Sample records for activates cyclic-amp response

  1. Cyclic AMP-responsive element-dependent activation of Epstein-Barr virus zebra promoter by human herpesvirus 6.

    PubMed Central

    Flamand, L; Menezes, J

    1996-01-01

    We have recently shown that infection of Epstein-Barr virus (EBV) genome-positive B cells by human herpesvirus 6 (HHV-6) results in the expression of the immediate-early EBV Zebra gene, followed by virus replication (L. Flamand, I. Stefanescu, D. V. Ablashi, and J. Menezes, J. Virol. 67:6768-6777, 1993). Here we show that HHV-6 upregulates Zebra gene transcription through a cyclic AMP-responsive element (CRE) located within the Zebra promoter (Zp). Using human B- or T-cell lines transfected with ZpCat reporter gene constructs, we demonstrate that a region designated the ZII domain of Zp is the target of HHV-6 transactivation. Mutation of the consensus AP-1/CRE site within ZII abolished the inducibility of Zp by HHV-6, whereas positioning of the ZII domain upstream of the beta-globin minimal promoter conferred responsiveness following HHV-6 infection. Binding of these factors to ZII was prevented by oligonucleotides containing CRE but not by AP-1 consensus sequences. Antibodies against CRE-binding (CREB) protein but not against c-Fos or c-Jun were able to supershift the DNA-protein complex, identifying the nature of the transcription factor which binds to ZII as a member of the CREB family of proteins. Finally, transfection of CREB protein and protein kinase A expression vectors were found to activate Zp in Jurkat cells, suggesting that phosphorylated form of CREB protein can play a determining role in the EBV reactivation process. PMID:8627701

  2. Fibroblast growth factor and cyclic AMP (cAMP) synergistically activate gene expression at a cAMP response element.

    PubMed Central

    Tan, Y; Low, K G; Boccia, C; Grossman, J; Comb, M J

    1994-01-01

    Growth factors and cyclic AMP (cAMP) are known to activate distinct intracellular signaling pathways. Fibroblast growth factor (FGF) activates ras-dependent kinase cascades, resulting in the activation of MAP kinases, whereas cAMP activates protein kinase A. In this study, we report that growth factors and cAMP act synergistically to stimulate proenkephalin gene expression. Positive synergy between growth factor- and cAMP-activated signaling pathways on gene expression has not been previously reported, and we suggest that these synergistic interactions represent a useful model for analyzing interactions between these pathways. Transfection and mutational studies indicate that both FGF-dependent gene activation and cAMP-dependent gene activation require cAMP response element 2 (CRE-2), a previously characterized cAMP-dependent regulatory element. Furthermore, multiple copies of this element are sufficient to confer FGF regulation upon a minimal promoter, indicating that FGF and cAMP signaling converge upon transcription factors acting at CRE-2. Among many different ATF/AP-1 factors tested, two factors, ATF-3 and c-Jun, stimulate proenkephalin transcription in an FGF- or Ras-dependent fashion. Finally, we show that ATF-3 and c-Jun form heterodimeric complexes in SK-N-MC cells and that the levels of both proteins are increased in response to FGF but not cAMP. Together, these results indicate that growth factor- and cAMP-dependent signaling pathways converge at CRE-2 to synergistically stimulate gene expression and that ATF-3 and c-Jun regulate proenkephalin transcription in response to both growth factor- and cAMP-dependent intracellular signaling pathways. Images PMID:7935470

  3. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  4. The Interplay between Cyclic AMP, MAPK, and NF-?B Pathways in Response to Proinflammatory Signals in Microglia

    PubMed Central

    Ghosh, Mousumi; Aguirre, Vladimir; Wai, Khine; Felfly, Hady; Dietrich, W. Dalton; Pearse, Damien D.

    2015-01-01

    Cyclic AMP is an important intracellular regulator of microglial cell homeostasis and its negative perturbation through proinflammatory signaling results in microglial cell activation. Though cytokines, TNF-? and IL-1?, decrease intracellular cyclic AMP, the mechanism by which this occurs is poorly understood. The current study examined which signaling pathways are responsible for decreasing cyclic AMP in microglia following TNF-? stimulation and sought to identify the role cyclic AMP plays in regulating these pathways. In EOC2 microglia, TNF-? produced a dramatic reduction in cyclic AMP and increased cyclic AMP-dependent PDE activity that could be antagonized by Rolipram, myristoylated-PKI, PD98059, or JSH-23, implicating a role for PDE4, PKA, MEK, and NF-?B in this regulation. Following TNF-? there were significant increases in iNOS and COX-2 immunoreactivity, phosphorylated ERK1/2 and NF-?B-p65, I?B degradation, and NF-?B p65 nuclear translocation, which were reduced in the presence of high levels of cyclic AMP, indicating that reductions in cyclic AMP during cytokine stimulation are important for removing its inhibitory action on NF-?B activation and subsequent proinflammatory gene expression. Further elucidation of the signaling crosstalk involved in decreasing cyclic AMP in response to inflammatory signals may provide novel therapeutic targets for modulating microglial cell activation during neurological injury and disease. PMID:25722974

  5. 5-Hydroxytryptamine2A receptor stimulation induces activator protein-1 and cyclic AMP-responsive element binding with cyclic AMP-responsive element-binding protein and Jun D as common components in cerebellar neurons.

    PubMed

    Chalecka-Franaszek, E; Chen, H; Chuang, D M

    1999-01-01

    Previous studies from our laboratory have demonstrated that stimulation of 5-hydroxytryptamine2A receptors in rat cerebellar granule cells produces an increase in the levels of 5-hydroxytryptamine2A receptor messenger RNA and binding sites, and that this up-regulation requires de novo RNA and protein synthesis. Here we showed that up-regulation of 5-hydroxytryptamine2A receptor binding sites induced by stimulation with the 5-hydroxytryptamine2A/2C receptor agonist, (+/-)-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane (DOI), is associated with an increase in the 5-hydroxytryptamine2A receptor transcription rate. To examine the possible role of transcriptional activation in DOI-induced 5-hydroxytryptamine2A receptor up-regulation, we studied the effects of DOI on transcription factor binding to activator protein-1 and cyclic AMP-responsive element (CRE) DNA consensus sequences. We found that DOI induces a time-dependent increase in activator protein-1 and CRE transcription factor binding activity, which is blocked by 5-hydroxytryptamine2A receptor antagonists. Similar to 5-hydroxytryptamine2A receptor up-regulation, DOI-induced activator protein-1 binding is suppressed by inhibitors of calmodulin and Ca2+/calmodulin-dependent kinases. The increased activator protein-1 binding is effectively competed by excessive activator protein-1 and CRE sequences as well as endogenous activator protein-1-like sequences present in the rat 5-hydroxytryptamine2A receptor gene. Supershift assays revealed that cAMP-responsive element-binding protein (CREB) and Jun D are common components of both activator protein-1 and CRE binding complexes. DOI also increased the level of phospho-CREB in a time-dependent manner. The binding of phospho-CREB transcription factor to the activator protein-1 site suggests that CREB may modulate the transcription of genes that contain activator protein-1 but lack CRE site in their promoters, through interaction with the activator protein-1 site. The rat 5-hydroxytryptamine2A receptor up-regulation may involve such a mechanism. PMID:10363825

  6. Novel interactions between human T-cell leukemia virus type I Tax and activating transcription factor 3 at a cyclic AMP-responsive element.

    PubMed Central

    Low, K G; Chu, H M; Schwartz, P M; Daniels, G M; Melner, M H; Comb, M J

    1994-01-01

    Human proenkephalin gene transcription is transactivated by human T-cell leukemia virus type I (HTLV-I) Tax in human Jurkat T lymphocytes. This transactivation was further enhanced in Jurkat cells treated with concanavalin A, cyclic AMP, or 12-O-tetradecanoylphorbol-13-acetate. Deletion and cis-element transfer analyses of the human proenkephalin promoter identified a cyclic AMP-responsive AP-1 element (-92 to -86) as both necessary and sufficient to confer Tax-dependent transactivation. Different AP-1 or cyclic AMP-responsive element-binding protein (CREB)/activating transcription factor (ATF) proteins which bind this element were expressed in murine teratocarcinoma F9 cells to identify those capable of mediating Tax-dependent transactivation of human proenkephalin gene transcription. Although CREB, c-Fos, c-Jun, and JunD did not have significant effects, JunB inhibited the Tax-dependent transactivation. In contrast, ATF3 dramatically induced Tax-dependent transactivation, which was further enhanced by protein kinase A. Electrophoretic mobility shift assays with recombinant fusion proteins expressed and purified from bacteria indicate that the DNA-binding activity of ATF3 is also dramatically enhanced by Tax. Chimeric fusion proteins consisting of the DNA-binding domain of the yeast transcription factor Gal4 and the amino-terminal domain (residues 1 to 66) of ATF3 were able to mediate Tax-dependent transactivation of a Gal4-responsive promoter, which suggests a direct involvement of this region of ATF3. Recombinant fusion proteins of glutathione S-transferase with either the amino- or carboxy-terminal (residues 139 to 181) domain of ATF3 were able to specifically interact with Tax. Furthermore, specific antisera directed against Tax coimmunoprecipitated ATF3 only in the presence of Tax. Images PMID:8007991

  7. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP

    Microsoft Academic Search

    Dario Difrancesco; Paolo Tortora

    1991-01-01

    CYCLIC AMP acts as a second messenger in the modulation of several ion channels1-9 that are typically controlled by a phosphorylation process10. In cardiac pacemaker cells, adrenaline and acetylcholine regulate the hyperpolarization-activated current (if), but in opposite ways; this current is involved in the generation and modulation of pacemaker activity11. These actions are mediated by cAMP and underlie control of

  8. Induction of cyclooxygenase-2 by ginsenoside Rd via activation of CCAAT-enhancer binding proteins and cyclic AMP response binding protein

    SciTech Connect

    Jeong, Hye Gwang [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Pokharel, Yuba Raj [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Han, Eun Hee [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Kang, Keon Wook [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of)]. E-mail: kwkang@chosun.ac.kr

    2007-07-20

    Panax ginseng is a widely used herbal medicine in East Asia and is reported to have a variety of pharmacological effects against cardiovascular diseases and cancers. Here we show a unique effect of ginsenoside Rd (Rd) on cyclooxygenase-2 (COX-2) expression in RAW264.7 macrophages. Rd (100 {mu}g/ml), but not other ginsenosides induced COX-2 and increased prostaglandin E{sub 2} production. Gel shift and Western blot analyses using nuclear fractions revealed that Rd increased both the DNA binding of and the nuclear levels of CCAAT/enhancer binding protein (C/EBP){alpha}/{beta} and cyclic AMP response element binding protein (CREB), but not of p65, in RAW264.7 cells. Moreover, Rd increased the luciferase reporter gene activity in cells transfected with a 574-bp mouse COX-2 promoter construct. Site-specific mutation analyses confirmed that Rd-mediated transcriptional activation of COX-2 gene was regulated by C/EBP and CREB. These results provide evidence that Rd activated C/EBP and CREB, and that the activation of C/EBP and CREB appears to be essential for induction of COX-2 in RAW264.7 cells.

  9. Low-Power Laser Irradiation Suppresses Inflammatory Response of Human Adipose-Derived Stem Cells by Modulating Intracellular Cyclic AMP Level and NF-?B Activity

    PubMed Central

    Wang, Chau-Zen; Ho, Mei-Ling; Yeh, Ming-Long; Wang, Yan-Hsiung

    2013-01-01

    Mesenchymal stem cell (MSC)-based tissue regeneration is a promising therapeutic strategy for treating damaged tissues. However, the inflammatory microenvironment that exists at a local injury site might restrict reconstruction. Low-power laser irradiation (LPLI) has been widely applied to retard the inflammatory reaction. The purpose of this study was to investigate the anti-inflammatory effect of LPLI on human adipose-derived stem cells (hADSCs) in an inflammatory environment. We showed that the hADSCs expressed Toll-like Receptors (TLR) 1, TLR2, TLR3, TLR4, and TLR6 and that lipopolysaccharide (LPS) significantly induced the production of pro-inflammatory cytokines (Cyclooxygenase-2 (Cox-2), Interleukin-1? (IL-1?), Interleukin-6 (IL-6), and Interleukin-8 (IL-8)). LPLI markedly inhibited LPS-induced, pro-inflammatory cytokine expression at an optimal dose of 8 J/cm2. The inhibitory effect triggered by LPLI might occur through an increase in the intracellular level of cyclic AMP (cAMP), which acts to down-regulate nuclear factor kappa B (NF-?B) transcriptional activity. These data collectively provide insight for further investigations of the potential application of anti-inflammatory treatment followed by stem cell therapy. PMID:23342077

  10. Low-power laser irradiation suppresses inflammatory response of human adipose-derived stem cells by modulating intracellular cyclic AMP level and NF-?B activity.

    PubMed

    Wu, Jyun-Yi; Chen, Chia-Hsin; Wang, Chau-Zen; Ho, Mei-Ling; Yeh, Ming-Long; Wang, Yan-Hsiung

    2013-01-01

    Mesenchymal stem cell (MSC)-based tissue regeneration is a promising therapeutic strategy for treating damaged tissues. However, the inflammatory microenvironment that exists at a local injury site might restrict reconstruction. Low-power laser irradiation (LPLI) has been widely applied to retard the inflammatory reaction. The purpose of this study was to investigate the anti-inflammatory effect of LPLI on human adipose-derived stem cells (hADSCs) in an inflammatory environment. We showed that the hADSCs expressed Toll-like Receptors (TLR) 1, TLR2, TLR3, TLR4, and TLR6 and that lipopolysaccharide (LPS) significantly induced the production of pro-inflammatory cytokines (Cyclooxygenase-2 (Cox-2), Interleukin-1? (IL-1?), Interleukin-6 (IL-6), and Interleukin-8 (IL-8)). LPLI markedly inhibited LPS-induced, pro-inflammatory cytokine expression at an optimal dose of 8 J/cm². The inhibitory effect triggered by LPLI might occur through an increase in the intracellular level of cyclic AMP (cAMP), which acts to down-regulate nuclear factor kappa B (NF-?B) transcriptional activity. These data collectively provide insight for further investigations of the potential application of anti-inflammatory treatment followed by stem cell therapy. PMID:23342077

  11. Doxorubicin-induced Id2A gene transcription is targeted at an activating transcription factor/cyclic AMP response element motif through novel mechanisms involving protein kinases distinct from protein kinase C and protein kinase A.

    PubMed Central

    Kurabayashi, M; Dutta, S; Jeyaseelan, R; Kedes, L

    1995-01-01

    We have recently shown that doxorubicin (Dox), an antineoplastic drug and an inhibitor of terminal differentiation of myogenic and adipogenic cells, induces expression of Id, a gene encoding a helix-loop-helix transcriptional inhibitor. In this study we have investigated the molecular mechanisms underlying Dox-induced Id2A expression. We have also attempted to determine whether the genetic responses to Dox are related to the UV response, a well-characterized set of reactions to UV and DNA-damaging compounds that is partly mediated by AP-1. Transient transfection of a series of deletions and point mutation derivatives of the human Id2A promoter sequence shows that two closely spaced and inverted short elements similar to an activating transcription factor (ATF) binding site or a cyclic AMP response element (CRE) are necessary and sufficient for a full response to Dox. We refer to this element as the IdATF site. Sequences containing an IdATF site conferred Dox inducibility on a minimal heterologous promoter. An electrophoretic mobility shift assay showed nuclear proteins specifically interacting with the IdATF sequence. While oligonucleotides containing either legitimate ATF/CRE or AP-1 binding sequences competed for binding, antibody supershift experiments suggested that neither CREB/ATF-1 nor AP-1 are major factors binding to IdATF. Several independent criteria suggest that Dox inducibility was independent of Ca2+/phospholipid-dependent protein kinase (protein kinase C), cyclic AMP-dependent protein kinase (protein kinase A), and tyrosine kinase. Moreover, we found that Dox also induces transcription from promoters of immediate-early genes through an AP-1-independent pathway. Taken together, our results suggest that Dox elicits a novel genetic response distinct from the classical UV response. PMID:7565791

  12. CyclicAMP Response Element-Based Signaling Assays for Characterization of Trk Family Tyrosine Kinases Modulators

    Microsoft Academic Search

    Jie Zhang; Diana Chen; Xiaohai Gong; Huaiping Ling; Guoming Zhang; Andrew Wood; Julia Heinrich; Seongeun Cho

    2006-01-01

    Neurotrophins (NTs) induce gene transcription by binding their high-affinity tropomyosin-related kinase (Trk) receptors and initiating intracellular signal transduction cascades. In particular, activation of the cyclic AMP response element (CRE) in the promoters of target genes serves as surrogate markers for Trk receptor activation as demonstrated in both in vivo and in vitro systems. We used a HEK293 cell line stably

  13. Inhibition of mammalian protein kinase and phosphodiesterase activities by a cyclic AMP-like compound isolated from higher plants.

    PubMed Central

    Wood, H N; Pomerantz, A H; Binns, A N; Allfrey, V G; Braun, A C

    1978-01-01

    A cyclic AMP-like substance has been isolated from higher plant tissues which can be quantitated with the use of a radioimmunoassay similar to that described by A. L. Steiner, D. M. Kipnis, R. Utiger, and C. Parker [(1969) Proc. Natl. Acad. Sci. USA 64, 367-373]. This compound has been extensively purified and is chromatographically distinct from authentic cyclic AMP. This cyclic AMP-like compound inhibited beef heart 3':5'-cyclic-nucleotide phosphodietsterase (3':5'-cyclic-nucleotide 5'-nucleotidohydrolase, EC 3.1.4.17), with half-maximal inhibition occurring at a concentration of 7.6 X 10(-10) M cyclic AMP equivalents. The compound also inhibited cyclic AMP-dependent protein kinase (ATP:protein phosphotransferase; EC 2.7.1.37) from bovine heart, with half-maximal inhibition of mixed histone phosphorylation occurring at 8.0 X 10(-11) M cyclic AMP equivalents. Equipotent inhibition of phosphorylation and associated trace ATPase activity were observed with the purified catalytic subunit of cyclic AMP-dependent protein kinase from calf thymus with a synthetic heptapeptide as substrate. Moreover, steady-state kinetic analysis of this inhibition in the latter system showed it to be nonlinear and noncompetitive versus MgATP. Images PMID:212743

  14. Cyclic AMP increases COX-2 expression via mitogen-activated kinase in human myometrial cells

    PubMed Central

    Chen, Li; Sooranna, Suren R; Lei, Kaiyu; Kandola, Mandeep; Bennett, Phillip R; Liang, Zhiqing; Grammatopoulos, Dimitri; Johnson, Mark R

    2012-01-01

    Abstract Cyclic AMP (cAMP) is the archetypal smooth muscle relaxant, mediating the effects of many hormones and drugs. However, recently PGI2, acting via cAMP/PKA, was found to increase contraction-associated protein expression in myometrial cells and to promote oxytocin-driven myometrial contractility. Cyclo-oxygenase-2 (COX-2) is the rate-limiting enzyme in prostaglandin synthesis, which is critical to the onset and progression of human labour. We have investigated the impact of cAMP on myometrial COX-2 expression, synthesis and activity. Three cAMP agonists (8-bromo-cAMP, forskolin and rolipram) increased COX-2 mRNA expression and further studies confirmed that this was associated with COX-2 protein synthesis and activity (increased PGE2 and PGI2 in culture supernatant) in primary cultures of human myometrial cells. These effects were neither reproduced by specific agonists nor inhibited by specific inhibitors of known cAMP-effectors (PKA, EPAC and AMPK). We then used shRNA to knockdown the same effectors and another recently described cAMP-effector PDZ-GEF1-2, without changing the response to cAMP. We found that MAPK activation mediated the cAMP effects on COX-2 expression and that PGE2 acts through EP-2 to activate MAPK and increase COX-2. These data provide further evidence in support of a dual role for cAMP in the regulation of myometrial function. PMID:21854542

  15. Cilostazol prevents tumor necrosis factor-alpha-induced cell death by suppression of phosphatase and tensin homolog deleted from chromosome 10 phosphorylation and activation of Akt/cyclic AMP response element-binding protein phosphorylation.

    PubMed

    Hong, Ki Whan; Kim, Ki Young; Shin, Hwa Kyoung; Lee, Jeong Hyun; Choi, Jae Moon; Kwak, Yong-Geun; Kim, Chi Dae; Lee, Won Suk; Rhim, Byung Yong

    2003-09-01

    This study examines the signaling mechanism by which cilostazol prevents neuronal cell death. Cilostazol ( approximately 0.1-100 microM) prevented tumor necrosis factor-alpha (TNF-alpha)-induced decrease in viability of SK-N-SH and HCN-1A cells, which was antagonized by 1 microM iberiotoxin, a maxi-K channel blocker. TNF-alpha did not suppress the viability of the U87-MG cell, a phosphatase and tensin homolog deleted from chromosome 10 (PTEN)-null glioblastoma cell, but it did decrease viability of U87-MG cells transfected with expression vectors for the sense PTEN, and this decrease was also prevented by cilostazol. Cilostazol as well as 1,3-dihydro-1-[2-hydroxy-5-(trifluoromethyl)phenyl]-5-(trifluoromethyl)-2H-benzimidazol-2-one (NS-1619) and (3S)(+)-(5-chloro-2-methoxyphenyl)-1,3-dihydro-3-fluoro-6-(trifluoromethyl)-2H-indole-2-one (BMS 204352), maxi-K channel openers, prevented increased DNA fragmentation evoked by TNF-alpha, which were antagonizable by iberiotoxin. TNF-alpha-induced increased PTEN phosphorylation and decreased Akt/cyclic AMP response element-binding protein (CREB) phosphorylation were significantly prevented by cilostazol, those of which were antagonized by both iberiotoxin and paxilline, maxi-K channel blockers. The same results were evident in U87-MG cells transfected with expression vectors for sense PTEN. Cilostazol increases the K+ current in SK-N-SH cells by activating maxi-K channels without affecting the ATP-sensitive K+ channel. Thus, our results for the first time provide evidence that cilostazol prevents TNF-alpha-induced cell death by suppression of PTEN phosphorylation and activation of Akt/CREB phosphorylation via mediation of the maxi-K channel opening. PMID:12807996

  16. Stimulation of bile acid active transport related to increased mucosal cyclic AMP content in rat ileum in vitro.

    PubMed

    Reymann, A; Braun, W; Drobik, C; Woermann, C

    1989-05-10

    The regulation of bile acid transport in rat ileum was studied in vitro using the adenylate cyclase stimulator forskolin, or 3-isobutyl-1-methylxanthine (IBMX), a phosphodiesterase inhibitor. Forskolin 20 microM as well as 100 microM IBMX enhanced mucosal cyclic AMP to 3-fold the control levels. As a physiological response, net fluid absorption in everted ileal sacs was reduced. Taurocholate (10-500 microM) transfer in everted perfused segments of rat ileum was measured using a three compartment dual label method suitable for measuring active transport. Transport asymmetry with absorption exceeding its counterflux by 26-fold, was measured at 500 microM taurocholate. Forskolin increased absorption of taurocholate still further, by 68%, and reduced the serosal to mucosal flux. Enhanced intracellular accumulation of taurocholate indicated a stimulatory action of forskolin on active transport at the mucosal brush-border membrane. In uptake studies, accumulation of taurocholate was enhanced by 100 microM IBMX also. Forskolin-induced uptake stimulation could also be shown for chenodeoxycholate and cholate. In the presence of the neuronal blocker tetrodotoxin, uptake stimulation was still effective. Results indicate that the ileal bile acid transporter is included within the group of sodium-dependent cotransporters of the rat small intestine which are subject to a cyclic AMP-related stimulation at the mucosal cellular level. PMID:2469477

  17. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  18. Cyclic AMP-elevating agents prevent oligodendroglial excitotoxicity.

    PubMed

    Yoshioka, A; Shimizu, Y; Hirose, G; Kitasato, H; Pleasure, D

    1998-06-01

    Previously, we have demonstrated that cells of the oligodendroglial lineage express non-NMDA glutamate receptor genes and are damaged by kainate-induced Ca2+ influx via non-NMDA glutamate receptor channels, representing oligodendroglial excitotoxicity. We find in the present study that agents that elevate intracellular cyclic AMP prevent oligodendroglial excitotoxicity. After oligodendrocyte-like cells, differentiated from the CG-4 cell line established from rat oligodendrocyte type-2 astrocyte progenitor cells, were exposed to 2 mM kainate for 24 h, cell death was evaluated by measuring activity of lactate dehydrogenase released into the culture medium. Released lactate dehydrogenase increased about threefold when exposed to 2 mM kainate. Kainate-induced cell death was prevented by one of the following agents: adenylate cyclase activator (forskolin), cyclic AMP analogues (dibutyryl cyclic AMP and 8-bromo-cyclic AMP), and cyclic AMP phosphodiesterase inhibitors (3-isobutyl-1-methylxanthine, pentoxifylline, propentofylline, and ibudilast). Simultaneous addition of both forskolin and phosphodiesterase inhibitors prevented the kainate-induced cell death in an additive manner. A remarkable increase in Ca2+ influx (approximately 5.5-fold) also was induced by kainate. The cyclic AMP-elevating agents caused a partial suppression of the kainate-induced increase in Ca2+ influx, leading to a less prominent response of intracellular Ca2+ concentration to kainate. The suppressing effect of forskolin on the kainate-induced Ca2+ influx was partially reversed by H-89, an inhibitor of cyclic AMP-dependent protein kinase. In contrast to this, okadaic acid, an inhibitor of protein phosphatases 1 and 2A, brought about a decrease in the kainate-induced Ca2+ influx. We therefore concluded that cyclic AMP-elevating agents prevented oligodendroglial excitotoxicity by cyclic AMP-dependent protein kinase-dependent protein phosphorylation, resulting in decreased kainate-induced Ca2+ influx. PMID:9603206

  19. Trehalase activity and cyclic AMP content during early development of Mucor rouxii spores.

    PubMed Central

    Dewerchin, M A; Van Laere, A J

    1984-01-01

    Incubation of Mucor rouxii sporangiospores in complex medium under aerobic conditions resulted in a transient 20-fold increase in trehalase activity. Maximum activity was reached after 15 min. Simultaneously, the cyclic AMP (cAMP) content increased approximately eightfold, reaching a maximum within 10 min. Increases in trehalase activity and cAMP content were also observed under anaerobic conditions (CO2). The extent of trehalase activation and the changes in cAMP content, during both aerobic and anaerobic incubation, varied with the medium used. Trehalase was activated in vitro by a cAMP- and ATP-dependent process. An even faster activation was obtained when cAMP was replaced by the catalytic subunit of beef heart protein kinase. The coincidence of, and the correlation between, increased cAMP contents and trehalase activities support the involvement of a cAMP-dependent phosphorylation in the in vivo regulation of trehalase activity. PMID:6327611

  20. Hypoxia-Activated Cytochrome bd Expression in Mycobacterium smegmatis Is Cyclic AMP Receptor Protein Dependent

    PubMed Central

    Aung, Htin Lin; Berney, Michael

    2014-01-01

    Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator. PMID:24936051

  1. The autophosphorylation reaction in the mechanism of activation of pig brain cyclic AMP-dependent protein kinase.

    PubMed

    Nesterova, M V; Ulmasov, K A; Shlyapnikov, S V; Severin, E S

    1981-07-24

    Autophosphorylation of cyclic AMP-dependent protein kinase (ATP: protein phosphotransferase, EC 2.7.1.37) was shown to occur via an intramolecular mechanism: the regulatory subunit undergoes phosphorylation only within the holoenzyme. The phospho form of the catalytic subunit has the capacity to phosphorylate the regulatory subunit. The phosphotransferase reaction and the reaction of autophosphorylation were found to proceed with the involvement of the same active site. The activation constant of phospho- and dephosphoprotein kinase under the influence of cyclic AMP and the dissociation constant of the cyclic AMP complex with phospho- and dephospho forms of the holoenzyme were estimated. Autophosphorylation was demonstrated to lead to almost complete dissociation of the holoenzyme under the influence of cyclic AMP. Circular dichroism spectra of the phosphorylated and non-phosphorylated forms of protein kinase were studied. The relative content of the secondary structure elements in proteins was estimated and conformational changes were detected in the enzyme upon its interaction with cycli AMP. The anti-conformation of the cyclic nucleotide fixed in the complex with the phospho form of the regulatory subunit is suggested. PMID:6268168

  2. Differentiation-responsive elements in the 5' region of the mouse tissue plasminogen activator gene confer two-stage regulation by retinoic acid and cyclic AMP in teratocarcinoma cells.

