenzamine (?-adrenergic receptor inhibitor) in rat pheochromocytoma PC12 cells. Moreover, the increase of Trx-1 expression was inhibited by SQ22536 (adenylyl cyclase inhibitor) and H-89 (protein kinase A inhibitor). Interestingly, the effect of Eph on dopamine- and cyclic AMP-regulated phosphoprotein (DARPP-32) was similar to Trx-1. Thus, the relationship between Trx-1 and DARPP-32 was further studied. The DARPP-32 siRNA significantly reduced Trx-1 expression, but Trx-1 siRNA did not exchange DARPP-32. These results suggested that Eph induced the Trx-1 expression through ?-adrenergic receptor/cyclic AMP/PKA/DARPP-32 signaling pathway. Furthermore, Eph induced PKA-mediated cyclic AMP response element-binding protein (CREB) phosphorylation. Down-regulation of DARPP-32 expression decreased phosphorylated CREB. In addition, Eph had a significant effect on the viability of the rat pheochromocytoma PC12 cells through ?-adrenergic receptors. Trx-1 may play an important role in the actions of Eph. PMID:23416460

  10. Expression of phosphorylated cyclic AMP response element-binding protein in melanin-concentrating hormone neurons and orexin neurons in male and female rats during ad-libitum feeding.

    PubMed

    Fukushima, Atsushi; Hagiwara, Hiroko; Yoshioka, Nozomu; Kimura, Fukuko; Akema, Tatsuo; Funabashi, Toshiya

    2014-07-01

    Using phosphorylated cyclic AMP response element-binding protein (pCREB) as a marker of neural activity, we previously suggested that orexin neurons and melanin-concentrating hormone (MCH) neurons play distinct roles in feeding behavior. In the present study, we examined the expression of pCREB during ad-libitum feeding; previously, only fasted animals were examined. MCH neurons, but not orexin neurons, expressed pCREB during spontaneous food intake. The induction of pCREB expression did not differ by sex, but attenuation seemed to occur faster in females than in males. On the basis of the results of the present study, we speculate that MCH neurons respond to nutrition-related feeding, but the feeding-related activity of orexin was not evident unless hunger was accompanied by stress, such as the stress caused by the absence of food in the case of fasting. Therefore, the desire to eat under normal conditions does not drive orexin neurons, but it does drive MCH neurons. We tested this hypothesis by examining the effects of consuming glucose or saccharin, a nonmetabolized sweetener, in fasted male and female rats. Glucose and saccharin were equally effective in reducing pCREB expression in the orexin neurons of female rats. In MCH neurons, glucose attenuated the expression of pCREB, but saccharin had no effect, irrespective of sex. Taken together, the results indicate that MCH and orexin peptides play physiologically distinct roles in feeding behavior. PMID:24780894

  11. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.

    PubMed

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D

    2015-03-01

    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways. PMID:25615818

  12. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells

    PubMed Central

    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W.; Hussain, Arif; Ross, Douglas D.

    2015-01-01

    We report a novel cyclic-AMP (cAMP) response element (CRE) in the human BCRP promoter that is functional in human cancer cell lines of multiple lineages. 8Br-cAMP increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Activation of the epidermal growth factor receptor (EGFR) pathway also led to an increase in BCRP promoter reporter activity and to phosphorylation of the c-AMP response element binding protein (CREB) via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound phospho-CREB; point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is also involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in multiple human cancer cell lines following activation of a variety of signaling pathways. PMID:25615818

  13. Involvement of cyclic nucleotide-dependent protein kinases in cyclic AMP-mediated vasorelaxation

    PubMed Central

    Eckly-Michel, Anita; Martin, Viviane; Lugnier, Claire

    1997-01-01

    The involvement of cyclic AMP-dependent protein kinase (PKA) and cyclic GMP-dependent protein kinase (PKG) in the effects of cyclic AMP-elevating agents on vascular smooth muscle relaxation, cyclic nucleotide dependent-protein kinase activities and ATP-induced calcium signalling ([Ca2+]i) was studied in rat aorta. Cyclic AMP-elevating agents used were a ?-adrenoceptor agonist (isoprenaline), a phosphodiesterase 3 (PDE3) inhibitor (SK&F 94120) and a PDE4 inhibitor (rolipram). In rat intact aorta, the relaxant effect induced by isoprenaline (0.010.3??M) was decreased by a specific inhibitor of PKA, H-89, whereas a specific inhibitor of PKG, Rp-8-Br-cyclic GMPS, was without effect. No significant difference in PKA and PKG activity ratios was detected in aortic rings when isoprenaline 10??M was used. At the same concentration, isoprenaline did not modify ATP-induced changes in [Ca2+]i in smooth muscle cells. Neither H-89 nor Rp-8-Br-cyclic GMPS modified this response. These findings suggest that PKA is only involved in the relaxant effect induced by low concentrations of isoprenaline (0.010.3??M), whereas for higher concentrations, other mechanisms independent of PKA and PKG are involved. The relaxant effects induced by SK&F 94120 and rolipram were inhibited by Rp-8-Br-cyclic GMPS with no significant effect of H-89. Neither SK&F 94120, nor rolipram at 30??M significantly modified the activity ratios of PKA and PKG. Rolipram inhibited the ATP-induced transient increase in [Ca2+]i. This decrease was abolished by Rp-8-Br-cyclic GMPS whereas H-89 had no significant effect. These results suggest that PKG is involved in the vascular effects induced by the inhibitors of PDE3 and PDE4. Moreover, since it was previously shown that PDE3 and PDE4 inhibitors only increased cyclic AMP levels with no change in cyclic GMP level, these data also suggest a cross-activation of PKG by cyclic AMP in rat aorta. The combination of 5??M SK&F 94120 with rolipram markedly potentiated the relaxant effect of rolipram. This relaxation was decreased by H-89 and not significantly modified by Rp-8-Br-cyclic GMPS. Moreover, the association of the two PDE inhibitors significantly increased the activity ratio of PKA without changing the PKG ratio. The present findings show that PKA rather than PKG is involved in this type of vasorelaxation. The differences in the participation of PKA vs PKG observed when inhibitors of PDE3 and PDE4 were used alone or together could be due to differences in the degree of accumulation of cyclic AMP, resulting in the activation of PKA or PKG which are differently localized in the cell. These findings support a role for both PKA and PKG in cyclic AMP-mediated relaxation in rat aorta. Their involvement depends on the cellular pathway used to increase the cyclic AMP level. PMID:9298542

  14. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to.... Cyclic AMP measurements are used in the diagnosis and treatment of endocrine disorders,...

  15. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to.... Cyclic AMP measurements are used in the diagnosis and treatment of endocrine disorders,...

  16. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to.... Cyclic AMP measurements are used in the diagnosis and treatment of endocrine disorders,...

  17. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to.... Cyclic AMP measurements are used in the diagnosis and treatment of endocrine disorders,...

  18. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230....1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to.... Cyclic AMP measurements are used in the diagnosis and treatment of endocrine disorders,...

  19. cap alpha. /sub 2/-Adrenergic receptor-mediated sensitization of forskolin-stimulated cyclic AMP production

    SciTech Connect

    Jones, S.B.; Toews, M.L.; Turner, J.T.; Bylund, D.B.

    1987-03-01

    Preincubation of HT29 human colonic adenocarcinoma cells with ..cap alpha../sub 2/-adrenergic agonists resulted in a 10- to 20-fold increase in forskolin-stimulated cyclic AMP production as compared to cells preincubated without agonist. Similar results were obtained using either a (/sup 3/H)adenine prelabeling assay or a cyclic AMP radioimmunoassay to measure cyclic AMP levels. This phenomenon, which is termed sensitization, is ..cap alpha../sub 2/-adrenergic receptor-mediated and rapid in onset and reversal. Yohimbine, an ..cap alpha../sub 2/-adrenergic receptor-selective antagonist, blocked norepinephrine-induced sensitization, whereas prazosin (..cap alpha../sub 1/-adrenergic) and sotalol (..beta..-adrenergic) did not. The time for half-maximal sensitization was 5 min and the half-time for reversal was 10 min. Only a 2-fold sensitization of cyclic AMP production stimulated by vasoactive intestinal peptide was observed, indicating that sensitization is relatively selective for forskolin. Sensitization reflects an increased production of cyclic AMP and not a decreased degradation of cyclic AMP, since incubation with a phosphodiesterase inhibitor and forskolin did not mimic sensitization. Increasing the levels of cyclic AMP during the preincubation had no effect on sensitization, indicating that sensitization is not caused by decreased cyclic AMP levels during the preincubation. This rapid and dramatic sensitization of forskolin-stimulated cyclic AMP production is a previously unreported effect that can be added to the growing list of ..cap alpha../sub 2/-adrenergic responses that are not mediated by a decrease in cyclic AMP.

  20. Regulation of cyclic AMP formation in brain tissue by alpha-adrenergic receptors: requisite intermediacy of prostaglandins of the E series.

    PubMed Central

    Partington, C R; Edwards, M W; Daly, J W

    1980-01-01

    The accumulations of cyclic AMP elicited by norepinephrine in slices of rat cerebral cortex or hypothalamus were markedly reduced after incubations with prostaglandin synthetase (8,11,14-eicosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) inhibitors such as indomethacin, aspirin, flufenamic acid, and acetoaminophen. Responses of cyclic AMP-generating systems to beta-adrenergic agonists or adenosine were unchanged by treatment with indomethacin and the reduction in the norepinephrine response appeared due primarily to a loss of the alpha-adrenergic component. The accumulation of cyclic AMP elicited by prostaglandin E2 [mean effective dose (EC50) 4 micro M] was increased by 2-fold by treatment with indomethacin. The alpha-adrenergic component of the norepinephrine response was fully restored by very low concentrations of prostaglandin E2 (EC50 20 nM). Prostaglandins of the F series had no effect on cyclic AMP generation under a variety of conditions. It appears that low levels of prostaglandins of the E series are required--perhaps by a calcium-dependent mechanism--for the expression of alpha-adrenergic receptor-mediated activation of cyclic AMP formation in brain tissue. PMID:6248884

  1. Apparent presence of Ser133-phosphorylated cyclic AMP response element binding protein (pCREB) in brain mitochondria is due to cross-reactivity of pCREB antibodies with pyruvate dehydrogenase.

    PubMed

    Pláteník, Jan; Balcar, Vladimír J; Yoneda, Yukio; Mioduszewska, Barbara; Buchal, Richard; Hynek, Radovan; Kilianek, Lukasz; Kuramoto, Nobuyuki; Wilczynski, Grzegorz; Ogita, Kiyokazu; Nakamura, Yoichi; Kaczmarek, Leszek

    2005-12-01

    Cyclic AMP response element binding protein (CREB) is a constitutive transcription factor that activates transcription following stimulus-dependent phosphorylation at Ser133, implicated in synaptic plasticity and neuronal survival pathways. The prevailing view that CREB is exclusively nuclear has been questioned by several studies, and, for example, mitochondrial localization has been reported. Using subcellular fractionation of rat brain cortex coupled with western immunoblotting with Ser133-phospho-CREB (pCREB) antibodies, we found a robust pCREB immunoreactivity (IR) in mitochondria-enriched fractions. The pCREB antibodies also stained the mitochondria, in addition to nuclei, of glial cells in primary cortical cultures. However, two CREB antibodies against different epitopes and gel shift assay detected the CREB protein mainly in the nuclear fraction. The two-dimensional electrophoretic mobility of mitochondrial pCREB IR differed markedly from the nuclear CREB/pCREB IR, indicating that the pCREB antibody cross-reacts with another mitochondrial protein. Immunoprecipitation of the mitochondrial pCREB IR produced three bands on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which were identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as E2, E1 alpha-subunit, and E1 beta-subunit of pyruvate dehydrogenase complex. The cross-reacting epitope was identified as phospho-Ser300 of the alpha-subunit. In conclusion, this study confirms the presence of pCREB-like IR in brain mitochondria that, after careful scrutiny, turned out to be pyruvate dehydrogenase rather than authentic CREB. PMID:16219034

  2. Equivalence between Pfr and Cyclic AMP in the Induction of d-Usnic Acid Dehydrogenase in the Lichen Evernia prunastri1

    PubMed Central

    Avalos, A.; Vicente, C.

    1987-01-01

    d-Usnic acid dehydrogenase is induced in Evernia prunastri thalli by a supply of exogenous d-usnic acid in light. This effect is enhanced by red light pulses through a two step way: a very rapid increase of activity after the first 10 minutes of red light, which is not reversed by far-red light, and a slow enhancement following successive red light pulses at the beginning of each hour of incubation. The last response is completely reversed by far-red following red light. Although induction of the enzyme is not achieved in the dark, 0.1 and 0.5 millimolar cyclic AMP, or 0.1 millimolar dibutyryl cyclic AMP substitutes light action and, then, the enzyme is produced. In addition, phytochrome—far red-absorbing form—increases the amount of endogenously produced cyclic AMP and this effect is shown to be photoreversible when ethylenediaminetetraacetic acid is inhibiting adenylate cyclase. PMID:16665525

  3. Effects of Prostaglandins and Cholera Enterotoxin on Intestinal Mucosal Cyclic AMP Accumulation

    PubMed Central

    Kimberg, Daniel V.; Field, Michael; Gershon, Elaine; Henderson, Antonia

    1974-01-01

    Both cholera enterotoxin and certain prostaglandins have been shown to stimulate intestinal fluid secretion in vivo, to cause ion flux changes in vitro similar to those caused by addition of cyclic 3′,5′-adenosine monophosphate (cyclic AMP), and to activate intestinal mucosal adenyl cyclase. It has been suggested that the effects of the enterotoxin on intestinal cyclic AMP metabolism may be indirect, and that locally synthesized prostaglandins may serve as required intermediates for the effects of the enterotoxin in activating intestinal mucosal adenyl cyclase. In order to clarify certain aspects of the mechanisms by which these two agents alter intestinal mucosal cyclic AMP metabolism and ion transport, their effects on cyclic AMP accumulation in rabbit ileal mucosa were examined in vitro. Addition of 5 μg per ml (75 μg per 150 mg mucosa) of purified cholera enterotoxin produced a peak increase in cyclic AMP level in 3 h but there was a time delay of at least 30 min before any effect was observed. Inhibition of cyclic nucleotide phosphodiesterase with theophylline failed to reduce this time delay. In contrast, addition of prostaglandin E1 (PGE1) increased the cyclic AMP level rapidly, a peak effect being observed in 2 min. The time of the peak prostaglandin-induced changes in cyclic AMP level and short-circuit current correlated closely. A maximal increment in cyclic AMP level was achieved with 5 × 10−5 M PGE1. When 10−4 M PGE1 was added to mucosa already maximally stimulated with cholera toxin, the resulting cyclic AMP level was equal to the sum of the levels reached when each agent was added alone. Furthermore, the effects of the enterotoxin on mucosal cyclic AMP levels were not influenced by indomethacin under conditions where mucosal prostaglandins synthesis was inhibited. The results suggest that endogenous prostaglandins do not provide an essential link in the activation of intestinal mucosal adenyl cyclase by cholera enterotoxin. The present study also indicates that the effect of cholera enterotoxin on intestinal mucosal cyclic AMP metabolism involves a definite time delay which is not due to cyclic nucleotide phosphodiesterase activity. PMID:4359941

  4. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  5. Relaxation of guinea-pig trachea by cyclic AMP phosphodiesterase inhibitors and their enhancement by sodium nitroprusside.

    PubMed Central

    Turner, N. C.; Lamb, J.; Worby, A.; Murray, K. J.

    1994-01-01

    1. The effects of agents that elevate either cyclic AMP (the phosphodiesterase (PDE) III inhibitor siguazodan, salbutamol) or cyclic GMP (sodium nitroprusside (SNP)) on the relaxant activity of the PDE IV inhibitor, rolipram, were investigated in carbachol (0.1 microM) precontracted guinea-pig tracheal sheets. 2. Rolipram, siguazodan and SNP caused concentration-related reductions in tone of tissues precontracted with 0.1 microM carbachol (EC50 values 12.5; 2.73 and 0.35 microM respectively). Whilst the concentration-response relationship for the PDE III inhibitor, siguazodan, was monophasic that of the PDE IV inhibitor, rolipram, was biphasic. 3. The relaxant activity of rolipram was markedly enhanced in the presence of 10 microM siguazodan (EC50 < 0.01 microM), 0.1 microM salbutamol (EC50 0.03 microM) and 0.3 microM SNP (EC50 0.03 microM). In contrast, the relaxant activity of siguazodan was unaffected by SNP and only modestly enhanced by rolipram (10 microM) and salbutamol (0.1 microM). 4. The relaxant activity of SNP was enhanced by the PDE V inhibitor SK&F 96231 (30 microM: EC50 0.06 microM) and rolipram (30 microM, EC50 0.08 microM) but was unaffected by 30 microM siguazodan. 5. At concentrations up to 10 microM, neither siguazodan nor rolipram elevated tracheal cyclic AMP levels. However, the combination of 10 microM rolipram and siguazodan caused a two fold increase in the cyclic AMP content (from 2.19 to 4.36 pmol cyclic AMP mg-1 protein). SNP (0.1-10 microM) failed to produce a significant increase in tracheal cyclic AMP levels. At 0.1 microM the effect of SNP on tracheal cyclic AMP levels was significantly (P < 0.05) increased in the presence of rolipram but not siguadozan.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8032589

  6. The ? opioid agonist morphine modulates potentiation of capsaicin-evoked TRPV1 responses through a cyclic AMP-dependent protein kinase A pathway

    PubMed Central

    Vetter, Irina; Wyse, Bruce D; Monteith, Gregory R; Roberts-Thomson, Sarah J; Cabot, Peter J

    2006-01-01

    Background The vanilloid receptor 1 (TRPV1) is critical in the development of inflammatory hyperalgesia. Several receptors including G-protein coupled prostaglandin receptors have been reported to functionally interact with the TRPV1 through a cAMP-dependent protein kinase A (PKA) pathway to potentiate TRPV1-mediated capsaicin responses. Such regulation may have significance in inflammatory pain. However, few functional receptor interactions that inhibit PKA-mediated potentiation of TRPV1 responses have been described. Results In the present studies we investigated the hypothesis that the ? opioid receptor (MOP) agonist morphine can modulate forskolin-potentiated capsaicin responses through a cAMP-dependent PKA pathway. HEK293 cells were stably transfected with TRPV1 and MOP, and calcium (Ca2+) responses to injection of the TRPV1 agonist capsaicin were monitored in Fluo-3-loaded cells. Pre-treatment with morphine did not inhibit unpotentiated capsaicin-induced Ca2+ responses but significantly altered capsaicin responses potentiated by forskolin. TRPV1-mediated Ca2+ responses potentiated by the direct PKA activator 8-Br-cAMP and the PKC activator Phorbol-12-myristate-13-acetatewere not modulated by morphine. Immunohistochemical studies confirmed that the TRPV1 and MOP are co-expressed on cultured Dorsal Root Ganglion neurones, pointing towards the existence of a functional relationship between the G-protein coupled MOP and nociceptive TRPV1. Conclusion The results presented here indicate that the opioid receptor agonist morphine acts via inhibition of adenylate cyclase to inhibit PKA-potentiated TRPV1 responses. Targeting of peripheral opioid receptors may therefore have therapeutic potential as an intervention to prevent potentiation of TRPV1 responses through the PKA pathway in inflammation. PMID:16842630

  7. Effects of forskolin analogs, phosphodiesterase inhibitors and 8-bromo cyclic AMP on plasma exudations induced with bradykinin and prostaglandin E/sub 1/ in rat skin

    SciTech Connect

    Sugio, K.; Daly, J.W.

    1984-01-09

    The effects of forskolin analogs, phosphodiesterase inhibitors and 8-bromo cyclic AMP on plasma exudations induced with bradykinin and prostaglandin E/sub 1/ in rat skin were investigated using (/sup 125/I) bovine serum albumin (/sup 125/I-BSA). Forskolin, forskolin 7-ethyl carbonate and 7-desacetylforskolin, which are potent activators of adenylate cyclase, greatly potentiated the bradykinin-induced plasma exudation and inhibited the prostaglandin E/sub 1/-induced response. The phosphodiesterase inhibitors, ZK 627ll, dipyridamole, HL 725, and 3-isobutyl-1-methylxanthine potentiated the bradykinin-induced plasma exudation and inhibited and prostaglandin E/sub 1/-induced response. 8-Bromo cyclic AMP in the doses of 0.01 to 1 ..mu..g potentiated the bradykinin-induced plasma exudation, but had no effect at doses of 10 and 100 ..mu..g. 8-bromo cyclic AMP at all doses significantly inhibited the prostaglandin E/sub 1/-induced response. The results suggest that the effects of forskolin and its analogs on plasma exudations induced with bradykinin and prostaglandin E/sub 1/ in rat skin derive from activation of cyclic AMP-generating systems.

  8. Stimulation by Alcohols of Cyclic AMP Metabolism in Human Leukocytes

    PubMed Central

    Atkinson, John P.; Sullivan, Timothy J.; Kelly, James P.; Parker, Charles W.

    1977-01-01

    In this study ethanol and certain other short-chain aryl (benzyl and phenethyl) and aliphatic (methyl, propyl, butyl, and amyl) alcohols produced up to 10-fold increases in cyclic AMP (cAMP) concentrations in purified human peripheral blood lymphocytes. Ethanol concentrations as low as 80 mg/dl produced significant elevations in lymphocyte cAMP. Significant but less marked augmentation of cAMP in response to alcohols was observed in human platelets, human granulocytes, and rabbit alveolar macrophages. The mechanism of the alcohol-induced cAMP accumulation is probably secondary to membrane perturbation and consequent activation of adenylate cyclase, because ethanol directly stimulated this enzyme in lymphocyte membrane preparations but had no effect on lymphocyte phosphodiesterase activity. Lysosomal enzyme release, by phagocytosing human leukocytes, and aminoisobutyric acid transport in mitogen-stimulated human lymphocytes were shown to be inhibited by ethanol and other alcohols at concentrations which also elevate cAMP. In general, the magnitude of the inhibition of these inflammatory processes correlated with the ability of the alcohol to elevate cAMP concentrations. Lectin-and anti-thymocyte globulin-induced lymphocyte mitogenesis was inhibited or unaffected depending upon both the concentration and type of mitogenic stimulus and the concentration and type of alcohol utilized. Inflammatory mediator release from rat mast cells also was inhibited by ethanol and certain other alcohols, but whole cell cAMP was not increased. Ethanol may alter these inflammatory responses and other biologic processes at least in part by modulating cellular levels of cAMP. PMID:194924

  9. Induction of Ca2+/calmodulin-stimulated cyclic AMP phosphodiesterase (PDE1) activity in Chinese hamster ovary cells (CHO) by phorbol 12-myristate 13-acetate and by the selective overexpression of protein kinase C isoforms.

    PubMed Central

    Spence, S; Rena, G; Sweeney, G; Houslay, M D

    1995-01-01

    The cAMP phosphodiesterase (PDE) activity of CHO cells was unaffected by the addition of Ca2+ +calmodulin (CaM), indicating the absence of any PDE1 (Ca2+/CaM-stimulated PDE) activity. Treatment with the tumour promoting phorbol ester phorbol 12-myristate 13-acetate (PMA) led to the rapid transient induction of PDE1 activity which attained a maximum value after about 13 h before slowly decreasing. Such induction was attenuated by actinomycin D. PCR primers were designed to hybridize with two regions identified as being characteristic of PDE1 forms found in various species and predicted to amplify a 601 bp fragment. RT-PCR using degenerate primers allowed an approx. 600 bp fragment to be amplified from RNA preparations of rat brain but not from CHO cells unless they had been treated with PMA. CHO cells transfected to overexpress protein kinase C (PKC)-alpha and PKC-epsilon, but not those transfected to overexpress PKC-beta I or PKC-gamma, exhibited a twofold higher PDE activity. They also expressed a PDE1 activity, with Ca2+/CaM effecting a 1.8-2.8-fold increase in total PDE activity. RT-PCR, with PDE1-specific primers, identified an approx. 600 bp product in CHO cells transfected to overexpress PKC-alpha and PKC-epsilon, but not in those overexpressing PKC-beta I or PKC-gamma. Treatment of PKC-alpha transfected cells with PMA caused a rapid, albeit transient, increase in PDE1 activity, which reached a maximum some 1 h after PMA challenge, before returning to resting levels some 2 h later. The residual isobutylmethylxanthine (IBMX)-insensitive PDE activity was dramatically reduced (approx. 4-fold) in the PKC-gamma transfectants, suggesting that the activity of the cyclic AMP-specific IBMX-insensitive PDE7 activity was selectively reduced by overexpression of this particular PKC isoform. These data identify a novel point of 'cross-talk' between the lipid and cyclic AMP signalling systems where the action of specific PKC isoforms is shown to cause the induction of Ca2+/CaM-stimulated PDE (PDE1) activity. It is suggested that this protein kinase C-mediated process might involve regulation of PDE1 gene expression by the AP-1 (fos/jun) system. Images Figure 3 Figure 4 PMID:7575435

  10. Bidirectional Regulation of the Cyclic-AMP Response Element Binding Protein Encodes Spatial Map Alignment in Prism-Adapting Barn Owls

    PubMed Central

    Nichols, Grant S; DeBello, William M

    2012-01-01

    The barn owl midbrain contains mutually aligned maps of auditory and visual space. Throughout life, map alignment is maintained through the actions of an instructive signal that encodes the magnitude of auditory-visual mismatch. The intracellular signaling pathways activated by this signal are unknown. Here we tested the hypothesis that CREB (cAMP response element binding protein) provides a cell-specific readout of instructive information. Owls were fitted with prismatic or control spectacles and provided rich auditory-visual experience - hunting live mice. CREB activation was analyzed within 30 minutes of hunting using phosphorylation state-specific (pCREB) and CREB antibodies, confocal imaging and immunofluorescence measurements at individual cell nuclei. In control owls or prism-adapted owls, which experience small instructive signals, the frequency distributions of pCREB/CREB values obtained for cell nuclei within the external nucleus of the inferior colliculus (ICX) were unimodal. In contrast, in owls adapting to prisms or re-adapting to normal conditions, the distributions were bimodal: certain cells had received a signal that positively regulated CREB, and by extension, transcription of CREB-dependent genes, while others a signal that negatively regulated it. These changes were restricted to the sub-region of the inferior colliculus that received optically displaced input, the rostral ICX, and not evident in the caudal ICX or central nucleus. Finally, the topographic pattern of CREB regulation was patchy, not continuous, as expected from the actions of a topographically precise signal encoding discrete events. These results support a model in which the magnitude of CREB activation within individual cells provides a readout of the instructive signal that guides plasticity and learning. PMID:18829948

  11. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration

    PubMed Central

    Siddiq, Mustafa M.; Hannila, Sari S.

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  12. Urinary 3'5' cyclic AMP. Diagnostic test in pseudohypoparathyroidism.

    PubMed Central

    Tze, W J; Saunders, J; Drummond, G I

    1975-01-01

    Measurement of urinary cyclic AMP (adenosine 3'5'-cyclic phosphate) and examination of calcium and phosphorus metabolism was carried out in two children with pseudohypoparathyroidism. In both patients infusion of parathyroid hormone failed to elicit any change in urinary cyclic AMP, while a dose-dependent increase in urinary cyclic AMP occurred in a normal control. The findings agree with concept of unresponsiveness of renal cortical tissue to parathyroid hormone in pseudohypoparathyroidism and provide further evidence that measurement of urinary cyclic AMP during parathyroid hormone infusion may be the method of choice in the diagnosis of this disease. PMID:173244

  13. Epidermal chalone and cyclic AMP: an in vivo study.

    PubMed

    Elgjo, K

    1975-01-01

    Water extracts of skin contain two factors that inhibit epidermal cell proliferation: one substance inhibits epidermal cells in the G2 phase (the epidermal G2 inhibitor), and another inhibits the transit of cells from the G1 phase into the S phase (the epidermal G1 inhibitor). Pretreatment of mice with a beta-receptor antagonist (propranolol) abolished the activity of the G2 inhibitor but not that of the G1 inhibitor. After pretreatment with both propranolol and a phosphodiesterase inhibitor (caffine)the G2 inhibitor had full effect. Cafine alone had a moderately inhibitory effect on epidermal G2 cells and enhanced the depressing effect of the G1 inhibitor on epidermal DNA synthesis. AMP level in epidermis to be active. Cyclic AMP is probably also involved in the regulation of the rate of transit of epidermal G1 cells into the S phase but the epidermal cyclic AMP level seems not to be so critical for the efficacy of the epidermal G2 inhibitor in epidermal cell differentiation. PMID:162919

  14. Activation of Na+-permeant cation channel by stretch and cyclic AMP-dependent phosphorylation in renal epithelial A6 cells.

    PubMed

    Marunaka, Y; Shintani, Y; Downey, G P; Niisato, N

    1997-09-01

    It is currently believed that a nonselective cation (NSC) channel, which responds to arginine vasotocin (an antidiuretic hormone) and stretch, regulates Na+ absorption in the distal nephron. However, the mechanisms of regulation of this channel remain incompletely characterized. To study the mechanisms of regulation of this channel, we used renal epithelial cells (A6) cultured on permeable supports. The apical membrane of confluent monolayers of A6 cells expressed a 29-pS channel, which was activated by stretch or by 3-isobutyl-1-methylxanthine (IBMX), an inhibitor of phosphodiesterase. This channel had an identical selectivity for Na+, K+, Li+, and Cs+, but little selectivity for Ca2+ (PCa/PNa < 0.005) or Cl- (PCl/PNa < 0.01), identifying it as an NSC channel. Stretch had no additional effects on the open probability (Po) of the IBMX-activated channel. This channel had one open ("O") and two closed (short "CS" and long "CL") states under basal, stretch-, or IBMX-stimulated conditions. Both stretch and IBMX increased the Po of the channel without any detectable changes in the mean open or closed times. These observations led us to the conclusion that a kinetic model "CL <--> CS <--> O" was the most suitable among three possible linear models. According to this model, IBMX or stretch would decrease the leaving rate of the channel for CL from CS, resulting in an increase in Po. Cytochalasin D pretreatment abolished the response to stretch or IBMX without altering the basal activity. H89 (an inhibitor of cAMP-dependent protein kinase) completely abolished the response to both stretch and IBMX, but, unlike cytochalasin D, also diminished the basal activity. We conclude that: (a) the functional properties of the cAMP-activated NSC channel are similar to those of the stretch-activated one, (b) the actin cytoskeleton plays a crucial role in the activation of the NSC channel induced by stretch and cAMP, and (c) the basal activity of the NSC channel is maintained by PKA-dependent phosphorylation but is not dependent on actin microfilaments. PMID:9276757

  15. Minocycline upregulates cyclic AMP response element binding protein and brain-derived neurotrophic factor in the hippocampus of cerebral ischemia rats and improves behavioral deficits

    PubMed Central

    Zhao, Yu; Xiao, Ming; He, Wenbo; Cai, Zhiyou

    2015-01-01

    Background and purpose The cAMP response element binding protein (CREB) plays an important role in the mechanism of cognitive impairment and is also pivotal in the switch from short-term to long-term memory. Brain-derived neurotrophic factor (BDNF) seems a promising avenue in the treatment of cerebral ischemia injury since this neurotrophin could stimulate structural plasticity and repair cognitive impairment. Several findings have displayed that the dysregulation of the CREB–BDNF cascade has been involved in cognitive impairment. The aim of this study was to investigate the effect of cerebral ischemia on learning and memory as well as on the levels of CREB, phosphorylated CREB (pCREB), and BDNF, and to determine the effect of minocycline on CREB, pCREB, BDNF, and behavioral functional recovery after cerebral ischemia. Methods The animal model was established by permanent bilateral occlusion of both common carotid arteries. Behavior was evaluated 5 days before decapitation with Morris water maze and open-field task. Four days after permanent bilateral occlusion of both common carotid arteries, minocycline was administered by douche via the stomach for 4 weeks. CREB and pCREB were examined by Western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry. BDNF was measured by immunohistochemistry and Western blotting. Results The model rats after minocycline treatment swam shorter distances than control rats before finding the platform (P=0.0007). The number of times the platform position was crossed for sham-operation rats was more than that of the model groups in the corresponding platform location (P=0.0021). The number of times the platform position was crossed for minocycline treatment animals was significantly increased compared to the model groups in the corresponding platform position (P=0.0016). CREB, pCREB, and BDNF were downregulated after permanent bilateral occlusion of both common carotid arteries in the model group. Minocycline increased the expression of CREB, pCREB, and BDNF, and improved cognitive suffered from impairment of permanent bilateral occlusion of both common carotid arteries. Conclusion Minocycline improved cognitive impairment from cerebral ischemia via enhancing CREB, pCREB, and BDNF activity in the hippocampus. PMID:25750531

  16. The In Vivo Activity of Ime1, the Key Transcriptional Activator of Meiosis-Specific Genes in Saccharomyces cerevisiae, Is Inhibited by the Cyclic AMP/Protein Kinase A Signal Pathway through the Glycogen Synthase Kinase 3-? Homolog Rim11

    PubMed Central

    Rubin-Bejerano, Ifat; Sagee, Shira; Friedman, Osnat; Pnueli, Lilach; Kassir, Yona

    2004-01-01

    Phosphorylation is the main mode by which signals are transmitted to key regulators of developmental pathways. The glycogen synthase kinase 3 family plays pivotal roles in the development and well-being of all eukaryotic organisms. Similarly, the budding yeast homolog Rim11 is essential for the exit of diploid cells from the cell cycle and for entry into the meiotic developmental pathway. In this report we show that in vivo, in cells grown in a medium promoting vegetative growth with acetate as the sole carbon source (SA medium), Rim11 phosphorylates Ime1, the master transcriptional activator required for entry into the meiotic cycle and for the transcription of early meiosis-specific genes. We demonstrate that in the presence of glucose, the kinase activity of Rim11 is inhibited. This inhibition could be due to phosphorylation on Ser-5, Ser-8, and/or Ser-12 because in the rim11S5AS8AS12A mutant, Ime1 is incorrectly phosphorylated in the presence of glucose and cells undergo sporulation. We further show that this nutrient signal is transmitted to Rim11 and consequently to Ime1 by the cyclic AMP/protein kinase A signal transduction pathway. Ime1 is phosphorylated in SA medium on at least two residues, Tyr-359 and Ser-302 and/or Ser-306. Ser-302 and Ser-306 are part of a consensus site for the mammalian homolog of Rim11, glycogen synthase kinase 3-?. Phosphorylation on Tyr-359 but not Ser-302 or Ser-306 is essential for the transcription of early meiosis-specific genes and sporulation. We show that Tyr-359 is phosphorylated by Rim11. PMID:15282298

  17. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1997-01-01

    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast nuclear proteins. These results identify C/EBPdelta as a hormonally activated inducer of IGF-I gene transcription in osteoblasts and show that the HS3D element within IGF-I promoter 1 is a high affinity binding site for this protein.

  18. Hetereogeneity of Dose and Time Effects of Estrogen on Neuron-specific Neuronal Protein (NeuN) and Phosphorylated Cyclic AMP Response Element-binding Protein (pCREB) in the Hippocampus of Ovariectomized Rats

    PubMed Central

    Bakkum, Barclay W.; Fan, Lu; Pandey, Subhash C.; Cohen, Rochelle S.

    2011-01-01

    Previous studies have shown changes in cyclic AMP response element-binding protein (CREB) signaling pathway in CA1 and CA3 regions of the rostral hippocampus with 10 µg estrogen treatment for 14 days. It appears that estrogen action on CREB phosphorylation in brain structures may depend on other estrogen doses and lengths of treatment. We, therefore, examined effects of moderate regimens (2.5 µg estradiol benzoate [EB] for 4 or 14 days) on mean numbers of neuron-specific neuronal protein (NeuN)-positive cells and phosphorylated CREB (pCREB)-positive cells and subregion volume defined by NeuN and pCREB immunolabeling and compared those results to the high regimen (10 µg EB for 14 days) in CA1, CA2 and CA3 regions and dorsal (DDG) and ventral (VDG) dentate gyrus and hilus of the hippocampus of ovariectomized rats by stereology. For whole hippocampus, all regimens increased mean neuronal (NeuN) numbers and pCREB-positive cell and volume compared to sesame oil (SO) in CA1, CA2 and CA3 regions, DDG and VDG dentate gyrus and hilus. In rostral hippocampus, however, some hippocampal subregions were not responsive to the high regimen and the moderate regimens appear more effective in increasing mean number of NeuN-positive neurons and pCREB-positive cells and subregion volume. Heterogeneity in responsiveness to estrogen was mainly seen within rostral, but not whole, hippocampal subregions. Our results indicate that responsiveness of cells expressing NeuN and pCREB to different EB regimens may vary depending on the specific region of the hippocampus. PMID:21337376

  19. Hetereogeneity of dose and time effects of estrogen on neuron-specific neuronal protein and phosphorylated cyclic AMP response element-binding protein in the hippocampus of ovariectomized rats.

    PubMed

    Bakkum, Barclay W; Fan, Lu; Pandey, Subhash C; Cohen, Rochelle S

    2011-06-01

    Previous studies have shown changes in the cyclic AMP response element-binding protein (CREB) signaling pathway in CA1 and CA3 regions of the rostral hippocampus with 10 μg estrogen treatment for 14 days. It appears that estrogen's action on CREB phosphorylation in brain structures depends on other estrogen doses and lengths of treatment. We therefore examined the effects of moderate regimens [2.5 μg estradiol benzoate (EB) for 4 or 14 days] on mean numbers of neuron-specific neuronal protein (NeuN)-positive cells and phosphorylated CREB (pCREB)-positive cells and subregion volume defined by NeuN and pCREB immunolabeling and compared those results with results from the high regimen (10 μg EB for 14 days) in CA1, CA2, and CA3 regions and dorsal (DDG) and ventral (VDG) dentate gyrus and hilus of the hippocampus of ovariectomized rats by stereology. For whole hippocampus, all regimens increased mean neuronal (NeuN) numbers and pCREB-positive cell and volume compared with sesame oil (SO) in CA1, CA2, and CA3 regions, DDG and VDG, and hilus. In rostral hippocampus, however, some hippocampal subregions were not responsive to the high regimen, and the moderate regimens appear to be more effective for increasing mean number of NeuN-positive neurons and pCREB-positive cells and subregion volume. Heterogeneity in responsiveness to estrogen was mainly seen within rostral, but not whole, hippocampal subregions. Our results indicate that responsiveness of cells expressing NeuN and pCREB to different EB regimens may vary depending on the specific region of the hippocampus. PMID:21337376

  20. Regulation of Cytotoxic T Lymphocyte Antigen 4 by Cyclic AMP

    PubMed Central

    Li, Jinghong; Lin, Ko-Wei; Murray, Fiona; Nakajima, Takeshi; Zhao, Yandong; Perkins, David L.

    2013-01-01

    Recent studies indicate that cyclic AMP (cAMP) induces cytotoxic T lymphocyte antigen (CTLA) 4. CTLA4 is expressed in T cells, and is a negative regulator of T cell activation. CTLA4 expression is regulated by T cell receptor plus CD28 (adaptive immune signaling) at both the transcriptional and post-transcriptional level. Here, we examine the pathways by which cAMP regulates CTLA4 expression, focusing on transcriptional activation. Elevating intracellular cAMP levels by cell-permeable cAMP analogs, the adenylyl cyclase activator, forskolin, or phosphodiesterase inhibitors increases CTLA4 mRNA expression in EL4 murine T cells and primary CD4+ T cells. Activation of protein kinase A (using the protein kinase Aselective agonist, N6-phenyladenosine-cAMP), but not exchange proteins activated by cAMP (using the exchange proteins activated by cAMPselective 8-pCPT-2Me-cAMP), increases CTLA4 promoter activity. Mutation constructs of the CTLA4 promoter uncover an enhancer binding site located within the ?150 to ?130 bp region relative to the transcription start site. Promoter analysis and chromatin immunoprecipitation assays suggest that cAMP response elementbinding is a putative transcription factor induced by cAMP. We have previously shown that CTLA4 mediates decreased pulmonary inflammation in an LPS-induced murine model of acute lung injury (ALI). We observed that LPS can induce CTLA4 transcription via the same cAMP-inducible promoter region. The immunosuppressant, rapamycin, decreases cAMP and LPS-induced CTLA4 transcription in vitro. In vivo, LPS induces cAMP accumulation in bronchoalveolar lavage fluid, bronchoalveolar lavage cells, and lung tissues in ALI. We demonstrate that rapamycin decreases cAMP accumulation and CTLA4 expression in ALI. Together, these data suggest that cAMP may negatively regulate pulmonary inflammatory responses in vivo and in vitro by altering CTLA4 expression. PMID:23024062

  1. Dose and time effects of estrogen on expression of neuron-specific protein and cyclic AMP response element-binding protein and brain region volume in the medial amygdala of ovariectomized rats.

    PubMed

    Fan, Lu; Hanbury, Rose; Pandey, Subhash C; Cohen, Rochelle S

    2008-01-01

    Although estrogen has been shown to be neuroprotective, studies concerning its effect on some behaviors are contradictory, reporting both ameliorative and detrimental effects. A factor involved in hormone efficacy is the estrogen regimen. We reported an effect of 10 microg estrogen for 14 days on the cyclic AMP response element-binding protein (CREB) pathway, including brain-derived neurotrophic factor, in rat medial amygdala (MeA). To determine the effects of estrogen on neuronal numbers and brain region volume in MeA and central nucleus of the amygdala (CeA), we used stereology to test the effect of various estrogen regimens on the number of neuron-specific protein (NeuN)-labeled neurons and brain region volume of MeA and CeA. Ovariectomized rats were injected with vehicle for 14 days, 2.5 microg estradiol benzoate (E2) for 4 or 14 days, or 10 microg estrogen for 14 days. Because NeuN-labeled neuronal number may be related to neuronal survival and upregulation of CREB signaling, we tested the effect of these regimens on levels of phosphorylated CREB (pCREB) labeling in the MeA and CeA. The 2.5 microg estrogen for 14 days regimen increased the mean number of NeuN-labeled neurons and pCREB-labeled cells in the MeA compared to vehicle or 2.5 microg for 4 days. There was an increase in volume of the MeA with 2.5 microg estrogen for 14 days compared to vehicle or 2.5 microg for 4 days. No differences in these parameters were seen in CeA. These data indicate a neuroanatomical heterogeneity of a time effect of estrogen on cells expressing NeuN and pCREB in the MeA versus CeA. PMID:18446018

  2. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  3. [The effect of some pharmacological agents and electroshock on the level of cyclic AMP of the total mouse brain].

    PubMed

    Joanny, P; Devolx, B C; Garron, J; Giannellini, F

    1976-01-01

    Amphetamin, pentobarbital, pargyline, parachlorophenylalanine, pentetrasol and maximal electroshock all increased significantly cyclic AMP in mice whole brain conversely reserpine induced a decrease of cyclic nucleotide. All those changes were tentatively correlated toward central monoaminergic systems activation. PMID:192423

  4. Activation of 3':5'-cyclic AMP-dependent protein kinase and induction of ornithine decarboxylase as early events in induction of mixed-function oxygenases.

    PubMed Central

    Byus, C V; Costa, M; Sipes, I G; Brodie, B B; Russell, D H

    1976-01-01

    The parenteral administration of a single dose of 3-methylcholanthrene to rats caused an increase in the liver of the concentration of 3', 5'-cAMP and of the activity of cAMP-dependent protein kinase (ATP:protein phosphotransferase, EC 2.7.1.37). These events were followed by an increased activity of ornithine decarboxylase (L-ornithine carboxy-lase, EC 4.1.1.17), the enzyme that controls the biosynthesis of polyamines. Finally, the activity of benzo[a]pyrene hydroxylase, as well as the amount of cytochrome P-448, was increased. Similarly, after the administration of phenobarbital, there was first an increase in the cAMP concentration and in the activity of cAMP-dependent protein kinase, then the induction of ornithine decarboxylase, and finally, an enhanced activity of ethylmorphine N-demethylase and an increased content of cytochrome P-450. These data suggest that the drug-induced processes in liver that increase the activities of the oxidative, and presumably other, drug-metabolizing enzymes include the following sequence of events: (1) increase in cAMP concentration and/or activation of cAMP-dependent protein kinase; (2) induction of ornithine decarboxylase; and, (3) induction of drug-metabolizing enzymes. PMID:177981

  5. Mlc is a transcriptional activator with a key role in integrating cyclic AMP receptor protein and integration host factor regulation of leukotoxin RNA synthesis in Aggregatibacter actinomycetemcomitans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cAMP receptor protein (CRP) indirectly increases ltxA expression...

  6. Glucose Evokes Rapid Ca2+ and Cyclic AMP Signals by Activating the Cell-Surface Glucose-Sensing Receptor in Pancreatic β-Cells

    PubMed Central

    Nakagawa, Yuko; Nagasawa, Masahiro; Medina, Johan; Kojima, Itaru

    2015-01-01

    Glucose is a primary stimulator of insulin secretion in pancreatic β-cells. High concentration of glucose has been thought to exert its action solely through its metabolism. In this regard, we have recently reported that glucose also activates a cell-surface glucose-sensing receptor and facilitates its own metabolism. In the present study, we investigated whether glucose activates the glucose-sensing receptor and elicits receptor-mediated rapid actions. In MIN6 cells and isolated mouse β-cells, glucose induced triphasic changes in cytoplasmic Ca2+ concentration ([Ca2+]c); glucose evoked an immediate elevation of [Ca2+]c, which was followed by a decrease in [Ca2+]c, and after a certain lag period it induced large oscillatory elevations of [Ca2+]c. Initial rapid peak and subsequent reduction of [Ca2+]c were independent of glucose metabolism and reproduced by a nonmetabolizable glucose analogue. These signals were also blocked by an inhibitor of T1R3, a subunit of the glucose-sensing receptor, and by deletion of the T1R3 gene. Besides Ca2+, glucose also induced an immediate and sustained elevation of intracellular cAMP ([cAMP]c). The elevation of [cAMP]c was blocked by transduction of the dominant-negative Gs, and deletion of the T1R3 gene. These results indicate that glucose induces rapid changes in [Ca2+]c and [cAMP]c by activating the cell-surface glucose-sensing receptor. Hence, glucose generates rapid intracellular signals by activating the cell-surface receptor. PMID:26630567

  7. A Fluorescence-Based High-Throughput Assay for the Discovery of Exchange Protein Directly Activated by Cyclic AMP (EPAC) Antagonists

    PubMed Central

    Tsalkova, Tamara; Mei, Fang C.; Cheng, Xiaodong

    2012-01-01

    Background The discovery, more than ten years ago, of exchange proteins directly activated by cAMP (EPAC) as a new family of intracellular cAMP receptors revolutionized the cAMP signaling research field. Extensive studies have revealed that the cAMP signaling network is much more complex and dynamic as many cAMP-related cellular processes, previously thought to be controlled by protein kinase A, are found to be also mediated by EPAC proteins. Although there have been many important discoveries in the roles of EPACs greater understanding of their physiological function in cAMP-mediated signaling is impeded by the absence of EPAC-specific antagonist. Methodology/Principal Findings To overcome this deficit, we have developed a fluorescence-based high throughput assay for screening EPAC specific antagonists. Our assay is highly reproducible and simple to perform using the mix and measure format. A pilot screening using the NCI-DTP diversity set library led to the identification of small chemical compounds capable of specifically inhibiting cAMP-induced EPAC activation while not affecting PKA activity. Conclusions/Significance Our study establishes a robust high throughput screening assay that can be effectively applied for the discovery of EPAC-specific antagonists, which may provide valuable pharmacological tools for elucidating the biological functions of EPAC and for promoting an understanding of disease mechanisms related to EPAC/cAMP signaling. PMID:22276201

  8. Characterization of histamine receptors coupled to /sup 3/H-cyclic AMP accumulation in a vesicular preparation of Guinea pig cortex

    SciTech Connect

    Newton, M.V.

    1985-01-01

    The histamine-stimulated accumulation of /sup 3/H-cyclic AMP (formed by prelabeling with /sup 3/H-adenine) was characterized pharmacologically in a vesicular preparation of guinea pig cortex to identify the receptors mediating this response. Systematic variation of the preincubation time, vessel size, buffer composition, and /sup 3/H-adenine labeling time significantly influenced both the basal and histamine-stimulated /sup 3/H-cyclic AMP levels, and showed that individual prelabeling of aliquots in Kreb's-Ringer bicarbonate (15 mM) buffer yielded the most reproducible histamine responses. Characterization of this histamine response showed that the H/sub 2/-antagonist cimetidine maximally blocked 80% of the response, whereas only 45% of the response could be inhibited by H/sub 1/-antagonists. These findings show that both H/sub 1/- and H/sub 2/-receptors mediate the response, but 25% of the response may require concomitant activation of both receptors. A metactoid model was developed to account for the H/sub 2/-, H/sub 1/-, and adenosine components of the histamine response. The model hypothesizes that 55% of the response is due to direct H/sub 2/-receptor stimulation, 25% is dependent on the metactoid sensitization of the H/sub 2/-response by H/sub 1/-receptors, and 20% is due to an analogous sensitization of adenosine responses by H/sub 1/-receptors. These findings resolve previous controversies regarding the identity of the receptors mediating histamine-stimulated accumulation of cyclic AMP in brain. Furthermore, the vesicular preparation and metactoid model developed presently may be of benefit in other studies of neurotransmitter control of cyclic AMP dynamics.

  9. Adenosine receptor-induced cyclic AMP generation and inhibition of 5-hydroxytryptamine release in human platelets.

    PubMed Central

    Cooper, J A; Hill, S J; Alexander, S P; Rubin, P C; Horn, E H

    1995-01-01

    1. We have assessed the effects of adenosine receptor agonists and antagonists on collagen-induced 5-hydroxytryptamine (5-HT) release and cyclic AMP generation in human platelets. 2. 5'-N-ethylcarboxamidoadenosine (NECA) and CGS 21680 elicited accumulations of cyclic AMP with mean EC50 values of 2678 and 980 nM, respectively. The maximal response to CGS 21680 was approximately half that of the response to 10 microM NECA. 3. NECA and CGS 21680 inhibited collagen-induced 5-hydroxytryptamine release with mean EC50 values of 960 and 210 nM, respectively. The maximal response to CGS 21680 was approximately 25% of the response to 10 microM NECA. 4. The A1/A2a-selective adenosine receptor antagonist PD 115,199 was more potent as an inhibitor of NECA-elicited responses than the A1-selective antagonist DPCPX with calculated Ki values of 22-32 nM and > 10 microM, respectively. 5. In the presence of a cyclic AMP phosphodiesterase inhibitor, the effects of CGS 21680 on cyclic AMP accumulation and 5-HT release were enhanced to levels similar to those elicited by 10 microM NECA. In the absence of phosphodiesterase inhibition, CGS 21680 did not antagonise the effects of NECA. Furthermore, endogenous adenosine did not contribute to the effects of CGS 21680 when phosphodiesterase was inhibited. 6. We conclude that an A2a adenosine receptor appears to be involved in the NECA-elicited increases in cyclic AMP levels and inhibition of 5-HT release in human platelets.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8527267

  10. Comparison between the effects of inhaled isoprenaline and fenoterol on plasma cyclic AMP and heart rate in normal subjects.

    PubMed Central

    Fairfax, A J; Rehahn, M; Jones, D; O'Malley, B

    1984-01-01

    The time course of changes in plasma cyclic AMP, heart rate and bronchial tone after inhalation of fenoterol or isoprenaline from a dose-metered aerosol are reported in a group of normal subjects. After isoprenaline, plasma cyclic AMP increased rapidly reaching a peak by 10 min and returned to basal levels within 60 min. A rapid, transient rise in heart rate occurred that was maximal by 5 min and returned to a basal level by 45 min. After fenoterol, the changes in cyclic AMP and heart rate were of much longer duration. The rise in plasma cyclic AMP was slower in onset and of greater magnitude than for isoprenaline, reaching a peak by 20 min and remaining above basal level for more than 6 h. The maximum increase in heart rate after fenoterol was less than that observed with isoprenaline but an elevated rate persisted for 4 h after inhalation of fenoterol. Fenoterol is known to have a longer duration of action as a bronchodilator in comparison with isoprenaline. The prolonged rise in plasma cyclic AMP in normal subjects given inhaled fenoterol may reflect this long duration of action. The concomitant rise in heart rate, however, suggests that the duration of plasma cyclic AMP response may in part be due to the systemic effect of the fraction of inhaled fenoterol known to be absorbed via the buccal and intestinal routes. PMID:6322828

  11. Muscarinic receptor stimulation and cyclic AMP-dependent effects in guinea-pig ventricular myocardium.

    PubMed Central

    Schmied, R.; Korth, M.

    1990-01-01

    1. The effect of carbachol on force of contraction, contraction duration, intracellular Na+ activity and cyclic AMP content was studied in papillary muscles of the guinea-pig exposed to isoprenaline or the phosphodiesterase inhibitor 3-isobutyl, 1-methyl xanthine (IBMX). The preparations were obtained from reserpine-pretreated animals and were electrically driven at a frequency of 0.2 Hz. 2. Isoprenaline (10 nM) and IBMX (100 microM) produced comparable positive inotropic effects of 9.8 and 9.7 mN, respectively. Carbachol (3 microM) attenuated the inotropic effects by 82% (isoprenaline) and by 79% (IBMX). The shortening of contraction duration which accompanied the positive inotropic effect of isoprenaline (by 14.9%) and of IBMX (by 22.4%) was not significantly affected by 3 microM carbachol. 3. The positive inotropic effect of 10 nM isoprenaline and of 100 microM IBMX was accompanied by an increase in cellular cyclic AMP content of 58 and 114%, respectively. Carbachol (3 microM) failed to reduce significantly the elevated cyclic AMP content of muscles exposed to either isoprenaline or IBMX. 4. In the quiescent papillary muscle, isoprenaline (10 nM) and IBMX (100 microM) reduced the intracellular Na+ activity by 28 and 17%, respectively. This decline was not influenced by the additional application of 3 microM carbachol. 5. The results demonstrate that muscarinic antagonism in guinea-pig ventricular myocardium exposed to cyclic AMP-elevating drugs is restricted to force of contraction. The underlying mechanism does not apparently involve the cytosolic signal molecule cyclic AMP. PMID:1691677

  12. Spatial encoding of cyclic AMP signalling specificity by GPCR endocytosis

    PubMed Central

    Tsvetanova, Nikoleta G.; von Zastrow, Mark

    2014-01-01

    G protein-coupled receptors (GPCRs) are well known to signal via cyclic AMP (cAMP) production at the plasma membrane, but it is now clear that various GPCRs also signal after internalization. Apart from its temporal impact through prolonging the cellular response, does the endosome-initiated signal encode any discrete spatial information? Using the beta2-adrenoceptor (?2-AR) as a model, we show that endocytosis is required for the full repertoire of downstream cAMP-dependent transcriptional control. Next, we describe an orthogonal optogenetic approach to definitively establish that the location of cAMP production is indeed the critical variable determining the transcriptional response. Finally, our results suggest that this spatial encoding scheme helps cells functionally discriminate chemically distinct ?2-AR ligands according to differences in their ability to promote receptor endocytosis. These findings reveal a discrete principle for achieving cellular signalling specificity, based on endosome-mediated spatial encoding of intracellular second messenger production and location aware downstream transcriptional control. PMID:25362359

  13. Cyclic AMP regulation of protein lysine acetylation in Mycobacterium tuberculosis.

    PubMed

    Lee, Ho Jun; Lang, P Therese; Fortune, Sarah M; Sassetti, Christopher M; Alber, Tom

    2012-08-01

    Protein lysine acetylation networks can regulate central processes such as carbon metabolism and gene expression in bacteria. In Escherichia coli, cyclic AMP (cAMP) regulates protein lysine acetyltransferase (PAT) activity at the transcriptional level, but in Mycobacterium tuberculosis, fusion of a cyclic nucleotide-binding domain to a Gcn5-like PAT domain enables direct cAMP control of protein acetylation. Here we describe the allosteric activation mechanism of M. tuberculosis PAT. The crystal structures of the autoinhibited and cAMP-activated PAT reveal that cAMP binds to a cryptic site in the regulatory domain that is over 32 Å from the catalytic site. An extensive conformational rearrangement relieves this autoinhibition by means of a substrate-mimicking lid that covers the protein-substrate binding surface. A steric double latch couples the domains by harnessing a classic, cAMP-mediated conformational switch. The structures suggest general features that enable the evolution of long-range communication between linked domains. PMID:22773105

  14. Influence of cyclic AMP on photosynthetic development in Rhodospirillum rubrum

    SciTech Connect

    Solaiman, D.; Uffen, R.L.

    1984-08-01

    During O-/sup 2/-free growth in the light and in medium with pyruvate, Rhodospirillum rubrum exhibits diauxic growth. The cells first fermented pyruvate and afterwards photometabolized. Exogenous cyclic AMP acted to prolong the lag period between fermentative and photosynthetic development, as well as to slow the light-dependent growth rate. This observation, and in situ changes in the cyclic AMP levels in cells undergoing biphasic growth, suggested that the cyclic nucleotide was involved in photosynthetic differentiation, perhaps by repressing the formation of the bacteriochlorophyll needed to support growth in the light. 17 references, 2 figures.

  15. Circadian cycles in VIP content and VIP stimulation of cyclic AMP accumulation in the rat pineal gland.

    PubMed

    Kaku, K; Tsuchiya, M; Tanizawa, Y; Okuya, S; Inoue, Y; Kaneko, T; Yanaihara, N

    1986-01-01

    VIP content in the rat pineal gland and cyclic AMP accumulation in response to VIP in the daily light and dark cycle were examined. VIP content in the pineal varied significantly during the day and night; the content decreased during exposure to light and was lowest at the onset of darkness, 6 p.m. (mean +/- SE, 23 +/- 5 pg/pineal), and increased during the night and was highest at the onset of light, 6 a.m. (72 +/- 12 pg/pineal). Response of cyclic AMP accumulation to VIP varied with a periodicity inversely related to the daily light and dark cycle of VIP content; cyclic AMP accumulation in response to 10(-7) M VIP increased in proportion to periods of exposure to light and peaked at 6 p.m., and decreased with the onset of darkness. PMID:3018698

  16. Cyclic AMP agonist inhibition increases at low levels of histamine release from human basophils

    SciTech Connect

    Tung, R.S.; Lichtenstein, L.M.

    1981-09-01

    The relationship between the intensity of the signal for antigen-induced immunoglobulin E-mediated histamine release from human basophils and the concentration of agonist needed to inhibit release has been determined. The agonists, prostaglandin E1, dimaprit, fenoterol, isobutylmethylxanthine and dibutyryl cyclic AMP, all act by increasing the cyclic AMP level. Each agonist was 10- to 1000-fold more potent (relative ID50) at low levels of histamine release (5-10% of total histamine) than at high levels (50-80%). Thus, the inhibitory potential of a drug is a function of the concentration of antigen used to initiate the response. Our results are now more in accord with the inhibitory profile of these drugs in human lung tissue. It is suggested that in vivo release is likely to be low and that this is the level at which to evaluate drugs in vitro.

  17. Cyclic AMP is both a pro-apoptotic and anti-apoptotic second messenger

    PubMed Central

    Insel, Paul A.; Zhang, Lingzhi; Murray, Fiona; Yokouchi, Hiroshi; Zambon, Alexander C.

    2011-01-01

    The second messenger cyclic AMP (cAMP) can either stimulate or inhibit programmed cell death (apoptosis). Here, we review examples of cell types that show pro-apoptotic or anti-apoptotic responses to increases in cAMP. We also show that cells can have both such responses, although predominantly having one or the other. Protein kinase A (PKA)-promoted changes in phosphoylation and gene expression can mediate pro-apoptotic responses, such as in murine S49 lymphoma cells, based on evidence that mutants lacking PKA fail to undergo cAMP-promoted, mitochondria-dependent apoptosis. Mechanisms for the anti-apoptotic response to cAMP likely involve Epac (Exchange protein activated by cAMP), a cAMP-regulated effector that is a guanine nucleotide exchange factor (GEF) for the low molecular weight G-protein, Rap1. Therapeutic approaches that activate PKA-mediated pro-apoptosis or that block Epac-mediated anti-apoptotisis may provide a means to enhance cell killing, such as in certain cancers. By contrast, efforts to block PKA or stimulate Epac have the potential to be useful in diseases settings (such as heart failure) associated with cAMP-promoted apoptosis. PMID:21385327

  18. Endothelins-induce cyclicAMP formation in the guinea-pig trachea through an ETA receptor- and cyclooxygenase-dependent mechanism.

    PubMed Central

    el-Mowafy, A. M.; Abou-Mohamed, G. A.

    1996-01-01

    1. The non-selective endothelin agonist, endothelin-1 (ET-1), and the selective ETB receptor agonist, sarafotoxin-S6c (SRTX-c), contracted guinea-pig isolated trachea in a concentration-dependent manner. The EC50 value for ET-1 (11 +/- 2.1 nM) was significantly higher than that of SRTX-c (3.2 +/- 0.21 nM) and the maximal developed tension due to SRTX-c was 42.8 +/- 2.3% higher than that produced by ET-1 (P < 0.05). 2. Pretreatment with the ETA antagonist, BQ-610, appreciably enhanced the developed tension due to ET-1 but not SRTX-c. Likewise, the cyclo-oxygenase inhibitor, indomethacin, markedly potentiated the contractile responses to ET-1, but not to SRTX-c. Combining BQ-610 with indomethacin was not more effective than either of them in augmenting ET-1-evoked tension. 3. ET-1 significantly increased cyclic AMP formation in the trachea in concentration- and time-dependent manners. A t1/2 value of 4.3 min, an EC50 value of 20 +/- 3 nM and a maximal cyclic AMP increment of 124% above the basal level, were obtained for ET-1. Similarly but less effectively, ET-3 (0.1 microM) increased cyclic AMP level (35 +/- 3.7% compared to 94 +/- 7.8% for the same concentration of ET-1). By contrast, SRTX-c did not alter the cyclicAMP level when applied in concentrations up to 1 microM. 4. Pre-incubation of the trachea with BQ-610 (1 microM) or indomethacin (1 microM) prevented cyclicAMP formation by either ET-1 or ET-3. 5. The results of the present study indicate a negative regulatory role mediated by the ETA receptor on the ETB-triggered mechanical response. This effect is likely to be mediated by activation of adenylate cyclase through a cyclo-oxygenase-dependent mechanism. PMID:8762074

  19. Dibutyryl-cyclic AMP inhibits cholesterol esterification in J 774 monocyte-like cells.

    PubMed

    Houtia, N E; Mazire, J C; Mazire, C; Auclair, M; Mora, L; Gardette, J; Polonovski, J

    1987-01-15

    The effect of dibutyryl-cyclic AMP (dbcAMP) and theophylline was investigated on oleic acid incorporation into cholesteryl esters and triacylglycerols in the mouse monocyte-macrophage cell line J 774. 24h pretreatment of macrophages with dbcAMP decreased cholesteryl ester formation in a dose-dependent manner (about 4 fold reduction for dbcAMP 10(-4)M + theophylline 10(-3)M), while oleic acid incorporation into triacylglycerols was markedly (2 to 3 fold) enhanced. The catabolism of acetylated LDL was only slightly affected (about 15-20% reduction with dbcAMP 5 X 10(-4)M + theophylline 10(-3)M). Acyl Coenzyme A: cholesterol-O-acyl-transferase activity, measured in vitro on cell homogenates, was reduced in dbcAMP-treated cells, whereas diacylglycerol acyltransferase activity was increased. These results suggest that cyclic AMP can modulate cholesteryl ester and triacylglycerol formation in macrophages, and that these metabolisms are inversely regulated. Agents which increase cyclic AMP intracellular level could be of interest for reducing cholesteryl ester accumulation in macrophages. PMID:3028397

  20. Prostaglandin A1 metabolism and inhibition of cyclic AMP extrusion by avian erythrocytes

    SciTech Connect

    Heasley, L.E.; Brunton, L.L.