    PubMed Central

    Rickles, R J; Darrow, A L; Strickland, S

    1989-01-01

    F9 cells induced to differentiate with retinoic acid (RA) increase transcription of the tissue plasminogen activator (t-PA) gene. Further treatment of these cells with cyclic AMP (cAMP) results in an additional stimulation of t-PA gene transcription. To investigate the mechanism of this two-stage regulation, 4 kilobase pairs (kbp) of 5'-flanking sequence from the murine t-PA gene was isolated. Two major start sites for transcription were found, neither of which depended on a classical TATA motif for correct initiation. By using transient transfection assays, it was determined that 4-kbp of flanking sequence could confer on reporter genes the same two-stage differentiation-specific expression as was observed for the endogenous t-PA gene. Deletion analyses of this 4-kbp fragment showed that 190 bp of flanking sequence was sufficient to bestow the same degree of two-stage regulation on reporter gene constructs. Within this region of DNA, sequence analysis revealed a possible cAMP regulatory element, a CTF/NF-1 recognition sequence, two potential Sp1 sites, and five potential binding sites for transcription factor AP-2. The deletion experiments, coupled with the positions of these potential cis-acting elements, suggest that multiple transcription factors, including those that bind to cAMP regulatory element, CTF/NF-1, Sp1, and AP-2 sites, may be involved in regulation of the t-PA gene during F9 cell differentiation. Images PMID:2542775

  3. See-saw signal processing in pinealocytes involves reciprocal changes in the alpha 1-adrenergic component of the cyclic GMP response and the beta-adrenergic component of the cyclic AMP response.

    PubMed

    Vanecek, J; Sugden, D; Weller, J L; Klein, D C

    1986-09-01

    Pineal cyclic AMP and cyclic GMP are regulated by norepinephrine (NE) acting through alpha 1- and beta-adrenoceptors. beta-Adrenergic stimulation appears to be an absolute requirement and alpha 1-adrenergic activation amplifies beta-adrenergic stimulation of the cyclic AMP response 10-fold and the cyclic GMP response 100-fold, respectively. Chronic deprivation of adrenergic stimulation, due to exposure to constant light (LL) or by surgical denervation, enhances the cyclic AMP response and diminishes the cyclic GMP response as compared to control animals in a 10:14 light/dark (LD) cycle. This phenomenon is termed see-saw signal processing. In the current study we find these changes do not reflect shifts in the time course or Ka of these responses. Dose-response studies indicate the beta-adrenergic component of cyclic AMP stimulation is enhanced and the alpha 1-adrenergic component of cyclic GMP stimulation is diminished in LL pinealocytes. Several observations indicate these changes may reflect alterations in Ca2+-sensitive postreceptor mechanisms. PMID:3016179

  4. Localized cyclic AMP-dependent protein kinase activity is required for myogenic cell fusion

    SciTech Connect

    Mukai, Atsushi [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan); Hashimoto, Naohiro [Department of Regenerative Medicine, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3 Gengo, Morioka, Oobu, Aichi 474-8522 (Japan)], E-mail: nao@nils.go.jp

    2008-01-15

    Multinucleated myotubes are formed by fusion of mononucleated myogenic progenitor cells (myoblasts) during terminal skeletal muscle differentiation. In addition, myoblasts fuse with myotubes, but terminally differentiated myotubes have not been shown to fuse with each other. We show here that an adenylate cyclase activator, forskolin, and other reagents that elevate intracellular cyclic AMP (cAMP) levels induced cell fusion between small bipolar myotubes in vitro. Then an extra-large myotube, designated a 'myosheet,' was produced by both primary and established mouse myogenic cells. Myotube-to-myotube fusion always occurred between the leading edge of lamellipodia at the polar end of one myotube and the lateral plasma membrane of the other. Forskolin enhanced the formation of lamellipodia where cAMP-dependent protein kinase (PKA) was accumulated. Blocking enzymatic activity or anchoring of PKA suppressed forskolin-enhanced lamellipodium formation and prevented fusion of multinucleated myotubes. Localized PKA activity was also required for fusion of mononucleated myoblasts. The present results suggest that localized PKA plays a pivotal role in the early steps of myogenic cell fusion, such as cell-to-cell contact/recognition through lamellipodium formation. Furthermore, the localized cAMP-PKA pathway might be involved in the specification of the fusion-competent areas of the plasma membrane in lamellipodia of myogenic cells.

  5. Cell cycle regulation of cyclin A gene expression by the cyclic AMP-responsive transcription factors CREB and CREM.

    PubMed Central

    Desdouets, C; Matesic, G; Molina, C A; Foulkes, N S; Sassone-Corsi, P; Brechot, C; Sobczak-Thepot, J

    1995-01-01

    Cyclin A is a pivotal regulatory protein which, in mammalian cells, is involved in the S phase of the cell cycle. Transcription of the human cyclin A gene is cell cycle regulated. We have investigated the role of the cyclic AMP (cAMP)-dependent signalling pathway in this cell cycle-dependent control. In human diploid fibroblasts (Hs 27), induction of cyclin A gene expression at G1/S is stimulated by 8-bromo-cAMP and suppressed by the protein kinase A inhibitor H89, which was found to delay S phase entry. Transfection experiments showed that the cyclin A promoter is inducible by activation of the adenylyl cyclase signalling pathway. Stimulation is mediated predominantly via a cAMP response element (CRE) located at positions -80 to -73 with respect to the transcription initiation site and is able to bind CRE-binding proteins and CRE modulators. Moreover, activation by phosphorylation of the activators CRE-binding proteins and CRE modulator tau and levels of the inducible cAMP early repressor are cell cycle regulated, which is consistent with the pattern of cyclin A inducibility by cAMP during the cell cycle. These results suggest that the CRE is, at least partly, implicated in stimulation of cyclin A transcription at G1/S. PMID:7760825

  6. Acetylcholine muscarinic m1 receptor regulation of cyclic AMP synthesis controls growth factor stimulation of Raf activity.

    PubMed Central

    Russell, M; Winitz, S; Johnson, G L

    1994-01-01

    Acetylcholine muscarinic m2 receptors (m2R) couple to heterotrimeric Gi proteins and activate the Ras/Raf/mitogen-activated protein kinase pathway and phosphatidylinositol 3-kinase in Rat 1a cells. In contrast to the m2R, stimulation of the acetylcholine muscarinic m1 receptor (m1R) does not activate the Ras/Raf/mitogen-activated protein kinase regulatory pathway in Rat 1a cells but rather causes a pronounced inhibition of epidermal growth factor and platelet-derived growth factor receptor activation of Raf. In Rat 1a cells, m1R stimulation of phospholipase C beta and the marked rise in intracellular calcium stimulated cyclic AMP (cAMP) synthesis, resulting in the activation of protein kinase A. Stimulation of protein kinase A inhibited Raf activation in response to growth factors. Platelet-derived growth factor receptor stimulation of phosphatidylinositol 3-kinase activity was not affected by either m1R stimulation or protein kinase A activation in response to forskolin-stimulated cAMP synthesis. GTP loading of Ras in response to growth factors was unaffected by protein kinase A activation but was partially inhibited by carbachol stimulation of the m1R. Therefore, protein kinase A action at the Ras/Raf activation interface selectively inhibited only one branch of the signal transduction network initiated by tyrosine kinases. Specific adenylyl cyclases responding to different signals, including calcium, with enhanced cAMP synthesis will regulate Raf activation in response to Ras.GTP. Taken together, the data indicate that G protein-coupled receptors can positively and negatively regulate the responsiveness of tyrosine kinase-stimulated mitogenic response pathways. Images PMID:8139539

  7. Activation of the adenylyl cyclase/cyclic AMP/protein kinase A pathway in endothelial cells exposed to cyclic strain

    NASA Technical Reports Server (NTRS)

    Cohen, C. R.; Mills, I.; Du, W.; Kamal, K.; Sumpio, B. E.

    1997-01-01

    The aim of this study was to assess the involvement of the adenylyl cyclase/cyclic AMP/protein kinase A pathway (AC) in endothelial cells (EC) exposed to different levels of mechanical strain. Bovine aortic EC were seeded to confluence on flexible membrane-bottom wells. The membranes were deformed with either 150 mm Hg (average 10% strain) or 37.5 mm Hg (average 6% strain) vacuum at 60 cycles per minute (0.5 s strain; 0.5 s relaxation) for 0-60 min. The results demonstrate that at 10% average strain (but not 6% average strain) there was a 1.5- to 2.2-fold increase in AC, cAMP, and PKA activity by 15 min when compared to unstretched controls. Further studies revealed an increase in cAMP response element binding protein in EC subjected to the 10% average strain (but not 6% average strain). These data support the hypothesis that cyclic strain activates the AC/cAMP/PKA signal transduction pathway in EC which may occur by exceeding a strain threshold and suggest that cyclic strain may stimulate the expression of genes containing cAMP-responsive promoter elements.

  8. Distinct developmental regulation and properties of the responsiveness of different genes to cyclic AMP in Dictyostelium discoideum.

    PubMed

    Bozzone, D M; Berger, E A

    1987-01-01

    Cyclic AMP (cAMP) is known to be an important mediator of gene expression in eukaryotic cells. At present, little is known about the developmental events which render specific genes responsive to cAMP in distinct cell types, or about the biochemical mechanisms by which cAMP exerts these regulatory effects. By examining the effects of cAMP treatment on specific mRNA levels in Dictyostelium discoideum cells with different 'developmental histories', we defined the developmental states in which specific genes display responsiveness to cAMP. We focused on two specific rapid responses: the ability of cAMP to inhibit the expression of an 'early' developmentally regulated mRNA (discoidin-I) and to stimulate the expression of a 'late', prespore-specific mRNA (PL3). Using this approach, we showed that, for both mRNAs, the ability to respond rapidly to cAMP is absent from vegetative cells grown on bacteria, and is acquired during development on filters. Furthermore, we identified several developmental states in which the discoidin-I response to cAMP is present, but in which the PL3 response is not. In experiments designed to examine the effects of cAMP analogues on the levels of these two mRNAs, we demonstrated that the analogue specificities of the discoidin-I and PL3 responses are different, and that the specificity for the PL3 response depends on the developmental state. The developmental kinetics and analogue specificity of the PL3 response suggest a two-step mode of action of cAMP in activating the expression of this gene. We discuss possible implications of these findings for the mechanisms of action of exogenous cAMP as well as for the role of cAMP in controlling the changes in gene expression that accompany normal development. PMID:3036635

  9. Long-range signaling in growing neurons after local elevation of cyclic AMP-dependent activity

    PubMed Central

    1994-01-01

    Cyclic AMP-dependent activity at the growth cone or the soma of cultured Xenopus spinal neurons was elevated by local extracellular perfusion of the neuron with culture medium containing 8-bromoadenosine 3',5'-cyclic monophosphate (8-br-cAMP) or forskolin. During local perfusion of one of the growth cones of multipolar neurons with these drugs, the perfused growth cone showed further extension, while the distant, unperfused growth cones were inhibited in their growth. Local perfusion of the growth cone with culture medium or local perfusion with 8-br-cAMP at a cell-free region 100 microns away from the growth cone did not produce any effect on the extension of the growth cone. Reduced extension of all growth cones was observed when the perfusion with 8-br-cAMP was restricted to the soma. The distant inhibitory effect does not depend on the growth of the perfused growth cone since local coperfusion of the growth cone with 8-br-cAMP and colchicine inhibited growth on both perfused and unperfused growth cones, while local perfusion with colchicine alone inhibited only the perfused growth cone. The distant inhibitory effect was abolished when the perfusion of 8-br-cAMP was carried out together with kinase inhibitor H- 8, suggesting the involvement of cAMP-dependent protein kinase and/or its downstream factors in the long-range inhibitory signaling. Uniform exposure of the entire neuron to bath-applied 8-br-cAMP, however, led to enhanced growth activity at all growth cones. Thus, local elevation of cAMP-dependent activity produces long-range and opposite effects on distant parts of the neuron, and a cytosolic gradient of second messengers may produce effects distinctly different from those following uniform global elevation of the messenger, leading to differential growth regulation at different regions of the same neuron. PMID:7798321

  10. Role of actin in the responses of adrenal cells to ACTH and cyclic AMP: inhibition by DNase I

    PubMed Central

    1984-01-01

    Erythrocyte ghosts were loaded with pancreatic DNase I and fused with Y- 1 adrenal tumor cells to test the possibility that this enzyme might inhibit the steroidogenic responses of the cells to ACTH and cyclic AMP. Fusion of erythrocyte ghosts loaded with DNase I, but not those containing albumin, ovalbumin, boiled DNase I, or DNase I with excess G- actin, inhibited the increase in production of 20 alpha- dihydroprogesterone produced by ACTH and dibutyryl cyclic AMP; inhibition was concentration-dependent with 50% inhibition by 3 X 10(7) molecules of DNase I per cell. It was found that inhibition by DNase I was exerted at the step in the steroidogenic pathway at which cholesterol is transported to mitochondria where steroidogenesis begins. This was shown by measuring transport of cholesterol into the inner mitochondrial membrane, by measuring the production of pregnenolone by isolated mitochondria and by demonstrating that DNase I was without effect on the conversion of pregnenolone to 20 alpha- dihydroprogesterone (an end-product of steroid synthesis). The actin content of Y-1 cells was measured by two methods based upon inhibition of DNase I and by SDS gels following centrifugation. The cells were found to contain 2-3 X 10(7) molecules of actin per cell of which two- thirds is present as G-actin. Since DNase I is known to bind to G-actin to give a one to one complex, these and other findings suggest that at least some of the G-actin in the cells may be necessary for the steroidogenic responses to ACTH and cyclic AMP. PMID:6090470

  11. Repression of protein kinase C and stimulation of cyclic AMP response elements by fumonisin, a fungal encoded toxin which is a carcinogen.

    PubMed

    Huang, C; Dickman, M; Henderson, G; Jones, C

    1995-04-15

    Fusarium moniliforme (FM) is a major fungal pathogen of corn and is involved with stalk rot disease. FM is widely spread throughout the world, including the United States. Most strains of FM produce several mycotoxins, the most prominent of which is called fumonisin. Recent epidemiological studies indicated that ingestion of fumonisin correlates with a higher incidence of esophageal cancer in Southern and Northern Africa and China. Furthermore, fumonisin causes a neurodegenerative disease in horses, induces hepatic cancer in rats, and induces pulmonary edema in swine. Considering that high levels of fumonisin have been detected in healthy and diseased corn grown in the United States, fumonisin may pose a health threat to humans and livestock animals. Structurally, fumonisin resembles sphingolipids which are present in the membranes of animal and plant cells. At the present time, very little is known concerning the mechanism by which fumonisin elicits its carcinogenic effect. Our studies indicate that fumonisin represses expression of protein kinase C and AP-1-dependent transcription. In contrast, fumonisin stimulated a simple promoter containing a single cyclic AMP response element. Since fumonisin did not alter protein kinase A activity, it appears that cyclic AMP response element activation was independent of protein kinase A. It is hypothesized that the ability of fumonisin to alter signal transduction pathways plays a role in carcinogenesis. PMID:7712470

  12. Pituitary adenylate cyclase-activating peptide induces long-lasting neuroprotection through the induction of activity-dependent signaling via the cyclic AMP response element-binding protein-regulated transcription co-activator 1

    PubMed Central

    Baxter, Paul S; Martel, Marc-Andre; McMahon, Aoife; Kind, Peter C; Hardingham, Giles E

    2011-01-01

    Pituitary adenylate cyclase-activating peptide (PACAP) is a neuroprotective peptide which exerts its effects mainly through the cAMP-protein kinase A (PKA) pathway. Here, we show that in cortical neurons, PACAP-induced PKA signaling exerts a major part of its neuroprotective effects indirectly, by triggering action potential (AP) firing. Treatment of cortical neurons with PACAP induces a rapid and sustained PKA-dependent increase in AP firing and associated intracellular Ca2+ transients, which are essential for the anti-apoptotic actions of PACAP. Transient exposure to PACAP induces long-lasting neuroprotection in the face of apoptotic insults which is reliant on AP firing and the activation of cAMP response element (CRE) binding protein (CREB)-mediated gene expression. Although direct, activity-independent PKA signaling is sufficient to trigger phosphorylation on CREB’s activating serine-133 site, this is insufficient for activation of CREB-mediated gene expression. Full activation is dependent on CREB-regulated transcription co-activator 1 (CRTC1), whose PACAP-induced nuclear import is dependent on firing activity-dependent calcineurin signaling. Over-expression of CRTC1 is sufficient to rescue PACAP-induced CRE-mediated gene expression in the face of activity-blockade, while dominant negative CRTC1 interferes with PACAP-induced, CREB-mediated neuroprotection. Thus, the enhancement of AP firing may play a significant role in the neuroprotective actions of PACAP and other adenylate cyclase-coupled ligands. PMID:21623792

  13. Evolution of developmental cyclic AMP signalling in the Dictyostelia from an amoebozoan stress response

    PubMed Central

    Schaap, Pauline

    2014-01-01

    The Dictyostelid social amoebas represent one of nature’s several inventions of multicellularity. Though normally feeding as single cells, nutrient stress triggers collection of amoebas into colonies that form delicately shaped fruiting structures in which the cells differentiate into spores and up to three cell types to support the spore mass. Cyclic AMP (cAMP) plays a very dominant role in controlling morphogenesis and cell differentiation in the model species D. discoideum. As a secreted chemoattractant cAMP coordinates cell movement during aggregation and fruiting body morphogenesis. Secreted cAMP also controls gene expression at different developmental stages, while intracellular cAMP is extensively used to transduce the effect of other stimuli that control the developmental programme. In this review, I present an overview of the different roles of cAMP in the model D. discoideum and I summarize studies aimed to resolve how these roles emerged during Dictyostelid evolution. PMID:21585352

  14. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  15. Outer Dynein Arm Light Chain 1 Is Essential for Controlling the Ciliary Response to Cyclic AMP in Paramecium tetraurelia

    PubMed Central

    Kutomi, Osamu; Hori, Manabu; Ishida, Masaki; Tominaga, Takashi; Kamachi, Hiroyuki; Koll, France; Cohen, Jean; Yamada, Norico

    2012-01-01

    The individual role of the outer dynein arm light chains in the molecular mechanisms of ciliary movements in response to second messengers, such as Ca2+ and cyclic nucleotides, is unclear. We examined the role of the gene termed the outer dynein arm light chain 1 (LC1) gene of Paramecium tetraurelia (ODAL1), a homologue of the outer dynein arm LC1 gene of Chlamydomonas reinhardtii, in ciliary movements by RNA interference (RNAi) using a feeding method. The ODAL1-silenced (ODAL1-RNAi) cells swam slowly, and their swimming velocity did not increase in response to membrane-hyperpolarizing stimuli. Ciliary movements on the cortical sheets of ODAL1-RNAi cells revealed that the ciliary beat frequency was significantly lower than that of control cells in the presence of ?1 mM Mg2+-ATP. In addition, the ciliary orientation of ODAL1-RNAi cells did not change in response to cyclic AMP (cAMP). A 29-kDa protein phosphorylated in a cAMP-dependent manner in the control cells disappeared in the axoneme of ODAL1-RNAi cells. These results indicate that ODAL1 is essential for controlling the ciliary response by cAMP-dependent phosphorylation. PMID:22427431

  16. The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi.

    PubMed

    Reverchon, S; Expert, D; Robert-Baudouy, J; Nasser, W

    1997-06-01

    The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi. PMID:9171393

  17. The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi.

    PubMed Central

    Reverchon, S; Expert, D; Robert-Baudouy, J; Nasser, W

    1997-01-01

    The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi. PMID:9171393

  18. Modulatory role of 1,25 dihydroxyvitamin D3 on pancreatic islet insulin release via the cyclic AMP pathway in the rat

    PubMed Central

    Bourlon, P -M; Faure-Dussert, A; Billaudel, B

    1997-01-01

    Previous studies have shown that vitamin D3 deficiency impairs the insulin response to glucose via an alteration of signal transduction pathways, such as Ca2+ handling and the phosphoinositide pathway. In the present study the adenylyl cyclase pathway was examined in islets from 3 independent groups: normal rats, 4 weeks-vitamin D3 deficient rats and one week-1,25 dihydroxyvitamin D3 (1,25(OH)2D3) treated rats. We found that the very low rate of insulin release observed in vitamin D3 deficient rats could be restored in vitamin D3 deficient islets only with high concentrations of dioctanoyl-cyclic AMP (DO-cyclic AMP), whereas 1,25(OH)2D3 improved the sensitivity of the islets to this exogenous cyclic AMP analogue. The beneficial effect of 1,25(OH)2D3 observed with or without DO-cyclic AMP was protein kinase A-dependent, since the addition of N-[2-(p-bromocinnamylamino) ethyl]-5-isoquinolinesulphonamide (H-89), a specific inhibitor of cyclic AMP-dependent protein kinases, decreased the insulin release of treated rats back to the level seen in vitamin D3 deficient islets. The low rate of insulin release could not be consistently related to an alteration in cyclic AMP content of the islets. Indeed, low insulin response to a barium + theophylline stimulus observed in vitamin D3 deficient islets was paradoxically associated with a supranormal cyclic AMP content in the islets. This paradoxical increase in cyclic AMP observed in these conditions could not be attributed to a lower total phosphodiesterase (PDE) activity, although the portion of Ca2+-calmodulin-independent PDE was predominant in islets from vitamin D3 deficient rats. On the other hand, the higher cyclic AMP content of vitamin D3 deficient islets could be related to an increase in glucagon-induced cyclic AMP synthesis in relation to the hyperglucagonaemia previously observed in vitamin D3 deficient rats. Since higher concentrations of exogenous glucagon and higher endogenous cyclic AMP concentrations were required in vitro to restore insulin release to normal values, the cyclic AMP-dependent pathways that usually potentiate insulin secretion appeared to be less efficient in relation to an alteration in the post cyclic AMP effector system. 1,25(OH)2D3 exerted a stimulating effect on insulin release via protein kinase A activation but reduced the supranormal cyclic AMP synthesis, thus exerting a differential modulatory influence on biochemical disturbances in islets induced by vitamin D3 deficiency. PMID:9208144

  19. Interplay of the E box, the cyclic AMP response element, and HTF4/HEB in transcriptional regulation of the neurospecific, neurotrophin-inducible vgf gene.