    1985-09-25

    Prostaglandins (PG) inhibit active cyclic AMP export from pigeon red cells, PGA1 and PGA2 most potently. To probe the mechanism of this action of PGA1, the authors have studied the interaction of (TH)PGA1 with suspensions of pigeon red cells. The interaction of PGA1 with pigeon red cells is a multistep process of uptake, metabolism, and secretion. (TH) PGA1 rapidly enters red cells and is promptly metabolized to a compound(s) that remains in the aqueous layer after ethylacetate extraction. The glutathione-depleting agent, diamide, inhibits formation of the PGA1 metabolite. The red cells secrete the polar metabolite of PGA1 by a saturable mechanism that lowered temperatures inhibit. Because uptake and metabolism progress with much greater rates than metabolite secretion, red cells transiently concentrate the polar compound intracellularly. Onset and reversal of inhibition of cyclic AMP export by PGA1 coincide with accumulation and secretion of PGA1 metabolite, suggesting that the polar metabolite acts at an intracellular site to inhibit cyclic AMP efflux.

  1. Modulation of agonist-induced phosphoinositide metabolism, Ca2+ signalling and contraction of airway smooth muscle by cyclic AMP-dependent mechanisms.

    PubMed Central

    Hoiting, B. H.; Meurs, H.; Schuiling, M.; Kuipers, R.; Elzinga, C. R.; Zaagsma, J.

    1996-01-01

    1. The effects of increased cellular cyclic AMP levels induced by isoprenaline, forskolin and 8-bromoadenosine 3':5'-cyclic monophosphate (8-Br-cyclic AMP) on phosphoinositide metabolism and changes in intracellular Ca2+ elicited by methacholine and histamine were examined in bovine isolated tracheal smooth muscle (BTSM) cells. 2. Isoprenaline (pD2 (-log10 EC50) = 6.32 +/- 0.24) and forskolin (pD2 = 5.6 +/- 0.05) enhanced cyclic AMP levels in a concentration-dependent fashion in these cells, while methacholine (pD2 = 5.64 +/- 0.12) and histamine (pD2 = 4.90 +/- 0.04) caused a concentration-related increase in [3H]-inositol phosphates (IP) accumulation in the presence of 10 mM LiCl. 3. Preincubation of the cells (5 min, 37 degrees C) with isoprenaline (1 microM), forskolin (10 microM) and 8-Br-cyclic AMP (1 mM) did not affect the IP accumulation induced by methacholine, but significantly reduced the maximal IP production by histamine (1 mM). However, the effect of isoprenaline was small (15.0 +/- 0.6% inhibition) and insignificant at histamine concentrations between 0.1 and 100 microM. 4. Both methacholine and histamine induced a fast (max. in 0.5-2 s) and transient increase of intracellular Ca2+ concentration ([Ca2+]i) followed by a sustained phase lasting several minutes. EGTA (5 mM) attenuated the sustained phase, indicating that this phase depends on extracellular Ca2+. 5. Preincubation of the cells (5 min, 37 degrees C) with isoprenaline (1 microM), forskolin (10 microM) and 8-Br-cyclic AMP (1 microM) significantly attenuated both the Ca(2+)-transient and the sustained phase generated at equipotent IP producing concentrations of 1 microM methacholine and 100 microM histamine (approx. 40% of maximal methacholine-induced IP response), but did not affect changes in [Ca2+]i induced by 100 microM methacholine (95.2 +/- 3.5% of maximal methacholine-induced IP response). 6. Significant correlations were found between the isoprenaline-induced inhibition of BTSM contraction and inhibition of Ca2+ mobilization or influx induced by methacholine and histamine, that were similar for each contractile agonist. 7. These data indicate that (a) cyclic AMP-dependent inhibition of Ca2+ mobilization in BTSM cells is not primarily caused by attenuation of IP production, suggesting that cyclic AMP induced protein kinase A (PKA) activation is effective at a different level in the [Ca2+]i homeostasis, (b) that attenuation of intracellular Ca2+ concentration plays a major role in beta-adrenoceptor-mediated relaxation of methacholine- and histamine-induced airway smooth muscle contraction, and (c) that the relative resistance of the muscarinic agonist-induced contraction to beta-adrenoceptor agonists, especially at (supra) maximal contractile concentrations is largely determined by its higher potency in inducing intracellular Ca2+ changes. PMID:8821529

  2. Coxiella burnetii alters cyclic AMP-dependent protein kinase signaling during growth in macrophages.

    PubMed

    MacDonald, Laura J; Kurten, Richard C; Voth, Daniel E

    2012-06-01

    Coxiella burnetii is the bacterial agent of human Q fever, an acute, flu-like illness that can present as chronic endocarditis in immunocompromised individuals. Following aerosol-mediated transmission, C. burnetii replicates in alveolar macrophages in a unique phagolysosome-like parasitophorous vacuole (PV) required for survival. The mechanisms of C. burnetii intracellular survival are poorly defined and a recent Q fever outbreak in the Netherlands emphasizes the need for better understanding this unique host-pathogen interaction. We recently demonstrated that inhibition of host cyclic AMP-dependent protein kinase (PKA) activity negatively impacts PV formation. In the current study, we confirmed PKA involvement in PV biogenesis and probed the role of PKA signaling during C. burnetii infection of macrophages. Using PKA-specific inhibitors, we found the kinase was needed for biogenesis of prototypical PV and C. burnetii replication. PKA and downstream targets were differentially phosphorylated throughout infection, suggesting prolonged regulation of the pathway. Importantly, the pathogen actively triggered PKA activation, which was also required for PV formation by virulent C. burnetii isolates during infection of primary human alveolar macrophages. A subset of PKA-specific substrates were differentially phosphorylated during C. burnetii infection, suggesting the pathogen uses PKA signaling to control distinct host cell responses. Collectively, the current results suggest a versatile role for PKA in C. burnetii infection and indicate virulent organisms usurp host kinase cascades for efficient intracellular growth. PMID:22473604

  3. Identification of basal and cyclic AMP regulatory elements in the promoter of the phosphoenolpyruvate carboxykinase gene

    SciTech Connect

    Quinn, P.G.; Wong, T.W.; Magnuson, M.A.; Shabb, J.B.; Granner, D.K.

    1988-08-01

    Promoter elements important for basal and cyclic AMP (cAMP)-regulated expression of the phosphoenolpyruvate carboxykinase (PEPCK) gene have been identified by analysis of a series of PEPCK promoter mutations in transfection experiments. Fusion genes containing wild-type and mutated PEPCK promoter sequences from -600 to +69 base pairs (bp) fused to the coding sequence for chloramphenicol acetyltransferase were studied. Internal deletion mutations that replaced specific bases with a 10-bp linker within the region from - 129 bp to - 18 bp of the PEPCK promoter were examined. In addition, wild-type and mutated DNA templates were used as probes in DNase I protection experiments to determine sites of protein-DNA interaction. The PEPCK promoter contains a binding site for nuclear factor 1-CAAT. Deletion of the 5' end of this binding site reduced the size of the DNase I footprint in this region but had no effect on promoter activity. In contrast, deletion or disruption of the 3' end of this binding site completely eliminated protein binding and reduced promoter activity by 50%. Deletion of core sequences of the cAMP regulatory element (CRE) resulted in loss of cAMP responsiveness and an 85% decrease in basal promoter activity, indicating that the CRE also functions as a basal stimulatory element.

  4. Posttranscriptional Regulation of the Yersinia pestis Cyclic AMP Receptor Protein Crp and Impact on Virulence

    PubMed Central

    Lathem, Wyndham W.; Schroeder, Jay A.; Bellows, Lauren E.; Ritzert, Jeremy T.; Koo, Jovanka T.; Price, Paul A.; Caulfield, Adam J.; Goldman, William E.

    2014-01-01

    ABSTRACT The cyclic AMP receptor protein (Crp) is a transcriptional regulator that controls the expression of numerous bacterial genes, usually in response to environmental conditions and particularly by sensing the availability of carbon. In the plague pathogen Yersinia pestis, Crp regulates the expression of multiple virulence factors, including components of the type III secretion system and the plasminogen activator protease Pla. The regulation of Crp itself, however, is distinctly different from that found in the well-studied Escherichia coli system. Here, we show that at physiological temperatures, the synthesis of Crp in Y. pestis is positively regulated at the posttranscriptional level. The loss of the small RNA chaperone Hfq results in decreased Crp protein levels but not in steady-state Crp transcript levels, and this regulatory effect occurs within the 5′ untranslated region (UTR) of the Crp mRNA. The posttranscriptional activation of Crp synthesis is required for the expression of pla, and decoupling crp from Hfq through the use of an exogenously controlled promoter and 5′ UTR increases Pla protein levels as well as partially rescues the growth defect associated with the loss of Hfq. Finally, we show that both Hfq and the posttranscriptional regulation of Crp contribute to the virulence of Y. pestis during pneumonic plague. The Hfq-dependent, posttranscriptional regulation of Crp may be specific to Yersinia species, and thus our data help explain the dramatic growth and virulence defects associated with the loss of Hfq in Y. pestis. PMID:24520064

  5. Substrate specificity of the cyclic AMP-dependent protein kinase.

    PubMed

    Kemp, B E; Bylund, D B; Huang, T S; Krebs, E G

    1975-09-01

    The protein substrate specificity of the catalytic subunit of rabbit skeletal muscle cyclic AMP-dependent protein kinase (EC 2.7.1.37; ATP:protein phosphotransferase) has been studied using genetic variants of beta casein. It was found that beta casein-B was phosphorylated at a much greater rate than beta caseins A1, A2, A3, or C. The enhanced phosphorylation of beta casein-B, as compared with the most common variant A2, was attributed to an arginine substitution for a serine at position 122, which caused a nearby residue, serine 124, to become a phosphorylation site for the protein kinase. These results further support the concept that the local primary structure is important in specificity and that arginine may be a specific determinant common to all the local phosphorylation site sequences recognized by the cyclic AMP-dependent protein kinase. PMID:1059131

  6. Isolation and characterization of the rolipram-sensitive cyclic AMP-specific phosphodiesterase (type IV PDE) in human term myometrium.

    PubMed

    Leroy, M J; Lugnier, C; Merezak, J; Tanguy, G; Olivier, S; Le Bec, A; Ferré, F

    1994-05-01

    On the basis of the potencies of classical selective modulators of cyclic nucleotide phosphodiesterase (PDE) activities, five cyclic nucleotide PDE isoforms have been isolated and characterized in the cytosolic fraction of human term myometrium. By means of successive ion-exchange chromatographies, a calcium-calmodulin sensitive isoform, a cyclic GMP-stimulated isoform, a cyclic GMP-inhibited isoform, a rolipram-sensitive cyclic AMP-specific isoform and a cyclic GMP-specific isoform, corresponding to PDE I, PDE II, PDE III, PDE IV and PDE V, respectively, have been identified. We found that near term, human myometrium contains a higher proportion of the rolipram-sensitive type IV PDE isoform (about 50% of total cyclic AMP hydrolytic activity) than the type III cyclic GMP-inhibited PDE isoform (only 10%). Type IV PDE displays simple Michaelis-Menten kinetics with a high affinity for cyclic AMP (Km approximately 4.4 microM) and is selectively and competitively inhibited by rolipram (K(i) approximately 0.9 microM) and Ro 20-1724 (K(i) approximately 2.6 microM). The predominance of type IV PDE at the end of pregnancy suggests that this isoform contributes, via a modulation of the intracellular cyclic AMP level, to local control of uterine motility and thus could help the myometrium prepare for pronounced contractile activity at the time of parturition. PMID:7946965

  7. Endogenous cyclic AMP-stimulated phosphorylation of a Wolfgram protein component in rabbit central-nervous-system myelin.

    PubMed Central

    Bradbury, J M; Campbell, R S; Thompson, R J

    1984-01-01

    Cyclic AMP-stimulated phosphorylation of membrane proteins in central-nervous-system myelin was investigated, with rabbit brain myelin. Subfractionation of a myelin membrane preparation by sucrose-density-gradient centrifugation produced a rapidly sedimenting population of membrane vesicles containing 5'-nucleotidase and acetylcholinesterase, a light membrane fraction containing myelin basic protein and 2',3'-cyclic nucleotide 3'-phosphodiesterase, and an intermediate membrane fraction containing the highest specific activity of 2',3'-cyclic nucleotide 3'-phosphodiesterase and a small proportion of myelin basic protein. Cyclic AMP stimulation of protein phosphorylation was confined to a protein of Mr 49 700, which co-electrophoresed with the upper component of the Wolfgram protein doublet. Cyclic AMP did not affect the phosphorylation of myelin basic protein. Cyclic AMP-stimulated phosphorylation of this protein followed 2',3'-cyclic nucleotide 3'-phosphodiesterase activity on subcellular fractionation and was correspondingly high in the intermediate or 'myelin-like' fraction on sucrose-density-gradient centrifugation. Images Fig. 1. Fig. 3. Fig. 4. PMID:6089736

  8. Effect of indomethacin on the cyclic AMP-dependent protein kinase.

    PubMed

    Cataln, R E; Aragones, M D; Martinez, A M; Armijo, M; Pia, M

    1980-05-01

    Indomethacin inhibited cyclic AMP-dependent protein kinase activity in small intestine in in vivo experiments. An inverse pattern of variation was exhibited by acetyl salicylic acid, eterylate and benorylate, acetyl-p-amino-phenol being inactive. Indomethacin, acetyl salicylic acid, eterylate and benorylate increased the protein kinase activity in liver, lung and heart after in vivo administration. The in vivo effect of indomethacin was confirmed by in vitro experiments with small intestine and heart protein kinases. These results support the concept that indomethacin can affect protein kinase activity in a tissue-specific way. PMID:6247165

  9. Electrical Stimulation Decreases Coupling Efficiency Between Beta-Adrenergic Receptors and Cyclic AMP Production in Cultured Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    1999-01-01

    Electrical stimulation of skeletal muscle cells in culture is an effective way to simulate the effects of muscle contraction and its effects on gene expression in muscle cells. Expression of the beta-adrenergic receptor and its coupling to cyclic AMP synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this project was to determine if electrical stimulation altered the beta-adrenergic response in muscle cells. Chicken skeletal muscle cells that had been grown for seven days in culture were subjected to electrical stimulation for an additional two days at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. At the end of this two-day stimulation period, beta-adrenergic receptor population was measured by the binding of tritium-labeled CGP-12177 to muscle cells, and coupling to cAMP synthesis was measured by Radioimmunoassay (RIA) after treating the cells for 10 min with the potent (beta)AR agonist, isoproterenol. The number of beta adrenergic receptors and the basal levels of intracellular cyclic AMP were not affected by electrical stimulation. However, the ability of these cells to synthesize cyclic AMP was reduced by approximately 50%. Thus, an enhanced level of contraction reduces the coupling efficiency of beta-adrenergic receptors for cyclic AMP production.

  10. The effects of histamine and prostaglandin D2 on rat mast-cell cyclic AMP and mediator release

    SciTech Connect

    Wescott, S.; Kaliner, M.

    1981-11-01

    The possibility that histamine may play a functional role in modulating mast-cell secretion, as has been suggested for basophil degranulation, has both physiologic and pharmacologic implications. Therefore the capacity of histamine to influence rat peritoneal mast-cell (RPMC) cyclic AMP levels and reversed anaphylatic degranulation as reflected in the release of 3H-serotonin (5-HT) was examined. To ascertain that RPMC were functionally responsive to exogenous hormonal stimulation, assessment of prostaglandin (PG) D2 effects on cyclic AMP and 5-HT release were determined in parallel. Although PGD2 (100 microM) increased cyclic AMP and inhibited 5-HT release in the presence of 50 microM aminophylline, histamine (up to 1000 microM) was ineffective was ineffective in both. However, 1000 microM histamine in the presence of 500 microM aminophylline was capable of transiently increasing RPMC cyclic AMP (for 15 to 30 sec) and under these conditions of suppressing 5-HT release. The receptor subtype involved in the suppressive actions of histamine appeared to be of the H-1 type as reflected in the capacity of specific H-1 agonists to reproduce the inhibition of 5-HT release, whereas neither H-2 agonists nor H-2 antagonists had any influence. Thus, under conditions in which phosphodiesterase enzymatic action is impaired, histamine in extremely high concentrations is able to modulate mast-cell secretion. However, it seems very unlikely that this action of histamine has any physiologic significance.

  11. Cyclic AMP elevating agents and nitric oxide modulate angiotensin II-induced leukocyte-endothelial cell interactions in vivo

    PubMed Central

    Alvarez, Angeles; Piqueras, Laura; Blazquez, Maria-Amparo; Sanz, Maria-Jesus

    2001-01-01

    Angiotensin (Ang-II) is a key molecule in the development of cardiac ischaemic disorders and displays proinflammatory activity in vivo. Since intracellular cyclic nucleotides elevating agents have proved to be effective modulators of leukocyte recruitment, we have evaluated their effect on Ang-II-induced leukocyte-endothelial cell interactions in vivo using intravital microscopy within the rat mesenteric microcirculation.Pretreatment with iloprost significantly inhibited (1?nM) Ang-II-induced increase in leukocyte rolling flux, adhesion and emigration at 60?min by 96, 92 and 90% respectively, and returned leukocyte rolling velocity to basal levels. Pretreatment with salbutamol or co-superfusion with forskolin exerted similar effects.When theophylline was administered, leukocyte rolling flux, adhesion and emigration elicited by Ang-II were significantly attenuated by 81, 89 and 71% respectively. Rolipram administration caused similar reduction of Ang-II-induced leukocyte responses.Co-superfusion of Ang-II with the NO-donor, spermine-NO, or 8-Br-cyclic GMP, or pretreatment with a transdermal nytroglycerin patch, resulted in a significant reduction of the leukocyte-endothelial cell interactions elicited by Ang-II.Salbutamol preadministration did not modify leukocyte-endothelial cell interactions elicited by either L-NAME or L-NAME+Ang-II, indicating that the inhibitory leukocyte effects caused by cyclic AMP-elevating agents are mediated through NO release.In conclusion, we have provided evidence that cyclic AMP elevating agents and NO donors, are potent inhibitors of Ang-II-induced leukocyte-endothelial cell interactions. Thus, they could constitute a powerful therapeutical tool in the control of the leukocyte recruitment characteristic of the vascular lesions that occur in cardiovascular disease states where Ang-II plays a critical role. PMID:11399665

  12. Mechanical control of cyclic AMP signalling and gene transcription through integrins

    NASA Technical Reports Server (NTRS)

    Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

    2000-01-01

    This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

  13. Study of enzymes regulating vasopressin-stimulated cyclic AMP metabolism in separated mitochondria-rich and granular epithelial cells of toad urinary bladder.

    PubMed

    Handler, J S; Preston, A S

    1976-02-17

    The epithelial cells of the toad urinary bladder are morphologically heterogenous. In order to relate the effect of vasopressin on cyclic AMP metabolism to cell type, the epithelial cells were separated by the density gradient technique of Scott, Sapirstein and Yoder (Science 184:797, 1974). The separation was verified by electron-microscopy and by observing that the band of cells enriched in mitochondria-rich cells was enriched in carbonic anhydrase activity compared to the band of granular cells. A large portion of cells collected from the gradient was considered to be nonviable, precluding further study of their function as intact cells. Vasopressin-stimulated adenylate cyclase activity in homogenates of granular cells was simular to that in homogenates of mitochondria-rich cells. Cyclic nucleotide phosphodiesterase activity was also similar in the two types of cell. Thus, the enzymes known to be involved in cyclic AMP metabolism in response to vasopressin appear to be located in both major cell types. PMID:176364

  14. VIP-induced relaxation of guinea-pig intestinal smooth muscle cells: sequential involvement of cyclic AMP and nitric oxide.

    PubMed Central

    Rekik, M.; Delvaux, M.; Tack, I.; Frexinos, J.; Bueno, L.

    1996-01-01

    1. A possible interaction between cyclic AMP and nitric oxide (NO) in mediating the relaxant effect of vasoactive intestinal polypeptide (VIP) on intestinal smooth muscle cells has been investigated. The effects of the inhibitor of NO synthesis, NG-nitro-L-arginine methyl ester (L-NAME), have been studied on VIP-, forskolin-, and 8 bromo-cyclic AMP- induced relaxation of cells, dispersed by enzymatic digestion of muscle strips from the circular layer of guinea-pig ileum. 2. VIP alone did not modify the length of isolated muscle cells. By contrast, when the cells were contracted by cholecystokinin octapeptide, CCK8 (10 nM), VIP inhibited this contraction, inducing a concentration-dependent relaxation of the cells. Maximal relaxation was induced by 1 microM VIP (EC50 = 408.2 +/- 16.7 pM). 3. N-ethylmaleimide, inhibitors of adenylate cyclase or somatostatin, abolished the relaxing effect of VIP. (R)-p-cAMPs, an antagonist of cyclic AMP on protein kinase A also inhibited the VIP-induced relaxation by 92.1 +/- 6.3%. Inhibitors of nitric oxide synthase (NOS), L-NAME and L-NMMA, partially inhibited VIP-induced relaxation. The effect of L-NAME was reversed by L-arginine but not by D-arginine. 4. (R)-p-cAMPS and L-NAME also inhibited the cell relaxation induced either by forskolin which directly stimulates adenylate cyclase activity or 8-bromo-cyclic AMP, an analogue of cyclic AMP. 5. When cells were incubated for 30 min with dexamethasone 10 microM, a glucocorticoid known to decrease the synthesis of iNOS, the relaxing effect of a maximal concentration of VIP was decreased by 52 +/- 4% and L-NMMA had no further effect on this residual VIP-induced relaxation. Milrinone, a phosphodiesterase type III inhibitor, potentiated the relaxant effect of VIP. 6. These data demonstrate that the intracellular pathway mediating the relaxant effect of VIP in intestinal smooth muscle cells includes the sequential activation of adenylate cyclase, protein kinase A, activation of NOS and finally production of NO and cyclic GMP. NO could in turn regulate the cyclic AMP-dependent pathway of cell relaxation. PMID:8762068

  15. Identification of a novel cyclic AMP-response element (CRE-II) and the role of CREB-1 in the cAMP-induced expression of the survival motor neuron (SMN) gene.

    PubMed

    Majumder, Sarmila; Varadharaj, Saradhadevi; Ghoshal, Kalpana; Monani, Umrao; Burghes, Arthur H M; Jacob, Samson T

    2004-04-01

    Spinal muscular atrophy, an autosomal recessive disorder, is caused by loss of the SMN1 (survival motor neuron) gene while retaining the SMN2 gene. SMN1 produces a majority of full-length SMN transcript, whereas SMN2 generates mostly an isoform lacking exon 7. Here, we demonstrate a novel cAMP-response element, CRE-II, in the SMN promoter that interacts with the cAMP-response element-binding (CREB) family of proteins. In vitro DNase I protection analysis and in vivo genomic footprinting of the SMN promoter using the brain and liver nuclei from SMN2 transgenic mice revealed footprinting at the CRE-II site. Site-directed mutation of the CRE-II element caused a marked reduction in the SMN promoter activity revealed by transient transfection assay. Activation of the cAMP pathway by dibutyryl cAMP (0.5 mm) alone or in combination with forskolin (20 microm) caused a 2-5-fold increase in the SMN promoter activity but had no effect on the CRE-II mutated promoter. Electrophoretic mobility shift assay and a UV-induced DNA-protein cross-linking experiment confirmed that CREB1 binds specifically to the CRE-II site. Transient overexpression of CREB1 protein resulted in a 4-fold increase of the SMN promoter activity. Intraperitoneal injection of epinephrine in mice expressing two copies of the human SMN2 gene resulted in a 2-fold increase in full-length SMN transcript in the liver. Combined treatment with dibutyryl cAMP and forskolin significantly increased the level of both the full-length and exon 7-deleted SMN (exonDelta7SMN) transcript in primary hepatocytes from mice expressing two copies of human SMN2 gene. Similar treatments of type I spinal muscular atrophy mouse and human fibroblasts as well as HeLa cells resulted in an augmented level of SMN transcript. These findings suggest that the CRE-II site in SMN promoter positively regulates the expression of the SMN gene, and treatment with cAMP-elevating agents increases expression of both the full-length and exonDelta7SMN transcript. PMID:14742439

  16. In GH3 pituitary cells, acetylcholine and vasoactive intestinal peptide antagonistically modulate adenylate cyclase, cyclic AMP content, and prolactin secretion.

    PubMed

    Onali, P; Eva, C; Olianas, M C; Schwartz, J P; Costa, E

    1983-09-01

    In GH3 pituitary cell homogenates, acetylcholine (ACh) (IC50 200 nM) inhibits adenylate cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] activity in a concentration- and GTP-dependent manner. Maximal inhibition was obtained with 10 microM ACh and corresponded to approximately a 50% decrease in basal enzyme activity. ACh inhibition is antagonized by atropine and is mimicked by muscarinic receptor agonists, but not by nicotine. ACh reduces the adenylate cyclase stimulation by vasoactive intestinal peptide (VIP), without changing its EC50. In intact GH3 cells, ACh decreases the cyclic AMP content and the rate of prolactin release in a concentration-dependent manner. When the cells are simultaneously exposed to VIP and ACh, the VIP-induced increases in cyclic AMP accumulation and prolactin release are reduced by 80% and 40%, respectively. The potency of VIP is not significantly changed by the presence of ACh, and vice versa. PMID:6310360

  17. Tissue-specific enhancer of the human glycoprotein hormone. cap alpha. -subunit gene: Dependence on cyclic AMP-inducible elements

    SciTech Connect

    Delegeane, A.M.; Ferland, L.H.; Mellon, P.L.

    1987-11-01

    The authors identified and characterized elements which confer tissue specificity and cyclic AMP (cAMP) responsiveness to the human glycoprotein ..cap alpha..-subunit gene. An enhancer containing an 18-base-pair repeat conferred cAMP responsiveness in a non-tissue-specific fashion. DNase I protection assays revealed DNA-binding factors that bound to this element in both placental and nonplacental cells. It also enhanced the ..cap alpha..-subunit promoter in a tissue-specific manner but had a negligible effect on a heterologous promoter. A unique element found upstream of this enhancer had no independent activity but, in combination with the cAMP - responsive enhancer, distinctly increased the tissue-specific activity of both the ..cap alpha..-subunit promoter and a heterologous promoter. A factor that bound to this upstream element was found in placental but not nonplacental cells. The authors conclude that this novel element acts, perhaps through a specific trans-acting factor, in concert with a cAMP-responsive enhancer to confer tissue specificity to the ..cap alpha..-subunit gene.

  18. Mechanism for acute control of fatty acid synthesis by glucagon and 3':5'-cyclic AMP in the liver cell.

    PubMed Central

    Watkins, P A; Tarlow, D M; Lane, M D

    1977-01-01

    Labeling experiments with chicken liver cell monolayers and suspensions show that glucagon and N6, O2-dibutyryladenosine 3':5'-cyclic monophosphate (dibutyryl cyclic AMP) block fatty acid synthesis from acetate without appreciably affecting cholesterogenesis from acetate or acylglyceride synthesis from palmitate. Neither acetyl-CoA carboxylase [acetyl-CoA:carbon-dioxide ligase (ADP-forming), EC 6.4.1.2] activity assayed in the presence of citrate nor fatty acid synthetase activity is decreased in extracts of cells treated with glucagon. However, the cytoplasmic concentration of citrate, a required allosteric activator of acetyl-CoA carboxylase, is depressed more than 90% by glucagon or dibutyrl cyclic AMP. Pyruvate or lactate largely prevents the inhibitory action of these effectors on fatty acid synthesis by causing a large increase in cytoplasmic citrate level. Thus, it appears that glucagon, acting via cyclic AMP, inhibits fatty acid synthesis by blocking the formation of citrate, an essential activator of acetyl-CoA carboxylase. Images PMID:193102

  19. Effects of cyclic GMP elevation on isoprenaline-induced increase in cyclic AMP and relaxation in rat aortic smooth muscle: role of phosphodiesterase 3.

    PubMed Central

    Delpy, E.; Coste, H.; Gouville, A. C.

    1996-01-01

    1. In rat aortic rings precontracted with phenylephrine, the beta-adrenoceptor agonist isoprenaline (10 nM to 30 microM) produces greater relaxant effects in preparations with endothelium than in endothelium-denuded preparations. The aim of this study was to determine the mechanisms involved in this effect and in particular investigate the possibility of a synergistic action between adenosine 3':5'-cyclic monophosphate (cyclic AMP) and guanosine 3':5'-cyclic monophosphate (cyclic GMP). 2. Isoprenaline-induced relaxation of rat aortic rings precontracted with phenylephrine was greatly reduced by the nitric oxide (NO) synthase inhibitor N omega-nitro-L-arginine methyl ester (L-NAME, 300 microM) or the soluble guanylate cyclase inhibitors methylene blue (10 microM) or IH-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ, 10 microM) but unaffected by indomethacin (10 microM), a cyclo-oxygenase inhibitor. Similarly, in intact rings, the concentration-response curve of forskolin (10 nM to 1 microM) was shifted to the right upon endothelium removal or treatment with methylene blue. 3. In endothelium-denuded rat aortic rings, isoprenaline-induced relaxation was potentiated by the guanylate cyclase activators atrial natriuretic factor (ANF, 1 to 10 nM) and sodium nitroprusside (SNP, 1 to 10 nM), and to a greater extent in the presence of the cyclic GMP-specific phosphodiesterase (PDE 5) inhibitor, 1,3dimethyl-6-(2-propoxy-5-methane sulphonylamidophenyl) pyrazolo [3,4-d] pyrimidin-4-(5H)-one (DMPPO, 30 nM). Relaxation induced by isoprenaline was also potentiated by the cyclic GMP-inhibited PDE (PDE 3) inhibitor cilostamide (100 nM). 4. Intracellular cyclic nucleotide levels were measured either in rat cultured aortic smooth muscle cells or in de-endothelialized aortic rings. In both types of preparation, isoprenaline (5 nM and 10 microM) increased cyclic AMP levels and this effect was potentiated by cilostamide (10 microM), by rolipram, a cyclic AMP-specific PDE (PDE 4) inhibitor (10 microM) and by cyclic GMP-elevating agents (50 nM ANF or 30 nM SNP plus 100 nM DMPPO). In isoprenaline-stimulated conditions, the increase in cyclic AMP induced by rolipram was further potentiated by cilostamide and by cyclic GMP-elevating agents. Cilostamide and cyclic GMP-elevating agents did not potentiate each other, suggesting a similar mechanism of action. 5. We conclude that in vascular smooth muscle (VSM) cells an increase in cyclic GMP levels may inhibit PDE 3 and, thereby, cyclic AMP catabolism. Under physiological conditions of constitutive NO release, and to a greater extent in the presence of the PDE 5 inhibitor DMPPO, cyclic GMP should act synergistically with adenylate cyclase activators to relax VSM. Images Figure 8 PMID:8894166

  20. Effects of cyclic AMP- and cyclic GMP- phosphodiesterase inhibitors on immunological release of histamine and on lung contraction.

    PubMed Central

    Frossard, N.; Landry, Y.; Pauli, G.; Ruckstuhl, M.

    1981-01-01

    1 Cyclic adenosine 3',5'-monophosphate (cyclic AMP)- and cyclic guanosine 3',5'-monophosphate (cyclic GMP)-phosphodiesterase activities from rat lung were selectively inhibited by ZK 62711 and M & B 22948, respectively. Theophylline and papaverine inhibited both activities. 2 Rat lung strips contracted by carbachol were relaxed by 4-(3-cyclopentyloxy-4-methoxyphenyl)-2-pyrrolidone (ZK 26711, EC25 = 7 x 10(-8)M) and 2-O-propoxyphenyl-8-azapurin-6-one (M & B 22948, EC25 = 5 x 10(-7)M) indicating relaxant properties of both cyclic AMP and cyclic GMP. 3 The antigen-induced histamine release from human basophils was inhibited by ZK 62711 (IC25 = 8 x 10(-7)M), whereas M & B 22948 had no effect. On the contrary, the release from rat mast cells was inhibited by M & B 22948 (IC25 = 10(-6)M), while ZK 62711 had no effect. 4 These data show an inhibitory effect of cyclic AMP on histamine release to be involved with basophils, whereas cyclic GMP is predominantly involved with mast cells. Is is suggested that the antianaphylactic properties of cyclic nucleotide phosphodiesterase inhibitors are mainly linked to the increase of cyclic GMP. PMID:6168323

  1. Activation of Cyclic AMP Signaling Leads to Different Pathway Alterations in Lesions of the Adrenal Cortex Caused by Germline PRKAR1A Defects versus Those due to Somatic GNAS Mutations

    PubMed Central

    Almeida, Madson Q.; Azevedo, Monalisa F.; Xekouki, Paraskevi; Bimpaki, Eirini I.; Horvath, Anelia; Collins, Michael T.; Karaviti, Lefkothea P.; Jeha, George S.; Bhattacharyya, Nisan; Cheadle, Chris; Watkins, Tonya; Bourdeau, Isabelle; Nesterova, Maria

    2012-01-01

    Context: The overwhelming majority of benign lesions of the adrenal cortex leading to Cushing syndrome are linked to one or another abnormality of the cAMP or protein kinase pathway. PRKAR1A-inactivating mutations are responsible for primary pigmented nodular adrenocortical disease, whereas somatic GNAS activating mutations cause macronodular disease in the context of McCune-Albright syndrome, ACTH-independent macronodular hyperplasia, and, rarely, cortisol-producing adenomas. Objective and Design: The whole-genome expression profile (WGEP) of normal (pooled) adrenals, PRKAR1A- (3) and GNAS-mutant (3) was studied. Quantitative RT-PCR and Western blot were used to validate WGEP findings. Results: MAPK and p53 signaling pathways were highly overexpressed in all lesions against normal tissue. GNAS-mutant tissues were significantly enriched for extracellular matrix receptor interaction and focal adhesion pathways when compared with PRKAR1A-mutant (fold enrichment 3.5, P < 0.0001 and 2.1, P < 0.002, respectively). NFKB, NFKBIA, and TNFRSF1A were higher in GNAS-mutant tumors (P < 0.05). Genes related to the Wnt signaling pathway (CCND1, CTNNB1, LEF1, LRP5, WISP1, and WNT3) were overexpressed in PRKAR1A-mutant lesions. Conclusion: WGEP analysis revealed that not all cAMP activation is the same: adrenal lesions harboring PRKAR1A or GNAS mutations share the downstream activation of certain oncogenic signals (such as MAPK and some cell cycle genes) but differ substantially in their effects on others. PMID:22259056

  2. Modulation of the phosphorylation state of tau in situ: the roles of calcium and cyclic AMP.

    PubMed Central

    Fleming, L M; Johnson, G V

    1995-01-01

    Alterations in situ in the phosphorylation state of the microtubule-associated protein tau were examined in response to increasing intracellular levels of Ca2+ through N-methyl-D-aspartate (NMDA)-receptor activation, or activating cyclic AMP (cAMP)-dependent protein kinase (cAMP-PK), in rat cerebral-cortical slices. Increasing intracellular concentrations of Ca2+ by treatment of the brain slices with the glutamate analogue NMDA in depolarizing conditions (55 mM KCl) resulted in dephosphorylation of tau. Addition of KCl+NMDA to the slices resulted in a 40% decrease in 32P incorporation into tau, whereas addition of KCl or NMDA alone had no effect on tau phosphorylation. The KCl+NMDA-induced dephosphorylation of tau was blocked by the non-competitive NMDA-receptor antagonist MK801. Determine the involvement of the Ca2+/calmodulin-dependent phosphatase, calcineurin, in the KCl+NMDA-induced dephosphorylation of tau, slices were pretreated with the calcineurin inhibitor Cyclosporin A. Pretreatment of the rat brain slices with Cyclosporin A completely abolished the dephosphorylation of tau induced by the addition of KCl+NMDA. The dephosphorylation of tau in situ was site-selective, as indicated by the loss of 32P label from only a few select peptides. Activation of cAMP-PK by stimulating adenylate cyclase in rat cerebral-cortical slices with forskolin resulted in a 73% increase over control levels in 32P incorporation into immunoprecipitated tau. Two-dimensional phosphopeptide mapping revealed that most of the sites on tau phosphorylated in brain slices in response to increased cAMP levels were the same as those phosphorylated on isolated tau by purified cAMP-PK. Although the state of tau phosphorylation is certainly regulated by many protein phosphatases and kinases in vivo, to our knowledge this study provides the first direct evidence of a specific protein phosphatase and kinase that modulate the phosphorylation state of tau in situ. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7619080

  3. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens

    PubMed Central

    Kalivoda, Eric J.; Stella, Nicholas A.; Aston, Marissa A.; Fender, James E.; Thompson, Paul P.; Kowalski, Regis P.; Shanks, Robert M. Q.

    2010-01-01

    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli camp phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens. PMID:20045458

  4. Cyclic AMP Controls mTOR through Regulation of the Dynamic Interaction between Rheb and Phosphodiesterase 4D ?

    PubMed Central

    Kim, Hyun Wook; Ha, Sang Hoon; Lee, Mi Nam; Huston, Elaine; Kim, Do-Hyung; Jang, Sung Key; Suh, Pann-Ghill; Houslay, Miles D.; Ryu, Sung Ho

    2010-01-01

    The mammalian target of rapamycin complex 1 (mTORC1) is a molecular hub that regulates protein synthesis in response to a number of extracellular stimuli. Cyclic AMP (cAMP) is considered to be an important second messenger that controls mTOR; however, the signaling components of this pathway have not yet been elucidated. Here, we identify cAMP phosphodiesterase 4D (PDE4D) as a binding partner of Rheb that acts as a cAMP-specific negative regulator of mTORC1. Under basal conditions, PDE4D binds Rheb in a noncatalytic manner that does not require its cAMP-hydrolyzing activity and thereby inhibits the ability of Rheb to activate mTORC1. However, elevated cAMP levels disrupt the interaction of PDE4D with Rheb and increase the interaction between Rheb and mTOR. This enhanced Rheb-mTOR interaction induces the activation of mTORC1 and cap-dependent translation, a cellular function of mTORC1. Taken together, our results suggest a novel regulatory mechanism for mTORC1 in which the cAMP-determined dynamic interaction between Rheb and PDE4D provides a key, unique regulatory event. We also propose a new role for PDE4 as a molecular transducer for cAMP signaling. PMID:20837708

  5. Investigation of guanine-nucleotide-binding protein involvement and regulation of cyclic AMP metabolism in interleukin 1 signal transduction.

    PubMed Central

    Ray, K; Thompson, N; Kennard, N; Rollins, P; Grenfell, S; Witham, S; Smithers, N; Solari, R

    1992-01-01

    The involvement of guanine-nucleotide-binding proteins (G-proteins) and regulation of cyclic AMP (cAMP) in interleukin 1 (IL1) signal transduction has been investigated in EL4 and 7OZ/3 cells expressing Type 1 and Type 2 IL1 receptors respectively. Results show that in both cell types IL1 alone failed to induce changes in cellular cAMP levels, and in membrane preparations the cytokine had no significant effect on adenylate cyclase activity. In contrast, forskolin stimulated cAMP levels in cells and membranes. IL1 did not significantly alter GTPase activity or rate of guanosine 5'-[gamma-[35S]thio]triphosphate binding measured in membrane preparations from the EL4 and 7OZ/3 cells. In EL4-cell membrane preparations the kinetics of 125I-IL1 binding were altered in the presence of guanosine 5'-[beta gamma-imido]triphosphate, resulting in the formation of a higher-affinity state for IL1 binding. Adenosine 5'-[beta gamma-imido]triphosphate at the same concentration was without effect. These results suggest that IL1 receptor function may be regulated by guanine nucleotides; however, the mechanism appears to differ from that exhibited by conventional G-protein-linked receptors. The lack of significant effects of IL1 on cAMP metabolism in these cells suggests that alternative pathways must exist to mediate the intracellular responses to stimulation via both types of the IL1 receptor. Images Fig. 8. PMID:1311561

  6. Cyclic AMP- and (Rp)-cAMPS-induced Conformational Changes in a Complex of the Catalytic and Regulatory (RI?) Subunits of Cyclic AMP-dependent Protein Kinase*

    PubMed Central

    Anand, Ganesh S.; Krishnamurthy, Srinath; Bishnoi, Tanushree; Kornev, Alexandr; Taylor, Susan S.; Johnson, David A.

    2010-01-01

    We took a discovery approach to explore the actions of cAMP and two of its analogs, one a cAMP mimic ((Sp)-adenosine cyclic 3?:5?-monophosphorothioate ((Sp)-cAMPS)) and the other a diastereoisomeric antagonist ((Rp)-cAMPS), on a model system of the type I? cyclic AMP-dependent protein kinase holoenzyme, RI?(91244)C-subunit, by using fluorescence spectroscopy and amide H/2H exchange mass spectrometry. Specifically, for the fluorescence experiments, fluorescein maleimide was conjugated to three cysteine single residue substitution mutants, R92C, T104C, and R239C, of RI?(91244), and the effects of cAMP, (Sp)-cAMPS, and (Rp)-cAMPS on the kinetics of R-C binding and the time-resolved anisotropy of the reporter group at each conjugation site were measured. For the amide exchange experiments, ESI-TOF mass spectrometry with pepsin proteolytic fragmentation was used to assess the effects of (Rp)-cAMPS on amide exchange of the RI?(91244)C-subunit complex. We found that cAMP and its mimic perturbed at least parts of the C-subunit interaction Sites 2 and 3 but probably not Site 1 via reduced interactions of the linker region and ?C of RI?(91244). Surprisingly, (Rp)-cAMPS not only increased the affinity of RI?(91244) toward the C-subunit by 5-fold but also produced long range effects that propagated through both the C- and R-subunits to produce limited unfolding and/or enhanced conformational flexibility. This combination of effects is consistent with (Rp)-cAMPS acting by enhancing the internal entropy of the RC complex. Finally, the (Rp)-cAMPS-induced increase in affinity of RI?(91244) toward the C-subunit indicates that (Rp)-cAMPS is better described as an inverse agonist because it decreases the fractional dissociation of the cyclic AMP-dependent protein kinase holoenzyme and in turn its basal activity. PMID:20167947

  7. Long-term increase of hippocampal excitability by histamine and cyclic AMP.

    PubMed

    Selbach, O; Brown, R E; Haas, H L

    1997-01-01

    The action of histamine (HA) on rat hippocampal CA1 pyramidal cells in vitro was investigated in slices perfused with solution containing 0.2 mM Ca2+/4.0 mM Mg2+. Extracellular recordings of the spontaneous discharges occurring under these conditions revealed that HA caused a long-lasting increase in cell firing. The HA-effects were dose-dependent, in that low concentrations of HA (0.1-0.5 microM) exhibited an initial transient depression of cell firing and practically no long-lasting action, whereas higher concentrations of HA (1-10 microM) exerted strong, non-declining increases. The H1-receptor antagonist mepyramine (1 microM) blocked the initial depression of firing and attenuated the long-lasting HA-mediated excitation. Pure H1-receptor activation, tested with the H1-receptor agonist 2-(3-fluorphenyl)histamine (1-10 microM) depressed cell firing, similar to the low dose effects of HA. HA-induced excitations were prevented by the H2-receptor antagonist cimetidine (10-50 microM), and mimicked by the very potent H2-receptor agonist impromidine (1 or 3 microM) which was, however, less effective compared to equal concentrations of HA. H3-receptor activation by R-alpha-methylhistamine had no significant effect on cell firing. Thus, histamine H1 and H2 receptors seem to cooperate in producing this long-lasting augmentation of excitability. 8-Bromo-cyclic AMP monophosphate (8-Br-cAMP, 50-100 microM) mimicked the long-term excitation, whereas the adenylyl-cyclase inhibitor 9-tetrahydro-2-furyladenine (THFA, 100-500 microM) or the PKA-inhibitor Rp-adenosine-3'5'-cyclic monophosphate (Rp-cAMPS, 10 microM) blocked it, indicating that the HA-mediated increase of excitability in the hippocampus is dependent on the adenylate cyclase/PKA-signal transduction cascade. DL-2-Amino-5-phosphonopentanoic acid (APV, 50 microM) significantly attenuated the magnitude of the HA-induced enhancement, indicating an NMDA receptor-dependent component. Other biogenic amines, acting through receptors positively coupled to adenylyl cyclase, elicited similar responses as HA, indicating common mechanisms by which these substances modulate excitability in CA1 pyramidal cells. PMID:9517424

  8. Induction of Stalk Cell Differentiation by Cyclic AMP in the Cellular Slime Mold Dictyostelium discoideum*

    PubMed Central

    Bonner, John Tyler

    1970-01-01

    Cyclic AMP, which is a cell attractant (acrasin) for Dictyostelium discoideum, will cause isolated, unaggregated cells to turn directly into stalk cells containing thick celluloselike walls and large vacuoles. From previous work we know that in the cell mass, acrasin is produced solely in the region of stalk formation during fruiting, that stalk formation involves a high level of catabolism, and that cyclic AMP stimulates catabolic enzymes in other systems. These facts obviously suggest that in the development of D. discoideum, cyclic AMP might be a key factor in stalk cell differentiation. Images PMID:4313192

  9. Cyclic AMP receptor protein from yeast mitochondria: submitochondrial localization and preliminary characterization.

    PubMed

    Rödel, G; Müller, G; Bandlow, W

    1985-01-01

    We have identified and characterized a cyclic AMP receptor protein in mitochondria of the yeast Saccharomyces cerevisiae. The binding is specific for cyclic nucleotides, particularly for cyclic AMP which is bound with high affinity (Kd of 10(-9) M) at 1 to 5 pmol/mg of mitochondrial protein. The mitochondrial cyclic AMP receptor is synthesized on cytoplasmic ribosomes and has an apparent molecular weight of 45,000 as determined by photoaffinity labeling. It is localized in the inner mitochondrial membrane and faces the intermembrane space. Cross-contamination of mitochondrial inner membranes by plasma membranes or soluble cytoplasmic proteins is excluded. PMID:2981811

  10. Potent constitutive cyclic AMP-generating activity of XLαs implicates this imprinted GNAS product in the pathogenesis of McCune-Albright syndrome and fibrous dysplasia of bone.

    PubMed

    Mariot, Virginie; Wu, Joy Y; Aydin, Cumhur; Mantovani, Giovanna; Mahon, Matthew J; Linglart, Agnès; Bastepe, Murat

    2011-02-01

    Patients with McCune-Albright syndrome (MAS), characterized primarily by hyperpigmented skin lesions, precocious puberty, and fibrous dyslasia of bone, carry postzygotic heterozygous mutations of GNAS causing constitutive cAMP signaling. GNAS encodes the α-subunit of the stimulatory G protein (Gsα), as well as a large variant (XLαs) derived from the paternal allele. The mutations causing MAS affect both GNAS products, but whether XLαs, like Gsα, can be involved in the pathogenesis remains unknown. Here, we investigated biopsy samples from four previously reported and eight new patients with MAS. Activating mutations of GNAS (Arg201 with respect to the amino acid sequence of Gsα) were present in all the previously reported and five of the new cases. The mutation was detected within the paternally expressed XLαs transcript in five and the maternally expressed NESP55 transcript in four cases. Tissues carrying paternal mutations appeared to have higher XLαs mRNA levels than maternal mutations. The human XLαs mutant analogous to Gsα-R201H (XLαs-R543H) showed markedly higher basal cAMP accumulation than wild-type XLαs in transfected cells. Wild-type XLαs demonstrated higher basal and isoproterenol-induced cAMP signaling than Gsα and co-purified with Gβ1γ2 in transduced cells. XLαs mRNA was measurable in mouse calvarial cells, with its level being significantly higher in undifferentiated cells than those expressing preosteoblastic markers osterix and alkaline phosphatase. XLαs mRNA was also expressed in murine bone marrow stromal cells and preosteoblastic MC3T3-E1 cells. Our findings are consistent with the possibility that constitutive XLαs activity adds to the molecular pathogenesis of MAS and fibrous dysplasia of bone. PMID:20887824

  11. Potent constitutive cyclic AMP-generating activity of XLαs implicates this imprinted GNAS product in the pathogenesis of McCune-Albright Syndrome and fibrous dysplasia of bone

    PubMed Central

    Mariot, Virginie; Wu, Joy Y.; Aydin, Cumhur; Mantovani, Giovanna; Mahon, Matthew J.; Linglart, Agnès; Bastepe, Murat

    2010-01-01

    Patients with McCune-Albright syndrome (MAS), characterized primarily by hyperpigmented skin lesions, precocious puberty, and fibrous dyslasia of bone, carry postzygotic heterozygous mutations of GNAS causing constitutive cAMP signaling. GNAS encodes the α-subunit of the stimulatory G protein (Gsα), as well as a large variant (XLαs) derived from the paternal allele. The mutations causing MAS affect both GNAS products, but whether XLαs, like Gsα, can be involved in the pathogenesis remains unknown. Here, we investigated biopsy samples from four previously reported and eight new patients with MAS. Activating mutations of GNAS (Arg201 with respect to the amino acid sequence of Gsα) were present in all the previously reported and five of the new cases. The mutation was detected within the paternally expressed XLαs transcript in five and the maternally expressed NESP55 transcript in four cases. Tissues carrying paternal mutations appeared to have higher XLαs mRNA levels than maternal mutations. The human XLαs mutant analogous to Gsα-R201H (XLαs-R543H) showed markedly higher basal cAMP accumulation than wild-type XLαs in transfected cells. Wild-type XLαs demonstrated higher basal and isoproterenol-induced cAMP signaling than Gsα and co-purified with Gβ1γ2 in transduced cells. XLαs mRNA was measurable in mouse calvarial cells, with its level being significantly higher in undifferentiated cells than those expressing preosteoblastic markers osterix and alkaline phosphatase. XLαs mRNA was also expressed in murine bone marrow stromal cells and preosteoblastic MC3T3-E1 cells. Our findings are consistent with the possibility that constitutive XLαs activity adds to the molecular pathogenesis of MAS and fibrous dysplasia of bone. PMID:20887824

  12. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  13. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  14. Effect of electrical stimulation on beta-adrenergic receptor population and cyclic amp production in chicken and rat skeletal muscle cell cultures

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Strietzel, C. J.

    2000-01-01

    Expression of the beta-adrenergic receptor (betaAR) and its coupling to cyclic AMP (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the betaAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically, chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the betaAR population was not significantly affected by electrical stimulation; however, the ability of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the betaAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  15. Cyclic AMP regulation of early gene expression in Dictyostelium discoideum: mediation via the cell surface cyclic AMP receptor.

    PubMed Central

    Mann, S K; Firtel, R A

    1987-01-01

    We examined two sets of genes expressed early in the developmental cycle of Dictyostelium discoideum that appear to be regulated by cyclic AMP (cAMP). The transcripts of both sets of genes were not detectable in vegetative cells. During normal development on filter pads, RNA complementary to these genes could be detected at about 2 h, peaked around 6 to 8 h, and decreased gradually thereafter. Expression of these genes upon starvation in shaking culture was stimulated by pulsing the cells with nanomolar levels of cAMP, a condition that mimics the in vivo pulsing during normal aggregation. Expression was inhibited by caffeine or by continuous levels of cAMP, a condition found later in development when in vivo expression of these genes decreased. The inhibition of caffeine could be overcome by pulsing cells with cAMP. These results suggest that the expression is mediated via the cell surface cAMP receptor, but does not require a rise in intracellular cAMP. mRNA from a gene of the second class was induced upon starvation, peaked by 2.5 h of development, and then declined. In contrast to the other genes, its expression was maintained by continuous levels of cAMP and repressed by cAMP pulses. These and other results on a number of classes of developmentally regulated genes indicates that changing levels of cAMP, acting via the cell surface cAMP receptor, are involved in controlling these groups of genes. We also examined the structure and partial sequence of the cAMP pulse-induced genes. The two tandemly duplicated M3 genes were almost continuously homologous over the sequenced portion of the protein-coding region except for a region near the N-terminal end. The two M3 genes had regions of homology in the 5' flanking sequence and showed slight homology to the same regions in gene D2, another cAMP pulse-induced gene. D2 showed extremely significant homology over its entire sequenced length to an acetylcholinesterase. The results presented here and by others suggest that expression of many early genes in D. discoideum is regulated via the cell surface cAMP receptor. We expect that many of these genes may play essential roles in early Dictyostelium development and could code for elements of the cAMP signal transduction pathway involved in aggregation. Images PMID:3031475

  16. Modulation of 3',5'-cyclic AMP homeostasis in human platelets by coffee and individual coffee constituents.

    PubMed

    Montoya, Gina A; Bakuradze, Tamara; Eirich, Marion; Erk, Thomas; Baum, Matthias; Habermeyer, Michael; Eisenbrand, Gerhard; Richling, Elke

    2014-11-14

    3',5'-Cyclic AMP (cAMP) is one of the most important second messengers in mammalian cells, mediating a multitude of diverse cellular signalling responses. Its homeostasis is primarily regulated by adenylate cyclases and phosphodiesterases (PDE), the activities of which are partially dependent on the downstream events of adenosine receptor signalling. The present study was conducted to determine whether coffee constituents other than caffeine can influence the homeostasis of intracellular cAMP in vitro and in vivo by evaluating the effects of selected constituents present in coffee, coffee brews and coffee extracts on platelet PDE activity. In addition, to evaluate the potential effects of these constituents on platelet cAMP concentrations and PDE activity in humans, a 7-week pilot intervention study with eight subjects was conducted. The subjects consumed a regular commercial coffee and a low-caffeine coffee at a rate of 750ml/d for 2 weeks each. The in vivo results revealed a highly significant inhibition of PDE activity (P<0001) after coffee intervention that was not directly dependent on the caffeine content of coffee. Although our in vitro and in vivo findings suggest that caffeine plays some role in the modulation of platelet cAMP status, other natural and roasting-associated compounds such as pyrazines and other currently unidentified species also appear to contribute significantly. In conclusion, moderate consumption of coffee can modulate platelet PDE activity and cAMP concentrations in humans, which may contribute to the putative beneficial health effects of coffee. Further detailed mechanistic investigations will be required to substantiate these beneficial effects and to elucidate the underlying mechanisms. PMID:25247601

  17. Effects of staurosporine, PMA and A23187 on human melanocyte cultures with dibutyryl cyclic AMP.

    TOXLINE Toxicology Bibliographic Information

    Maeda K; Tomita Y; Fukuda M; Tagami H

    1992-02-01

    Staurosporine, a protein kinase (PK) inhibitor, phorbol-12-myristate-13-acetate (PMA), a PKC activator and A23187 calcium ionophore were added to human melanocyte cultures with or without dibutyryl cyclic AMP (dbcAMP). After 2 days' incubation, changes in various melanogenic factors were examined such as tyrosinase activity and the amount of tyrosinase-related protein (TRP) as well as the morphology of the melanocytes. dbcAMP stimulated all the melanogenic factors. Staurosporine increased tyrosinase activity and amount of TRP and caused morphological changes with the formation of numerous dendrites, regardless of the presence of dbcAMP. In contrast, PMA did not significantly affect tyrosinase activity, TRP content or dendrite formation, with or without dbcAMP. The effects of staurosporine on tyrosinase activity and TRP content were completely inhibited by PMA, but PMA did not significantly affect the staurosporine-induced morphological changes. A23187 inhibited both tyrosinase activity and TRP content, regardless of the presence of dbcAMP, but did not affect the morphology of melanocytes. These findings suggest that tyrosinase activity and TRP content are regulated by adenylate cyclase and Ca2+ and partly by PKC, while the morphological features of melanocytes are affected by intracellular cAMP accumulation and by the inhibition of PKC.

  18. Autoregulation of PhoP/PhoQ and Positive Regulation of the Cyclic AMP Receptor Protein-Cyclic AMP Complex by PhoP in Yersinia pestis

    PubMed Central

    Zhang, Yiquan; Wang, Li; Han, Yanping; Yan, Yanfeng; Tan, Yafang; Zhou, Lei; Cui, Yujun; Du, Zongmin; Wang, Xiaoyi; Bi, Yujing; Yang, Huiying; Song, Yajun; Zhang, Pingping

    2013-01-01

    Yersinia pestis is one of the most dangerous bacterial pathogens. PhoP and cyclic AMP receptor protein (CRP) are global regulators of Y. pestis, and they control two distinct regulons that contain multiple virulence-related genes. The PhoP regulator and its cognate sensor PhoQ constitute a two-component regulatory system. The regulatory activity of CRP is triggered only by binding to its cofactor cAMP, which is synthesized from ATP by adenylyl cyclase (encoded by cyaA). However, the association between the two regulatory systems PhoP/PhoQ and CRP-cAMP is still not understood for Y. pestis. In the present work, the four consecutive genes YPO1635, phoP, phoQ, and YPO1632 were found to constitute an operon, YPO1635-phoPQ-YPO1632, transcribed as a single primary RNA, whereas the last three genes comprised another operon, phoPQ-YPO1632, transcribed with two adjacent transcriptional starts. Through direct PhoP-target promoter association, the transcription of these two operons was stimulated and repressed by PhoP, respectively; thus, both positive autoregulation and negative autoregulation of PhoP/PhoQ were detected. In addition, PhoP acted as a direct transcriptional activator of crp and cyaA. The translational/transcriptional start sites, promoter −10 and −35 elements, PhoP sites, and PhoP box-like sequences were determined for these PhoP-dependent genes, providing a map of the PhoP-target promoter interaction. The CRP and PhoP regulons have evolved to merge into a single regulatory cascade in Y. pestis because of the direct regulatory association between PhoP/PhoQ and CRP-cAMP. PMID:23264579

  19. Effects of catecholamines and cyclic amp on excitation--contraction coupling in isolated skeletal muscle fibres of the frog.

    PubMed Central

    Gonzalez-Serratos, H; Hill, L; Valle-Aguilera, R

    1981-01-01

    1. In skeletal muscle the presence of a positive inotropic effect induced by adrenaline has been a matter of controversy. If it exists, it could be due to catecholamines acting on the actomyosin system, on the sarcoplasmic reticulum (SR) Ca2+ pump or on the release or influx of Ca2+. We investigated these possibilities by using intact, split and skinned skeletal muscle fibres. We also investigated whether adrenaline acts directly or through cyclic AMP. 2. Catecholamines produced an increase in twitch tension and in maximum rates of tension development and tension decay. The inotropic effect took 3 min to appear and 8 min to reach its maximum level. With tetanic stimulations the extra force appeared only at the beginning of the tetanus while approaching the same maximum level, and tended to disappear faster, the higher the frequency of stimulation. At 4 shocks/sec the peak twitch tension with catecholamines decreased during the first seven to ten twitches and became steady afterwards at a level that was still greater than the control. 3. Resting and action potentials showed no important changes in the presence of adrenaline that could explain the inotropic effect. 4. In split fibres the force produced with the release of Ca2+ from the SR by caffeine was 60-100% larger when cyclic AMP was added to the previous loading solution. In skinned fibres adrenaline given directly to the interior of the cell produced no changes in contraction--relaxation cycles induced by fixed amounts of Ca2+ applied with a pipette. 5. These results strongly suggest that catecholamines through cyclic AMP stimulate the SR Ca2+ pump, increasing thereby the concentration of Ca2+ within the SR. This extra Ca2+ when released during subsequent activation may produce the increase in twitch tension. PMID:6273540

  20. 19F n.m.r. studies of conformational changes accompanying cyclic AMP binding to 3-fluorophenylalanine-containing cyclic AMP receptor protein from Escherichia coli.

    PubMed Central

    Hinds, M G; King, R W; Feeney, J

    1992-01-01

    A fluorine-containing analogue of the cyclic AMP (cAMP) receptor protein (CRP) from Escherichia coli was prepared by biosynthetic incorporation of 3-fluorophenylalanine (3-F-Phe). 19F n.m.r. studies on this protein have provided direct evidence for cAMP-induced conformational changes not only within the cAMP-binding domain but also within the hinge region connecting the cAMP-binding domain to the DNA-binding headpiece. At 313 K, the 19F n.m.r. spectrum of [3-F-Phe]CRP showed five signals corresponding to the five phenylalanine residues as expected for a symmetrical dimer. Proteolysis of [3-F-Phe]CRP with subtilisin produced a fragment (the alpha-fragment) containing the cAMP-binding domain. The alpha-fragment contains all the phenylalanines except for Phe-136, a residue located in the hinge region. By comparing the 19F spectra of [3-F-Phe]CRP and its alpha-fragment, the signal for Phe-136 was assigned. The chemical shifts of the corresponding signals in the two spectra are similar, indicating that the alpha-fragment retains the structure it has in the intact protein. The largest cAMP-induced shift was observed for the signal from Phe-136 providing direct evidence for a conformational change in the hinge region. However, whereas binding of a single cAMP molecule to a CRP dimer is known to be sufficient to activate the DNA binding, the n.m.r. data indicate that the hinge region does not have the same conformation in both subunits when only one cAMP molecule is bound. PMID:1332679

  1. The Cyclic AMP-Vfr Signaling Pathway in Pseudomonas aeruginosa Is Inhibited by Cyclic Di-GMP

    PubMed Central

    Almblad, Henrik; Harrison, Joe J.; Rybtke, Morten; Groizeleau, Julie; Givskov, Michael; Parsek, Matthew R.

    2015-01-01

    ABSTRACT The opportunistic human pathogen Pseudomonas aeruginosa expresses numerous acute virulence factors in the initial phase of infection, and during long-term colonization it undergoes adaptations that optimize survival in the human host. Adaptive changes that often occur during chronic infection give rise to rugose small colony variants (RSCVs), which are hyper-biofilm-forming mutants that commonly possess mutations that increase production of the biofilm-promoting secondary messenger cyclic di-GMP (c-di-GMP). We show that RSCVs display a decreased production of acute virulence factors as a direct result of elevated c-di-GMP content. Overproduction of c-di-GMP causes a decrease in the transcription of virulence factor genes that are regulated by the global virulence regulator Vfr. The low level of Vfr-dependent transcription is caused by a low level of its coactivator, cyclic AMP (cAMP), which is decreased in response to a high level of c-di-GMP. Mutations that cause reversion of the RSCV phenotype concomitantly reactivate Vfr-cAMP signaling. Attempts to uncover the mechanism underlying the observed c-di-GMP-mediated lowering of cAMP content provided evidence that it is not caused by inhibition of adenylate cyclase production or activity and that it is not caused by activation of cAMP phosphodiesterase activity. In addition to the studies of the RSCVs, we present evidence that the deeper layers of wild-type P. aeruginosa biofilms have high c-di-GMP levels and low cAMP levels. IMPORTANCE Our work suggests that cross talk between c-di-GMP and cAMP signaling pathways results in downregulation of acute virulence factors in P. aeruginosa biofilm infections. Knowledge about this cross-regulation adds to our understanding of virulence traits and immune evasion by P. aeruginosa in chronic infections and may provide new approaches to eradicate biofilm infections. PMID:25897033

  2. Ecklonia cava Polyphenol Has a Protective Effect against Ethanol-Induced Liver Injury in a Cyclic AMP-Dependent Manner.