    PubMed Central

    Di Rocco, G; Pennuto, M; Illi, B; Canu, N; Filocamo, G; Trani, E; Rinaldi, A M; Possenti, R; Mandolesi, G; Sirinian, M I; Jucker, R; Levi, A; Nasi, S

    1997-01-01

    vgf is a neurotrophin response-specific, developmentally regulated gene that codes for a neurosecretory polypeptide. Its transcription in neuronal cells is selectively activated by the neurotrophins nerve growth factor (NGF), brain-derived neurotrophic factor, and neurotrophin 3, which induce survival and differentiation, and not by epidermal growth factor. We studied a short region of the rat vgf promoter which is essential for its regulated expression. A cyclic AMP response element (CRE) within this region is necessary for NGF induction of vgf transcription. Two sites upstream of CRE, an E box and a CCAAT sequence, bind nuclear protein complexes and are involved in transcriptional control. The E box has a dual role. It acts as an inhibitor in NIH 3T3 fibroblasts, together with a second E box located downstream, and as a stimulator in the NGF-responsive cell line PC12. By expression screening, we have isolated the cDNA for a basic helix-loop-helix transcription factor, a homolog of the HTF4/HEB E protein, that specifically binds the vgf promoter E box. The E protein was present in various cell lines, including PC12 cells, and was a component of a multiprotein nuclear complex that binds the promoter in vitro. The E box and CRE cooperate in binding to this complex, which may be an important determinant for neural cell-specific expression. PMID:9032251

  20. Bacillus anthracis Edema Toxin Suppresses Human Macrophage Phagocytosis and Cytoskeletal Remodeling via the Protein Kinase A and Exchange Protein Activated by Cyclic AMP Pathways

    Microsoft Academic Search

    Linsey A. Yeager; Ashok K. Chopra; Johnny W. Peterson

    2009-01-01

    Bacillus anthracis, the etiological agent of anthrax, is a gram-positive spore-forming bacterium. It produces edema toxin (EdTx), a powerful adenylate cyclase that increases cyclic AMP (cAMP) levels in host cells. Because other cAMP-increasing agents inhibit key macrophage (M) functions, such as phagocytosis, it was hypothesized that EdTx would exhibit similar suppressive activities. Our previous GeneChip data showed that EdTx downregulated

  1. Activation of adenosine A 2A and dopamine D 1 receptors stimulates cyclic AMP-dependent phosphorylation of DARPP-32 in distinct populations of striatal projection neurons

    Microsoft Academic Search

    P Svenningsson; M Lindskog; F Rognoni; B. B Fredholm; P Greengard; G Fisone

    1998-01-01

    In the striatum, adenosine A2A and dopamine D1 receptors are segregated in striatopallidal and striatonigral projection neurons, respectively. In this study, we have examined the effects of activating adenosine A2A and dopamine D1 receptors on the state of phosphorylation of DARPP-32 (dopamine- and cyclic AMP-regulated phosphoprotein of mol. wt 32,000), a potent endogenous regulator of protein phosphatase-1 that is highly

  2. The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice.

    PubMed

    Lazaroff, M; Patankar, S; Yoon, S O; Chikaraishi, D M

    1995-09-15

    Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at -45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the AP1/dyad (AD) element at -205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at -91 or -95. However, in its native context at -205, the AD could not support expression. In contrast, a CRE, moved from its normal position at -45 to -206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context-and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines. PMID:7665571

  3. Uptake of Cyclic AMP by Natural Populations of Marine Bacteria

    PubMed Central

    Ammerman, James W.; Azam, Farooq

    1982-01-01

    The major objective of this study was to describe the mechanism(s) of cyclic AMP uptake by natural populations of marine bacteria. A second objective was to determine whether this uptake could contribute to the intracellular regulatory pool of cyclic AMP. Using high-specific-activity 32P-labeled cyclic AMP, we found several high-affinity uptake systems. The highest-affinity system had a half-saturation constant of <10 pM. This system was extremely specific for cyclic nucleotides, particularly cyclic AMP. It appeared to meet the criteria for active transport. Uptake of cyclic AMP over a wide concentration range (up to 2 ?M) showed multiphasic kinetics, with half-saturation constants of 1 nM and greater. These lower-affinity systems were much less specific for cyclic nucleotides. Although much of the labeled cyclic AMP taken up by the high-affinity systems was metabolized, some remained as intact cyclic AMP within the cells during 1 h of incubation. This suggests that at least some of the bacteria use cyclic AMP dissolved in seawater to augment their intracellular pools. PMID:16345995

  4. Iontophoresis of cyclic AMP.

    PubMed Central

    Cohen, M H; Drage, D J; Robertson, A

    1975-01-01

    The design, calibration, and operation of a source of controlled amounts of cyclic AMP (c-AMP) are described. Typically, 1.5 s pulses containing 10(10)-10(-12) molecules of c-AMP can be delivered to a region about 10 mum in diameter on an agar plate. The resulting concentration profiles are given as functions of distance and time. The diffusion coefficient of c-AMP in agar was measured to be 0.97 times 10(-5) cm2-s-1 at 21 degrees C. PMID:167878

  5. Hepatitis C virus NS2 protein activates cellular cyclic AMP-dependent pathways

    SciTech Connect

    Kim, Kyoung Mi [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Kwon, Shi-Nae [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Kang, Ju-Il [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Lee, Song Hee [Department of Life Science, Pohang University of Science and Technology, San 31, Hyoja Dong, Pohang, Kyungbuk 790-784 (Korea, Republic of); Jang, Sung Key [Department of Life Science, Pohang University of Science and Technology, San 31, Hyoja Dong, Pohang, Kyungbuk 790-784 (Korea, Republic of); Ahn, Byung-Yoon [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Yoon Ki [School of Life Sciences and Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of)]. E-mail: yk-kim@korea.ac.kr

    2007-05-18

    Chronic infection of the hepatitis C virus (HCV) leads to liver cirrhosis and cancer. The mechanism leading to viral persistence and hepatocellular carcinoma, however, has not been fully understood. In this study, we show that the HCV infection activates cellular cAMP-dependent pathways. Expression of a luciferase reporter gene controlled by a basic promoter with the cAMP response element (CRE) was significantly elevated in human hepatoma Huh-7 cells infected with the HCV JFH1. Analysis with viral subgenomic replicons indicated that the HCV NS2 protein is responsible for the effect. Furthermore, the level of cellular transcripts whose stability is known to be regulated by cAMP was specifically reduced in cells harboring NS2-expressing replicons. These results allude to the HCV NS2 protein having a novel function of regulating cellular gene expression and proliferation through the cAMP-dependent pathway.

  6. Mechanisms of tyrosine hydroxylase regulation in striatal synaptosomes: effects of activation of cyclic AMP-dependent protein kinase

    SciTech Connect

    Colby, K.A.

    1987-01-01

    The regulation of tyrosine hydroxylase (TH), the rate-limiting enzyme of catecholamine biosynthesis, was examined in synaptosomes prepared from rat corpus striatum. Exposure of striatal synaptosomes to dibutyryl-cyclic AMP (dbcAMP) causes an increase in the maximal velocity of TH, but does not change the K/sub m/ of the enzyme for the synthetic cofactor, 2-amino-4-hydroxy-6-methyl-tetrahydropterin. Activation of TH by synaptosomal exposure to dbcAMP also causes a decrease in the pH sensitivity and an increase in the thermolability of the enzyme. Striatal synaptosomes were used to examine the in vitro phosphorylation of TH. Under the protocol developed as part of this work, TH in synaptosomes can be labelled with /sup 32/P. This is the first report of in vitro labelling of TH in a biochemically intact CNS preparation. Under certain protocols, treatment of synaptosomes with dbcAMP causes an increase in the /sup 32/P labelling of TH. These results are consistent with the notion that dbcAMP produces changes in the physical properties of TH by activating cAMP-dependent protein kinase which subsequently phosphorylates TH. In vivo electrical stimulation of the rat medial forebrain bundle causes an activation of striatal TH as well as an decrease in the pH sensitivity of the enzyme. Since similar changes are produced upon activation of snaptosomal TH by dbcAMP, it is likely that phosphorylation of TH is involved in the increase in TH activity that is associated with neuronal depolarization.

  7. Modification by psychotropic drugs of the cyclic AMP response to norepinephrine in the rat brain in vitro

    Microsoft Academic Search

    G. C. Palmer; G. A. Robison; A. A. Manian; F. Sulser

    1972-01-01

    Tissue slices were prepared from paired areas of the rat hypothalamus and brain stem. Exposure of the brain slices for 6 min to 5×10-5 M norepinephrine (NE) consistently resulted in a 3- to 5-fold increase in the level of adenosine 3',5'monophosphate (cyclic AMP). Prochlorperazine and 7-hydroxychlorpromazine at 10-5 M antagonized the increase of the cyclic nucleotide elicited by NE in

  8. Cooperative interaction of Zhangfei and ATF4 in transactivation of the cyclic AMP response element

    Microsoft Academic Search

    Melissa R. Hogan; Gregory P. Cockram; Rui Lu

    2006-01-01

    Zhangfei (ZF) is a basic region-leucine zipper protein that has been implicated in herpesvirus infection cycle and related cellular processes. Here we show both in vivo and in vitro data demonstrating that ZF is a novel cellular binding partner of activating transcription factor 4 (ATF4) (or CREB2). We found that ZF competed with ATF4 to form ATF4-ZF heterodimeric complexes through

  9. The Yeast Ras\\/Cyclic AMP Pathway Induces Invasive Growth by Suppressing the Cellular Stress Response

    Microsoft Academic Search

    ARIEL STANHILL; NAOMI SCHICK; DAVID ENGELBERG

    1999-01-01

    Haploid yeast cells are capable of invading agar when grown on rich media. Cells of the S1278b genetic background manifest this property, whereas other laboratory strains are incapable of invasive growth. We show that disruption of the RAS2 gene in the S1278b background significantly reduces invasive growth but that expression of a constitutively active Ras2p (Ras2Val19p) in this strain has

  10. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    PubMed Central

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the ?-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using ?-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature ?-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known ?-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  11. Activation of cyclic AMP-dependent kinase is required but may not be sufficient to mimic cyclic AMP-dependent DNA synthesis and thyroglobulin expression in dog thyroid cells.

    PubMed Central

    Dremier, S; Pohl, V; Poteet-Smith, C; Roger, P P; Corbin, J; Doskeland, S O; Dumont, J E; Maenhaut, C

    1997-01-01

    Thyrotropin (TSH), via a cyclic AMP (cAMP)-dependent pathway, induces cytoplasmic retractions, proliferation, and differentiation expression in dog thyroid cells. The role of cAMP-dependent protein kinase (PKA) in the induction of these events was assessed by microinjection into living cells. Microinjection of the heat-stable inhibitor of PKA (PKI) inhibited the effects of TSH, demonstrating that activation of PKA was required in this process. Overexpression of the catalytic (C) subunit of PKA brought about by microinjection of the expression plasmid pC alpha ev or of purified C subunit itself was sufficient to mimic the cAMP-dependent cytoplasmic changes and thyroperoxidase mRNA expression but not to induce DNA synthesis and thyroglobulin (Tg) expression. The cAMP-dependent morphological effect was not observed when C subunit was coinjected with the regulatory subunit (RI or RII subunit) of PKA. To mimic the cAMP-induced PKA dissociation into free C and R subunits, the C subunit was coinjected with the regulation-deficient truncated RI subunit (RIdelta1-95) or with wild-type RI or native RII subunits, followed by incubation with TSH at a concentration too low to stimulate the cAMP-dependent events by itself. Although the cAMP-dependent morphology changes were still observed, neither DNA synthesis nor Tg expression was stimulated in these cells. Taken together, these data suggest that in addition to PKA activation, another cAMP-dependent mechanism could exist and play an important role in the transduction of the cAMP signal in thyroid cells. PMID:9343436

  12. Identification and Function of Exchange Proteins Activated Directly by Cyclic AMP (Epac) in Mammalian Spermatozoa

    PubMed Central

    Miro-Moran, Alvaro; Jardin, Isaac; Ortega-Ferrusola, Cristina; Salido, Gines M.; Peña, Fernando J.; Tapia, Jose A.; Aparicio, Ines M.

    2012-01-01

    The role of cAMP in spermatic functions was classically thought to be mediated exclusively through the activation of Protein Kinase A (PKA). However, it has recently been shown that cAMP also exerts its effects through a PKA-independent pathway activating a family of proteins known as Epac proteins. Therefore, many of the spermatic functions thought to be regulated by cAMP through the activation of PKA are again under study. We aimed to identify and to investigate the role of Epac proteins in spermatozoa using a specific permeable analog (8-Br-2?-O-Me-cAMP). Also, we aimed to study its relationship with E-cadherin, an adhesion protein involved in fertility. Our results demonstrate the presence and sub-cellular distribution of Epac 1 and Epac 2 in mammalian spermatozoa. Capacitation and the acrosome reaction induced a change in the localization of Epac proteins in sperm. Moreover, incubation with 8-Br-2?-O-Me-cAMP prompted an increase in Rap1 activation, in the scrambling of plasma membrane phospholipids (necessary for the capacitation process), the acrosome reaction, motility, and calcium mobilization, when spermatozoa were incubated in acrosome reaction conditions. Finally, the activation of Epac proteins induced a change in the distribution of E-cadherin. Therefore, the increase in the acrosome reaction, together with the increase in calcium (which is known to be essential for fertilization) and the Epac nteraction with E-cadherin, might indicate that Epac proteins have an important role in gamete recognition and fertilization. PMID:22662198

  13. Bovine Brain Diacylglycerol Lipase: Substrate Specificity and Activation by Cyclic AMP-dependent Protein Kinase

    Microsoft Academic Search

    Thad A. Rosenberger; Akhlaq A. Farooqui; Lloyd A. Horrocks

    2007-01-01

    Diacylglycerol lipase (EC 3.1.1.3) was purified from bovine brain microsomes using multiple column chromatographic techniques.\\u000a The purified enzyme migrates as a single band on SDS-PAGE and has an apparent molecular weight of 27 kDa. Substrate specificity\\u000a experiments using mixed molecular species of 1,2-diacyl-sn-glycerols indicate that low concentrations of Ca2+ and Mg2+ have no direct effect on enzymic activity and 1,2-diacyl-sn-glycerols are

  14. Mlc Is a Transcriptional Activator with a Key Role in Integrating Cyclic AMP Receptor Protein and Integration Host Factor Regulation of Leukotoxin RNA Synthesis in Aggregatibacter actinomycetemcomitans

    PubMed Central

    Childress, Catherine; Feuerbacher, Leigh A.; Phillips, Linda; Burgum, Alex

    2013-01-01

    Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cyclic AMP (cAMP) receptor protein (CRP) indirectly increases ltxA expression, but the intermediary regulator is unknown. Integration host factor (IHF) binds to and represses the leukotoxin promoter, but neither CRP nor IHF is responsible for the anaerobic induction of ltxA RNA synthesis. Thus, we have undertaken studies to identify other regulators of leukotoxin transcription and to demonstrate how these proteins work together to modulate leukotoxin synthesis. First, analyses of ltxA RNA expression from defined leukotoxin promoter mutations in the chromosome identify positions ?69 to ?35 as the key control region and indicate that an activator protein modulates leukotoxin transcription. We show that Mlc, which is a repressor in Escherichia coli, functions as a direct transcriptional activator in A. actinomycetemcomitans; an mlc deletion mutant reduces leukotoxin RNA synthesis, and recombinant Mlc protein binds specifically at the ?68 to ?40 region of the leukotoxin promoter. Furthermore, we show that CRP activates ltxA expression indirectly by increasing the levels of Mlc. Analyses of ?mlc, ?ihf, and ?ihf ?mlc strains demonstrate that Mlc can increase RNA polymerase (RNAP) activity directly and that IHF represses ltxA RNA synthesis mainly by blocking Mlc binding. Finally, a ?ihf ?mlc mutant still induces ltxA during anaerobic growth, indicating that there are additional factors involved in leukotoxin transcriptional regulation. A model for the coordinated regulation of leukotoxin transcription is presented. PMID:23475968

  15. Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP

    PubMed Central

    Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

    2011-01-01

    Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

  16. Isolation and characterization of the human chorionic gonadotropin beta subunit (CG beta) gene cluster: regulation of transcriptionally active CG beta gene by cyclic AMP.

    PubMed Central

    Jameson, J L; Lindell, C M

    1988-01-01

    The alpha and beta subunit genes encoding chorionic gonadotropin (CG) are regulated transcriptionally in placental cells by cyclic AMP (cAMP). The regulatory response sequences of the alpha gene have been studied extensively. Similar studies of the CG beta subunit (CG beta) gene have not been possible because transcriptionally active sequences have not been identified in the clones isolated to date. The CG beta subunit genes form a complex cluster of seven structurally similar genes that include six CG beta-like genes and a single luteinizing hormone beta subunit (LH beta) gene. We isolated overlapping clones containing the entire CG beta/LH beta gene cluster (68 kilobases) from a human genomic cosmid library. The organization of the gene cluster was similar to that found in previous analyses, as determined by Southern blots of genomic DNA, but differed from some of the gene assignments, as determined by fragments cloned in lambda phage. The 5'-flanking sequence of the most active CG beta gene (CG beta 5) was linked to the chloramphenicol acetyltransferase (CAT) coding sequence for analyses of transient expression in different cell types. CG beta CAT was expressed preferentially in JEG-3 choriocarcinoma cells, and expression was markedly stimulated by treatment with 8-bromo-cAMP. Deletion mutagenesis of the CG beta 5'-flanking sequence revealed that multiple regions were required for maximal expression. The kinetics for cAMP stimulation of alpha CAT and CG beta CAT expression were different, suggesting that different pathways may be involved in cAMP-stimulated expression of the alpha and CG beta genes. Images PMID:2468994

  17. Dose and Time Effects of Estrogen on Expression of Neuron-Specific Protein and Cyclic AMP Response Element-Binding Protein and Brain Region Volume in the Medial Amygdala of Ovariectomized Rats

    Microsoft Academic Search

    Lu Fan; Rose Hanbury; Subhash C. Pandey; Rochelle S. Cohen

    2008-01-01

    Although estrogen has been shown to be neuroprotective, studies concerning its effect on some behaviors are contradictory, reporting both ameliorative and detrimental effects. A factor involved in hormone efficacy is the estrogen regimen. We reported an effect of 10 ?g estrogen for 14 days on the cyclic AMP response element-binding protein (CREB) pathway, including brain-derived neurotrophic factor, in rat medial

  18. Alpha 2-adrenergic receptor-mediated sensitization of forskolin-stimulated cyclic AMP production.

    PubMed Central

    Jones, S B; Toews, M L; Turner, J T; Bylund, D B

    1987-01-01

    Preincubation of HT29 human colonic adenocarcinoma cells with alpha 2-adrenergic agonists resulted in a 10- to 20-fold increase in forskolin-stimulated cyclic AMP production as compared to cells preincubated without agonist. Similar results were obtained using either a [3H]adenine prelabeling assay or a cyclic AMP radioimmunoassay to measure cyclic AMP levels. This phenomenon, which is termed sensitization, is alpha 2-adrenergic receptor-mediated and rapid in onset and reversal. Yohimbine, an alpha 2-adrenergic receptor-selective antagonist, blocked norepinephrine-induced sensitization, whereas prazosin (alpha 1-adrenergic) and sotalol (beta-adrenergic) did not. The time for half-maximal sensitization was 5 min and the half-time for reversal was 10 min. Only a 2-fold sensitization of cyclic AMP production stimulated by vasoactive intestinal peptide was observed, indicating that sensitization is relatively selective for forskolin. Sensitization reflects an increased production of cyclic AMP and not a decreased degradation of cyclic AMP, since incubation with a phosphodiesterase inhibitor and forskolin did not mimic sensitization. Increasing the levels of cyclic AMP during the preincubation (using a phosphodiesterase inhibitor) had no effect on sensitization, indicating that sensitization is not caused by decreased cyclic AMP levels during the preincubation. This rapid and dramatic sensitization of forskolin-stimulated cyclic AMP production is a previously unreported effect that can be added to the growing list of alpha 2-adrenergic responses that are not mediated by a decrease in cyclic AMP. PMID:2881298

  19. Synergism between Calcium and Cyclic GMP in Cyclic AMP Response Element-Dependent Transcriptional Regulation Requires Cooperation between CREB and C/EBP-?

    PubMed Central

    Chen, Yongchang; Zhuang, Shunhui; Cassenaer, Stijn; Casteel, Darren E.; Gudi, Tanima; Boss, Gerry R.; Pilz, Renate B.

    2003-01-01

    Calcium induces transcriptional activation of the fos promoter by activation of the cyclic AMP response element (CRE)-binding protein (CREB), and in some cells its effect is enhanced synergistically by cyclic GMP (cGMP) through an unknown mechanism. We observed calcium-cGMP synergism in neuronal and osteogenic cells which express type II cGMP-dependent protein kinase (G-kinase); the effect on the fos promoter was mediated by the CRE and proportional to G-kinase activity. Dominant negative transcription factors showed involvement of CREB- and C/EBP-related proteins but not of AP-1. Expression of C/EBP-? but not C/EBP-? or -? enhanced the effects of calcium and cGMP on a CRE-dependent reporter gene. The transactivation potential of full-length CREB fused to the DNA-binding domain of Gal4 was increased synergistically by calcium and cGMP, and overexpression of C/EBP-? enhanced the effect, while a dominant negative C/EBP inhibited it. With a mammalian two-hybrid system, coimmunoprecipitation experiments, and in vitro binding studies, we demonstrated that C/EBP-? and CREB interacted directly; this interaction involved the C terminus of C/EBP-? but occurred independently of CREB's leucine zipper domain. CREB Ser133 phosphorylation was stimulated by calcium but not by cGMP; in cGMP-treated cells, 32PO4 incorporation into C/EBP-? was decreased and C/EBP-?/CRE complexes were increased, suggesting regulation of C/EBP-? functions by G-kinase-dependent dephosphorylation. C/EBP-? and CREB associated with the fos promoter in intact cells, and the amount of promoter-associated C/EBP-? was increased by calcium and cGMP. We conclude that calcium and cGMP transcriptional synergism requires cooperation of CREB and C/EBP-?, with calcium and cGMP modulating the phosphorylation states of CREB and C/EBP-?, respectively. PMID:12773552

  20. Revisiting the mechanism of activation of cyclic AMP receptor protein (CRP) by cAMP in Escherichia coli: lessons from a subunit-crosslinked form of CRP.

    PubMed

    Saha, Abinit; Mukhopadhyay, Jayanta; Datta, Ajit Bikram; Parrack, Pradeep

    2015-01-30

    Cyclic AMP receptor protein (CRP), the global transcription regulator in prokaryotes, is active only as a cAMP-CRP complex. Binding of cAMP changes the conformation of CRP, transforming it from a transcriptionally 'inactive' to an 'active' molecule. These conformers are also characterized by distinct biochemical properties including the ability to form an S-S crosslink between the C178 residues of its two monomeric subunits. We studied a CRP variant (CRP(cl)), in which the subunits are crosslinked. We demonstrate that CRP(cl) can activate transcription even in the absence of cAMP. Implications of these results for the crystallographically-determined structure of cAMP-CRP are discussed. PMID:25541491

  1. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  2. Enhanced Leptin Sensitivity, Reduced Adiposity, and Improved Glucose Homeostasis in Mice Lacking Exchange Protein Directly Activated by Cyclic AMP Isoform 1

    PubMed Central

    Yan, Jingbo; Mei, Fang C.; Cheng, Hongqiang; Lao, Dieu Hung; Hu, Yaohua; Wei, Jingna; Patrikeev, Igor; Hao, Dapeng; Stutz, Sonja J.; Dineley, Kelly T.; Motamedi, Massoud; Hommel, Jonathan D.; Cunningham, Kathryn A.

    2013-01-01

    The prototypic second messenger cyclic AMP (cAMP) is essential for controlling cellular metabolism, including glucose and lipid homeostasis. In mammals, the majority of cAMP functions are mediated by cAMP-dependent protein kinase (PKA) and exchange proteins directly activated by cAMP (Epacs). To explore the physiological functions of Epac1, we generated Epac1 knockout mice. Here we report that Epac1 null mutants have reduced white adipose tissue and reduced plasma leptin levels but display heightened leptin sensitivity. Epac1-deficient mice are more resistant to high-fat diet-induced obesity, hyperleptinemia, and glucose intolerance. Furthermore, pharmacological inhibition of Epac by use of an Epac-specific inhibitor reduces plasma leptin levels in vivo and enhances leptin signaling in organotypic hypothalamic slices. Taken together, our results demonstrate that Epac1 plays an important role in regulating adiposity and energy balance. PMID:23263987

  3. Enhanced leptin sensitivity, reduced adiposity, and improved glucose homeostasis in mice lacking exchange protein directly activated by cyclic AMP isoform 1.

    PubMed

    Yan, Jingbo; Mei, Fang C; Cheng, Hongqiang; Lao, Dieu Hung; Hu, Yaohua; Wei, Jingna; Patrikeev, Igor; Hao, Dapeng; Stutz, Sonja J; Dineley, Kelly T; Motamedi, Massoud; Hommel, Jonathan D; Cunningham, Kathryn A; Chen, Ju; Cheng, Xiaodong

    2013-03-01

    The prototypic second messenger cyclic AMP (cAMP) is essential for controlling cellular metabolism, including glucose and lipid homeostasis. In mammals, the majority of cAMP functions are mediated by cAMP-dependent protein kinase (PKA) and exchange proteins directly activated by cAMP (Epacs). To explore the physiological functions of Epac1, we generated Epac1 knockout mice. Here we report that Epac1 null mutants have reduced white adipose tissue and reduced plasma leptin levels but display heightened leptin sensitivity. Epac1-deficient mice are more resistant to high-fat diet-induced obesity, hyperleptinemia, and glucose intolerance. Furthermore, pharmacological inhibition of Epac by use of an Epac-specific inhibitor reduces plasma leptin levels in vivo and enhances leptin signaling in organotypic hypothalamic slices. Taken together, our results demonstrate that Epac1 plays an important role in regulating adiposity and energy balance. PMID:23263987

  4. Location of an Isoproterenol-Responsive Cyclic AMP Pool in Adrenergic Nerve Cell Bodies and Its Relationship to Tyrosine 3Monooxygenase Induction

    Microsoft Academic Search

    U. Otten; R. A. Mueller; F. Oesch; H. Thoenen

    1974-01-01

    To decide whether adenosine 3':5'-cyclic monophosphate (cyclic AMP) plays a role as a second messenger in the trans-synaptic induction of tyrosine 3-monooxygenase (EC 1.14.16.2), it is desirable to discriminate between neuronal and extraneuronal changes in cyclic AMP concentration. Treatment of newborn rats with nerve growth factor antiserum or 6-hydroxydopamine, leading to destruction of 61-85% of the adrenergic nerve cell bodies

  5. Comparative transcriptome analysis reveals novel roles of the Ras and cyclic AMP signaling pathways in environmental stress response and antifungal drug sensitivity in Cryptococcus neoformans.

    PubMed

    Maeng, Shinae; Ko, Young-Joon; Kim, Gyu-Bum; Jung, Kwang-Woo; Floyd, Anna; Heitman, Joseph; Bahn, Yong-Sun

    2010-03-01

    The cyclic AMP (cAMP) pathway plays a central role in the growth, differentiation, and virulence of pathogenic fungi, including Cryptococcus neoformans. Three upstream signaling regulators of adenylyl cyclase (Cac1), Ras, Aca1, and Gpa1, have been demonstrated to control the cAMP pathway in C. neoformans, but their functional relationship remains elusive. We performed a genome-wide transcriptome analysis with a DNA microarray using the ras1Delta, gpa1Delta, cac1Delta, aca1Delta, and pka1Delta pka2Delta mutants. The aca1Delta, gpa1Delta, cac1Delta, and pka1Delta pka2Delta mutants displayed similar transcriptome patterns, whereas the ras1Delta mutant exhibited transcriptome patterns distinct from those of the wild type and the cAMP mutants. Interestingly, a number of environmental stress response genes are modulated differentially in the ras1Delta and cAMP mutants. In fact, the Ras signaling pathway was found to be involved in osmotic and genotoxic stress responses and the maintenance of cell wall integrity via the Cdc24-dependent signaling pathway. Notably, the Ras and cAMP mutants exhibited hypersensitivity to a polyene drug, amphotericin B, without showing effects on ergosterol biosynthesis, which suggested a novel method of antifungal combination therapy. Among the cAMP-dependent gene products that we characterized, two small heat shock proteins, Hsp12 and Hsp122, were found to be involved in the polyene antifungal drug susceptibility of C. neoformans. PMID:20097740

  6. Ephedrine induced thioredoxin-1 expression through ?-adrenergic receptor/cyclic AMP/protein kinase A/dopamine- and cyclic AMP-regulated phosphoprotein signaling pathway.

    PubMed

    Jia, Jin-Jing; Zeng, Xian-Si; Li, Ye; Ma, Sha; Bai, Jie

    2013-05-01

    Ephedrine (Eph) is one of alkaloids that has been isolated from the ancient herb ephedra (ma huang) and is used as the treatment of asthma, hypotension and fatigue. However, its molecular mechanism remains unknown. Thioredoxin-1 (Trx-1) is a redox regulating protein, which has various biological activities, including regulating transcription factor DNA binding activity and neuroprotection. In this study, we found that Eph induced Trx-1 expression, which was inhibited by propranolol (?-adrenergic receptor inhibitor), but not by phenoxybenzamine (?-adrenergic receptor inhibitor) in rat pheochromocytoma PC12 cells. Moreover, the increase of Trx-1 expression was inhibited by SQ22536 (adenylyl cyclase inhibitor) and H-89 (protein kinase A inhibitor). Interestingly, the effect of Eph on dopamine- and cyclic AMP-regulated phosphoprotein (DARPP-32) was similar to Trx-1. Thus, the relationship between Trx-1 and DARPP-32 was further studied. The DARPP-32 siRNA significantly reduced Trx-1 expression, but Trx-1 siRNA did not exchange DARPP-32. These results suggested that Eph induced the Trx-1 expression through ?-adrenergic receptor/cyclic AMP/PKA/DARPP-32 signaling pathway. Furthermore, Eph induced PKA-mediated cyclic AMP response element-binding protein (CREB) phosphorylation. Down-regulation of DARPP-32 expression decreased phosphorylated CREB. In addition, Eph had a significant effect on the viability of the rat pheochromocytoma PC12 cells through ?-adrenergic receptors. Trx-1 may play an important role in the actions of Eph. PMID:23416460

  7. Glucocorticoids Stimulate CREB Binding to a CyclicAMP Response Element in the Rat Serine Dehydratase Gene

    Microsoft Academic Search

    Michael J. Haas; Henry C. Pitot

    1999-01-01

    Transcription of the rat serine dehydratase (SDH) gene, which is stimulated in hepatocytes by glucagon through the activity of the second messenger, cAMP, is augmented by pretreatment with glucocorticoids. A putative cAMP response element (CRE) located approximately 3.5 kbp upstream of the transcriptional start site was hypothesized to be responsible for this effect. Here we have demonstrated by DNaseI footprinting

  8. Cyclic AMP Signaling: A Molecular Determinant of Peripheral Nerve Regeneration

    PubMed Central

    Knott, Eric P.; Assi, Mazen; Pearse, Damien D.

    2014-01-01

    Disruption of axonal integrity during injury to the peripheral nerve system (PNS) sets into motion a cascade of responses that includes inflammation, Schwann cell mobilization, and the degeneration of the nerve fibers distal to the injury site. Yet, the injured PNS differentiates itself from the injured central nervous system (CNS) in its remarkable capacity for self-recovery, which, depending upon the length and type of nerve injury, involves a series of molecular events in both the injured neuron and associated Schwann cells that leads to axon regeneration, remyelination repair, and functional restitution. Herein we discuss the essential function of the second messenger, cyclic adenosine monophosphate (cyclic AMP), in the PNS repair process, highlighting the important role the conditioning lesion paradigm has played in understanding the mechanism(s) by which cyclic AMP exerts its proregenerative action. Furthermore, we review the studies that have therapeutically targeted cyclic AMP to enhance endogenous nerve repair. PMID:25177696

  9. Antidepressant-like effect of sildenafil through oxytocin-dependent cyclic AMP response element-binding protein phosphorylation.

    PubMed

    Matsushita, H; Matsuzaki, M; Han, X-J; Nishiki, T-I; Ohmori, I; Michiue, H; Matsui, H; Tomizawa, K

    2012-01-01

    Oxytocin (OT) levels in plasma increase during sexual response and are significantly lower in patients with depression. A drug for the treatment of sexual dysfunction, sildenafil, enhances the electrically evoked release of OT from the posterior pituitary. In this study, we showed that sildenafil had an antidepressant-like effect through activation of an OT signaling pathway. Application of sildenafil reduced depression-related behavior in male mice. The antidepressant-like effect was blocked by an OT receptor (OTR) antagonist and was absent in OTR knockout (KO) mice. Sildenafil increased the phosphorylation of cAMP response element-binding protein (CREB) in the hippocampus. The OTR antagonist inhibited sildenafil-induced CREB phosphorylation and sildenafil had no effect on CREB phosphorylation in OTR KO mice. These results suggest sildenafil to have an antidepressant-like effect through the activation of OT signaling and to be a promising drug for the treatment of depression. PMID:22088430

  10. Regulation of cyclic AMP formation in brain tissue by alpha-adrenergic receptors: requisite intermediacy of prostaglandins of the E series.

    PubMed Central

    Partington, C R; Edwards, M W; Daly, J W

    1980-01-01

    The accumulations of cyclic AMP elicited by norepinephrine in slices of rat cerebral cortex or hypothalamus were markedly reduced after incubations with prostaglandin synthetase (8,11,14-eicosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) inhibitors such as indomethacin, aspirin, flufenamic acid, and acetoaminophen. Responses of cyclic AMP-generating systems to beta-adrenergic agonists or adenosine were unchanged by treatment with indomethacin and the reduction in the norepinephrine response appeared due primarily to a loss of the alpha-adrenergic component. The accumulation of cyclic AMP elicited by prostaglandin E2 [mean effective dose (EC50) 4 micro M] was increased by 2-fold by treatment with indomethacin. The alpha-adrenergic component of the norepinephrine response was fully restored by very low concentrations of prostaglandin E2 (EC50 20 nM). Prostaglandins of the F series had no effect on cyclic AMP generation under a variety of conditions. It appears that low levels of prostaglandins of the E series are required--perhaps by a calcium-dependent mechanism--for the expression of alpha-adrenergic receptor-mediated activation of cyclic AMP formation in brain tissue. PMID:6248884

  11. Multiple Control of Flagellum Biosynthesis in Escherichia coli: Role of H-NS Protein and the Cyclic AMP-Catabolite Activator Protein Complex in Transcription of the flhDC Master Operon

    Microsoft Academic Search

    O. SOUTOURINA; A. KOLB; E. KRIN; C. LAURENT-WINTER; S. RIMSKY; A. DANCHIN; P. BERTIN

    1999-01-01

    Little is known about the molecular mechanism by which histone-like nucleoid-structuring (H-NS) protein and cyclic AMP-catabolite activator protein (CAP) complex control bacterial motility. In the present paper, we show that crp and hns mutants are nonmotile due to a complete lack of flagellin accumulation. This results from a reduced expression in vivo of fliA and fliC, which encode the specific

  12. Chlorotoxin does not inhibit volume-regulated, calcium-activated and cyclic AMP-activated chloride channels

    PubMed Central

    Maertens, Chantal; Wei, Lin; Tytgat, Jan; Droogmans, Guy; Nilius, Bernd

    2000-01-01

    It was the aim of this study to look for a high-affinity and selective polypeptide toxin, which could serve as a probe for the volume-regulated anion channel (VRAC) or the calcium-activated chloride channel (CaCC). We have partially purified chlorotoxin, including new and homologous short chain insectotoxins, from the crude venom of Leiurus quinquestriatus quinquestriatus (Lqq) by means of gel filtration chromatography. Material eluting between 280 and 420?min, corresponding to fractions 15–21, was lyophilized and tested on VRAC and CaCC, using the whole-cell patch-clamp technique. We have also tested the commercially available chlorotoxin on VRAC, CaCC, the cystic fibrosis transmembrane conductance regulator (CFTR) and on the glioma specific chloride channel (GCC). VRAC and the correspondent current, ICl,swell, was activated in Cultured Pulmonary Artery Endothelial (CPAE) cells by a 25% hypotonic solution. Neither of the fractions 16–21 significantly inhibited ICl,swell (n=4–5). Ca2+-activated Cl? currents, ICl,Ca, activated by loading T84 cells via the patch pipette with 1??M free Ca2+, were not inhibited by any of the tested fractions (15–21), (n=2–5). Chlorotoxin (625?nM) did neither effect ICl,swell nor ICl,Ca (n=4–5). The CFTR channel, transiently transfected in COS cells and activated by a cocktail containing IBMX and forskolin, was not affected by 1.2??M chlorotoxin (n=5). In addition, it did not affect currents through GCC. We conclude that submicromolar concentrations of chlorotoxin do not block volume-regulated, Ca2+-activated and CFTR chloride channels and that it can not be classified as a general chloride channel toxin. PMID:10683204

  13. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  14. The plasma cyclic-AMP response to noise in humans and rats—short-term exposure to various noise levels

    NASA Astrophysics Data System (ADS)

    Iwamoto, M.; Dodo, H.; Ishii, F.; Yoneda, J.; Yamazaki, S.; Goto, H.

    1988-12-01

    Rats were exposed to short-term noise which was found to activate the hypothalamohypophyseal-adrenal system and result in a decrease of adrenal ascorbic acid (AAA) and an increase of serum corticosterone (SCS). The threshold limit value lay between 60 and 70 dB(A). To characterize better the effect of noise on the human hypothalamo-hypophyseal-adrenal system, a large group of subjects was exposed to short-term noise at 85 dB(A) and higher, and tested for levels of adrenocortical steroid (cortisol) and anterior pituitary hormones such as ACTH, growth hormone (GH) and prolactin (PRL). Results in humans showed hyperfunction of the hypothalamo-pituitary system. However, as the responses in rats and humans differed, a further experiment was performed using C-AMP, a second messenger mediating many of the effects of a variety of hormones. Plasma C-AMP in humans and rats increased significantly after exposure to noise greater than 70 dB(A). We suggest that plasma C-AMP could be useful as a sensitive index for noise-related stress in the daily living environment of humans and rats.

  15. The cyclic AMP response element-binding protein antisense oligonucleotide induced anti-nociception and decreased the expression of KIF17 in spinal cord after peripheral nerve injury in mice

    PubMed Central

    Bo, Jinhua; Zhang, Wei; Sun, Xiaofeng; Yang, Yan; Liu, Xiaojie; Jiang, Ming; Ma, Zhengliang; Gu, Xiaoping

    2014-01-01

    Backgrounds: The cyclic AMP response element-binding protein (CREB) plays an important role in neuropathic pain. Kinesin superfamily motor protein 17 (KIF17) is involved in long-term memory formation. CREB could increase the level of KIF17 when activated by synaptic input. This study is to investigate the role and mechanism of CREB antisense oligonucleotide (ODN) in neuropathic pain induced by chronic constriction injury (CCI) in mice. Results: CCI surgery decreased thresholds of mechanical allodynia and thermal hyperalgesia whereas CREB antisense oligonucleotide ODN significantly attenuated these pain behaviors (P < 0.05). CCI significantly induced the protein expression of phosphorylated CREB (pCREB) and KIF17, but not KIF5B, in the spinal cord of CCI mice (P < 0.05). Additionally, the mRNA expression of CREB and KIF17 was significantly increased by CCI (P < 0.05). However, CREB antisense ODN significantly decreased the protein expression of pCREB and KIF17 (but not KIF5B), and the mRNA expression of CREB and KIF17 (P < 0.05). Conclusions: CREB antisense oligonucleotide ODN may reduce neuropathic pain through targeting CREB and decreasing the expression of pCREB and KIF17. PMID:25664020

  16. Exchange Protein Activated by Cyclic AMP (Epac)-Mediated Induction of Suppressor of Cytokine Signaling 3 (SOCS-3) in Vascular Endothelial Cells

    PubMed Central

    Sands, William A.; Woolson, Hayley D.; Milne, Gillian R.; Rutherford, Claire; Palmer, Timothy M.

    2006-01-01

    Here, we demonstrate that elevation of intracellular cyclic AMP (cAMP) in vascular endothelial cells (ECs) by either a direct activator of adenylyl cyclase or endogenous cAMP-mobilizing G protein-coupled receptors inhibited the tyrosine phosphorylation of STAT proteins by an interleukin 6 (IL-6) receptor trans-signaling complex (soluble IL-6R?/IL-6). This was associated with the induction of suppressor of cytokine signaling 3 (SOCS-3), a bona fide inhibitor in vivo of gp130, the signal-transducing component of the IL-6 receptor complex. Attenuation of SOCS-3 induction in either ECs or SOCS-3-null murine embryonic fibroblasts abolished the inhibitory effect of cAMP, whereas inhibition of SHP-2, another negative regulator of gp130, was without effect. Interestingly, the inhibition of STAT phosphorylation and SOCS-3 induction did not require cAMP-dependent protein kinase activity but could be recapitulated upon selective activation of the alternative cAMP sensor Epac, a guanine nucleotide exchange factor for Rap1. Consistent with this hypothesis, small interfering RNA-mediated knockdown of Epac1 was sufficient to attenuate both cAMP-mediated SOCS-3 induction and inhibition of STAT phosphorylation, suggesting that Epac activation is both necessary and sufficient to observe these effects. Together, these data argue for the existence of a novel cAMP/Epac/Rap1/SOCS-3 pathway for limiting IL-6 receptor signaling in ECs and illuminate a new mechanism by which cAMP may mediate its potent anti-inflammatory effects. PMID:16914720

  17. Luteinizing hormone-releasing hormone (LHRH) attenuates morphine-induced inhibition of cyclic AMP (cAMP) in opioid-responsive SK-N-SH cells

    Microsoft Academic Search

    A Ratka; J. W Simpkins

    1997-01-01

    SK-N-SH cells were used to assess the effects of luteinizing hormone-releasing hormone (LHRH) on opioid receptor-mediated changes in cyclic AMP (cAMP). Prostaglandin E1 (PGE1, 1 ?M) caused a dramatic increase in cAMP levels. Treatment with 10 ?M morphine (MOR) significantly inhibited the stimulatory effect of PGE1. LHRH (0.8 ?M) caused an increase in the basal level of intracellular cAMP and

  18. Regulation of hormone-induced cyclic AMP response to parathyroid hormone and prostaglandin E 2 in cells cultured from human giant cell tumors of bone

    Microsoft Academic Search

    Steven R. Goldring; Jean-Michel Dayer; Stephen M. Krane

    1979-01-01

    Summary  Cells dispersed from human giant cell tumors of bone and grown in monolayer culture increase intracellular cyclic AMP (cAMP)\\u000a when incubated with parathyroid hormone (PTH) or prostaglandin E2 (PGE2). When cells are continuously exposed to PTH, cAMP levels increase acutely but then decrease rapidly to pretreatment values\\u000a despite continued presence of hormone or addition of new hormone. Preincubation of cells

  19. 4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models

    PubMed Central

    Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3?, 5?-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3?, 5?-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  20. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    2003-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate CAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of CAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of CAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of CAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of CAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of CAMP by either epinephrine or isoproterenol.

  1. Activation of Cyclic AMP Synthesis by Full and Partial Beta-Adrenergic Receptor Agonists in Chicken Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Cureri, Peter A. (Technical Monitor)

    2002-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Accordingly, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax concentrations were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. When cimaterol and clenbuterol were added to culture media at concentrations known to cause significant muscle hypertrophy in animals, there was no detectable effect on stimulation of cAMP synthesis. Finally, these same levels of cimaterol and clenbuterol did not antagonize the stimulation of cAMP by either epinephrine or isoproterenol.

  2. Mitotic activation of the DISC1-inducible cyclic AMP phosphodiesterase-4D9 (PDE4D9), through multi-site phosphorylation, influences cell cycle progression.

    PubMed

    Sheppard, Catherine L; Lee, Louisa C Y; Hill, Elaine V; Henderson, David J P; Anthony, Diana F; Houslay, Daniel M; Yalla, Krishna C; Cairns, Lynne S; Dunlop, Allan J; Baillie, George S; Huston, Elaine; Houslay, Miles D

    2014-09-01

    In Rat-1 cells, the dramatic decrease in the levels of both intracellular cyclic 3'5' adenosine monophosphate (cyclic AMP; cAMP) and in the activity of cAMP-activated protein kinase A (PKA) observed in mitosis was paralleled by a profound increase in cAMP hydrolyzing phosphodiesterase-4 (PDE4) activity. The decrease in PKA activity, which occurs during mitosis, was attributable to PDE4 activation as the PDE4 selective inhibitor, rolipram, but not the phosphodiesterase-3 (PDE3) inhibitor, cilostamide, specifically ablated this cell cycle-dependent effect. PDE4 inhibition caused Rat-1 cells to move from S phase into G2/M more rapidly, to transit through G2/M more quickly and to remain in G1 for a longer period. Inhibition of PDE3 elicited no observable effects on cell cycle dynamics. Selective immunopurification of each of the four PDE4 sub-families identified PDE4D as being selectively activated in mitosis. Subsequent analysis uncovered PDE4D9, an isoform whose expression can be regulated by Disrupted-In-Schizophrenia 1 (DISC1)/activating transcription factor 4 (ATF4) complex, as the sole PDE4 species activated during mitosis in Rat-1 cells. PDE4D9 becomes activated in mitosis through dual phosphorylation at Ser585 and Ser245, involving the combined action of ERK and an unidentified 'switch' kinase that has previously been shown to be activated by H2O2. Additionally, in mitosis, PDE4D9 also becomes phosphorylated at Ser67 and Ser81, through the action of MK2 (MAPKAPK2) and AMP kinase (AMPK), respectively. The multisite phosphorylation of PDE4D9 by all four of these protein kinases leads to decreased mobility (band-shift) of PDE4D9 on SDS-PAGE. PDE4D9 is predominantly concentrated in the perinuclear region of Rat-1 cells but with a fraction distributed asymmetrically at the cell margins. Our investigations demonstrate that the diminished levels of cAMP and PKA activity that characterise mitosis are due to enhanced cAMP degradation by PDE4D9. PDE4D9, was found to locate primarily not only in the perinuclear region of Rat-1 cells but also at the cell margins. We propose that the sequestration of PDE4D9 in a specific complex together with AMPK, ERK, MK2 and the H2O2-activatable 'switch' kinase allows for its selective multi-site phosphorylation, activation and regulation in mitosis. PMID:24815749

  3. The Midbrain Periaqueductal Gray and Fear Extinction: Opioid Receptor Subtype and Roles of Cyclic AMP, Protein Kinase A, and Mitogen-Activated Protein Kinase

    Microsoft Academic Search

    Gavan P. McNally; Boo-Wahl Lee; Janet Y. Chiem; Eun A. Choi

    2005-01-01

    Four experiments studied the opioid receptor subtype and signal transduction mechanisms mediating fear extinction in the ventrolateral quadrant of the midbrain periaqueductal gray (vlPAG). Microinjection of a ?- but not a ?- or ?-opioid receptor antagonist into the vlPAG retarded extinction. Extinction was also dose-dependently retarded by vlPAG infusions of a cyclic AMP (cAMP) analog but was unaffected by infusions

  4. Pro-inflammatory cytokine regulation of cyclic AMP-phosphodiesterase 4 signaling in microglia in vitro and following CNS injury

    PubMed Central

    Ghosh, Mousumi; Garcia-Castillo, Daniela; Aguirre, Vladimir; Golshani, Roozbeh; Atkins, Coleen M.; Bramlett, Helen M.; Dietrich, W. Dalton; Pearse, Damien D.

    2015-01-01

    Cyclic AMP suppresses immune cell activation and inflammation. The positive feedback loop of pro-inflammatory cytokine production and immune activation implies that cytokines may not only be regulated by cyclic AMP but conversely regulate cyclic AMP. This study examined the effects of TNF-? and IL-1? on cyclic AMP-phosphodiesterase (PDE) signaling in microglia in vitro and after spinal cord or traumatic brain injury (SCI, TBI). TNF-? or IL-1? stimulation produced a profound reduction (>90%) of cyclic AMP within EOC2 microglia from 30min that then recovered after IL-1? but remained suppressed with TNF-? through 24h. Cyclic AMP was also reduced in TNF-?-stimulated primary microglia, albeit to a lesser extent. Accompanying TNF-?-induced cyclic AMP reductions, but not IL-1?, was increased cyclic AMP-PDE activity. The role of PDE4 activity in cyclic AMP reductions was confirmed by using Rolipram. Examination of pde4 mRNA revealed an immediate, persistent increase in pde4b with TNF-?; IL-1? increased all pde4 mRNAs. Immunoblotting for PDE4 showed that both cytokines increased PDE4A1, but only TNF-? increased PDE4B2. Immunocytochemistry revealed PDE4B nuclear translocation with TNF-? but not IL-1?. Acutely after SCI/TBI, where cyclic AMP levels are reduced, PDE4B was localized to activated OX-42+ microglia; PDE4B was absent in OX-42+ cells in uninjured spinal cord/cortex or inactive microglia. Immunoblotting showed PDE4B2 up-regulation from 24h to 1wk post-SCI, the peak of microglia activation. These studies show that TNF-? and IL-1? differentially affect cyclic AMP-PDE signaling in microglia. Targeting PDE4B2 may be a putative therapeutic direction for reducing microglia activation in CNS injury and neurodegenerative diseases. PMID:22865690

  5. ? 2 Adrenergic activation increases glycogen synthesis in L6 skeletal muscle cells through a signalling pathway independent of cyclic AMP

    Microsoft Academic Search

    D. L. Yamamoto; D. S. Hutchinson; T. Bengtsson

    2007-01-01

    Aims\\/hypothesis  In skeletal muscle, the storage of glycogen by insulin is regulated by glycogen synthase, which is regulated by glycogen synthase\\u000a kinase 3 (GSK3). Here we examined whether adrenergic receptor activation, which can increase glucose uptake, regulates glycogen\\u000a synthesis in L6 skeletal muscle cells.\\u000a \\u000a \\u000a \\u000a Methods  We used L6 cells and measured glycogen synthesis (as incorporation of d-[U-14C]glucose into glycogen) and GSK3 phosphorylation

  6. Cyclic AMP Levels, Adenylyl Cyclase Activity, and Their Stimulation by Serotonin Quantif?ied in Intact Neurons

    PubMed Central

    Sudlow, Leland C.; Gillette, Rhanor

    1997-01-01

    In molluscan central neurons that express cAMP-gated Na+ current (INa,cAMP), estimates of the cAMP binding affinity of the channels have suggested that effective native intracellular cAMP concentrations should be much higher than characteristic of most cells. Using neurons of the marine opisthobranch snail Pleurobranchaea californica, we applied theory and conventional voltage clamp techniques to use INa,cAMP to report basal levels of endogenous cAMP and adenylyl cyclase, and their stimulation by serotonin. Measurements were calibrated to iontophoretic cAMP injection currents to enable expression of the data in molar terms. In 30 neurons, serotonin stimulated on average a 23-fold increase in submembrane [cAMP], effected largely by an 18-fold increase in adenylyl cyclase activity. Serotonin stimulation of adenylyl cyclase and [cAMP] was inversely proportional to cells' resting adenylyl cyclase activity. Average cAMP concentration at the membrane rose from 3.6 to 27.6 ?M, levels consistent with the expected cAMP dissociation constants of the INa,cAMP channels. These measures confirm the functional character of INa,cAMP in the context of high levels of native cAMP. Methods similar to those employed here might be used to establish critical characters of cyclic nucleotide metabolism in the many cells of invertebrates and vertebrates that are being found to express ion currents gated by direct binding of cyclic nucleotides. PMID:9276752

  7. Cyclic AMP Analog Blocks Kinase Activation by Stabilizing Inactive Conformation: Conformational Selection Highlights a New Concept in Allosteric Inhibitor Design*

    PubMed Central

    Badireddy, Suguna; Yunfeng, Gao; Ritchie, Mark; Akamine, Pearl; Wu, Jian; Kim, Choel W.; Taylor, Susan S.; Qingsong, Lin; Swaminathan, Kunchithapadam; Anand, Ganesh S.