    PubMed

    Yamashita, Haruka; Goto, Mayu; Matsui-Yuasa, Isao; Kojima-Yuasa, Akiko

    2015-06-01

    Previously, we showed that Ecklonia cava polyphenol (ECP) treatment suppressed ethanol-induced increases in hepatocyte death by scavenging intracellular reactive oxygen species (ROS) and maintaining intracellular glutathione levels. Here, we examined the effects of ECP on the activities of alcohol-metabolizing enzymes and their regulating mechanisms in ethanol-treated hepatocytes. Isolated hepatocytes were incubated with or without 100 mM ethanol. ECP was dissolved in dimethylsulfoxide. ECP was added to cultured cells that had been incubated with or without ethanol. The cells were incubated for 0-24 h. In cultured hepatocytes, the ECP treatment with ethanol inhibited cytochrome P450 2E1 (CYP2E1) expression and activity, which is related to the production of ROS when large quantities of ethanol are oxidized. On the other hand, ECP treatment with ethanol increased the activity of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase. These changes in activities of CYP2E1 and ADH were suppressed by treatment with H89, an inhibitor of protein kinase A. ECP treatment with ethanol enhanced cyclic AMP concentrations compared with those of control cells. ECP may be a candidate for preventing ethanol-induced liver injury via regulating alcohol metabolic enzymes in a cyclic AMP-dependent manner. PMID:26096275

  3. Ecklonia cava Polyphenol Has a Protective Effect against Ethanol-Induced Liver Injury in a Cyclic AMP-Dependent Manner

    PubMed Central

    Yamashita, Haruka; Goto, Mayu; Matsui-Yuasa, Isao; Kojima-Yuasa, Akiko

    2015-01-01

    Previously, we showed that Ecklonia cava polyphenol (ECP) treatment suppressed ethanol-induced increases in hepatocyte death by scavenging intracellular reactive oxygen species (ROS) and maintaining intracellular glutathione levels. Here, we examined the effects of ECP on the activities of alcohol-metabolizing enzymes and their regulating mechanisms in ethanol-treated hepatocytes. Isolated hepatocytes were incubated with or without 100 mM ethanol. ECP was dissolved in dimethylsulfoxide. ECP was added to cultured cells that had been incubated with or without ethanol. The cells were incubated for 0–24 h. In cultured hepatocytes, the ECP treatment with ethanol inhibited cytochrome P450 2E1 (CYP2E1) expression and activity, which is related to the production of ROS when large quantities of ethanol are oxidized. On the other hand, ECP treatment with ethanol increased the activity of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase. These changes in activities of CYP2E1 and ADH were suppressed by treatment with H89, an inhibitor of protein kinase A. ECP treatment with ethanol enhanced cyclic AMP concentrations compared with those of control cells. ECP may be a candidate for preventing ethanol-induced liver injury via regulating alcohol metabolic enzymes in a cyclic AMP-dependent manner. PMID:26096275

  4. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  5. Compartmentalization of cyclic AMP-dependent protein kinases in human erythrocytes.

    PubMed Central

    Dreyfuss, G; Schwartz, K J; Blout, E R

    1978-01-01

    The human erythrocyte contains two types of cyclic AMP-dependent protein kinase. The membrane-associated protein kinase holoenzyme can be released intact by hypotonic treatment at alkaline pH. Chromatography on DEAE-cellulose and molecular weight determinations demonstrate that this enzyme is a type I cyclic AMP-dependent protein kinase, while the predominant cyclic AMP-dependent protein kinase found in the cytoplasm is type II. The catalytic subunits of the two types of kinase found in the erythrocyte are identical, but the regulatory subunits, which distinguish the two types of kinase, determine their localization within the cell. It is proposed that the regulatory subunit of the type I enzyme, in addition to binding the catalytic subunit, interacts specifically with one or more membrane proteins and that this interaction may serve to position the kinase in preferential proximity to protein substrates. PMID:216002

  6. Isolated horizontal cells from carp retina demonstrate dopamine-dependent accumulation of cyclic AMP.

    PubMed Central

    Van Buskirk, R; Dowling, J E

    1981-01-01

    Horizontal cells of the carp retina were separated from other retinal cell types by using enzymatic dissociation and velocity sedimentation at unit gravity. Fractions containing horizontal cells were tested for their ability to accumulate cyclic AMP in the presence of various putative neurotransmitters. Micromolar concentrations of dopamine, when added in the presence of 3-isobutyl-1-methylxanthine, stimulated cyclic AMP accumulation in these isolated cells. The dopamine-dependent accumulation of cyclic AMP in intact isolated horizontal cells was blocked by nanomolar concentrations of dopamine antagonists such as haloperidol, (+)-butaclamol, and fluphenazine. The results indicate that there is a postsynaptic dopamine receptor on carp horizontal cells that is associated with adenylate cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1]. Images PMID:6278491

  7. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  8. Protein phosphorylation in electrically permeabilized islets of Langerhans. Effects of Ca2+, cyclic AMP, a phorbol ester and noradrenaline.

    PubMed Central

    Jones, P M; Salmon, D M; Howell, S L

    1988-01-01

    The incorporation of 32P from [gamma-32P]ATP into intracellular proteins was studied in electrically permeabilized rat islets of Langerhans. Ca2+ (10 microM), cyclic AMP (100 microM) and a protein kinase C-activating phorbol ester, phorbol 13-myristate 12-acetate (PMA; 100 nM) produced marked changes in the phosphorylation state of a number of proteins in permeabilized islets after incubation for 1 min at 37 degrees C. Ca2+ modified the effects of cyclic AMP and PMA on protein phosphorylation. Noradrenaline (10 microM) had no detectable effects on Ca2+-dependent protein phosphorylation, but significantly inhibited Ca2+-induced insulin secretion from electrically permeabilized islets. These results suggest that electrically permeabilized islets offer a useful model in which to study rapid events in protein phosphorylation as a mechanism of stimulus-secretion coupling. If the rapid Ca2+-induced effects on protein phosphorylation are involved in the control of insulin secretion, the results of this study also imply that part of the catecholamine inhibition of insulin secretion occurs at a stage in the secretory pathway beyond the activation of the regulated protein kinases. Images Fig. 1. Fig. 4. PMID:2845950

  9. Two phosphodiesterase genes, PDEL and PDEH, regulate development and pathogenicity by modulating intracellular cyclic AMP levels in Magnaporthe oryzae.

    PubMed

    Zhang, Haifeng; Liu, Kaiyue; Zhang, Xing; Tang, Wei; Wang, Jiansheng; Guo, Min; Zhao, Qian; Zheng, Xiaobo; Wang, Ping; Zhang, Zhengguang

    2011-01-01

    Cyclic AMP (cAMP) signaling plays an important role in regulating multiple cellular responses, such as growth, morphogenesis, and/or pathogenicity of eukaryotic organisms such as fungi. As a second messenger, cAMP is important in the activation of downstream effector molecules. The balance of intracellular cAMP levels depends on biosynthesis by adenylyl cyclases (ACs) and hydrolysis by cAMP phosphodiesterases (PDEases). The rice blast fungus Magnaporthe oryzae contains a high-affinity (PdeH/Pde2) and a low-affinity (PdeL/Pde1) PDEases, and a previous study showed that PdeH has a major role in asexual differentiation and pathogenicity. Here, we show that PdeL is required for asexual development and conidial morphology, and it also plays a minor role in regulating cAMP signaling. This is in contrast to PdeH whose mutation resulted in major defects in conidial morphology, cell wall integrity, and surface hydrophobicity, as well as a significant reduction in pathogenicity. Consistent with both PdeH and PdeL functioning in cAMP signaling, disruption of PDEH only partially rescued the mutant phenotype of ?magB and ?pka1. Further studies suggest that PdeH might function through a feedback mechanism to regulate the expression of pathogenicity factor Mpg1 during surface hydrophobicity and pathogenic development. Moreover, microarray data revealed new insights into the underlying cAMP regulatory mechanisms that may help to identify potential pathogenicity factors for the development of new disease management strategies. PMID:21386978

  10. Serratia marcescens Cyclic AMP Receptor Protein Controls Transcription of EepR, a Novel Regulator of Antimicrobial Secondary Metabolites

    PubMed Central

    Stella, Nicholas A.; Lahr, Roni M.; Brothers, Kimberly M.; Kalivoda, Eric J.; Hunt, Kristin M.; Kwak, Daniel H.; Liu, Xinyu

    2015-01-01

    ABSTRACT Serratia marcescens generates secondary metabolites and secreted enzymes, and it causes hospital infections and community-acquired ocular infections. Previous studies identified cyclic AMP (cAMP) receptor protein (CRP) as an indirect inhibitor of antimicrobial secondary metabolites. Here, we identified a putative two-component regulator that suppressed crp mutant phenotypes. Evidence supports that the putative response regulator eepR was directly transcriptionally inhibited by cAMP-CRP. EepR and the putative sensor kinase EepS were necessary for the biosynthesis of secondary metabolites, including prodigiosin- and serratamolide-dependent phenotypes, swarming motility, and hemolysis. Recombinant EepR bound to the prodigiosin and serratamolide promoters in vitro. Together, these data introduce a novel regulator of secondary metabolites that directly connects the broadly conserved metabolism regulator CRP with biosynthetic genes that may contribute to competition with other microbes. IMPORTANCE This study identifies a new transcription factor that is directly controlled by a broadly conserved transcription factor, CRP. CRP is well studied in its role to help bacteria respond to the amount of nutrients in their environment. The new transcription factor EepR is essential for the bacterium Serratia marcescens to produce two biologically active compounds, prodigiosin and serratamolide. These two compounds are antimicrobial and may allow S. marcescens to compete for limited nutrients with other microorganisms. Results from this study tie together the CRP environmental nutrient sensor with a new regulator of antimicrobial compounds. Beyond microbial ecology, prodigiosin and serratamolide have therapeutic potential; therefore, understanding their regulation is important for both applied and basic science. PMID:25897029

  11. Cellular regulation of basal and FSH-stimulated cyclic AMP production in irradiated rat testes

    SciTech Connect

    Kangasniemi, M.; Kaipia, A.; Toppari, J.; Mali, P.; Huhtaniemi, I.; Parvinen, M. )

    1990-05-01

    Basal and follicle-stimulating hormone (FSH)-stimulated cyclic AMP (cAMP) productions by seminiferous tubular segments from irradiated adult rats were investigated at defined stages of the epithelial cycle when specific spermatogenic cells were low in number. Seven days post-irradiation, depletion of spermatogonia did not influence the basal cAMP production, but FSH response increased in stages II-VIII. Seventeen days post-irradiation when spermatocytes were low in number, there was a small increase in basal cAMP level in stages VII-VIII and FSH-stimulated cAMP production increased in stages VII-XII and XIII-I. At 38 days when pachytene spermatocytes and round spermatids (steps 1-6) were low in number, a decreased basal cAMP production was measured in stages II-VI and IX-XII. FSH-stimulated cAMP output increased in stages VII-XII but decreased in stages II-VI. At 52 days when all spermatids were low in number, basal cAMP levels decreased in all stages of the cycle, whereas FSH response was elevated only in stages VII-XII. All spermatogenic cell types seem to have an effect on cAMP production by the seminiferous tubule in a stage-specific fashion. Germ cells appear to regulate Sertoli cell FSH response in a paracrine way, and a part of cAMP may originate from spermatids stimulated by an unknown FSH-dependent Sertoli cell factor. The FSH-dependent functions may control such phenomena as spermatogonial proliferation, final maturation of spermatids, and onset of meiosis.

  12. Cyclic AMP Receptor Protein Regulates Pheromone-Mediated Bioluminescence at Multiple Levels in Vibrio fischeri ES114

    PubMed Central

    Lyell, Noreen L.; Colton, Deanna M.; Bose, Jeffrey L.; Tumen-Velasquez, Melissa P.; Kimbrough, John H.

    2013-01-01

    Bioluminescence in Vibrio fischeri ES114 is activated by autoinducer pheromones, and this regulation serves as a model for bacterial cell-cell signaling. As in other bacteria, pheromone concentration increases with cell density; however, pheromone synthesis and perception are also modulated in response to environmental stimuli. Previous studies suggested that expression of the pheromone-dependent bioluminescence activator LuxR is regulated in response to glucose by cyclic AMP (cAMP) receptor protein (CRP) (P. V. Dunlap and E. P. Greenberg, J. Bacteriol. 164:4550, 1985; P. V. Dunlap and E. P. Greenberg, J. Bacteriol. 170:40404046, 1988; P. V. Dunlap, J. Bacteriol. 171:11991202, 1989; and W. F. Friedrich and E. P. Greenberg, Arch. Microbiol. 134:8791, 1983). Consistent with this model, we found that bioluminescence in V. fischeri ES114 is modulated by glucose and stimulated by cAMP. In addition, a ?crp mutant was ?100-fold dimmer than ES114 and did not increase luminescence in response to added cAMP, even though cells lacking crp were still metabolically capable of producing luminescence. We further discovered that CRP regulates not only luxR but also the alternative pheromone synthase gene ainS. We found that His-tagged V. fischeri CRP could bind sequences upstream of both luxR and ainS, supporting bioinformatic predictions of direct regulation at both promoters. Luminescence increased in response to cAMP if either the ainS or luxR system was under native regulation, suggesting cAMP-CRP significantly increases luminescence through both systems. Finally, using transcriptional reporters in transgenic Escherichia coli, we elucidated two additional regulatory connections. First, LuxR-independent basal transcription of the luxI promoter was enhanced by CRP. Second, the effect of CRP on the ainS promoter depended on whether the V. fischeri regulatory gene litR was also introduced. These results suggest an integral role for CRP in pheromone signaling that goes beyond sensing cell density. PMID:23995643

  13. Effect of Electrical Stimulation on Beta-Adrenergic Receptor Population and Cyclic AMP Production in Chicken and Rat Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Strietzel, Catherine J.

    2000-01-01

    Expression of the beta-adrenergic receptor (PAR) and its coupling to Adenosine 3'5' Cyclic Monophosphate (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the PAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture, were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the PAR population was not significantly affected by electrical stimulation; however, the ability, of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the PAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  14. Interaction of prostaglandins E1 and E2 in regulation of cyclic-AMP and aggregation in human platelets: evidence for a common prostaglandin receptor.

    PubMed

    McDonald, J W; Stuart, R K

    1974-07-01

    The effects of (PGE) prostaglandins E1 and E2 on the aggregation and release reaction induced in human platelets by ADP have been investigated. Measurements of cyclic-AMP content in (PRP) platelet-rich plasma were made concurrently. Although both PGE1 and PGE2 independently increased platelet cyclic-AMP and inhibited 1st phase ADP-induced aggregation (order of potency, PGE1 PGE2), the effect of a fixed concentration of PGE2 in the presence of PGE1 varied. At low PGE1 concentrations, the effects were additive, but at higher PGE1 concentrations PGE2 lowered the efficacy of PGE1. These results suggest that PGE2 may be a "partial agonist" of PGE1. PGE2 enhanced and PGE1 inhibited the 2nd phase of ADP-induced aggregation and the release of serotonin by a mechanism which appeared to be independent of cyclic-AMP content. A mixture of the 2 PGs produced responses intermediate between those observed with each PG independently. Binding of PGE1-3H to platelets was demonstrated in PRP and in concentrated platelet suspensions. PGE1 and PGE2 inhibited binding in a simular manner. It is proposed that PGE1 and PGE2 compete for a common receptor on the platelet membrane. PMID:4365532

  15. Cyclic AMP-dependent protein kinase interferes with GTP. gamma. S stimulated IP sub 3 formation in differentiated HL-60 cell membranes

    SciTech Connect

    Misaki, Naoyuki; Imaizumi, Taro; Watanabe, Yashuiro )

    1989-01-01

    The effects of addition of activated cyclic AMP-dependent protein kinase (PKA) on the function of islet-activating protein (IAP)-sensitive GTP-binding (G) protein were studied in the plasma membranes of {sup 3}H-inositol-labeled differentiated human leukemic (HL-60) cells. Pretreatment of the membranes with activated PKA in the presence of MgATP for 15 min. at 37{degree}C decreased GTP {gamma}S-stimulated inositol trisphosphate (IP{sub 3}) formation by about 30%, but had no influence on Ca{sup 2+}-stimulated IP{sub 3} formation. And autoradiography in the phosphorylation experiments of solubilized HL-60 cell membranes by PKA showed some {sup 32}P incorporated bands, and among them one of the major bands showed the migration at 40 kDa supporting that the G protein coupling with PI response was phosphorylated by PKA. These results showed that pretreatment with activated PKA inhibited the mediating function of the G protein between the fMLP receptor and phospholipase C by its phosphorylation.

  16. A novel cyclic AMP metabolism exhibited by giant cells and its possible role in the sexual development of Dictyostelium discoideum.

    PubMed

    Abe, K; Orii, H; Okada, Y; Saga, Y; Yanagisawa, K

    1984-08-01

    In Dictyostelium discoideum cyclic AMP (cAMP) metabolism during macrocyst development, i.e., the sexual cycle of this organism, and in giant cells, i.e., fusion products from opposite mating-type cells, was investigated. The pattern of change in cAMP levels during macrocyst development differed considerably from that observed during fruiting-body formation, i.e., the asexual cycle. Giant cells produced and excreted considerable amounts of cAMP. Adenylate cyclase activity catalyzing cAMP production in giant cells was comparable to that of unfused cells. However, the activity of membrane-bound phosphodiesterase in giant cells was extremely low, and no extracellular phosphodiesterase was excreted. A phosphodiesterase inhibitory protein was secreted in excess by giant cells. PMID:6086430

  17. Rab11, but not Rab4, facilitates cyclic AMP- and tauroursodeoxycholate-induced MRP2 translocation to the plasma membrane

    PubMed Central

    Park, Se Won; Schonhoff, Christopher M.; Webster, Cynthia R. L.

    2014-01-01

    Rab proteins (Ras homologous for brain) play an important role in vesicle trafficking. Rab4 and Rab11 are involved in vesicular trafficking to the plasma membrane from early endosomes and recycling endosomes, respectively. Tauroursodeoxycholate (TUDC) and cAMP increase bile formation, in part, by increasing plasma membrane localization of multidrug resistance-associated protein 2 (MRP2). The goal of the present study was to determine the role of these Rab proteins in the trafficking of MRP2 by testing the hypothesis that Rab11 and/or Rab4 facilitate cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. Studies were conducted in HuH-NTCP cells (HuH7 cells stably transfected with human NTCP), which constitutively express MRP2. HuH-NTCP cells were transfected with Rab11-WT and GDP-locked dominant inactive Rab11-GDP or with Rab4-GDP to study the role of Rab11 and Rab4. A biotinylation method and a GTP overlay assay were used to determine plasma membrane MRP2 and activation of Rab proteins (Rab11 and Rab4), respectively. Cyclic AMP and TUDC increased plasma membrane MRP2 and stimulated Rab11 activity. Plasma membrane translocation of MRP2 by cAMP and TUDC was increased and inhibited in cells transfected with Rab11-WT and Rab11-GDP, respectively. Cyclic AMP (previous study) and TUDC increased Rab4 activity. However, cAMP- and TUDC-induced increases in MRP2 were not inhibited by Rab4-GDP. Taken together, these results suggest that Rab11 is involved in cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. PMID:25190474

  18. Rab11, but not Rab4, facilitates cyclic AMP- and tauroursodeoxycholate-induced MRP2 translocation to the plasma membrane.

    PubMed

    Park, Se Won; Schonhoff, Christopher M; Webster, Cynthia R L; Anwer, M Sawkat

    2014-10-15

    Rab proteins (Ras homologous for brain) play an important role in vesicle trafficking. Rab4 and Rab11 are involved in vesicular trafficking to the plasma membrane from early endosomes and recycling endosomes, respectively. Tauroursodeoxycholate (TUDC) and cAMP increase bile formation, in part, by increasing plasma membrane localization of multidrug resistance-associated protein 2 (MRP2). The goal of the present study was to determine the role of these Rab proteins in the trafficking of MRP2 by testing the hypothesis that Rab11 and/or Rab4 facilitate cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. Studies were conducted in HuH-NTCP cells (HuH7 cells stably transfected with human NTCP), which constitutively express MRP2. HuH-NTCP cells were transfected with Rab11-WT and GDP-locked dominant inactive Rab11-GDP or with Rab4-GDP to study the role of Rab11 and Rab4. A biotinylation method and a GTP overlay assay were used to determine plasma membrane MRP2 and activation of Rab proteins (Rab11 and Rab4), respectively. Cyclic AMP and TUDC increased plasma membrane MRP2 and stimulated Rab11 activity. Plasma membrane translocation of MRP2 by cAMP and TUDC was increased and inhibited in cells transfected with Rab11-WT and Rab11-GDP, respectively. Cyclic AMP (previous study) and TUDC increased Rab4 activity. However, cAMP- and TUDC-induced increases in MRP2 were not inhibited by Rab4-GDP. Taken together, these results suggest that Rab11 is involved in cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. PMID:25190474

  19. Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887

    NASA Technical Reports Server (NTRS)

    Mednieks, Maija I.; Popova, Irina A.; Grindeland, Richard E.

    1991-01-01

    The cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 is determined. Photoaffinity labeling of soluble and particular cell fractions with a (32P)-8-azido analog of cyclic AMP is followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. It is shown that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins exhibited some variability in tissues of individual animals, but showed no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. It is inferred that the cardiac cell integrity or its protein content is not compromised under flight conditions.

  20. Acute morphine alters GABAergic transmission in the central amygdala during naloxone-precipitated morphine withdrawal: role of cyclic AMP

    PubMed Central

    Bajo, Michal; Madamba, Samuel G.; Roberto, Marisa; Siggins, George R.

    2014-01-01

    The central amygdala (CeA) plays an important role in opioid addiction. Therefore, we examined the effects of naloxone-precipitated morphine withdrawal (WD) on GABAergic transmission in rat CeA neurons using whole-cell recordings with naloxone in the bath. The basal frequency of miniature inhibitory postsynaptic currents (mIPSCs) increased in CeA neurons from WD compared to placebo rats. Acute morphine (10 μ M) had mixed effects (≥20% change from baseline) on mIPSCs in placebo and WD rats. In most CeA neurons (64%) from placebo rats, morphine significantly decreased mIPSC frequency and amplitude. In 32% of placebo neurons, morphine significantly increased mIPSC amplitudes but had no effect on mIPSC frequency. In WD rats, acute morphine significantly increased mIPSC frequency but had no effect on mIPSC amplitude in 41% of CeA neurons. In 45% of cells, acute morphine significantly decreased mIPSC frequency and amplitude. Pre-treatment with the cyclic AMP inhibitor (R)-adenosine, cyclic 3',5'-(hydrogenphosphorothioate) triethylammonium (RP), prevented acute morphine-induced potentiation of mIPSCs. Pre-treatment of slices with the Gi/o G-protein subunit inhibitor pertussis toxin (PTX) did not prevent the acute morphine-induced enhancement or inhibition of mIPSCs. PTX and RP decreased basal mIPSC frequencies and amplitudes only in WD rats. The results suggest that inhibition of GABAergic transmission in the CeA by acute morphine is mediated by PTX-insensitive mechanisms, although PTX-sensitive mechanisms cannot be ruled out for non-morphine responsive cells; by contrast, potentiation of GABAergic transmission is mediated by activated cAMP signaling that also mediates the increased basal GABAergic transmission in WD rats. Our data indicate that during the acute phase of WD, the CeA opioid and GABAergic systems undergo neuroadaptative changes conditioned by a previous chronic morphine exposure and dependence. PMID:24926240

  1. Complex transcriptional control of the sigma s-dependent stationary-phase-induced and osmotically regulated osmY (csi-5) gene suggests novel roles for Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex, and integration host factor in the stationary-phase response of Escherichia coli.

    PubMed Central

    Lange, R; Barth, M; Hengge-Aronis, R

    1993-01-01

    osmY (csi-5) is a representative of a large group of sigma s-dependent genes in Escherichia coli that exhibit both stationary-phase induction and osmotic regulation. A chromosomal transcriptional lacZ fusion (csi-5::lacZ) was used to study the regulation of osmY. We show here that in addition to sigma s, the global regulators Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex (cAMP-CRP), and integration host factor (IHF) are involved in the control of osmY. All three regulators negatively modulate the expression of osmY, and they act independently from sigma s. Stationary-phase induction of osmY in minimal medium can be explained by stimulation by sigma s combined with a relief of Lrp repression. Stationary-phase induction of osmY in rich medium is mediated by the combined action of sigma s, Lrp, cAMP-CRP, and IHF, with the latter three proteins acting as transition state regulators. The transcriptional start site of osmY was determined and revealed an mRNA with an unusual long nontranslated leader of 244 nucleotides. The regulatory region is characterized by a sigma 70-like -10 promoter region and contains potential binding sites for Lrp, CRP, and IHF. Whereas sigma s, Lrp, CRP, and IHF are clearly involved in stationary-phase induction, none of these regulators is essential for osmotic regulation of osmY. Images PMID:8253679

  2. A stereochemical investigation of the hydrolysis of cyclic AMP and the (Sp)-and (Rp)-diastereoisomers of adenosine cyclic 3':5'-phosphorothioate by bovine heart and baker's-yeast cyclic AMP phosphodiesterases.

    PubMed Central

    Jarvest, R L; Lowe, G; Baraniak, J; Stec, W J

    1982-01-01

    Bovine heart cyclic AMP phosphodiesterase, which has a requirement for Mg2+, hydrolyses cyclic AMP with inversion of configuration at the phosphorus atom, but only the (Sp)-diastereoisomer of adenosine cyclic 3':5'-phosphorothioate is hydrolysed by this enzyme. By contrast, the low-affinity yeast cyclic AMP phosphodiesterase, which contains tightly bound Zn2+, hydrolyses both the (Sp)- and the (Rp)-diastereoisomers of adenosine cyclic 3':5'-phosphorothioate, the (Rp)-diastereoisomer being the preferred substrate under V max. conditions. Both of the diastereoisomers of adenosine cyclic 3':5'-phosphorothioate, as well as cyclic AMP, are hydrolysed with inversion of configuration at the phosphorus atom by the yeast enzyme. It is proposed that, with both enzymes, the bivalent metal ion co-ordinates with the phosphate residue of the substrate, and that hydrolysis is catalysed by a direct "in-line' mechanism. PMID:6288001

  3. Inhibitors of cyclic AMP phosphodiesterase. 2. Structural variations of N-cyclohexyl-N-methyl-4-[(1,2,3,5-tetrahydro- 2-oxoimidazo[2,1-b]quinazolin-7-yl)-oxy]butyramide (RS-82856).

    PubMed

    Venuti, M C; Jones, G H; Alvarez, R; Bruno, J J

    1987-02-01

    A series of analogues of the cyclic AMP phosphodiesterase (PDE) inhibitor N-cyclohexyl-N-methyl-4-[(1,2,3,5-tetrahydro- 2-oxoimidazo[2,1-b]quinazolin-7-yl)oxy]butyramide (RS-82856, 1) was prepared by systematic variation of the side-chain substituent, length, position, connecting atom, and the parent heterocycle itself. The compounds were evaluated as inhibitors of cyclic AMP phosphodiesterase from both human platelets and rat or dog heart tissue and as inhibitors of ADP-induced platelet aggregation. Structure-activity correlations for the analogue series revealed significant limitations on the steric bulk of substituents on the 1,2,3,5-tetrahydroimidazo[2,1-b]quinazolin-2-one heterocycle and the position and length of the side chain. As inhibitors of cyclic AMP phosphodiesterase (PDE), potency steadily increased with increasingly lipophilic side chains. In platelet aggregation inhibition studies, however, a maximum in activity was reached with 1, while more lipophilic compounds were significantly less active. Major changes in the heterocycle itself, represented by isomeric and other carbonyl variations, also decreased activity. The molecular features defined by this series of analogues of 1 correlate to a high degree with current understanding of the chemical and topographical requirements of the active site of the FIII (type IV) form of cyclic AMP PDE. Selective inhibition of this enzyme has been proposed as the principal component of the positive inotropic action of a number of cardiotonic agents. PMID:3027339

  4. 19F-n.m.r. studies of ligand binding to 5-fluorotryptophan- and 3-fluorotyrosine-containing cyclic AMP receptor protein from Escherichia coli.

    PubMed Central

    Sixl, F; King, R W; Bracken, M; Feeney, J

    1990-01-01

    Two fluorine-containing analogues of the cyclic AMP receptor protein (CRP) from Escherichia coli were prepared by biosynthetic incorporation of 5-fluorotryptophan (5-F-Trp) and 3-fluorotyrosine (3-F-Tyr). The 19F-n.m.r. spectrum of the [5-F-Trp]CRP showed two signals corresponding to the two tryptophan residues, and that of the [3-F-Tyr]CRP showed six signals (two overlapping) corresponding to the six tyrosine residues: these results are as expected for a symmetrical dimer. A comparison of the 19F-n.m.r. spectra of the CRP analogues in the presence and in the absence of cyclic AMP reveals that the chemical shifts of both tryptophan residues and of two of the six tyrosine residues show differences. Since none of these residues is in direct contact with the bound nucleotide (although Trp-85 is fairly close), these shift changes must arise from induced conformational effects. The 19F-n.m.r. spectra of complexes with cyclic GMP showed chemical-shift perturbations different from those caused by cyclic AMP, indicating that different conformational changes are induced by the binding of cyclic GMP. The 19F-n.m.r. spectrum of the complex of [3-F-Tyr]CRP with tubercidin 3',5'-(cyclic)monophosphate (which can activate transcription) showed essentially the same chemical-shift changes as seen for the cyclic AMP complex, indicating that similar conformational changes have been induced by the nucleotide binding. [3-F-Tyr]CRP in the presence of an equimolar amount of the 20 bp self-complementary DNA oligomer 5'-AATGTGAGTTAACTCACATT-3' and excess cyclic AMP gave an 19F-n.m.r. spectrum that was almost identical with that for the [3-F-Tyr]CRP-cyclic AMP complex, indicating that the binding of DNA does not induce significant conformational changes involving the tyrosine residues. Proteolysis of [3-F-Tyr]CRP with chymotrypsin produced a 31 kDa fragment that is a dimer containing the cyclic AMP-binding domain. This fragment contains five of the six tyrosine residues, and its 19F-n.m.r. chemical shifts were essentially the same as those of the intact protein except for one missing signal (signal F): this signal could be assigned to Tyr-206 and shown to be unperturbed by the binding of cyclic nucleotide to the intact [3-F-Tyr]CRP. The similarity of the 19F-n.m.r. chemical shifts in the alpha-fragment and the intact CRP indicates that the alpha-fragment retains the same structure as found in the intact protein.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2156500

  5. Oscillator control of cell division in Euglena: cyclic AMP oscillations mediate the phasing of the cell division cycle by the circadian clock.

    PubMed

    Carr, I A; Edmunds, L N

    1993-04-01

    The achlorophyllous ZC strain of Euglena gracilis exhibits a circadian rhythm of cell division in constant darkness (DD). Mitosis occurs during a restricted part of the circadian cycle, corresponding to the dark intervals in a light-dark cycle comprising 12 h of light and 12 h of darkness. We have demonstrated that division-phased cultures also exhibit bimodal, circadian changes of cyclic AMP level. Maximum cyclic AMP levels occurred at the beginning of the light period (CT (circadian time) 00-02), and at the beginning of darkness (CT 12-14). These variations persisted in cultures that had been transferred into DD and appeared to be under the control of the circadian oscillator rather than to be cell division cycle (CDC)-dependent, since they continued in cultures that had reached the stationary phase of growth. In the experiments reported in this paper, we tested for the possible role of this periodic cyclic AMP signal in the generation of cell division rhythmicity by examining the effects of exogenous cyclic AMP signals and of forskolin, which permanently increased the cyclic AMP level, on the cell division rhythm. Perturbations of the cyclic AMP oscillation by exogenous cyclic AMP resulted in the temporary uncoupling of the CDC from the circadian timer. The addition of cyclic AMP during the subjective day resulted in delays (up to 9 h) of the next synchronous division step. In contrast, mitosis was stimulated when cyclic AMP was administered in the middle of the subjective night. Measurement of the DNA content of cells by flow cytometry indicated that cyclic AMP injected at CT 06-08 delayed progression through S phase, and perhaps also through mitosis. When added at CT 18-20, cyclic AMP accelerated the G2/M transition. The circadian oscillator was not perturbed by the addition of exogenous cyclic AMP: the division rhythm soon returned to its original phase. On the other hand, the permanent elevation of cyclic AMP levels in the presence of forskolin induced a rapid loss of cell division rhythmicity. These findings are consistent with the hypothesis that cyclic AMP acts downstream from the oscillator and that the cyclic AMP oscillation is an essential component of the signaling pathway for the control of the CDC by the circadian oscillator. The receptors for cyclic AMP in Euglena have been shown to be two cyclic AMP-dependent kinases (cPKA and cPKB). Pharmacological studies using cyclic AMP analogs suggested that cPKA mediates cyclic AMP effects during the subjective day, and cPKB during the subjective night.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:8391014

  6. The myriad roles of cyclic AMP in microbial pathogens, from signal to sword

    PubMed Central

    McDonough, Kathleen A.; Rodriguez, Ana

    2013-01-01

    All organisms must sense and respond to their external environments, and this signal transduction is often done with second messengers such as cyclic nucleotides. Adenosine 3'5'-cyclic AMP is a universal second messenger that is used by diverse forms of life, including mammals, fungi, protozoa and bacteria. In this review, we discuss the many roles of cAMP in bacterial, fungal and protozoan pathogens and its contributions to microbial pathogenesis. These include coordination of intracellular processes such as virulence gene expression with extracellular signals from the host environment, and manipulation of host immunity by increasing cAMP levels in host cells during infection. PMID:22080930

  7. Regulation of hippocampus-dependent memory by cyclic AMP-dependent protein kinase

    PubMed Central

    Abel, Ted; Nguyen, Peter V.

    2010-01-01

    The hippocampus is crucial for the consolidation of new declarative long-term memories. Genetic and behavioral experimentation have revealed that several protein kinases are critical for the formation of hippocampus-dependent long-term memories. Cyclic-AMP dependent protein kinase (PKA) is a serinethreonine kinase that has been strongly implicated in the expression of specific forms of hippocampus-dependent memory. We review evidence that PKA is required for hippocampus-dependent memory in mammals, and we highlight some of the proteins that have been implicated as targets of PKA. Future directions and open questions regarding the role of PKA in memory storage are also described. PMID:18394470

  8. Mechanisms of cyclic AMP/protein kinase A- and glucocorticoid-mediated apoptosis using S49 lymphoma cells as a model system.

    PubMed

    Keshwani, Malik M; Kanter, Joan R; Ma, Yuliang; Wilderman, Andrea; Darshi, Manjula; Insel, Paul A; Taylor, Susan S

    2015-10-13

    Cyclic AMP/protein kinase A (cAMP/PKA) and glucocorticoids promote the death of many cell types, including cells of hematopoietic origin. In wild-type (WT) S49 T-lymphoma cells, signaling by cAMP and glucocorticoids converges on the induction of the proapoptotic B-cell lymphoma-family protein Bim to produce mitochondria-dependent apoptosis. Kin(-), a clonal variant of WT S49 cells, lacks PKA catalytic (PKA-C?) activity and is resistant to cAMP-mediated apoptosis. Using sorbitol density gradient fractionation, we show here that in kin(-) S49 cells PKA-C? is not only depleted but the residual PKA-C? mislocalizes to heavier cell fractions and is not phosphorylated at two conserved residues (Ser(338) or Thr(197)). In WT S49 cells, PKA-regulatory subunit I (RI) and Bim coimmunoprecipitate upon treatment with cAMP analogs and forskolin (which increases endogenous cAMP concentrations). By contrast, in kin(-) cells, expression of PKA-RI? and Bim is prominently decreased, and increases in cAMP do not increase Bim expression. Even so, kin(-) cells undergo apoptosis in response to treatment with the glucocorticoid dexamethasone (Dex). In WT cells, glucorticoid-mediated apoptosis involves an increase in Bim, but in kin(-) cells, Dex-promoted cell death appears to occur by a caspase 3-independent apoptosis-inducing factor pathway. Thus, although cAMP/PKA-C? and PKA-R1?/Bim mediate apoptotic cell death in WT S49 cells, kin(-) cells resist this response because of lower levels of PKA-C? and PKA-RI? subunits as well as Bim. The findings for Dex-promoted apoptosis imply that these lymphoma cells have adapted to selective pressure that promotes cell death by altering canonical signaling pathways. PMID:26417071

  9. Cyclic AMP Effectors in African Trypanosomes Revealed by Genome-Scale RNA Interference Library Screening for Resistance to the Phosphodiesterase Inhibitor CpdA

    PubMed Central

    Gould, Matthew K.; Bachmaier, Sabine; Ali, Juma A. M.; Alsford, Sam; Tagoe, Daniel N. A.; Munday, Jane C.; Schnaufer, Achim C.; Horn, David

    2013-01-01

    One of the most promising new targets for trypanocidal drugs to emerge in recent years is the cyclic AMP (cAMP) phosphodiesterase (PDE) activity encoded by TbrPDEB1 and TbrPDEB2. These genes were genetically confirmed as essential, and a high-affinity inhibitor, CpdA, displays potent antitrypanosomal activity. To identify effectors of the elevated cAMP levels resulting from CpdA action and, consequently, potential sites for adaptations giving resistance to PDE inhibitors, resistance to the drug was induced. Selection of mutagenized trypanosomes resulted in resistance to CpdA as well as cross-resistance to membrane-permeable cAMP analogues but not to currently used trypanocidal drugs. Resistance was not due to changes in cAMP levels or in PDEB genes. A second approach, a genome-wide RNA interference (RNAi) library screen, returned four genes giving resistance to CpdA upon knockdown. Validation by independent RNAi strategies confirmed resistance to CpdA and suggested a role for the identified cAMP Response Proteins (CARPs) in cAMP action. CARP1 is unique to kinetoplastid parasites and has predicted cyclic nucleotide binding-like domains, and RNAi repression resulted in >100-fold resistance. CARP2 and CARP4 are hypothetical conserved proteins associated with the eukaryotic flagellar proteome or with flagellar function, with an orthologue of CARP4 implicated in human disease. CARP3 is a hypothetical protein, unique to Trypanosoma. CARP1 to CARP4 likely represent components of a novel cAMP signaling pathway in the parasite. As cAMP metabolism is validated as a drug target in Trypanosoma brucei, cAMP effectors highly divergent from the mammalian host, such as CARP1, lend themselves to further pharmacological development. PMID:23877697

  10. REVIEW: Role of cyclic AMP signaling in the production and function of the incretin hormone glucagon-like peptide-1

    NASA Astrophysics Data System (ADS)

    Yu, Zhiwen; Jin, Tianru

    2008-01-01

    Pancreatic cells express the proglucagon gene (gcg) and thereby produce the peptide hormone glucagon, which stimulates hepatic glucose production and thereby increases blood glucose levels. The same gcg gene is also expressed in the intestinal endocrine L cells and certain neural cells in the brain. In the gut, gcg expression leads to the production of glucagon-like peptide-1 (GLP-1). This incretin hormone stimulates insulin secretion when blood glucose level is high. In addition, GLP-1 stimulates pancreatic cell proliferation, inhibits cell apoptosis, and has been utilized in the trans-differentiation of insulin producing cells. Today, a long-term effective GLP-1 receptor agonist has been developed as a drug in treating diabetes and potentially other metabolic disorders. Extensive investigations have shown that the expression of gcg and the production of GLP-1 can be activated by the elevation of the second messenger cyclic AMP (cAMP). Recent studies suggest that in addition to protein kinase A (PKA), exchange protein activated by cAMP (Epac), another effector of cAMP signaling, and the crosstalk between PKA and Wnt signaling pathway, are also involved in cAMP-stimulated gcg expression and GLP-1 production. Furthermore, functions of GLP-1 in pancreatic cells are mainly mediated by cAMP-PKA, cAMP-Epac and Wnt signaling pathways as well.

  11. Adenylyl cyclase-cyclicAMP signaling in mood disorders: Role of the crucial phosphorylating enzyme protein kinase A

    PubMed Central

    Dwivedi, Yogesh; Pandey, Ghanshyam N

    2008-01-01

    Mood disorders are among the most prevalent and recurrent forms of psychiatric illnesses. In the last decade, there has been increased understanding of the biological basis of mood disorders. In fact, novel mechanistic concepts of the neurobiology of unipolar and bipolar disorders are evolving based on recent pre-clinical and clinical studies, most of which now focus on the role of signal transduction mechanisms in these psychiatric illnesses. Particular investigative emphasis has been given to the role of phosphorylating enzymes, which are crucial in regulating gene expression and neuronal and synaptic plasticity. Among the most important phosphorylating enzyme is protein kinase A (PKA), a component of adenylyl cyclase–cyclic adenosine monophosphate (AC–cAMP) signaling system. In this review, we critically and comprehensively discuss the role of various components of AC–cAMP signaling in mood disorders, with a special focus on PKA, because of the interesting observation that have been made about its involvement in unipolar and bipolar disorders. We also discuss the functional significance of the findings regarding PKA by discussing the role of important PKA substrates, namely, Rap-1, cyclicAMP-response element binding protein, and brain-derived neurotrophic factor. These studies suggest the interesting possibility that PKA and related signaling molecules may serve as important neurobiological factors in mood disorders and may be relevant in target-specific therapeutic interventions for these disorders. PMID:18728821

  12. Capsaicin-induced ion fluxes increase cyclic GMP but not cyclic AMP levels in rat sensory neurones in culture.

    PubMed

    Wood, J N; Coote, P R; Minhas, A; Mullaney, I; McNeill, M; Burgess, G M

    1989-10-01

    Capsaicin, which induces fluxes of sodium, calcium, and potassium ions in a subset of both neonatal and adult rat dorsal root ganglion neurones, increased cyclic GMP (cGMP) levels by a factor of 20 (EC50 0.07 microM) to 10-20 pmol cGMP/mg protein in these cells. Cyclic AMP (cAMP) levels were unaffected. Nonneuronal cells derived from rat ganglia, and both neurones and nonneuronal cells from chick were unresponsive to capsaicin. Capsaicin-induced cGMP elevation in rat dorsal root ganglion (DRG) neurones was unaffected by pertussis toxin, lowered by compounds that block voltage-sensitive calcium channels, and was abolished by the removal of extracellular calcium. Calcium, guanidine, and rubidium fluxes were unaffected by treatment of DRG cells with sodium nitroprusside or dibutyryl cGMP. The cGMP response to capsaicin is thus a function of capsaicin-evoked calcium uptake through voltage-sensitive calcium channels. Elevated cGMP levels do not, however, contribute to capsaicin-evoked ion fluxes or to their desensitisation. PMID:2549199

  13. The TonB3 System in the Human Pathogen Vibrio vulnificus Is under the Control of the Global Regulators Lrp and Cyclic AMP Receptor Protein

    PubMed Central

    Crosa, Jorge H.

    2012-01-01

    TonB systems transduce the proton motive force of the cytoplasmic membrane to energize substrate transport through a specific TonB-dependent transporter across the outer membrane. Vibrio vulnificus, an opportunistic marine pathogen that can cause a fatal septicemic disease in humans and eels, possesses three TonB systems. While the TonB1 and TonB2 systems are iron regulated, the TonB3 system is induced when the bacterium grows in human serum. In this work we have determined the essential roles of the leucine-responsive protein (Lrp) and cyclic AMP (cAMP) receptor protein (CRP) in the transcriptional activation of this system. Whereas Lrp shows at least four very distinctive DNA binding regions spread out from position ?59 to ?509, cAMP-CRP binds exclusively in a region centered at position ?122.5 from the start point of the transcription. Our results suggest that both proteins bind simultaneously to the region closer to the RNA polymerase binding site. Importantly, we report that the TonB3 system is induced not only by serum but also during growth in minimal medium with glycerol as the sole carbon source and low concentrations of Casamino Acids. In addition to catabolite repression by glucose, l-leucine acts by inhibiting the binding of Lrp to the promoter region, hence preventing transcription of the TonB3 operon. Thus, this TonB system is under the direct control of two global regulators that can integrate different environmental signals (i.e., glucose starvation and the transition between feast and famine). These results shed light on new mechanisms of regulation for a TonB system that could be widespread in other organisms. PMID:22307757

  14. A Cyclic AMP Receptor Protein-Regulated Cell-Cell Communication System Mediates Expression of a FecA Homologue in Stenotrophomonas maltophilia?

    PubMed Central

    Huang, Tzu-Pi; Wong, Amy C. Lee

    2007-01-01

    Stenotrophomonas maltophilia WR-C possesses an rpf/diffusible signal factor (DSF) cell-cell communication system. It produces cis-?2-11-methyl-dodecenoic acid, a DSF, and seven structural derivatives, which require rpfF and rpfB for synthesis. Acquisition of iron from the environment is important for bacterial growth as well as the expression of virulence genes. We identified a gene homologous to fecA, which encodes a ferric citrate receptor that transports exogenous siderophore ferric citrate from the environment into the bacterial periplasm. Western blot analysis with anti-FecA-His6 antibody showed that the FecA homologue was induced in the iron-depleted medium supplemented with a low concentration of ferric citrate. Deletion of rpfF or rpfB resulted in reduced FecA expression compared to the wild type. Synthetic DSF restored FecA expression by the ?rpfF mutant to the wild-type level. Reverse transcription-PCR showed that the fecA transcript was decreased in the ?rpfF mutant compared to the wild type. These data suggest that DSF affected the level of fecA mRNA. Transposon inactivation of crp, which encodes cyclic AMP (cAMP) receptor protein (CRP) resulted in reduced FecA expression and rpfF transcript level. Putative CRP binding sites were located upstream of the rpfF promoter, indicating that the effect of CRP on FecA is through the rpf/DSF pathway and by directly controlling rpfF. We propose that CRP may serve as a checkpoint for iron uptake, protease activity, and hemolysis in response to environmental changes such as changes in concentrations of glucose, cAMP, iron, or DSF. PMID:17574998

  15. The TonB3 system in the human pathogen Vibrio vulnificus is under the control of the global regulators Lrp and cyclic AMP receptor protein.

    PubMed

    Alice, Alejandro F; Crosa, Jorge H

    2012-04-01

    TonB systems transduce the proton motive force of the cytoplasmic membrane to energize substrate transport through a specific TonB-dependent transporter across the outer membrane. Vibrio vulnificus, an opportunistic marine pathogen that can cause a fatal septicemic disease in humans and eels, possesses three TonB systems. While the TonB1 and TonB2 systems are iron regulated, the TonB3 system is induced when the bacterium grows in human serum. In this work we have determined the essential roles of the leucine-responsive protein (Lrp) and cyclic AMP (cAMP) receptor protein (CRP) in the transcriptional activation of this system. Whereas Lrp shows at least four very distinctive DNA binding regions spread out from position -59 to -509, cAMP-CRP binds exclusively in a region centered at position -122.5 from the start point of the transcription. Our results suggest that both proteins bind simultaneously to the region closer to the RNA polymerase binding site. Importantly, we report that the TonB3 system is induced not only by serum but also during growth in minimal medium with glycerol as the sole carbon source and low concentrations of Casamino Acids. In addition to catabolite repression by glucose, l-leucine acts by inhibiting the binding of Lrp to the promoter region, hence preventing transcription of the TonB3 operon. Thus, this TonB system is under the direct control of two global regulators that can integrate different environmental signals (i.e., glucose starvation and the transition between "feast" and "famine"). These results shed light on new mechanisms of regulation for a TonB system that could be widespread in other organisms. PMID:22307757

  16. Seventeen Sxy-Dependent Cyclic AMP Receptor Protein Site-Regulated Genes Are Needed for Natural Transformation in Haemophilus influenzae

    PubMed Central

    Mell, Joshua C.; Redfield, Rosemary J.

    2012-01-01

    Natural competence is the ability of bacteria to actively take up extracellular DNA. This DNA can recombine with the host chromosome, transforming the host cell and altering its genotype. In Haemophilus influenzae, natural competence is induced by energy starvation and the depletion of nucleotide pools. This induces a 26-gene competence regulon (Sxy-dependent cyclic AMP receptor protein [CRP-S] regulon) whose expression is controlled by two regulators, CRP and Sxy. The role of most of the CRP-S genes in DNA uptake and transformation is not known. We have therefore created in-frame deletions of each CRP-S gene and studied their competence phenotypes. All but one gene (ssb) could be deleted. Although none of the remaining CRP-S genes were required for growth in rich medium or survival under starvation conditions, DNA uptake and transformation were abolished or reduced in most of the mutants. Seventeen genes were absolutely required for transformation, with 14 of these genes being specifically required for the assembly and function of the type IV pilus DNA uptake machinery. Only five genes were dispensable for both competence and transformation. This is the first competence regulon for which all genes have been mutationally characterized. PMID:22821979

  17. Spiral waves of cyclic amp in a model of slime mold aggregation

    NASA Astrophysics Data System (ADS)

    Tyson, John J.; Alexander, Kevin A.; Manoranjan, V. S.; Murray, J. D.

    1989-01-01

    During the aggregation phase of their life cycle, Dictyostelium discoideum amoebae communicate with each other by traveling waves of cyclic AMP (cAMP). These waves often have the geometry of rotating spirals. We calculate the properties of these spiral waves, their rotation period, wavespeed, and shape, from a model of the synthesis and degradation of cAMP by Dictyostelium cells. Our model is based on kinetic rate laws developed by Martiel and Goldbeter to account for oscillations and signal relaying by Dictyostelium amoebae in well-stirred cell suspensions. We show that the model also describes in quantitative detail experimental observations of rotating spiral waves of cAMP in fields of amoebae distributed over an agar surface. Furthermore, our numerically calculated spiral waves agree quantitatively with the singular perturbation theory of rotating spirals developed by Keener and Tyson.

  18. Novel Mechanism Coupling Cyclic AMP-Protein Kinase A Signaling and Golgi Trafficking via Gyp1 Phosphorylation in Polarized Growth

    PubMed Central

    Wang, Haitao; Wang, Yan-Ming

    2014-01-01

    The cyclic AMP (cAMP)-protein kinase A (PKA) signaling activates virulence expression during hyphal development in the fungal human pathogen Candida albicans. The hyphal growth is characterized by Golgi polarization toward the hyphal tips, which is thought to enhance directional vesicle transport. However, how the hypha-induction signal regulates Golgi polarization is unknown. Gyp1, a Golgi-associated protein and the first GTPase-activating protein (GAP) in the Rab GAP cascade, critically regulates membrane trafficking from the endoplasmic reticulum to the plasma membrane. Here, we report a novel pathway by which the cAMP-PKA signaling triggers Golgi polarization during hyphal growth. We demonstrate that Gyp1 plays a crucial role in actin-dependent Golgi polarization. Hyphal induction activates PKA, which in turn phosphorylates Gyp1. Phosphomimetic mutation of four PKA sites identified by mass spectrometry (Gyp14E) caused strong Gyp1 polarization to hyphal tips, whereas nonphosphorylatable mutations (Gyp14A) abolished it. Gyp14E exhibited enhanced association with the actin motor Myo2, while Gyp14A showed the opposite effect, providing a possible mechanism for Golgi polarization. A GAP-dead Gyp1 (Gyp1R292K) showed strong polarization similar to that seen with Gyp14E, indicating a role for the GAP activity. Mutating the PKA sites on Gyp1 also impaired the recruitment of a late Golgi marker, Sec7. Furthermore, proper PKA phosphorylation and GAP activity of Gyp1 are required for virulence in mice. We propose that the cAMP-PKA signaling directly targets Gyp1 to promote Golgi polarization in the yeast-to-hypha transition, an event crucial for C. albicans infection. PMID:25326521

  19. Induction of germ-cell alkaline phosphatase by butyrate and cyclic AMP in BeWo choriocarcinoma cells.

    PubMed Central

    Telfer, J F; Green, C D

    1993-01-01

    BeWo choriocarcinoma cells synthesize two alkaline phosphatase isoenzymes: germ-cell alkaline phosphatase and tissue-unspecific alkaline phosphatase. We have made use of the differential heat-stabilities of these two isoenzymes to study the induction of germ-cell alkaline phosphatase by sodium butyrate and cyclic AMP (cAMP). Sodium butyrate causes a large induction of germ-cell alkaline phosphatase activity (approx. 35-fold after 96 h) after an initial lag period of 12-24 h. We showed that butyrate increases germ-cell alkaline phosphatase mRNA. Dibutyryl cAMP also induces germ cell alkaline phosphatase (approx. 2.5-fold after 96 h). When optimal concentrations of butyrate and dibutyryl cAMP were added simultaneously to cells, they caused a synergistic induction of activity. This suggested that these compounds use separate mechanisms to induce germ-cell alkaline phosphatase activity and that it is the cAMP moiety of dibutyryl cAMP that induces enzyme activity. This was confirmed by the use of two additional cAMP analogues, 8-(4-chlorophenylthio) cAMP and 8-bromo cAMP, and of two compounds, 3-methyl-1-isobutylxanthine and cholera toxin, which raise the endogenous concentration of cAMP. All four compounds caused a 2-fold increase in enzyme activity. Treatment of cells with 8-(4-chlorophenylthio) cAMP, 8-bromo cAMP and cholera toxin increased germ-cell alkaline phosphatase mRNA between 2- and 7-fold. These data suggest that this alkaline phosphatase isoenzyme is regulated at the level of its mRNA by cAMP, in a manner distinct from that of butyrate. Images Figure 2 Figure 5 PMID:7504459

  20. Cyclic AMP Stimulates SF-1-Dependent CYP11A1 Expression through Homeodomain-Interacting Protein Kinase 3-Mediated Jun N-Terminal Kinase and c-Jun Phosphorylation?

    PubMed Central

    Lan, Hsin-Chieh; Li, Hua-Jung; Lin, Guang; Lai, Pao-Yen; Chung, Bon-chu

    2007-01-01

    Steroids are synthesized in adrenal glands and gonads under the control of pituitary peptides. These peptides bind to cell surface receptors to activate the cyclic AMP (cAMP) signaling pathway leading to an increase of steroidogenic gene expression. Exactly how cAMP activates steroidogenic gene expression is not clear, except for the knowledge that transcription factor SF-1 plays a key role. Investigating the factors participating in SF-1 action, we found that c-Jun and homeodomain-interacting protein kinase 3 (HIPK3) were required for basal and cAMP-stimulated expression of one major steroidogenic gene, CYP11A1. HIPK3 enhanced SF-1 activity, and c-Jun was required for the functional interaction of HIPK3 with SF-1. Furthermore, after cAMP stimulation, both c-Jun and Jun N-terminal kinase (JNK) were phosphorylated through HIPK3. These phosphorylations were important for SF-1 activity and CYP11A1 expression. Thus, we have defined HIPK3-mediated JNK activity and c-Jun phosphorylation as important events that increase SF-1 activity for CYP11A1 transcription in response to cAMP. This finding has linked three common factors, HIPK3, JNK, and c-Jun, to the cAMP signaling pathway leading to increased steroidogenic gene expression. PMID:17210646

  1. Insulin and IGF-I stimulated RNA synthesis in primary cultures of neuronal cells: involvement of cyclic AMP and protein kinase-C.

    PubMed

    Cortizo, A M; van Arnaldo, J; Burgess, S K; Espinal, J

    1991-01-01

    Insulin and insulin-like growth factor I promote the growth of rat neuronal cells in primary culture. In order to investigate the mechanism of hormone signalling in this biological system, we studied the effect of cyclic AMP agonists and a protein kinase C stimulator on basal and hormone-induced RNA synthesis. Agents elevating endogenous cyclic AMP levels (forskolin, dibutyryl cyclic AMP, cholera toxin) blocked the stimulatory effects of both insulin and the growth factor; dibutyryl cyclic AMP, however, altered the binding of neither hormone. Although, unlike the aforementioned agents, phorbol ester significantly elevated basal RNA synthesis; it nevertheless inhibited the stimulation by insulin; this latter effect probably being mediated by an increase in intracellular cyclic AMP levels, as has been found in other cell types. Staurosporine, an inhibitor of protein kinase C, also blocked the effects of insulin on RNA synthesis. PMID:1726909

  2. Ethanol increases receptor-dependent cyclic AMP production in cultured hepatocytes by decreasing G(i)-mediated inhibition.

    PubMed Central

    Nagy, L E; DeSilva, S E

    1992-01-01

    Increasing evidence suggests that ethanol-induced changes in cyclic AMP (cAMP) signal transduction play a critical role in the acute and chronic effects of ethanol. Here we have investigated the effects of ethanol on cAMP signal transduction in primary cultures of rat hepatocytes. Acute exposure to ethanol had a biphasic effect on glucagon-receptor-dependent cAMP production in intact cells: 25-50 mM-ethanol decreased cAMP, whereas treatment with 100-200 mM-ethanol increased cAMP. After chronic exposure to 50-200 mM-ethanol for 48 h in culture, glucagon-receptor-dependent cAMP levels were increased, but no change in glucagon receptor number was observed. These effects of ethanol were independent of ethanol oxidation. Chronic ethanol treatment also increased adenosine-receptor- and forskolin-stimulated cAMP production. Increased cAMP production was also observed upon stimulation of adenylate cyclase with glucagon, forskolin and F- in membranes isolated from cells cultured with 100 mM-ethanol for 48 h. However, no differences were observed in basal and MnCl2-stimulated adenylate cyclase activity. The quantity of alpha i protein was decreased by 35% after chronic ethanol treatment, but no change in the quantity of alpha s protein was detected. Decreased alpha i protein was associated with a decrease in G(i) function, as assessed by the ability of 0.1 nM-guanosine 5'-[beta gamma-imido]triphosphate and 1 microM-somatostatin to inhibit forskolin-stimulated adenylate cyclase activity. Taken together, these results suggest that chronic exposure to ethanol increases receptor-dependent cAMP production in hepatocytes by decreasing the quantity of alpha i protein at the plasma membrane and thereby decreasing the inhibitory effects of G(i) on adenylate cyclase activity. Images Fig. 4. PMID:1358061

  3. Differential sensitivity to cardiotonic drugs of cyclic AMP phosphodiesterases isolated from canine ventricular and sinoatrial-enriched tissues.

    PubMed

    Komas, N; Lugnier, C; Le Bec, A; Serradeil-Le Gal, C; Barthlmy, G; Stoclet, J C

    1989-08-01

    A cardiac phosphodiesterase (PDE) which specifically hydrolyzes cAMP and is inhibited by cyclic GMP has been suggested to be the site of action of new cardiotonic drugs. To investigate the effect of inhibitors, canine cyclic nucleotide PDEs were isolated from left ventricle and from sinoatrial node-enriched tissue, using identical techniques. Four PDE forms could be chromatographically resolved from each tissue, including a peak I PDE (calmodulin-activated phosphodiesterase, CaM-PDE), a peak II PDE (cyclic GMP-stimulated phosphodiesterase, CGS-PDE) and a peak III PDE (specific for cyclic AMP). The latter was further fractionated into two forms: One was inhibited by cyclic GMP and by the platelet antiaggregant AAL 05 (CGI-PDE), and the second was insensitive to cyclic GMP and was inhibited by rolipram (ROI-PDE). Reference PDE inhibitors, isobutyl-1-methylxanthine (IBMX) and papaverine, nonselectively inhibited the four forms isolated from the two tissues. Cardiotonic drugs (CI 930, LY 181512, piroximone, enoximone, and SK&F 94120) selectively inhibited CGI-PDE from ventricular tissue but were poorly active on both CGI-PDE and ROI-PDE from the sinoatrial-enriched fraction. In contrast, milrinone inhibited CGI-PDEs and ROI-PDEs from both ventricular and sinoatrial tissues. These results are in good agreement with pharmacologic data in the literature on the positive chronotropic and inotropic effects of the studied drugs in the dog. They provide a possible basis for the dissociation of these two properties of PDE inhibitors. PMID:2476593

  4. Cross Talk between the Cell Wall Integrity and Cyclic AMP/Protein Kinase A Pathways in Cryptococcus neoformans

    PubMed Central

    Donlin, Maureen J.; Upadhya, Rajendra; Gerik, Kimberly J.; Lam, Woei; VanArendonk, Laura G.; Specht, Charles A.; Sharma, Neil K.

    2014-01-01

    ABSTRACT Cryptococcus neoformansis a fungal pathogen of immunocompromised people that causes fatal meningitis. The fungal cell wall is essential to viability and pathogenesis of C.neoformans, and biosynthesis and repair of the wall is primarily controlled by the cell wall integrity (CWI) signaling pathway. Previous work has shown that deletion of genes encoding the four major kinases in the CWI signaling pathway, namely, PKC1, BCK1, MKK2, and MPK1 results in severe cell wall phenotypes, sensitivity to a variety of cell wall stressors, and for Mpk1, reduced virulence in a mouse model. Here, we examined the global transcriptional responses to gene deletions of BCK1, MKK2, and MPK1 compared to wild-type cells. We found that over 1,000 genes were differentially expressed in one or more of the deletion strains, with 115 genes differentially expressed in all three strains, many of which have been identified as genes regulated by the cyclic AMP (cAMP)/protein kinase A (PKA) pathway. Biochemical measurements of cAMP levels in the kinase deletion strains revealed significantly less cAMP in all of the deletion strains compared to the wild-type strain. The deletion strains also produced significantly smaller capsules than the wild-type KN99 strain did under capsule-inducing conditions, although the levels of capsule they shed were similar to those shed by the wild type. Finally, addition of exogenous cAMP led to reduced sensitivity to cell wall stress and restored surface capsule to levels near those of wild type. Thus, we have direct evidence of cross talk between the CWI and cAMP/PKA pathways that may have important implications for regulation of cell wall and capsule homeostasis. PMID:25118241

  5. Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

    PubMed Central

    Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

    1994-01-01

    DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267

  6. Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

    PubMed

    Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

    1994-10-25

    DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. PMID:7971267

  7. Identification of electrostatic interaction sites between the regulatory and catalytic subunits of cyclic AMP-dependent protein kinase.

    PubMed Central

    Gibson, R. M.; Ji-Buechler, Y.; Taylor, S. S.

    1997-01-01

    Two classes of molecules inhibit the catalytic subunit (C) of the cyclic AMP-dependent protein kinase (cAPK), the heat-stable protein kinase inhibitors (PKIs) and the regulatory (R) subunits. Basic sites on C, previously identified as important for R/C interaction in yeast TPK1 and corresponding to Lys213, Lys217, and Lys189 in murine C alpha, were replaced with either Ala or Thr and characterized for their kinetic properties and ability to interact with RI and PKI. rC(K213A) and rC(K217A) were both defective in forming holoenzyme with RI but were inhibited readily with PKI. This contrasts with rC(R133A), which is defective in binding PKI but not RI (Wen & Taylor, 1994). Thus, the C-subunit employs two distinct electrostatic surfaces to achieve high-affinity binding with these two types of inhibitory molecules even though all inhibitors share a common consensus site that occupies the active site cleft. Unlike TPK1, mutation of Lys189 had no effect. The mutant C subunits that were defective in binding RI, rC(K213A) and rC(K217A), were then paired with three RI mutants, rRI(D140A), rRI(E143A), and rRI(D258A), shown previously to be defective in recognition of C. Although the mutations at Asp140 and Asp258 in RI were additive with respect to the C mutations. rC(K213A) and rRI(E143A) were compensatory, thus identifying a specific electrostatic interaction site between RI and C. The results are discussed in terms of the RI and C crystal structures and the sequence homology between the yeast and mammalian enzymes. PMID:9300482

  8. GEMM-I riboswitches from Geobacter sense the bacterial second messenger cyclic AMP-GMP

    PubMed Central

    Kellenberger, Colleen A.; Wilson, Stephen C.; Hickey, Scott F.; Gonzalez, Tania L.; Su, Yichi; Hallberg, Zachary F.; Brewer, Thomas F.; Iavarone, Anthony T.; Carlson, Hans K.; Hsieh, Yu-Fang; Hammond, Ming C.