    2011-01-01

    The regulatory (R) subunit of protein kinase A serves to modulate the activity of protein kinase A in a cAMP-dependent manner and exists in two distinct and structurally dissimilar, end point cAMP-bound “B” and C-subunit-bound “H”-conformations. Here we report mechanistic details of cAMP action as yet unknown through a unique approach combining x-ray crystallography with structural proteomics approaches, amide hydrogen/deuterium exchange and ion mobility mass spectrometry, applied to the study of a stereospecific cAMP phosphorothioate analog and antagonist((Rp)-cAMPS). X-ray crystallography shows cAMP-bound R-subunit in the B form but surprisingly the antagonist Rp-cAMPS-bound R-subunit crystallized in the H conformation, which was previously assumed to be induced only by C-subunit-binding. Apo R-subunit crystallized in the B form as well but amide exchange mass spectrometry showed large differences between apo, agonist and antagonist-bound states of the R-subunit. Further ion mobility reveals the apo R-subunit as an ensemble of multiple conformations with collisional cross-sectional areas spanning both the agonist and antagonist-bound states. Thus contrary to earlier studies that explained the basis for cAMP action through “induced fit” alone, we report evidence for conformational selection, where the ligand-free apo form of the R-subunit exists as an ensemble of both B and H conformations. Although cAMP preferentially binds the B conformation, Rp-cAMPS interestingly binds the H conformation. This reveals the unique importance of the equatorial oxygen of the cyclic phosphate in mediating conformational transitions from H to B forms highlighting a novel approach for rational structure-based drug design. Ideal inhibitors such as Rp-cAMPS are those that preferentially “select” inactive conformations of target proteins by satisfying all “binding” constraints alone without inducing conformational changes necessary for activation. PMID:21081668

  8. Elevation of cyclic AMP decreases phosphoinositide turnover and inhibits thrombin-induced secretion in human platelets

    Microsoft Academic Search

    Anita Ryningen; Baard Olav Jensen; Holm Holmsen

    1998-01-01

    Elevation of cyclic AMP (cAMP) in platelets inhibits agonist-induced, G protein-mediated responses and activation of polyphosphoinositide-specific phospholipase C (PLC) by ill-defined mechanism(s). Signal transduction steps downstream of PLC are inhibited by elevated cAMP, suggesting an inhibitory effect of cAMP, via protein kinase A, on PLC. In [32P]i-prelabeled platelets, forskolin increased intracellular cAMP (104 nmol\\/1011 cells at 10?5 M forskolin) and

  9. AIB1 = amplified in breast cancer; AF-1 = activation function-1; AF-2 = activation function-2; cAMP = cyclic AMP; CBP = CREB-binding protein; DES = diethylstilbestrol; E2 = 17-estradiol; ER = estrogen receptor; ERE = estrogen response element; EGF = epide

    E-print Network

    Brown, Myles

    39 AIB1 = amplified in breast cancer; AF-1 = activation function-1; AF-2 = activation function-2; c; PKA = protein kinase A; SERM = selective estrogen receptor modulator. Available online http://breast-cancer, they have also been associated pathologically with an increased risk for breast and endometrial cancer [2

  10. Effects of glucagon and insulin on the cyclic AMP binding capacity of hepatocyte cyclic AMP-dependent protein kinase

    Microsoft Academic Search

    Carlos J. Ciudad; Jordi Vila; M. Angels Mor; Joan J. Guinovart

    1987-01-01

    Extracts obtained from rat hepatocytes incubated with saline, glucagon or insulin were electrophoresed on polyacrylamide gels and then assayed for cyclic (3H)AMP binding capacity. Analysis of the binding patterns demonstrated that glucagon dissociated a holoenzyme of cyclic AMP-dependent protein kinase in a dose-dependent manner. The increase in free regulatory subunits and, hence, in free catalytic subunits explains the activation of

  11. 17?-estradiol induced Ca 2+ influx via L-type calcium channels activates the Src\\/ERK\\/cyclicAMP response element binding protein signal pathway and BCL2 expression in rat hippocampal neurons: A potential initiation mechanism for estrogen-induced neuroprotection

    Microsoft Academic Search

    T.-W. Wu; J. M. Wang; S. Chen; R. D. Brinton

    2005-01-01

    Our group and others have demonstrated that 17?-estradiol (E2) induces neurotrophic and neuroprotective responses in hippocampal and cortical neurons which are dependent upon the Src\\/extracellular signal-regulated kinase (ERK) signaling pathways. The purpose of this study was to determine the upstream mechanism(s) that initiates the signaling cascade leading to E2-inducible neuroprotection. We tested the hypothesis that E2 activates rapid Ca2+ influx

  12. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure...the diagnosis and treatment of endocrine disorders, including...

  13. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure...the diagnosis and treatment of endocrine disorders, including...

  14. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure...the diagnosis and treatment of endocrine disorders, including...

  15. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure...the diagnosis and treatment of endocrine disorders, including...

  16. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a) Identification. A cyclic AMP test system is a device intended to measure...the diagnosis and treatment of endocrine disorders, including...

  17. Agents which increase cyclic AMP have diverse effects on low-density-lipoprotein-receptor function in human vascular smooth-muscle cells and skin fibroblasts.

    PubMed Central

    Middleton, A; Middleton, B

    1990-01-01

    Receptor-mediated binding and metabolism of low-density lipoproteins (LDL) in cultured human vascular smooth-muscle cells and skin fibroblasts are altered by increased cellular cyclic AMP concentrations. However, the LDL receptor does not respond to changes in cyclic AMP concentration in a simple manner. The activation of adenylate cyclase with forskolin, or the addition of membrane-permeant cyclic AMP analogues, initially decreases the expression of the LDL receptor, but is followed by a substantial increase in receptor expression after 24 h. This increase does not occur in the presence of inhibitors of RNA or protein synthesis, and is due to doubling of the Bmax. of the LDL receptor, without alteration of its affinity for LDL. By contrast, elevation of cyclic AMP concentration by inhibition of phosphodiesterases results in decreased receptor expression throughout the 24 h period. These two response patterns are reproducible phenomena, consistently observed in low-passaged cells derived from seven unrelated individuals. Images Fig. 3. Fig. 9. PMID:1692702

  18. Genetic characterization of transactivation of the human T-cell leukemia virus type 1 promoter: Binding of Tax to Tax-responsive element 1 is mediated by the cyclic AMP-responsive members of the CREB/ATF family of transcription factors.

    PubMed Central

    Bantignies, F; Rousset, R; Desbois, C; Jalinot, P

    1996-01-01

    To achieve a better understanding of the mechanism of transactivation by Tax of human T-cell leukemia virus type 1 Tax-responsive element 1 (TRE-1), we developed a genetic approach with Saccharomyces cerevisiae. We constructed a yeast reporter strain containing the lacZ gene under the control of the CYC1 promoter associated with three copies of TRE-1. Expression of either the cyclic AMP response element-binding protein (CREB) or CREB fused to the GAL4 activation domain (GAD) in this strain did not modify the expression of the reporter gene. Tax alone was also inactive. However, expression of the reporter gene was induced by coexpression of Tax and CREB. This effect was stronger with the GAD-CREB fusion protein. Analysis of different CREB mutants with this genetic system indicated that the C-terminal 92 amino acid residues, which include the basic domain and the leucine zipper, are necessary and sufficient to mediate transactivation by Tax. To identify cellular proteins binding to TRE-1 in a Tax-dependent manner, this strain was also used to screen a library of human cDNAs fused to GAD. Of five positive clones isolated from 0.75 x 10(6) yeast colonies, four were members of the CREB/activating transcription factor (ATF) family: CREB, two isoforms of the cyclic AMP-responsive element modulator (CREM), and ATF-1. Interestingly, these three proteins can be phosphorylated by protein kinase A and thus form a particular subgroup within the CREB/ATF family. Expression of ATF-2 in S. cerevisiae did not activate TRE-1 in the presence of Tax. This shows that in a eukaryotic nucleus, Tax specifically interacts with the basic domain-leucine zipper region of ATF-1, CREB, and CREM. The fifth clone identified in this screening corresponded to the Ku autoantigen p70 subunit. When fused to GAD, the C-terminal region of Ku was able to activate transcription via TRE-1 but this activation was not dependent on Tax. PMID:8628284

  19. Long-term regulation of synaptic acetylcholine release and nicotinic transmission: the role of cyclic AMP.

    PubMed Central

    Briggs, C. A.; McAfee, D. A.; McCaman, R. E.

    1988-01-01

    1. Using the rat superior cervical ganglion in vitro, the relative efficacy of nicotinic synaptic transmission was estimated by recording the postganglionic compound action potential and the amount of endogenous acetylcholine (ACh) released. These two parameters were correlated in individual ganglia by sampling the bathing medium for the assay of ACh while simultaneously recording the postganglionic response. 2. The beta-adrenoceptor agonist isoprenaline potentiated both the evoked release of ACh and the postganglionic response by about 20% during preganglionic stimulation at 0.2 Hz. 3. The adenosine receptor agonist 2-chloroadenosine inhibited ACh release and the postganglionic response by about 35%. 4. Tetanic preganglionic stimulation for a few seconds induced a long-term potentiation of nicotinic responses and of ACh release. Both of these potentiations were dependent upon extracellular Ca2+ during the tetani. 5. Forskolin and analogues of cyclic AMP also caused a long-lasting potentiation of both the evoked release of ACh and the postganglionic response, indicating that cyclic AMP may regulate transmission by a presynaptic mechanism. The specificity of the cyclic AMP analogues was tested using various butyryl- and bromo-purine nucleotides. 6. The effects of forskolin and 8-bromo-cyclic AMP did not appear to be dependent upon extracellular Ca2+. 7. The potentiation caused by forskolin was consistently augmented by three phosphodiesterase inhibitors--AH 21-132, papaverine and SQ 20-006. However, the effect of forskolin was not consistently enhanced by theophylline, nor was it reduced by the adenylate cyclase inhibitor SQ 22-536. 8. The neurogenic long-term potentiation was augmented by two of the phosphodiesterase inhibitors that also augmented the forskolin-induced potentiation--papaverine and SQ 20-006. 9. It was concluded that cyclic AMP can enhance nicotinic transmission, and can do so by increasing the evoked release of ACh. However, it was not possible to prove that cyclic AMP mediates the long-term potentiation induced by tetanic preganglionic stimulation. PMID:2833971

  20. Chloride permeability regulation via a cyclic AMP pathway in cultured human sweat duct cells.

    PubMed Central

    Pedersen, P S

    1990-01-01

    1. Isolated coiled reabsorptive sweat ducts from normal subjects and patients with cystic fibrosis (CF) were cultured in vitro. Cells were harvested and plated onto permeable supports to form confluent cell sheets. The Ussing chamber technique was used to study pharmacological regulation of the transepithelial ion transport in these membranes. 2. Addition of a stable cyclic AMP analogue, 8-Br-cyclic AMP, to normal cell cultures resulted in a decrease of the transepithelial potential difference (PD). 3. Forskolin exposure resulted in a similar PD decrease, which was augmented by the phosphodiesterase inhibitor, isobutylmethylxanthine (IBMX). 4. Exposure to isoprenaline, prostaglandin E2 (PGE2), and phenylephrine resulted in a response mimicking the forskolin-induced response, that was also amplified by IBMX. 5. Pre-incubation with cholera toxin abolished the isoprenaline response and reduced the control resistance. 6. Propranolol abolished the responses induced by isoprenaline and phenylephrine, whereas phentolamine had no effect. PGE2-induced responses were inert to both types of blockers. 7. Indomethazine addition to an unstimulated membrane resulted in a weak PD increase, i.e. a response opposite to that induced by isoprenaline. 8. IBMX addition to an unstimulated membrane resulted in a weak isoprenaline-like response. When the cells were pre-treated with indomethazine this IBMX response was absent. 9. Unidirectional Cl- isotope flux studies demonstrated a large increase of net Cl- reabsorption in response to isoprenaline and PGE2. 10. Mannitol isotope flux studies revealed that the paracellular permeability was unaffected by isoprenaline exposure. 11. Membranes derived from CF patients did not respond similarly to any of these agents. However, a weak spike, occasionally followed by a gradual increase of the short-circuit current (Iscc), was observed in both normal subjects and CF patients. 12. It is concluded that the primary effect on ion transport of factors increasing the cyclic AMP in normal cultured sweat duct cells is an activation of a transcellular Cl- permeability. This effect was missing in cells derived from CF patients. PMID:1693399

  1. Cyclic AMP response element-binding protein positively regulates production of IFN-gamma by T cells in response to a microbial pathogen.

    PubMed

    Samten, Buka; Howard, Susan T; Weis, Steven E; Wu, Shiping; Shams, Homayoun; Townsend, James C; Safi, Hassan; Barnes, Peter F

    2005-05-15

    IFN-gamma is essential for resistance to many intracellular pathogens, including Mycobacterium tuberculosis. Transcription of the IFN-gamma gene in activated T cells is controlled by the proximal promoter element (-73 to -48 bp). CREB binds to the IFN-gamma proximal promoter, and binding is enhanced by phosphorylation of CREB. Studies in human T cell lines and in transgenic mice have yielded conflicting results about whether CREB is a positive or a negative regulator of IFN-gamma transcription. To determine the role of CREB in mediating IFN-gamma production in response to a microbial pathogen, we evaluated the peripheral blood T cell response to M. tuberculosis in healthy tuberculin reactors. EMSAs, chromatin immunoprecipitation, and Western blotting demonstrated that stimulation of PBMC with M. tuberculosis induced phosphorylation and enhanced binding of CREB to the IFN-gamma proximal promoter. Neutralization of CREB with intracellular Abs or down-regulation of CREB levels with small interfering RNA decreased M. tuberculosis-induced production of IFN-gamma and IFN-gamma mRNA expression. In addition, M. tuberculosis-stimulated T cells from tuberculosis patients, who have ineffective immunity, showed diminished IFN-gamma production, reduced amounts of CREB binding to the IFN-gamma proximal promoter, and absence of phosphorylated CREB. These findings demonstrate that CREB positively regulates IFN-gamma production by human T cells that respond to M. tuberculosis. PMID:15879136

  2. Cyclic AMP mediates inhibition of the Na(+)-K+ electrogenic pump by serotonin in tactile sensory neurones of the leech.

    PubMed Central

    Catarsi, S; Scuri, R; Brunelli, M

    1993-01-01

    1. Serotonin (5-HT) reduced the after-hyperpolarization (AHP) amplitude in tactile sensory neurones (T) but not in pressor (P) or nociceptive (N) cells of the leech. 2. Adenylate cyclase activators, phosphodiesterase inhibitors and membrane permeant analogues of cyclic adenosine monophosphate (cyclic AMP) mimicked the effect of 5-HT in reducing the AHP amplitude in T neurones. 3. Ionophoretic injection of cyclic AMP in T cells reduced the AHP amplitude, while cyclic guanosine monophosphate (cyclic GMP) or adenosine-5'-monophosphate (AMP) were without effect. 4. Inhibition of adenylate cyclase by the drug RMI 12330A (also known as MDL 12330A) suggested that 5-HT reduced the AHP amplitude through cyclic AMP. 5. 8-Bromoadenosine-3'-5'-cyclic monophosphate (8-Br-cyclic AMP) was still able to reduce the AHP amplitude after blocking the Ca(2+)-activated K+ conductance with CdCl2 and converted the normal hyperpolarization which follows the intracellular injection of Na+ into a depolarization. In addition, the cyclic AMP analogue slowed down and reduced the repolarization usually induced by CsCl after perfusion with K(+)-free solution. It is proposed that, in T sensory neurones, cyclic AMP mediates the inhibition of the Na(+)-K+ electrogenic pump induced by 5-HT application. PMID:7687293

  3. Effects of cyclic AMP response element binding protein–Zhangfei (CREBZF) on the unfolded protein response and cell growth are exerted through the tumor suppressor p53

    PubMed Central

    Zhang, Rui; Misra, Vikram

    2014-01-01

    Zhangfei/CREBZF, a basic region-leucine zipper (bLZip) transcription factor, is a potent suppressor of growth and the unfolded protein response (UPR) in some cancer cell lines, including the canine osteosarcoma cell line, D-17. However, the effects of Zhangfei are not universal, and it has no obvious effects on untransformed cells and some cancer cell lines, suggesting that Zhangfei may act through an intermediary that is either not induced or is defective in cells that it does not affect. Here we identify the tumor suppressor protein p53 as this intermediary. We show the following: in cells ectopically expressing Zhangfei, the protein stabilizes p53 and co-localizes with it in cellular nuclei; the bLZip domain of Zhangfei is required for its profound effects on cell growth and interaction with p53. Suppression of p53 by siRNA at least partially inhibits the effects of Zhangfei on the UPR and cell growth. The effects of Zhangfei on D-17 cells is mirrored by its effects on the p53-expressing human osteosarcoma cell line U2OS, while Zhangfei has no effect on the p53-null osteosarcoma cell line MG63. In U2OS cells, Zhangfei displaces the E3 ubiquitin ligase mouse double minute homolog 2 (Mdm2) from its association with p53, suggesting a mechanism for the effects of Zhangfei on p53. PMID:24200963

  4. Cardiac muscle ultrastructure and cyclic AMP reactions to altered gravity conditions

    SciTech Connect

    Mednieks, M.I.; Fine, A.S.; Oyama, J.; Philpott, D.E.

    1987-02-01

    Morphological and biochemical analyses of heart muscle of rats subjected to microgravity on Spacelab 3(SL-3) flight and rats born and reared under increased gravity (1.7 G) conditions were compared with 1-G controls. Electronmicroscopic studies showed an increase in the number of lipid droplets and in areas of glycogen storage. Distribution changes of microtubules and cytoskeletal elements from both SL-3 and 1.7-G groups were observed. The high K/sub m/(2,8-/sup 3/H) cyclic AMP phosphodiesterase activity was lower in SL-3 heart muscle, and low K/sub m/ activity was lower in 1.7-G males but was unaltered in females. Cyclic AMP-dependent protein kinase (cA-PK) activity was decreased in subcellular fractions of heart muscle of SL-3 animals. Recompartmentalization of cA-PK activity occurred in particulate tissue fraction of 1.7-g animals (70.3% of total for 1.7 G vs. 35.9% for controls). Phosphorylation of endogenous low-mobility proteins increased in SL-3 heart-soluble fractions. Photoaffinity labeling (18 h, 4/sup 0/C) decreased in type II cA-PK regulatory (R) subunits in both SL-3 and in 1.7-G male heart tissue particulate fractions. The 1.7-G female heart R subunit distribution did not differ from controls. These findings indicate that in heart muscle altered gravity conditions influenced physiological reactions similar to catecholamine-induced receptor-mediated hormonal responses.

  5. Cyclic-AMP and bacterial cyclic-AMP receptor proteins revisited: adaptation for different ecological niches?

    PubMed Central

    Green, Jeffrey; Stapleton, Melanie R; Smith, Laura J; Artymiuk, Peter J; Kahramanoglou, Christina; Hunt, Debbie M; Buxton, Roger S

    2014-01-01

    Escherichia coli cyclic-AMP receptor protein (CRP) represents one of the paradigms of bacterial gene regulation. Yet despite decades of intensive study, new information continues to emerge that prompts reassessment of this classic regulatory system. Moreover, in recent years CRPs from several other bacterial species have been characterized, allowing the general applicability of the CRP paradigm to be tested. Here the properties of the E. coli, Mycobacterium tuberculosis and Pseudomonas putida CRPs are considered in the context of the ecological niches occupied by these bacteria. It appears that the cyclic-AMP-CRP regulatory system has been adapted to respond to distinct external and internal inputs across a broad sensitivity range that is, at least in part, determined by bacterial lifestyles. PMID:24509484

  6. Cyclic-AMP and bacterial cyclic-AMP receptor proteins revisited: adaptation for different ecological niches.

    PubMed

    Green, Jeffrey; Stapleton, Melanie R; Smith, Laura J; Artymiuk, Peter J; Kahramanoglou, Christina; Hunt, Debbie M; Buxton, Roger S

    2014-04-01

    Escherichia coli cyclic-AMP receptor protein (CRP) represents one of the paradigms of bacterial gene regulation. Yet despite decades of intensive study, new information continues to emerge that prompts reassessment of this classic regulatory system. Moreover, in recent years CRPs from several other bacterial species have been characterized, allowing the general applicability of the CRP paradigm to be tested. Here the properties of the E. coli, Mycobacterium tuberculosis and Pseudomonas putida CRPs are considered in the context of the ecological niches occupied by these bacteria. It appears that the cyclic-AMP-CRP regulatory system has been adapted to respond to distinct external and internal inputs across a broad sensitivity range that is, at least in part, determined by bacterial lifestyles. PMID:24509484

  7. Thyroid-stimulating hormone and cyclic AMP activate p38 mitogen-activated protein kinase cascade. Involvement of protein kinase A, rac1, and reactive oxygen species.

    PubMed

    Pomerance, M; Abdullah, H B; Kamerji, S; Correze, C; Blondeau, J P

    2000-12-22

    p38 mitogen-activated protein kinases (p38-MAPKs) are activated by cytokines, cellular stresses, growth factors, and hormones. We show here that p38-MAPKs are activated upon stimulation by thyroid-stimulating hormone (TSH) or cAMP. TSH caused the phosphorylation of p38-MAPK in Chinese hamster ovary cells stably transfected with the human TSH receptor but not in wild-type Chinese hamster ovary cells. The effect of TSH was fully mimicked by the adenylyl cyclase activator, forskolin, and by a permeant analog of cAMP. The effect of forskolin was reproduced in FRTL5 rat thyroid cells. TSH also stimulated the phosphorylation of MAPK kinase 3 or 6, over the same time scale as that of p38-MAPKs. TSH and forskolin stimulated the activity of the alpha-isoform of p38-MAPK assayed by phosphorylation of the transcription factor ATF2. The activity of MAPK-activated protein kinase-2 was stimulated by TSH and forskolin. This stimulation was abolished by SB203580, a specific inhibitor of p38-MAPKs. The protein kinase A inhibitor H89 inhibited the stimulation of phosphorylation of p38-MAPKs by forskolin, whereas inhibitors of protein kinase C, p70(S6k), and phosphatidylinositol 3-kinase were ineffective. Expression of the dominant negative form of Rac1, but not that of Ras, blocked forskolin-induced p38-MAPK activation. Diphenylene iodonium, a potent inhibitor of NADPH oxidase(s), and ascorbic acid, an effective free radical scavenger, suppressed TSH- or forskolin-stimulated p38-MAPK phosphorylation, indicating that the generation of reactive oxygen species plays a key role in signaling from cAMP to p38-MAPKs. Inhibition of the p38-MAPK pathway with SB203580 partially but significantly, attenuates cAMP- and TSH-induced expression of the sodium iodide symporter in FRTL-5 cells. These results point to a new signaling pathway for the G(s)-coupled TSH receptor, involving cAMP, protein kinase A, Rac1, and reactive oxygen species and resulting in the activation of a signaling kinase cascade that includes MAPK kinase 3 or 6, p38-MAPK, and MAPK-activated protein kinase-2. PMID:11006268

  8. Potent antiplatelet activity of sesamol in an in vitro and in vivo model: pivotal roles of cyclic AMP and p38 mitogen-activated protein kinase.

    PubMed

    Chang, Chao C; Lu, Wan J; Chiang, Cheng W; Jayakumar, Thanasekaran; Ong, Eng T; Hsiao, George; Fong, Tsorng H; Chou, Duen S; Sheu, Joen R

    2010-12-01

    Sesamol is a potent phenolic antioxidant which possesses antimutagenic, antihepatotoxic and antiaging properties. Platelet activation is relevant to a variety of acute thrombotic events and coronary heart diseases. There have been few studies on the effect of sesamol on platelets. Therefore, the aim of this study was to systematically examine the detailed mechanisms of sesamol in preventing platelet activation in vitro and in vivo. Sesamol (2.5-5 ?M) exhibited more potent activity of inhibiting platelet aggregation stimulated by collagen than other agonists. Sesamol inhibited collagen-stimulated platelet activation accompanied by [Ca(2+)](i) mobilization, thromboxane A(2) (TxA(2)) formation, and phospholipase C (PLC)?2, protein kinase C (PKC) and mitogen-activated protein kinase (MAPK) phosphorylation in washed platelets. Sesamol markedly increased cAMP and cGMP levels, endothelial nitric oxide synthase (eNOS) expression and NO release, as well as vasodilator-stimulated phosphoprotein (VASP) phosphorylation. SQ22536, an inhibitor of adenylate cyclase, markedly reversed the sesamol-mediated inhibitory effects on platelet aggregation and p38 MAPK phosphorylation, and sesamol-mediated stimulatory effects on VASP and eNOS phosphorylation, and NO release. Sesamol also reduced hydroxyl radical (OH(?)) formation in platelets. In an in vivo study, sesamol (5 mg/kg) significantly prolonged platelet plug formation in mice. The most important findings of this study demonstrate for the first time that sesamol possesses potent antiplatelet activity, which may involve activation of the cAMP-eNOS/NO-cGMP pathway, resulting in inhibition of the PLC?2-PKC-p38 MAPK-TxA(2) cascade, and, finally, inhibition of platelet aggregation. Sesamol treatment may represent a novel approach to lowering the risk of or improving function in thromboembolism-related disorders. PMID:20015631

  9. A calcium\\/calmodulin kinase pathway connects brain-derived neurotrophic factor to the cyclic amp-responsive transcription factor in the rat hippocampus

    Microsoft Academic Search

    P. R Blanquet; J Mariani; P Derer

    2003-01-01

    Brain-derived neurotrophic factor (BDNF) plays fundamental roles in synaptic plasticity in rat hippocampus. Recently, using rat hippocampal slices, we found that BDNF induces activation of calcium\\/calmodulin-dependent protein kinase 2 (CaMKII), a critical mediator of synaptic plasticity. CaMKII in turn activates the p38 subfamily of mitogen-activated protein kinases (MAPK) and its downstream effector, MAPK-activated protein kinase 2 (MAPKAPK-2). Herein, we determined

  10. Minocycline upregulates cyclic AMP response element binding protein and brain-derived neurotrophic factor in the hippocampus of cerebral ischemia rats and improves behavioral deficits

    PubMed Central

    Zhao, Yu; Xiao, Ming; He, Wenbo; Cai, Zhiyou

    2015-01-01

    Background and purpose The cAMP response element binding protein (CREB) plays an important role in the mechanism of cognitive impairment and is also pivotal in the switch from short-term to long-term memory. Brain-derived neurotrophic factor (BDNF) seems a promising avenue in the treatment of cerebral ischemia injury since this neurotrophin could stimulate structural plasticity and repair cognitive impairment. Several findings have displayed that the dysregulation of the CREB–BDNF cascade has been involved in cognitive impairment. The aim of this study was to investigate the effect of cerebral ischemia on learning and memory as well as on the levels of CREB, phosphorylated CREB (pCREB), and BDNF, and to determine the effect of minocycline on CREB, pCREB, BDNF, and behavioral functional recovery after cerebral ischemia. Methods The animal model was established by permanent bilateral occlusion of both common carotid arteries. Behavior was evaluated 5 days before decapitation with Morris water maze and open-field task. Four days after permanent bilateral occlusion of both common carotid arteries, minocycline was administered by douche via the stomach for 4 weeks. CREB and pCREB were examined by Western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry. BDNF was measured by immunohistochemistry and Western blotting. Results The model rats after minocycline treatment swam shorter distances than control rats before finding the platform (P=0.0007). The number of times the platform position was crossed for sham-operation rats was more than that of the model groups in the corresponding platform location (P=0.0021). The number of times the platform position was crossed for minocycline treatment animals was significantly increased compared to the model groups in the corresponding platform position (P=0.0016). CREB, pCREB, and BDNF were downregulated after permanent bilateral occlusion of both common carotid arteries in the model group. Minocycline increased the expression of CREB, pCREB, and BDNF, and improved cognitive suffered from impairment of permanent bilateral occlusion of both common carotid arteries. Conclusion Minocycline improved cognitive impairment from cerebral ischemia via enhancing CREB, pCREB, and BDNF activity in the hippocampus.

  11. The morphological transformation and inhibition of growth of bovine luteal cells in tissue culture induced by luteinizing hormone and dibutyryl cyclic AMP.

    PubMed

    Gospodarowicz, D; Gospodarowicz, F

    1975-02-01

    The luteal cells obtained from bovine corpus luteum by enzymatic treatment have been maintained in tissue culture. When the cells were maintained in the absence of luteinizing hormone or dibutyryl cyclic AMP, they grew parallel to one another and were elongated, thus giving to the culture a fibroblastic appearance. No contact inhibition was observed and the progestin secretion rate was low (3 pg per cell per day). In contrast, when luteinizing hormone or dibutyryl cyclic AMP was present, the cells became polygonal, growing as a monolayer and taking the appearance of epithelial cells. In this case contact inhibition was observed. The rate of progestin secretion was 250 pg per cell per day. As soon as luteinizing hormone or dibutyryl cyclic AMP was removed from the media, the cells reverted to a fibroblastic appearance. Agents such as colcemid, vinblastin or cytochalasin B inhibited the morphological effect of luteinizing hormone or dibutyryl cyclic AMP. Since those agents are known to inhibit the assembly of microtubules, the data suggest that LH and dibutyryl cyclic AMP act by promoting the organization of microtubules from protein monomers. This microtubular system (cytoskeleton) is responsible for the morphological appearance of the cells. Concomitant with the morphological changes induced by luteinizing hormone and dibutyryl cyclic AMP an inhibition in the growth rate of luteal cells was observed. It suggests that by raising the intracellular level of cyclic AMP the luteinizing hormone inhibits the division of luteal cells and is not, for that reason, a mitogenic agent. A similar effect was obtained with other agents known to stimulate cyclic AMP production such asthe prostaglandins. Steroids such as glucocorticoids and testosterone but not progesterone also inhibited the growth rate. It is concluded that luteinizing hormone by controlling the level of cyclic AMP within the luteal cells is responsible for the expression of the phenotype of the cells and the maintenance of differentiation. PMID:163187

  12. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1997-01-01

    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast nuclear proteins. These results identify C/EBPdelta as a hormonally activated inducer of IGF-I gene transcription in osteoblasts and show that the HS3D element within IGF-I promoter 1 is a high affinity binding site for this protein.

  13. Mlc is a transcriptional activator with a key role in integrating cyclic AMP receptor protein and integration host factor regulation of leukotoxin RNA synthesis in Aggregatibacter actinomycetemcomitans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cAMP receptor protein (CRP) indirectly increases ltxA expression...

  14. Regulation of the laminin beta 1 (LAMB1), retinoic acid receptor beta, and bone morphogenetic protein 2 genes in mutant F9 teratocarcinoma cell lines partially deficient in cyclic AMP-dependent protein kinase activity.

    PubMed

    Shen, J; Li, C; Gudas, L J

    1997-12-01

    We stably transfected a gene encoding a dominant negative regulatory subunit of cyclic AMP (cAMP)-dependent protein kinase A (PKA) into F9 cells and generated cell lines partially deficient in PKA activity (DN16 and DN19). In these cell lines, the retinoic acid (RA) receptor beta and laminin beta(1) chain (LAMB1) genes were regulated normally by RA alone, indicating that in the absence of exogenous modulation of cAMP levels, the PKA signaling pathway does not seem to play a major role in the RA-associated regulation of these genes. However, alterations in gene regulation were observed when the mutant cell lines were treated with a combination of RA and cAMP analogues. Moreover, in the DN16 cell line, which exhibits the lowest PKA activity among the mutant cell lines [22% of wild type (WT) at 1 microM cAMP], there was a significant decrease in the cAMP-associated activation of the LAMB1 gene DNase I hypersensitivity site 2 enhancer, as measured by chloramphenicol acetyl transferase assays. Using electrophoretic mobility shift assays, less protein binding was observed at one of the motifs (C2) within this enhancer region in the DN16 cells as compared to the F9 WT cells after treatment of the cells with RA and cAMP analogues for 24 h. Furthermore, no increase in C2 binding was observed when extracts from RA-treated F9 ST or DN16 cells were subjected to in vitro phosphorylation, suggesting that PKA is involved in the induction of the C2-binding protein in RA-treated cells. In contrast to the results with RA receptor beta and LAMB1, the effects of cAMP analogues on the RA-associated regulation of the bone morphogenetic protein 2 gene were not altered in the cell lines that exhibited reduced PKA activity. These results suggest that a partial reduction in PKA activity is not sufficient to abrogate the effects of cAMP analogues on all of the genes regulated by RA. PMID:9419418

  15. Inhibition of carbonic anhydrase by parathyroid hormone and cyclic AMP in rat renal cortex in vitro.

    PubMed Central

    Beck, N; Kim, K S; Wolak, M; Davis, B B

    1975-01-01

    It has been demonstrated that parathyroid hormone (PTH) inhibits the proximal tubular reabsorption of bicarbonate, and increases the urinary excretion of that ion. There is also a qualitative similarity between the alterations of the proximal tubular reabsorption of phosphate, sodium, and water after PTH administration and after acetazolamide administration. These findings suggest that the renal effect of PTH is possibly mediated through the inhibition of carbonic anhydrase in proximal tubules. Therefore, a possible inhibitory effect of PTH on carbonic anhydrase was evaluated in the homogenate of rat renal cortex by an indicator titration method. Incubation of cortical homogenates with PTH for 10 min at 37degreesC inhibited carbonic anhydrase activity. The inhibitory effect of PTH was ATP-, Mg++-, and K+-dependent and temperature-dependent; inactivation of PTH by heating at 100degreesC abolished the effect of PTH both to activate adenylate cyclase and to inhibit carbonic anhydrase. Calcium 5 mM also partially abolished effects of PTH to activate adenylate cyclase and to inhibit carbonic anhydrase. The inhibitory effect of PTH on carbonic anhydrase was specific to renal cortex. Cyclic AMP, the intracellular messenger substance for PTH, also inhibited carbonic anhydrase in renal cortex. The cyclic AMP-induced inhibition was also Mg++ dependent and temperature dependent, and required preincubation at 37degreesC. But 5'-AMP, a metabolic derivative of cyclic AMP without its biological effect, had no inhibitory effect on carbonic anhydrase. All the above results are consistent with the hypothesis that PTH inhibits proximal tubular reabsorption of bicarbonate and phosphate through the inhibition of carbonic anhydrase, and that inhibitory effect is mediated through the cyclic AMP system. PMID:233968

  16. Cyclic AMP Signaling Pathway Modulates Susceptibility of Candida Species and Saccharomyces cerevisiae to Antifungal Azoles and Other Sterol Biosynthesis Inhibitors

    Microsoft Academic Search

    Pooja Jain; Indira Akula; Thomas Edlind

    2003-01-01

    Azoles are widely used antifungals; however, their efficacy is compromised by fungistatic activity and selection of resistant strains during treatment. Recent studies demonstrated roles for the protein kinase C and calcium signaling pathways in modulating azole activity. Here we explored a role for the signaling pathway mediated by cyclic AMP (cAMP), which is synthesized by the regulated action of adenylate

  17. Posttranscriptional Regulation of the Yersinia pestis Cyclic AMP Receptor Protein Crp and Impact on Virulence

    PubMed Central

    Lathem, Wyndham W.; Schroeder, Jay A.; Bellows, Lauren E.; Ritzert, Jeremy T.; Koo, Jovanka T.; Price, Paul A.; Caulfield, Adam J.; Goldman, William E.

    2014-01-01

    ABSTRACT The cyclic AMP receptor protein (Crp) is a transcriptional regulator that controls the expression of numerous bacterial genes, usually in response to environmental conditions and particularly by sensing the availability of carbon. In the plague pathogen Yersinia pestis, Crp regulates the expression of multiple virulence factors, including components of the type III secretion system and the plasminogen activator protease Pla. The regulation of Crp itself, however, is distinctly different from that found in the well-studied Escherichia coli system. Here, we show that at physiological temperatures, the synthesis of Crp in Y. pestis is positively regulated at the posttranscriptional level. The loss of the small RNA chaperone Hfq results in decreased Crp protein levels but not in steady-state Crp transcript levels, and this regulatory effect occurs within the 5? untranslated region (UTR) of the Crp mRNA. The posttranscriptional activation of Crp synthesis is required for the expression of pla, and decoupling crp from Hfq through the use of an exogenously controlled promoter and 5? UTR increases Pla protein levels as well as partially rescues the growth defect associated with the loss of Hfq. Finally, we show that both Hfq and the posttranscriptional regulation of Crp contribute to the virulence of Y. pestis during pneumonic plague. The Hfq-dependent, posttranscriptional regulation of Crp may be specific to Yersinia species, and thus our data help explain the dramatic growth and virulence defects associated with the loss of Hfq in Y. pestis. PMID:24520064

  18. CYCLIC AMP, CYCLIC GMP, AND GLUCOCORTICOIDS AS POTENTIAL METABOLIC REGULATORS OF EPIDERMAL PROLIFERATION AND DIFFERENTIATION

    Microsoft Academic Search

    John J. Voorhees; Cynthia L. Marcelo; Elizabeth A. Duell

    1975-01-01

    The two cyclic nucleotides, cyclic AMP and cyclic GMP, appear to be central to the metabolic regulation of cell proliferation and differentiation in various cells. Moreover, in many systems glucocorticoids appear to act in concert with or parallel to cyclic AMP. The available evidence suggests that these three molecular species – cyclic AMP, cyclic GMP, and glucocorticoids – may be

  19. Electrical Stimulation Decreases Coupling Efficiency Between Beta-Adrenergic Receptors and Cyclic AMP Production in Cultured Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    1999-01-01

    Electrical stimulation of skeletal muscle cells in culture is an effective way to simulate the effects of muscle contraction and its effects on gene expression in muscle cells. Expression of the beta-adrenergic receptor and its coupling to cyclic AMP synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this project was to determine if electrical stimulation altered the beta-adrenergic response in muscle cells. Chicken skeletal muscle cells that had been grown for seven days in culture were subjected to electrical stimulation for an additional two days at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. At the end of this two-day stimulation period, beta-adrenergic receptor population was measured by the binding of tritium-labeled CGP-12177 to muscle cells, and coupling to cAMP synthesis was measured by Radioimmunoassay (RIA) after treating the cells for 10 min with the potent (beta)AR agonist, isoproterenol. The number of beta adrenergic receptors and the basal levels of intracellular cyclic AMP were not affected by electrical stimulation. However, the ability of these cells to synthesize cyclic AMP was reduced by approximately 50%. Thus, an enhanced level of contraction reduces the coupling efficiency of beta-adrenergic receptors for cyclic AMP production.

  20. Mechanical control of cyclic AMP signalling and gene transcription through integrins

    NASA Technical Reports Server (NTRS)

    Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

    2000-01-01

    This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

  1. Cyclic AMP-Mediated Cyst Expansion

    PubMed Central

    Wallace, Darren P.

    2010-01-01

    In polycystic kidney disease (PKD), intracellular cAMP promotes cyst enlargement by stimulating mural epithelial cell proliferation and transepithelial fluid secretion. The proliferative effect of cAMP in PKD is unique in that cAMP is anti-mitogenic in normal renal epithelial cells. This phenotypic difference in the proliferative response to cAMP appears to involve cross-talk between cAMP and Ca2+ signaling to B-Raf, a kinase upstream of the MEK/ERK pathway. In normal cells, B-Raf is repressed by Akt (protein kinase B), a Ca2+-dependent kinase, preventing cAMP activation of ERK and cell proliferation. In PKD cells, disruption of intracellular Ca2+ homeostasis due to mutations in the PKD genes relieves Akt inhibition of B-Raf, allowing cAMP stimulation of B-Raf, ERK and cell proliferation. Fluid secretion by cystic cells is driven by cAMP-dependent transepithelial Cl? secretion involving apical cystic fibrosis transmembrane conductance regulator (CFTR) Cl? channels. This review summarizes the current knowledge of cAMP-dependent cyst expansion, focusing on cell proliferation and Cl?-dependent fluid secretion, and discusses potential therapeutic approaches to inhibit renal cAMP production and its downstream effects on cyst enlargement. PMID:21118718

  2. Cyclic AMP regulation of calcium mobilization and amylase release from isolated permeabilized rat parotid cells.

    PubMed

    Rubin, R P; Adolf, M A

    1994-02-01

    This study examined the mechanistic basis of the synergistic interaction between the cyclic AMP (cAMP) and phosphoinositide pathways in salivary amylase secretion. cAMP produced a concentration-dependent increase in Ca++ mobilization from saponin-permeabilized rat parotid acinar cells. A threshold concentration of cAMP (50 microM) significantly increased the peak Ca(++)-releasing activity of submaximal concentrations of inositol 1,4,5-trisphosphate (IP3) but did not augment the Ca++ mobilization induced by a maximal stimulating concentration of IP3 (30 microM). A maximal stimulating concentration of cAMP (500 microM) failed to modify the Ca++ releasing action of IP3. IP3-induced Ca++ release was also augmented by catalytic subunit of cAMP-dependent protein kinase. A specific protein kinase inhibitor reversed this effect. The cAMP-induced Ca++ release was blocked by ryanodine but not by heparin, by contrast with the IP3-induced Ca++ release. Thapsigargin only partially depressed the cAMP response but completely abolished the IP3 response. The amylase release elicited by fixed concentrations of Ca++ was not further enhanced by either cAMP or forskolin. Thus, unlike diacylglycerol, which decreases the Ca++ requirement for secretion by inducing activation of protein kinase C, cAMP appears to mediate salivary amylase secretion by regulating the sensitivity of parotid cells to the Ca++ mobilizing action of IP3. In addition, cAMP possesses a second action, i.e., directly eliciting Ca++ mobilization from an IP3-insensitive pool. PMID:7509390

  3. The role of the cyclic GMP-inhibited cyclic AMP-specific phosphodiesterase (PDE3) in regulating clonal BRIN-BD11 insulin secreting cell survival

    Microsoft Academic Search

    Masroor Ahmad; Peter R Flatt; Brian L Furman; Nigel J Pyne

    2000-01-01

    We report here that the cyclic GMP-inhibited cyclic AMP specific phosphodiesterase (PDE3B) is expressed as a membrane-bound protein in clonal insulin-secreting BRIN-BD11 cells. This was shown using SKF94836 (PDE3 inhibitor) which maximally inhibited membrane-bound cyclic AMP PDE activity by ?25-30% and by RT-PCR. We also demonstrated that insulin growth factor-1 (IGF-1) activates PDE3B in BRIN-BD11 cells. We therefore evaluated the

  4. Sustained signalling by PTH modulates IP3 accumulation and IP3 receptors through cyclic AMP junctions.

    PubMed

    Meena, Abha; Tovey, Stephen C; Taylor, Colin W

    2015-01-15

    Parathyroid hormone (PTH) stimulates adenylyl cyclase through type 1 PTH receptors (PTH1R) and potentiates the Ca(2+) signals evoked by carbachol, which stimulates formation of inositol 1,4,5-trisphosphate (IP3). We confirmed that in HEK cells expressing PTH1R, acute stimulation with PTH(1-34) potentiated carbachol-evoked Ca(2+) release. This was mediated by locally delivered cyclic AMP (cAMP), but unaffected by inhibition of protein kinase A (PKA), exchange proteins activated by cAMP, cAMP phosphodiesterases (PDEs) or substantial inhibition of adenylyl cyclase. Sustained stimulation with PTH(1-34) causes internalization of PTH1R-adenylyl cyclase signalling complexes, but the consequences for delivery of cAMP to IP3R within cAMP signalling junctions are unknown. Here, we show that sustained stimulation with PTH(1-34) or with PTH analogues that do not evoke receptor internalization reduced the potentiated Ca(2+) signals and attenuated carbachol-evoked increases in cytosolic IP3. Similar results were obtained after sustained stimulation with NKH477 to directly activate adenylyl cyclase, or with the membrane-permeant analogue of cAMP, 8-Br-cAMP. These responses were independent of PKA and unaffected by substantial inhibition of adenylyl cyclase. During prolonged stimulation with PTH(1-34), hyperactive cAMP signalling junctions, within which cAMP is delivered directly and at saturating concentrations to its targets, mediate sensitization of IP3R and a more slowly developing inhibition of IP3 accumulation. PMID:25431134

  5. Cyclic AMP can promote APL progression and protect myeloid leukemia cells against anthracycline-induced apoptosis

    PubMed Central

    Gausdal, G; Wergeland, A; Skavland, J; Nguyen, E; Pendino, F; Rouhee, N; McCormack, E; Herfindal, L; Kleppe, R; Havemann, U; Schwede, F; Bruserud, Ø; Gjertsen, B T; Lanotte, M; Ségal-Bendirdjian, E; Døskeland, S O

    2013-01-01

    We show that cyclic AMP (cAMP) elevating agents protect blasts from patients with acute promyelocytic leukemia (APL) against death induced by first-line anti-leukemic anthracyclines like daunorubicin (DNR). The cAMP effect was reproduced in NB4 APL cells, and shown to depend on activation of the generally cytoplasmic cAMP-kinase type I (PKA-I) rather than the perinuclear PKA-II. The protection of both NB4 cells and APL blasts was associated with (inactivating) phosphorylation of PKA site Ser118 of pro-apoptotic Bad and (activating) phosphorylation of PKA site Ser133 of the AML oncogene CREB. Either event would be expected to protect broadly against cell death, and we found cAMP elevation to protect also against 2-deoxyglucose, rotenone, proteasome inhibitor and a BH3-only mimetic. The in vitro findings were mirrored by the findings in NSG mice with orthotopic NB4 cell leukemia. The mice showed more rapid disease progression when given cAMP-increasing agents (prostaglandin E2 analog and theophylline), both with and without DNR chemotherapy. The all-trans retinoic acid (ATRA)-induced terminal APL cell differentiation is a cornerstone in current APL treatment and is enhanced by cAMP. We show also that ATRA-resistant APL cells, believed to be responsible for treatment failure with current ATRA-based treatment protocols, were protected by cAMP against death. This suggests that the beneficial pro-differentiating and non-beneficial pro-survival APL cell effects of cAMP should be weighed against each other. The results suggest also general awareness toward drugs that can affect bone marrow cAMP levels in leukemia patients. PMID:23449452

  6. Sustained signalling by PTH modulates IP3 accumulation and IP3 receptors through cyclic AMP junctions

    PubMed Central

    Meena, Abha; Tovey, Stephen C.; Taylor, Colin W.

    2015-01-01

    ABSTRACT Parathyroid hormone (PTH) stimulates adenylyl cyclase through type 1 PTH receptors (PTH1R) and potentiates the Ca2+ signals evoked by carbachol, which stimulates formation of inositol 1,4,5-trisphosphate (IP3). We confirmed that in HEK cells expressing PTH1R, acute stimulation with PTH(1-34) potentiated carbachol-evoked Ca2+ release. This was mediated by locally delivered cyclic AMP (cAMP), but unaffected by inhibition of protein kinase A (PKA), exchange proteins activated by cAMP, cAMP phosphodiesterases (PDEs) or substantial inhibition of adenylyl cyclase. Sustained stimulation with PTH(1-34) causes internalization of PTH1R–adenylyl cyclase signalling complexes, but the consequences for delivery of cAMP to IP3R within cAMP signalling junctions are unknown. Here, we show that sustained stimulation with PTH(1-34) or with PTH analogues that do not evoke receptor internalization reduced the potentiated Ca2+ signals and attenuated carbachol-evoked increases in cytosolic IP3. Similar results were obtained after sustained stimulation with NKH477 to directly activate adenylyl cyclase, or with the membrane-permeant analogue of cAMP, 8-Br-cAMP. These responses were independent of PKA and unaffected by substantial inhibition of adenylyl cyclase. During prolonged stimulation with PTH(1-34), hyperactive cAMP signalling junctions, within which cAMP is delivered directly and at saturating concentrations to its targets, mediate sensitization of IP3R and a more slowly developing inhibition of IP3 accumulation. PMID:25431134

  7. Regulation of the Discoidin I gamma gene in Dictyostelium discoideum: identification of individual promoter elements mediating induction of transcription and repression by cyclic AMP.

    PubMed

    Vauti, F; Morandini, P; Blusch, J; Sachse, A; Nellen, W

    1990-08-01

    We dissected the promoter of the developmentally induced and cyclic AMP-repressed discoidin I gamma gene and identified a sequence element essential for developmental induction. Transfer of the element to an inactive heterologous promoter demonstrated that this sequence is sufficient to confer expression in axenically growing cells and to induce gene activity in development after growth on bacteria. A 16-base-pair sequence within this element was shown to be sufficient for induction in the discoidin promoter context and was used to reactivate different truncated promoter constructs. This led to the localization of an element necessary for down regulation of gene expression by extracellular cyclic AMP. PMID:2196444

  8. Cyclic AMP facilitates the electrically evoked release of radiolabelled noradrenaline, dopamine and 5-hydroxytryptamine from rat brain slices.

    PubMed

    Schoffelmeer, A N; Wardeh, G; Mulder, A H

    1985-07-01

    The adenylate cyclase activator forskolin as well as 8-bromo-cyclic AMP enhanced the electrically evoked release of 3H-noradrenaline and 3H-5-hydroxytryptamine from superfused rat neocortical slices and that of 3H-dopamine from neostriatal slices with comparable EC50's of about 0.5 and 50 microM, respectively, without affecting spontaneous tritium efflux. The phosphodiesterase inhibitor ZK 62771 (3-100 microM) also enhanced 3H-noradrenaline and 3H-dopamine release but slightly reduced 3H-5-hydroxytryptamine release. However, this drug profoundly enhanced spontaneous tritium release in the latter case. The facilitatory effect of forskolin (0.3 microM) on the release of the amine neurotransmitters was potentiated in the presence of ZK 62771 (30 microM). Therefore, cyclic AMP appears to exert a general facilitatory effect on the release of these biogenic amines from central nerve terminals. PMID:2995841

  9. Exogenous substrate stimulates autodephosphorylation of cyclic-AMP-dependent protein kinase II.

    PubMed

    Gjertsen, B T; Fauske, B; Døskeland, S O

    1993-09-01

    The autophosphorylated regulatory subunit (32P-RII) of cyclic-AMP-dependent protein kinase II was efficiently dephosphorylated by its C subunit in the absence of added ADP, provided that Mg/ATP and a standard protein kinase peptide substrate were present. This raises the possibility that autodephosphorylation could be significant in the intact cell. Only the cyclic-AMP-complexed free form of 32P-RII was efficiently dephosphorylated, indicating that the autodephosphorylation was intermolecular. Autodephosphorylation of 32P-RII in the presence of MgATP and kemptide occurred with formation of [gamma-32P]ATP, suggesting transfer of 32P of phospho-RII to a transient C*(MgADP) complex formed during the forward kinase reaction with peptide as substrate. Autodephosphorylation promoted by phosphorylation of exogenous substrates could operate also for other kinases conforming to a mechanism where MgADP remains bound to the active site after the other product (phosphorylated substrate) has left the catalytic complex. PMID:8396916

  10. Exogenous substrate stimulates autodephosphorylation of cyclic-AMP-dependent protein kinase II.

    PubMed Central

    Gjertsen, B T; Fauske, B; Døskeland, S O

    1993-01-01

    The autophosphorylated regulatory subunit (32P-RII) of cyclic-AMP-dependent protein kinase II was efficiently dephosphorylated by its C subunit in the absence of added ADP, provided that Mg/ATP and a standard protein kinase peptide substrate were present. This raises the possibility that autodephosphorylation could be significant in the intact cell. Only the cyclic-AMP-complexed free form of 32P-RII was efficiently dephosphorylated, indicating that the autodephosphorylation was intermolecular. Autodephosphorylation of 32P-RII in the presence of MgATP and kemptide occurred with formation of [gamma-32P]ATP, suggesting transfer of 32P of phospho-RII to a transient C*(MgADP) complex formed during the forward kinase reaction with peptide as substrate. Autodephosphorylation promoted by phosphorylation of exogenous substrates could operate also for other kinases conforming to a mechanism where MgADP remains bound to the active site after the other product (phosphorylated substrate) has left the catalytic complex. Images Figure 5 PMID:8396916

  11. Developmentally regulated enzymes and cyclic AMP-binding sites in Dictyostelium discoideum cells blocked during development by alpha-chymotrypsin.