    2015-01-01

    Cyclic dinucleotides are an expanding class of signaling molecules that control many aspects of bacterial physiology. A synthase for cyclic AMP-GMP (cAG, also referenced as 3?-5?, 3?-5? cGAMP) called DncV is associated with hyperinfectivity of Vibrio cholerae but has not been found in many bacteria, raising questions about the prevalence and function of cAG signaling. We have discovered that the environmental bacterium Geobacter sulfurreducens produces cAG and uses a subset of GEMM-I class riboswitches (GEMM-Ib, Genes for the Environment, Membranes, and Motility) as specific receptors for cAG. GEMM-Ib riboswitches regulate genes associated with extracellular electron transfer; thus cAG signaling may control aspects of bacterial electrophysiology. These findings expand the role of cAG beyond organisms that harbor DncV and beyond pathogenesis to microbial geochemistry, which is important to environmental remediation and microbial fuel cell development. Finally, we have developed an RNA-based fluorescent biosensor for live-cell imaging of cAG. This selective, genetically encodable biosensor will be useful to probe the biochemistry and cell biology of cAG signaling in diverse bacteria. PMID:25848022

  9. Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent

    PubMed Central

    Stella, Nicholas A.; Shanks, Robert M. Q.

    2014-01-01

    The cyclic-nucleotide 3’,5’-cyclic AMP (cAMP) is an ancient and wide spread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-CRP regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

  10. The inhibitory GTP-binding protein (Gi) regulates the agonistic property of beta-adrenergic ligands in isolated rat adipocytes. Evidence for a priming effect of cyclic AMP.

    PubMed Central

    Wesslau, C; Smith, U

    1992-01-01

    Prenalterol, an allegedly beta 1-selective adrenergic agonist with high intrinsic sympathomimetic activity (ISA), was shown to be weakly lipolytic in rat adipocytes. However, in pertussis-toxin-treated adipocytes, the ISA of prenalterol was markedly increased (from 10-20% to approx. 100% of that of isoprenaline). The cellular sensitivity was also increased (EC50 approx. 60 nM and approx. 3 microM in pertussis-toxin-treated and control cells respectively). A similar effect was seen for other partial agonists such as the beta 2-selective agonist terbutaline and for beta-adrenergic antagonists with some intrinsic activity (metoprolol, pindolol). There was no clear change in sensitivity to isoprenaline's ability to stimulate adenylate cyclase in adipocyte membranes from pertussis-toxin-treated animals but the cyclase activity was increased approx. 4-fold in the presence of 1 microM-GTP. Prenalterol stimulated lipolysis by only small increases in intracellular cyclic AMP (cAMP) levels (less than 10% of that seen with isoprenaline). Basal lipolysis was increased in cells from pertussis-toxin-treated rats and the cellular sensitivity to the non-degradable cAMP analogue, N6-monobutyryl-cAMP, was increased. In control cells, a submaximal concentration of prenalterol (0.1 microM) increased the sensitivity to the cAMP analogues, N6-monobutyryl-cAMP and 8-bromo-cAMP. A low concentration (1 mM) of 8-bromo-cAMP also increased the effect of prenalterol. Similar effects were seen when the phosphodiesterase was inhibited. Thus (1) lipolysis is extremely sensitive to small increases in intracellular cAMP; (2) the degree of activation of adenylate cyclase and thus cAMP formation is the rate-limiting step for the biological response of partial agonists; (3) the inhibitory GTP-binding protein, Gi, is an important modulator ('tissue factor') of the beta-adrenergic agonistic property; (4) low levels of cAMP exert a priming effect on protein kinase A. Images Fig. 1 PMID:1280115

  11. Mastoparan promotes exocytosis and increases intracellular cyclic AMP in human platelets. Evidence for the existence of a Ge-like mechanism of secretion.

    PubMed

    Wheeler-Jones, C P; Saermark, T; Kakkar, V V; Authi, K S

    1992-01-15

    Recent studies have shown that mastoparan, an amphiphilic peptide derived from wasp venom, accelerates guanine nucleotide exchange and GTPase activity of purified GTP-binding proteins. In the present study we have examined the functional consequences of exposure of intact human platelets to mastoparan. Mastoparan promoted rapid (less than or equal to 1 min) dose-dependent increases in 5-hydroxy[14C]tryptamine and beta-thromboglobulin release from dense-granule and alpha-granule populations respectively. The exocytotic response did not result from a lytic effect of mastoparan and occurred in the complete absence of platelet shape change and aggregation. Liberation of [3H]arachidonate and increases in cytosolic [Ca2+] (detected with fura 2) were not observed in platelets stimulated with mastoparan. Similarly, in platelets preloaded with [3H]inositol during reversible electroporation, mastoparan did not cause the accumulation of [3H]inositol phosphates. Mastoparan-induced secretion was unaffected by preincubation with either the protein kinase C inhibitor staurosporine (10 nM-10 microM) or prostacyclin (PGI2; 100 ng/ml) and was not accompanied by phosphorylation of the 45 kDa protein kinase C substrate or the 20 kDa protein normally associated with platelet activation. The G-protein inhibitor guanosine 5'-[beta-thio]diphosphate (GDP[S]; 1 mM) attenuated the secretion induced by mastoparan in both intact and saponin-permeabilized platelets. Encapsulation of GDP[S] during reversible permeabilization inhibited mastoparan-induced secretion, providing evidence for an intracellular action of GDP[S]. In all these studies thrombin (0.05-0.2 unit/ml) elicited characteristic responses, and thrombin-induced secretion was inhibited by staurosporine, PGI2 and GDP[S]. Mastoparan also increased intra-platelet cyclic AMP in a dose-dependent manner. Mastoparan and PGI2 increased 32P incorporation into a protein of approx. 24 kDa, whereas phosphorylation of a 50 kDa substrate was only seen in PGI2-stimulated platelets. These results indicate that mastoparan promotes secretion by a mechanism which does not involve stimulation of phospholipase C and suggest that the secretory event may result either from a direct fusogenic action of mastoparan and/or from stimulation of the putative exocytosis-linked G-protein, Ge. PMID:1310599

  12. The Role of Cyclic AMP in Normalizing the Function of Engineered Human Blood Microvessels in Microfluidic Collagen Gels

    PubMed Central

    Wong, Keith H. K.; Truslow, James G.; Tien, Joe

    2010-01-01

    Nearly all engineered tissues must eventually be vascularized to survive. To this end, we and others have recently developed methods to synthesize extracellular matrix-based scaffolds that contain open microfluidic networks. These scaffolds serve as templates for the formation of endothelial tubes that can be perfused; whether such microvascular structures are stable and/or functional is largely unknown. Here, we show that compounds that elevate intracellular concentrations of the second messenger cyclic AMP (cAMP) strongly normalize the phenotype of engineered human microvessels in microfluidic type I collagen gels. Cyclic AMP-elevating agents promoted vascular stability and barrier function, and reduced cellular turnover. Under conditions that induced the highest levels of cAMP, the physiology of engineered microvessels in vitro quantitatively mirrored that of native vessels in vivo. Computational analysis indicated that cAMP stabilized vessels partly via its enhancement of barrier function. PMID:20303168

  13. Cyclic AMP suppresses interleukin-5 synthesis by human helper T cells via the downregulation of the calcium mobilization pathway

    PubMed Central

    Kaminuma, Osamu; Mori, Akio; Ogawa, Koji; Kikkawa, Hideo; Nakata, Aya; Ikezawa, Katsuo; Okudaira, Hirokazu

    1999-01-01

    To delineate the mechanism by which cyclic AMP (cAMP) suppresses interleukin (IL)-5 synthesis, the effects of prostaglandin (PG) E2, forskolin, dibutyryl (db)-cAMP and the Ca2+ ionophore, ionomycin on cytokine synthesis, proliferation and CD25 expression of human T cells were investigated. Further studies were performed by measurement of the intracellular concentrations of cyclic AMP ([cAMP]i) and Ca2+ ([Ca2+]i) and by electrophoretic mobility shift analysis (EMSA).PGE2, forskolin and db-cAMP suppressed IL-5 production by human T cell line following T cell receptor (TCR)-stimulation. PGE2 suppressed TCR-induced messenger RNA (mRNA) expression of IL-2, IL-4 and IL-5, as well as proliferation and CD25 expression.Cyclic AMP-mediated suppression of cytokine synthesis, proliferation and CD25 expression in human T cells were attenuated by ionomycin.[cAMP]i was increased by PGE2 and forskolin. PGE2 suppressed the TCR-induced biphasic increase in [Ca2+]i. EMSA revealed that four specific protein-DNA binding complexes related to NF-AT were detected at the IL-5 promoter sequence located from −119 to −90 relative to the transcription initiation site. The slowest migrating complex induced by TCR stimulation was enhanced by PGE2 and further upregulated by ionomycin. Another binding which did not compete with cold AP-1 oligonucleotides, was constitutively present and was unaffected by PGE2 but enhanced by ionomycin.The suppressive effect of cyclic AMP on human IL-5 synthesis is mediated by interference with intracellular Ca2+ mobilization but distinct from the NF-AT-related pathway. PMID:10385254

  14. Cyclic AMP levels during induction and repression of cellulase biosynthesis in Thermomonospora curvata

    SciTech Connect

    Wood, W.E.; Neubauer, D.G.; Stutzenberger, F.J.

    1984-12-01

    Specific cellulase production rates (SCPR) were compared with intracellular cyclic AMP (cAMP) levels in the thermophilic actinomycete, Thermomonospora curvata, during growth on several carbon sources in a chemically defined medium. SCPR and cAMP levels were 0.03 U (endoglucanase (EG) units) and 2 pmol per mg of dry cells, respectively, during exponential growth on glucose. These values increased to about 6 and 25, respectively, during growth on cellulose. Detectable EG production ceased when cAMP levels dropped below 10. Cellobiose (usually considered to be a cellulase inducer) caused a sharp decrease in cAMP levels and repressed EG production when added to cellulose-grown cultures. 2-deoxy-D-glucose, although nometabolizable in T. curvata, depressed cAMP to levels observed with glucose, but unlike glucose, the 2DG effect persisted until cells were washed and transferred to fresh medium. SCPR values and cAMP levels in cells grown in continuous culture under conditions of cellobiose limitation were markedly influenced by dilution rate (D). The maxima for both occurred at D = 0.085 (culture generation time of 11.8 h). When D was held constant and cellobiose concentration was increased over a 14-fold range to support higher steady state population levels, SCPR values decreased about fivefold, indicating that extracellular catabolite accumulation may be a factor in EG repression. The role of cAMP in the mechanism of this repression appears to be neither simple nor direct, since large changes (up to 200-fold) in SCPR accompany relatively small changes (10-fold) in cellular cAMP levels.

  15. Regulation of osteosarcoma EGF receptor affinity by phorbol ester and cyclic AMP

    SciTech Connect

    Borst, S.E.; Catherwood, B.D. )

    1989-04-01

    We studied the binding and degradation of 125I-labeled epidermal growth factor (EGF) by UMR-106 osteosarcoma cells and the regulation of EGF receptor affinity for EGF by the phorbol ester 12-O-tetradecanoyl-phorbol-13-acetate (TPA) and by treatments that raise intracellular levels of cyclic AMP. Cell surface binding of (125I)EGF to A431 cells reached a plateau after a 30 minute incubation at 37 degrees C but was undetectable in UMR-106 cells. Degradation of (125I)EGF proceeded at a 50-fold higher rate in A431 cells on a per cell basis, but receptor-bound (125I)EGF was internalized and degraded at a 3.5-fold higher rate by UMR-106 cells on a per receptor basis. At 4 degrees C, (125I)EGF labeled a single class of surface binding sites in the UMR-106 cell. Treatment with TPA at 37 degrees C reduced subsequent cell surface binding of (125I)EGF at 4 degrees C a maximum of 80% with an IC50 of 1.25 ng/ml. Maximal TPA reduction of (125I)EGF binding was observed within 5-15 minutes and was due to a reduction in the affinity of cell surface receptors of (125I)EGF without a change in receptor density. Pretreatment of the cells for 4 h with 30 microM forskolin, 1 mM isobutylmethylxanthine (IBMX) plus 30 microM forskolin, or 1 mM IBMX plus 100 ng/ml parathyroid hormone (PTH) attenuated the loss in (125I)EGF binding caused by a subsequent dose of 10 ng/ml of TPA by 17% (p less than 0.0005), 39% (p less than 0.0002), and 35% (p less than 0.002), respectively.

  16. Calcium-mediated cyclic AMP inhibition of Na-H exchange in small intestine.

    PubMed

    Semrad, C E; Chang, E B

    1987-03-01

    8-Bromo cyclic AMP (cAMP) (10(-4) M) inhibits Na absorption in isolated chicken enterocytes as has been reported previously. Direct measurements of intracellular pH (pHi) using 5,6-carboxyfluorescein diacetate showed that both 8-bromo cAMP and the diuretic amiloride (10(-3) M) stimulated a persistent decrease in pHi of approximately 0.1 pH units, effects that were Na dependent and were not additive when cells were stimulated with both agents. These results suggest inhibition of an amiloride-sensitive Na/H exchange by cAMP. Direct measurements of intracellular Ca [Ca]i were also made using quin 2. 8-Bromo cAMP (10(-4) M) stimulated an immediate and persistent (greater than 10 min) increase in [Ca]i of approximately 20 nM, an effect that was not dependent on extracellular Ca. Pretreatment of cells with the specific calmodulin inhibitor calmidazolium (10(-7) M) and the intracellular Ca-buffering agent MAPTAM blocked cAMP's effects on pH and Na uptake, but did not interfere with amiloride's effects. An increase in [Ca]i stimulated by the Ca ionophore A23187 (10(-6) M) was sufficient by itself to decrease pHi and inhibit amiloride-sensitive Na influx in isolated enterocytes. We conclude that cAMP stimulates the release of endogenous Ca in isolated enterocytes. This increase in [Ca]i appears to be essential for inhibition of amiloride-sensitive Na-H exchange by this cyclic nucleotide. PMID:3030130

  17. Inhibition by sodium butyrate of enzyme induction by glucocorticoids and dibutyryl cyclic AMP. A role for the rapid form of histone acetylation.

    PubMed

    Plesko, M M; Hargrove, J L; Granner, D K; Chalkley, R

    1983-11-25

    We have found that butyrate selectively inhibits hormonal induction of a few specific proteins and messenger RNAs in hepatoma cells. The fatty acid salt reversibly abolishes induction of tyrosine aminotransferase by dexamethasone and dibutyryl cyclic AMP in HTC cells by inhibiting the production of tyrosine aminotransferase messenger RNA. Half-maximal inhibition of enzyme induction occurred in 0.9 mM butyrate. This effect is highly specific, since 4 h after the addition of butyrate to induced HTC cells, the relative abundance of only five messenger RNA species out of several hundred observable on two-dimensional gels of translational products is changed. Upon removal of the butyrate from cell cultures pretreated with dexamethasone, tyrosine aminotransferase activity begins to increase more rapidly than if dexamethasone is added to control cultures, indicating that part of the induction process occurs in the presence of butyrate. A dose-dependent reduction of fast histone acetylation by butyrate was demonstrated by treating cells with butyrate followed by a short pulse with [3H]acetate and chase in a high concentration of butyrate. The butyrate concentration test range over which rapid histone acetylation is inhibited is similar to that which inhibits enzyme induction to the same extent. In contrast, the slow form of histone acetylation is unaffected in the concentration range examined. The induction of tyrosine aminotransferase by dexamethasone is delayed in hypoacetylated cells. This lag is consistent with the time required to initiate the recovery of the fast form of histone acetylation after its transient disappearance (Covault, J., Perry, M., and Chalkley, R. (1982) J. Biol. Chem. 257, 13433-13440). We conclude that sodium butyrate interferes with the ability of dexamethasone and dibutyryl cyclic AMP to increase production of several specific species of messenger RNA in hepatoma cells. This effect correlates well with its ability to reduce rapid acetylation of histones in HTC cells; we discuss potential roles of rapid histone acetylation in modulating hormonal stimulation of transcription. PMID:6196355

  18. [The role of gonadotropins, cyclic AMP, 22-R-OH-cholesterol and cofactors in regulating endocrine functions of the Leydig cells in rats. III. Mechanisms responsible for "desensitization" of the Leydig cells of rats caused by high doses of hCG].

    PubMed

    Grochowski, D; Szamatowicz, M

    1989-05-01

    Two groups of rats (a control group and the group examined) were administered intraperitoneally supraphysiological doses of hCG in order to induce a "down regulation" effect on the level of receptors LH and to achieve the desensibilization of Leydig cells. The authors tried to find out at which stage of sequence of changes from receptor stimulation to hormone production there appears a state of cellular resistance to further stimulation. Sections of the nucleus were incubated with various substances influencing steridogenesis (LH, hCG, dbcAMP, 22-R-OH-cholesterol, NAD + NADP + G-6-P + G-6-PDH). An index of the influence of the above substances on the synthesis of androgens were amounts of pregnenolon as the first and testosterone as the final stage of hormonal changes marked radioimmunologically in nucleus homogenates and incubating media. It was shown that the resistance of Leydig cells to further stimulation in the group of animals that were given high doses of hCG is the result of enzymatic blocks in testosterone synthesis. The first block is "late" block of 17 alpha-hydroxylase and 17-20 desmolase, disturbing transforming of 21-carbon steriods into 19-carbon androgens. When the dose of hCG increases, there appears the second block, the so called "early" block, disturbing mitochondrial synthesis of pregnenolon. It was found that exogenic cofactors are in a position, at least partially, to restore the activity of blocked enzymes.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2561360

  19. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites.

    PubMed

    Berg, O G; von Hippel, P H

    1988-04-20

    The statistics of base-pair usage within known recognition sites for a particular DNA-binding protein can be used to estimate the relative protein binding affinities to these sites, as well as to sites containing any other combinations of base-pairs. As has been described elsewhere, the connection between base-pair statistics and binding free energy is made by an equal probability selection assumption; i.e. that all base-pair sequences that provide appropriate binding strength are equally likely to have been chosen as recognition sites in the course of evolution. This is analogous to a statistical-mechanical system where all configurations with the same energy are equally likely to occur. In this communication, we apply the statistical-mechanical selection theory to analyze the base-pair statistics of the known recognition sequences for the cyclic AMP receptor protein (CRP). The theoretical predictions are found to be in reasonable agreement with binding data for those sequences for which experimental binding information is available, thus lending support to the basic assumptions of the selection theory. On the basis of this agreement, we can predict the affinity for CRP binding to any base-pair sequence, albeit with a large statistical uncertainty. When the known recognition sites for CRP are ranked according to predicted binding affinities, we find that the ranking is consistent with the hypothesis that the level of function of these sites parallels their fractional saturation with CRP-cAMP under in-vivo conditions. When applied to the entire genome, the theory predicts the existence of a large number of randomly occurring "pseudosites" with strong binding affinity for CRP. It appears that most CRP molecules are engaged in non-productive binding at non-specific or pseudospecific sites under in-vivo conditions. In this sense, the specificity of the CRP binding site is very low. Relative specificity requirements for polymerases, repressors and activators are compared in light of the results of this and the first paper in this series. PMID:3045325

  20. Changes in sodium, potassium-ATPase induced by repeated fencamfamine: the roles of cyclic AMP-dependent protein kinase and the nitric oxide-cyclic GMP pathway.

    PubMed

    Munhoz, Carolina Demarchi; Glezer, Isaias; Kawamoto, Elisa Mitiko; Arajo, Ana Paula Natalini; Lepscha, Luclia B; Planeta, Cleopatra S; DeLucia, Roberto; Scavone, Cristoforo

    2003-12-01

    Fencamfamine (FCF) is an indirect dopamine agent with effects similar to amphetamine and cocaine. In the present study, we investigate changes in Na,K-ATPase, cyclic AMP-dependent protein kinase (PKA) and nitric oxide synthase (NOS) activity and cyclic GMP levels in the nucleus accumbens (NAc) and striatum (ST) of animals acutely or repeatedly treated with FCF (3.5 mg/kg). Na,K-ATPase had a similar activity in control and repeatedly treated animals, but was reduced in the NAc of the acute group. This enzyme was reduced in the ST in acute and repeatedly treated animals, compared to the control group. Expression of the alpha(1,2,3)-Na,K-ATPase isoforms in the NAc and the ST was not altered in all groups studied. Acute FCF induced a significant increase in PKA activity in both the ST and the NAc. Repeatedly treated animals showed a higher increase in PKA activity in the NAc, but not in the ST, when compared to the acute group. There was also an increase in both NOS activity and cyclic GMP levels only in the NAc of FCF repeatedly treated animals compared to the acute and control groups. We suggest that chronic FCF treatment is linked to a modification in Na,K-ATPase activity through the PKA and NO-cyclic GMP pathway. PMID:14614957

  1. Production and release of cyclic AMP by Daphnia pulex: implications of grazing activity

    SciTech Connect

    Francko, D.A.; Wetzel, R.G.

    1982-04-01

    Daphnia pulex, a common cladoceran zooplankton species, contains tissue cAMP concentrations similar to those found in algae, bacteria, and aquatic macrophytes. Daphnia release significant quantities of cAMP into the extracellular medium. Release of algal cellular cAMP as a result of digestive degradation of algal cells may also be an important source of dissolved cAMP in lakewater.

  2. Production and release of cyclic AMP by Daphnia pulex: implications of grazing activity

    SciTech Connect

    Francko, D.A.; Wetzel, R.G.

    1982-04-01

    Daphnia pulex, a common cladoceran zooplankton species, contains tissue cAMP concentrations similar to those found in algae, bacteria, and aquatic macrophytes. Daphnia release significant quantities of cAMP into the extracellular medium. Release of algal cellular cAMP as a result of digstive degradation of algal cells may also be an important source of dissolved cAMP in lakewater.

  3. Effect of cyclo-oxygenase inhibitors and modulators of cyclic AMP formation on lipopolysaccharide-induced neutrophil infiltration in mouse lung.

    PubMed Central

    Goncalves de Moraes, V. L.; Boris Vargaftig, B.; Lefort, J.; Meager, A.; Chignard, M.

    1996-01-01

    1. The adult respiratory distress syndrome (ARDS) is an acute lung inflammation developed after direct or indirect contact with pathogenic agents. In the present study, a mouse model was developed to mimic this condition using aerosolized bacterial lipopolysaccharide (LPS) and to investigate the mechanisms involved in the lung inflammatory response. 2. Inhalation of LPS led to a time and dose-dependent increase in tumour necrosis factor-alpha (TNF-alpha) production and neutrophil recruitment into the bronchoalveolar lavage fluid (BALF) of Balb/c mice. Under the same conditions, neutrophil infiltration was also found in the BALF of the LPS-sensitive mouse strain C3H/HeN, but was absent in the LPS-resistant strain C3H/HeJ. Intranasal administration of murine recombinant TNF-alpha also triggered neutrophil recruitment. 3. One hour after inhalation of LPS, half of the maximal level of TNF-alpha was measured in the BALF, but only a few neutrophils were detected at this time. The peak TNF-alpha concentration was reached at 3 h, when the neutrophil amount started to increase. At 24 h, maximal neutrophil number was found in the BALF and TNF-alpha was no longer present. 4. Pretreatment of mice under different experimental conditions demonstrated that: (a) cycloheximide almost completely blocks both neutrophil recruitment and TNF-alpha production; (b) anti TNF-alpha antibodies block neutrophil recruitment; (c) indomethacin or aspirin enhance by two fold neutrophil recruitment; (d) indomethacin significantly increases TNF-alpha production 1 h after inhalation of LPS; (e) dibutyryl cyclic AMP and prostaglandin E2 (PGE2) block both neutrophil recruitment and TNF-alpha production. 5. It is concluded that aerosolized LPS in mice triggers an acute lung inflammation which can be used as a potential model of inhalational ARDS and that, strategies leading to the elevation of cyclic AMP levels in vivo can be effective in modulating LPS-induced TNF-alpha synthesis and neutrophil recruitment. PMID:8732293

  4. Vasopressin and interactive calcium, cyclic AMP and purinergic signaling in Polycystic Kidney Disease

    PubMed Central

    Chebib, Fouad T.; Sussman, Caroline R.; Wang, Xiaofang; Harris, Peter C.; Torres, Vicente E.

    2015-01-01

    Autosomal Dominant Polycystic Kidney Disease (ADPKD) is the most common monogenic kidney disease and the fourth leading cause of end-stage renal disease, responsible for 5–10% of cases. The disease is characterized by relentless development and growth of cysts causing progressive kidney enlargement associated with hypertension, pain, reduced quality of life, and eventually kidney failure. It is caused by mutations to PKD1 or PKD2, encoding polycystin-1 and polycystin-2, respectively. Their function and the molecular mechanisms responsible for the development of polycystic kidney disease are not well understood. The objective of this review is to synthesize a large body of literature that examines how reduction of functional PC1 or PC2 at the primary cilia and/or the endoplasmic reticulum directly disrupts intracellular calcium signaling and indirectly disrupts calcium regulated cAMP and purinergic signaling. We propose a hypothetical model where dysregulated metabolism of cAMP and purinergic signaling increase the sensitivity of principal cells in collecting ducts and of tubular epithelial cells in the distal nephron to the constant tonic action of vasopressin. The resulting magnified response to vasopressin further enhances the disruption of calcium signaling initiated by mutations to PC1 or PC2 and activates downstream signaling pathways responsible for impaired tubulogenesis, cell proliferation, increased fluid secretion and interstitial inflammation. PMID:25870007

  5. Role of phosphodiesterases III and IV in the modulation of vascular cyclic AMP content by the NO/cyclic GMP pathway.

    PubMed Central

    Eckly, A E; Lugnier, C

    1994-01-01

    1. The effect on cyclic nucleotide contents of selective inhibitors of cyclic nucleotide phosphodiesterase (PDE) isoforms III and IV (respectively SK&F 94120 and rolipram) and their interactions with endothelium and NO have been studied in rat aorta in the presence of indomethacin (10 microM). The participation of NO was assessed by using either NG-nitro-L-arginine methyl ester (L-NAME) (NO synthase inhibitor: 30 microM) or 3-morpholinosydnonimine (SIN-1, NO donor: 10 microM with SOD 100 units ml-1). 2. The presence of endothelium significantly increased both adenosine 3':5'-cyclic monophosphate (cyclic AMP, 1.7 fold) and guanosine 3':5'-cyclic monophosphate (cyclic GMP, 2.2 fold) contents. Cyclic GMP was largely affected by L-NAME or SIN-1 treatment, this was not the case for cyclic AMP suggesting that the presence of endothelium modified cyclic AMP content in aorta independently of the NO production. 3. In the presence or absence of endothelium, neither SK&F 94120 nor rolipram, alone or combined, significantly modified cyclic GMP content. 4. The PDE III inhibitor significantly affected cyclic AMP content only in non treated aorta without endothelium. In contrast, the PDE IV inhibitor increased cyclic AMP in all conditions. These increases were generally about 2 fold but markedly higher in aorta treated with SIN-1 and superoxide dismutase (SOD, 6 fold). Association of a low concentration of the PDE III inhibitor (5 microM) with the PDE IV inhibitor (30 microM) potentiated the effect of the PDE IV inhibitor on cyclic AMP content, except for aorta without endothelium treated with SIN-1 plus SOD.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7834194

  6. Platelet-derived growth factor-BB and thrombin generate positive and negative signals for human hepatic stellate cell proliferation. Role of a prostaglandin/cyclic AMP pathway and cross-talk with endothelin receptors.

    PubMed

    Mallat, A; Gallois, C; Tao, J; Habib, A; Maclouf, J; Mavier, P; Praux, A M; Lotersztajn, S

    1998-10-16

    Proliferation of myofibroblastic hepatic stellate cells (HSC) in response to growth factors is essential for the development of liver fibrosis. We have reported that prostaglandins (PG) and cyclic AMP (cAMP) inhibit growth of human HSC. This PG/cAMP pathway transduces the endothelin (ET) B-mediated antiproliferative effect of endothelin-1 (ET-1) and up-regulates ETB receptors. Here, we show that platelet-derived growth factor (PDGF)-BB and thrombin, although mitogenic, generate growth inhibitory PGE2 in myofibroblastic human HSC. The two peptides elicit early PGE2 and cAMP synthesis, and also promote delayed induction of cyclooxygenase (COX)-2. Both early and delayed production of PGE2 counteract the mitogenic effect of PDGF-BB and thrombin because: (i) pretreatment with the COX inhibitor ibuprofen markedly enhances the mitogenic effect of both peptides; (ii) blocking early synthesis of PGE2 greatly enhances extracellular signal-regulated kinase (ERK) activation by both growth factors; (iii) enhancement of DNA synthesis by ibuprofen is only lost when the inhibitor is added after COX-2 induction has occurred. Finally, PDGF-BB and thrombin raise ETB receptors through the PG pathway. Thus, ibuprofen blunts growth factor-induced increase in ETB receptors. Up-regulation of the growth inhibitory ETB receptors by both mitogens may enhance the antiproliferative effect of ET-1 and thereby establish a negative feedback of their mitogenic effect. Our results shed light on novel growth inhibitory signals evoked by two mitogenic growth factors expressed during liver injury. PMID:9765255

  7. Neutrophil beta-adrenergic receptor responses are potentiated by acute exposure to phorbol ester without changes in receptor distribution or coupling

    SciTech Connect

    Kilfeather, S.A.; Stein, M.; O'Malley, K. )

    1991-01-01

    Exposure to the phorbol ester, phorbol 12-myristate, 13-acetate for 10 minutes enhanced cyclic AMP accumulation in human neutrophils under basal conditions and in response to the beta-adrenergic receptor agonist isoproterenol (ISO, 1{mu}M) and the adenylate cyclase activator forskolin (FSK, 10mM). Potentiation of responses to ISO by PMA was dose-dependent between 0.1 and 100nM PMA. The diacylglycerol analogue, 1-oleoyl-2-actylgylcerol (OAG) (50 {mu}M) also elevated beta-receptor responses, but 4beta-phorbol (100nM), lacking the capacity to activate PMA, was ineffective. Short-term exposure to the peptide n-formylmethionine leucyl-phenylalanine (FMLP, 1 {mu}M) also elevated neutrophil cyclic AMP accumulation. All potentiating effects of PMA on cyclic AMP production were inhibited by the protein kinase inhibitor 1-(5-isoquinolinylsulphonyl)-2-methylpiperazine (H{sub 7}). PMA had no apparent effect on beta-receptor agonist-affinity, distribution between cell-surface and internalized compartments, or the capacity of ISO to induce beta-receptor internalization. Responses to FSK or ISO in terms of fold-stimulation of basal cyclic AMP accumulation int he presence of PMA were not elevated by PMA.

  8. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    SciTech Connect

    Livi, G.P.; McHale, M.J.; Sathe, G.M.; Taylor, D.P. ); Kmetz, P.; Balcarek, J.M. ); Cieslinski, L.B.; Torphy, T.J. ); Davis, R.L. . Dept. of Cell Biology)

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding region of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.

  9. Cyclic AMP-mediated suppression of neutrophil extracellular trap formation and apoptosis by the Bordetella pertussis adenylate cyclase toxin.

    PubMed

    Eby, Joshua C; Gray, Mary C; Hewlett, Erik L

    2014-12-01

    The adenylate cyclase toxin (ACT) of Bordetella pertussis intoxicates target cells by generating supraphysiologic levels of intracellular cyclic AMP (cAMP). Since ACT kills macrophages rapidly and potently, we asked whether ACT would also kill neutrophils. In fact, ACT prolongs the neutrophil life span by inhibiting constitutive apoptosis and preventing apoptosis induced by exposure to live B. pertussis. Imaging of B. pertussis-exposed neutrophils revealed that B. pertussis lacking ACT induces formation of neutrophil extracellular traps (NETs), whereas wild-type B. pertussis does not, suggesting that ACT suppresses NET formation. Indeed, ACT inhibits formation of NETs by generating cAMP and consequently inhibiting the oxidative burst. Convalescent-phase serum from humans following clinical pertussis blocks the ACT-mediated suppression of NET formation. These studies provide novel insight into the phagocyte impotence caused by ACT, which not only impairs neutrophil function but also inhibits death of neutrophils by apoptosis and NETosis. PMID:25287922

  10. Alterations in the binding site of the cyclic AMP receptor protein at the Escherichia coli galactose operon regulatory region.

    PubMed

    Gaston, K; Chan, B; Kolb, A; Fox, J; Busby, S

    1988-08-01

    Gene manipulation techniques have been used to alter the binding site for the cyclic AMP-cyclic AMP receptor protein complex (cAMP-CRP) at the regulatory region of the Escherichia coli galactose (gal) operon. The effects of these changes on CRP-dependent stimulation of expression from the galP1 promoter in vivo have been measured, and gel binding assays have been used to measure the affinity of cAMP-CRP for the modified sites. Firstly we have deleted progressively longer sequences from upstream of the gal CRP site in order to locate the functional limit of the site. A deletion to -49, removing the first base that corresponds to the consensus sequence for a CRP binding site, is sufficient to reduce CRP binding and block CRP-dependent stimulation of P1. Secondly, we used synthetic oligonucleotides to invert the asymmetric nucleotide sequence at the gal CRP binding site or to make the sequence symmetric. Inversion of the site has little effect on CRP binding, the architecture of open complexes at P1 revealed by DNAase I footprinting, or the stimulation of transcription from P1. Making the site symmetric increases the affinity for CRP by over 50-fold and leads to increased transcription from P1, whilst hardly altering the DNAase I footprint of open complexes. Our results confirm that the strength of binding of CRP depends on the nature of the site and show that it is this that principally accounts for differences in CRP-dependent stimulation of transcription. PMID:2845937

  11. Modulation of a human lymphoblastoid B cell line by cyclic AMP. Ig secretion and phosphatidylcholine metabolism

    SciTech Connect

    Shearer, W.T.; Patke, C.L.; Gilliam, E.B.; Rosenblatt, H.M.; Barron, K.S.; Orson, F.M.

    1988-09-01

    A transformed human B cell line, LA350, was found to be sensitive to cAMP-elevating agents by responding with rapid (0 to 2 h) severalfold elevations of intracellular cAMP to treatment with cholera toxin, isobutylmethylxanthine (IBMX), forskolin, and dibutyryl cAMP (all p less than 0.001). These cAMP-elevating agents also produced significant inhibitions of subsequent (48 to 72 h) Ig secretion by the same B cells as measured by a reverse hemolytic plaque assay and an enzyme-linked immunoadsorbent assay for IgM (both p less than 0.001). PMA- and IBMX-treated cells were particularly responsive to the effects of cholera toxin, showing a doubling of cAMP content and profound decrease in Ig production (p less than 0.001). Because our previous studies had correlated activation of the metabolic turnover of the phosphatidylcholine (PC) fraction of membrane phospholipids with enhanced Ig secretion, we examined the sensitivity of PC metabolism to cAMP in control and PMA-stimulated cells. Formation of PC was found to be inhibited by forskolin and IBMX (both p less than 0.002) but breakdown of PC was stimulated (p less than 0.001). These findings imply that as the enzymatic products of PC, choline phosphate and diacylglycerol, are depleted due to the combined effects of cAMP upon synthesis and turnover of PC, there is a decrease in Ig secretion. Since diacylglycerol activates protein kinase C, it appears reasonable that Ig secretion is at least partially regulated by cAMP-responsive alterations in PC metabolism produced by protein kinase C-induced phosphorylation. We conclude that the early cAMP-sensitive changes in PC metabolism in this activated B cell line may signal for subsequent alterations in Ig secretion.

  12. Cyclic AMP concentrations in dendritic cells induce and regulate Th2 immunity and allergic asthma

    PubMed Central

    Lee, Jihyung; Kim, Tae Hoon; Murray, Fiona; Li, Xiangli; Choi, Sara S.; Broide, David H.; Corr, Maripat; Lee, Jongdae; Webster, Nicholas J. G.; Insel, Paul A.; Raz, Eyal

    2015-01-01

    The inductive role of dendritic cells (DC) in Th2 differentiation has not been fully defined. We addressed this gap in knowledge by focusing on signaling events mediated by the heterotrimeric GTP binding proteins G?s, and G?i, which respectively stimulate and inhibit the activation of adenylyl cyclases and the synthesis of cAMP. We show here that deletion of Gnas, the gene that encodes G?s in mouse CD11c+ cells (Gnas?CD11c mice), and the accompanying decrease in cAMP provoke Th2 polarization and yields a prominent allergic phenotype, whereas increases in cAMP inhibit these responses. The effects of cAMP on DC can be demonstrated in vitro and in vivo and are mediated via PKA. Certain gene products made by Gnas?CD11c DC affect the Th2 bias. These findings imply that G protein-coupled receptors, the physiological regulators of G?s and G?i activation and cAMP formation, act via PKA to regulate Th bias in DC and in turn, Th2-mediated immunopathologies. PMID:25605931

  13. Cyclic-AMP levels in the lichen Evernia prunastri are modulated by light quantity and quality.

    PubMed

    Segovia, María; Gordillo, Francisco J L; Figueroa, Félix L

    2003-07-01

    Changes in the accumulation of cAMP levels were measured by the isotope dilution assay using protein kinase A in the lichen Evernia prunastri at varying light conditions. cAMP levels decreased following exposure to low irradiance (20 micromol quanta m(-2) s(-1), and below the compensation point for photosynthesis) of red light (600-710-nm wave length) and increased by 50% after far-red light illumination (15 micromol quanta m(-2) s(-1), 710-800-nm wavelength). Far-red partially reverted the effect of red light when the former was supplied after the latter. cAMP increased to its maximum level under high irradiance supplied by a non-photomorphogenic yellow light source (400 micromol quanta m(-2) s(-1), reaching photosynthetic saturation). The addition of small quantities of red and far-red light, however, had profound restricting effects on cAMP accumulation. The addition of inhibitors of electron transport chains did not promote any significant change in cAMP levels in any of the treatments, indicating that cAMP accumulation could not depend on ATP synthesis. We propose that the response of cAMP accumulation at low irradiance comprises the activation of a morphogenic pathway through a red/far-red photoreceptor. In addition, at high irradiance the response would occur most likely through photosystems II and I acting as sensors of light quantity, that can be strongly modified by the red/far-red photomorphogenic system. Thus, cAMP would be involved in sensing the overall light environment. PMID:12962638

  14. Cyclic AMP-induced slow inward current in depolarized neurons of Aplysia californica.

    PubMed

    Kehoe, J

    1990-10-01

    Cyclic nucleotides have been implicated in many long-lasting transmitter-induced effects on membrane conductance. One previously observed effect of cAMP on molluscan neurons is to induce a slow inward current, which has been further evaluated here in depolarized anterior and medial cells of the pleural ganglion of Aplysia californica in order to understand better its underlying ionic mechanisms and its sensitivity to a variety of pharmacological agents. This current, which appears to be the only cAMP-induced current seen in the anterior cells, was shown to invert at about +25 mV, that is, approximately 25-30 mV inferior to ENa. This reversal potential was lowered by about 15-16 mV when half of the extracellular Na was replaced by either mannitol or N-methyl-D-glucamine, whereas it was unaffected by changes in extracellular Cl, Ca, or Mg. The response persisted in seawater in which the Na had been totally replaced by K, and its reversal potential shifted towards more negative values. These data are consistent with the hypothesis that both Na and K ions permeate the channel, with a Na/K permeability ratio of approximately 2. Ca ions do not appear to permeate the channel, but they do have a marked inhibitory effect on the response amplitude, as do Mg ions when Ca is not present. Caffeine, intracellular acidification, and phosphodiesterase inhibitors enhance and prolong the response without changing its reversal potential. Previous studies have shown that both caffeine and intracellular acidification inhibit phosphodiesterase, and it is assumed that the common effect of these manipulations on the cAMP-induced inward current is mediated, at least partially, by the inhibition of that enzyme. In the medial cells of the pleural ganglion, this slow inward current is present, but is dominated in the depolarized cell by a cAMP-induced diminution in a Ca-activated K conductance (Kehoe, 1985b). This K conductance and, consequently, the noninverting, cAMP-induced inward current that reflects its diminution, were shown to disappear in Ca-free solutions, in the presence of isobutyl-1-methylxanthine (IBMX) or caffeine, and upon acidification of the cytoplasm. When this cAMP-sensitive K conductance is blocked, the presence of the inverting cAMP-induced cationic current is unmasked. The cAMP-induced cationic current is shown to have many properties in common with cyclic nucleotide-induced currents described in photoreceptors, olfactory receptor cilia, and cardiac myocytes, all of which have been shown to be outwardly rectifying cationic currents that are inhibited by divalent cations and do not involve the activation of a cAMP-dependent kinase. PMID:1698940

  15. Steady-State Modulation of Voltage-Gated K+ Channels in Rat Arterial Smooth Muscle by Cyclic AMP-Dependent Protein Kinase and Protein Phosphatase 2B

    PubMed Central

    Brignell, Jennifer L.; Perry, Matthew D.; Nelson, Carl P.; Willets, Jonathon M.; Challiss, R. A. John; Davies, Noel W.

    2015-01-01

    Voltage-gated potassium channels (Kv) are important regulators of membrane potential in vascular smooth muscle cells, which is integral to controlling intracellular Ca2+ concentration and regulating vascular tone. Previous work indicates that Kv channels can be modulated by receptor-driven alterations of cyclic AMP-dependent protein kinase (PKA) activity. Here, we demonstrate that Kv channel activity is maintained by tonic activity of PKA. Whole-cell recording was used to assess the effect of manipulating PKA signalling on Kv and ATP-dependent K+ channels of rat mesenteric artery smooth muscle cells. Application of PKA inhibitors, KT5720 or H89, caused a significant inhibition of Kv currents. Tonic PKA-mediated activation of Kv appears maximal as application of isoprenaline (a ?-adrenoceptor agonist) or dibutyryl-cAMP failed to enhance Kv currents. We also show that this modulation of Kv by PKA can be reversed by protein phosphatase 2B/calcineurin (PP2B). PKA-dependent inhibition of Kv by KT5720 can be abrogated by pre-treatment with the PP2B inhibitor cyclosporin A, or inclusion of a PP2B auto-inhibitory peptide in the pipette solution. Finally, we demonstrate that tonic PKA-mediated modulation of Kv requires intact caveolae. Pre-treatment of the cells with methyl-?-cyclodextrin to deplete cellular cholesterol, or adding caveolin-scaffolding domain peptide to the pipette solution to disrupt caveolae-dependent signalling each attenuated PKA-mediated modulation of the Kv current. These findings highlight a novel, caveolae-dependent, tonic modulatory role of PKA on Kv channels providing new insight into mechanisms and the potential for pharmacological manipulation of vascular tone. PMID:25793374

  16. Synthesis of interleukin 6 (interferon-. beta. /sub 2//B cell stimulatory factor 2) in human fibroblasts is triggered by an increase in intracellular cyclic AMP

    SciTech Connect

    Zhange, Y.; Lin, J.X.; Vilcek, J.

    1988-05-05

    Interleukin 6 (IL-6; also referred to as interferon-..beta../sub 2/, 26-kDa protein, and B cell stimulatory factor 2) is a cytokine whose actions include a stimulation of immunoglobulin synthesis, enhancement of B cell growth, and modulation of acute phase protein synthesis by hepatocytes. Synthesis of IL-6 is stimulated by interleukin 1 (IL-1), tumor necrosis factor (TNF), or platelet-derived growth factor. The authors examined the role of the cyclic AMP (cAMP)-dependent signal transduction pathway in IL-6 gene expression. Several activators of adenylate cyclase, including prostaglandin E1, forskolin, and cholera toxin, as well as the phosphodiesterase inhibitor isobutylmethylxanthine and the cAMP analog dibutyryl cAMP, shared the ability to cause a dramatic and sustained increase in IL-6 mRNA levels in human FS-4 fibroblasts. Actinomycin D treatment abolished this enhancement. Treatments that increased intracellular cAMP also stimulated the secretion of the IL-6 protein in a biologically active form. Increased intracellular cAMP appears to enhance IL-6 gene expression by a protein kinase C-independent mechanism because down-regulation of protein kinase C by a chronic exposure of cells to a high dose of 12-O-tetradecanoylphorbol 13-acetate did not abolish the enhancement of IL-6 expression by treatments that increase cAMP. IL-1 and TNF too increased IL-6 mRNA levels by a protein kinase C-independent mechanism. The results suggest a role for the cAMP-dependent pathway(s) in IL-6 gene activation by TNF and IL-1.

  17. Phosphorylation of the protein kinase A catalytic subunit is induced by cyclic AMP deficiency and physiological stresses in the fission yeast, Schizosaccharomyces pombe

    SciTech Connect

    McInnis, Brittney; Mitchell, Jessica; Marcus, Stevan

    2010-09-03

    Research highlights: {yields} cAMP deficiency induces phosphorylation of PKA catalytic subunit (Pka1) in S. pombe. {yields} Pka1 phosphorylation is further induced by physiological stresses. {yields} Pka1 phosphorylation is not induced in cells lacking the PKA regulatory subunit. {yields} Results suggest that cAMP-independent Pka1 phosphorylation is stimulatory in nature. -- Abstract: In the fission yeast, Schizosaccharomyces pombe, cyclic AMP (cAMP)-dependent protein kinase (PKA) is not essential for viability under normal culturing conditions, making this organism attractive for investigating mechanisms of PKA regulation. Here we show that S. pombe cells carrying a deletion in the adenylate cyclase gene, cyr1, express markedly higher levels of the PKA catalytic subunit, Pka1, than wild type cells. Significantly, in cyr1{Delta} cells, but not wild type cells, a substantial proportion of Pka1 protein is hyperphosphorylated. Pka1 hyperphosphorylation is strongly induced in cyr1{Delta} cells, and to varying degrees in wild type cells, by both glucose starvation and stationary phase stresses, which are associated with reduced cAMP-dependent PKA activity, and by KCl stress, the cellular adaptation to which is dependent on PKA activity. Interestingly, hyperphosphorylation of Pka1 was not detected in either cyr1{sup +} or cyr1{Delta} S. pombe strains carrying a deletion in the PKA regulatory subunit gene, cgs1, under any of the tested conditions. Our results demonstrate the existence of a cAMP-independent mechanism of PKA catalytic subunit phosphorylation, which we propose could serve as a mechanism for inducing or maintaining specific PKA functions under conditions in which its cAMP-dependent activity is downregulated.

  18. CCR-08-0827 Version 2 Targeted inhibition of cyclic AMP phosphodiesterase-4 promotes brain tumor regression

    PubMed Central

    Goldhoff, Patricia; Warrington, Nicole; Limbrick, David D.; Hope, Andrew; Woerner, B. Mark; Jackson, Erin; Perry, Arie; Piwnica-Worms, David; Rubin, Joshua B.

    2008-01-01

    Statement of Clinical Relevance Therapies that can overcome the resistance of malignant brain tumors would be a major clinical advance. Here, we investigate the role of cAMP Phosphodiesterase-4 in stimulating brain tumor growth and the therapeutic utility of cAMP Phosphodiesterase-4 inhibition in the treatment of malignant brain tumors. Cyclic AMP Phosphodiesterase-4 was widely expressed in human brain tumors of glial and neuronal lineage, and forced expression of PDE4A1 accelerated intracranial glioblastoma and medulloblastoma xenograft growth. Moreover, targeted inhibition of PDE4, in combination with standard radiation and chemotherapy, induced a unique regression of established intracranial glioblastoma xenografts. These findings identify PDE4 as a novel molecular target for brain tumor therapy and indicate that PDE4 inhibition should be evaluated in clinical trials for malignant brain tumors. Purpose As favorable outcomes from malignant brain tumors remain limited by poor survival and treatment-related toxicity, novel approaches to cure are essential. Previously, we identified the cyclic AMP phosphodiesterase-4 (PDE4) inhibitor Rolipram as a potent anti-tumor agent. Here, we investigate the role of PDE4 in brain tumors and examine the utility of PDE4 as a therapeutic target. Experimental Design Immunohistochemistry was used to evaluate the expression pattern of a subfamily of PDE4, PDE4A, in multiple brain tumor types. To evaluate the effect of PDE4A on growth, a brain-specific isoform, PDE4A1 was overexpressed in xenografts of Daoy medulloblastoma and U87 glioblastoma cells. To determine therapeutic potential of PDE4 inhibition, Rolipram, temozolomide, and radiation were tested alone and in combination on mice bearing intracranial U87 xenografts. Results We found that PDE4A is expressed in medulloblastoma, glioblastoma, oligodendroglioma, ependymoma and meningioma. Moreover, when PDE4A1 was overexpressed in Daoy medulloblastoma and U87 glioblastoma cells, in vivo doubling times were significantly shorter for PDE4A1 overexpressing xenografts compared to controls. In long-term survival and bioluminescence studies, Rolipram in combination with first-line therapy for malignant gliomas (temozolomide and conformal radiation therapy) enhanced the survival of mice bearing intracranial xenografts of U87 glioblastoma cells. Bioluminescence imaging indicated that while temozolomide and radiation therapy arrested intracranial tumor growth, the addition of Rolipram to this regimen resulted in tumor regression. Conclusion This study shows that PDE4 is widely expressed in brain tumors and promotes their growth, and that inhibition with Rolipram overcomes tumor resistance and mediates tumor regression. PMID:19047098

  19. Increased intracellular cyclic AMP inhibits inositol phospholipid hydrolysis induced by perturbation of the T cell receptor/CD3 complex but not by G-protein stimulation. Association with protein kinase A-mediated phosphorylation of phospholipase C-gamma 1.

    PubMed Central

    Alava, M A; DeBell, K E; Conti, A; Hoffman, T; Bonvini, E

    1992-01-01

    Modulation of inositol phospholipid (InsPL) hydrolysis in response to increasing intracellular concentrations of cyclic AMP (cAMP) was studied in a murine T helper type II (Th2) lymphocyte clone, 8-5-5. Intact 8-5-5 cells produced maximal amounts of cAMP in response to prostaglandin E2 (PGE2), cholera toxin (CTx) or 7 beta-deacetyl-7 beta-(gamma-N-methylpiperazino)butyryl forskolin (dmpb-forskolin). cAMP generation reached a plateau after 5 min of treatment with dmpb-forskolin (300 microM) or PGE2 (1 microM), but required 60 min of treatment with CTx (1 microgram/ml). Preincubation of 8-5-5 cells with 1 microM-PGE2 or 300 microM-dmpb-forskolin (10 min at 37 degrees C) or with 1 microgram of CTx/ml (60 min at 37 degrees C) completely inhibited InsPL hydrolysis induced by perturbation of the T cell receptor (TCR)/CD3 complex with the monoclonal antibody 145.2C11. Preincubation with the cAMP analogue 8-bromo-cyclic AMP (8-Br-cAMP) also inhibited InsPL hydrolysis. Tetanolysin-permeabilized 8-5-5 cells produced cAMP in response to PGE2, dmpb-forskolin and guanosine 5'-[gamma-thio]triphosphate (GTP[S]), a non-cell-permeating, non-hydrolysable analogue of GTP that directly activates G-proteins. No inhibition of TCR/CD3-induced InsPL hydrolysis was observed under these conditions. InsPL hydrolysis was also unaffected when permeabilized cells were incubated with up to 10 mM-8-Br-cAMP, suggesting that permeabilized cells lost (a) soluble effector molecule(s) involved in mediating the inhibitory effect observed in intact cells. Treatment of 8-5-5 cells with dmpb-forskolin or CTx prior to permeabilization resulted in inhibition of TCR/CD3-induced InsPL hydrolysis, but did not affect InsPL hydrolysis induced via G-protein stimulation with GTP[S]. Treatment of permeabilized 8-5-5 cells with purified cAMP-dependent protein kinase (PKA) resulted in inhibition of TCR/CD3- but not GTP[S]-induced InsPL hydrolysis. This effect was associated with phosphorylation of phospholipase (PLC)-gamma 1 in the absence of phosphorylation of components of the TCR/CD3 complex. These results suggest that PKA-mediated phosphorylation of PLC may regulate TCR/CD3-induced InsPL hydrolysis. Images Fig. 7. PMID:1318020

  20. Acetate Regulation of Spore Formation Is under the Control of the Ras/Cyclic AMP/Protein Kinase A Pathway and Carbon Dioxide in Saccharomyces cerevisiae

    PubMed Central

    Jungbluth, Marc; Msch, Hans-Ulrich

    2012-01-01

    In Saccharomyces cerevisiae, the Ras/cyclic AMP (cAMP)/protein kinase A (PKA) pathway is a nutrient-sensitive signaling cascade that regulates vegetative growth, carbohydrate metabolism, and entry into meiosis. How this pathway controls later steps of meiotic development is largely unknown. Here, we have analyzed the role of the Ras/cAMP/PKA pathway in spore formation by the meiosis-specific manipulation of Ras and PKA or by the disturbance of cAMP production. We found that the regulation of spore formation by acetate takes place after commitment to meiosis and depends on PKA and appropriate A kinase activation by Ras/Cyr1 adenylyl cyclase but not by activation through the Gpa2/Gpr1 branch. We further discovered that spore formation is regulated by carbon dioxide/bicarbonate, and an analysis of mutants defective in acetate transport (ady2?) or carbonic anhydrase (nce103?) provided evidence that these metabolites are involved in connecting the nutritional state of the meiotic cell to spore number control. Finally, we observed that the potential PKA target Ady1 is required for the proper localization of the meiotic plaque proteins Mpc70 and Spo74 at spindle pole bodies and for the ability of these proteins to initiate spore formation. Overall, our investigation suggests that the Ras/cAMP/PKA pathway plays a crucial role in the regulation of spore formation by acetate and indicates that the control of meiotic development by this signaling cascade takes places at several steps and is more complex than previously anticipated. PMID:22660623

  1. Role of cyclic GMP in the mediation of circadian rhythmicity of the adenylate cyclase-cyclic AMP-phosphodiesterase system in Euglena.

    PubMed

    Tong, J; Edmunds, L N

    1993-05-25

    Cyclic AMP (cAMP) and cyclic GMP (cGMP) are two second messengers that have been proposed to act as a dualistic system in biological regulation. To determine if cGMP plays a role in the mediation of circadian rhythmicity of the adenylate cyclase (AC)-cAMP-phosphodiesterase (PDE) system in the achlorophyllous ZC mutant of the unicellular flagellate Euglena, the levels of cAMP and cGMP were monitored in synchronized cell populations, and the effects of the cGMP analog 8-bromo-cGMP (8-Br-cGMP) and the cGMP inhibitor 6-anilinoquinoline-5,8-quinone (LY 83583) on the activity of AC and PDE, as well as on the level of cAMP, were measured in vivo. A bimodal, 24-hr rhythm of cGMP content was found in both dividing and nondividing cultures in either a 12-hr:12-hr light-dark cycle or constant darkness. The peaks and troughs of the cGMP rhythm occurred 2 hr in advance of those of the cAMP rhythm that has been reported previously. The addition of 8-Br-cGMP at different circadian times increased the cAMP level in vivo by two to five times, whereas LY 83583 reduced the amplitude of the cAMP rhythm so that it disappeared. The effects of 8-Br-cGMP on the activity of AC and PDE were circadian phase-dependent and consistent with the changes in cAMP content. These findings suggest that cGMP may serve as an upstream effector that mediates the cAMP oscillation by regulation of the AC-cAMP-PDE system. PMID:8390260

  2. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  3. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  4. The roles of cyclic AMP-ERK-Bad signaling pathways on 6-hydroxydopamine-induced cell survival and death in PC12 cells.

    PubMed

    Park, Hyun Jin; Park, Keun Hong; Shin, Keon Sung; Lee, Myung Koo

    2013-12-01

    The roles of cyclic AMP (cAMP)-ERK1/2-Bad signaling pathways in 6-hydroxydopamine (6-OHDA)-induced cell survival and death were investigated. In PC12 cells, 6-OHDA (10-100?M) concentration-dependently increased the intracellular levels of cAMP mediated by the Ca(2+)-CaMKII-adenylyl cyclase system. 6-OHDA at the non-toxic level (10?M) induced transient ERK1/2 phosphorylation and BadSer112 phosphorylation, which maintained cell survival. In contrast, the high levels of cAMP induced by toxic levels (50 and 100?M) of 6-OHDA induced sustained ERK1/2 phosphorylaton and BadSer155 phosphorylation. The cells then moved to cell death process through Bcl2 phosphorylation and caspase-3 activation. BadSer155 phosphorylation by 6-OHDA was inhibited by PKA (H89) and MEK (U0126) inhibitors, indicating that it was mediated via the cAMP-PKA-sustained ERK1/2 system. In SK-N-BE(2)C cells, the non-toxic level of 6-OHDA also showed transient ERK1/2 phosphorylation and BadSer112 phosphorylation, and toxic levels of 6-OHDA exhibited sustained ERK1/2 phosphorylation and BadSer155 phosphorylation. These results suggest that ERK1/2 phosphorylation by 6-OHDA shows biphasic functions on cell survival and death in PC12 cells. It is, therefore, proposed that the cAMP-ERK1/2-Bad signaling pathways incurred by toxic levels of 6-OHDA play a role in dopamine neuron death of animal models of Parkinson's disease. PMID:24055892

  5. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  6. Ca/sup + +/- and cyclic AMP-induced changes in intact cell phosphorylation of ileal microvillus membrane proteins

    SciTech Connect

    Sharp, G.W.G.; Hannah, C.M.; Cohen, M.; Donowitz, M.

    1986-03-05

    Pieces of rabbit distal ileal mucosa, with the muscularis propria and serosa removed, were incubated for 90 minutes in Krebs-Ringer bicarborate buffer (KRB) with /sup 32/PO/sub 4/ to label the intracellular nucleotide pools. After rinsing, the mucosal pieces were transferred to KRB in the absence and presence of 10 ..mu..M A23187 or 10 mM theophylline. After a further 10 minutes the cells were scraped off and microvillus membranes prepared. The membranes were solubilized, subjected to two dimensional gel electrophoresis and autoradiography, and analyzed by densitometry. A23187 increased the phosphorylation of four microvillus membrane proteins with M/sub r/ of 32, 52, 110 and 116K. Increased phosphorylation of the 52 and 116K proteins has also been detected in microvillus membranes subjected to Ca/sup + +/ and calmodulin in the presence of ..gamma..-/sup 32/P-ATP. Theophylline increased the phosphorylation of the same 32 and 52K proteins and, additionally, of a second 32K peptide. While any of these proteins could be involved in the control of electrolyte transport, it is noteworthy that increased Ca/sup + +/, and increased cyclic AMP levels exert similar effects upon intestinal electrolyte transport. That A23187 and theophylline both increase the phosphorylation of the 32 and 52K proteins increases the possibility that these are involved in ion transport.

  7. Dopamine D1 receptor stimulation of cyclic AMP accumulation in COS-1 cells.

    PubMed

    Steffey, M E; Snyder, G L; Barrett, R W; Fink, J S; Ackerman, M; Adams, P; Bhatt, R; Gomez, E; MacKenzie, R G

    1991-08-14

    Dopamine is shown to stimulate cAMP accumulation in COS-1 cells via endogenously expressed dopamine D1 receptors. A dissociation of dopamine and beta-adrenoceptor responses is demonstrated by the use of selective antagonists and different desensitization patterns following exposure of the cells to dopamine or the beta-adrenoceptor agonist, isoproterenol. The dopamine response in COS-1 cells exhibits a pharmacological profile similar to that found in dopamine D1 tissues such as rat striatum and fish retina. The presence of DARPP-32 (dopamine- and cAMP-regulated phosphoprotein, Mr 32,000) immunoreactivity in COS-1 cells is shown by Western blotting and is consistent with the endogenous expression of a dopamine D1 receptor in these cells. It is concluded that a dopamine D1 receptor is expressed in COS-1 cells and the implications of this are discussed. PMID:1664335

  8. Cyclic AMP-mediated induction of ornithine decarboxylase of glioma and neuroblastoma cells.

    PubMed Central

    Bachrach, U

    1975-01-01

    The activity of ornithine decarboxylase (EC 4.1.1.17; L-ornithine carboxy-lyase) of C6-BU-1 glioma and N115 neuroblastoma cells increases significantly when confluent cultures are treated with compounds that increase cellular cAMP levels. These include norepinephrine or isoproterenol, and prostaglandin E1 or adenosine, which stimulate ornithine decarboxylase activity in C6-BU-1 glioma and N115 neuroblastoma cells, respectively. Ornithine decarboxylase activity is also elevated in confluent C6-BU-1 glioma cells treated with dibutyrylcAMP and theophylline, or after the glioma cells are fed with a serum-depleted medium in the presence of catecholamines and inhibitors of cyclic nucleotide phosphodiesterase. The activity of the enzyme increases 500- to 1000-fold, 2-6 hr after stationary-phase N115 neuroblastoma cells are fed with a serum-free medium, supplemented with phosphodiesterase inhibitors, adenosine, or prostaglandin E1. This stimulation is antagonized by carbamoyl choline and is blocked by actinomycin D or cycloheximide. These results suggest that the synthesis of ornithine decarboxylase of C6-BU-1 glioma and N115 neuroblastoma cells is controlled by cAMP. PMID:171652

  9. Cyclic Amp-Dependent Resuscitation of Dormant Mycobacteria by Exogenous Free Fatty Acids

    PubMed Central

    Shleeva, Margarita; Goncharenko, Anna; Kudykina, Yuliya; Young, Danielle; Young, Michael; Kaprelyants, Arseny

    2013-01-01

    One third of the world population carries a latent tuberculosis (TB) infection, which may reactivate leading to active disease. Although TB latency has been known for many years it remains poorly understood. In particular, substances of host origin, which may induce the resuscitation of dormant mycobacteria, have not yet been described. In vitro models of dormant (“non-culturable”) cells of Mycobacterium smegmatis (mc2155) and Mycobacterium tuberculosis H37Rv were used. We found that the resuscitation of dormant M. smegmatis and M. tuberculosis cells in liquid medium was stimulated by adding free unsaturated fatty acids (FA), including arachidonic acid, at concentrations of 1.6–10 µM. FA addition enhanced cAMP levels in reactivating M. smegmatis cells and exogenously added cAMP (3–10 mM) or dibutyryl-cAMP (0.5–1 mM) substituted for FA, causing resuscitation of M. smegmatis and M. tuberculosis dormant cells. A M. smegmatis null-mutant lacking MSMEG_4279, which encodes a FA-activated adenylyl cyclase (AC), could not be resuscitated by FA but it was resuscitated by cAMP. M. smegmatis and M. tuberculosis cells hyper-expressing AC were unable to form non-culturable cells and a specific inhibitor of AC (8-bromo-cAMP) prevented FA-dependent resuscitation. RT-PCR analysis revealed that rpfA (coding for resuscitation promoting factor A) is up-regulated in M. smegmatis in the beginning of exponential growth following the cAMP increase in lag phase caused by FA-induced cell activation. A specific Rpf inhibitor (4-benzoyl-2-nitrophenylthiocyanate) suppressed FA-induced resuscitation. We propose a novel pathway for the resuscitation of dormant mycobacteria involving the activation of adenylyl cyclase MSMEG_4279 by FAs resulted in activation of cellular metabolism followed later by increase of RpfA activity which stimulates cell multiplication in exponential phase. The study reveals a probable role for lipids of host origin in the resuscitation of dormant mycobacteria, which may function during the reactivation of latent TB. PMID:24376605

  10. Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclic AMP concentrations of eukaryotic cells.