    PubMed

    Schmidt, J A; Stirling, J L

    1982-08-15

    When cells of the slime mould Dictyostelium discoideum are allowed to starve in the presence of alpha-chymotrypsin, they are blocked in development at the stage where tight aggregates form tips. Analysis of developmentally regulated enzymes has shown that alpha-mannosidase, beta-N-acetylglucosaminidase, threonine deaminase, tyrosine aminotransferase, beta-glucosidase and the carbohydrate-binding protein discoidin are unaffected, but enzymes that show an increase in specific activity during post-aggregative development, namely glycogen phosphorylase, UDP-glucose pyrophosphorylase, UDP-galactose 4-epimerase, UDP-galactose polysaccharide transferase and alkaline phosphatase, did not show the characteristic increase when development was blocked by alpha-chymotrypsin. Recovery of cells from the effects of alpha-chymotrypsin was accompanied by the formation of fruiting bodies and a concomitant increase in the specific activity of UDP-glucose pyrophosphorylase. Uptake or efflux of 45Ca2+ was not altered in the presence of alpha-chymotrypsin. Cells allowed to develop in alpha-chymotrypsin, or treated with the enzyme for 15 min, had a markedly reduced ability to bind cyclic AMP with low affinity; high-affinity binding was unaffected. Pronase had a similar effect on cyclic AMP binding, but trypsin, which does not alter developmental processes, has no effect on cyclic AMP binding to D. discoideum cells. PMID:7150239

  12. Cyclic AMP-dependent modification of gonad-selective TAF(II)105 in a human ovarian granulosa cell line.

    PubMed

    Wu, Yimin; Lu, Yunzhe; Hu, Yanfen; Li, Rong

    2005-11-01

    In response to gonadotropins, the elevated level of intracellular-cyclic AMP (cAMP) in ovarian granulosa cells triggers an ordered activation of multiple ovarian genes, which in turn promotes various ovarian functions including folliculogenesis and steroidogenesis. Identification and characterization of transcription factors that control ovarian gene expression are pivotal to the understanding of the molecular basis of the tissue-specific gene regulation programs. The recent discovery of the mouse TATA binding protein (TBP)-associated factor 105 (TAF(II)105) as a gonad-selective transcriptional co-activator strongly suggests that general transcription factors such as TFIID may play a key role in regulating tissue-specific gene expression. Here we show that the human TAF(II)105 protein is preferentially expressed in ovarian granulosa cells. We also identified a novel TAF(II)105 mRNA isoform that results from alternative exon inclusion and is predicted to encode a dominant negative mutant of TAF(II)105. Following stimulation by the adenylyl cyclase activator forskolin, TAF(II)105 in granulosa cells undergoes rapid and transient phosphorylation that is dependent upon protein kinase A (PKA). Thus, our work suggests that pre-mRNA processing and post-translational modification represent two important regulatory steps for the gonad-specific functions of human TAF(II)105. PMID:16088961

  13. Cyclic AMP Controls mTOR through Regulation of the Dynamic Interaction between Rheb and Phosphodiesterase 4D ?

    PubMed Central

    Kim, Hyun Wook; Ha, Sang Hoon; Lee, Mi Nam; Huston, Elaine; Kim, Do-Hyung; Jang, Sung Key; Suh, Pann-Ghill; Houslay, Miles D.; Ryu, Sung Ho

    2010-01-01

    The mammalian target of rapamycin complex 1 (mTORC1) is a molecular hub that regulates protein synthesis in response to a number of extracellular stimuli. Cyclic AMP (cAMP) is considered to be an important second messenger that controls mTOR; however, the signaling components of this pathway have not yet been elucidated. Here, we identify cAMP phosphodiesterase 4D (PDE4D) as a binding partner of Rheb that acts as a cAMP-specific negative regulator of mTORC1. Under basal conditions, PDE4D binds Rheb in a noncatalytic manner that does not require its cAMP-hydrolyzing activity and thereby inhibits the ability of Rheb to activate mTORC1. However, elevated cAMP levels disrupt the interaction of PDE4D with Rheb and increase the interaction between Rheb and mTOR. This enhanced Rheb-mTOR interaction induces the activation of mTORC1 and cap-dependent translation, a cellular function of mTORC1. Taken together, our results suggest a novel regulatory mechanism for mTORC1 in which the cAMP-determined dynamic interaction between Rheb and PDE4D provides a key, unique regulatory event. We also propose a new role for PDE4 as a molecular transducer for cAMP signaling. PMID:20837708

  14. Stimulatory and inhibitory effects of cyclic AMP on pancreatic glucagon release from monolayer cultures and the controlling role of calcium

    Microsoft Academic Search

    C. B. Wollheim; B. Blondel; A. E. Renold; G. W. G. Sharp

    1976-01-01

    Summary  When glucagon release from monolayer cultures of newborn rat pancreas was measured over four hours in media containing 2.5 mM Ca++, a significant cyclic AMP-related inhibition of release was observed. This was noted whether intracellular cyclic AMP levels were raised by the addition of exogenous cyclic AMP or dibutyryl cyclic AMP, by phosphodiesterase inhibition with theophylline, or by the stimulation

  15. Effect of electrical stimulation on beta-adrenergic receptor population and cyclic amp production in chicken and rat skeletal muscle cell cultures

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Strietzel, C. J.

    2000-01-01

    Expression of the beta-adrenergic receptor (betaAR) and its coupling to cyclic AMP (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the betaAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically, chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the betaAR population was not significantly affected by electrical stimulation; however, the ability of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the betaAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  16. Taming platelets with cyclic nucleotides 1 1 Abbreviations: ABP, actin binding protein; AC, adenylyl cyclase; cAMP, cyclic AMP; cAMP-PK, cAMP-dependent protein kinase; cGMP, cyclic GMP; cGMP-PK, cGMP-dependent protein kinase; DAG, 1,2-diacylglycerol; EDRF, endothelium-derived relaxing factor; GC, guanylyl cyclase; GP, glycoprotein; Hsp27, heat shock protein 27; IP 3, inositol 1,4,5- trisphosphate; IRAG, IP 3 receptor-associated cGMP-PK substrate; MAPK, mitogen-activated protein kinase; MAPKAPK-2, MAPK-activated protein kinase-2; MARCKS, myristoylated alanine-rich C kinase substrate; MLC, myosin light chain; MLCK, myosin light chain kinase; PDE, phosphodiesterase; PGE1, prostaglandin E 1; PGI 2, prostacyclin; PIP 2, phosphatidylinositol 4,5-bisphosphate; PKC, protein kinase C; PLC, phospholipase C; TxA 2, thromboxane A 2, and VASP, vasodilator-stimulated phosphoprotein

    Microsoft Academic Search

    Ulrike R. Schwarz; Ulrich Walter; Martin Eigenthaler

    2001-01-01

    Cardiovascular diseases are often accompanied and aggravated by pathologic platelet activation. Tight regulation of platelet function is an essential prerequisite for intact vessel physiology or effective cardiovascular therapy. Physiological platelet antagonists as well as various pharmacological vasodilators inhibit platelet function by activating adenylyl and guanylyl cyclases and increasing intracellular cyclic AMP (cAMP) and cyclic GMP (cGMP) levels, respectively. Elevation of

  17. Effects of calcium ions and substances affecting Ca2+ -related mechanisms on histamine-evoked stimulation of cyclic AMP formation in chick pineal gland.

    PubMed

    Zawilska, J B; Woldan-Tambor, A; Nowak, J Z

    1998-01-01

    In avian central nervous system (CNS), and particularly in the pineal gland, histamine (HA) potently stimulates synthesis of cyclic AMP in intact tissue, and only weakly affects adenylyl cyclase activity in membrane preparation. In this work, we focussed on calcium (Ca2+) as a possible link in the mechanism through which HA affects cyclic AMP generation in the chick pineal. The problem was studied in two sets of experiments where the action of HA on the pineal cyclic AMP was tested: (1) in the incubation medium containing various compounds influencing Ca2+ influx and/or Ca2+ intracellular concentration/action (Ca2+ -ionophore calcimycin, Ca2+ -channel agonist Bay-K 8644, Ca2+ -channels blockers: diltiazem, verapamil, nifedipine and omega-conotoxin-GVIA, CaCl2, EGTA in the absence of CaCl2 in the incubation medium, as well as calmodulin inhibitors: calmidazolium and W-7), and (2) in a CaCl2-free incubation medium yet containing different concentrations of BaCl2, CdCl2, CoCl2, MgCl2, and NiSO4. The results of the first series were mostly negative; an exception was the inhibiton of the HA-evoked cyclic AMP formation observed in the presence of 5.2 and 10.4 mM CaCl2 In the second series of experiments, divalent cations (however with the exception of Mg2+, which was inactive at concentrations up to 15.6 mM) inhibited the HA-evoked cyclic AMP production, with the following rank order of potency: Cd2+ > Co2+ > Ni2+ > Ba2+. The inhibitory effect of CdCl2 was prevented by nifedipine. Taken together, the present data suggest that intracellular Ca2+ -related mechanisms are not of major importance in the HA action on cyclic AMP synthesis in the chick pineal. It could be suspected that the inhibition of the HA-driven cyclic AMP formation by high concentrations of Ca2+, and other divalent cations, probably resulted from their direct inhibitory interaction with the catalytic site of the pineal adenylyl cyclase. PMID:10091715

  18. Identification of a Novel Cyclic AMP-response Element (CRE-II) and the Role of CREB-1 in the cAMP-induced Expression of the Survival Motor Neuron (SMN) Gene*

    PubMed Central

    Majumder, Sarmila; Varadharaj, Saradhadevi; Ghoshal, Kalpana; Monani, Umrao; Burghes, Arthur H. M.; Jacob, Samson T.

    2006-01-01

    Spinal muscular atrophy, an autosomal recessive disorder, is caused by loss of the SMN1 (survival motor neuron) gene while retaining the SMN2 gene. SMN1 produces a majority of full-length SMN transcript, whereas SMN2 generates mostly an isoform lacking exon 7. Here, we demonstrate a novel cAMP-response element, CRE-II, in the SMN promoter that interacts with the cAMP-response element-binding (CREB) family of proteins. In vitro DNase I protection analysis and in vivo genomic footprinting of the SMN promoter using the brain and liver nuclei from SMN2 transgenic mice revealed footprinting at the CRE-II site. Site-directed mutation of the CRE-II element caused a marked reduction in the SMN promoter activity revealed by transient transfection assay. Activation of the cAMP pathway by dibutyryl cAMP (0.5 mM) alone or in combination with forskolin (20 ?M) caused a 2–5-fold increase in the SMN promoter activity but had no effect on the CRE-II mutated promoter. Electrophoretic mobility shift assay and a UV-induced DNA-protein cross-linking experiment confirmed that CREB1 binds specifically to the CRE-II site. Transient overexpression of CREB1 protein resulted in a 4-fold increase of the SMN promoter activity. Intraperitoneal injection of epinephrine in mice expressing two copies of the human SMN2 gene resulted in a 2-fold increase in full-length SMN transcript in the liver. Combined treatment with dibutyryl cAMP and forskolin significantly increased the level of both the full-length and exon 7-deleted SMN (exon?7SMN) transcript in primary hepatocytes from mice expressing two copies of human SMN2 gene. Similar treatments of type I spinal muscular atrophy mouse and human fibroblasts as well as HeLa cells resulted in an augmented level of SMN transcript. These findings suggest that the CRE-II site in SMN promoter positively regulates the expression of the SMN gene, and treatment with cAMP-elevating agents increases expression of both the full-length and exon?7SMN transcript. PMID:14742439

  19. Gating by Cyclic AMP: Expanded Role for an Old Signaling Pathway

    NSDL National Science Digital Library

    Ravi Iyengar (City University of New York; Department of Pharmacology, Mount Sinai School of Medicine)

    1996-01-26

    Access to the article is free, however registration and sign-in are required. The intracellular signal transduction pathway that utilizes cyclic AMP as a key messenger was the first such pathway to be described and has served as a model for many other transducing systems. Now Iyengar illustrates how this classic pathway has yet another function--in a number of different biological systems, the cyclic AMP pathway appears to gate (either negatively or positively) other signal transduction pathways.

  20. Helodermin, helospectin, and PACAP stimulate cyclic AMP formation in intact bone, isolated osteoblasts, and osteoblastic cell lines.

    PubMed

    Lerner, U H; Lundberg, P; Ransjö, M; Persson, P; Håkanson, R

    1994-04-01

    Helodermin and helospectin are peptides structurally similar to vasoactive intestinal polypeptide (VIP) which were recently isolated from the salivary gland venom of the lizard Heloderma suspectum. Pituitary adenylate cyclase-activating polypeptide (PACAP) has been isolated from ovine hypothalamus and also shows sequence homology to VIP. A helodermin-like peptide has been detected by combined immunohistochemical and immunochemical techniques in the thyroid C-cells. In the present study, lizard helodermin was found to cause a time- and dose-dependent stimulation of cyclic AMP (cAMP) formation in neonatal mouse calvarial bones. Also, helospectin I, PACAP 27, and the C-terminally extended PACAP 38 stimulated cAMP accumulation in the mouse calvariae. The cAMP rise in response to helodermin was comparable to that induced by VIP, both in terms of potency and magnitude of the response. Helodermin, helospectin I, PACAP 27, and PACAP 38, at concentrations of 1 mumol/liter, stimulated cAMP accumulation in enzymatically isolated mouse calvarial bone cells. A significant response to all peptides was observed in both early and late released bone cells isolated from the calvariae, with low and high alkaline phosphatase activity, respectively. Helodermin and VIP stimulated cAMP accumulation in the cloned mouse calvarial osteoblastic cell line MC3T3-E1, in rat (UMR 106-01), and human (Saos-2) osteoblastic osteosarcoma cell lines, but not in the rat osteosarcoma cell line ROS 17/2.8. The effect of helodermin was synergistically and dose-dependently enhanced by forskolin (0.1 and 1 mumol/liter). These data show that bone cells, including osteoblasts, respond to several peptides of the VIP family, including helodermin, helospectin I, PACAP 27, and PACAP 38.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7914821

  1. Modulation of 3',5'-cyclic AMP homeostasis in human platelets by coffee and individual coffee constituents.

    PubMed

    Montoya, Gina A; Bakuradze, Tamara; Eirich, Marion; Erk, Thomas; Baum, Matthias; Habermeyer, Michael; Eisenbrand, Gerhard; Richling, Elke

    2014-11-14

    3',5'-Cyclic AMP (cAMP) is one of the most important second messengers in mammalian cells, mediating a multitude of diverse cellular signalling responses. Its homeostasis is primarily regulated by adenylate cyclases and phosphodiesterases (PDE), the activities of which are partially dependent on the downstream events of adenosine receptor signalling. The present study was conducted to determine whether coffee constituents other than caffeine can influence the homeostasis of intracellular cAMP in vitro and in vivo by evaluating the effects of selected constituents present in coffee, coffee brews and coffee extracts on platelet PDE activity. In addition, to evaluate the potential effects of these constituents on platelet cAMP concentrations and PDE activity in humans, a 7-week pilot intervention study with eight subjects was conducted. The subjects consumed a regular commercial coffee and a low-caffeine coffee at a rate of 750 ml/d for 2 weeks each. The in vivo results revealed a highly significant inhibition of PDE activity (P< 0·001) after coffee intervention that was not directly dependent on the caffeine content of coffee. Although our in vitro and in vivo findings suggest that caffeine plays some role in the modulation of platelet cAMP status, other natural and roasting-associated compounds such as pyrazines and other currently unidentified species also appear to contribute significantly. In conclusion, moderate consumption of coffee can modulate platelet PDE activity and cAMP concentrations in humans, which may contribute to the putative beneficial health effects of coffee. Further detailed mechanistic investigations will be required to substantiate these beneficial effects and to elucidate the underlying mechanisms. PMID:25247601

  2. Schizosaccharomyces pombe Git7p, a Member of the Saccharomyces cerevisiae Sgt1p Family, Is Required for Glucose and Cyclic AMP Signaling, Cell Wall Integrity, and Septation

    Microsoft Academic Search

    Kevin Schadick; H. Matthew Fourcade; Peter Boumenot; Jeffrey J. Seitz; Jennifer L. Morrell; Louise Chang; Kathleen L. Gould; Janet F. Partridge; Robin C. Allshire; Katsumi Kitagawa; Phil Hieter; Charles S. Hoffman

    2002-01-01

    The Schizosaccharomyces pombe fbp1 gene, encoding fructose-1,6-bisphosphatase, is transcriptionally re- pressed by glucose. Mutations that confer constitutive fbp1 transcription identify git (glucose-insensitive transcription) genes that encode components of a cyclic AMP (cAMP) signaling pathway required for adenylate cyclase activation. Four of these genes encode the three subunits of a heterotrimeric G protein (gpa2, git5, and git11) and a G protein-coupled

  3. Murine laminin B1 gene regulation during the retinoic acid- and dibutyryl cyclic AMP-induced differentiation of embryonic F9 teratocarcinoma stem cells.

    PubMed

    Li, C; Gudas, L J

    1996-03-22

    Retinoic acid (RA) and cyclic AMP analogs cause the differentiation of F9 embryonic teratocarcinoma stem cells into parietal endoderm, an epithelial cell of the early mouse embryo. Laminin B1 is induced in this differentiation process, but is not transcriptionally activated until 24-48 h after RA addition and is not maximally induced until approximately 72 h. Cyclic AMP analogs enhance this transcriptional activation. Although several DNase I hypersensitive sites (DHSS) were observed in the LAMB1 5 -flanking DNA, one of the sites, DHSS2, was detected only after 72 h of RA treatment. Transient transfections have demonstrated that the DHSS2 region functions as a "late-acting RA-inducible enhancer," and motifs in this enhancer contain the homeobox protein-binding site TTATTAACA. Greater binding is observed at these sites by electrophoretic mobility shift assay when cells are cultured with RA and cyclic AMP analogs versus RA alone, and no binding is seen in extracts from RA-treated F9 RAR gamma-/- cells which lack RAR gamma mRNA and protein. Laminin B1 mRNA is not induced by RA in the RAR gamma-/- cells (Boylan, J. F., Lohnes, D., Taneja, R., Chambon, P., and Gudas, L. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9601-9605). Our data show that these DNA regulatory elements contribute to the transcriptional activation of the LAMB1 gene during the later stages of the differentiation process. PMID:8636104

  4. Tiotropium sustains the anti-inflammatory action of olodaterol via the cyclic AMP pathway.

    PubMed

    Costa, Luigi; Roth, Michael; Miglino, Nicola; Keglowich, Laura; Zhong, Jun; Lardinois, Didier; Tamm, Michael; Borger, Pieter

    2014-02-01

    Mesenchymal cells (fibroblasts) of the airway wall respond to cholinergic stimulation by releasing pro-inflammatory and chemotactic cytokines and may thus contribute to chronic inflammation of the lung. Here, we studied the anti-inflammatory potential of olodaterol, a long acting ?2-adrenergic receptor agonist, and tiotropium, a long-acting muscarinic receptor antagonist, and whether they interact at the level of the cyclic AMP dependent signaling pathway. Pulmonary fibroblasts of asthmatic (n = 9) and non-asthmatic (n = 8) subjects were stimulated with the muscarinic receptor agonist carbachol and interleukin-1? (IL-1 beta) in presence or absence of tiotropium or olodaterol alone, or their combination. We also measured cAMP levels and phosphorylation of the cAMP response element binding protein (CREB). As single components, carbachol, olodaterol and tiotropium did not affect IL-6 and IL-8 release. Carbachol concentration-dependently enhanced the production of IL-1?-induced IL-6 and IL-8, which was blocked by the simultaneous addition of tiotropium. The combination of olodaterol plus tiotropium further reduced IL-6 and IL-8 release. Olodaterol induced cAMP and the phosphorylation of CREB, an effect counteracted by carbachol, but rescued by tiotropium. We conclude that olodaterol plus tiotropium cooperate to decrease the inflammatory response in pulmonary fibroblasts in vitro. PMID:24269928

  5. Inhibition of the Raf-1 kinase by cyclic AMP agonists causes apoptosis of v-abl-transformed cells.

    PubMed Central

    Weissinger, E M; Eissner, G; Grammer, C; Fackler, S; Haefner, B; Yoon, L S; Lu, K S; Bazarov, A; Sedivy, J M; Mischak, H; Kolch, W

    1997-01-01

    Here we investigate the role of the Raf-1 kinase in transformation by the v-abl oncogene. Raf-1 can activate a transforming signalling cascade comprising the consecutive activation of Mek and extracellular-signal-regulated kinases (Erks). In v-abl-transformed cells the endogenous Raf-1 protein was phosphorylated on tyrosine and displayed high constitutive kinase activity. The activities of the Erks were constitutively elevated in both v-raf- and v-abl-transformed cells. In both cell types the activities of Raf-1 and v-raf were almost completely suppressed after activation of the cyclic AMP-dependent kinase (protein kinase A [PKA]), whereas the v-abl kinase was not affected. Raf inhibition substantially diminished the activities of Erks in v-raf-transformed cells but not in v-abl-transformed cells, indicating that v-abl can activate Erks by a Raf-1-independent pathway. PKA activation induced apoptosis in v-abl-transformed cells while reverting v-raf transformation without severe cytopathic effects. Overexpression of Raf-1 in v-abl-transformed cells partially protected the cells from apoptosis induced by PKA activation. In contrast to PKA activators, a Mek inhibitor did not induce apoptosis. The diverse biological responses correlated with the status of c-myc gene expression. v-abl-transformed cells featured high constitutive levels of expression of c-myc, which were not reduced following PKA activation. Myc activation has been previously shown to be essential for transformation by oncogenic Abl proteins. Using estrogen-regulated c-myc and temperature-sensitive Raf-1 mutants, we found that Raf-1 activation could protect cells from c-myc-induced apoptosis. In conclusion, these results suggest (i) that Raf-1 participates in v-abl transformation via an Erk-independent pathway by providing a survival signal which complements c-myc in transformation, and (ii) that cAMP agonists might become useful for the treatment of malignancies where abl oncogenes are involved, such as chronic myeloid leukemias. PMID:9154822

  6. Possible role of cyclic AMP phosphodiesterases in the actions of ibudilast on eosinophil thromboxane generation and airways smooth muscle tone.

    PubMed

    Souness, J E; Villamil, M E; Scott, L C; Tomkinson, A; Giembycz, M A; Raeburn, D

    1994-04-01

    1. The possible role of cyclic AMP phosphodiesterase (PDE) in the inhibitory actions of ibudilast on tracheal smooth muscle contractility and eosinophil thromboxane generation was investigated. 2. Ibudilast was a non-selective inhibitor of partially purified cyclic nucleotide PDE isoenzymes from pig aorta and bovine tracheal smooth muscle, exhibiting only moderate potency against bovine tracheal PDE IV (IC50 = 12 +/- 4 microM, n = 3). Similar or slightly lower potencies were displayed against PDEs I, II, III and V. In contrast, rolipram exhibited selectivity for PDE IV (3 +/- 0.5 microM, n = 3). 3. Ibudilast (IC50 = 0.87 +/- 0.37 microM, n = 3), like rolipram (IC50 = 0.20 +/- 0.04 microM, n = 3), was a more potent inhibitor of membrane-bound PDE IV from guinea-pig eosinophils than of partially purified PDE IV from bovine tracheal smooth muscle. The potency of ibudilast increased when the eosinophil enzyme was solubilised with deoxycholate and NaCl (IC50 = 0.11 +/- 0.05 microM, n = 3) or exposed to vanadate/glutathione complex (V/GSH) (IC50 = 0.11 +/- 0.02 microM, n = 3). The potency of rolipram was also increased by solubilization (IC50 = 0.012 +/- 0.003, n = 3) or V/GSH (IC50 = 0.012 +/- 0.003, n = 3). 4. In intact eosinophils, ibudilast (0.032 microM-20 microM) potentiated isoprenaline-induced cyclic AMP accumulation in a concentration-dependent manner, being approximately 20 fold less potent than rolipram. Little or no effect on basal cyclic AMP levels was observed with either compound. The cyclicAMP-dependent protein kinase activity ratio was significantly increased following incubation of eosinophils with either ibudilast (20 MicroM) or rolipram (20 MicroM) in the absence or presence of isoprenaline.5. Leukotriene B4 (300 nM)-induced thromboxane generation from guinea-pig eosinophils was inhibited by ibudilast (IC50 = 11.3 +/- 3.7 MicroM, n = 5) and rolipram (IC50 = 0.280 +/- 0.067 MicroM, n = 5) in a concentration-dependent manner.6. Ibudilast (10 nM-1 MicroM), whilst generally less potent than rolipram (1 nM- 1 MicroM), produced concentration-dependent relaxation of spasmogen (methacholine, histamine, LTD4)-induced tone in the guinea pig isolated tracheal strip. Ibudilast was less potent in reversing the methacholine (IC50 = 1.95 +/- 0.40 JM,n =6)-induced contraction than those of histamine (IC50 = 0.18 +/- 0.70 MicroM, n =6) or leukotriene D4(LTD4, IC50 = 0.12 +/- 0.05 MicroM, n = 6). Rolipram also exhibited a similar pattern of activity, although the difference in potency against methacholine (IC50 = 0.1 +/- 0.01 MicroM, n = 6) compared with the other two spasmogens, histamine (IC50 = 0.034 +/- 0.017 MicroM, n = 7) and LTD4 (IC50 = 0.026 +/- 0.008 MicroM, n = 7), was not as great.7. These results demonstrate that ibudilast, like rolipram, has several biological actions on the eosinophil and airways smooth muscle which may be attributed to inhibition of cyclic AMP PDE. These actions may account, at least in part, for the recently reported anti-asthma effects of ibudilast. PMID:8032594

  7. Effect of Electrical Stimulation on Beta-Adrenergic Receptor Population and Cyclic AMP Production in Chicken and Rat Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Strietzel, Catherine J.

    2000-01-01

    Expression of the beta-adrenergic receptor (PAR) and its coupling to Adenosine 3'5' Cyclic Monophosphate (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the PAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture, were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the PAR population was not significantly affected by electrical stimulation; however, the ability, of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the PAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  8. The cyclic-AMP receptor protein (CRP) regulon in Aggregatibacter actinomycetemcomitans includes leukotoxin

    PubMed Central

    Feuerbacher, Leigh A.; Burgum, Alex; Kolodrubetz, David

    2011-01-01

    The cyclic-AMP receptor protein (CRP) acts as a global regulatory protein among bacteria. Here, the CRP regulon has been defined in Aggregatibacter actinomycetemcomitans using microarray analysis of A. actinomycetemcomitans strain JP2 wild type cells compared to an isogenic crp deletion mutant. Genes whose expression levels changed at least 2-fold with p ? 0.05 were considered significant. Of the 300 genes identified as being CRP-regulated, 139 were CRP-activated, including leukotoxin, with the remaining being CRP-repressed. The 300 genes represent 14.2% of ORFs probed which is significantly higher than what has been reported for CRP regulons in other bacteria. If the CRP-regulated genes are put into 17 functional classes, all 17 categories had at least 1 CRP-regulated gene. Several functional categories, mainly transport and binding proteins and energy metabolism proteins, were disproportionately represented in the CRP-regulated subset of genes relative to their overall representation in the genome. This is similar to the patterns seen in other bacteria. Finally, quantitative RT-PCR was used to show that the leukotoxin RNA levels were repressed 16-fold in the CRP mutant indicating that CRP activates leukotoxin transcription. However, this regulation appears to be acting through another regulatory protein since the leukotoxin promoter, unlike ~129 other promoters of CRP-regulated genes, does not have a match to the consensus CRP binding site. Several candidate genes for this intermediary transcription factor have been identified in the CRP-regulon. PMID:21575705

  9. Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williaes, B. A.