    PubMed Central

    Leppla, S H

    1982-01-01

    Anthrax toxin is composed of three proteins: protective antigen (PA), lethal factor (LF), and edema factor (EF). These proteins individually cause no known physiological effects in animals but in pairs produce two toxic actions. Injection of PA with LF causes death of rats in 60 min, whereas PA with EF causes edema in the skin of rabbits and guinea pigs. The mechanisms of action of these proteins have not been determined. It is shown here that EF is an adenylate cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] produced by Bacillus anthracis in an inactive form. Activation occurs upon contact with a heat-stable eukaryotic cell material. The specific activity of the resulting adenylate cyclase nearly equals that of the most active known cyclase. In Chinese hamster ovary cells exposed to PA and EF, cAMP concentrations increase without a lag to values about 200-fold above normal, remain high in the continued presence of toxin, and decrease rapidly after its removal. The increase in cAMP is completely blocked by excess LF. It is suggested that PA interacts with cells to form a receptor system by which EF and perhaps LF gain access to the cytoplasm. Images PMID:6285339

  11. The effects of pro-opiomelanocortin peptides on cyclic AMP and tyrosinase in melanoma cells.

    PubMed

    Farah, J M; Bishop, J F; Nguyen, H Q; O'Donohue, T L

    1986-01-01

    Des-, mono-, and diacetylated melanotropin (des-, mono-, and di-Ac MSH, respectively) were compared for their dose-related effects on content of adenosine 3':5'-monophosphate (cAMP) and tyrosinase activity in the Cloudman S91 mouse melanoma tumor. Des-Ac MSH was more potent than the acetylated forms of MSH at increasing cellular levels of cAMP; mono- and di-Ac MSHs, however, were more potent than des-Ac MSH at elevating the activity of the enzyme, tyrosinase. Lysine-gamma1 MSH, a melanotropin from the amino terminus of pro-opiomelanocortin, exhibited slight stimulatory effects on tyrosinase and these actions were less than additive to those of mono-Ac MSH. Unlike their actions on amphibian skin-darkening or in mammalian behavior, neither beta-endorphin1-31 nor its derivatives, N-Ac-beta-endorphin1-27 or beta-endorphin30-31 (glycylglutamine), exhibited any influence on tyrosinase activity evoked by mono-Ac MSH in the tumor cells. PMID:3022251

  12. Cyclic-AMP Mediated Regulation of ABCB mRNA Expression in Mussel Haemocytes

    PubMed Central

    Franzellitti, Silvia; Fabbri, Elena

    2013-01-01

    Background The multixenobiotic resistance system (MXR) allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp). In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. Methodology/Principal Findings cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis) exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX) alone or in combination with 0.3 ng/L propranolol (PROP). FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin) and pharmacological modulators (PROP, forskolin, dbcAMP, and H89) of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT) decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. Conclusions This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels. PMID:23593491

  13. Cyclic AMP regulates the migration and invasion potential of human pancreatic cancer cells.

    PubMed

    Zimmerman, Noah P; Roy, Ishan; Hauser, Andrew D; Wilson, Jessica M; Williams, Carol L; Dwinell, Michael B

    2015-03-01

    Aggressive dissemination and metastasis of pancreatic ductal adenocarcinoma (PDAC) results in poor prognosis and marked lethality. Rho monomeric G protein levels are increased in pancreatic cancer tissue. As the mechanisms underlying PDAC malignancy are little understood, we investigated the role for cAMP in regulating monomeric G protein regulated invasion and migration of pancreatic cancer cells. Treatment of PDAC cells with cAMP elevating agents that activate adenylyl cyclases, forskolin, protein kinase A (PKA), 6-Bnz-cAMP, or the cyclic nucleotide phosphodiesterase inhibitor cilostamide significantly decreased migration and Matrigel invasion of PDAC cell lines. Inhibition was dose-dependent and not significantly different between forskolin or cilostamide treatment. cAMP elevating drugs not only blocked basal migration, but similarly abrogated transforming-growth factor-?-directed PDAC cell migration and invasion. The inhibitory effects of cAMP were prevented by the pharmacological blockade of PKA. Drugs that increase cellular cAMP levels decreased levels of active RhoA or RhoC, with a concomitant increase in phosphorylated RhoA. Diminished Rho signaling was correlated with the appearance of thickened cortical actin bands along the perimeter of non-motile forskolin or cilostamide-treated cells. Decreased migration did not reflect alterations in cell growth or programmed cell death. Collectively these data support the notion that increased levels of cAMP specifically hinder PDAC cell motility through F-actin remodeling. PMID:24115212

  14. Ezrin is a cyclic AMP-dependent protein kinase anchoring protein.

    PubMed Central

    Dransfield, D T; Bradford, A J; Smith, J; Martin, M; Roy, C; Mangeat, P H; Goldenring, J R

    1997-01-01

    cAMP-dependent protein kinase (A-kinase) anchoring proteins (AKAPs) are responsible for the subcellular sequestration of the type II A-kinase. Previously, we identified a 78 kDa AKAP which was enriched in gastric parietal cells. We have now purified the 78 kDa AKAP to homogeneity from gastric fundic mucosal supernates using type II A-kinase regulatory subunit (RII) affinity chromatography. The purified 78 kDa AKAP was recognized by monoclonal antibodies against ezrin, the canalicular actin-associated protein. Recombinant ezrin produced in either Sf9 cells or bacteria also bound RII. Recombinant radixin and moesin, ezrin-related proteins, also bound RII in blot overlay. Analysis of recombinant truncations of ezrin mapped the RII binding site to a region between amino acids 373 and 439. This region contained a 14-amino-acid amphipathic alpha-helical putative RII binding region. A synthetic peptide containing the amphipathic helical region (ezrin409-438) blocked RII binding to ezrin, but a peptide with a leucine to proline substitution at amino acid 421 failed to inhibit RII binding. In mouse fundic mucosa, RII immunoreactivity redistributed from a predominantly cytosolic location in resting parietal cells, to a canalicular pattern in mucosa from animals stimulated with gastrin. These results demonstrate that ezrin is a major AKAP in gastric parietal cells and may function to tether type II A-kinase to a region near the secretory canaliculus. PMID:9009265

  15. Cyclic AMP Mimics the Anti-ageing Effects of Calorie Restriction by Up-Regulating Sirtuin

    PubMed Central

    Wang, Zhuoran; Zhang, Lu; Liang, Yaru; Zhang, Chi; Xu, Zhiyu; Zhang, Lang; Fuji, Ryosuke; Mu, Wei; Li, Liyuan; Jiang, Junjun; Ju, Yong; Wang, Zhao

    2015-01-01

    Cyclic adenosine monophosphate (cAMP) plays an important role in many biological processes as a second messenger, and cAMP treatment has been reported to extend the lifespan of wild-type Drosophila melanogaster. Our study showed that exogenous cAMP improved ageing-related phenotypes by increasing the protein level of Sirtuins, which prevented metabolic disorders to mimic the effect of calorie restriction. Experiments in vitro showed that cAMP directly bound to SIRT1 and SIRT3 and consequently increased their activity. These findings suggest that cAMP slows the ageing process and is a good candidate to mimic calorie restriction. Our research provides a promising therapeutic strategy to target metabolic disorder-induced ageing-related diseases. PMID:26153625

  16. Binding of regulatory subunits of cyclic AMP-dependent protein kinase to cyclic CMP agarose.

    PubMed

    Hammerschmidt, Andreas; Chatterji, Bijon; Zeiser, Johannes; Schrder, Anke; Genieser, Hans-Gottfried; Pich, Andreas; Kaever, Volkhard; Schwede, Frank; Wolter, Sabine; Seifert, Roland

    2012-01-01

    The bacterial adenylyl cyclase toxins CyaA from Bordetella pertussis and edema factor from Bacillus anthracis as well as soluble guanylyl cyclase ?(1)?(1) synthesize the cyclic pyrimidine nucleotide cCMP. These data raise the question to which effector proteins cCMP binds. Recently, we reported that cCMP activates the regulatory subunits RI? and RII? of cAMP-dependent protein kinase. In this study, we used two cCMP agarose matrices as novel tools in combination with immunoblotting and mass spectrometry to identify cCMP-binding proteins. In agreement with our functional data, RI? and RII? were identified as cCMP-binding proteins. These data corroborate the notion that cAMP-dependent protein kinase may serve as a cCMP target. PMID:22808067

  17. Role of cyclic AMP in pulmonary xenobiotic metabolism with special emphasis on benzo(a)pyrene

    SciTech Connect

    Schaeffer, V.H.

    1986-01-01

    This thesis was intended to investigate the role of the intracellular regulator, cAMP, on pulmonary xenobiotic metabolism using the well-studied carcinogen, benzo(a)pyrene (BP) as a representative xenobiotic. Lung slices from rats administered N/sup 6/, O/sup 2/', dibutyryl cAMP (DcAMP), theophylline or forskolin, all of which elevated biologically reactive cAMP levels in the lung, showed an increased ability to metabolize (/sup 3/H)-BP. This effect occurred beyond 6 hr following treatment and reached a maximum at 12 hr, at a time when cAMP content had already peaked and returned to basal levels. The perfusion of BP through the isolated lungs of animals administered DcAMP in vivo indicated that the BP metabolites primarily responsible for the cyclic nucleotide-induced increase in metabolism were the 3-hydroxy BP, 9-hydroxy BP, BP 9, 10 diol, BP-glucuronides and BP-glutathione conjugates. Kinetic analysis indicated that the Km component of these reactions was altered without a corresponding change in Vmax, suggesting that elevated pulmonary cAMP content may be affecting the detoxication enzymes, UDP-glucuronyltransferase and sulfotransferase. Studies with pulmonary microsomes from DcAMP-treated animals indicated that the cyclic nucleotide not only enhanced the hydroxylation of BP but also the cytochrome P450-dependent hydroxylation of coumarin. This is supported by the fact that DcAMP administration in vivo also enhanced phosphorylation of two classes of nuclear proteins, histones and nuclear acidic proteins, believed to play a role in the transcription of RNA and DNA.

  18. Regulation of cyclic AMP metabolism by prostaglandins in rabbit cortical collecting tubule cells

    SciTech Connect

    Sonnenburg, W.K.

    1987-01-01

    In the rabbit cortical collecting tubule (RCCT), prostaglandin E/sub 1/ (PGE/sub 1/) and prostaglandin E/sub 2/ (PGE/sub 2/) at 1 nM inhibit arginine-vasopressin (AVP)-induced water reabsorption, while 100 nM PGE/sub 1/ and PGE/sub 2/ alone stimulate water reabsorption. Reported here are studies designed to investigate the molecular basis for the biphasic physiological action of PGE/sub 1/ and PGE/sub 2/ in the collecting duct. In freshly isolated RCCT cells, PGE/sub 1/, PGE/sub 2/, and 16,16-dimethyl-PGE/sub 2/ (DM-PGE/sub 2/) stimulated cAMP synthesis at concentrations ranging from 0.1 to 10 M. Other prostaglandins including the synthetic PGE/sub 2/ analogue, sulprostone, failed to stimulate cAMP synthesis. Moreover, sulprostone did not antagonize PGE/sub 2/-stimulated cAMP formation. In contrast, PGE/sub 2/ and sulprostone at concentrations ranging from 1 to 100 nM, inhibited AVP-induced cAMP accumulation in freshly isolated RCCT cells. PGE/sub 2/, PGE/sub 1/, DM-PGE/sub 2/ and sulprostone at 100 nM were equally effective in inhibiting AVP-induced cAMP formation. Moreover sulprostone inhibited AVP-stimulated adenylate cyclase activity. These results suggest that PGE derivatives mediate either inhibition or activation of adenylate cyclase by stimulating different PGE receptors. To further test this concept, PGE/sub 2/ binding to freshly isolated RCCT cell membranes was characterized. Two different classes of PGE/sub 2/ binding were detected. //sup 3/H/PGE/sub 2/ binding to the high affinity class of sites was increased by the GTP-analogue, GTP S, while pertussis toxin pretreatment blocked the stimulatory action. In contrast, //sup 3/H/ PGE/sub 2/ binding to the low affinity class of sites was decreased by GTP S; this inhibitory effect was not blocked by pertussis toxin pretreatment.

  19. Cyclic AMP-dependent protein lysine acylation in mycobacteria regulates fatty acid and propionate metabolism.

    PubMed

    Nambi, Subhalaxmi; Gupta, Kallol; Bhattacharyya, Moitrayee; Ramakrishnan, Parvathy; Ravikumar, Vaishnavi; Siddiqui, Nida; Thomas, Ann Terene; Visweswariah, Sandhya S

    2013-05-17

    Acetylation of lysine residues is a posttranslational modification that is used by both eukaryotes and prokaryotes to regulate a variety of biological processes. Here we identify multiple substrates for the cAMP-dependent protein lysine acetyltransferase from Mycobacterium tuberculosis (KATmt). We demonstrate that a catalytically important lysine residue in a number of FadD (fatty acyl CoA synthetase) enzymes is acetylated by KATmt in a cAMP-dependent manner and that acetylation inhibits the activity of FadD enzymes. A sirtuin-like enzyme can deacetylate multiple FadDs, thus completing the regulatory cycle. Using a strain deleted for the KATmt ortholog in Mycobacterium bovis Bacillus Calmette-Guérin (BCG), we show for the first time that acetylation is dependent on intracellular cAMP levels. KATmt can utilize propionyl CoA as a substrate and, therefore, plays a critical role in alleviating propionyl CoA toxicity in mycobacteria by inactivating acyl CoA synthetase (ACS). The precision by which mycobacteria can regulate the metabolism of fatty acids in a cAMP-dependent manner appears to be unparalleled in other biological organisms and is ideally suited to adapt to the complex environment that pathogenic mycobacteria experience in the host. PMID:23553634

  20. Dose and chemical modification considerations for continuous cyclic AMP analog delivery to the injured CNS.

    PubMed

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D; Pearse, Damien D

    2009-05-01

    In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1-250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  1. Parathyroid hormone promotes the disassembly of cytoskeletal actin and myosin in cultured osteoblastic cells: Mediation by cyclic AMP

    SciTech Connect

    Egan, J.J.; Gronowicz, G.; Rodan, G.A. )

    1991-01-01

    Parathyroid hormone (PTH) alters the shape of osteoblastic cells both in vivo and in vitro. In this study, we examined the effect of PTH on cytoskeletal actin and myosin, estimated by polyacrylamide gel electrophoresis of Triton X-100 (1%) nonextractable proteins. After 2-5 minutes, PTH caused a rapid and transient decrease of 50-60% in polymerized actin and myosin associated with the Triton X-100 nonextractable cytoskeleton. Polymerized actin returned to control levels by 30 min. The PTH effect was dose-dependent with an IC50 of about 1 nM, and was partially inhibited by the (3-34) PTH antagonist. PTH caused a rapid transient rise in cyclic AMP (cAMP) in these cells that peaked at 4 min, while the nadir in cytoskeletal actin and myosin was recorded around 5 min. The intracellular calcium chelator Quin-2/AM (10 microM) also decreased cytoskeletal actin and myosin, to the same extent as did PTH (100 nM). To distinguish between cAMP elevation and Ca++ reduction as mediators of PTH action, we measured the phosphorylation of the 20 kD (PI 4.9) myosin light chain in cells preincubated with (32P)-orthophosphate. The phosphorylation of this protein decreased within 2-3 min after PTH addition and returned to control levels after 5 min. The calcium ionophore A-23187 did not antagonize this PTH effect. Visualization of microfilaments with rhodamine-conjugated phalloidin showed that PTH altered the cytoskeleton by decreasing the number of stress fibers. These changes in the cytoskeleton paralleled changes in the shape of the cells from a spread configuration to a stellate form with retracting processes. The above findings indicate that the alteration in osteoblast shape produced by PTH involve relatively rapid and transient changes in cytoskeletal organization that appear to be mediated by cAMP.

  2. Occupancy of adenosine receptors raises cyclic AMP alone and in synergy with occupancy of chemoattractant receptors and inhibits membrane depolarization.

    PubMed Central

    Cronstein, B N; Kramer, S B; Rosenstein, E D; Korchak, H M; Weissmann, G; Hirschhorn, R

    1988-01-01

    We have recently demonstrated that adenosine, acting via adenosine A2 receptors, inhibits generation of superoxide anions (O2-) by stimulated neutrophils. To determine the mechanism(s) by which adenosine inhibits O2- generation stimulated by the chemoattractant N-formylmethionylleucylphenylalanine (FMLP), we examined cyclic AMP (cAMP) concentrations, stimulated membrane depolarization and Ca2+ movements. Neither adenosine nor 5'-N-ethylcarboxamidoadenosine (NECA), the most potent agonist at adenosine A2 receptors, increases neutrophil cAMP content. However in the presence of the non-methylxanthine phosphodiesterase inhibitor, Ro-20-1724, both adenosine and NECA elicit a reversible increase in intracellular cAMP concentration. The chemoattractant FMLP also elicits an increment in the neutrophil cAMP content. NECA, in the presence of Ro-20-1724, synergistically enhances the increment in cAMP following stimulation by FMLP. However Ro-20-1724 does not potentiate the inhibition of O2- generation by NECA. Unlike other agents which increase neutrophil cAMP concentrations, NECA, even in the presence of a phosphodiesterase inhibitor, only trivially inhibits degranulation. We also found that adenosine markedly inhibits stimulated membrane depolarization but does not affect the stimulated increment in free ionized intracellular calcium. Moreover, inhibition by adenosine of O2- generation does not vary with the concentration of extracellular calcium. These results fulfil the last criterion for the demonstration of an A2 receptor on human neutrophils, and indicate that adenosine occupies an A2 receptor on neutrophils to raise intracellular cAMP in synergy with occupancy of the FMLP receptor. The results reported here also indicate that cAMP is not the second messenger for inhibition of O2- generation by adenosine and its analogues. PMID:2844154

  3. Functional Roles of arcA, etrA, Cyclic AMP (cAMP)-cAMP Receptor Protein, and cya in the Arsenate Respiration Pathway in Shewanella sp. Strain ANA-3?

    PubMed Central

    Murphy, Julie N.; Durbin, K. James; Saltikov, Chad W.

    2009-01-01

    Microbial arsenate respiration can enhance arsenic release from arsenic-bearing mineralsa process that can cause arsenic contamination of water. In Shewanella sp. strain ANA-3, the arsenate respiration genes (arrAB) are induced under anaerobic conditions with arsenate and arsenite. Here we report how genes that encode anaerobic regulator (arcA and etrA [fnr homolog]) and carbon catabolite repression (crp and cya) proteins affect arsenate respiration in ANA-3. Transcription of arcA, etrA, and crp in ANA-3 was similar in cells grown on arsenate and cells grown under aerobic conditions. ANA-3 strains lacking arcA and etrA showed minor to moderate growth defects, respectively, with arsenate. However, crp was essential for growth on arsenate. In contrast to the wild-type strain, arrA was not induced in the crp mutant in cultures shifted from aerobic to anaerobic conditions containing arsenate. This indicated that cyclic AMP (cAMP)-cyclic AMP receptor (CRP) activates arr operon transcription. Computation analysis for genome-wide CRP binding motifs identified a putative binding motif within the arr promoter region. This was verified by electrophoretic mobility shift assays with cAMP-CRP and several DNA probes. Lastly, four putative adenylate cyclase (cya) genes were identified in the genome. One particular cya-like gene was differentially expressed under aerobic versus arsenate respiration conditions. Moreover, a double mutant lacking two of the cya-like genes could not grow with arsenate as a terminal electron acceptor; exogenous cAMP could complement growth of the double cya mutant. It is concluded that the components of the carbon catabolite repression system are essential to regulating arsenate respiratory reduction in Shewanella sp. strain ANA-3. PMID:19060154

  4. Purification, characterization and analysis of rolipram inhibition of a human type-IVA cyclic AMP-specific phosphodiesterase expressed in yeast.

    PubMed Central

    Wilson, M; Sullivan, M; Brown, N; Houslay, M D

    1994-01-01

    Analyses were done on a human type-IV cyclic AMP (cAMP) phosphodiesterase (hPDE-IVA-h6.1) expressed in an engineered strain of Saccharomyces cerevisiae. This strain (YMS6) expressed soluble PDE activity, together with an insoluble activity which was not released by re-homogenization, treatment with high-ionic-strength solutions or with the detergent Triton X-100. Pellet and soluble PDE activities were typical of type-IV PDE. They were cAMP-specific, insensitive to the addition of either cGMP (1 microM) or Ca2+/calmodulin, and inhibited by rolipram. Thermostability studies showed both activities to decay as single exponentials, indicating the presence of homogeneous PDE protein species in each fraction. Pellet PDE activity was more thermostable than the soluble enzyme. Mg2+ and Mn2+ dose-dependently increased PDE activity and reversed the inactivating effect of EDTA.h6.1 was engineered to express a C-terminal five-histidine motif (h6.1his5). This allowed purification of the PDE to apparent homogeneity in a simple two-step process involving a rolipram affinity column and a Ni2(+)-chelate column. A single monomeric protein of subunit molecular mass approximately 73 kDa and native molecular mass approximately 74 kDa resulted after a approximately 53000-fold purification. This exhibited a Km for cAMP of 8 microM, a true Vmax. of 0.8 mumol of cAMP hydrolysed/min per mg of PDE protein, a kcat. of 3702 s-1, and a value of the specificity constant kcat/Km of 4.6 x 10(8) M-1.s-1, the last implying a diffusion controlled reaction. Rolipram (Ki 0.4 soluble; 0.7 microM pellet) and 3-isobutyl-1-methylxanthine (Ki 15 soluble; 19 microM pellet) served as simple competitive inhibitors for both soluble and pellet forms of h6.1, respectively. Images Figure 1 PMID:7528009

  5. The insulin- and glucagon-stimulated 'dense-vesicle' high-affinity cyclic AMP phosphodiesterase from rat liver. Purification, characterization and inhibitor sensitivity.

    PubMed Central

    Pyne, N J; Cooper, M E; Houslay, M D

    1987-01-01

    The hormone-stimulated 'dense-vesicle' cyclic AMP phosphodiesterase was solubilized as a proteolytically 'clipped' species, and purified to apparent homogeneity from rat liver with a 2000-3000-fold purification and a 13-18% yield. It appeared to be a dimer (Mr 112,000), of two Mr-57,000 subunits. Solubilization of either a liver or a hepatocyte membrane fraction, with sodium cholate in the presence of the protein inhibitor benzamidine, identified three protein bands which could be immunoprecipitated by a polyclonal antibody raised against the pure enzyme. The major band at Mr 62,000 is suggested to be the native 'dense-vesicle' enzyme, having a Mr-5000 extension which serves to anchor this enzyme to the membrane and which is cleaved off during proteolytic solubilization; the Mr-200,000 band is an aggregate of the Mr-62,000 species, and the Mr-63,000 species is possibly a precursor. The purified 'clipped' enzyme hydrolysed cyclic AMP with kinetics indicative of apparent negative co-operativity, with a Hill coefficient (h) of 0.43 and limiting kinetic constants of Km1 = 0.3 +/- 0.05 microM, Km2 = 29 +/- 6 microM, Vmax.1 = 0.114 +/- 0.015 unit/mg of protein and Vmax.2 = 0.633 +/- 0.054 unit/mg of protein. It hydrolysed cyclic GMP with Michaelis kinetics, Km = 10 +/- 1 microM and Vmax. = 4.1 +/- 0.2 units/mg of protein. Cyclic GMP was a potent inhibitor of cyclic AMP hydrolysis, with an IC50 (concn. giving 50% inhibition) of 0.20 +/- 0.01 microM-cyclic GMP when assayed at 0.1 microM-cyclic AMP. This enzyme was inhibited potently by several drugs known to exert positive inotropic effects on the heart, was extremely thermolabile, with a half-life of 4.5 +/- 0.5 min at 40 degrees C, and was shown to be distinct from the rat liver insulin-stimulated peripheral-plasma-membrane cyclic AMP phosphodiesterase [Marchmont, Ayad & Houslay (1981) Biochem. J. 195, 645-652]. Images Fig. 3. Fig. 4. Fig. 6. PMID:3036087

  6. Pharmacological modulation of platelet-activating factor (PAF) release from rabbit leucocytes. I. Role of cAMP.

    PubMed Central

    Bussolino, F; Benveniste, J

    1980-01-01

    Basophil-rich rabbit leucocytes sensitized by anti-horseradish peroxidase antibodies released platelet-activating factor (PAF) and histamine upon exposure to the specific antigen. This release was preceded and accompanied by a sharp decrease in the intracellular concentration of cyclic AMP. Isoproterenol, a beta-adrenergic agent, and theophylline, a phosphodiesterase inhibitor, used individually or in combination, increased the intracellular concentration of cyclic AMP and inhibited the release of both PAF and histamine. Propranolol, a beta-adrenergic blocking agent, suppressed the effect of isoproterenol on cyclic AMP level and mediator release. Dibutyryl cyclic AMP, an alkylated derivative of cyclic AMP, inhibited PAF and histamine release. These results indicate that cyclic AMP, which is known to control the release of other mediators of immediate hypersensitivity, also regulates the release of PAF. Histamine and PAF followed one another closely in all of our release or inhibition experiments, bringing more evidence for the basophil origin of PAF. PMID:6159308

  7. Genetic regulation of glycogen biosynthesis in Escherichia coli: in vitro effects of cyclic AMP and guanosine 5'-diphosphate 3'-diphosphate and analysis of in vivo transcripts.

    PubMed Central

    Romeo, T; Preiss, J

    1989-01-01

    Glycogen accumulation in Escherichia coli is inversely related to the growth rate and occurs most actively when cells enter the stationary phase. The levels of the three biosynthetic enzymes undergo corresponding changes under these conditions, suggesting that genetic control of enzyme biosynthesis may account for at least part of the regulation (J. Preiss, Annu. Rev. Microbiol. 38:419-458, 1984). We have begun to explore the molecular basis of this control by identifying factors which affect the expression of the glycogen genes and by determining the 5'-flanking regions required to mediate the regulatory effects. The in vitro coupled transcription-translation of two of the biosynthetic genes, glgC (ADPglucose pyrophosphorylase) and glgA (glycogen synthase), was enhanced up to 26- and 10-fold, respectively, by cyclic AMP (cAMP) and cAMP receptor protein (CRP). Guanosine 5'-diphosphate 3'-diphosphate stimulated the expression of these genes 3.6- and 1.8-fold, respectively. The expression of glgB (glycogen branching enzyme) was affected weakly or negligibly by the above-mentioned compounds. Assays which measured the in vitro formation of the first dipeptide of glgC showed that a restriction fragment which contained 0.5 kilobases of DNA upstream from the initiation codon supported cAMP-CRP-activated expression. Sequence-specific binding of cAMP-CRP to a 243-base-pair restriction fragment from the region upstream from glgC was observed by virtue of the altered electrophoretic mobility of the bound DNA. S1 nuclease protection analysis identified 5' termini of four in vivo transcripts within 0.5 kilobases of the glgC coding region. The relative concentrations of transcripts were higher in the early stationary phase than in the exponential phase. Two mutants which overproduced the biosynthesis enzymes accumulated elevated levels of specific transcripts. The 5' termini of three of the transcripts were mapped to a high resolution. Their upstream sequences showed weak similarity to the E. coli consensus promoter. These results suggest complex transcriptional regulation of the glycogen biosynthesis genes involving multiple promoter sites and direct control of gene expression by at least two global regulatory systems. Images PMID:2468650

  8. Abnormal function of the vasopressin-cyclic-AMP-aquaporin2 axis during urine concentrating and diluting in patients with reduced renal function. A case control study

    PubMed Central

    2010-01-01

    Background The kidneys ability to concentrate and dilute urine is deteriorated during progressive renal insufficiency. We wanted to test the hypothesis that these phenomena could be attributed to an abnormal function of the principal cells in the distal part of the nephron. Methods Healthy control subjects and patients with chronic kidney diseases were studied. Group 1 comprised healthy subjects, n = 10. Groups 2-4 comprised patients with chronic kidney disease (Group 2, n = 14, e-GFR ? 90 m1/min; Group 3, n = 11, 60 m1/min ? e-GFR < 90 ml/min; and Group 4, n = 16, 15 ml/min ? e-GFR < 60 ml/min). The subjects collected urine during 24 hours. A urine concentrating test was done by thirsting during the following 12 hours. Thereafter, a urine diluting test was performed with a water load of 20 ml/kg body weight. The effect variables were urinary excretions of aquaporin2 (u-AQP2), cyclic-AMP (u-c-AMP), urine volume (UV), free water clearance (CH2O), urine osmolarity (u-Osm), and plasma arginine vasopressin (p-AVP). Results After fluid deprivation, u-Osm increased. In all groups, UV and CH2O decreased and u-AQP2 and u-c-AMP increased in Groups 1 and 2, but were unchanged in Group 3 and 4. P-AVP was significantly higher in Group 4 than in the other groups. During urine diluting, UV and CH2O reached significantly higher levels in Groups 1-3 than Group 4. Both before and after water loading, u-AQP2 and p-AVP were significantly higher and u-c-AMP was significantly lower in Group 4 than the other groups. Estimated-GFR was correlated negatively to p-AVP and positively to u-c-AMP. Conclusions Patients with moderately severe chronic kidney disease have a reduced renal concentrating and diluting capacity compared to both patients with milder chronic kidney disease and healthy control subjects. These phenomena can be attributed, at least partly, to an abnormally decreased response in the AVP-c-AMP-AQP2 axis. ClinicalTrials.Gov Identifier: NCT00313430 PMID:20923561

  9. Pharmacological characterization of the dopamine receptor coupled to cyclic AMP formation expressed by rat mesenteric artery vascular smooth muscle cells in culture.

    PubMed Central

    Hall, A. S.; Bryson, S. E.; Vaughan, P. F.; Ball, S. G.; Balmforth, A. J.

    1993-01-01

    1. Mesenteric artery vascular smooth muscle cells derived from male Wistar rats and grown in culture were prelabelled with [3H]-adenine and exposed to a range of dopamine receptor agonists and antagonists. Resultant [3H]-cyclic AMP formation was determined and concentration-effect curves constructed, in the presence of propranolol (10-6) M) and the phosphodiesterase inhibitor IBMX (5 x 10(-4) M). 2. Ka apparent values for D1/DA1 dopamine receptor agonists SKF 38393, fenoldopam, 6,7-ADTN, and dopamine were 0.06, 0.59, 4.06 and 5.77 x 10(-6) M respectively. Although fenoldopam and SKF 38393 were more potent than dopamine, they were partial agonists with efficacies, relative to dopamine of approximately 48% and 24% respectively. 6,7-ADTN, in contrast, behaved as a full agonist. 3. Dopamine-stimulated cyclic AMP formation was inhibited in a concentration-dependent manner by the D1/DA1 dopamine receptor selective antagonists, SCH 23390 and cis-flupenthixol (Ki values 0.53 and 36.1 x 10(-1) M respectively). In contrast, the D2/DA2 dopamine receptor selective antagonists, domperidone and (-)-sulpiride, were less potent (Ki values 2.06 and 5.82 x 10(-6) M respectively). Furthermore, the stereoisomers of SCH 23390 and cis-flupenthixol, SCH 23388 and trans-flupenthixol, were at least two orders of magnitude less potent (Ki values 0.14 and 13.2 x 10(-6) M respectively) indicating the stereoselective nature of this receptor. 4. Our results indicate that rat mesenteric artery vascular smooth muscle cells in culture express a dopamine receptor coupled to cyclic AMP formation, which has the pharmacological profile, characteristic of the D1 dopamine receptor subfamily. PMID:7902178

  10. Cyclic AMP deficiency negatively affects cell growth and enhances stress-related responses in tobacco Bright Yellow-2 cells.

    PubMed

    Sabetta, Wilma; Vannini, Candida; Sgobba, Alessandra; Marsoni, Milena; Paradiso, Annalisa; Ortolani, Francesca; Bracale, Marcella; Viggiano, Luigi; Blanco, Emanuela; de Pinto, Maria Concetta

    2016-03-01

    Cyclic adenosine 3',5'-monophosphate (cAMP) is a recognized second messenger; however, knowledge of cAMP involvement in plant physiological processes originates primarily from pharmacological studies. To obtain direct evidence for cAMP function in plants, tobacco Bright Yellow-2 (BY-2) cells were transformed with the cAMP sponge, which is a genetically encoded tool that reduces cAMP availability. BY-2 cells expressing the cAMP sponge (cAS cells), showed low levels of free cAMP and exhibited growth inhibition that was not proportional to the cAMP sponge transcript level. Growth inhibition in cAS cells was closely related to the precocious inhibition of mitosis due to a delay in cell cycle progression. The cAMP deficiency also enhanced antioxidant systems. Remarkable changes occurred in the cAS proteomic profile compared with that of wild-type (WT) cells. Proteins involved in translation, cytoskeletal organization, and cell proliferation were down-regulated, whereas stress-related proteins were up-regulated in cAS cells. These results support the hypothesis that BY-2 cells sense cAMP deficiency as a stress condition. Finally, many proteasome subunits were differentially expressed in cAS cells compared with WT cells, indicating that cAMP signaling broadly affects protein degradation via the ubiquitin/proteasome pathway. PMID:26786166

  11. Dopamine and cyclic AMP-regulated phosphoprotein immunoreactive neurons are innervated by axon terminals immunopositive for vasoactive intestinal polypeptide in the bed nuclei of the stria terminalis and central nucleus of the amygdala.

    PubMed

    Kozicz, Tams

    2003-02-01

    The bed nuclei of the stria terminalis (BST) and the central nucleus of the amygdala (CeA) are highly heterogeneous structures, which play a central role in the modulation and/or regulation of stress responses. The oval nucleus of the anterior division of BST (BSTov) and the CeA exhibit several dopamine and cyclic AMP-regulated phosphoprotein (DARPP-32) immunoreactive (ir) neurons. It has been demonstrated that DARPP-32, if phosphorylated, can inhibit protein-phophatase-1, thereby controlling other neuropeptide/neurotransmitter actions. In addition, a dense network of vasoactive polypeptide (VIP) immunoreactive axon terminals was also observed here. VIP, via its receptors, increases intracellular cAMP levels, therefore it can play an important role in regulating the phosphorylation of DARPP-32. Since the localization of DARPP-32- and VIP-ir neuronal structures overlaps in the BSTov and CeA, the aim of this study was to investigate the possible synaptic innervation of DARPP-32-ir neurons by fiber terminals immunopositive for VIP, to provide anatomical evidence for the interaction between a neuropeptide and a phosphoprotein. In summary, this study for the first time demonstrated that VIP-ir axon terminals innervate DARPP-32 perikarya and dendrites in the BSTov and CeA, which play an important role in the central autonomic regulation of stress responses. In addition, morphological evidence for possible interaction between neuropeptides and phosphoproteins was also provided at the electron microscopic level. PMID:12543476

  12. Niflumic acid-sensitive ion channels play an important role in the induction of glucose-stimulated insulin secretion by cyclic AMP in mice

    PubMed Central

    Fujimoto, W.; Miki, T.; Ogura, T.; Zhang, M.; Seino, Y.; Satin, L. S.; Nakaya, H.

    2015-01-01

    Aims/hypothesis We have previously reported that glucose-stimulated insulin secretion (GSIS) is induced by glucagon-like peptide-1 (GLP-1) in mice lacking ATP-sensitive K+ (KATP) channels (Kir6.2?/? mice [up-to-date symbol for Kir6.2 gene is Kcnj11]), in which glucose alone does not trigger insulin secretion. This study aimed to clarify the mechanism involved in the induction of GSIS by GLP-1. Methods Pancreas perfusion experiments were performed using wild-type (Kir6.2+/+) or Kir6.2?/? mice. Glucose concentrations were either changed abruptly from 2.8 to 16.7 mmol/l or increased stepwise (1.4 mmol/l per step) from 2.8 to 12.5 mmol/l. Electrophysiological experiments were performed using pancreatic beta cells isolated from Kir6.2?/? mice or clonal pancreatic beta cells (MIN6 cells) after pharmacologically inhibiting their KATP channels with glibenclamide. Results The combination of cyclic AMP plus 16.7 mmol/l glucose evoked insulin secretion in Kir6.2?/? pancreases where glucose alone was ineffective as a secretagogue. The secretion was blocked by the application of niflumic acid. In KATP channel-inactivated MIN6 cells, niflumic acid similarly inhibited the membrane depolarisation caused by cAMP plus glucose. Surprisingly, stepwise increases of glucose concentration triggered insulin secretion only in the presence of cAMP or GLP-1 in Kir6.2+/+, as in Kir6.2?/? pancreases. Conclusions/interpretation Niflumic acid-sensitive ion channels participate in the induction of GSIS by cyclic AMP in Kir6.2?/? beta cells. Cyclic AMP thus not only acts as a potentiator of insulin secretion, but appears to be permissive for GSIS via novel, niflumic acid-sensitive ion channels. This mechanism may be physiologically important for triggering insulin secretion when the plasma glucose concentration increases gradually rather than abruptly. PMID:19266181

  13. Distinct receptors, second messengers and conductances underlying the dual responses to serotonin in an identified leech neurone.

    PubMed

    Sanchez-Armass, S; Merz, D C; Drapeau, P

    1991-01-01

    1. Pressure-sensitive mechanosensory (P) neurones of the leech Hirudo medicinalis produce two responses to serotonin (5-HT): activation of a Cl- conductance and of a non-selective monovalent cation conductance. The effects of channel blockers, the receptor pharmacology and the second-messenger dependence of these responses were studied in voltage-clamped P cells in culture. Antagonists were applied by superfusion and agonists by pressure ejection. 2. Zn2+ (100 mumol l-1) and H+ (pH 6.5 and lower) reversibly reduced the Cl- conductance activated by 5-HT. The cation conductance was impermeant to calcium ions and was reduced by micromolar concentrations of the Na+ channel inhibitors amiloride and 3,4-dichlorobenzamil. 3. High concentrations of antagonists or agonists of 5-HT1 receptors and an antagonist of 5-HT3 receptors had no effect on either response of P cells to 5-HT. Micromolar concentrations of ketanserin or cyproheptadine, which selectively antagonize 5-HT2 receptors, reduced the cation but not the Cl- conductance. From these results, the receptor underlying the cation conductance appears to be of the 5-HT2 subtype, whereas the receptor activating the Cl- conductance does not fit within the mammalian classification scheme. 4. Brief (less than 500 ms) application of membrane-permeant agonists of the second messenger cyclic AMP elicited a Cl- conductance, whereas antagonists of cyclic-AMP-dependent protein kinase A reversibly suppressed the Cl- conductance elicited by 5-HT and by cyclic AMP agonists. Compounds affecting other second messenger pathways were without effect on the Cl- conductance. It therefore appears that the Cl- conductance is activated by cyclic-AMP-dependent protein kinase A. 5. Cyclic nucleotide agonists and antagonists were without effect on the cation conductance. However, brief application of phorbol esters, which activate protein kinase C, elicited an amiloride-sensitive cation current. An inhibitor of protein kinase C reduced the cation conductance activated by 5-HT and by phorbol esters. Therefore, the cation conductance appears to depend on activation of protein kinase C. 6. We conclude that 5-HT activates two types of receptor coupled to separate ionic channels via different second messenger pathways in P cells. A receptor that is distinct from the mammalian subtypes activates Cl- channels via cyclic-AMP-dependent protein kinase A. 5-HT2 receptors appear to activate cation channels by means of protein kinase C. PMID:1849957

  14. Cyclic AMP stimulation of transferrin secretion by breast cancer cell grown on extracellular matrix or in two-compartment culture chambers

    SciTech Connect

    Vandewalle, B.; Hornez, L.; Revillion, F.; Lefebvre, J. )

    1991-06-28

    Extrahepatic synthesis and secretion of transferrin (Tf), the major iron-carrying protein, have been described in normal and tumoral tissues suggesting a potential role for paracrine or autocrine function. In breast tumor cell MCF-7, we have previously shown a Tf secretion stimulated by estradiol which might confer selective growth advantages of these rapidly proliferating cells. The present work refers to possible additional Tf functions related to differentiation of breast tumor cells. We induced MCF-7 cell differentiation by the cyclic AMP derivative, dibutyryl cAMP (dB cAMP) and studied Tf secretion in different culture conditions after labeling with (35S) methionine. Our results demonstrate that dB cAMP stimulates Tf secretion only in culture environment that permits access to the basolateral surface and caters to the polarity requirements of the cell. These results suggest that Tf may also act as a modulator of cellular differentiation in breast cancer cells.

  15. Effect of beta-ADrenergic Agonist on Cyclic AMP Synthesis in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Because it seems logical that these agonists exert their action on muscle through stimulation of cAMP synthesis, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax levels were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. In addition, the EC50 values for isoproterenol, cimaterol, clenbuterol, epinephrine, and albuterol were 360 nM, 630 nM, 900 nM, 2,470 nM, and 3,650 nM, respectively. Finally, dose response curves show that the concentrations of cimaterol and clenbuterol in culture media at concentrations known to cause significant muscle hypertrophy in animals had no detectable effect on stimulation of CAMP accumulation in chicken skeletal muscle cells.

  16. Involvement of a putative cyclic amp receptor protein (CRP)-like binding sequence and a CRP-like protein in glucose-mediated catabolite repression of thn genes in Rhodococcus sp. strain TFB.

    PubMed

    Toms-Gallardo, Laura; Santero, Eduardo; Floriano, Beln

    2012-08-01

    Glucose catabolite repression of tetralin catabolic genes in Rhodococcus sp. strain TFB was shown to be exerted by a protein homologous to transcriptional regulators of the cyclic AMP receptor (CRP)-FNR family. The protein was detected bound to putative CRP-like boxes localized at the promoters of the thnA1 and thnS genes. PMID:22636000

  17. DOSE-DEPENDENT EFFECT OF PRENATAL DEXAMETHASONE TREATMENT ON B-ADRENERGIC RECEPTOR COUPLING TO ORNITHINE DECARBOXYLASE AND CYCLIC AMP

    EPA Science Inventory

    Glucocorticoids regulate the coupling of B-adrenergic receptors to cell function. n the current study, the potential role of these agents in the development of adrenergic responses was evaluated in the offspring of pregnant rats given 0.8 mg/kg of dexamethasone on gestational day...

  18. Transcriptome analysis of cyclic AMP-dependent protein kinase A-regulated genes reveals the production of the novel natural compound fumipyrrole by Aspergillus fumigatus.

    PubMed

    Macheleidt, Juliane; Scherlach, Kirstin; Neuwirth, Toni; Schmidt-Heck, Wolfgang; Straburger, Maria; Spraker, Joseph; Baccile, Joshua A; Schroeder, Frank C; Keller, Nancy P; Hertweck, Christian; Heinekamp, Thorsten; Brakhage, Axel A

    2015-04-01

    Aspergillus fumigatus is an opportunistic human pathogenic fungus causing life-threatening infections in immunocompromised patients. Adaptation to different habitats and also virulence of the fungus depends on signal perception and transduction by modules such as the cyclic AMP-dependent protein kinase A (PKA) pathway. Here, by transcriptome analysis, 632 differentially regulated genes of this important signaling cascade were identified, including 23 putative transcriptional regulators. The highest upregulated transcription factor gene was located in a previously unknown secondary metabolite gene cluster, which we named fmp, encoding an incomplete non-ribosomal peptide synthetase, FmpE. Overexpression of the regulatory gene fmpR using the Tet(On) system led to the specific expression of the other six genes of the fmp cluster. Metabolic profiling of wild type and fmpR overexpressing strain by HPLC-DAD and HPLC-HRESI-MS and structure elucidation by NMR led to identification of 5-benzyl-1H-pyrrole-2-carboxylic acid, which we named fumipyrrole. Fumipyrrole was not described as natural product yet. Chemical synthesis of fumipyrrole confirmed its structure. Interestingly, deletion of fmpR or fmpE led to reduced growth and sporulation of the mutant strains. Although fmp cluster genes were transcribed in infected mouse lungs, deletion of fmpR resulted in wild-type virulence in a murine infection model. PMID:25582336

  19. Cyclic AMP (cAMP) and cAMP receptor protein influence both synthesis and uptake of extracellular autoinducer 2 in Escherichia coli.

    TOXLINE Toxicology Bibliographic Information

    Wang L; Hashimoto Y; Tsao CY; Valdes JJ; Bentley WE

    2005-03-01

    Bacterial autoinducer 2 (AI-2) is proposed to be an interspecies mediator of cell-cell communication that enables cells to operate at the multicellular level. Many environmental stimuli have been shown to affect the extracellular AI-2 levels, carbon sources being among the most important. In this report, we show that both AI-2 synthesis and uptake in Escherichia coli are subject to catabolite repression through the cyclic AMP (cAMP)-CRP complex, which directly stimulates transcription of the lsr (for "luxS regulated") operon and indirectly represses luxS expression. Specifically, cAMP-CRP is shown to bind to a CRP binding site located in the upstream region of the lsr promoter and works with the LsrR repressor to regulate AI-2 uptake. The functions of the lsr operon and its regulators, LsrR and LsrK, previously reported in Salmonella enterica serovar Typhimurium, are confirmed here for E. coli. The elucidation of cAMP-CRP involvement in E. coli autoinduction impacts many areas, including the growth of E. coli in fermentation processes.

  20. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. PMID:1322129

  1. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed Central

    Brierley, I; Hoggett, J G

    1992-01-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129

  2. Cyclic AMP (cAMP) and cAMP Receptor Protein Influence both Synthesis and Uptake of Extracellular Autoinducer 2 in Escherichia coli

    PubMed Central

    Wang, Liang; Hashimoto, Yoshifumi; Tsao, Chen-Yu; Valdes, James J.; Bentley, William E.

    2005-01-01

    Bacterial autoinducer 2 (AI-2) is proposed to be an interspecies mediator of cell-cell communication that enables cells to operate at the multicellular level. Many environmental stimuli have been shown to affect the extracellular AI-2 levels, carbon sources being among the most important. In this report, we show that both AI-2 synthesis and uptake in Escherichia coli are subject to catabolite repression through the cyclic AMP (cAMP)-CRP complex, which directly stimulates transcription of the lsr (for “luxS regulated”) operon and indirectly represses luxS expression. Specifically, cAMP-CRP is shown to bind to a CRP binding site located in the upstream region of the lsr promoter and works with the LsrR repressor to regulate AI-2 uptake. The functions of the lsr operon and its regulators, LsrR and LsrK, previously reported in Salmonella enterica serovar Typhimurium, are confirmed here for E. coli. The elucidation of cAMP-CRP involvement in E. coli autoinduction impacts many areas, including the growth of E. coli in fermentation processes. PMID:15743955

  3. Effect of Increased Cyclic AMP Concentration on Muscle Protein Synthesis and Beta-Adrenergic Receptor Expression in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Vaughn, J. R.; Bridge, K. Y.; Smith, C. K.

    1998-01-01

    Analogies of epinephrine are known to cause hypertrophy of skeletal muscle when fed to animals. These compounds presumably exert their physiological action through interaction with the P-adrenergic receptor. Since the intracellular signal generated by the Beta-adrenergic receptor is cyclic AMP (cAMP), experiments were initiated in cell culture to determine if artificial elevation of cAMP by treatment with forskolin would alter muscle protein metabolism and P-adrenergic receptor expression. Chicken skeletal muscle cells after 7 days in culture were treated with 0.2-30 micrometers forskolin for a total of three days. At the end of the treatment period, both the concentration of cAMP and the quantity of myosin heavy chain (MHC) were measured. Concentration of cAMP in forskolin-treated cells increased up to 10-fold in a dose dependent manner. In contrast, the quantity of MHC was increased approximately 50% above control cells at 0.2 micrometers forskolin, but exhibited a gradual decline at higher levels of forskolin so that the quantity of MHC in cells treated with 30 micrometers forskolin was not significantly different from controls. Curiously, the intracellular concentration of cAMP which elicited the maximum increase in the quantity of MHC was only 40% higher than cAMP concentration in control cells.

  4. Differential regulation of the β-adrenoceptor density and cyclic AMP level with age and sex in turkey cardiac chambers.

    PubMed

    Hoffmann, Sandra; Böhme, Julia; Kube, Christian; Haufe, Jörg; Krautwald-Junghanns, Maria-Elisabeth; Abraham, Getu

    2016-04-15

    Decreased responses of the heart to β-adrenoceptor stimulation with aging have been shown to occur merely in selected heart chambers in relation to increased catecholamine levels. However, there are no systematic studies that investigate all cardiac chambers with regard to receptor density and cAMP (adenosine 3', 5'-cyclic monophosphate) responses. We used meat-type turkey poults (British United Turkey (B.U.T.) Big 6) with increasing age because their heart seems to decrease in weight in relation to body weight and they are often used as an animal model for heart failure. The receptor density and distribution were quantified by radioligand binding analysis using (-)-[(125)I]-iodocyanopindolol and β-adrenoceptor subtype-specific antagonists (ICI 118.551 and CGP 20712 A) in membranes of four cardiac chambers (right and left atria and ventricles) of 6-week-, 12-week-, 16/21-week-, and 57-week-old B.U.T. BIG 6 turkeys. Receptor function was determined by measuring basal and stimulated cAMP production. In both sexes, the β-adrenoceptor density decreased significantly in all chambers with age without altered β-adrenoceptor subtype distribution. The receptor affinity (KD) to the radioligand was similar in hearts of all age groups. β-adrenoceptor-(isoproterenol and guanosine 5'-triphosphate), G-protein-(NaF) and catalytic unit of adenylate cyclase (forskolin, Mn(2+)) mediated cAMP responses were not chamber-dependent. Indeed, the cAMP level was significantly lower in 57-week-old hearts than in 6-week-, 12-week-, 16/21-week-old hearts. These data suggest that with increasing age and body weight, the β-adrenoceptor signal transduction pathway was highly blunted in all cardiac chambers, occurring by decreased receptor density and cAMP responses. PMID:26957056

  5. Cyclic AMP-dependent protein kinase A negatively regulates conidia formation by the tangerine pathotype of Alternaria alternata.

    PubMed

    Tsai, Hsieh-Chin; Yang, Siwy Ling; Chung, Kuang-Ren

    2013-02-01

    The necrotrophic fungal pathogen Alternaria alternata causes brown spot diseases in many citrus cultivars. The FUS3 and SLT2 mitogen-activated protein kinases (MAPK)-mediated signaling pathways have been shown to be required for conidiation. Exogenous application of cAMP to this fungal pathogen decreased conidia formation considerably. This study determined whether a cAMP-activated protein kinase A (PKA) is required for conidiation. Using loss-of-function mutations in PKA catalytic and regulatory subunit-coding genes, we demonstrated that PKA negatively regulates conidiation. Fungal mutants lacking PKA catalytic subunit gene (PKA ( cat )) reduced growth, lacked detectable PKA activity, and produced higher amounts of conidia compared to wild-type. Introduction of a functional copy of PKA ( cat ) into a null mutant partially restored PKA activity and produced wild-type level of conidia. In contrast, fungi lacking PKA regulatory subunit gene (PKA ( reg )) produced detectable PKA activity, exhibited severe growth reduction, formed swelling hyphal segments, and produced no mature conidia. Introduction of the PKA ( reg ) gene to a regulatory subunit mutant restored all phenotypes to wild type. PKA ( reg )-null mutants induced fewer necrotic lesions on citrus compared to wild-type, whereas PKA ( cat ) mutant displayed wild-type virulence. Overall, our studies indicate that PKA and FUS3-mediated signaling pathways apparently have very different roles in the regulation of conidia production and A. alternata pathogenesis in citrus. PMID:23054702

  6. Cooperative DNA binding of heterologous proteins: Evidence for contact between the cyclic AMP receptor protein and RNA polymerase

    SciTech Connect

    Ren, Y.L.; Garges, S.; Adhya, S.; Krakow, J.S. )

    1988-06-01

    Four cAMP-independent receptor protein mutants (designated CRP* mutants) isolated previously are able to activate in vivo gene transcription in the absence of cAMP and their activity can be enhanced by cAMP or cGMP. One of the four mutant proteins, CRP*598 (Arg-142 to His, Ala-144 to Thr), has been characterized with regard to its conformational properties and ability to bind to and support abortive initiation from the lac promoter. Binding of wild-type CRP to its site on the lac promoter and activation of abortive initiation by RNA polymerase on this promoter are effected by cAMP but not by cGMP. CRP*598 can activate lacP{sup +}-directed abortive initiation in the presence of cAMP and less efficiently in the presence of cGMP or in the absence of cyclic nucleotide. DNase I protection (footprinting) indicates that cAMP-CRP* binds to its site on the lac promoter whereas unliganded CRP* and cGMP-CRP* form a stable complex with the ({sup 32}P)lacP{sup +} fragment only in the presence of RNA polymerase, showing cooperative binding of two heterologous proteins. This cooperative binding provides strong evidence for a contact between CRP and RNA polymerase for activation of transcription. Although cGMP binds to CRP, it cannot replace cAMP in effecting the requisite conformational transition necessary for site-specific promoter binding.

  7. Boron and silicon: Effects on growth, plasma lipids, urinary cyclic AMP and bone and brain mineral composition of male rats

    SciTech Connect

    Seaborn, C.D.; Nielsen, F.H. . Grand Forks Human Nutrition Research Center)

    1994-06-01

    Because boron resembles silicon in its chemical properties, an experiment was performed to determine if excessive dietary boron would affect the response to silicon deprivation and, conversely, if silicon would influence the effects of an excessive intake of boron. Male weanling Sprague-Dawley rats were assigned to groups of 6 or 12 in a two-by-two factorially arranged experiment. Supplemented to a ground corn/casein diet containing 1.2 [mu]g silicon and 3 [mu]g boron per gram were silicon as sodium metasilicate at 0 or 50 [mu]g/g and boron as orthoboric acid at 0 or 500 [mu]g/g diet. At nine weeks, animals fed high dietary boron had significantly decreased final body weights, liver-weight-to-body-weight ratios, urinary cAMP concentrations, plasma triglyceride, cholesterol, glycine, valine, leucine, and lysine concentrations and skull copper, sodium, and manganese concentrations. High dietary boron also significantly increased brain-weight-to-body-weight ratios, magnesium concentrations of femur, brain, and plasma, zinc concentration of femur, and iron concentration of skull. The bone mineral findings suggest that excess dietary boron exerts subtle effects on bone composition. Dietary silicon affected blood urea nitrogen, hematocrit, hemoglobin, and the concentrations of plasma threonine and aspartic acid in animals fed excess boron. Depression of the testes-weight-to-body-weight ratio of animals fed 500 [mu]g boron per gram diet was most marked in animals not fed silicon. Although excessive dietary boron did not markedly enhanced the response of rats to silicon deprivation, dietary silicon affected their response to high dietary boron. Thus, dietary silicon apparently can influence boron toxicity.

  8. Biochemical studies on the DNA binding function of the cyclic-amp reactor protein of Escherichia coli

    SciTech Connect

    Angulo, J.A.

    1986-01-01

    The cAMP receptor protein (CRP) is an allosteric protein in which binding of cAMP effects a conformational change with a consequent increased affinity for DNA. Binding of double-stranded deoxyribopolynucleotides and calf thymus DNA by cAMP-CRP confers protection against attack by trypsin, subtilisin, Staph. aureus V8 protease and clostripain. Of the single-stranded deoxy- and ribopolynucleotides tested, only r(I)/sub n/ and r(A)/sub n/ gave significant protection against attack by these proteases. In the absence of cAMP, CRP is resistant to proteolysis. Incubation of CRP-DNA with trypsin results in the accumulation of two novel fragments. CRP-DNA is partially sensitive to digestion by chymotrypsin but resistant to attack by subtilisin, the Staph. aureus V8 protease and clostripain. Cleavage of CRP-DNA to fragments is accompanied by the loss of /sup 3/H-cAMP binding activity. Modification of the arginines with phenylglyoxal or butanedione results in loss of DNA binding activity. cAMP-CRP incorporates more /sup 14/C-phenylglyoxal than unliganded CRP. Titration of the arginines with /sup 14/C-phenylglyoxal to where over 90% of the DNA binding activity is lost results in incorporation of one mole of reagent per mole of subunit.

  9. Cyclic nucleotide responses and radiation-induced mitotic delay in Physarum polycephalum

    SciTech Connect

    Daniel, J.W.; Oleinick, N.L.

    1984-02-01

    The response of the plasmodial levels of cyclic AMP and cyclic GMP in Physarum polycephalum to several putative phosphodiesterase inhibitors and to ionizing radiation has been measured. Isobutylmethylxanthine (2 mM) induces a rapid transient threefold elevation of cyclic AMP alone, with maximum response in about 10 min and return to the base line in about 30 min. Theophylline (2 mM) induces a rapid, sustained twofold elevation of cyclic GMP only. Caffeine (2mM) and Ro-20-1724 (18 ..mu..M) both elicit a rapid transient rise in cyclic AMP, resembling the isobutylmethylxanthine response, and a slow transient elevation of the cyclic GMP level. Of particular interest is the rapid threefold transient elevation of the cyclic AMP, but not of the cyclic GMP, level by ..gamma.. radiation.

  10. (S)-α-Chlorohydrin Inhibits Protein Tyrosine Phosphorylation through Blocking Cyclic AMP - Protein Kinase A Pathway in Spermatozoa

    PubMed Central

    Zheng, Weiwei; Yang, Bei; Pi, Jingbo; He, Gengsheng; Qu, Weidong

    2012-01-01

    α-Chlorohydrin is a common contaminant in food. Its (S)-isomer, (S)-α-chlorohydrin (SACH), is known for causing infertility in animals by inhibiting glycolysis of spermatozoa. The aim of present work was to examine the relationship between SACH and protein tyrosine phosphorylation (PTP), which plays a critical role in regulating mammalian sperm capacitation. In vitro exposure of SACH 50 µM to isolated rat epididymal sperm inhibited PTP. Sperm-specific glyceraldehyde 3-phosphate dehydrogenase (GAPDS) activities, the intracellular adenosine 5′-triphosphate (ATP) levels, 3′-5′-cyclic adenosine monophosphate (cAMP) levels and phosphorylation of protein kinase A (PKA) substrates in rat sperm were diminished dramatically, indicating that both glycolysis and the cAMP/PKA signaling pathway were impaired by SACH. The inhibition of both PTP and phosphorylation of PKA substrates by SACH could be restored by addition of cAMP analog dibutyryl-cAMP (dbcAMP) and phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX). Moreover, addition of glycerol protected glycolysis, ATP levels, phosphorylation of PKA substrates and PTP against the influence of SACH. These results suggested SACH inhibited PTP through blocking cAMP/PKA pathway in sperm, and PTP inhibition may play a role in infertility associated with SACH. PMID:22916194

  11. Beta-Adrenergic Receptor Population is Up-Regulated by Increased Cyclic Amp Concentration in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Vaughn, Jeffrey R.

    1999-01-01

    Skeletal muscle hypertrophy is promoted in vivo by administration of beta-drenergic receptor (bAR) agonists. Chicken skeletal muscle cells were treated with 1 (mu)M isoproterenol, a strong bAR agonist, between days 7 and 10 in culture. bAR population increased by approximately 40% during this treatment; however, the ability of the cells to synthesize cyclic AMP (cAMP) was diminished by two-fold. The quantity of myosin heavy chain (MHC) was not affected. To understand further the relationship between intracellular cAMP levels, bAR population, and muscle protein accumulation, intracellular cAMP levels were artificially elevated by treatment with 0-10 uM forskolin for up to three days. The basal concentration of CAMP in forskolin-treated cells increased up to 7-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in bAR population, with a maximum increase of approximately 40-60% at 10 uM forskolin. A maximum increase of 40-50% in the quantity of MHC was observed at 0.2 uM forskolin, but higher concentrations of forskolin reduced the quantity of MHC back to control levels. At 0.2 uM forskolin, intracellular levels of cAMP were higher by approximately 35%, and the (beta)AR population was higher by approximately 30%. Neither the number of muscle nuclei fused into myotubes nor the percentage of nuclei in myotubes were affected by forskolin at any of the concentrations studied.

  12. Dibutyryl cyclic AMP stimulation of a monocyte-like cell line, U937: a model for monocyte chemotaxis and Fc receptor-related functions.

    PubMed

    Sheth, B; Dransfield, I; Partridge, L J; Barker, M D; Burton, D R

    1988-03-01

    Treatment of the U937 cell line with 1 mM dibutyryl cyclic AMP (Bt2cAMP) resulted in a reduction in cell size and inhibition of DNA synthesis, and morphologically the cells appeared similar to macrophages. Electron micrographs indicated an increase in intracellular apparatus, whilst histochemical studies revealed smaller, denser nuclei and a greater intensity of non-specific esterase staining. Ia-like antigens (HLA-DR and HLA-DC) and complement receptor CR1 were not detected on U937 cells by monoclonal antibodies, nor were they induced by Bt2cAMP. CR3 was present in small amounts on U937 cells, and stimulation with Bt2cAMP increased the expression of this molecule in the cytoplasm and on the cell surface. Leu M3, a monocyte-specific antibody, was weakly reactive on both unstimulated and stimulated cells, whereas transferrin receptors, present on 90% of U937 cells, were lost after 48-hr stimulation with Bt2cAMP. JW6 and NH6, two monoclonal antibodies raised in our laboratory and found to be against immature monocytic antigens, showed decreased expression on stimulation. Monomer IgG binding via Fc receptors decreased on stimulated cells, and a monoclonal antibody (32.2) specific for FcRI confirmed this to be due to a decrease in the number of high-affinity receptors, rather than a decrease in IgG-binding affinity. In contrast, expression of the low-affinity FcRII, monitored by monoclonal antibody IV3, increased dramatically after stimulation. Other functional changes included the production of superoxide anions and the induction of non-specific phagocytosis. Two dimensional gel analysis, of detergent soluble proteins from unstimulated and 48-hr stimulated U937 cells, showed many differences in protein expression. A detailed investigation of these changes will facilitate a better understanding of the molecular mechanisms involved in the differentiation of U937 cells. PMID:2832314

  13. Functional Similarities between the Listeria monocytogenes Virulence Regulator PrfA and Cyclic AMP Receptor Protein: the PrfA* (Gly145Ser) Mutation Increases Binding Affinity for Target DNA

    PubMed Central

    Vega, Yolanda; Dickneite, Carmen; Ripio, María-Teresa; Böckmann, Regine; González-Zorn, Bruno; Novella, Susana; Domínguez-Bernal, Gustavo; Goebel, Werner; Vázquez-Boland, José A.

    1998-01-01

    Most Listeria monocytogenes virulence genes are positively regulated by the PrfA protein, a transcription factor sharing sequence similarities with cyclic AMP (cAMP) receptor protein (CRP). Its coding gene, prfA, is regulated by PrfA itself via an autoregulatory loop mediated by the upstream PrfA-dependent plcA promoter. We have recently characterized prfA* mutants from L. monocytogenes which, as a result of a single amino acid substitution in PrfA, Gly145Ser, constitutively overexpress prfA and the genes of the PrfA virulence regulon. Here, we show that about 10 times more PrfA protein is produced in a prfA* strain than in the wild type. Thus, the phenotype of prfA* mutants is presumably due to the synthesis of a PrfA protein with higher promoter-activating activity (PrfA*), which keeps its intracellular levels constantly elevated by positive feedback. We investigated the interaction of PrfA and PrfA* (Gly145Ser) with target DNA. Gel retardation assays performed with a DNA fragment carrying the PrfA binding site of the plcA promoter demonstrated that the PrfA* mutant form is much more efficient than wild-type PrfA at forming specific DNA-protein complexes. In footprinting experiments, the two purified PrfA forms interacted with the same nucleotides at the target site, although the minimum amount required for protection was 6 to 7 times lower with PrfA*. These results show that the primary functional consequence of the Gly145Ser mutation is an increase in the affinity of PrfA for its target sequence. Interestingly, similar mutations at the equivalent position in CRP result in a transcriptionally active, CRP* mutant form which binds with high affinity to target DNA in the absence of the activating cofactor, cAMP. Our observations suggest that the structural similarities between PrfA and CRP are also functionally relevant and support a model in which the PrfA protein, like CRP, shifts from transcriptionally inactive to active conformations by interaction with a cofactor. PMID:9852011

  14. Co-localization of the dihydropyridine receptor and the cyclic AMP-binding subunit of an intrinsic protein kinase to the junctional membrane of the transverse tubules of skeletal muscle.

    PubMed Central

    Salvatori, S; Damiani, E; Barhanin, J; Furlan, S; Salviati, G; Margreth, A

    1990-01-01

    Junctional transverse tubules (TT) isolated from triads of rabbit skeletal muscle by centrifugation in an ion-free sucrose gradient were compared with membrane subfractions, predominantly derived from the free portion of TT, that had been purified from sarcoplasmic reticulum membrane contaminants by three different methods. The markers used were diagnostic membrane markers and the dihydropyridine (DHP) receptor, which is a specific marker of the junctional membrane of TT. Junctional TT have a high membrane density (Bmax. 60 pmol/mg of protein) of high-affinity (Kd 0.25 nM) DHP-binding sites using [3H]PN200-110 as the specific ligand. When analysed by SDS/PAGE under reducing conditions and by Western blot techniques, the TT were found to contain a concanavalin A-binding 150 kDa glycoprotein which probably corresponds to the alpha 2-subunit of the DHP receptor. This conclusion was supported by correlative immunoblot experiments with a specific antibody. Junctional TT are further distinguished from free TT by the presence of a high number (Bmax. 20 pmol/mg of protein) of [3H]cyclic AMP receptor sites, as determined by the Millipore filtration technique of Gill & Walton [(1974) Methods Enzymol. 38, 376-381]. Use of this method means that the number of receptors may have been underestimated. The TT-bound cyclic AMP receptor was identified as a 55 kDa protein by specific photoaffinity labelling with 8-N3-[3H]cyclic AMP, and had similar phosphorylation properties and apparent molecular mass to the RII form of the regulatory subunit of cyclic AMP-dependent protein kinase. Co-localization of the intrinsic cyclic AMP-dependent protein kinase and of the DHP receptor complex to the junctional membrane of TT supports the hypothesis that the 170 kDa alpha 1-subunit of the receptor is a substrate for the kinase. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. Fig. 7. Fig. 8. Fig. 9. PMID:2160233

  15. Transforming growth factor beta decreases the rate of proliferation of rat vascular smooth muscle cells by extending the G2 phase of the cell cycle and delays the rise in cyclic AMP before entry into M phase.

    PubMed Central

    Grainger, D J; Kemp, P R; Witchell, C M; Weissberg, P L; Metcalfe, J C

    1994-01-01

    Transforming growth factor beta 1 (TGF-beta 1) decreased the rate of proliferation of rat aortic vascular smooth muscle cells (VSMCs) stimulated with serum showing a maximal effect at > 5 ng/ml (200 pM). However, it did not reduce the proportion of cells which passed through S phase (> 90%) and entry into S phase was delayed by less than 3 h. The proportion of cells passing through M phase (> 90%) was also unaffected, but entry into mitosis was delayed by approx. 24 h. This increase in cell cycle time was therefore due mainly to an increase in the G2 to mitotic metaphase period. Addition of TGF-beta 1 late in G1 or late in S phase failed to delay the onset of mitosis, but the presence of TGF-beta 1 between 0 and 12 h after the addition of serum to quiescent cells was sufficient to cause the maximal delay in mitosis of approx. 24 h. The role of cyclic AMP in the mechanism of the TGF-beta 1 effects on the cell cycle was examined. Entry into mitosis was preceded by a transient 2-fold increase in cyclic AMP concentration and TGF-beta 1 delayed both this increase in cyclic AMP and entry into mitosis to the same extent. Addition of forskolin or 8-(4-chlorophenylthio)-cyclic AMP to cells 30 h after stimulation with serum completely reversed the increase in duration of G2 in the presence of TGF-beta 1, suggesting that the rise in cyclic AMP levels which precedes mitosis might trigger entry of the VSMCs into M phase. Addition of forskolin late in S phase (26 h after stimulation with serum) advanced the entry of the cells into M phase and they divided prematurely. This effect was unaffected by the addition of cycloheximide with the forskolin; however, the effect of forskolin on cell division was completely inhibited when cycloheximide was added late in G1. TGF-beta 1 prevented the loss of smooth-muscle-specific myosin heavy chain (SM-MHC), which occurs in primary VSMC cultures in the presence or absence of serum, and the cells proliferated while maintaining a differentiated phenotype. However, TGF-beta 1 did not cause re-differentiation of subcultured VSMCs which contained very low amounts of SM-MHC and the effect of TGF-beta 1 in extending the G2 phase of the cell cycle is exerted independently of its effect on differentiation. Images Figure 3 PMID:8166645

  16. Ultraviolet radiation augments epidermal beta-adrenergic adenylate cyclase response

    SciTech Connect

    Iizuka, H.; Kajita, S.; Ohkawara, A.

    1985-05-01

    Pig skin was irradiated in vivo with fluorescent sunlamp tubes (peak emission at 305 nm). A significant increase in epidermal beta-adrenergic adenylate cyclase response was observed as early as 12 h following 1-2 minimum erythema doses (MEDs) UVB exposure, which lasted at least 48 h. The augmentation of adenylate cyclase response was relatively specific to the beta-adrenergic system and there was no significant difference in either adenosine- or histamine-adenylate cyclase response of epidermis. The increased beta-adrenergic adenylate cyclase response was less marked at higher doses of UVB exposure (5 MEDs); in the latter condition, a significant reduction in adenosine- or histamine-adenylate cyclase response was observed. There was no significant difference in either low- or high-Km cyclic AMP phosphodiesterase activity between control and UVB-treated skin at 1-2 MEDs. These data indicate that the epidermal adenylate cyclase responses are affected in vivo by UVB irradiation, which might be a significant regulatory mechanism of epidermal cyclic AMP systems.

  17. Cellular signal level of cyclic AMP and functional integrity of the small bowel after ischemic preservation: an experimental pilot study in the rat.

    PubMed

    Minor, T; Isselhard, W

    1998-01-01

    The intestinal mucosa is one the tissues most sensitive to ischemia. Anoxia of the gut is known to result in an early impairment of cellular permeability and transcapillary barrier function upon reperfusion. In vitro, an increased permeability of endothelial cell monolayers could be shown to be related to a decrease in cellular content of cyclic AMP (cAMP). Thus, the present study was aimed at investigating the role of the cellular cAMP second messenger signal in the context of intestinal ischemia/reperfusion injury after cold preservation. Segments of the upper jejunum were isolated from Wistar rats with vascular pedicle and flushed with 10 ml of UW preservation solution. The intestinal lumen was rinsed with 10-15 ml of UW solution and the organ was stored immersed in UW solution at 4 degrees C for 4 or 18 h. After 18 h of cold ischemic storage structural and functional integrity of the preparation was tested by perfusion via the vascular system with modified Krebs-Henseleit buffer and the intestinal lumen with saline solution (containing 200 mg % of galactose) for 30 min. In half of the experiments, dibutyryl-cAMP a membrane permeable cAMP analogue, was admixed to the flush solution (2 mM). It was found that tissue levels of cAMP linearily decreased to 34% during 18 h of ischemic preservation in UW. Addition of dibutyryl cAMP significantly improved postischemic recovery of the intestinal preparations by decreasing cellular loss of lactic dehydrogenase (18.2 +/- 4.6 vs. 7.6 +/- 2.6 U/I) and improving intestinal absorbtion of galactose from the luminal circuit (0.18 +/- 0.14 vs. 0.36 +/- 0.14 mg %) after 30 min of oxygenated reperfusion, but was not effective to reduce transcapillary water loss into the gut lumen. It is concluded that the anoxia-related decrease of the cellular cAMP level may represent a codeterminator influencing postischemic recovery of the small bowel and that the control of the cAMP signal of ischemic intestines might improve the quality of cold preservation of the gut prior to transplantation. PMID:9565749

  18. Activation of mitogen-activated protein kinases by stimulation of the central cannabinoid receptor CB1.

    PubMed Central

    Bouaboula, M; Poinot-Chazel, C; Bourrié, B; Canat, X; Calandra, B; Rinaldi-Carmona, M; Le Fur, G; Casellas, P

    1995-01-01

    The G-protein-coupled central cannabinoid receptor (CB1) has been shown to be functionally associated with several biological responses including inhibition of adenylate cyclase, modulation of ion channels and induction of the immediate-early gene Krox-24. Using stably transfected Chinese Hamster Ovary cells expressing human CB1 we show here that cannabinoid treatment induces both phosphorylation and activation of mitogen-activated protein (MAP) kinases, and that these effects are inhibited by SR 141716A, a selective CB1 antagonist. The two p42 and p44 kDa MAP kinases are activated in a time- and dose-dependent manner. The rank order of potency for the activation of MAP kinases with various cannabinoid agonists is CP-55940 > delta 9-tetrahydrocannabinol > WIN 55212.2, in agreement with the pharmacological profile of CB1. The activation of MAP kinases is blocked by pertussis toxin but not by treatment with hydrolysis-resistant cyclic AMP analogues. This suggests that the signal transduction pathway between CB1 and MAP kinases involves a pertussis-toxin-sensitive GTP-binding protein and is independent of cyclic AMP metabolism. This coupling of CB1 subtype and mitogenic signal pathway, also observed in the human astrocytoma cell line U373 MG, may explain the mechanism of action underlying cannabinoid-induced Krox-24 induction. Images Figure 1 Figure 2 Figure 3 PMID:8526880

  19. PAC1hop, null and hip receptors mediate differential signaling through cyclic AMP and calcium leading to splice variant-specific gene induction in neural cells

    PubMed Central

    Holighaus, Yvonne; Mustafa, Tomris; Eiden, Lee E.

    2011-01-01

    Pituitary adenylate cyclase-activating polypeptide (PACAP)-mediated activation of its G protein-coupled receptor PAC1 results in activation of the two G proteins Gs and Gq to alter second messenger generation and gene transcription in the nervous system, important for homeostatic responses to stress and injury. Heterologous expression of the three major splice variants of the rat PAC1 receptor, PAC1hop, null and hip, in neural NG108-15 cells conferred PACAP-mediated intracellular cAMP generation, while elevation of [Ca2+]i occurred only in PAC1hop-, and to a lesser extent in PAC1null-expressing cells. Induction of vasoactive intestinal polypeptide (VIP) and stanniocalcin 1 (STC1), two genes potentially involved in PACAP’s homeostatic responses, was examined as a function of the expressed PAC1 variant. VIP induction was greatest in PAC1hop-expressing cells, suggesting that a maximal transcriptional response requires combinatorial signaling through both cAMP and Ca2+. STC1 induction was similar for all three receptor splice variants and was mimicked by the adenylate cyclase activator forskolin, indicating that cAMP elevation is sufficient to induce STC1. The degree of activation of two different second messenger pathways appears to determine the transcriptional response, suggesting that cellular responses to stressors are fine-tuned through differential receptor isoform expression. Signaling to the VIP gene proceeded through cAMP and protein kinase A (PKA) in these cells, independently of the MAP kinase ERK1/2. STC1 gene induction by PACAP was dependent on cAMP and ERK1/2, independently of PKA. Differential gene induction via different cAMP dependent signaling pathways potentially provides further targets for the design of treatments for stress-associated disorders. PMID:21693142

  20. Engineers and Active Responsibility.

    PubMed

    Pesch, Udo

    2015-08-01

    Knowing that technologies are inherently value-laden and systemically interwoven with society, the question is how individual engineers can take up the challenge of accepting the responsibility for their work? This paper will argue that engineers have no institutional structure at the level of society that allows them to recognize, reflect upon, and actively integrate the value-laden character of their designs. Instead, engineers have to tap on the different institutional realms of market, science, and state, making their work a 'hybrid' activity combining elements from the different institutional realms. To deal with this institutional hybridity, engineers develop routines and heuristics in their professional network, which do not allow societal values to be expressed in a satisfactory manner. To allow forms of 'active' responsibility, there have to be so-called 'accountability forums' that guide moral reflections of individual actors. The paper will subsequently look at the methodologies of value-sensitive design (VSD) and constructive technology assessment (CTA) and explore whether and how these methodologies allow engineers to integrate societal values into the design technological artifacts and systems. As VSD and CTA are methodologies that look at the process of technological design, whereas the focus of this paper is on the designer, they can only be used indirectly, namely as frameworks which help to identify the contours of a framework for active responsibility of engineers. PMID:25005341

  1. Type II heat-labile enterotoxin of Escherichia coli activates adenylate cyclase in human fibroblasts by ADP ribosylation.

    PubMed

    Chang, P P; Moss, J; Twiddy, E M; Holmes, R K

    1987-08-01

    Type II heat-labile enterotoxin (LT-II) from Escherichia coli causes characteristic morphological changes and accumulation of cyclic AMP in Y-1 adrenal cells, but it is not neutralized by antisera against choleragen (CT) or the classical type I heat-labile enterotoxin (LT-1) from E. coli. The action of purified LT-II on CT- and LT-I-responsive human fibroblasts was investigated and compared with that of CT. Fibroblasts incubated with LT-II or CT had an increased cyclic AMP content as well as a fourfold elevation of membrane adenylate cyclase activity. In membranes, activation of cyclase by toxin was enhanced by NAD, GTP, and dithiothreitol. The effect of LT-II on intact fibroblasts or membranes was increased by trypsin treatment of toxin. Since activation of adenylate cyclase by LT-II was stimulated by NAD, the ability of LT-II to catalyze the [32P]ADP-ribosylation of membrane proteins in the presence of [32P]NAD from control and LT-II- and CT-treated fibroblasts was investigated. Similar proteins were [32P]ADP-ribosylated in membranes exposed to LT-II or CT; LT-II- and CT-specific labeling was significantly decreased in membranes prepared from cells preincubated with either LT-II or CT. These studies are consistent with the hypothesis that LT-II, similar to CT and LT-I, increases cyclic AMP by activating adenylate cyclase through the GTP-dependent ADP-ribosylation of specific membrane proteins. PMID:3112012

  2. Role of cyclic AMP sensor Epac1 in masseter muscle hypertrophy and myosin heavy chain transition induced by ?2-adrenoceptor stimulation

    PubMed Central

    Ohnuki, Yoshiki; Umeki, Daisuke; Mototani, Yasumasa; Jin, Huiling; Cai, Wenqian; Shiozawa, Kouichi; Suita, Kenji; Saeki, Yasutake; Fujita, Takayuki; Ishikawa, Yoshihiro; Okumura, Satoshi

    2014-01-01

    The predominant isoform of ?-adrenoceptor (?-AR) in skeletal muscle is ?2-AR and that in the cardiac muscle is ?1-AR. We have reported that Epac1 (exchange protein directly activated by cAMP 1), a new protein kinase A-independent cAMP sensor, does not affect cardiac hypertrophy in response to pressure overload or chronic isoproterenol (isoprenaline) infusion. However, the role of Epac1 in skeletal muscle hypertrophy remains poorly understood. We thus examined the effect of disruption of Epac1, the major Epac isoform in skeletal muscle, on masseter muscle hypertrophy induced by chronic ?2-AR stimulation with clenbuterol (CB) in Epac1-null mice (Epac1KO). The masseter muscle weight/tibial length ratio was similar in wild-type (WT) and Epac1KO at baseline and was significantly increased in WT after CB infusion, but this increase was suppressed in Epac1KO. CB treatment significantly increased the proportion of myosin heavy chain (MHC) IIb at the expense of that of MHC IId/x in both WT and Epac1KO, indicating that Epac1 did not mediate the CB-induced MHC isoform transition towards the faster isoform. The mechanism of suppression of CB-mediated hypertrophy in Epac1KO is considered to involve decreased activation of Akt signalling. In addition, CB-induced histone deacetylase 4 (HDAC4) phosphorylation on serine 246 mediated by calmodulin kinase II (CaMKII), which plays a role in skeletal muscle hypertrophy, was suppressed in Epac1KO. Our findings suggest that Epac1 plays a role in ?2-AR-mediated masseter muscle hypertrophy, probably through activation of both Akt signalling and CaMKII/HDAC4 signalling. PMID:25344550

  3. Role of cyclic AMP sensor Epac1 in masseter muscle hypertrophy and myosin heavy chain transition induced by ?2-adrenoceptor stimulation.

    PubMed

    Ohnuki, Yoshiki; Umeki, Daisuke; Mototani, Yasumasa; Jin, Huiling; Cai, Wenqian; Shiozawa, Kouichi; Suita, Kenji; Saeki, Yasutake; Fujita, Takayuki; Ishikawa, Yoshihiro; Okumura, Satoshi

    2014-12-15

    The predominant isoform of ?-adrenoceptor (?-AR) in skeletal muscle is ?2-AR and that in the cardiac muscle is ?1-AR. We have reported that Epac1 (exchange protein directly activated by cAMP 1), a new protein kinase A-independent cAMP sensor, does not affect cardiac hypertrophy in response to pressure overload or chronic isoproterenol (isoprenaline) infusion. However, the role of Epac1 in skeletal muscle hypertrophy remains poorly understood. We thus examined the effect of disruption of Epac1, the major Epac isoform in skeletal muscle, on masseter muscle hypertrophy induced by chronic ?2-AR stimulation with clenbuterol (CB) in Epac1-null mice (Epac1KO). The masseter muscle weight/tibial length ratio was similar in wild-type (WT) and Epac1KO at baseline and was significantly increased in WT after CB infusion, but this increase was suppressed in Epac1KO. CB treatment significantly increased the proportion of myosin heavy chain (MHC) IIb at the expense of that of MHC IId/x in both WT and Epac1KO, indicating that Epac1 did not mediate the CB-induced MHC isoform transition towards the faster isoform. The mechanism of suppression of CB-mediated hypertrophy in Epac1KO is considered to involve decreased activation of Akt signalling. In addition, CB-induced histone deacetylase 4 (HDAC4) phosphorylation on serine 246 mediated by calmodulin kinase II (CaMKII), which plays a role in skeletal muscle hypertrophy, was suppressed in Epac1KO. Our findings suggest that Epac1 plays a role in ?2-AR-mediated masseter muscle hypertrophy, probably through activation of both Akt signalling and CaMKII/HDAC4 signalling. PMID:25344550

  4. Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis.

    PubMed

    Kaname, Tadashi; Ki, Chang-Seok; Niikawa, Norio; Baillie, George S; Day, Jonathan P; Yamamura, Ken-Ichi; Ohta, Tohru; Nishimura, Gen; Mastuura, Nobuo; Kim, Ok-Hwa; Sohn, Young Bae; Kim, Hyun Woo; Cho, Sung Yoon; Ko, Ah-Ra; Lee, Jin Young; Kim, Hyun Wook; Ryu, Sung Ho; Rhee, Hwanseok; Yang, Kap-Seok; Joo, Keehyoung; Lee, Jooyoung; Kim, Chi Hwa; Cho, Kwang-Hyun; Kim, Dongsan; Yanagi, Kumiko; Naritomi, Kenji; Yoshiura, Ko-Ichiro; Kondoh, Tatsuro; Nii, Eiji; Tonoki, Hidefumi; Houslay, Miles D; Jin, Dong-Kyu

    2014-11-01

    Acrodysostosis without hormone resistance is a rare skeletal disorder characterized by brachydactyly, nasal hypoplasia, mental retardation and occasionally developmental delay. Recently, loss-of-function mutations in the gene encoding cAMP-hydrolyzing phosphodiesterase-4D (PDE4D) have been reported to cause this rare condition but the pathomechanism has not been fully elucidated. To understand the pathogenetic mechanism of PDE4D mutations, we conducted 3D modeling studies to predict changes in the binding efficacy of cAMP to the catalytic pocket in PDE4D mutants. Our results indicated diminished enzyme activity in the two mutants we analyzed (Gly673Asp and Ile678Thr; based on PDE4D4 residue numbering). Ectopic expression of PDE4D mutants in HEK293 cells demonstrated this reduction in activity, which was identified by increased cAMP levels. However, the cells from an acrodysostosis patient showed low cAMP accumulation, which resulted in a decrease in the phosphorylated cAMP Response Element-Binding Protein (pCREB)/CREB ratio. The reason for this discrepancy was due to a compensatory increase in expression levels of PDE4A and PDE4B isoforms, which accounted for the paradoxical decrease in cAMP levels in the patient cells expressing mutant isoforms with a lowered PDE4D activity. Skeletal radiographs of 10-week-old knockout (KO) rats showed that the distal part of the forelimb was shorter than in wild-type (WT) rats and that all the metacarpals and phalanges were also shorter in KO, as the name acrodysostosis implies. Like the G-protein ?-stimulatory subunit and PRKAR1A, PDE4D critically regulates the cAMP signal transduction pathway and influences bone formation in a way that activity-compromising PDE4D mutations can result in skeletal dysplasia. We propose that specific inhibitory PDE4D mutations can lead to the molecular pathology of acrodysostosis without hormone resistance but that the pathological phenotype may well be dependent on an over-compensatory induction of other PDE4 isoforms that can be expected to be targeted to different signaling complexes and exert distinct effects on compartmentalized cAMP signaling. PMID:25064455

  5. Differences in Adiposity in Cushing Syndrome Caused by PRKAR1A Mutations: Clues for the Role of Cyclic AMP Signaling in Obesity and Diagnostic Implications

    PubMed Central

    Rothenbuhler, Anya; Lodish, Maya; Gourgari, Evgenia; Keil, Meg; Lyssikatos, Charalampos; de la Luz Sierra, Maria; Patronas, Nicolas; Nesterova, Maria; Stratakis, Constantine A.

    2014-01-01

    Context: The cAMP signaling pathway is implicated in bilateral adrenocortical hyperplasias. Bilateral adrenocortical hyperplasia is often associated with ACTH-independent Cushing syndrome (CS) and may be caused by mutations in genes such as PRKAR1A, which is responsible for primary pigmented nodular adrenocortical disease (PPNAD). PRKAR1A regulates cAMP-dependent protein kinase (PKA), an essential enzyme in the regulation of adiposity. Although CS is invariably associated with obesity, its different forms, including those associated with PKA defects, have not been compared. Objective: The purpose of this study was to characterize the phenotypic and molecular differences in periadrenal adipose tissue (PAT) between patients with CS with and without PRKAR1A mutations. Design and Setting: Samples from adrenalectomies of 51 patients were studied: patients with CS with (n = 13) and without (n = 32) PRKAR1A mutations and a comparison group with aldosterone-producing adenomas (APAs) (n = 6). In addition, clinical data from a larger group of patients with Cushing disease (n = 89) and hyperaldosteronism (n = 26) were used for comparison. Methods: Body mass index (BMI), abdominal computed tomography scans, and cortisol data were collected preoperatively. PAT was assayed for PKA activity, cAMP levels, and PKA subunit expression. Results: BMI was lower in adult patients with CS with PRKAR1A mutations. cAMP and active PKA levels in PAT were elevated in patients with CS with PRKAR1A mutations. Conclusions: Increased PKA signaling in PAT was associated with lower BMI in CS. Differences in fat distribution may contribute to phenotypic differences between patients with CS with and without PRKAR1A mutations. The observed differences are in agreement with the known roles of cAMP signaling in regulating adiposity, but this is the first time that germline defects of PKA are linked to variable obesity phenotypes in humans. PMID:24248186

  6. Regulation by intracellular Ca sup 2+ and cyclic AMP of the growth factor-induced ruffling membrane formation and stimulation of fluid-phase endocytosis and exocytosis

    SciTech Connect

    Miyata, Yoshihiko Tokyo Metropolitan Inst. of Medical Science ); Nishida, Eisuke; Sakai, Hikoichi ); Koyasu, Shigeo; Yahara, Ichiro )

    1989-04-01

    Insulin, insulin-like growth factor-I (IGF-I), and epidermal growth factor (EGF) induce formation of ruffling membranes and stimulate the fluid-phase endocytosis and exocytosis in human epidermoid carcinoma KB cells. An increase in intracellular Ca{sup 2+} concentration by treatment with A23187, a calcium ionophore, or an increase in intracellular cAMP level by treatment with dibutyryl cAMP or forskolin almost completely inhibited the insulin-, IGF-I-, or EGF-induced formation of ruffling membranes. Increases in Ca{sup 2+} or cAMP concentration also inhibited almost completely the stimulation of fluid-phase endocytosis and exocytosis elicited by these growth factors. These results suggest that the growth factor-induced ruffling membrane formation and the stimulation of fluid-phase endocytosis and exocytosis have a common regulatory mechanism involving intracellular concentrations of Ca{sup 2+} and cAMP. {sup 125}I-EGF binding assays and immunoprecipitation experiments with anti-phosphotyrosine antibody revealed that treatment of KB cells with A23187, dibutyryl cAMP, or forskolin did not inhibit the EGF binding to the cells nor subsequent tyrosine autophosphorylation of its receptors. These results indicate that Ca{sup 2+}- and/or cAMP-sensitive intracellular reactions exist downstream from the receptor kinase activation in the process of these early cellular responses.

  7. {alpha}MSH and Cyclic AMP elevating agents control melanosome pH through a protein kinase A-independent mechanism.

    PubMed

    Cheli, Yann; Luciani, Flavie; Khaled, Mehdi; Beuret, Laurent; Bille, Karine; Gounon, Pierre; Ortonne, Jean-Paul; Bertolotto, Corine; Ballotti, Robert

    2009-07-10

    Melanins are synthesized in melanocytes within specialized organelles called melanosomes. Numerous studies have shown that the pH of melanosome plays a key role in the regulation of melanin synthesis. However, until now, acute regulation of melanosome pH by a physiological stimulus has never been demonstrated. In the present study, we show that the activation of the cAMP pathway by alphaMSH or forskolin leads to an alkalinization of melanosomes and a concomitant regulation of vacuolar ATPases and ion transporters of the solute carrier family. The solute carrier family members include SLC45A2, which is mutated in oculocutaneous albinism type IV, SLC24A4 and SLC24A5, proteins implicated in the control of eye, hair, and skin pigmentation, and the P protein, encoded by the oculocutaneous albinism type II locus. Interestingly, H89, a pharmacological inhibitor of protein kinase A (PKA), prevents the cAMP-induced pigmentation and induces acidification of melanosomes. The drastic depigmenting effect of H89 is not due to an inhibition of tyrosinase expression. Indeed, H89 blocks the induction of melanogenesis induced by LY294002, a potent inhibitor of the PI 3-kinase pathway, without any effect on tyrosinase expression. Furthermore, PKA is not involved in the inhibition of pigmentation promoted by H89 because LY294002 induces pigmentation independently of PKA. Also, other PKA inhibitors do not affect pigmentation. Taken together, our results strengthen the support for a key role of melanosome pH in the regulation of melanin synthesis and, for the first time, demonstrate that melanosome pH is regulated by cAMP and alphaMSH. Notably, these are both mediators of the response to solar UV radiation, the main physiological stimulus of skin pigmentation. PMID:19389708

  8. Spinal Glia Division Contributes to Conditioning Lesion-Induced Axon Regeneration Into the Injured Spinal Cord: Potential Role of Cyclic AMP-Induced Tissue Inhibitor of Metalloproteinase-1.

    PubMed

    Liu, Huaqing; Angert, Mila; Nishihara, Tasuku; Shubayev, Igor; Dolkas, Jennifer; Shubayev, Veronica I

    2015-06-01

    Regeneration of sensory neurons after spinal cord injury depends on the function of dividing neuronal-glial antigen 2 (NG2)-expressing cells. We have shown that increases in the number of dividing NG2-positive cells through short-term pharmacologic inhibition of matrix metalloproteinases contributes to recovery after spinal cord injury. A conditioning sciatic nerve crush (SNC) preceding spinal cord injury stimulates central sensory axon regeneration via the intraganglionic action of cyclic adenosine monophosphate. Here, using bromodeoxyuridine, mitomycin (mitosis inhibitor), and cholera toxin B tracer, we demonstrate that SNC-induced division of spinal glia is related to the spinal induction of tissue inhibitor of metalloproteinase-1 and contributes to central sensory axon growth into the damaged spinal cord. Dividing cells were mainly NG2-positive and Iba1-positive and included myeloid NG2-positive populations. The cells dividing in response to SNC mainly matured into oligodendrocytes and microglia within the injured spinal cord. Some postmitotic cells remained NG2-reactive and were associated with regenerating fibers. Moreover, intraganglionic tissue inhibitor of metalloproteinase-1 expression was induced after administration of SNC or cyclic adenosine monophosphate analog (dbcAMP) to dorsal root ganglia in vivo and in primary adult dorsal root ganglia cultures. Collectively, these findings support a novel model whereby a cyclic adenosine monophosphate-activated regeneration program induced in sensory neurons by a conditioning peripheral nerve lesion uses tissue inhibitor of metalloproteinase-1 to protect against short-term proteolysis, enabling glial cell division and promoting axon growth into the damaged CNS. PMID:25933384

  9. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals

    PubMed Central

    Altarejos, Judith Y.; Montminy, Marc

    2014-01-01

    The cyclic AMP-responsive element-binding protein (CREB) is phosphorylated in response to a wide variety of signals, yet target gene transcription is only increased in a subset of cases. Recent studies indicate that CREB functions in concert with a family of latent cytoplasmic co-activators called cAMP-regulated transcriptional co-activators (CRTCs), which are activated through dephosphorylation. A dual requirement for CREB phosphorylation and CRTC dephosphorylation is likely to explain how these activatorco-activator cognates discriminate between different stimuli. Following their activation, CREB and CRTCs mediate the effects of fasting and feeding signals on the expression of metabolic programmes in insulin-sensitive tissues. PMID:21346730

  10. CYCLIC AMP-DEPENDENT PROTEIN KINASE INDUCTION BY POLYCHLORINATED BIPHENYLS (PCBS) STIMULATES CREB PHOSPHORYLATION VIA A CALCIUM-DEPENDENT, PKC-INDEPENDENT PATHWAY IN CORTICAL NEURONS.

    EPA Science Inventory

    We have previously demonstrated that the PCB mixture, Aroclor 1254 (A1254), increases the phosphorylated form of CREB (pCREB), the cAMP-responsive element binding protein. This transcription factor is important in nervous system development and plasticity. Phosphorylation
    of C...

  11. Mutagenesis of the cyclic AMP receptor protein of Escherichia coli: targeting positions 83, 127 and 128 of the cyclic nucleotide binding pocket.

    PubMed Central

    Lee, E J; Glasgow, J; Leu, S F; Belduz, A O; Harman, J G

    1994-01-01

    The cyclic 3', 5' adenosine monophosphate (cAMP) binding pocket of the cAMP receptor protein (CRP) of Escherichia coli was mutagenized to substitute cysteine or glycine for serine 83; cysteine, glycine, isoleucine, or serine for threonine 127; and threonine or alanine for serine 128. Cells that expressed the binding pocket residue-substituted forms of CRP were characterized by measurements of beta-galactosidase activity. Purified wild-type and mutant CRP preparations were characterized by measurement of cAMP binding activity and by their capacity to support lacP activation in vitro. CRP structure was assessed by measurement of sensitivity to protease and DTNB-mediated subunit crosslinking. The results of this study show that cAMP interactions with serine 83, threonine 127 and serine 128 contribute to CRP activation and have little effect on cAMP binding. Amino acid substitutions that introduce hydrophobic amino acid side chain constituents at either position 127 or 128 decrease CRP discrimination of cAMP and cGMP. Finally, cAMP-induced CRP structural change(s) that occur in or near the CRP hinge region result from cAMP interaction with threonine 127; substitution of threonine 127 by cysteine, glycine, isoleucine, or serine produced forms of CRP that contained, independently of cAMP binding, structural changes similar to those of the wild-type CRP:cAMP complex. Images PMID:8065899

  12. Effects of cold exposure on cyclic AMP concentration in plasma, liver, and brown and white adipose tissues in cold-acclimated rats

    NASA Astrophysics Data System (ADS)

    Habara, Yoshiaki

    1989-06-01

    Effects of acute cold exposure on plasma energy substrates and tissue 3',5'-adenosine monophosphate (cAMP) were analyzed in intact rats, to define an involvement of the nucleotide in nonshivering thermogenesis (NST) and resultant cold acclimation. After an acute cold exposure to -5C, the plasma glucose level increased gradually in warm-kept control rats (C) while it decreased significantly in cold-acclimated rats (CA). However, it was increased considerably by an extreme cold exposure to -15C in both C and CA. By contrast, plasma levels of free fatty acids (FFA) increased immediately after cold exposure and the release lasted during the period of exposure especially in C. The cold exposure also increased plasma cAMP concentration but no concomitant increase was found in the liver. In both brown (IBAT) and white (WAT) adipose tissues the nucleotide concentration showed a stepwise decrease. The observed correlation between lipolysis and plasma cAMP response after cold exposure suggests an involvement of the adenylate cyclase-cAMP system in NST via lipid metabolism, at least, in the early stages of cold acclimation.

  13. Rescue of Cyclic AMP Mediated Long Term Potentiation Impairment in the Hippocampus of Mecp2 Knockout (Mecp2-/y) Mice by Rolipram

    PubMed Central

    Balakrishnan, Saju; Niebert, Marcus; Richter, Diethelm W.

    2016-01-01

    Rett syndrome (RTT) patients experience learning difficulties and memory loss. Analogous deficits of hippocampal plasticity are reported in mouse models of RTT. To elucidate the underlying pathophysiology, we studied long term potentiation (LTP) at the CA3 to CA1 synapses in the hippocampus in acute brain slices from WT and Mecp2-/y mice, by either activating cAMP dependent pathway or using high frequency stimulation, by means of patch clamp. We have observed that, the NMDA channel current characteristics remain unchanged in the Mecp2-/y mice. The adenylyl cyclase (AC) agonist forskolin evoked a long lasting potentiation of evoked EPSCs in WT CA1 neurons, but only minimally enhanced the EPSCs in the Mecp2-/y mice. This weaker potentiation in Mecp2-/y mice was ameliorated by application of phosphodiesterase 4 inhibitor rolipram. The hyperpolarization activated cyclic nucleotide gated channel current (Ih) was potentiated to similar extent by forskolin in both phenotypes. Multiple tetanus induced cAMP-dependent plasticity was also impaired in the Mecp2-/y mice, and was also partially rescued by rolipram. Western blot analysis of CA region of Mecp2-/y mice hippocampus revealed more than twofold up-regulation of protein kinase A (PKA) regulatory subunits, while the expression of the catalytic subunit remained unchanged. We hypothesize that the overexpressed PKA regulatory subunits buffer cAMP and restrict the PKA mediated phosphorylation of target proteins necessary for LTP. Blocking the degradation of cAMP, thereby saturating the regulatory subunits alleviated this defect. PMID:26869885

  14. Rescue of Cyclic AMP Mediated Long Term Potentiation Impairment in the Hippocampus of Mecp2 Knockout (Mecp2(-/y) ) Mice by Rolipram.

    PubMed

    Balakrishnan, Saju; Niebert, Marcus; Richter, Diethelm W

    2016-01-01

    Rett syndrome (RTT) patients experience learning difficulties and memory loss. Analogous deficits of hippocampal plasticity are reported in mouse models of RTT. To elucidate the underlying pathophysiology, we studied long term potentiation (LTP) at the CA3 to CA1 synapses in the hippocampus in acute brain slices from WT and Mecp2(-/y) mice, by either activating cAMP dependent pathway or using high frequency stimulation, by means of patch clamp. We have observed that, the NMDA channel current characteristics remain unchanged in the Mecp2(-/y) mice. The adenylyl cyclase (AC) agonist forskolin evoked a long lasting potentiation of evoked EPSCs in WT CA1 neurons, but only minimally enhanced the EPSCs in the Mecp2(-/y) mice. This weaker potentiation in Mecp2 (-/) (y) mice was ameliorated by application of phosphodiesterase 4 inhibitor rolipram. The hyperpolarization activated cyclic nucleotide gated channel current (I h) was potentiated to similar extent by forskolin in both phenotypes. Multiple tetanus induced cAMP-dependent plasticity was also impaired in the Mecp2 (-/) (y) mice, and was also partially rescued by rolipram. Western blot analysis of CA region of Mecp2 (-/) (y) mice hippocampus revealed more than twofold up-regulation of protein kinase A (PKA) regulatory subunits, while the expression of the catalytic subunit remained unchanged. We hypothesize that the overexpressed PKA regulatory subunits buffer cAMP and restrict the PKA mediated phosphorylation of target proteins necessary for LTP. Blocking the degradation of cAMP, thereby saturating the regulatory subunits alleviated this defect. PMID:26869885

  15. Smooth muscle cell expression of type I cyclic GMP-dependent protein kinase is suppressed by continuous exposure to nitrovasodilators, theophylline, cyclic GMP, and cyclic AMP.

    PubMed Central

    Soff, G A; Cornwell, T L; Cundiff, D L; Gately, S; Lincoln, T M

    1997-01-01

    A key component of the nitric oxide-cyclic guanosine monophosphate (cGMP) pathway in smooth muscle cells (SMC) is the type I GMP-dependent protein kinase (PK-G I). Activation of PK-G I mediates the reduction of cytoplasmic calcium concentrations and vasorelaxation. In this manuscript, we demonstrate that continuous exposure of SMC in culture to the nitrovasodilators S-nitroso-N-acetylpenicillamine (SNAP) or sodium nitroprusside (SNP) results in approximately 75% suppression of PK-G I mRNA by 48 h. PK-G I mRNA and protein were also suppressed by continuous exposure to cGMP analogues 8-bromo- and 8-(4-chlorophenylthio) guanosine-3,5-monophosphate or the cAMP analogue dibutyryl cAMP. These results suggest that activation of one or both of the cyclic nucleotide-dependent protein kinases mediates PK-G I mRNA suppression. Using isoform-specific cDNA probes, only the PK-G I alpha was detected in SMC, either at baseline or after suppression, while PK-G I beta was not detected, indicating that isoform switch was not contributing to the gene regulation. Using the transcription inhibitor actinomycin D, the PK-G I mRNA half-life in bovine SMC was observed to be 5 h. The half-life was not affected by the addition of SNAP to actinomycin D, indicating no effect on PK-G I mRNA stability. Nuclear runoff studies indicated a suppression of PK-G I gene transcription by SNAP. PK-G I suppression was also observed in vivo in rats given isosorbide dinitrate in the drinking water, with a dose-dependent suppression of PK-G I protein in the aorta. PK-G I antigen in whole rat lung extract was also suppressed by administration of isosorbide or theophylline in the drinking water. These data may contribute to our understanding of nitrovasodilator resistance, a phenomenon resulting from continuous exposure to nitroglycerin or other nitrovasodilators. PMID:9366573

  16. Regulation of pineal alpha1B-adrenergic receptor mRNA: day/night rhythm and beta-adrenergic receptor/cyclic AMP control.

    TOXLINE Toxicology Bibliographic Information

    Coon SL; McCune SK; Sugden D; Klein DC

    1997-04-01

    Mammalian pineal function is regulated by norepinephrine acting through alpha1beta- and beta1-adrenergic receptors (ARs). Noradrenergic stimulation of alpha1beta-ARs potentiates the beta1-AR-driven increase in cAMP, serotonin N-acetyltransferase, and melatonin production. In the present study, we describe a 3-fold daily rhythm in mRNA-encoding alpha1beta-ARs in the pineal gland, with a peak at midnight. Pharmacological studies indicate that this increase in alpha1beta-AR mRNA is due to activation of beta-ARs. Second messenger studies indicate that alpha1beta-AR mRNA is increased by agents that increase cAMP, including dibutyryl cAMP, cholera toxin, forskolin, or vasoactive intestinal peptide. These observations indicate that alpha1beta-AR mRNA can be physiologically regulated by a beta-AR-dependent enhancement of cAMP. It also was observed that in vivo and in vitro changes in alpha1beta-AR mRNA are not accompanied by similar changes in alpha1beta-AR binding, indicating that turnover of alpha1beta-AR protein is significantly slower than that of alpha1beta-AR mRNA and that post-transcriptional mechanisms play an important role in regulating alpha1beta-AR binding.

  17. Anaerobic growth of Rhodopseudomonas palustris on 4-hydroxybenzoate is dependent on AadR, a member of the cyclic AMP receptor protein family of transcriptional regulators.

    PubMed Central

    Dispensa, M; Thomas, C T; Kim, M K; Perrotta, J A; Gibson, J; Harwood, C S

    1992-01-01

    The purple nonsulfur phototrophic bacterium Rhodopseudomonas palustris converts structurally diverse aromatic carboxylic acids, including lignin monomers, to benzoate and 4-hydroxybenzoate under anaerobic conditions. These compounds are then further degraded via aromatic ring-fission pathways. A gene termed aadR, for anaerobic aromatic degradation regulator, was identified by complementation of mutants unable to grow anaerobically on 4-hydroxybenzoate. The deduced amino acid sequence of the aadR product is similar to a family of transcriptional regulators which includes Escherichia coli Fnr and Crp, Pseudomonas aeruginosa Anr, and rhizobial FixK and FixK-like proteins. A mutant with a deletion in aadR failed to grow on 4-hydroxybenzoate under anaerobic conditions and grew very slowly on benzoate. It also did not express aromatic acid-coenzyme A ligase II, an enzyme that catalyzes the first step of 4-hydroxybenzoate degradation, and it was defective in 4-hydroxybenzoate-induced expression of benzoate-coenzyme A ligase. The aadR deletion mutant was unaffected in other aspects of anaerobic growth. It grew normally on nonaromatic carbon sources and also under nitrogen-fixing conditions. In addition, aerobic growth on 4-hydroxybenzoate was indistinguishable from that of the wild type. These results indicate that AadR functions as a transcriptional activator of anaerobic aromatic acid degradation. Images PMID:1522059

  18. Rapid glucocorticoid inhibition of vasoactive intestinal peptide-induced cyclic AMP accumulation and prolactin release in rat pituitary cells in culture.

    PubMed Central

    Rotsztejn, W H; Dussaillant, M; Nobou, F; Rosselin, G

    1981-01-01

    Vasoactive intestinal peptide (VIP) stimulates both adenosine 3',5'-cyclic monophosphate (cAMP) accumulation and prolactin release in normal rat pituitary cells in culture. cAMP accumulation is significant (P less than 0.01) at VIP concentrations as low as 1 nM and reaches a maximum with 0.1 microM. Addition of dexamethasone as early as 15 min before VIP inhibits VIP stimulation of both cAMP production and PRL secretion. The rapid inhibition is dose-dependent: it appears at doses as low as 0.01 pM and is complete at 1 pM dexamethasone. Increasing concentrations of dexamethasone induce a noncompetitive type of inhibition, as shown by the decrease in Vmax with no change in the apparent Km for VIP. Cycloheximide (1 mM) counteracts the inhibitory effect of dexamethasone on VIP-induced cAMP production, which suggests the involvement of a rapid protein synthesis mechanism. Ru-26988, a specific glucocorticoid devoid of any mineralocorticoid activity and which does not bind to intracellular transcortin-like component, also produces an inhibition of VIP-induced cAMP accumulation. Corticosterone also inhibits VIP-induced cAMP production but at concentrations higher than those of dexamethasone. In contrast, aldosterone, progesterone, estradiol, and testosterone have no effect. These results demonstrate that, in normal rat pituitary cells in culture, glucocorticoids at physiological concentrations rapidly inhibit the cAMP production and prolactin release induced by VIP by acting through specific glucocorticoid receptors. PMID:6278481

  19. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios.

    PubMed

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoX(VC) was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoX(VC)promoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoX(VF) in V. fluvialis was determined, and -10/-35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar -10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  20. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios

    PubMed Central

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  1. Neural activation during response competition

    NASA Technical Reports Server (NTRS)

    Hazeltine, E.; Poldrack, R.; Gabrieli, J. D.

    2000-01-01

    The flanker task, introduced by Eriksen and Eriksen [Eriksen, B. A., & Eriksen, C. W. (1974). Effects of noise letters upon the identification of a target letter in a nonsearch task. Perception & Psychophysics, 16, 143--149], provides a means to selectively manipulate the presence or absence of response competition while keeping other task demands constant. We measured brain activity using functional magnetic resonance imaging (fMRI) during performance of the flanker task. In accordance with previous behavioral studies, trials in which the flanking stimuli indicated a different response than the central stimulus were performed significantly more slowly than trials in which all the stimuli indicated the same response. This reaction time effect was accompanied by increases in activity in four regions: the right ventrolateral prefrontal cortex, the supplementary motor area, the left superior parietal lobe, and the left anterior parietal cortex. The increases were not due to changes in stimulus complexity or the need to overcome previously learned associations between stimuli and responses. Correspondences between this study and other experiments manipulating response interference suggest that the frontal foci may be related to response inhibition processes whereas the posterior foci may be related to the activation of representations of the inappropriate responses.

  2. A specific adenylyl cyclase inhibitor (DDA) and a cyclic AMP-dependent protein kinase inhibitor (H-89) block the action of equine growth hormone on in vitro maturation of equine oocytes.

    PubMed

    Pereira, Gabriel Ribas; Lorenzo, Pedro Luis; Carneiro, Gustavo Ferrer; Bilodeau-Goeseels, Sylvie; Kastelic, John; Liu, Irwin K M

    2015-12-01

    The objectives of this study were firstly to determine whether the stimulatory function of equine growth hormone (eGH) on equine oocyte maturation in vitro is mediated via cyclic adenosine monophosphate (cAMP); and secondly if the addition of eGH in vitro influences oocyte nuclear maturation and if this effect is removed when GH inhibitors are added to the culture. Cumulus-oocyte complexes (COCs) were recovered from follicles <25 mm in diameter and randomly allocated as follows: (i) control (no additives); and (ii) 400 ng/ml of eGH. A specific inhibitor against cyclic AMP-dependent protein kinase (H-89; 10-9, 10-11 or 10-15 M concentration) and a specific adenylate cyclase inhibitor, 2',3'-dideoxyadenosine (DDA; 10-8, 10-10 or 10-14 M concentration) were used to observe whether they could block the eGH effect. After 30 h of in vitro maturation at 38.5°C with 5% CO2 in air, oocytes were stained with 10 μg/ml of Hoechst to evaluate nuclear status. More mature oocytes (P < 0.05) were detected when COCs were incubated with eGH (29 of 84; 34.5%) than in the control group (18 of 82; 21.9%). The H-89 inhibitor used at a concentration of 10-9 M (4 of 29; 13.8%) decreased (P < 0.05) the number of oocytes reaching nuclear maturation when compared with eGH (11 of 29; 38%). The DDA inhibitor at a concentration of 10-8 M (2 of 27; 7.4%) also reduced (P < 0.05) the number of oocytes reaching maturity when compared with the eGH group (9 of 30; 30%). Results from the present study show that H-89 and DDA can be used in vitro to block the eGH effect on equine oocyte maturation. PMID:25257826

  3. A CREB-Sirt1-Hes1 Circuitry Mediates Neural Stem Cell Response to Glucose Availability.

    PubMed

    Fusco, Salvatore; Leone, Lucia; Barbati, Saviana Antonella; Samengo, Daniela; Piacentini, Roberto; Maulucci, Giuseppe; Toietta, Gabriele; Spinelli, Matteo; McBurney, Michael; Pani, Giovambattista; Grassi, Claudio

    2016-02-01

    Adult neurogenesis plays increasingly recognized roles in brain homeostasis and repair and is profoundly affected by energy balance and nutrients. We found that the expression of Hes-1 (hairy and enhancer of split 1) is modulated in neural stem and progenitor cells (NSCs) by extracellular glucose through the coordinated action of CREB (cyclic AMP responsive element binding protein) and Sirt-1 (Sirtuin 1), two cellular nutrient sensors. Excess glucose reduced CREB-activated Hes-1 expression and results in impaired cell proliferation. CREB-deficient NSCs expanded poorly invitro and did not respond to glucose availability. Elevated glucose also promoted Sirt-1-dependent repression of the Hes-1 promoter. Conversely, in low glucose, CREB replaced Sirt-1 on the chromatin associated with the Hes-1 promoter enhancing Hes-1 expression and cell proliferation. Thus, the glucose-regulated antagonism between CREB and Sirt-1 for Hes-1 transcription participates in the metabolic regulation of neurogenesis. PMID:26804914

  4. D1 agonists suppress zero Mg(2+)-induced epileptiform activity in the rat cingulate cortex slice.

    PubMed

    Alam, A M; Starr, M S

    1993-10-25

    This study determined whether dopamine can influence epileptiform activity in vitro through an action at D1 receptors. Dopamine (50-1000 microM) and the selective D1 agonists SKF 38393, SKF 75670, SKF 80723 and SKF 82526 (10-250 microM) suppressed the paroxysmal discharges produced in rat cingulate cortex slices by the omission of Mg2+ from the bathing medium. These antiepileptic effects were mimicked by forskolin (10-100 microM), blocked by the D1 antagonist SCH 39166 (0.5 microM), facilitated by IBMX (500 microM) and unaffected by propranolol (2 microM), suggesting the participation of cyclic AMP in the D1 response. Possible mechanisms, including direct postsynaptic inhibition, modulatory enhancement of GABA activity and presynaptic inhibition of glutamate release are considered. PMID:7506591

  5. Active Response Gravity Offload System

    NASA Technical Reports Server (NTRS)

    Valle, Paul; Dungan, Larry; Cunningham, Thomas; Lieberman, Asher; Poncia, Dina

    2011-01-01

    The Active Response Gravity Offload System (ARGOS) provides the ability to simulate with one system the gravity effect of planets, moons, comets, asteroids, and microgravity, where the gravity is less than Earth fs gravity. The system works by providing a constant force offload through an overhead hoist system and horizontal motion through a rail and trolley system. The facility covers a 20 by 40-ft (approximately equals 6.1 by 12.2m) horizontal area with 15 ft (approximately equals4.6 m) of lifting vertical range.

  6. Localization of the murine activating transcription factor 4 gene to mouse chromosome 15

    SciTech Connect

    Mielnicki, L.M.; Elliott, R.W.; Pruitt, S.C. )

    1993-01-01

    Restriction fragment length variant analysis employing a mouse cDNA probe was used to localize the gene encoding murine activating transcription factor 4 (ATF-4) to mouse chromosome 15 in close proximity to Sis (the cellular homolog of the simian sarcoma virus oncoprotein). Previous studies suggest that conserved linkage relationships exist between this region of mouse chromosome 15 and human chromosome 22q. The chromosomal locations of genes encoding most members of the ATF and cyclic AMP response element binding protein (CREB) subfamilv of b-zip proteins have not been determined. This study demonstrates that the location of the gene for murine ATF-4 is not linked to the genes for JUN family members, CREB1 and CREB2. Further mapping of individual ATF/ CREB subfamily members in the mouse will provide insight into the evolution of this multigene family. 15 refs., 1 fig., 1 tab.

  7. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in

  8. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  9. Bronchial responsiveness in active steelworkers.

    PubMed

    Corhay, J L; Bury, T; Louis, R; Delavignette, J P; Kayembe, J M; Weber, G; Albert, A; Radermecker, M F

    1998-02-01

    Coke-oven workers are exposed to dust and irritant gases. Therefore they are at risk of developing lung diseases including chronic bronchitis. Nonspecific bronchial hyperresponsiveness (BHR) has been advocated as a potential risk factor predisposing to the development of chronic bronchitis. In a previous study, we showed that prevalence of BHR was higher in retired coke-oven workers than in retired blast furnace workers. The present study was carried out to determine the prevalence of BHR in active steelworkers. Thus, 137 coke-oven workers and 150 blast furnace workers underwent clinical examination, a standardized questionnaire for the study of respiratory symptoms, pulmonary function testing and methacholine aerosol challenge. The study demonstrates a higher prevalence and degree of BHR [provocative concentration of methacholine causing a 20% fall in forced expiratory volume in one second (PC20) < or = 8 mg x mL(-1)] in coke-oven workers than in blast furnace workers (31.4 versus 6.7%; p<0.001). Moreover, the frequency of respiratory symptoms and basal bronchial obstruction were greater among coke-oven workers with BHR in nonresponders. The basal maximum expiratory flow from 25-75% of forced vital capacity and the respiratory symptoms were correlated with bronchial responsiveness. The lack of correlation observed between BHR and the intensity of smoking or years spent in coke-oven environment may be explained by the high proportion of smokers, the worker turnover in the steel plant, and the "healthy worker effect". In conclusion, the higher prevalence and degree of bronchial hyperresponsiveness in coke-oven workers suggests that coke-oven pollutants are more intense irritants than those that escape from blast furnaces. PMID:9551724

  10. Differences in responsiveness of intrapulmonary artery and vein to arachidonic acid: mechanism of arterial relaxation involves cyclic guanosine 3':5'-monophosphate and cyclic adenosine 3':5'-monophosphate

    SciTech Connect

    Ignarro, L.J.; Harbison, R.G.; Wood, K.S.; Wolin, M.S.; McNamara, D.B.; Hyman, A.L.; Kadowitz, P.J.

    1985-06-01

    The objective of this study was to examine the relationship between responses of bovine intrapulmonary artery and vein to arachidonic acid and cyclic nucleotide levels in order to better understand the mechanism of relaxation elicited by arachidonic acid and acetylcholine. Arachidonic acid relaxed phenylephrine-precontracted arterial rings and elevated both cyclic GMP and cyclic AMP levels in arteries with intact endothelium. In contrast, endothelium-damaged arterial rings contracted to arachidonic acid without demonstrating significant changes in cyclic nucleotide levels. Indomethacin partially inhibited endothelium-dependent relaxation and abolished cyclic AMP accumulation whereas methylene blue, a guanylate cyclase inhibitor, partially inhibited relaxation and abolished cyclic GMP accumulation in response to arachidonic acid. All vessel responses were blocked by a combination of the two inhibitors. Prostaglandin (PG) I2 relaxed arterial rings and elevated cyclic AMP levels whereas PGE2 and PGF2 alpha caused contraction, suggesting that the indomethacin-sensitive component of arachidonic acid-elicited relaxation is due to PGI2 formation and cyclic AMP accumulation. The methylene blue-sensitive component is attributed to an endothelium-dependent but cyclooxygenase-independent generation of a substance causing cyclic GMP accumulation. Intrapulmonary veins contracted to arachidonic acid with no changes in cyclic nucleotide levels and PGI2 was without effect. Homogenates of intrapulmonary artery and vein formed 6-keto-PGF1 alpha, PGF2 alpha and PGE2 from (/sup 14/C)arachidonic acid, which was inhibited by indomethacin. Thus, bovine intrapulmonary vein may not possess receptors for PGI2.

  11. Vasorelaxant effect of isoliquiritigenin, a novel soluble guanylate cyclase activator, in rat aorta.

    PubMed Central

    Yu, S M; Kuo, S C

    1995-01-01

    1. The vasorelaxant activity of isoliquiritigenin, isolated from Dalbergia odorifera T, was investigated in the phenylephrine-precontracted rat aorta by measuring tension, guanylate and adenylate cyclase activities, guanosine 3':5'-cyclic monophosphate (cyclic GMP) and adenosine 3':5'-cyclic monophosphate (cyclic AMP) levels. 2. Isoliquiritigenin concentration-dependently relaxed rat aorta contracted with phenylephrine, KCl, U-46619, endothelin and 5-hydroxytryptamine, with EC50s of 7.4 +/- 1.6, 10.5 +/- 2.3, 14.3 +/- 3.3, 11.8 +/- 2.0 and 13.6 +/- 3.7 microM, respectively. 3. Isoliquiritigenin caused endothelium-independent relaxation of phenylephrine-precontracted rat aortic rings. Neither NG-monomethyl-L-arginine (L-NMMA) (an inhibitor of the L-arginine-NO pathway) nor oxyhaemoglobin (which binds NO) modified the relaxant effect of isoliquiritigenin. The relaxant action of isoliquiritigenin also persisted in intact aorta in the presence of indomethacin or glibenclamide. However, methylene blue, an inhibitor of soluble guanylate cyclase, abolished relaxation induced by isoliquiritigenin. 4. Incubation of rat aorta with isoliquiritigenin not only increased aortic cyclic GMP content but also caused small increases in aortic cyclic AMP content, and greatly potentiated the increases in cyclic AMP observed in the presence of forskolin. The maximum increase in cyclic GMP by isoliquiritigenin was reached earlier than the increase in cyclic AMP. This result suggests that the increases in cyclic GMP caused by isoliquiritigenin might stimulate the accumulation of cyclic AMP. 5. Concentration-dependent increases in soluble guanylate cyclase activity were observed in isoliquiritigenin (1-100 microM)- or sodium nitroprusside (SNP)-treated rat aortic smooth muscle cells, while adenylate cyclase activity was unchanged in isoliquiritigenin (100 microM)-treated cells.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7599926

  12. Appetitive Cue-Evoked ERK Signaling in the Nucleus Accumbens Requires NMDA and D1 Dopamine Receptor Activation and Regulates CREB Phosphorylation

    ERIC Educational Resources Information Center

    Kirschmann, Erin K. Z.; Mauna, Jocelyn C.; Willis, Cory M.; Foster, Rebecca L.; Chipman, Amanda M.; Thiels, Edda

    2014-01-01

    Conditioned stimuli (CS) can modulate reward-seeking behavior. This modulatory effect can be maladaptive and has been implicated in excessive reward seeking and relapse to drug addiction. We previously demonstrated that exposure to an appetitive CS causes an increase in the activation of extracellular signal-regulated kinase (ERK) and cyclic-AMP

  13. cAMP Response Element Binding Protein1 Is Essential for Activation of Steroyl Co-Enzyme A Desaturase 1 (Scd1) in Mouse Lung Type II Epithelial Cells

    PubMed Central

    Antony, Nisha; Weir, Jacqui R.; McDougall, Annie R. A.; Mantamadiotis, Theo; Meikle, Peter J.

    2013-01-01

    Cyclic AMP Response Element-Binding Protein 1 (Creb1) is a transcription factor that mediates cyclic adenosine 3?, 5?-monophosphate (cAMP) signalling in many tissues. Creb1?/? mice die at birth due to respiratory failure and previous genome-wide microarray analysis of E17.5 Creb1?/? fetal mouse lung identified important Creb1-regulated gene targets during lung development. The lipogenic enzymes stearoyl-CoA desaturase 1 (Scd1) and fatty acid synthase (Fasn) showed highly reduced gene expression in Creb1?/? lungs. We therefore hypothesized that Creb1 plays a crucial role in the transcriptional regulation of genes involved in pulmonary lipid biosynthetic pathways during lung development. In this study we confirmed that Scd1 and Fasn mRNA levels were down regulated in the E17.5 Creb1?/? mouse lung while the lipogenic-associated transcription factors SrebpF1, C/ebp? and Ppar? were increased. In vivo studies using germline (Creb1?/?) and lung epithelial-specific (Creb1Epi?/?) Creb1 knockout mice showed strongly reduced Scd1, but not Fasn gene expression and protein levels in lung epithelial cells. In vitro studies using mouse MLE-15 epithelial cells showed that forskolin-mediated activation of Creb1 increased both Scd1 gene expression and protein synthesis. Additionally, MLE15 cells transfected with a dominant-negative ACreb vector blocked forskolin-mediated stimulation of Scd1 gene expression. Lipid profiling in MLE15 cells showed that dominant-negative ACreb suppressed forskolin-induced desaturation of ether linked lipids to produce plasmalogens, as well as levels of phosphatidylethanolamine, ceramide and lysophosphatidylcholine. Taken together these results demonstrate that Creb1 is essential for the induction and maintenance of Scd1 in developing fetal mouse lung epithelial cells. PMID:23637738

  14. Mechanisms responsible for the cardiotoxic effects of cocaine.

    PubMed

    Billman, G E

    1990-05-01

    Cocaine can induce lethal cardiovascular events, including myocardial infarction and ventricular fibrillation. The mechanisms responsible for these cardiotoxic effects of cocaine remain largely to be determined. Cocaine has both sympathomimetic (inhibition of neuronal uptake of norepinephrine) and local anesthetic (Na+ channel blockade) properties. Neurotransmitters released from cardiac sympathetic nerves bind to both alpha- and beta-adrenergic receptors eliciting a cascade of intracellular responses. Stimulation of beta-adrenergic receptors activates adenylate cyclase, increasing cyclic AMP levels, whereas alpha-adrenergic receptor stimulation activates phospholipase C, increasing inositol trisphosphate. These second messengers, in turn, elicit increases in cystolic calcium. Elevations in cystolic calcium can provoke oscillatory depolarizations of the cardiac membrane, triggering sustained action potential generation and extrasystoles. Cocaine also acts as a local anesthetic by inhibiting sodium influx into cardiac cells, which impairs impulse conduction and creates an ideal substrate for reentrant circuits. Thus, the adrenergic and anesthetic properties of cocaine could act synergistically to elicit and maintain ventricular fibrillation. Adrenergic receptor activation would trigger the event whereas sodium channel blockade would create the reentrant substrate to perpetuate the malignant arrhythmias. PMID:2185973

  15. Activating Transcription Factor 3 and the Nervous System

    PubMed Central

    Hunt, David; Raivich, Gennadij; Anderson, Patrick Norval

    2012-01-01

    Activating transcription factor 3 (ATF3) belongs to the ATF/cyclic AMP responsive element binding family of transcription factors and is often described as an adaptive response gene whose activity is usually regulated by stressful stimuli. Although expressed in a number of splice variants and generally recognized as a transcriptional repressor, ATF3 has the ability to interact with a number of other transcription factors including c-Jun to form complexes which not only repress, but can also activate various genes. ATF3 expression is modulated mainly at the transcriptional level and has markedly different effects in different types of cell. The levels of ATF3 mRNA and protein are normally very low in neurons and glia but their expression is rapidly upregulated in response to injury. ATF3 expression in neurons is closely linked to their survival and the regeneration of their axons following axotomy, and that in peripheral nerves correlates with the generation of a Schwann cell phenotype that is conducive to axonal regeneration. ATF3 is also induced by Toll-like receptor (TLR) ligands but acts as a negative regulator of TLR signaling, suppressing the innate immune response which is involved in immuno-surveillance and can enhance or reduce the survival of injured neurons and promote the regeneration of their axons. PMID:22347845

  16. Physiological Response to Physical Activity in Children.

    ERIC Educational Resources Information Center

    Gilliam, Thomas B.

    This is a report on research in the field of physical responses of children to strenuous activity. The paper is divided into three subtopics: (1) peak performance measure in children; (2) training effects on children; and (3) importance of physical activity for children. Measurements used are oxygen consumption, ventilation, heart rate, cardiac

  17. Alpha 2 adrenoceptor potentiates glycine receptor-mediated taurine response through protein kinase A in rat substantia nigra neurons.

    PubMed

    Nabekura, J; Omura, T; Akaike, N

    1996-10-01

    1. The modulatory effect of alpha 2 adrenoceptor on the taurine response was investigated in substantia nigra (SN) neurons acutely dissociated from the rat using a nystatin perforated-patch recording mode under voltage-clamp conditions. 2. Complete cross-desensitization was observed between 10(-3) M glycine and 3 x 10(-3) M taurine-induced currents. Both currents were antagonized by 10(-6) M strychnine, thus indicating that taurine acts on strychnine-sensitive glycine receptor on the SN neurons. 3. The simultaneous application of norepinephrine (NE) with prazosin (10(-5) M) and propranolol (10(-5) M) potentiated the taurine response (Itau) in an NE concentration-dependent manner at a holding potential (VH) of -40 mV. Clonidine mimicked the NE effect on the Itau, thus indicating the involvement of alpha 2 adrenoceptor activation in the potentiation of Itau. 4. Alpha 2 adrenoceptor activation by NE with prazosin and propranolol significantly potentiated the peak amplitude of Itau without shifting the taurine concentration-response relationships either to left or right side. The respective concentrations of taurine for the threshold, half maximal and maximal responses in the presence of 10(-4) M NE with prazosin (10(-5) M) and propranolol (10(-5) M) were 3 x 10(-5) M, 3.1 x 10(-4) M, and 3 x 10(-3) M. The same concentrations in the absence of NE were 3 x 10(-5) M, 3.2 x 10(-4) M, and 3 x 10(-3) M, respectively. 5. The reversal potentials of Itau with and without NE were very close to the theoretical Cl- equilibrium potential, thus indicating that the potentiation of Itau by alpha 2 adrenoceptor activation was due to an increase in the taurine-induced Cl- currents. 6. Forskolin (3 x 10(-5) M) and isobutylmethylxanthine (3 x 10(-5) M) suppressed the peak amplitude of Itau. In the presence of dibutyryl cyclic AMP (10(-4) M), which also suppressed Itau, alpha 2 adrenoceptor activation failed to potentiate Itau. 7. N-[2(methylamino)ethyl]-5-isoquinoline sulfonamide dihydrochloride (H-89) mimicked the effect of alpha 2 adrenoceptor activation on Itau. In addition, the potentiation of Itau by alpha 2 adrenoceptor was not observed in the presence of 10(-6) M H-89. 8. The treatment of SN neurons with pertussis toxin (500 ng/ ml) for 18 h completely abolished the facilitatory effect of alpha 2 adrenoceptor on Itau. 9. These results suggest that the activation of alpha 2 adrenoceptor coupled with IAP-sensitive GTP binding protein decreases the intracellular cyclic AMP and cyclic AMP-dependent protein kinase activity, thus resulting in the potentiation of glycine receptor-mediated taurine response in rat SN neurons. PMID:8899617

  18. Regulation of Cardiac Calcium Channels in the Fight-or-Flight Response

    PubMed Central

    Catterall, William A.

    2015-01-01

    Intracellular calcium transients generated by activation of voltage-gated calcium (CaV) channels generate local signals, which initiate physiological processes such as secretion, synaptic transmission, and excitation-contraction coupling. Regulation of calcium entry through CaV channels is crucial for control of these physiological processes. In this article, I review experimental results that have emerged over several years showing that cardiac CaV1.2 channels form a local signaling complex, in which their proteolytically processed distal C-terminal domain, an A-Kinase Anchoring Protein, and cyclic AMP-dependent protein kinase (PKA) interact directly with the transmembrane core of the ion channel through the proximal C-terminal domain. This signaling complex is the substrate for β-adrenergic up-regulation of the CaV1.2 channel in the heart during the fight-or-flight response. Protein phosphorylation of two sites at the interface between the distal and proximal C-terminal domains contributes importantly to control of basal CaV1.2 channel activity, and phosphorylation of Ser1700 by PKA at that interface up-regulates CaV1.2 activity in response to β-adrenergic signaling. Thus, the intracellular C-terminal domain of CaV1.2 channels serves as a signaling platform, mediating beat-to-beat physiological regulation of channel activity and up-regulation by β-adrenergic signaling in the fight-or-flight response. PMID:25966697

  19. Stress Reorganization and Response in Active Solids

    NASA Astrophysics Data System (ADS)

    Hawkins, Rhoda J.; Liverpool, Tanniemola B.

    2014-07-01

    We present a microscopic model of a disordered viscoelastic active solid, i.e., an active material whose long time behavior is elastic as opposed to viscous. It is composed of filaments, passive cross-links, and molecular motors powered by stored chemical energy, e.g., actomyosin powered by adenosine triphosphate. Our model allows us to study the collective behavior of contractile active elements and how their interaction with each other and the passive elastic elements determines the macroscopic mechanical properties of the active material. As a result of the (un)binding dynamics of the active elements, we find that this system provides a highly responsive material with a dynamic mechanical response strongly dependent on the amount of deformation.

  20. Spatial learning associated with stimulus response in goldfish Carassius auratus: relationship to activation of CREB signalling.

    PubMed

    Rajan, Koilmani Emmanuvel; Thangaleela, Subramanian; Balasundaram, Chellam

    2015-06-01

    Earlier, we reported spatial learning ability in goldfish (Carassius auratus) by using spatial paradigm with food reward. Therefore, we hypothesized that goldfish may use associated cue to integrate "where" and "what" for spatial memory. To test our hypothesis, we first trained goldfish to learn to cross the gate1, which is associated with spatial task. Subsequently, they were trained to learn to enter the task chamber and to identify the food reward chamber associated with visual cue (red/green light). Red and green lights were positioned randomly for each trial but always the food reward was kept in green chamber. In addition, to elucidate the role of the signalling cascade in spatial memory associated with visual cue, nicotinamide (NAM, 1000mg/kg, i.p), a NAD(+) precursor, was used to inhibit the Sirtuin 1 (SIRT1) cyclic AMP response element binding protein (CREB) pathway. Fishes were trained for 5days in a maze after treating with either vehicle (VEH, DD H2O) or NAM, and then, they were individually tested for memory. We found that VEH-treated fish learned and recalled the task successfully by showing less latency and making more correct choices than NAM-treated group. Subsequent analysis showed that NAM treatment significantly down-regulated the phosphorylation of extracellular signal-regulated kinase (ERK1/2), CREB, expression of SirT1 and brain-derived neurotrophic factor (Bdnf) in telencephalon. Taken together, our results provide behavioural evidence of spatial memory associated with visual cue in C. auratus, which could be regulated by ERK1/2-CREB-SirT1-Bdnf pathway. PMID:25739351

  1. Regional modulation of cyclic nucleotides by endothelin-1 in rat pulmonary arteries: direct activation of Gi2-protein in the main pulmonary artery

    PubMed Central

    Mullaney, Ian; Vaughan, Diane M; MacLean, Margaret R

    2000-01-01

    The ability of endothelin-1 (ET-1) to modulate the cyclic nucleotides, guanosine 3? 5? cyclic monophosphate (cyclic GMP) and adenosine 3? 5? cyclic monophosphate (cyclic AMP) was assessed in the main elastic pulmonary elastic artery (45?mm i.d.) and the small muscular pulmonary arteries (150200??m i.d.) of the rat. ET-1 caused an increase in cyclic GMP in the larger vessels but had no effect in the smaller arteries. The increase in cyclic GMP was not dependent on an intact endothelium and was inhibited by the ETA-receptor antagonist FR139137 (1??M). ET-1 caused a decrease in cyclic AMP in the main pulmonary arteries, an effect that was partially blocked by FR139317 but not influenced by the ETB-receptor antagonist BQ-788 (1??M) or removal of the vascular endothelium. In contrast, ET-1 caused an increase in cyclic AMP in the small vessels, an effect that was blocked by BQ-788 but unaffected by FR139317. In the main pulmonary arteries, ET-1 caused enhanced incorporation of radiolabelled ADP-ribose by cholera toxin into Gi2 in the main pulmonary artery, an indicator of its receptor-mediated activation. In summary, we have shown that in the small muscular pulmonary artery of the rat, (where ETB mediated vasoconstriction prevails), there is an ETB-mediated increase in cyclic AMP with no net effect on cyclic GMP levels. In the large arteries, (where vasoconstriction is mediated via the ETA receptor), there is an ETA-mediated increase in cyclic GMP (endothelium independent) and an ETA-mediated (endothelium independent) decrease in cyclic AMP. PMID:10696107

  2. Active thermal isolation for temperature responsive sensors

    NASA Technical Reports Server (NTRS)

    Martinson, Scott D. (Inventor); Gray, David L. (Inventor); Carraway, Debra L. (Inventor); Reda, Daniel C. (Inventor)

    1994-01-01

    A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specified surface of the body. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes: (1) operating the isolator at the same temperature as the constant temperature of the sensor and (2) establishing a fixed boundary temperature which is either less than or equal to or slightly greater than the sensor constant temperature.

  3. Chemosensory responses of Acanthamoeba castellanii: visual analysis of random movement and responses to chemical signals.

    PubMed

    Schuster, F L; Levandowsky, M

    1996-01-01

    A visual assay slide chamber was used in conjunction with time-lapse videomicroscopy to analyze chemotactic behavior of axenically grown Acanthamoeba castellanii. Data were collected and analyzed as vector scatter diagrams and cell tracks. Amebas responded to a variety of bacterial products or potential bacterial products by moving actively toward the attractant. Responses to the chemotactic peptide formyl-methionyl-leucyl-phenylalanine (fMLP), lipopolysaccharide, and lipid A were statistically significant (P < or = 0.03), as was the response to fMLP benzylamide (P < or = 0.05). Significant responses to cyclic AMP, lipoteichoic acid, and N-acetyl glucosamine were also found. Chemotactic peptide antagonists, mannose, mannosylated bovine serum albumin, and N-acetyl muramic acid all yielded nonsignificant responses (P > 0.05). There was no single optimal concentration for response to any of the attractants tested, and amebas responded equally over the range of concentrations tested. Pretreatment of amebas with chemotactic peptides, bacterial products, and bacteria reduced the directional response to attractants. Amebas that had been grown in the presence of bacteria appeared more responsive to chemotactic peptides. Treatment of amebas with trypsin reduced the response of cells to chemotactic peptides, though sensitivity was restored within a couple of hours. This suggests the ameba membrane may have receptors, sensitive to these bacterial substances, which are different from the mannose receptors involved in binding bacteria to the membrane during phagocytosis. The rate of movement was relatively constant (ca. 0.40 microns/s), indicating that the locomotor response to these signals is a taxis, or possibly a klinokinesis, but not an orthokinesis. Studies of the population diffusion rate in the absence of signals indicate that the basic population motility follows the pattern of a Levy walk, rather than the more familiar Gaussian diffusion. This suggests that the usual mathematical models of ameboid dispersion may need to be modified. PMID:8720945

  4. Rigor and Responsiveness in Classroom Activity

    ERIC Educational Resources Information Center

    Thomspon, Jessica; Hagenah, Sara; Kang, Hosun; Stroupe, David; Braaten, Melissa; Colley, Carolyn; Windschitl, Mark

    2016-01-01

    Background/Context: There are few examples from classrooms or the literature that provide a clear vision of teaching that simultaneously promotes rigorous disciplinary activity and is responsive to all students. Maintaining rigorous and equitable classroom discourse is a worthy goal, yet there is no clear consensus of how this actually works in a…

  5. Induction of differentiation in v-Ha-ras-transformed MDCK cells by prostaglandin E2 and 8-bromo-cyclic AMP is associated with a decrease in steady-state level of inositol 1,4,5-trisphosphate.

    PubMed Central

    Wu, Y Y; Lin, M C

    1990-01-01

    We used Ha-ras-transformed Madin-Darby canine kidney (MDCK) cells as a model to study possible signal transduction mechanisms underlying the induction of glucagon responsiveness by the differentiation inducers prostaglandin E2 (PGE2) and 8-bromo-cyclic (8-Br-cAMP) AMP and the inhibition of induction by phorbol ester or a serum factor. The steady-state level of inositol 1,4,5-trisphosphate (IP3) was higher in Ha-ras-transformed MDCK cells than in parental MDCK cells. In contrast, the steady-state level of intracellular cAMP of transformed cells was similar to that of normal cells. PGE2 and 8-Br-cAMP increased cAMP content but decreased IP3 levels in a concentration-dependent fashion after 5 days of treatment. We examined the time course for effects of PGE2 and 8-Br-cAMP and found that there was a lag period of 8 to 16 h between elevation of cAMP after the addition of 8-Br-cAMP or PGE2 and the decrease of IP3 levels. Another lag period of 2 days existed before the induction of differentiation. Both the reduction of IP3 levels and the induction of glucagon responsiveness were blocked by phorbol-12-myristate-13-acetate or serum, suggesting that a decrease in the IP3 level might be causally involved in induction of differentiation in transformed MDCK cells. However, induction of differentiation was not due to changes in the expression or guanine nucleotide-binding properties of p21 protein. It is likely that cAMP has a direct regulatory effect on the phospholipid signaling pathway. We conclude that perturbation of the inositol phosphate signaling pathway may be responsible for the induction of differentiation by PGE2 and 8-Br-cAMP in transformed MDCK cells. Images PMID:2152966

  6. Chromatin-dependent cooperativity between constitutive and inducible activation domains in CREB.

    TOXLINE Toxicology Bibliographic Information

    Asahara H; Santoso B; Guzman E; Du K; Cole PA; Davidson I; Montminy M

    2001-12-01

    The cyclic AMP (cAMP)-responsive factor CREB induces target gene expression via constitutive (Q2) and inducible (KID, for kinase-inducible domain) activation domains that function synergistically in response to cellular signals. KID stimulates transcription via a phospho (Ser133)-dependent interaction with the coactivator paralogs CREB binding protein and p300, whereas Q2 recruits the TFIID complex via a direct association with hTAF(II)130. Here we investigate the mechanism underlying cooperativity between the Q2 domain and KID in CREB by in vitro transcription assay with naked DNA and chromatin templates containing the cAMP-responsive somatostatin promoter. The Q2 domain was highly active on a naked DNA template, and Ser133 phosphorylation had no additional effect on transcriptional initiation in crude extracts. Q2 activity was repressed on a chromatin template, however, and this repression was relieved by the phospho (Ser133) KID-dependent recruitment of p300 histone acetyltransferase activity to the promoter. In chromatin immunoprecipitation assays of NIH 3T3 cells, cAMP-dependent recruitment of p300 to the somatostatin promoter stimulated acetylation of histone H4. Correspondingly, overexpression of hTAFII130 potentiated CREB activity in cells exposed to cAMP, but had no effect on reporter gene expression in unstimulated cells. We propose that cooperativity between the KID and Q2 domains proceeds via a chromatin-dependent mechanism in which recruitment of p300 facilitates subsequent interaction of CREB with TFIID.

  7. Low dielectric response in enzyme active site

    PubMed Central

    Mertz, Edward L.; Krishtalik, Lev I.

    2000-01-01

    The kinetics of charge transfer depend crucially on the dielectric reorganization of the medium. In enzymatic reactions that involve charge transfer, atomic dielectric response of the active site and of its surroundings determines the efficiency of the protein as a catalyst. We report direct spectroscopic measurements of the reorganization energy associated with the dielectric response in the active site of ?-chymotrypsin. A chromophoric inhibitor of the enzyme is used as a spectroscopic probe. We find that water strongly affects the dielectric reorganization in the active site of the enzyme in solution. The reorganization energy of the protein matrix in the vicinity of the active site is similar to that of low-polarity solvents. Surprisingly, water exhibits an anomalously high dielectric response that cannot be described in terms of the dielectric continuum theory. As a result, sequestering the active site from the aqueous environment inside low-dielectric enzyme body dramatically reduces the dielectric reorganization. This reduction is particularly important for controlling the rate of enzymatic reactions. PMID:10681440

  8. Olfactory response termination involves Ca2+-ATPase in vertebrate olfactory receptor neuron cilia.

    PubMed

    Antolin, Salome; Reisert, Johannes; Matthews, Hugh R

    2010-04-01

    In vertebrate olfactory receptor neurons (ORNs), odorant-induced activation of the transduction cascade culminates in production of cyclic AMP, which opens cyclic nucleotide-gated channels in the ciliary membrane enabling Ca(2+) influx. The ensuing elevation of the intraciliary Ca(2+) concentration opens Ca(2+)-activated Cl(-) channels, which mediate an excitatory Cl(-) efflux from the cilia. In order for the response to terminate, the Cl(-) channel must close, which requires that the intraciliary Ca(2+) concentration return to basal levels. Hitherto, the extrusion of Ca(2+) from the cilia has been thought to depend principally on a Na(+)-Ca(2+) exchanger. In this study, we show using simultaneous suction pipette recording and Ca(2+)-sensitive dye fluorescence measurements that in fire salamander ORNs, withdrawal of external Na(+) from the solution bathing the cilia, which incapacitates Na(+)-Ca(2+)exchange, has only a modest effect on the recovery of the electrical response and the accompanying decay of intraciliary Ca(2+) concentration. In contrast, exposure of the cilia to vanadate or carboxyeosin, a manipulation designed to block Ca(2+)-ATPase, has a substantial effect on response recovery kinetics. Therefore, we conclude that Ca(2+)-ATPase contributes to Ca(2+) extrusion in ORNs, and that Na(+)-Ca(2+)exchange makes only a modest contribution to Ca(2+) homeostasis in this species. PMID:20351061

  9. Sex differences in feeding behavior in rats: the relationship with neuronal activation in the hypothalamus

    PubMed Central

    Fukushima, Atsushi; Hagiwara, Hiroko; Fujioka, Hitomi; Kimura, Fukuko; Akema, Tatsuo; Funabashi, Toshiya

    2015-01-01

    There is general agreement that the central nervous system in rodents differs between sexes due to the presence of gonadal steroid hormone during differentiation. Sex differences in feeding seem to occur among species, and responses to fasting (i.e., starvation), gonadal steroids (i.e., testosterone and estradiol), and diet (i.e., western-style diet) vary significantly between sexes. The hypothalamus is the center for controlling feeding behavior. We examined the activation of feeding-related peptides in neurons in the hypothalamus. Phosphorylation of cyclic AMP response element-binding protein (CREB) is a good marker for neural activation, as is the Fos antigen. Therefore, we predicted that sex differences in the activity of melanin-concentrating hormone (MCH) neurons would be associated with feeding behavior. We determined the response of MCH neurons to glucose in the lateral hypothalamic area (LHA) and our results suggested MCH neurons play an important role in sex differences in feeding behavior. In addition, fasting increased the number of orexin neurons harboring phosphorylated CREB in female rats (regardless of the estrous day), but not male rats. Glucose injection decreased the number of these neurons with phosphorylated CREB in fasted female rats. Finally, under normal spontaneous food intake, MCH neurons, but not orexin neurons, expressed phosphorylated CREB. These sex differences in response to fasting and glucose, as well as under normal conditions, suggest a vulnerability to metabolic challenges in females. PMID:25870535

  10. Effect of Global Regulators RpoS and Cyclic-AMP/CRP on the Catabolome and Transcriptome of Escherichia coli K12 during Carbon- and Energy-Limited Growth

    PubMed Central

    Egli, Thomas

    2015-01-01

    For heterotrophic microbes, limited availability of carbon and energy sources is one of the major nutritional factors restricting the rate of growth in most ecosystems. Physiological adaptation to this hunger state requires metabolic versatility which usually involves expression of a wide range of different catabolic pathways and of high-affinity carbon transporters; together, this allows for simultaneous utilization of mixtures of carbonaceous compounds at low concentrations. In Escherichia coli the stationary phase sigma factor RpoS and the signal molecule cAMP are the major players in the regulation of transcription under such conditions; however, their interaction is still not fully understood. Therefore, during growth of E. coli in carbon-limited chemostat culture at different dilution rates, the transcriptomes, expression of periplasmic proteins and catabolomes of strains lacking one of these global regulators, either rpoS or adenylate cyclase (cya), were compared to those of the wild-type strain. The inability to synthesize cAMP exerted a strong negative influence on the expression of alternative carbon source uptake and degradation systems. In contrast, absence of RpoS increased the transcription of genes belonging to high-affinity uptake systems and central metabolism, presumably due to reduced competition of σD with σS. Phenotypical analysis confirmed this observation: The ability to respire alternative carbon substrates and to express periplasmic high-affinity binding proteins was eliminated in cya and crp mutants, while these properties were not affected in the rpoS mutant. As expected, transcription of numerous stress defence genes was negatively affected by the rpoS knock-out mutation. Interestingly, several genes of the RpoS stress response regulon were also down-regulated in the cAMP-negative strain indicating a coordinated global regulation. The results demonstrate that cAMP is crucial for catabolic flexibility during slow, carbon-limited growth, whereas RpoS is primarily involved in the regulation of stress response systems necessary for the survival of this bacterium under hunger conditions. PMID:26204448

  11. Comparison of cellular responses induced by low level light in different cell types

    NASA Astrophysics Data System (ADS)

    Huang, Ying-Ying; Chen, Aaron C.-H.; Sharma, Sulbha K.; Wu, Qiuhe; Hamblin, Michael R.

    2010-02-01

    Discoveries are rapidly being made in multiple laboratories that shed "light" on the fundamental molecular and cellular mechanisms underlying the use of low level light therapy (LLLT) in vitro, in animal models and in clinical practice. Increases in cellular levels of respiration, in cytochrome c oxidase activity, in ATP levels and in cyclic AMP have been found. Increased expression of reactive oxygen species and release of nitric oxide have also been shown. In order for these molecular changes to have a major effect on cell behavior, it is likely that various transcription factors will be activated, possibly via different signal transduction pathways. In this report we compare and contrast the effects of LLLT in vitro on murine embryonic fibroblasts, primary cortical neurons, cardiomyocytes and bone-marrow derived dendritic cells. We also examined two human cell lines, HeLa cancer cells and HaCaT keratinocytes. The effects of 810-nm near-infra-red light delivered at low and high fluences were addressed. Reactive oxygen species generation, transcription factor activation and ATP increases are reported. The data has led to the hypothesis that cells with a high level of mitochondrial activity (mitochondrial membrane potential) have a higher response to light than cells with low mitochondrial activity.

  12. The Neuroprotective Effect of Lithium in cannabinoid Dependence is Mediated through Modulation of Cyclic AMP, ERK1/2 and GSK-3? Phosphorylation in Cerebellar Granular Neurons of Rat

    PubMed Central

    Rahimi, Hamid Reza; Ghahremani, Mohammad Hossein; Dehpour, Ahmad Reza; Sharifzadeh, Mohammad; Ejtemaei-Mehr, Shahram; Razmi, Ali; Ostad, Seyed Nasser

    2015-01-01

    Lithium (Li), a glycogen synthase kinase-3? (GSK-3?) inhibitor, has used to attenuate the cannabinoid-induced dependence/withdrawal signs, but molecular mechanisms related to this are unclear. Recent studies indicate the involvement of upstream extracellular signal kinase1/2 (ERK1/2) and downstream GSK-3? pathways in the development of cannabinoid-induced dependence. This is mediated through cannabinoid receptor 1 (CB1) enriched in cerebellar granular neurons (CGNs). Accordingly, the present study aimed to investigate the mechanism of modulatory/neuroprotective effects of Li on a cannabinoid agonist (WIN 55,212-2 (WIN))-induced dependence, through quantitative analysis of some involved proteins such as ERK1/2, GSK-3? and related signaling pathways including their phosphorylated forms; and cAMP level as the other molecular mechanisms leading to dependence, in CGNs model. The CGNs were prepared from 7-day-old Wistar rat pup in a 12-well plate, pretreated with Li (1mM) and an ERK1/2 inhibitor SL327 (SL, 10 M). The WIN (1 M) was added 30 minutes prior to treatment and AM251 (AM, 1 M), as a cannabinoid antagonist was co-treated with WIN. The cAMP level, as an indicator of cannabinoid-induced dependence, was measured by ELISA following forskolin (FSK) stimulation. Western blot analyses determined the phosphorylated forms of ERK1/2 (p-ERK1/2), GSK-3? (p-GSK-3?) as well as their total expressions in various treatment times and doses in CGNs. WIN alone could down regulate the cAMP/p-ERK1/2 cascade compared to AM treatment. However, P-GSK-3? was up-regulated with Li and WIN or with SL and Li pretreatment to AM-induced cellular response, which was the highest 60 minutes after CGNs exposure. Results further suggested the potential role of Li pretreatment to diminish the development of cannabinoid-induced dependence/neuronal injury through possible mechanisms of modulating the cAMP/p-ERK1/2 cascade independent of p-GSK-3? signaling pathway in-vitro.

  13. The Neuroprotective Effect of Lithium in cannabinoid Dependence is Mediated through Modulation of Cyclic AMP, ERK1/2 and GSK-3? Phosphorylation in Cerebellar Granular Neurons of Rat.

    PubMed

    Rahimi, Hamid Reza; Ghahremani, Mohammad Hossein; Dehpour, Ahmad Reza; Sharifzadeh, Mohammad; Ejtemaei-Mehr, Shahram; Razmi, Ali; Ostad, Seyed Nasser

    2015-01-01

    Lithium (Li), a glycogen synthase kinase-3? (GSK-3?) inhibitor, has used to attenuate the cannabinoid-induced dependence/withdrawal signs, but molecular mechanisms related to this are unclear. Recent studies indicate the involvement of upstream extracellular signal kinase1/2 (ERK1/2) and downstream GSK-3? pathways in the development of cannabinoid-induced dependence. This is mediated through cannabinoid receptor 1 (CB1) enriched in cerebellar granular neurons (CGNs). Accordingly, the present study aimed to investigate the mechanism of modulatory/neuroprotective effects of Li on a cannabinoid agonist (WIN 55,212-2 (WIN))-induced dependence, through quantitative analysis of some involved proteins such as ERK1/2, GSK-3? and related signaling pathways including their phosphorylated forms; and cAMP level as the other molecular mechanisms leading to dependence, in CGNs model. The CGNs were prepared from 7-day-old Wistar rat pup in a 12-well plate, pretreated with Li (1mM) and an ERK1/2 inhibitor SL327 (SL, 10 M). The WIN (1 M) was added 30 minutes prior to treatment and AM251 (AM, 1 M), as a cannabinoid antagonist was co-treated with WIN. The cAMP level, as an indicator of cannabinoid-induced dependence, was measured by ELISA following forskolin (FSK) stimulation. Western blot analyses determined the phosphorylated forms of ERK1/2 (p-ERK1/2), GSK-3? (p-GSK-3?) as well as their total expressions in various treatment times and doses in CGNs. WIN alone could down regulate the cAMP/p-ERK1/2 cascade compared to AM treatment. However, P-GSK-3? was up-regulated with Li and WIN or with SL and Li pretreatment to AM-induced cellular response, which was the highest 60 minutes after CGNs exposure. Results further suggested the potential role of Li pretreatment to diminish the development of cannabinoid-induced dependence/neuronal injury through possible mechanisms of modulating the cAMP/p-ERK1/2 cascade independent of p-GSK-3? signaling pathway in-vitro. PMID:26664379

  14. Electrophysiological responses of neurons in the rat spinal cord to nitric oxide.

    PubMed

    Pehl, U; Schmid, H A

    1997-03-01

    The effects of nitric oxide-containing solution and different nitric oxide donors were investigated on spontaneously active neurons using extracellular recording technique in areas of rat spinal cord slices where high levels of nitric oxide synthase are present. In lamina X, 93% of all neurons investigated (n = 84) increased their firing rate and 2% decreased it by superfusion with the nitric oxide donor sodium nitroprusside. In contrast, 49% of all neurons in laminae I and II (n = 90) were inhibited and only 28% were activated. Both effects were due to the postsynaptic action of sodium nitroprusside, because they could still be observed in medium containing 0.3 mM Ca2+ and 9 mM Mg2+, known to block synaptic transmission. Application of 8-bromo-cyclic-GMP caused an excitation of every neuron which was excited by sodium nitroprusside and an inhibition of every cell which was inhibited by sodium nitroprusside (n = 25). This effect was different from the effect of 8-bromo-cyclic-AMP, which mimicked only the excitatory, but not the inhibitory response of sodium nitroprusside. These results provide evidence that nitric oxide in the spinal cord can directly cause an excitation or an inhibition of the electrical activity of spinal neurons. Another, more general conclusion from our results is that the nitric oxide-induced production of cyclic-GMP alone does not allow any prediction about an excitatory or inhibitory effect on the neuronal activity, which has to be determined separately. PMID:9472412

  15. Nuclear condensation of cyclic adenosine monophosphate responsive element-binding protein in discrete murine brain structures.

    PubMed

    Kuramoto, Nobuyuki; Kubo, Keita; Ogita, Kiyokazu; Pláteník, Jan; Balcar, Vladimir J; Takarada, Takeshi; Nakamichi, Noritaka; Yoneda, Yukio

    2005-06-01

    We have directed a polyclonal antibody against an oligo-peptide (123-136) of the transcription factor cyclic AMP responsive element-binding protein (CREB) including the serine residue at 133. Rabbit sera were purified by ammonium sulfate precipitation, followed by affinity chromatography to homogeneity on one-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis. The purified antibody not only induced marked supershift of CREB binding, without affecting binding of activator protein-1 on gel retardation electrophoresis, but also differentiated between CREB and CREB phosphorylated at serine133 in brain nuclear fractions on Western blotting. Immunoreactive CREB was detected in both cytosolic and nuclear fractions of discrete murine brain structures but was more highly condensed in cerebellum than in neocortex and hippocampus. Incubation of brain nuclear fractions led to a marked export of immunoreactive CREB in a temperature-dependent manner, whereas the temperature-dependent export activity was significantly lower in cerebellum than in other brain structures. Suppression of general new protein synthesis by cycloheximide (500 mg/kg, i.p.) in vivo resulted in a significant decrease in the nuclear CREB level, with a concomitant increase in the cytosolic level in hippocampus, but not in cerebellum. These results suggest that the nuclear export activity might vary from region to region in murine brains through a hitherto unidentified mechanism other than the nuclear localization signal, to result in different nuclear condensation ratios for subsequent elicitation of differential transcriptional activities by the constitutive transcription factor CREB in the nucleus. PMID:15880467

  16. The Epithelial Sodium Channel (ENaC) Establishes a Trafficking Vesicle Pool Responsible for Its Regulation

    PubMed Central

    Edinger, Robert S.; Bertrand, Carol A.; Rondandino, Christine; Apodaca, Gerard A.; Johnson, John P.; Butterworth, Michael B.

    2012-01-01

    The epithelial sodium channel (ENaC) is the rate-limiting step for sodium reabsorption across tight epithelia. Cyclic-AMP (cAMP) stimulation promotes ENaC trafficking to the apical surface to increase channel number and transcellular Na+ transport. Removal of corticosteroid supplementation in a cultured cortical collecting duct cell line reduced ENaC expression. Concurrently, the number of vesicles trafficked in response to cAMP stimulation, as measured by a change in membrane capacitance, also decreased. Stimulation with aldosterone restored both the basal and cAMP-stimulated ENaC activity and increased the number of exocytosed vesicles. Knocking down ENaC directly decreased both the cAMP-stimulated short-circuit current and capacitance response in the presence of aldosterone. However, constitutive apical recycling of the Immunoglobulin A receptor was unaffected by alterations in ENaC expression or trafficking. Fischer Rat Thyroid cells, transfected with α,β,γ-mENaC had a significantly greater membrane capacitance response to cAMP stimulation compared to non-ENaC controls. Finally, immunofluorescent labeling and quantitation revealed a smaller number of vesicles in cells where ENaC expression was reduced. These findings indicate that ENaC is not a passive passenger in regulated epithelial vesicle trafficking, but plays a role in establishing and maintaining the pool of vesicles that respond to cAMP stimulation. PMID:23029554

  17. THE MOLECULAR PHYSIOLOGY OF CRH NEURONS

    PubMed Central

    Aguilera, Greti; Liu, Ying

    2012-01-01

    Corticotropin releasing hormone (CRH) is essential for stress adaptation by mediating hypothalamic-pituitary adrenal (HPA) axis, behavioral and autonomic responses to stress. Activation of CRH neurons depends on neural afferents from the brain stem and limbic system, leading to sequential CRH release and synthesis. CRH transcription is required to restore mRNA and peptide levels, but termination of the response is essential to prevent pathology associated with chronic elevations of CRH and HPA axis activity. Inhibitory feedback mediated by glucocorticoids and intracellular production of the repressor, Inducible Cyclic AMP Early Repressor (ICER), limit the magnitude and duration of CRH neuronal activation. Induction of CRH transcription is mediated by the cyclic AMP/protein kinase A/cyclic AMP responsive element binding protein (CREB)-dependent pathways, and requires cyclic AMP-dependent nuclear translocation of the CREB co-activator, Transducer of Regulated CREB activity (TORC). This article reviews current knowledge on the mechanisms regulating CRH neuron activity. PMID:21871477

  18. Active thermal isolation for temperature responsive sensors

    NASA Technical Reports Server (NTRS)

    Martinson, Scott D. (Inventor); Gray, David L. (Inventor); Carraway, Debra L. (Inventor); Reda, Daniel C. (Inventor)

    1994-01-01

    The detection of flow transition between laminar and turbulent flow and of shear stress or skin friction of airfoils is important in basic research for validation of airfoil theory and design. These values are conventionally measured using hot film nickel sensors deposited on a polyimide substrate. The substrate electrically insulates the sensor and underlying airfoil but is prevented from thermally isolating the sensor by thickness constraints necessary to avoid flow contamination. Proposed heating of the model surface is difficult to control, requires significant energy expenditures, and may alter the basic flow state of the airfoil. A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specific surface of the body. The total thickness of the isolator and sensor avoid any contamination of the flow. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes (1) operating the isolator at the same temperature as the constant temperature of the sensor; and (2) establishing a fixed boundary temperature which is either less than or equal to, or slightly greater than the sensor constant temperature. The present invention accordingly thermally isolates a temperature responsive sensor in an energy efficient, controllable manner while avoiding any contamination of the flow.

  19. Cyclic AMP induces differentiation in vitro of human melanoma cells.

    PubMed

    Giuffrè, L; Schreyer, M; Mach, J P; Carrel, S

    1988-03-15

    Treating human melanoma lines with dibutyryl adenosine 3':5'-cyclic monophosphate (dbc AMP) resulted in morphologic changes associated with the altered expression of cell surface antigens. After treatment, cells developed long cellular projections characteristic of mature melanocytes and showed the presence of an increased number of Stage II premelanosomes. In addition, induction of melanin synthesis, detected as brown perinuclear pigmentation, was observed. The AMP further drastically reduced the growth rate of the five melanoma cell lines that were tested. The influence of dbc AMP was completely reversible 3 days after the agent was removed from the culture medium. The antigenic phenotype of the melanoma lines was compared before and after dbc AMP treatment. This was done with four monoclonal antibodies directed against major histocompatibility complex (MHC) Class I and II antigens and 11 monoclonal antibodies defining eight different melanoma-associated antigenic systems. Treatment with dbc AMP reduced the expression of human leukocyte antigen (HLA)-ABC antigens and beta-2-microglobulin in five of five melanoma lines. In the two HLA-DR-positive cell lines dbc AMP reduced the expression of this antigen in one line and enhanced it in the other. No induction of HLA-DR or HLA-DC antigens was observed in the Class II negative cell lines. Furthermore, dbc-AMP modulated the expression of the majority of the melanoma antigenic systems tested. The expression of a 90-kilodalton (KD) antigen, which has been found to be upregulated by interferon-gamma, was markedly decreased in all the five cell lines. A similar decrease in the expression of the high molecular weight proteoglycan-associated antigen (220-240 KD) was observed. The reduced expression of Class I and II MHC antigens as well as the altered expression of the melanoma-associated antigens studied were shown to be reversible after dbc AMP was removed. Our results collectively show that the monoclonal antibody-defined melanoma-associated molecules are linked to differentiation. They could provide useful tools for monitoring the maturation of melanomas in vivo induced by chemical agents or natural components favoring differentiation. PMID:2830005

  20. Effect of captopril on ocular irritative response to topical neutral formaldehyde and YAG-laser capsulotomy in the rabbit.

    PubMed

    Krootila, K; Oksala, O; Von Dickhoff, K; Palkama, A; Uusitalo, H

    1995-01-01

    Angiotensin converting enzyme (ACE) -inhibitors inhibit degradation of inflammatory mediators substance P (SP) and bradykinin, which may further stimulate the synthesis of prostaglandins. The resulting increase in inflammatory mediators in tissues is suggested to be the reason for the dry cough, involving sensory C-fiber activation, among patients receiving ACE-inhibitor therapy. In the present study, the effect of an ACE-inhibitor, captopril, on ocular irritative responses was studied in the rabbit. Intravenous captopril decreased markedly the blood pressure and the intraocular pressure (IOP) modestly. Topical neutral formaldehyde elicits an irritative response in the eye mediated through sensory neuropeptides SP and calcitonin gene-related peptide (CGRP). Following topical neutral formaldehyde, the increase in IOP and breakdown of the blood-aqueous barrier were inhibited by captopril, while miosis was not affected. Cyclic AMP (cAMP) content in the aqueous humour was increased by captopril, and this increase was inhibited by indomethacin. Following YAG-laser anterior capsulotomy, captopril inhibited the increase in IOP, breakdown of the blood-aqueous barrier and miosis. The present study demonstrates that use of short-term administration of captopril prior to sensory nerve stimulation or YAG laser anterior capsulotomy does not enhance the ocular responses to these stimuli in the rabbit. In the present study, captopril inhibited these responses, at least partly by decreasing the blood pressure. PMID:8590256

  1. Metabolic responses to simulated extravehicular activity

    NASA Technical Reports Server (NTRS)

    Williamson, Rebecca C.; Sharer, Peter J.; Webbon, Bruce W.; Rendon, Lisa R.

    1992-01-01

    Automatic control of the liquid cooling garment (LCG) worn by astronauts during extravehicular activity (EVA) would more efficiently regulate astronaut thermal comfort and improve astronaut productivity. An experiment was conducted in which subjects performed exercise profiles on a unique, supine upper body ergometer to elicit physiological and thermal responses similar to those achieved during zero-g EVAs. Results were analyzed to quantify metabolic rate, various body temperatures, and other heat balance parameters. Such data may lead to development of a microprocessor-based system to automatically maintain astronaut heat balance during extended EVAs.

  2. Hormonal control of pyruvate kinase activity and of gluconeogenesis in isolated hepatocytes.

    PubMed Central

    Feli, J E; Hue, L; Hers, H G

    1976-01-01

    Treatment of isolated rat hepatocytes with saturating concentrations of glucagon caused several modifications properties of pyruvate kinase (ATP:pyruvate 2-O-phosphotransferase, EC 2.7.1.40): S0.5 (substrate concentration at half maximum velocity) for phosphoenolpyruvate was about doubled, whereas Vmax was not changed; the activity measured at 0.15 mM phosphoenolpyruvate (physiological concentration) was reduced 65-80%; and there was also an increase in the Hill coefficient and in the affinity of the enzyme for the inhibitors Mg-ATP and alanine. Glucagon, 3':5'-cyclic AMP, and epinephrine caused an inactivation of pyruvate kinase together with a sitmulation of gluconeogenesis. Insulin (10 nM) antagonized the effect of suboptimal doses of glucagon or cyclic AMP and of even maximal doses of epinephrine, on both pyruvate kinase activity and on gluconeogenesis. These observations can be explained by a phosphorylation of pyruvate kinase by cyclic-AMP-dependent protein kinase, as described by Ljungstrm et al. [(1974) Biochim. Biophys. Acta 358, 289-298] in a reconstructed system. They offer a molecular explanation for the hormonal control of gluconeogenesis. Glucose caused an inhibition of gluconeogenesis with no corresponding change in pyruvate kinase activity. PMID:183209

  3. Multistep regulation of enhancer activity of the 21-base-pair element of human T-cell leukemia virus type I.

    PubMed Central

    Niki, M; Ohtani, K; Nakamura, M; Sugamura, K

    1992-01-01

    We examined the regulatory mechanisms of binding and transcriptional enhancement of the 21-bp core element of the enhancer of human T-cell leukemia virus type I (HTLV-I) in response to forskolin, 12-O-tetradecanoylphorbol-13-acetate (TPA), and a viral transactivator, p40tax. The 21-bp core element has been shown to bind to a cyclic AMP-responsive element binding protein (CREB)-like molecule at the site of an imperfect palindrome containing the TGAC motif. Experiments with oligonucleotides with mutations in the imperfect palindrome demonstrated that one TGAC motif is necessary and sufficient for both the binding of the CREB-related factor and transcriptional activity in response to forskolin in a human T-cell line, Jurkat. We also found that binding of the CREB-like factor to the 21-bp core element was enhanced by treatment with TPA, with little effect on transcriptional activity; in contrast, forskolin and p40tax did not facilitate binding, though they enhanced transcription. The combination of forskolin and TPA synergistically induced the transcription activity of the element, showing a hierarchical mechanism of regulation of the HTLV-I core enhancer element to levels sufficient for formation of the factor-enhancer complex and for activation of the complex. Added to those findings, our results indicate that the modes of activation by forskolin and p40tax are different from each other. Images PMID:1534852

  4. Identification and Functional Characterization of Rca1, a Transcription Factor Involved in both Antifungal Susceptibility and Host Response in Candida albicans

    PubMed Central

    Vandeputte, Patrick; Pradervand, Sylvain; Ischer, Françoise; Coste, Alix T.; Ferrari, Sélène; Harshman, Keith

    2012-01-01

    The identification of novel transcription factors associated with antifungal response may allow the discovery of fungus-specific targets for new therapeutic strategies. A collection of 241 Candida albicans transcriptional regulator mutants was screened for altered susceptibility to fluconazole, caspofungin, amphotericin B, and 5-fluorocytosine. Thirteen of these mutants not yet identified in terms of their role in antifungal response were further investigated, and the function of one of them, a mutant of orf19.6102 (RCA1), was characterized by transcriptome analysis. Strand-specific RNA sequencing and phenotypic tests assigned Rca1 as the regulator of hyphal formation through the cyclic AMP/protein kinase A (cAMP/PKA) signaling pathway and the transcription factor Efg1, but also probably through its interaction with a transcriptional repressor, most likely Tup1. The mechanisms responsible for the high level of resistance to caspofungin and fluconazole observed resulting from RCA1 deletion were investigated. From our observations, we propose that caspofungin resistance was the consequence of the deregulation of cell wall gene expression and that fluconazole resistance was linked to the modulation of the cAMP/PKA signaling pathway activity. In conclusion, our large-scale screening of a C. albicans transcription factor mutant collection allowed the identification of new effectors of the response to antifungals. The functional characterization of Rca1 assigned this transcription factor and its downstream targets as promising candidates for the development of new therapeutic strategies, as Rca1 influences host sensing, hyphal development, and antifungal response. PMID:22581526

  5. KLF2 Is a Novel Transcriptional Regulator of Endothelial Proinflammatory Activation

    PubMed Central

    SenBanerjee, Sucharita; Lin, Zhiyong; Atkins, G. Brandon; Greif, Daniel M.; Rao, Ravi M.; Kumar, Ajay; Feinberg, Mark W.; Chen, Zhiping; Simon, Daniel I.; Luscinskas, F. William; Michel, Thomas M.; Gimbrone, Michael A.; García-Cardeña, Guillermo; Jain, Mukesh K.

    2004-01-01

    The vascular endothelium is a critical regulator of vascular function. Diverse stimuli such as proinflammatory cytokines and hemodynamic forces modulate endothelial phenotype and thereby impact on the development of vascular disease states. Therefore, identification of the regulatory factors that mediate the effects of these stimuli on endothelial function is of considerable interest. Transcriptional profiling studies identified the Kruppel-like factor (KLF)2 as being inhibited by the inflammatory cytokine interleukin-1β and induced by laminar shear stress in cultured human umbilical vein endothelial cells. Overexpression of KLF2 in umbilical vein endothelial cells robustly induced endothelial nitric oxide synthase expression and total enzymatic activity. In addition, KLF2 overexpression potently inhibited the induction of vascular cell adhesion molecule-1 and endothelial adhesion molecule E-selectin in response to various proinflammatory cytokines. Consistent with these observations, in vitro flow assays demonstrate that T cell attachment and rolling are markedly attenuated in endothelial monolayers transduced with KLF2. Finally, our studies implicate recruitment by KLF2 of the transcriptional coactivator cyclic AMP response element–binding protein (CBP/p300) as a unifying mechanism for these various effects. These data implicate KLF2 as a novel regulator of endothelial activation in response to proinflammatory stimuli. PMID:15136591

  6. Continental response to active ridge subduction

    NASA Astrophysics Data System (ADS)

    Haschke, M.; Sobel, E. R.; Blisniuk, P.; Strecker, M. R.; Warkus, F.

    2006-08-01

    Apatite fission track ages from a ~2000 m elevation transect from the Patagonian fold and thrust belt (47.5S) allow us to quantify the denudational and orographic response of the upper plate to active ridge subduction. Accelerated cooling started at 17 Ma, predating the onset of ridge collision (14-10 Ma), and was followed by reheating between 10 and 6 Ma. Thermal modeling favors reheating on the order of 60C at ~28C/Ma due to east-migration of a slab window after the ridge-trench collision. Final rapid cooling since 4 Ma of ~18C/Ma (geothermal gradient of 14C/km) correlates with the presence of an orographic barrier and >1 km rock uplift in this region between 17.1 and 6.3 Ma. Increased precipitation and erosion since 4 Ma caused asymmetric exhumation, with 3-4 km on the leeside. Repeated crustal unroofing in response to active ridge subduction can explain the positive gravity anomaly south of the Chile Triple Junction.

  7. Saccharomyces cerevisiae Phospholipase C Regulates Transcription of Msn2p-Dependent Stress-Responsive Genes?

    PubMed Central

    Demczuk, Agnieszka; Guha, Nilanjan; Nguyen, Peter H.; Desai, Parima; Chang, Jennifer; Guzinska, Katarzyna; Rollins, Janet; Ghosh, Chandra C.; Goodwin, Leslie; Vancura, Ales

    2008-01-01

    Phosphatidylinositol phosphates are involved in signal transduction, cytoskeletal organization, and membrane trafficking. Inositol polyphosphates, produced from phosphatidylinositol phosphates by the phospholipase C-dependent pathway, regulate chromatin remodeling. We used genome-wide expression analysis to further investigate the roles of Plc1p (phosphoinositide-specific phospholipase C in Saccharomyces cerevisiae) and inositol polyphosphates in transcriptional regulation. Plc1p contributes to the regulation of approximately 2% of yeast genes in cells grown in rich medium. Most of these genes are induced by nutrient limitation and other environmental stresses and are derepressed in plc1? cells. Surprisingly, genes regulated by Plc1p do not correlate with gene sets regulated by Swi/Snf or RSC chromatin remodeling complexes but show correlation with genes controlled by Msn2p. Our results suggest that the increased expression of stress-responsive genes in plc1? cells is mediated by decreased cyclic AMP synthesis and protein kinase A (PKA)-mediated phosphorylation of Msn2p and increased binding of Msn2p to stress-responsive promoters. Accordingly, plc1? cells display other phenotypes characteristic of cells with decreased PKA activity. Our results are consistent with a model in which Plc1p acts together with the membrane receptor Gpr1p and associated G? protein Gpa2p in a pathway separate from Ras1p/Ras2p and converging on PKA. PMID:18375619

  8. Transcriptional Activation by NF-?B Requires Multiple Coactivators

    PubMed Central

    Sheppard, Kelly-Ann; Rose, David W.; Haque, Zaffar K.; Kurokawa, Riki; McInerney, Eileen; Westin, Stefan; Thanos, Dimitris; Rosenfeld, Michael G.; Glass, Christopher K.; Collins, Tucker

    1999-01-01

    Nuclear factor-?B (NF-?B) plays a role in the transcriptional regulation of genes involved in inflammation and cell survival. In this report we demonstrate that NF-?B recruits a coactivator complex that has striking similarities to that recruited by nuclear receptors. Inactivation of either cyclic AMP response element binding protein (CREB)-binding protein (CBP), members of the p160 family of coactivators, or the CBP-associated factor (p/CAF) by nuclear antibody microinjection prevents NF-?B-dependent transactivation. Like nuclear receptor-dependent gene expression, NF-?B-dependent gene expression requires specific LXXLL motifs in one of the p160 family members, and enhancement of NF-?B activity requires the histone acetyltransferase (HAT) activity of p/CAF but not that of CBP. This coactivator complex is differentially recruited by members of the Rel family. The p50 homodimer fails to recruit coactivators, although the p50-p65 heterodimeric form of the transcription factor assembles the integrator complex. These findings provide new mechanistic insights into how this family of dimeric transcription factors has a differential effect on gene expression. PMID:10454583

  9. Dopamine counteracts octopamine signalling in a neural circuit mediating food response in C. elegans.

    PubMed

    Suo, Satoshi; Culotti, Joseph G; Van Tol, Hubert H M

    2009-08-19

    Animals assess food availability in their environment by sensory perception and respond to the absence of food by changing hormone and neurotransmitter signals. However, it is largely unknown how the absence of food is perceived at the level of functional neurocircuitry. In Caenorhabditis elegans, octopamine is released from the RIC neurons in the absence of food and activates the cyclic AMP response element binding protein in the cholinergic SIA neurons. In contrast, dopamine is released from dopaminergic neurons only in the presence of food. Here, we show that dopamine suppresses octopamine signalling through two D2-like dopamine receptors and the G protein Gi/o. The D2-like receptors work in both the octopaminergic neurons and the octopamine-responding SIA neurons, suggesting that dopamine suppresses octopamine release as well as octopamine-mediated downstream signalling. Our results show that C. elegans detects the absence of food by using a small neural circuit composed of three neuron types in which octopaminergic signalling is activated by the cessation of dopamine signalling. PMID:19609300

  10. Strain activation of bovine aortic smooth muscle cell proliferation and alignment: study of strain dependency and the role of protein kinase A and C signaling pathways

    NASA Technical Reports Server (NTRS)

    Mills, I.; Cohen, C. R.; Kamal, K.; Li, G.; Shin, T.; Du, W.; Sumpio, B. E.

    1997-01-01

    Smooth muscle cell (SMC) phenotype can be altered by physical forces as demonstrated by cyclic strain-induced changes in proliferation, orientation, and secretion of macromolecules. However, the magnitude of strain required and the intracellular coupling pathways remain ill defined. To examine the strain requirements for SMC proliferation, we selectively seeded bovine aortic SMC either on the center or periphery of silastic membranes which were deformed with 150 mm Hg vacuum (0-7% center; 7-24% periphery). SMC located in either the center or peripheral regions showed enhanced proliferation compared to cells grown under the absence of cyclic strain. Moreover, SMC located in the center region demonstrated significantly (P < 0.005) greater proliferation as compared to those in the periphery. In contrast, SMC exposed to high strain (7-24%) demonstrated alignment perpendicular to the strain gradient, whereas SMC in the center (0-7%) remained aligned randomly. To determine the mechanisms of these phenomena, we examined the effect of cyclic strain on bovine aortic SMC signaling pathways. We observed strain-induced stimulation of the cyclic AMP pathway including adenylate cyclase activity and cyclic AMP accumulation. In addition, exposure of SMC to cyclic strain caused a significant increase in protein kinase C (PKC) activity and enzyme translocation from the cytosol to a particulate fraction. Further study was conducted to examine the effect of strain magnitude on signaling, particularly protein kinase A (PKA) activity as well as cAMP response element (CRE) binding protein levels. We observed significantly (P < 0.05) greater PKA activity and CRE binding protein levels in SMC located in the center as compared to the peripheral region. However, inhibition of PKA (with 10 microM Rp-cAMP) or PKC (with 5-20 ng/ml staurosporine) failed to alter either the strain-induced increase in SMC proliferation or alignment. These data characterize the strain determinants for activation of SMC proliferation and alignment. Although strain activated both the AC/cAMP/PKA and the PKC pathways in SMC, singular inhibition of PKA and PKC failed to prevent strain-induced alignment and proliferation, suggesting either their lack of involvement or the multifactorial nature of these responses.

  11. A novel family of dehydrin-like proteins is involved in stress response in the human fungal pathogen Aspergillus fumigatus

    PubMed Central

    Hoi, Joanne Wong Sak; Lamarre, Claude; Beau, Rémi; Meneau, Isabelle; Berepiki, Adokiye; Barre, Annick; Mellado, Emilia; Read, Nick D.; Latgé, Jean-Paul

    2011-01-01

     During a search for genes controlling conidial dormancy in Aspergillus fumigatus, two dehydrin-like genes, DprA and DprB, were identified. The deduced proteins had repeated stretches of 23 amino acids that contained a conserved dehydrin-like protein (DPR) motif. Disrupted DprAΔ mutants were hypersensitive to oxidative stress and to phagocytic killing, whereas DprBΔ mutants were impaired in osmotic and pH stress responses. However, no effect was observed on their pathogenicity in our experimental models of invasive aspergillosis. Molecular dissection of the signaling pathways acting upstream showed that expression of DprA was dependent on the stress-activated kinase SakA and the cyclic AMP-protein kinase A (cAMP-PKA) pathways, which activate the bZIP transcription factor AtfA, while expression of DprB was dependent on the SakA mitogen-activated protein kinase (MAPK) pathway, and the zinc finger transcription factor PacC. Fluorescent protein fusions showed that both proteins were associated with peroxisomes and the cytosol. Accordingly, DprA and DprB were important for peroxisome function. Our findings reveal a novel family of stress-protective proteins in A. fumigatus and, potentially, in filamentous ascomycetes. PMID:21490150

  12. PakD, a putative p21-activated protein kinase in Dictyostelium discoideum, regulates actin.

    PubMed

    Garcia, Miguel; Ray, Sibnath; Brown, Isaiah; Irom, Jon; Brazill, Derrick

    2014-01-01

    Proper regulation of the actin cytoskeleton is essential for cell function and ultimately for survival. Tight control of actin dynamics is required for many cellular processes, including differentiation, proliferation, adhesion, chemotaxis, endocytosis, exocytosis, and multicellular development. Here we describe a putative p21-activated protein kinase, PakD, that regulates the actin cytoskeleton in Dictyostelium discoideum. We found that cells lacking pakD are unable to aggregate and thus unable to develop. Compared to the wild type, cells lacking PakD have decreased membrane extensions, suggesting defective regulation of the actin cytoskeleton. pakD(-) cells show poor chemotaxis toward cyclic AMP (cAMP) but normal chemotaxis toward folate, suggesting that PakD mediates some but not all chemotaxis responses. pakD(-) cells have decreased polarity when placed in a cAMP gradient, indicating that the chemotactic defects of the pakD(-) cells may be due to an impaired cytoskeletal response to cAMP. In addition, while wild-type cells polymerize actin in response to global stimulation by cAMP, pakD(-) cells exhibit F-actin depolymerization under the same conditions. Taken together, the results suggest that PakD is part of a pathway coordinating F-actin organization during development. PMID:24243792

  13. PakD, a Putative p21-Activated Protein Kinase in Dictyostelium discoideum, Regulates Actin

    PubMed Central

    Garcia, Miguel; Ray, Sibnath; Brown, Isaiah; Irom, Jon

    2014-01-01

    Proper regulation of the actin cytoskeleton is essential for cell function and ultimately for survival. Tight control of actin dynamics is required for many cellular processes, including differentiation, proliferation, adhesion, chemotaxis, endocytosis, exocytosis, and multicellular development. Here we describe a putative p21-activated protein kinase, PakD, that regulates the actin cytoskeleton in Dictyostelium discoideum. We found that cells lacking pakD are unable to aggregate and thus unable to develop. Compared to the wild type, cells lacking PakD have decreased membrane extensions, suggesting defective regulation of the actin cytoskeleton. pakD? cells show poor chemotaxis toward cyclic AMP (cAMP) but normal chemotaxis toward folate, suggesting that PakD mediates some but not all chemotaxis responses. pakD? cells have decreased polarity when placed in a cAMP gradient, indicating that the chemotactic defects of the pakD? cells may be due to an impaired cytoskeletal response to cAMP. In addition, while wild-type cells polymerize actin in response to global stimulation by cAMP, pakD? cells exhibit F-actin depolymerization under the same conditions. Taken together, the results suggest that PakD is part of a pathway coordinating F-actin organization during development. PMID:24243792

  14. Distribution and effects of pituitary adenylate cyclase activating peptide in cat and human lower oesophageal sphincter.

    PubMed Central

    Ny, L.; Larsson, B.; Alm, P.; Ekstrm, P.; Fahrenkrug, J.; Hannibal, J.; Andersson, K. E.

    1995-01-01

    1. The localization, tissue concentrations, and effects of pituitary adenylate cyclase activating peptide (PACAP) 27 and 38 were investigated in cat and human lower oesophageal sphincter (LOS), and compared with those of vasoactive intestinal peptide (VIP) and helospectin. 2. PACAP-immunoreactive nerve structures were found in the cat and human LOS, with an abundance in the circular smooth muscle layer. PACAP 27-immunoreactivity was often co-localized with VIP-immunoreactivity. 3. In cat tissue, PACAP (PACAP 27 plus PACAP 38) concentrations were 50 fold lower than VIP concentrations; in human tissue they were 10 fold lower. 4. PACAP 27, PACAP 38, helospectin I, and VIP induced concentration-dependent relaxations in circular smooth muscle preparations from cat and human LOS. The order of potency was: VIP > helospectin I > or = PACAP 27 > PACAP 38. NG-nitro-L-arginine, scopolamine, or apamin, did not influence the relaxant effects of PACAP 27 or VIP. 5. In cat preparations, both cyclic AMP and cyclic GMP levels were increased after exposure to PACAP 27 and helospectin I, whereas exposure to VIP was followed by an increase in cyclic AMP levels only. In human preparations, there was an increase in cyclic AMP levels without any change in cyclic GMP levels. 6. These results suggest that in the cat and human LOS, PACAP 27 and VIP can occur within the same nerve structures. PACAP 27 has a potent relaxant action, but its functional importance has to be established. Images Figure 1 Figure 2 Figure 3 PMID:8680719

  15. Gliadins induce TNFalpha production through cAMP-dependent protein kinase A activation in intestinal cells (Caco-2).

    PubMed

    Laparra Llopis, Jos Moiss; Sanz Herranz, Yolanda

    2010-06-01

    Celiac disease is an autoimmune enteropathy caused by a permanent intolerance to gliadins. In this study the effects of two gliadin-derived peptides (PA2, PQPQLPYPQPQLP and PA9, QLQPFPQPQLPY) on TNFalpha production by intestinal epithelial cells (Caco-2) and whether these effects were related to protein kinase A (PKA) and/or -C (PKC) activities have been evaluated. Caco-2 cell cultures were challenged with several sets of gliadin peptides solutions (0.25 mg/mL), with/without different activators of PKA or PKC, bradykinin (Brdkn) and pyrrolidine dithiocarbamate (PDTC). The gliadin-derived peptides assayed represent the two major immunodominant epitopes of the peptide 33-mer of alpha-gliadin (56-88) (LQLQPFPQPQLPYPQPQLPYPQPQLPYPQPQPF). Both peptides induced the TNFalpha production triggering the inflammatory cell responses, the PA2 being more effective. The addition of the peptides in the presence of dibutyril cyclic AMP (cAMP), Brdkn or PDTC, inhibited the TNFalpha production. The PKC-activator phorbol 12-myristate 13-diacetate additionally increased the PA2- and PA9-induced TNFalpha production. These results link the gliadin-derived peptides induced TNFalpha production through cAMP-dependent PKA activation, where ion channels controlling calcium influx into cells could play a protective role, and requires NF-kappaB activation. PMID:20514534

  16. Ibudilast, a Pharmacologic Phosphodiesterase Inhibitor, Prevents Human Immunodeficiency Virus-1 Tat-Mediated Activation of Microglial Cells

    PubMed Central

    Kiebala, Michelle; Maggirwar, Sanjay B.

    2011-01-01

    Human Immunodeficiency Virus-1 (HIV-1)-associated neurocognitive disorders (HAND) occur, in part, due to the inflammatory response to viral proteins, such as the HIV-1 transactivator of transcription (Tat), in the central nervous system (CNS). Given the need for novel adjunctive therapies for HAND, we hypothesized that ibudilast would inhibit Tat-induced excess production of pro-inflammatory cytokines, such as tumor necrosis factor-alpha (TNF?) in microglial cells. Ibudilast is a non-selective cyclic AMP phosphodiesterase inhibitor that has recently shown promise as a treatment for neuropathic pain via its ability to attenuate glial cell activation. Accordingly, here we demonstrate that pre-treatment of both human and mouse microglial cells with increasing doses of ibudilast inhibited Tat-induced synthesis of TNF? by microglial cells in a manner dependent on serine/threonine protein phosphatase activity. Ibudilast had no effect on Tat-induced p38 MAP kinase activation, and blockade of adenosine A2A receptor activation did not reverse ibudilast's inhibition of Tat-induced TNF? production. Interestingly, ibudilast reduced Tat-mediated transcription of TNF?, via modulation of nuclear factor-kappa B (NF-?B) signaling, as shown by transcriptional activity of NF-?B and analysis of inhibitor of kappa B alpha (I?B?) stability. Together, our findings shed light on the mechanism of ibudilast's inhibition of Tat-induced TNF? production in microglial cells and may implicate ibudilast as a potential novel adjunctive therapy for the management of HAND. PMID:21494611

  17. Guanosine triphosphate can directly regulate cortisol production by activating Ca(2+)-messenger systems in bovine adrenal fasciculata cells.

    PubMed

    Nishikawa, Tetsuo; Suematsu, Sachiko; Matsuzawa, Yoko; Saito, Jun; Omura, Masao

    2016-01-31

    Adenosine triphosphate (ATP) is known to stimulate cortisol production in vitro, however, the effect of guanosine triphosphate (GTP) on cortisol production is not known. We studied the effect of GTP on cortisol production and investigated the regulation of intracellular signal transduction systems, including the cyclic AMP-dependent and Ca(2+)-messenger systems, in bovine adrenal fasciculata cells. GTP clearly induced cortisol biosynthesis but only to a level less than half the adrenocorticotropic hormone (ACTH)-induced maximum. The binding site for [?-(35)S]-GTP?S was shown to differ completely from that for ATP and also from those for Gs and Gi, as indicated by the fact that binding was not influenced by pretreatment with cholera toxin and pertussis toxin. GTP significantly increased cytosolic calcium ([Ca(2+)]i) and inositol 1, 4, 5-triphosphate without affecting cyclic AMP formation. GTP-induced cortisol production was suppressed by H-9 and Calphostin C (specific protein kinase C inhibitors) but not by H-8 and KT5720 (specific inhibitors of cyclic AMP-dependent protein kinase), suggesting that GTP activates cortisol biosynthesis possibly via a protein kinase C-dependent pathway. Extracellular calcium may be essential for GTP activity since GTP-induced cortisol production was almost completely suppressed in its absence. In conclusion, it can be postulated that GTP-induced steroid secretion in bovine adrenal fasciculata cells is under paracrine or autocrine control. PMID:26560437

  18. Molecular correlates of impaired prefrontal plasticity in response to chronic stress.

    PubMed

    Kuipers, S D; Trentani, A; Den Boer, J A; Ter Horst, G J

    2003-06-01

    Disturbed adaptations at the molecular and cellular levels following stress could represent compromised neural plasticity that contributes to the pathophysiology of stress-induced disorders. Evidence illustrates atrophy and cell death of stress-vulnerable neurones in the prefrontal cortex. Reduced plasticity may be realized through the destabilized function of selective proteins involved in organizing the neuronal skeleton and translating neurotrophic signals. To elucidate the mechanisms underlying these effects, rats were exposed to chronic footshock stress. Patterns of c-fos, phospho-extracellular-regulated protein kinases 1/2 (ERK1/2), calcineurin and phospho-cyclic-AMP response-element binding protein (CREB) expression were subsequently investigated. The results indicate chronic stress-induced impairments in prefrontal and cingulate signal transduction cascades underlying neuronal plasticity. The medial prefrontal cortex, demonstrated functional hyperactivity and dendritic phospho-ERK1/2 hyperphosphorylation, while reduced c-fos and calcineurin immunoreactivity occurred in the cingulate cortex. Significantly reduced phospho-CREB expression in both cortical regions, considering its implication in brain-derived neurotrophic factor (BDNF) transcription, suggests reduced synaptic plasticity. This data confirms the damaging effect of stress on cortical activity, on a molecular level. Due to the association of these markers in the regulation of BDNF signalling, these findings suggest a central role for intracellular neurotrophin transduction members in the pathways underlying cellular actions of stress in the brain. PMID:12753089

  19. Particular nuclear transcription factors responsive to systemic administration of kainic acid in murine brain.

    PubMed

    Azuma, Y; Ogita, K; Yoneda, Y

    1996-09-01

    Gel retardation electrophoresis revealed that binding of a radiolabeled double stranded oligonucleotide probe for the nuclear transcription factor activator protein-1 (AP1) was markedly potentiated 2 h after the intraperitoneal injection of kainic acid (KA) at a dose range of 10-40 mg/kg in a dose-dependent manner in the murine hippocampus. The potentiation was seen in a manner independent of the crisis of convulsive seizures following the administration of KA at different doses. At the highest dose employed, the systemic KA significantly potentiated the AP1 binding in most central discrete structures examined except the cerebellum. In contrast, KA significantly potentiated binding of a radiolabeled probe for cyclic AMP response element binding protein (CREB) in a dose-dependent fashion in the hippocampus, without altering that in other parts of murine brain. No significant alteration was detected in binding of a probe for c-Myc in any brain regions examined 2 h after the administration of KA at different doses. However, immunoblotting analysis demonstrated that KA was ineffective in altering endogenous levels of both CREB and CREB phosphorylated at serine133 in the hippocampus and cerebellum. These results suggest that in vivo systemic KA signals may be selectively transduced to nuclear AP1 in the hippocampus through a mechanism different from phosphorylation of CREB at serine133 in murine brain. PMID:8885288

  20. The phospholipase B homolog Plb1 is a mediator of osmotic stress response and of nutrient-dependent repression of sexual differentiation in the fission yeast Schizosaccharomyces pombe

    PubMed Central

    Yang, P.; Du, H.; Hoffman, C.S.

    2015-01-01

    Although phospholipase B (PLB) enzymes have been described in eukaryotes from yeasts to mammals, their biological functions are poorly understood. Here we describe the characterization of plb1, one of five genes predicted to encode PLB homologs in the fission yeast, Schizosaccharomyces pombe. The plb1 gene is dispensable under normal growth conditions but required for viability in high-osmolarity media and for normal osmotic stress-induced gene expression. Unlike mutants defective in function for the stress-activated MAP kinase Spc1, plb1? cells are not hypersensitive to oxidative or temperature stresses, nor do they undergo a G2-specific arrest in response to osmotic stress. In addition to defects in osmotic stress response, plb1? cells exhibit a cold-sensitive defect in nutrient-mediated mating repression, a phenotype reminiscent of mutants in the cyclic AMP (cAMP) pathway. We show that, like plb1? cells, mutants in the cAMP pathway are defective for growth in high-osmolarity media, demonstrating a previously unrecognized role for the cAMP pathway in osmotic stress response. Furthermore, we show that gain-of function in the cAMP pathway can rescue the osmosensitive growth defect of plb1? cells, suggesting that the cAMP pathway is a potential downstream target of the actions of Plb1 in S. pombe. PMID:12715160

  1. Characterization of quinolone antibacterial-induced convulsions and increases in nuclear AP-1 DNA- and CRE-binding activities in mouse brain.

    PubMed

    Ito, Y; Ishige, K; Aizawa, M; Fukuda, H

    1999-05-01

    The quinolone antibacterials enoxacin and norfloxacin (2.5 mg/kg, i.v.) provoked clonic convulsions in mice treated concomitantly with biphenylacetic acid (BPAA, 100 mg/kg, i.p.), a major metabolite of the nonsteroidal anti-inflammatory drug fenbufen. Gel-shift assays showed that enoxacin-induced convulsions resulted in increases in nuclear activator protein 1 (AP-1) DNA- and cyclic AMP responsive element (CRE)-binding activities in the cerebral cortex and hippocampus, but not in other regions, such as the cerebellum and thalamus. In contrast, ofloxacin and levofloxacin, at the same doses, in the presence of BPAA did not evoke convulsions or increase these DNA-binding activities. Administration of these quinolones and BPAA alone elicited neither convulsions nor increases in these DNA-binding activities. These results suggest that the increased nuclear AP-1 DNA- and CRE-binding activities in the cerebral cortex and hippocampus induced by quinolones with BPAA correlated with seizure activities and that these brain regions play pivotal roles in quinolone-induced convulsions. PMID:10340309

  2. Acetaldehyde Induces Cytotoxicity of SH-SY5Y Cells via Inhibition of Akt Activation and Induction of Oxidative Stress.

    PubMed

    Yan, Tingting; Zhao, Yan; Zhang, Xia

    2016-01-01

    Excessive alcohol consumption can lead to brain tissue damage and cognitive dysfunction. It has been shown that heavy drinking is associated with an earlier onset of neurodegenerative diseases such as Alzheimer's disease. Acetaldehyde, the most toxic metabolite of ethanol, is speculated to mediate the brain tissue damage and cognitive dysfunction induced by the chronic excessive consumption of alcohol. However, the exact mechanisms by which acetaldehyde induces neurotoxicity are not totally understood. In this study, we investigated the cytotoxic effects of acetaldehyde in SH-SY5Y cells and found that acetaldehyde induced apoptosis of SH-SY5Y cells by downregulating the expression of antiapoptotic Bcl-2 and Bcl-xL and upregulating the expression of proapoptotic Bax. Acetaldehyde treatment led to a significant decrease in the levels of activated Akt and cyclic AMP-responsive element binding protein (CREB). In addition, acetaldehyde induced the activation of p38 mitogen-activated protein kinase (MAPK) while inhibiting the activation of extracellular signal-regulated kinases (ERKs, p44/p42MAPK). Meanwhile, acetaldehyde treatment caused an increase in the production of reactive oxygen species and elevated the oxidative stress in SH-SY5Y cells. Therefore, acetaldehyde induces cytotoxicity of SH-SY5Y cells via promotion of apoptotic signaling, inhibition of cell survival pathway, and induction of oxidative stress. PMID:26649137

  3. Acetaldehyde Induces Cytotoxicity of SH-SY5Y Cells via Inhibition of Akt Activation and Induction of Oxidative Stress

    PubMed Central

    Yan, Tingting; Zhao, Yan; Zhang, Xia

    2016-01-01

    Excessive alcohol consumption can lead to brain tissue damage and cognitive dysfunction. It has been shown that heavy drinking is associated with an earlier onset of neurodegenerative diseases such as Alzheimer's disease. Acetaldehyde, the most toxic metabolite of ethanol, is speculated to mediate the brain tissue damage and cognitive dysfunction induced by the chronic excessive consumption of alcohol. However, the exact mechanisms by which acetaldehyde induces neurotoxicity are not totally understood. In this study, we investigated the cytotoxic effects of acetaldehyde in SH-SY5Y cells and found that acetaldehyde induced apoptosis of SH-SY5Y cells by downregulating the expression of antiapoptotic Bcl-2 and Bcl-xL and upregulating the expression of proapoptotic Bax. Acetaldehyde treatment led to a significant decrease in the levels of activated Akt and cyclic AMP-responsive element binding protein (CREB). In addition, acetaldehyde induced the activation of p38 mitogen-activated protein kinase (MAPK) while inhibiting the activation of extracellular signal-regulated kinases (ERKs, p44/p42MAPK). Meanwhile, acetaldehyde treatment caused an increase in the production of reactive oxygen species and elevated the oxidative stress in SH-SY5Y cells. Therefore, acetaldehyde induces cytotoxicity of SH-SY5Y cells via promotion of apoptotic signaling, inhibition of cell survival pathway, and induction of oxidative stress. PMID:26649137

  4. Identification and functional characterisation of the cellular activating transcription factor 43 (ATF-43) protein.

    PubMed Central

    Hurst, H C; Totty, N F; Jones, N C

    1991-01-01

    The promoter motif CGTCA binds multiple cellular factors that mediate a variety of inducible events, including positive responses to raised cellular levels of cAMP and to the Adenovirus E1a protein. To date, at least ten mammalian cDNA clones have been isolated that encode distinct proteins capable of binding to this motif. However, in most cases the precise stimuli that may regulate these different factors have yet to be determined. We have previously shown that the abundant Hela protein ATF-43 forms a complex in vivo with the cyclic AMP response element binding protein (CREB). In this report we definitively show that ATF-43 is the product of the two published cDNA clones, ATF1 and TREB 36. We confirm that ATF1 efficiently heterodimerises with CREB and demonstrate that even though ATF1 and CREB homodimers, as well as the ATF1/CREB heterodimer efficiently bind to the CGTCA motif, the resulting DNA-protein complexes have significantly different stabilities. A region outside the DNA binding domain of ATF1 contributes to the instability of its interaction with DNA. We further show that despite ATF1's homology to CREB, it responds poorly to activation by protein kinase A. In light of our finding that in Hela cells the majority of CREB protein is heterodimerised with ATF1, we speculate on the functional significance of such heterodimers. Images PMID:1653949

  5. A CaMK cascade activates CRE-mediated transcription in neurons of Caenorhabditis elegans.

    PubMed

    Kimura, Yoshishige; Corcoran, Ethan E; Eto, Koh; Gengyo-Ando, Keiko; Muramatsu, Masa-Aki; Kobayashi, Ryoji; Freedman, Jonathan H; Mitani, Shohei; Hagiwara, Masatoshi; Means, Anthony R; Tokumitsu, Hiroshi

    2002-10-01

    Calcium (Ca2+) signals regulate a diverse set of cellular responses, from proliferation to muscular contraction and neuro-endocrine secretion. The ubiquitous Ca2+ sensor, calmodulin (CaM), translates changes in local intracellular Ca2+ concentrations into changes in enzyme activities. Among its targets, the Ca2+/CaM-dependent protein kinases I and IV (CaMKs) are capable of transducing intraneuronal signals, and these kinases are implicated in neuronal gene regulation that mediates synaptic plasticity in mammals. Recently, the cyclic AMP response element binding protein (CREB) has been proposed as a target for a CaMK cascade involving not only CaMKI or CaMKIV, but also an upstream kinase kinase that is also CaM regulated (CaMKK). Here, we report that all components of this pathway are coexpressed in head neurons of Caenorhabditis elegans. Utilizing a transgenic approach to visualize CREB-dependent transcription in vivo, we show that this CaMK cascade regulates CRE-mediated transcription in a subset of head neurons in living nematodes. PMID:12231504

  6. Activation state of the hyperpolarization-activated current modulates temperature-sensitivity of firing in locus coeruleus neurons from bullfrogs.

    PubMed

    Santin, Joseph M; Hartzler, Lynn K

    2015-06-15

    Locus coeruleus neurons of anuran amphibians contribute to breathing control and have spontaneous firing frequencies that, paradoxically, increase with cooling. We previously showed that cooling inhibits a depolarizing membrane current, the hyperpolarization-activated current (I h) in locus coeruleus neurons from bullfrogs, Lithobates catesbeianus (Santin JM, Watters KC, Putnam RW, Hartzler LK. Am J Physiol Regul Integr Comp Physiol 305: R1451-R1464, 2013). This suggests an unlikely role for I h in generating cold activation, but led us to hypothesize that inhibition of I h by cooling functions as a physiological brake to limit the cold-activated response. Using whole cell electrophysiology in brain slices, we employed 2 mM Cs(+) (an I h antagonist) to isolate the role of I h in spontaneous firing and cold activation in neurons recorded with either control or I h agonist (cyclic AMP)-containing artificial intracellular fluid. I h did not contribute to the membrane potential (V m) and spontaneous firing at 20C. Although voltage-clamp analysis confirmed that cooling inhibits I h, its lack of involvement in setting baseline firing and V m precluded its ability to regulate cold activation as hypothesized. In contrast, neurons dialyzed with cAMP exhibited greater baseline firing frequencies at 20C due to I h activation. Our hypothesis was supported when the starting level of I h was enhanced by elevating cAMP because cold activation was converted to more ordinary cold inhibition. These findings indicate that situations leading to enhancement of I h facilitate firing at 20C, yet the hyperpolarization associated with inhibiting a depolarizing cation current by cooling blunts the net V m response to cooling to oppose normal cold-depolarizing factors. This suggests that the influence of I h activation state on neuronal firing varies in the poikilothermic neuronal environment. PMID:25833936

  7. By activating matrix metalloproteinase-7, shear stress promotes chondrosarcoma cell motility, invasion and lung colonization

    PubMed Central

    Guan, Pei-Pei; Yu, Xin; Guo, Jian-Jun; Wang, Yue; Wang, Tao; Li, Jia-Yi; Konstantopoulos, Konstantinos; Wang, Zhan-You; Wang, Pu

    2015-01-01

    Interstitial fluid flow and associated shear stress are relevant mechanical signals in cartilage and bone (patho)physiology. However, their effects on chondrosarcoma cell motility, invasion and metastasis have yet to be delineated. Using human SW1353, HS.819.T and CH2879 chondrosarcoma cell lines as model systems, we found that fluid shear stress induces the accumulation of cyclic AMP (cAMP) and interleukin-1β (IL-1β), which in turn markedly enhance chondrosarcoma cell motility and invasion via the induction of matrix metalloproteinase-7 (MMP-7). Specifically, shear-induced cAMP and IL-1β activate PI3-K, ERK1/2 and p38 signaling pathways, which lead to the synthesis of MMP-7 via transactivating NF-κB and c-Jun in human chondrosarcoma cells. Importantly, MMP-7 upregulation in response to shear stress exposure has the ability to promote lung colonization of chondrosarcomas in vivo. These findings offer a better understanding of the mechanisms underlying MMP-7 activation in shear-stimulated chondrosarcoma cells, and provide insights on designing new therapeutic strategies to interfere with chondrosarcoma invasion and metastasis. PMID:25823818

  8. Androgen-Induced Activation of Gonadotropin-Regulated Testicular RNA Helicase (GRTH/Ddx25) Transcription: Essential Role of a Nonclassical Androgen Response Element Half-Site

    PubMed Central

    Villar, Joaquin; Tsai-Morris, Chon-Hwa; Dai, Lisheng

    2012-01-01

    GRTH, a testis-specific member of the DEAD-box family of RNA helicases essential for spermatogenesis, is present in Leydig cells (LC) and germ cells. In LC, it exerts an autocrine negative regulation on androgen production induced by gonadotropin. GRTH is transcriptionally upregulated by gonadotropin via cyclic AMP/androgen through androgen receptors (AR). For studies of GRTH regulation by androgen in LC, we utilized in vitro/in vivo models. Androgen-induced GRTH expression was prevented by an AR antagonist. Two putative atypical ARE half-sites are present at bp ?200 and ?827 (ARE1 and ARE2). Point mutation of ARE2 prevented androgen-induced AR binding/function and upregulation of GRTH transcription. Chromatin immunoprecipitation (ChIP) assays showed recruitment of AR, SRC-1, Med-1, transcription factor IIB (TFIIB), and polymerase II (PolII) to GRTH ARE2 (bp ?980/?702) and to the promoter region (bp ?80/+63). ChIP3C assays revealed short-range chromosomal looping between AR/ARE2 and the core transcriptional machinery at the promoter. Knockdown of Med-1 and/or SRC-1 demonstrated the presence of a nonproductive complex which included AR, TFIIB, and PolII and the essential role of these coactivators in the transcriptional activation of GRTH. Our findings provide new insights into the molecular mechanism of androgen-regulated transcription in LC. PMID:22331472

  9. An Overview of the Environmental Response Team's Air Surveillance Procedures at Emergency Response Activities.

    ERIC Educational Resources Information Center

    Turpin, Rodney D.; Campagna, Philip

    1991-01-01

    Describes the United States Environmental Protection Agency's program for analytical response to chemical spills. Discusses the role and activities of the Environmental Response Team and the Safety and Air Surveillance Section (SASS). Describes SASS equipment and procedures. Provides case studies that demonstrate emergency response activities.

  10. 76 FR 19766 - Agency Information Collection Activities OMB Responses

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-08

    ... 1808.06; Environmental Impact Assessment of Nongovernmental Activities in Antarctica (Renewal); 40 CFR... From the Federal Register Online via the Government Publishing Office ENVIRONMENTAL PROTECTION AGENCY Agency Information Collection Activities OMB Responses AGENCY: Environmental Protection...

  11. Dissociation of the effect of spatial behaviors on the phosphorylation of cAMP-response element binding protein (CREB) within the nucleus accumbens.

    PubMed

    Alvarez-Jaimes, L; Centeno-Gonzlez, M; Feliciano-Rivera, M; Maldonado-Vlaar, C S

    2005-01-01

    Several studies have reported a role for the nucleus accumbens (NAcc) in learning and synaptic plasticity. Many of them suggest that the NAcc is involved in translating cortico-limbic information to the motor system mediating spatial learning and memory processes. Previous studies from our laboratory have shown that protein kinase C is activated following training in a food search spatial learning task. The present study further characterizes the molecular substrates associated with NAcc-dependent spatial behavior. The cyclic AMP-response element binding protein (CREB), a transcription factor implicated in the formation of long-term memory, was studied in the NAcc following spatial training in a food search spatial learning task. Western blots were performed to detect phosphorylated (activated) and total CREB protein levels. Our results show that CREB is significantly phosphorylated in the NAcc 48 h after habituation and at 5 min and 1 h after the first spatial training session in comparison with the naive animals that remained in their home cages. Since published data show that NAcc plays a role in novelty detection and reactivity, we conducted further experiments in order to dissociate the effect on CREB phosphorylation and expression of spatial novelty (single exposure), exploration, and spatial learning in the food search apparatus. Results show that CREB phosphorylation is significantly increased 48 h after exposure to a novel environment. The present study suggests that CREB phosphorylation observed in the NAcc during habituation and spatial training may be mainly triggered by detection of spatial novelty. PMID:15652982

  12. Diverse signaling systems activated by the sweet taste receptor in human GLP-1-secreting cells.

    PubMed

    Ohtsu, Yoshiaki; Nakagawa, Yuko; Nagasawa, Masahiro; Takeda, Shigeki; Arakawa, Hirokazu; Kojima, Itaru

    2014-08-25

    Sweet taste receptor regulates GLP-1 secretion in enteroendocrine L-cells. We investigated the signaling system activated by this receptor using Hutu-80 cells. We stimulated them with sucralose, saccharin, acesulfame K and glycyrrhizin. These sweeteners stimulated GLP-1 secretion, which was attenuated by lactisole. All these sweeteners elevated cytoplasmic cyclic AMP ([cAMP]c) whereas only sucralose and saccharin induced a monophasic increase in cytoplasmic Ca(2+) ([Ca(2+)]c). Removal of extracellular calcium or sodium and addition of a Gq/11 inhibitor greatly reduced the [Ca(2+)]c responses to two sweeteners. In contrast, acesulfame K induced rapid and sustained reduction of [Ca(2+)]c. In addition, glycyrrhizin first reduced [Ca(2+)]c which was followed by an elevation of [Ca(2+)]c. Reductions of [Ca(2+)]c induced by acesulfame K and glycyrrhizin were attenuated by a calmodulin inhibitor or by knockdown of the plasma membrane calcium pump. These results indicate that various sweet molecules act as biased agonists and evoke strikingly different patterns of intracellular signals. PMID:25017733

  13. Context-Dependent Activation Kinetics Elicited by Soluble versus Outer Membrane Vesicle-Associated Heat-Labile Enterotoxin ▿

    PubMed Central

    Chutkan, Halima; Kuehn, Meta J.

    2011-01-01

    Enterotoxigenic Escherichia coli (ETEC) is the leading cause of traveler's diarrhea and children's diarrhea worldwide. Among its virulence factors, ETEC produces heat-labile enterotoxin (LT). Most secreted LT is associated with outer membrane vesicles that are rich in lipopolysaccharide. The majority of prior studies have focused on soluble LT purified from ETEC periplasm. We investigated the hypothesis that the extracellular vesicle context of toxin presentation might be important in eliciting immune responses. We compared the polarized epithelial cell responses to apically applied soluble LT and LT-containing vesicles (LT+ vesicles) as well as controls using a catalytically inactive mutant of LT and vesicles lacking LT. Although vesicle treatments with no or catalytically inactive LT induced a modest amount of interleukin-6 (IL-6), samples containing catalytically active LT elicited higher levels. A combination of soluble LT and LT-deficient vesicles induced significantly higher IL-6 levels than either LT or LT+ vesicles alone. The responses to LT+ vesicles were found to be independent of the canonical LT pathway, because the inhibition of cyclic AMP response element (CRE)-binding protein (CREB) phosphorylation did not lead to a decrease in cytokine gene expression levels. Furthermore, soluble LT caused earlier phosphorylation of CREB and activation of CRE compared with LT+ vesicles. Soluble LT also led to the activation of activator protein 1, whereas LT+ vesicle IL-6 responses appeared to be mediated by NF-κB. In summary, the results demonstrate that soluble LT and vesicle-bound LT elicit ultimately similar cytokine responses through distinct different activation pathways. PMID:21708992

  14. Solar activity, the QBO, and tropospheric responses

    NASA Technical Reports Server (NTRS)

    Tinsley, Brian A.; Brown, Geoffrey M.; Scherrer, Philip H.

    1989-01-01

    The suggestion that galactic cosmic rays (GCR) as modulated by the solar wind are the carriers of the component of solar variability that affects weather and climate has been discussed in the literature for 30 years, and there is now a considerable body of evidence that supports it. Variations of GCR occur with the 11 year solar cycle, matching the time scale of recent results for atmospheric variations, as modulated by the quasibiennial oscillation of equatorial stratospheric winds (the QBO). Variations in GCR occur on the time scale of centuries with a well defined peak in the coldest decade of the little ice age. New evidence is presented on the meteorological responses to GCR variations on the time scale of a few days. These responses include changes in the vertical temperature profile in the troposphere and lower stratosphere in the two days following solar flare related high speed plasma streams and associated GCR decreases, and in decreases in Vorticity Area Index (VAI) following Forbush decreases of GCR. The occurrence of correlations of GCR and meteorological responses on all three time scales strengthens the hypothesis of GCR as carriers of solar variability to the lower atmosphere. Both short and long term tropospheric responses are understandable as changes in the intensity of cyclonic storms initiated by mechanisms involving cloud microphysical and cloud electrification processes, due to changes in local ion production from changes in GCR fluxes and other high energy particles in the MeV to low GeV range. The nature of these mechanisms remains undetermined. Possible stratospheric wind (particularly QBO) effects on the transport of HNO3 and other constituents incorporated in cluster ions and possible condensation and freezing nuclei are considered as relevant to the long term variations.

  15. Glucose Inhibition of Adenylate Cyclase in Intact Cells of Escherichia coli B

    PubMed Central

    Peterkofsky, Alan; Gazdar, Celia

    1974-01-01

    Previous studies in E. coli B have demonstrated an inverse correlation between the presence of glucose in the medium and the accumulation of cyclic AMP in the medium. This observation could not be explained by the action of glucose as a repressor of adenylate cyclase (EC 4.6.1.1) synthesis, as a stabilizer of cyclic AMP phosphodiesterase (EC 3.1.4.17) activity, or as a direct inhibitor of adenylate cyclase activity in cell-free preparations. The recent development of an in vivo assay for adenylate cyclase has provided a basis for further exploring the inhibitory action of glucose in intact cells. With this assay it has been possible to show that, while glucose does not affect adenylate cyclase in vitro, it rapidly inhibits the enzyme activity in intact cells. Extensive metabolism of glucose is not required, since α-methylglucoside also inhibits adenylate cyclase in vivo. When cells are grown on glucose as carbon source, some sugars (mannose, glucosamine) substitute for glucose as adenylate cyclase inhibitors while others (e.g., fructose) do not. Dose-response studies indicate that low concentrations of glucose lead to essentially complete inhibition of adenylate cyclase activity while only moderately decreasing intracellular cyclic AMP concentrations. The evidence presented suggests that the decreased cellular cyclic AMP levels resulting from glucose addition can be accounted for by inhibition of adenylate cyclase without any significant effect on cyclic AMP phosphodiesterase or the transport of cyclic AMP from the cells to the medium. PMID:4366761

  16. George Arcement Explains USGS Flood Response Activities

    USGS Multimedia Gallery

    USGS Louisiana Water Science Center Director George Arcement explains USGS' activities during the 2011 to WAFB Meteorologist Jay Grymes. USGS has crews measuring streamflow, sediment and water quality throughout South Louisiana, including daily measurements at the Morganza and Bonnet Carre Spillways...

  17. Dynamics of telomerase activity in response to acute psychological stress

    PubMed Central

    Epel, Elissa S.; Lin, Jue; Dhabhar, Firdaus S.; Wolkowitz, Owen M.; Puterman, E; Karan, Lori; Blackburn, Elizabeth H.

    2010-01-01

    Telomerase activity plays an essential role in cel0l survival, by lengthening telomeres and promoting cell growth and longevity. It is now possible to quantify the low levels of telomerase activity in human leukocytes. Low basal telomerase activity has been related to chronic stress in people and to chronic glucocorticoid exposure in vitro. Here we test whether leukocyte telomerase activity changes under acute psychological stress. We exposed 44 elderly women, including 22 high stress dementia caregivers and 22 matched low stress controls, to a brief laboratory psychological stressor, while examining changes in telomerase activity of peripheral blood mononuclear cells (PBMC). At baseline, caregivers had lower telomerase activity levels than controls, but during stress telomerase activity increased similarly in both groups. Across the entire sample, subsequent telomerase activity increased by 18% one hour after the end of the stressor (p<0.01). The increase in telomerase activity was independent of changes in numbers or percentages of monocytes, lymphocytes, and specific T cell types, although we cannot fully rule out some potential contribution from immune cell redistribution in the change in telomerase activity. Telomerase activity increases were associated with greater cortisol increases in response to the stressor. Lastly, psychological response to the tasks (greater threat perception) was also related to greater telomerase activity increases in controls. These findings uncover novel relationships of dynamic telomerase activity with exposure to an acute stressor, and with two classic aspects of the stress response -- perceived psychological stress and neuroendocrine (cortisol) responses to the stressor. PMID:20018236

  18. Thrombin-induced lysosomal exocytosis in human platelets is dependent on secondary activation by ADP and regulated by endothelial-derived substances.

    PubMed

    Sdergren, Anna L; Svensson Holm, Ann-Charlotte B; Ramstrm, Sofia; Lindstrm, Eva G; Grenegrd, Magnus; llinger, Karin

    2016-01-01

    Exocytosis of lysosomal contents from platelets has been speculated to participate in clearance of thrombi and vessel wall remodelling. The mechanisms that regulate lysosomal exocytosis in platelets are, however, still unclear. The aim of this study was to identify the pathways underlying platelet lysosomal secretion and elucidate how this process is controlled by platelet inhibitors. We found that high concentrations of thrombin induced partial lysosomal exocytosis as assessed by analysis of the activity of released N-acetyl-?-glucosaminidase (NAG) and by identifying the fraction of platelets exposing the lysosomal-associated membrane protein (LAMP)-1 on the cell surface by flow cytometry. Stimulation of thrombin receptors PAR1 or PAR4 with specific peptides was equally effective in inducing LAMP-1 surface expression. Notably, lysosomal exocytosis in response to thrombin was significantly reduced if the secondary activation by ADP was inhibited by the P2Y12 antagonist cangrelor, while inhibition of thromboxane A2 formation by treatment with acetylsalicylic acid was of minor importance in this regard. Moreover, the NO-releasing drug S-nitroso-N-acetyl penicillamine (SNAP) or the cyclic AMP-elevating eicosanoid prostaglandin I2 (PGI2) significantly suppressed lysosomal exocytosis. We conclude that platelet inhibitors that mimic functional endothelium such as PGI2 or NO efficiently counteract lysosomal exocytosis. Furthermore, we suggest that secondary release of ADP and concomitant signaling via PAR1/4- and P2Y12 receptors is important for efficient platelet lysosomal exocytosis by thrombin. PMID:25970449

  19. Regulation of endothelial cell cyclic nucleotide metabolism by prostacyclin.

    PubMed Central

    Hopkins, N K; Gorman, R R

    1981-01-01

    An analysis of prostaglandin-stimulated adenosine 3',5'-cyclic monophosphate (cyclic AMP) accumulation in cultured human umbilical vein endothelial cells showed prostacyclin (PGI2) to be the most potent agonist followed by prostaglandin (PG)H2, which was more potent than PGE2, while PGD2 was essentially inactive. The endothelial cells studied apparently have a high rate of cyclic AMP phosphodiesterase activity because significant PGI2-mediated increases in cyclic AMP could not be shown in the presence of the phosphodiesterase inhibitor isobutylmethylxanthine (MIX). Endoperoxide PGH2-stimulation of cyclic AMP accumulation was inhibited 75--80% by the prostacyclin synthetase inhibitors 12-hydroperoxyeicosatetraenoic acid or 9,11-azoprosta-5,13-dienoic acid. These data indicate that the PGH2-stimulation is due primarily to conversion to PGI2. The beta-adrenergic agonist L-isoproterenol stimulated cyclic AMP accumulation in the endothelial cells. This accumulation was completely blocked by propranolol. However, stimulation of cyclic AMP accumulation by the beta-adrenergic agent did not equal that induced by PGI2. Furthermore, the PGI2 response could not be blocked by propranolol. Thrombin-stimulated PGI2 biosynthesis was attenuated by PGE1 or isoproterenol in the presence of MIX. MIX alone was less effective than a combination of PGE1 or isoproterenol plus MIX. These data suggest two potential effects of PGI2 biosynthesis by endothelial cells: first, the PGI2 can elevate cyclic AMP in platelets, and second, endothelial cell cyclic AMP can be elevated as well, so that subsequent PGI2 synthesis will be attenuated. PMID:6257764

  20. Pythium infection activates conserved plant defense responses in mosses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The moss Physcomitrella patens (P. patens) is a useful model to study abiotic stress responses since it is highly tolerant to drought, salt and osmotic stress. However, little is known about the defense mechanisms activated in this moss after pathogen assault. Here the induction of defense responses...

  1. A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging

    PubMed Central

    Chen, Yao; Saulnier, Jessica L.; Yellen, Gary; Sabatini, Bernardo L.

    2014-01-01

    Neuromodulators have profound effects on behavior, but the dynamics of their intracellular effectors has remained unclear. Most neuromodulators exert their function via G-protein-coupled receptors (GPCRs). One major challenge for understanding neuromodulator action is the lack of dynamic readouts of the biochemical signals produced by GPCR activation. The adenylate cyclase/cyclic AMP/protein kinase A (PKA) module is a central component of such biochemical signaling. This module is regulated by several behaviorally important neuromodulator receptors. Furthermore, PKA activity is necessary for the induction of many forms of synaptic plasticity as well as for the formation of long-term memory. In order to monitor PKA activity in brain tissue, we have developed a 2-photon fluorescence lifetime imaging microscopy (2pFLIM) compatible PKA sensor termed FLIM-AKAR, which is based on the ratiometric FRET sensor AKAR3. FLIM-AKAR shows a large dynamic range and little pH sensitivity. In addition, it is a rapidly diffusible cytoplasmic protein that specifically reports net PKA activity in situ. FLIM-AKAR expresses robustly in various brain regions with multiple transfection methods, can be targeted to genetically identified cell types, and responds to activation of both endogenous GPCRs and spatial-temporally specific delivery of glutamate. Initial experiments reveal differential regulation of PKA activity across subcellular compartments in response to neuromodulator inputs. Therefore, the reporter FLIM-AKAR, coupled with 2pFLIM, enables the study of PKA activity in response to neuromodulator inputs in genetically identified neurons in the brain, and sheds light on the intracellular dynamics of endogenous GPCR activation. PMID:24765076

  2. Modulation of emetic response by carotid baro- and chemoreceptor activations.

    PubMed

    Uchino, Masahiro; Kuwahara, Masayoshi; Ebukuro, Susumu; Tsubone, Hirokazu

    2006-07-30

    We hypothesized that baroreceptor or chemoreceptor activation might be involved in the emetic, and prodromal cardiovascular and respiratory responses. To test this hypothesis, we induced the emetic responses by gastric distension in anesthetized Suncus murinus (house musk shrew), that had intact and absent baroreceptor and chemoreceptor afferents. Secondly, we stimulated the aortic depressor nerve (ADN) and the carotid sinus nerve (CSN) with or without gastric distension. Internal carotid artery ligation in the bifurcation area, which abolished reflex bradycardia by baroreceptor activation, and abolition of chemoreceptor reflex bradycardia and hyperventilation, by carotid body denervation, suppressed the emetic response but did not abolish it. ADN denervation, which produced no significant effects on the baroreceptor or chemoreceptor reflex bradycardia, had no effect on the emetic response, including the prodromal phase. CSN stimulation with gastric distension elicited retching accompanied by reflex bradycardia and hypotension during or just after stimulation, whereas ADN stimulation with gastric distension did not induce the cardiovascular reflex, and had no effects on the emetic response. These results indicate that carotid, rather than aortic, baroreceptor or chemoreceptor activation plays an important role in the augmentation of cardiac parasympathetic activity and the development of emetic response. In conclusion, carotid baroreceptor or chemoreceptor activation, which is non-emetic stimulation, acts as a modulator in the central mechanisms of emesis. PMID:16490404

  3. Protein kinase activators alter glial cholesterol esterification

    SciTech Connect

    Jeng, I.; Dills, C.; Klemm, N.; Wu, C.

    1986-05-01

    Similar to nonneural tissues, the activity of glial acyl-CoA cholesterol acyltransferase is controlled by a phosphorylation and dephosphorylation mechanism. Manipulation of cyclic AMP content did not alter the cellular cholesterol esterification, suggesting that cyclic AMP is not a bioregulator in this case. Therefore, the authors tested the effect of phorbol-12-myristate 13-acetate (PMA) on cellular cholesterol esterification to determine the involvement of protein kinase C. PMA has a potent effect on cellular cholesterol esterification. PMA depresses cholesterol esterification initially, but cells recover from inhibition and the result was higher cholesterol esterification, suggesting dual effects of protein kinase C. Studies of other phorbol analogues and other protein kinase C activators such as merezein indicate the involvement of protein kinase C. Oleoyl-acetyl glycerol duplicates the effect of PMA. This observation is consistent with a diacyl-glycerol-protein kinase-dependent reaction. Calcium ionophore A23187 was ineffective in promoting the effect of PMA. They concluded that a calcium-independent and protein C-dependent pathway regulated glial cholesterol esterification.

  4. Transcriptional regulation of the miR-212/miR-132 cluster in insulin-secreting β-cells by cAMP-regulated transcriptional co-activator 1 and salt-inducible kinases.

    PubMed

    Malm, Helena Anna; Mollet, Inês G; Berggreen, Christine; Orho-Melander, Marju; Esguerra, Jonathan Lou S; Göransson, Olga; Eliasson, Lena

    2016-03-15

    MicroRNAs are central players in the control of insulin secretion, but their transcriptional regulation is poorly understood. Our aim was to investigate cAMP-mediated transcriptional regulation of the miR-212/miR-132 cluster and involvement of further upstream proteins in insulin secreting β-cells. cAMP induced by forskolin+IBMX or GLP-1 caused increased expression of miR-212/miR-132, and elevated phosphorylation of cAMP-response-element-binding-protein (CREB)/Activating-transcription-factor-1 (ATF1) and Salt-Inducible-Kinases (SIKs). CyclicAMP-Regulated Transcriptional Co-activator-1 (CRTC1) was concomitantly dephosphorylated and translocated to the nucleus. Silencing of miR-212/miR-132 reduced, and overexpression of miR-212 increased, glucose-stimulated insulin secretion. Silencing of CRTC1 expression resulted in decreased insulin secretion and miR-212/miR-132 expression, while silencing or inhibition of SIKs was associated with increased expression of the microRNAs and dephosphorylation of CRTC1. CRTC1 protein levels were reduced after silencing of miR-132, suggesting feed-back regulation. Our data propose cAMP-dependent co-regulation of miR-212/miR-132, in part mediated through SIK-regulated CRTC1, as an important factor for fine-tuned regulation of insulin secretion. PMID:26797246

  5. Adenosine modulates light responses of rat retinal ganglion cell photoreceptors througha cAMP-mediated pathway.

    PubMed

    Sodhi, Puneet; Hartwick, Andrew T E

    2014-10-01

    Adenosine is an established neuromodulator in the mammalian retina, with A1 adenosine receptors being especially prevalent in the innermost ganglion cell layer. Activation of A1 receptors causes inhibition of adenylate cyclase, decreases in intracellular cyclic AMP (cAMP) levels and inhibition of protein kinase A (PKA). In this work, our aim was to characterize the effects of adenosine on the light responses of intrinsically photosensitive retinal ganglion cells (ipRGCs) and to determine whether these photoreceptors are subject to neuromodulation through intracellular cAMP-related signalling pathways. Using multielectrode array recordings from postnatal and adult rat retinas, we demonstrated that adenosine significantly shortened the duration of ipRGC photoresponses and reduced the number of light-evoked spikes fired by these neurons. The effects were A1 adenosine receptor-mediated, and the expression of this receptor on melanopsin-containing ipRGCs was confirmed by calcium imaging experiments on isolated cells in purified cultures. While inhibition of the cAMP/PKA pathway by adenosine shortened ipRGC light responses, stimulation of this pathway with compounds such as forskolin had the opposite effect and lengthened the duration of ipRGC spiking. Our findings reveal that the modification of ipRGC photoresponses through a cAMP/PKA pathway is a general feature of rat ganglion cell photoreceptors, and this pathway can be inhibited through activation of A1 receptors by adenosine. As adenosine levels in the retina rise at night, adenosinergic modulation of ipRGCs may serve as an internal regulatory mechanism to limit transmission of nocturnal photic signals by ipRGCs to the brain. Targeting retinal A1 adenosine receptors for ipRGC inhibition represents a potential therapeutic target for sleep disorders and migraine-associated photophobia. PMID:25038240

  6. Adenosine modulates light responses of rat retinal ganglion cell photoreceptors througha cAMP-mediated pathway

    PubMed Central

    Sodhi, Puneet; Hartwick, Andrew T E

    2014-01-01

    Adenosine is an established neuromodulator in the mammalian retina, with A1 adenosine receptors being especially prevalent in the innermost ganglion cell layer. Activation of A1 receptors causes inhibition of adenylate cyclase, decreases in intracellular cyclic AMP (cAMP) levels and inhibition of protein kinase A (PKA). In this work, our aim was to characterize the effects of adenosine on the light responses of intrinsically photosensitive retinal ganglion cells (ipRGCs) and to determine whether these photoreceptors are subject to neuromodulation through intracellular cAMP-related signalling pathways. Using multielectrode array recordings from postnatal and adult rat retinas, we demonstrated that adenosine significantly shortened the duration of ipRGC photoresponses and reduced the number of light-evoked spikes fired by these neurons. The effects were A1 adenosine receptor-mediated, and the expression of this receptor on melanopsin-containing ipRGCs was confirmed by calcium imaging experiments on isolated cells in purified cultures. While inhibition of the cAMP/PKA pathway by adenosine shortened ipRGC light responses, stimulation of this pathway with compounds such as forskolin had the opposite effect and lengthened the duration of ipRGC spiking. Our findings reveal that the modification of ipRGC photoresponses through a cAMP/PKA pathway is a general feature of rat ganglion cell photoreceptors, and this pathway can be inhibited through activation of A1 receptors by adenosine. As adenosine levels in the retina rise at night, adenosinergic modulation of ipRGCs may serve as an internal regulatory mechanism to limit transmission of nocturnal photic signals by ipRGCs to the brain. Targeting retinal A1 adenosine receptors for ipRGC inhibition represents a potential therapeutic target for sleep disorders and migraine-associated photophobia. PMID:25038240

  7. Maternal deprivation in rats is associated with corticotropin releasing hormone (CRH) promoter hypomethylation and enhances CRH transcriptional responses to stress in adulthood

    PubMed Central

    Chen, Jun; Evans, Andrew N.; Liu, Ying; Honda, Masaru; Saavedra, Juan M.; Aguilera, Greti

    2012-01-01

    Exposure to stress during early development causes long-lasting alterations in behavior and hypothalamic pituitary adrenal (HPA) axis activity, including increased expression of corticotropin releasing hormone (CRH). To determine whether early life stress causes epigenetic changes in the CRH promoter leading to increased CRH transcription, 8-week old female and male rats, subjected to maternal deprivation (MD) between days 2 and 13 post-birth, were studied for HPA axis responses to stress and CRH promoter methylation in the hypothalamic paraventricular nucleus (PVN) and central nucleus of the amygdala (CeA). Plasma corticosterone and PVN CRH hnRNA responses to acute restraint stress were higher in MD rats of both sexes. DNA methylation analysis of the CRH promoter revealed a significantly lower percent of methylation in 2 CpGs preceding (CpG1) and inside (CpG2) the cyclic AMP-responsive element (CRE) at ?230 bp in the CRH promoter in the PVN but not the CeA of MD rats. Gel-shift assays, using nuclear proteins from forskolin treated hypothalamic 4B cells and CRH promoter CRE oligonucleotides, unmethylated or methylated at CpG1, revealed a strong band which was supershifted by phospho-CREB antibody. This band was 50% weaker using oligonucleotides methylated at CpG2 (intra-CRE), or methylated at both CpG1 and CpG2. These findings demonstrate that HPA axis hypersensitivity caused by neonatal stress causes long-lasting enhanced CRH transcriptional activity in the PVN of both sexes. Hypomethylation of the CRH promoter CRE, a region critical for CRH transcriptional activation, could serve as a mechanism for the increased transcriptional responses to stress observed in MD rats. PMID:22375940

  8. T3-induced liver AMP-activated protein kinase signaling: Redox dependency and upregulation of downstream targets

    PubMed Central

    Videla, Luis A; Fernndez, Virginia; Cornejo, Pamela; Vargas, Romina; Morales, Paula; Ceballo, Juan; Fischer, Alvaro; Escudero, Nicols; Escobar, Oscar

    2014-01-01

    AIM: To investigate the redox dependency and promotion of downstream targets in thyroid hormone (T3)-induced AMP-activated protein kinase (AMPK) signaling as cellular energy sensor to limit metabolic stresses in the liver. METHODS: Fed male Sprague-Dawley rats were given a single ip dose of 0.1 mg T3/kg or T3 vehicle (NaOH 0.1 N; controls) and studied at 8 or 24 h after treatment. Separate groups of animals received 500 mg N-acetylcysteine (NAC)/kg or saline ip 30 min prior T3. Measurements included plasma and liver 8-isoprostane and serum ?-hydroxybutyrate levels (ELISA), hepatic levels of mRNAs (qPCR), proteins (Western blot), and phosphorylated AMPK (ELISA). RESULTS: T3 upregulates AMPK signaling, including the upstream kinases Ca2+-calmodulin-dependent protein kinase kinase-? and transforming growth factor-?-activated kinase-1, with T3-induced reactive oxygen species having a causal role due to its suppression by pretreatment with the antioxidant NAC. Accordingly, AMPK targets acetyl-CoA carboxylase and cyclic AMP response element binding protein are phosphorylated, with the concomitant carnitine palmitoyltransferase-1? (CPT-1?) activation and higher expression of peroxisome proliferator-activated receptor-? co-activator-1? and that of the fatty acid oxidation (FAO)-related enzymes CPT-1?, acyl-CoA oxidase 1, and acyl-CoA thioesterase 2. Under these conditions, T3 induced a significant increase in the serum levels of ?-hydroxybutyrate, a surrogate marker for hepatic FAO. CONCLUSION: T3 administration activates liver AMPK signaling in a redox-dependent manner, leading to FAO enhancement as evidenced by the consequent ketogenic response, which may constitute a key molecular mechanism regulating energy dynamics to support T3 preconditioning against ischemia-reperfusion injury. PMID:25516653

  9. Decreased hypothalamic growth hormone-releasing hormone content and pituitary responsiveness in hypothyroidism.

    PubMed Central

    Katakami, H; Downs, T R; Frohman, L A

    1986-01-01

    The effects of thyroidectomy (Tx) and thyroxine replacement (T4Rx) on pituitary growth hormone (GH) secretion and hypothalamic GH-releasing hormone (GRH) concentration were compared to define the mechanism of hypothyroid-associated GH deficiency. Thyroidectomized rats exhibited a complete loss of pulsatile GH secretion with extensive reduction in GRH responsiveness and pituitary GH content. Cultured pituitary cells from Tx rats exhibited reduced GRH sensitivity, maximal GH responsiveness, and intracellular cyclic AMP accumulation to GRH, while somatostatin (SRIF) suppressive effects on GH secretion were increased. Hypothalamic GRH content was also markedly reduced. T4Rx completely restored hypothalamic GRH content and spontaneous GH secretion despite only partial recovery of pituitary GH content, GRH and SRIF sensitivity, and intracellular cyclic AMP response to GRH. The results indicate multiple effects of hypothyroidism on GH secretion and suggest that a critical role of T4 in maintaining normal GH secretion, in addition to restoring GH synthesis, is related to its effect on hypothalamic GRH. Images PMID:2871046

  10. Baseline Brain Activity Predicts Response to Neuromodulatory Pain Treatment

    PubMed Central

    Jensen, Mark P.; Sherlin, Leslie H.; Fregni, Felipe; Gianas, Ann; Howe, Jon D.; Hakimian, Shahin

    2015-01-01

    Objectives The objective of this study was to examine the associations between baseline electroencephalogram (EEG)-assessed brain oscillations and subsequent response to four neuromodulatory treatments. Based on available research, we hypothesized that baseline theta oscillations would prospectively predict response to hypnotic analgesia. Analyses involving other oscillations and the other treatments (meditation, neurofeedback, and both active and sham transcranial direct current stimulation) were viewed as exploratory, given the lack of previous research examining brain oscillations as predictors of response to these other treatments. Design Randomized controlled study of single sessions of four neuromodulatory pain treatments and a control procedure. Methods Thirty individuals with spinal cord injury and chronic pain had their EEG recorded before each session of four active treatments (hypnosis, meditation, EEG biofeedback, transcranial direct current stimulation) and a control procedure (sham transcranial direct stimulation). Results As hypothesized, more presession theta power was associated with greater response to hypnotic analgesia. In exploratory analyses, we found that less baseline alpha power predicted pain reduction with meditation. Conclusions The findings support the idea that different patients respond to different pain treatments and that between-person treatment response differences are related to brain states as measured by EEG. The results have implications for the possibility of enhancing pain treatment response by either 1) better patient/treatment matching or 2) influencing brain activity before treatment is initiated in order to prepare patients to respond. Research is needed to replicate and confirm the findings in additional samples of individuals with chronic pain. PMID:25287554

  11. Patterning of sympathetic nerve activity in response to vestibular stimulation

    NASA Technical Reports Server (NTRS)

    Kerman, I. A.; McAllen, R. M.; Yates, B. J.

    2000-01-01

    Growing evidence suggests a role for the vestibular system in regulation of autonomic outflow during postural adjustments. In the present paper we review evidence for the patterning of sympathetic nerve activity elicited by vestibular stimulation. In response to electrical activation of vestibular afferents, firing of sympathetic nerves located throughout the body is altered. However, activity of the renal nerve is most sensitive to vestibular inputs. In contrast, high-intensity simultaneous activation of cutaneous and muscle inputs elicits equivalent changes in firing of the renal, superior mesenteric and lumbar colonic nerves. Responses of muscle vasoconstrictor (MVC) efferents to vestibular stimulation are either inhibitory (Type I) or are comprised of a combination of excitation and inhibition (Type II). Interestingly, single MVC units located in the hindlimb exhibited predominantly Type I responses while those located in the forelimb and face exhibited Type II responses. Furthermore, brachial and femoral arterial blood flows were dissociated in response to vestibular stimulation, such that brachial vascular resistance increased while femoral resistance decreased. These studies demonstrate that vestibulosympathetic reflexes are patterned according to both the anatomical location and innervation target of a particular sympathetic nerve, and can lead to distinct changes in local blood flow.

  12. Chemosensory responses by the heterotrophic marine dinoflagellateCrypthecodinium cohnii.

    PubMed

    Hauser, D C; Levandowsky, M; Hutner, S H; Chunosoff, L; Hollwitz, J S

    1974-12-01

    Chemosensory responses by the colorles inshore marine dinoflagellateCrypthecodinium cohnii were observed in quadrant-divided Petri plates containing an agar layer + liquid overlay. A suspension of organisms in salt solution was poured onto this and allowed to stand 3 hr. A differential tendency of the cells to become firmly attached or embedded in the substratum was observed when various substances were incorporated in the gel. A positive response (tendency to attach) occurred with: ?-L-fucose, dimethyl-?-propiothetin, betaine, sucrose, glycine, L-alanine, hemin, and fructose; negative response: formalin, glutathione, acid hydrolyzed agar, protamine SO4, L-glutamic acid, lactose, glutamine, taurine, L-aspartic acid, putrescine 2 HCl, choline citrate, choline bitartrate, K citrate, and choline HCl. ?-Aminobutyric acid was negative or positive dependeng on concentration. Dead or immotile cells did not become attached. The following compounds elicited no response: ?-D-fucose, dimethyl acetothetin chloride, cyclic AMP, and glucose. PMID:24241032

  13. Responses of wintering bald eagles to boating activity

    USGS Publications Warehouse

    Knight, Richard L.; Knight, Susan K.

    1984-01-01

    Wintering populations of bald eagles show a close association with open water (Spencer 1976, Steenhof 1978). With the dramatic increase in the use of waterways for recreational activity in recent decades (Brockman and Merriam 1973, Jensen 1973), concern has arisen regarding the effects of boating activity on wintering eagles (Stalmaster 1980). Boating activity can be detrimental because it disrupts feeding activity and affects large areas in short periods of time (Skagen 1980, Stalmaster 1980). Disturbance may result in increased energy expenditures due to avoidance flights and decreased energy intake due to interference with feeding activity (Stalmaster 1980). In this paper we examine flushing responses and flight distances of wintering bald eagles to a canoe of two adjacent rivers with widely disparate levels of boating activity. We examine individual and interactive effects of eagle age, behavior, and social grouping.

  14. The endoplasmic reticulum stress transducer BBF2H7 suppresses apoptosis by activating the ATF5-MCL1 pathway in growth plate cartilage.

    PubMed

    Izumi, Soutarou; Saito, Atsushi; Kanemoto, Soshi; Kawasaki, Noritaka; Asada, Rie; Iwamoto, Hideo; Oki, Mami; Miyagi, Hidetaka; Ochi, Mitsuo; Imaizumi, Kazunori

    2012-10-19

    BBF2H7 (box B-binding factor 2 human homolog on chromosome 7) is a basic leucine zipper transmembrane transcription factor that belongs to the cyclic AMP-responsive element-binding protein (CREB)/activating transcription factor (ATF) family. This novel endoplasmic reticulum (ER) stress transducer is localized in the ER and is cleaved in its transmembrane region in response to ER stress. BBF2H7 has been shown to be expressed in proliferating chondrocytes in cartilage during the development of long bones. The target of BBF2H7 is Sec23a, one of the coat protein complex II components. Bbf2h7-deficient (Bbf2h7(-/-)) mice exhibit severe chondrodysplasia, with expansion of the rough ER in proliferating chondrocytes caused by impaired secretion of extracellular matrix (ECM) proteins. We observed a decrease in the number of proliferating chondrocytes in the cartilage of Bbf2h7(-/-) mice. TUNEL staining of the cartilage showed that apoptosis was promoted in Bbf2h7(-/-) chondrocytes. Atf5 (activating transcription factor 5), another member of the CREB/ATF family and an antiapoptotic factor, was also found to be a target of BBF2H7 in chondrocytes. ATF5 activated the transcription of Mcl1 (myeloid cell leukemia sequence 1), which belongs to the antiapoptotic B-cell leukemia/lymphoma 2 family, to suppress apoptosis. Finally, we found that the BBF2H7-ATF5-MCL1 pathway specifically suppressed ER stress-induced apoptosis in chondrocytes. Taken together, our findings indicate that BBF2H7 is activated in response to ER stress caused by synthesis of abundant ECM proteins and plays crucial roles as a bifunctional regulator to accelerate ECM protein secretion and suppress ER stress-induced apoptosis by activating the ATF5-MCL1 pathway during chondrogenesis. PMID:22936798

  15. Circulatory response and autonomic nervous activity during gum chewing.

    PubMed

    Hasegawa, Yoko; Sakagami, Joe; Ono, Takahiro; Hori, Kazuhiro; Zhang, Min; Maeda, Yoshinobu

    2009-08-01

    Mastication has been proven to enhance the systemic circulation, with circulatory responses seeming to be largely regulated by autonomic nervous activity via a more complex regulatory system than those of other activities. However, few studies have examined the relationships between changes in autonomic nervous activity and the systemic circulation that are induced by masticatory movement. We investigated changes in the systemic circulation and autonomic nervous activity during gum chewing to clarify the influence of mastication. Electrocardiograms, arterial blood pressure, and masseter electromyograms were taken while chewing gum continuously as indicators of systemic circulation in 10 healthy subjects with normal dentition. Cardiac sympathetic activity and vagus nervous activity, as well as vasomotor sympathetic nervous activity, were evaluated by fluctuation analysis of heart rate and blood pressure. Repeated analysis of variance and multiple comparisons were performed to determine chronological changes in each indicator during gum chewing. Gum chewing increased the heart rate and the mean arterial pressure. Although cardiac sympathetic activity and vagus nervous activity showed significant changes, vasomotor sympathetic nervous activity did not. These results suggest that changes in the autonomic nervous activity of the heart are mainly involved in the enhancement of systemic circulation with gum chewing. This explains some characteristics of autonomic nervous regulation in masticatory movement. PMID:19627361

  16. 78 FR 26772 - Agency Information Collection Activities OMB Responses

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-08

    ... AGENCY Agency Information Collection Activities OMB Responses AGENCY: Environmental Protection Agency... of information unless it displays a currently valid OMB control number. The OMB control numbers for EPA regulations are listed in 40 CFR part 9 and 48 CFR chapter 15. FOR FURTHER INFORMATION...

  17. 75 FR 54626 - Agency Information Collection Activities OMB Responses

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-08

    ... without change. EPA ICR Number 2322.01; Critical Public Information Needs during Drinking Water... AGENCY Agency Information Collection Activities OMB Responses AGENCY: Environmental Protection Agency... of information unless it displays a currently valid OMB control number. The OMB control numbers...

  18. 75 FR 10249 - Agency Information Collection Activities OMB Responses

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-05

    ... HCFC Allowance System (Renewal); 40 CFR part 82, subpart A; was approved on 02/01/2010; OMB Number 2060...'s Chemical Evaluation Program (VCCEP); 40 CFR part 790; was approved on 02/11/2010; OMB Number 2070... AGENCY Agency Information Collection Activities OMB Responses AGENCY: Environmental Protection...

  19. Dynamics of lung macrophage activation in response to helminth infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most of our understanding of the development and phenotype of alternatively activated macrophages (AAM) has been obtained from studies investigating the response of bone marrow- and peritoneal-derived cells to IL-4 or IL-13 stimulation. Comparatively little is known about the development of the AAM...

  20. Mechanisms of Inflammasome Activation by Vibrio cholerae Secreted Toxins Vary with Strain Biotype

    PubMed Central

    Queen, Jessica; Agarwal, Shivani; Dolores, Jazel S.; Stehlik, Christian

    2015-01-01

    Activation of inflammasomes is an important aspect of innate immune responses to bacterial infection. Recent studies have linked Vibrio cholerae secreted toxins to inflammasome activation by using murine macrophages. To increase relevance to human infection, studies of inflammasome-dependent cytokine secretion were conducted with the human THP-1 monocytic cell line and corroborated in primary human peripheral blood mononuclear cells (PBMCs). Both El Tor and classical strains of V. cholerae activated ASC (apoptosis-associated speck-like protein-containing a CARD domain)-dependent release of interleukin-1β (IL-1β) when cultured with human THP-1 cells, but the pattern of induction was distinct, depending on the repertoire of toxins the strains produced. El Tor biotype strains induced release of IL-1β dependent on NOD-like receptor family pyrin domain-containing 3 (NLRP3) and ASC due to the secreted pore-forming toxin hemolysin. Unlike in studies with mouse macrophages, the MARTX toxin did not contribute to IL-1β release from human monocytic cells. Classical biotype strains, which do not produce either hemolysin or the MARTX toxin, activated low-level IL-1β release that was induced by cholera toxin (CT) and dependent on ASC but independent of NLRP3 and pyroptosis. El Tor strains likewise showed increased IL-1β production dependent on CT when the hemolysin gene was deleted. In contrast to studies with murine macrophages, this phenotype was dependent on a catalytically active CT A subunit capable of inducing production of cyclic AMP and not on the B subunit. These studies demonstrate that the induction of the inflammasome in human THP-1 monocytes and in PBMCs by V. cholerae varies with the biotype and is mediated by both NLRP3-dependent and -independent pathways. PMID:25847959

  1. Mechanisms of inflammasome activation by Vibrio cholerae secreted toxins vary with strain biotype.

    PubMed

    Queen, Jessica; Agarwal, Shivani; Dolores, Jazel S; Stehlik, Christian; Satchell, Karla J F

    2015-06-01

    Activation of inflammasomes is an important aspect of innate immune responses to bacterial infection. Recent studies have linked Vibrio cholerae secreted toxins to inflammasome activation by using murine macrophages. To increase relevance to human infection, studies of inflammasome-dependent cytokine secretion were conducted with the human THP-1 monocytic cell line and corroborated in primary human peripheral blood mononuclear cells (PBMCs). Both El Tor and classical strains of V. cholerae activated ASC (apoptosis-associated speck-like protein-containing a CARD domain)-dependent release of interleukin-1β (IL-1β) when cultured with human THP-1 cells, but the pattern of induction was distinct, depending on the repertoire of toxins the strains produced. El Tor biotype strains induced release of IL-1β dependent on NOD-like receptor family pyrin domain-containing 3 (NLRP3) and ASC due to the secreted pore-forming toxin hemolysin. Unlike in studies with mouse macrophages, the MARTX toxin did not contribute to IL-1β release from human monocytic cells. Classical biotype strains, which do not produce either hemolysin or the MARTX toxin, activated low-level IL-1β release that was induced by cholera toxin (CT) and dependent on ASC but independent of NLRP3 and pyroptosis. El Tor strains likewise showed increased IL-1β production dependent on CT when the hemolysin gene was deleted. In contrast to studies with murine macrophages, this phenotype was dependent on a catalytically active CT A subunit capable of inducing production of cyclic AMP and not on the B subunit. These studies demonstrate that the induction of the inflammasome in human THP-1 monocytes and in PBMCs by V. cholerae varies with the biotype and is mediated by both NLRP3-dependent and -independent pathways. PMID:25847959

  2. Anticipating Human Activities Using Object Affordances for Reactive Robotic Response.

    PubMed

    Koppula, Hema S; Saxena, Ashutosh

    2016-01-01

    An important aspect of human perception is anticipation, which we use extensively in our day-to-day activities when interacting with other humans as well as with our surroundings. Anticipating which activities will a human do next (and how) can enable an assistive robot to plan ahead for reactive responses. Furthermore, anticipation can even improve the detection accuracy of past activities. The challenge, however, is two-fold: We need to capture the rich context for modeling the activities and object affordances, and we need to anticipate the distribution over a large space of future human activities. In this work, we represent each possible future using an anticipatory temporal conditional random field (ATCRF) that models the rich spatial-temporal relations through object affordances. We then consider each ATCRF as a particle and represent the distribution over the potential futures using a set of particles. In extensive evaluation on CAD-120 human activity RGB-D dataset, we first show that anticipation improves the state-of-the-art detection results. We then show that for new subjects (not seen in the training set), we obtain an activity anticipation accuracy (defined as whether one of top three predictions actually happened) of 84.1, 74.4 and 62.2 percent for an anticipation time of 1, 3 and 10 seconds respectively. Finally, we also show a robot using our algorithm for performing a few reactive responses. PMID:26656575

  3. Humpback Dolphin (Genus Sousa) Behavioural Responses to Human Activities.

    PubMed

    Piwetz, Sarah; Lundquist, David; Würsig, Bernd

    2015-01-01

    Humpback dolphins (genus Sousa) use shallow, near-shore waters throughout their range. This coastal distribution makes them vulnerable to recreational and commercial disturbances, especially near heavily populated and industrialized areas. Most research focusing on Sousa and human activities has emphasized direct impacts and threats, involving injury and death, with relatively little focus on indirect effects on dolphins, such as changes in behaviour that may lead to deleterious effects. Understanding behaviour is important in resolving human-wildlife conflict and is an important component of conservation. This chapter gives an overview of animal behavioural responses to human activity with examples from diverse taxa; reviews the scientific literature on behavioural responses of humpback dolphins to human activity throughout their range, including marine vessel traffic, dolphin tourism, cetacean-fishery interactions, noise pollution, and habitat alteration; and highlights information and data gaps for future humpback dolphin research to better inform behaviour-based management decisions that contribute to conservation efforts. PMID:26555621

  4. Identification of a cAMP-response element in the regulator of G-protein signaling-2 (RGS2) promoter as a key cis-regulatory element for RGS2 transcriptional regulation by angiotensin II in cultured vascular smooth muscles.

    PubMed

    Xie, Zhongwen; Liu, Dexiang; Liu, Shu; Calderon, Lindsay; Zhao, Guogang; Turk, John; Guo, Zhenheng

    2011-12-30

    Mice deficient in regulator of G-protein signaling-2 (RGS2) have severe hypertension, and RGS2 genetic variations occur in hypertensive humans. A potentially important negative feedback loop in blood pressure homeostasis is that angiotensin II (Ang II) increases vascular smooth muscle cell (VSMC) RGS2 expression. We reported that Group VIA phospholipase A(2) (iPLA(2)?) is required for this response (Xie, Z., Gong, M. C., Su, W., Turk, J., and Guo, Z. (2007) J. Biol. Chem. 282, 25278-25289), but the specific molecular causes and consequences of iPLA(2)? activation are not known. Here we demonstrate that both protein kinases C (PKC) and A (PKA) participate in Ang II-induced VSMC RGS2 mRNA up-regulation, and that actions of PKC and PKA precede and follow iPLA(2)? activation, respectively. Moreover, we identified a conserved cAMP-response element (CRE) in the murine RGS2 promoter that is critical for cAMP-response element-binding protein (CREB) binding and RGS2 promoter activation. Forskolin-stimulated RGS2 mRNA up-regulation is inhibited by CREB sequestration or specific disruption of the CREB-RGS2 promoter interaction, and Ang II-induced CREB phosphorylation and nuclear localization are blocked by iPLA(2)? pharmacologic inhibition or genetic ablation. Ang II-induced intracellular cyclic AMP accumulation precedes CREB phosphorylation and is diminished by inhibiting iPLA(2), cyclooxygenase, or lipoxygenase. Moreover, three single nucleotide polymorphisms identified in hypertensive patients are located in the human RGS2 promoter CREB binding site. Point mutations corresponding to these single nucleotide polymorphisms interfere with stimulation of human RGS2 promoter activity by forskolin. Our studies thus delineate a negative feedback loop to attenuate Ang II signaling in VSMC with potential importance in blood pressure homeostasis and the pathogenesis of human essential hypertension. PMID:22057271