    1983-01-01

    It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

  10. Pharmacological characterization of cyclic AMP receptors mediating gene regulation in Dictyostelium discoideum.

    PubMed

    Haribabu, B; Dottin, R P

    1986-07-01

    Extracellular molecules regulate gene expression in eucaryotes. Exogenous cyclic AMP (cAMP) affects the expression of a large number of developmentally regulated genes in Dictyostelium discoideum. Here, we determine the specificity of the receptor(s) which mediates gene expression by using analogs of cAMP. The order of potency with which these analogs affect the expression of specific genes is consistent with the specificity of their binding to a cell surface receptor and is distinct from their affinity for intracellular cAMP-dependent protein kinase. Dose-response curves with cAMP and adenosine 3',5'-monophosphorothioate, a nonhydrolyzable analog, revealed that the requirement for high concentrations of exogenous cAMP for regulating gene expression is due to the rapid degradation of cAMP by phosphodiesterase. The addition of low concentrations of cAMP (100 nM) or analogs in pulses also regulates gene expression. Both the genes that are positively regulated by exogenous cAMP and the discoidin gene, which is negatively regulated, respond to cAMP analogs to the same degree. Genes expressed in prespore or prestalk cells are also similarly regulated. These data suggest that the effects are mediated through the same receptor. The specificity of this receptor is indistinguishable from that of the well-characterized cell surface cAMP receptor. PMID:3023932

  11. The Small Molecule Triclabendazole Decreases the Intracellular Level of Cyclic AMP and Increases Resistance to Stress in Saccharomyces cerevisiae

    PubMed Central

    Lee, Yong Joo; Shi, Runhua; Witt, Stephan N.

    2013-01-01

    The Ras-adenylyl cyclase-protein kinase A nutrient-sensing pathway controls metabolism, proliferation and resistance to stress in Saccharomyces cerevisiae. The genetic disruption of this pathway increases resistance to a variety of stresses. We show here that the pharmacological inhibition of this pathway by the drug triclabendazole increases resistance to oxidants, heat stress and extends the chronological life. Evidence is presented that triclabendazole decreases the intracellular level of cyclic AMP by inhibiting adenylyl cyclase and triggers the parallel rapid translocation of the stress-resistance transcription factor Msn2 from the cytosol into the nucleus, as deduced from experiments employing a strain in which MSN2 is replaced with MSN2-GFP (GFP, green fluorescent protein). Msn2 and Msn4 are responsible for activating the transcription of numerous genes that encode proteins that protect cells from stress. The results are consistent with triclabendazole either inhibiting the association of Ras with adenylyl cyclase or directly inhibiting adenylyl cyclase, which in turn triggers Msn2/4 to enter the nucleus and activate stress-responsible element gene expression. PMID:23667708

  12. Regulation of yeast trehalase by a monocyclic, cyclic AMP-dependent phosphorylation-dephosphorylation cascade system.

    PubMed Central

    Ortiz, C H; Maia, J C; Tenan, M N; Braz-Padrão, G R; Mattoon, J R; Panek, A D

    1983-01-01

    Mutation at the GLC1 locus in Saccharomyces cerevisiae resulted in simultaneous deficiencies in glycogen and trehalose accumulation. Extracts of yeast cells containing the glc1 mutation exhibited an abnormally high trehalase activity. This elevated activity was associated with a defective cyclic AMP (cAMP)-dependent monocyclic cascade which, in normal cells, regulates trehalase activity by means of protein phosphorylation and dephosphorylation. Trehalase in extracts of normal cells was largely in a cryptic form which could be activated in vitro by ATP . Mg in the presence of cAMP. Normal extracts also exhibited a correlated cAMP-dependent protein kinase which catalyzed incorporation of label from [gamma-32P]ATP into protamine. In contrast, cAMP had little or no additional activating effect on trehalase or on protamine phosphorylation in extracts of glc1 cells. Similar, unregulated activation of cryptic trehalase was also found in glycogen-deficient strains bearing a second, independently isolated mutant allele, glc1-2. Since trehalase activity was not directly affected by cAMP, the results indicate that the glc1 mutation results in an abnormally active protein kinase which has lost its normal dependence on cAMP. Trehalase in extracts of either normal or mutant cells underwent conversion to a cryptic form in an Mg2+-dependent, fluoride-sensitive reaction. Rates of this reversible reduction of activity were similar in extracts of mutant and normal cells. This same, unregulated protein kinase would act on glycogen synthase, maintaining it in the phosphorylated low-activity D-form. The glc1 mutants provide a novel model system for investigating the in vivo metabolic functions of a specific, cAMP-dependent protein kinase. PMID:6296049

  13. Cyclic nucleotides of cone-dominant retinas. Reduction of cyclic AMP levels by light and by cone degeneration.

    PubMed

    Farber, D B; Souza, D W; Chase, D G; Lolley, R N

    1981-01-01

    Dark-adapted retinas or whole eyes of 13-line ground squirrels (Citellus tridecemlineatus) and western fence lizards (Sceloporus occidentalis) contain higher levels of cyclic AMP than of cyclic GMP. In these cone-dominant retinas, light reduces cyclic AMP content selectively. Freezing of dark- or light-adapted retinas or eyes also reduces cyclic AMP content, with only minimal changes in cyclic GMP levels. In addition, exposure of frozen retinas of dark-adapted ground squirrel to light results in a significant decrease in cyclic AMP content. The destruction of cone visual cells of ground squirrel retina by iodoacetic acid injection decreases the cyclic nucleotide content of the dark-adapted retina. Considering the relative loss of cyclic nucleotides from cone degeneration, we estimate that the content of cyclic AMP in visual cells of ground squirrel retina is about four times greater than that of cyclic GMP. PMID:6256308

  14. Cyclic AMP Receptor Protein Regulates cspD, a Bacterial Toxin Gene, in Escherichia coli

    PubMed Central

    Shetty, Deeksha M.; Jawali, Narendra

    2014-01-01

    cspD, a member of cspA family of cold shock genes in Escherichia coli, is not induced during cold shock. Its expression is induced during stationary phase. CspD inhibits DNA replication, and a high level of the protein is toxic to cells. Recently, CspD was proposed to be associated with persister cell formation in E. coli. Here, we show that cyclic AMP receptor protein (CRP) upregulates cspD transcription. Sequence analysis of the cspD upstream region revealed two tandem CRP target sites, CRP site-I (the proximal site centered at ?83.5 with respect to the transcription start) and CRP site-II (the distal site centered at ?112.5). The results from electrophoretic mobility shift assays showed that CRP indeed binds to these two target sites in PcspD. The promoter-proximal CRP target site was found to play a major role in PcspD activation by CRP, as studied by transcriptional fusions carrying mutations in the target sites. The results from in vitro transcription assays demonstrated that CRP activates PcspD transcription in the absence of additional factors other than RNA polymerase. The requirement for activating region 1 of CRP in PcspD activation, along with the involvement of the 287, 265, and 261 determinants of the ?-CTD, suggest that CRP activates by a class I-type mechanism. However, only moderate activation in vitro was observed compared to high activation in vivo, suggesting there might be additional activators of PcspD. Overall, our findings show that CRP, a global metabolic regulator in E. coli, activates a gene potentially related to persistence. PMID:24509317

  15. Adenylyl Cyclase-Associated Protein Aca1 Regulates Virulence and Differentiation of Cryptococcus neoformans via the Cyclic AMP-Protein Kinase A Cascade†

    PubMed Central

    Bahn, Yong-Sun; Hicks, Julie K.; Giles, Steven S.; Cox, Gary M.; Heitman, Joseph

    2004-01-01

    The evolutionarily conserved cyclic AMP (cAMP) signaling pathway controls cell functions in response to environmental cues in organisms as diverse as yeast and mammals. In the basidiomycetous human pathogenic fungus Cryptococcus neoformans, the cAMP pathway governs virulence and morphological differentiation. Here we identified and characterized adenylyl cyclase-associated protein, Aca1, which functions in parallel with the G? subunit Gpa1 to control the adenylyl cyclase (Cac1). Aca1 interacted with the C terminus of Cac1 in the yeast two-hybrid system. By molecular and genetic approaches, Aca1 was shown to play a critical role in mating by regulating cell fusion and filamentous growth in a cAMP-dependent manner. Aca1 also regulates melanin and capsule production via the Cac1-cAMP-protein kinase A pathway. Genetic epistasis studies support models in which Aca1 and Gpa1 are necessary and sufficient components that cooperate to activate adenylyl cyclase. Taken together, these studies further define the cAMP signaling cascade controlling virulence of this ubiquitous human fungal pathogen. PMID:15590822

  16. Rab11, but not Rab4, facilitates cyclic AMP- and tauroursodeoxycholate-induced MRP2 translocation to the plasma membrane.

    PubMed

    Park, Se Won; Schonhoff, Christopher M; Webster, Cynthia R L; Anwer, M Sawkat

    2014-10-15

    Rab proteins (Ras homologous for brain) play an important role in vesicle trafficking. Rab4 and Rab11 are involved in vesicular trafficking to the plasma membrane from early endosomes and recycling endosomes, respectively. Tauroursodeoxycholate (TUDC) and cAMP increase bile formation, in part, by increasing plasma membrane localization of multidrug resistance-associated protein 2 (MRP2). The goal of the present study was to determine the role of these Rab proteins in the trafficking of MRP2 by testing the hypothesis that Rab11 and/or Rab4 facilitate cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. Studies were conducted in HuH-NTCP cells (HuH7 cells stably transfected with human NTCP), which constitutively express MRP2. HuH-NTCP cells were transfected with Rab11-WT and GDP-locked dominant inactive Rab11-GDP or with Rab4-GDP to study the role of Rab11 and Rab4. A biotinylation method and a GTP overlay assay were used to determine plasma membrane MRP2 and activation of Rab proteins (Rab11 and Rab4), respectively. Cyclic AMP and TUDC increased plasma membrane MRP2 and stimulated Rab11 activity. Plasma membrane translocation of MRP2 by cAMP and TUDC was increased and inhibited in cells transfected with Rab11-WT and Rab11-GDP, respectively. Cyclic AMP (previous study) and TUDC increased Rab4 activity. However, cAMP- and TUDC-induced increases in MRP2 were not inhibited by Rab4-GDP. Taken together, these results suggest that Rab11 is involved in cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. PMID:25190474

  17. Artificial control maturation of porcine oocyte by dibutyryl cyclicAMP

    PubMed Central

    Zhao, Ming-Hui; Jin, Yong-Xun; Lee, Seul-Ki; Kim, Nam-Hyung; Cui, Xiang-Shun

    2014-01-01

    In this study, we investigated the effects of various durations of dibutyryl cyclic AMP (dbcAMP) treatment on the in vitro maturation (IVM) and subsequent development of parthenogenetically activated embryos. Immature porcine oocytes were cultured with or without 1 mM dbcAMP during the first 20, 28, or 36 h of culture, and then incubated for an additional 24 h without dbcAMP. The expression of Wee1B, Myt, and Cdc25B and the level of maturation promoting factor (MPF) in metaphase II oocytes were analyzed by real-time PCR (qRT-PCR) and enzyme linked immunosorbent assay (ELISA), respectively. The distribution of actin microfilaments in oocytes was also assessed. Subsequently, apoptotic cells in blastocysts from each group were visualized by transferase-mediated dUTP nick-end labeling staining. Results showed that oocytes extruded the first polar body between 12 and 18 h after being released from dbcAMP. MPF activity in oocytes at 28 + 24 h and 36 + 24 h after dbcAMP treatment was higher than that in the control group. Significantly more blastocysts were present among embryos in 28 + 24 h (54.28% vs. 39.11%, P < 0.05) and 36 + 24 h (47.24% vs. 32.94%, P < 0.05) groups than among embryos cultured in the absence of dbcAMP. However, the number of total and apoptotic cells was not significantly different between groups. The distribution of actin microfilaments was abnormal in oocytes cultured for 60 h without dbcAMP. In addition, the expression of Wee1B, Myt, and Cdc25B was higher in the control group at 44 h than in the dbcAMP group, but there were no differences in expression at the other time points. In conclusion, dbcAMP treatment delays oocyte maturation and maintains oocyte quality. PMID:24683444

  18. Dynamic Fluctuations Provide the Basis of a Conformational Switch Mechanism in Apo Cyclic AMP Receptor Protein

    PubMed Central

    Aykaç Fas, Burcu; Tutar, Yusuf; Halilo?lu, Türkan

    2013-01-01

    Escherichia coli cyclic AMP Receptor Protein (CRP) undergoes conformational changes with cAMP binding and allosterically promotes CRP to bind specifically to the DNA. In that, the structural and dynamic properties of apo CRP prior to cAMP binding are of interest for the comprehension of the activation mechanism. Here, the dynamics of apo CRP monomer/dimer and holo CRP dimer were studied by Molecular Dynamics (MD) simulations and Gaussian Network Model (GNM). The interplay of the inter-domain hinge with the cAMP and DNA binding domains are pre-disposed in the apo state as a conformational switch in the CRP's allosteric communication mechanism. The hinge at L134-D138 displaying intra- and inter-subunit coupled fluctuations with the cAMP and DNA binding domains leads to the emergence of stronger coupled fluctuations between the two domains and describes an on state. The flexible regions at K52-E58, P154/D155 and I175 maintain the dynamic coupling of the two domains. With a shift in the inter-domain hinge position towards the N terminus, nevertheless, the latter correlations between the domains loosen and become disordered; L134-D138 dynamically interacts only with the cAMP and DNA binding domains of its own subunit, and an off state is assumed. We present a mechanistic view on how the structural dynamic units are hierarchically built for the allosteric functional mechanism; from apo CRP monomer to apo-to-holo CRP dimers. PMID:23874183

  19. Cyclic AMP-dependent regulation of K+ transport in the rat distal colon.

    PubMed Central

    Diener, M.; Hug, F.; Strabel, D.; Scharrer, E.

    1996-01-01

    1. The effect of agonists of the cyclic AMP pathway and of 293B, a chromanole-derived K+ channel blocker, on K+ transport in the rat distal colon was studied by measuring unidirectional fluxes, uptake, and efflux of Rb+ in mucosa-submucosa preparations and by patch-clamp of crypt epithelia from isolated crypts. 2. 293B concentration-dependently inhibited basal and forskolin-stimulated short-circuit current. In isolated crypts 293B blocked a basal K+ conductance but had no effect on cyclic AMP-evoked depolarization induced by the opening of apical Cl- channels. When the effect of cyclic AMP on Cl- conductance was prevented by substituting Cl- with gluconate, an inhibition of total cellular K+ conductance by forskolin and a membrane-permeable cyclic AMP analogue was unmasked. 3. Unidirectional ion flux measurements revealed that 293B suppressed the increase in JRbsm induced by forskolin. This, together with the inhibition of cyclic AMP-induced anion secretion indicates that the drug blocks K+ channels, presumably both in the apical and the basolateral membrane. Forskolin caused not only inhibition of K+ absorption, but also stimulation of K+ secretion. The inhibition was diminished, but not blocked, in the presence of inhibitors of the apical H(+)-K(+)-ATPase, vanadate and ouabain. Forskolin stimulated serosal, bumetanide-sensitive Rb+ uptake, whereas mucosal, ouabain/vanadate-sensitive uptake remained unaffected. 4. Efflux experiments revealed that forskolin caused a redistribution of cellular K+ efflux reducing the ratio of basolateral versus apical Rb+ efflux. 5. These results suggest that intracellular cyclic AMP exerts its effects on K+ transport by several mechanisms: an increase in the driving force for K+ efflux due to the depolarization induced by opening of Cl- channels, a stimulation of the basolateral uptake of K+ via the Na(+)-K(+)-Cl(-)-cotransporter, and a decrease of the ratio of basolateral versus apical K+ conductance leading to an enhanced efflux of K+ into the lumen and a reduced K+ efflux to the serosal compartment. PMID:8832075

  20. Acute morphine alters GABAergic transmission in the central amygdala during naloxone-precipitated morphine withdrawal: role of cyclic AMP

    PubMed Central

    Bajo, Michal; Madamba, Samuel G.; Roberto, Marisa; Siggins, George R.

    2014-01-01

    The central amygdala (CeA) plays an important role in opioid addiction. Therefore, we examined the effects of naloxone-precipitated morphine withdrawal (WD) on GABAergic transmission in rat CeA neurons using whole-cell recordings with naloxone in the bath. The basal frequency of miniature inhibitory postsynaptic currents (mIPSCs) increased in CeA neurons from WD compared to placebo rats. Acute morphine (10 ? M) had mixed effects (?20% change from baseline) on mIPSCs in placebo and WD rats. In most CeA neurons (64%) from placebo rats, morphine significantly decreased mIPSC frequency and amplitude. In 32% of placebo neurons, morphine significantly increased mIPSC amplitudes but had no effect on mIPSC frequency. In WD rats, acute morphine significantly increased mIPSC frequency but had no effect on mIPSC amplitude in 41% of CeA neurons. In 45% of cells, acute morphine significantly decreased mIPSC frequency and amplitude. Pre-treatment with the cyclic AMP inhibitor (R)-adenosine, cyclic 3',5'-(hydrogenphosphorothioate) triethylammonium (RP), prevented acute morphine-induced potentiation of mIPSCs. Pre-treatment of slices with the Gi/o G-protein subunit inhibitor pertussis toxin (PTX) did not prevent the acute morphine-induced enhancement or inhibition of mIPSCs. PTX and RP decreased basal mIPSC frequencies and amplitudes only in WD rats. The results suggest that inhibition of GABAergic transmission in the CeA by acute morphine is mediated by PTX-insensitive mechanisms, although PTX-sensitive mechanisms cannot be ruled out for non-morphine responsive cells; by contrast, potentiation of GABAergic transmission is mediated by activated cAMP signaling that also mediates the increased basal GABAergic transmission in WD rats. Our data indicate that during the acute phase of WD, the CeA opioid and GABAergic systems undergo neuroadaptative changes conditioned by a previous chronic morphine exposure and dependence. PMID:24926240

  1. Endogenous expression of histamine H1 receptors functionally coupled to phosphoinositide hydrolysis in C6 glioma cells: regulation by cyclic AMP.

    PubMed Central

    Peakman, M C; Hill, S J

    1994-01-01

    1. The effects of histamine receptor agonists and antagonists on phospholipid hydrolysis in rat-derived C6 glioma cells have been investigated. 2. Histamine H1 receptor-stimulation caused a concentration-dependent increase in the accumulation of total [3H]-inositol phosphates in cells prelabelled with [3H]-myo-inositol. The rank order of agonist potencies was histamine (EC50 = 24 microM) > N alpha-methylhistamine (EC50 = 31 microM) > 2-thiazolylethylamine (EC50 = 91 microM). 3. The response to 0.1 mM histamine was antagonized in a concentration-dependent manner by the H1-antagonists, mepyramine (apparent Kd = 1 nM) and (+)-chlorpheniramine (apparent Kd = 4 nM). In addition, (-)-chlorpheniramine was more than two orders of magnitude less potent than its (+)-stereoisomer. 4. Elevation of intracellular cyclic AMP accumulation with forskolin (10 microM, EC50 = 0.3 microM), isoprenaline (1 microM, EC50 = 4 nM) or rolipram (0.5 mM), significantly reduced the histamine-mediated (0.1 mM) inositol phosphate response by 37%, 43% and 26% respectively. In contrast, 1,9-dideoxyforskolin did not increase cyclic AMP accumulation and had no effect on the phosphoinositide response to histamine. 5. These data indicate the presence of functionally coupled, endogenous histamine H1 receptors in C6 glioma cells. Furthermore, the results also indicate that H1 receptor-mediated phospholipid hydrolysis is inhibited by the elevation of cyclic AMP levels in these cells. PMID:7889313

  2. The progestin levonorgestrel induces endothelium-independent relaxation of rabbit jugular vein via inhibition of calcium entry and protein kinase?C: role of cyclic AMP

    PubMed Central

    Herkert, Olaf; Kuhl, Herbert; Busse, Rudi; Schini-Kerth, Valérie B

    2000-01-01

    The progestin and oestrogen component of oral contraceptives have been involved in the development of venous thromboembolic events in women. In the present study we determined the vasoactive effects of sex steroids used in oral contraceptives in isolated preconstricted rabbit jugular veins in the presence of diclofenac and examined the underlying mechanisms.The natural hormone progesterone, the synthetic progestins levonorgestrel, 3-keto-desogestrel, gestodene and chlormadinone acetate, and the synthetic estrogen 17 ?-ethinyloestradiol induced concentration-dependent relaxations of endothelium-intact veins constricted with U46619. Levonorgestrel also inhibited constrictions evoked by either a high potassium (K+) solution or phorbol myristate acetate (PMA) in the absence and presence of extracellular calcium (Ca2+). In addition, levonorgestrel depressed contractions evoked by Ca2+ and reduced 45Ca2+ influx in depolarized veins.Relaxations to levonorgestrel in U46619-constricted veins were neither affected by the presence of the endothelium nor by the inhibitor of soluble guanylyl cyclase, NS2028, but were significantly improved either by the selective cyclic AMP phosphodiesterase inhibitor rolipram or in the absence of diclofenac, and decreased by the protein kinase?A inhibitor, Rp-8-CPT-cAMPS. Rolipram also potentiated relaxations to levonorgestrel in PMA-constricted veins in the presence, but not in the absence of extracellular Ca2+. Levonorgestrel increased levels of cyclic AMP and inhibited PMA-induced activation of protein kinase?C in veins.These findings indicate that levonorgestrel caused endothelium-independent relaxations of jugular veins via inhibition of Ca2+ entry and of protein kinase?C activation. In addition, the cyclic AMP effector pathway contributes to the levonorgestrel-induced relaxation possibly by depressing Ca2+ entry. PMID:10952682

  3. The effects of forskolin on cyclic AMP, intraocular pressure and aqueous humor formation in rabbits.

    PubMed

    Bartels, S P; Lee, S R; Neufeld, A H

    1987-02-01

    Forskolin was used to study cyclic AMP-mediated regulation of aqueous humor dynamics in rabbits. Crystalline forskolin was solubilized in oil and its pharmacological effects were studied both in vitro and following topical ocular administration. In vitro, using cultured corneal epithelial cells, forskolin rapidly stimulated cyclic AMP production and in vivo increased cyclic AMP concentration in the aqueous humor 10-fold following topical administration. The effect of topical forskolin on intraocular pressure and aqueous humor formation was determined in vivo using pneumatonometry and fluorophotometry, respectively. Forskolin caused a prolonged reduction of intraocular pressure and decreased aqueous humor formation. The ability of forskolin to potentiate the ocular hypotensive effect of epinephrine was investigated. Forskolin in combination with epinephrine caused a decrease in intraocular pressure of longer duration than either 0.1% epinephrine or 1% forskolin administered separately. Forskolin caused a small but significant increase in the permeability of the blood-aqueous barrier at the time of maximal intraocular pressure reduction. This effect on the blood-aqueous barrier may explain the inhibitory effect of forskolin on aqueous humor formation. PMID:3032517

  4. Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887

    NASA Technical Reports Server (NTRS)

    Mednieks, Maija I.; Popova, Irina A.; Grindeland, Richard E.

    1991-01-01

    The cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 is determined. Photoaffinity labeling of soluble and particular cell fractions with a (32P)-8-azido analog of cyclic AMP is followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. It is shown that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins exhibited some variability in tissues of individual animals, but showed no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. It is inferred that the cardiac cell integrity or its protein content is not compromised under flight conditions.

  5. Cyclic AMP and the regeneration of retinal ganglion cell axons.

    PubMed

    Hellström, Mats; Harvey, Alan R

    2014-11-01

    In this paper we present a brief review of studies that have reported therapeutic benefits of elevated cAMP on plasticity and regeneration after injury to the central nervous system (CNS). We also provide new data on the cellular mechanisms by which elevation of cyclic adenosine monophosphate (cAMP) promotes cytokine driven regeneration of adult CNS axons, using the visual system as the experimental model. cAMP is a second messenger for many intracellular signalling pathways. Elevation of cAMP in the eye by intravitreal injection of the cell permeant analogue (8-(4-chlorophenylthio)-adenosine-3',5'-cyclic monophosphate; CPT-cAMP), when added to recombinant ciliary neurotrophic factor (rCNTF), significantly enhances rCNTF-induced regeneration of adult rat retinal ganglion cell (RGC) axons into peripheral nerve (PN) grafted onto transected optic nerve. This effect is mediated to some extent by protein kinase A (PKA) signalling, but CPT-cAMP also acts via PI3K/Akt signalling to reduce suppressor of cytokine signalling protein 3 (SOCS3) activity in RGCs. Another target for cAMP is the exchange protein activated by cAMP (Epac), which can also mediate cAMP-induced axonal growth. Here we describe some novel results and discuss to what extent the pro-regenerative effects of CPT-cAMP on adult RGCs are mediated via Epac as well as via PKA-dependent pathways. We used the established PN-optic nerve graft model and quantified the survival and regenerative growth of adult rat RGCs after intravitreal injection of rCNTF in combination with a selective activator of PKA and/or a specific activator of Epac. Viable RGCs were identified by ?III-tubulin immunohistochemistry and regenerating RGCs retrogradely labelled and quantified after an injection of fluorogold into the distal end of the PN grafts, 4 weeks post-transplantation. The specific agonists of either PKA or Epac were both effective in enhancing the effects of rCNTF on RGC axonal regeneration, but interestingly, injections that combined rCNTF with both agonists were significantly less effective. The results are discussed in relation to previous CPT-cAMP studies on RGCs, and we also consider the need to modulate cAMP levels in order to obtain the most functionally effective regenerative response after CNS trauma. This article is part of a directed issue entitled: Regenerative Medicine: the challenge of translation. PMID:24796847

  6. p54nrb/NONO Regulates Cyclic AMP-Dependent Glucocorticoid Production by Modulating Phosphodiesterase mRNA Splicing and Degradation.

    PubMed

    Lu, Jia Yang; Sewer, Marion B

    2015-04-01

    Glucocorticoid production in the adrenal cortex is activated in response to an increase in cyclic AMP (cAMP) signaling. The nuclear protein p54(nrb)/NONO belongs to the Drosophila behavior/human splicing (DBHS) family and has been implicated in several nuclear processes, including transcription, splicing, and RNA export. We previously identified p54(nrb)/NONO as a component of a protein complex that regulates the transcription of CYP17A1, a gene required for glucocorticoid production. Based on the multiple mechanisms by which p54(nrb)/NONO has been shown to control gene expression and the ability of the protein to be recruited to the CYP17A1 promoter, we sought to further define the molecular mechanism by which p54(nrb)/NONO confers optimal cortisol production. We show here that silencing p54(nrb)/NONO expression in H295R human adrenocortical cells decreases the ability of the cells to increase intracellular cAMP production and subsequent cortisol biosynthesis in response to adrenocorticotropin hormone (ACTH) stimulation. Interestingly, the expression of multiple phosphodiesterase (PDE) isoforms, including PDE2A, PDE3A, PDE3B, PDE4A, PDE4D, and PDE11A, was induced in p54(nrb)/NONO knockdown cells. Investigation of the mechanism by which silencing of p54(nrb)/NONO led to increased expression of select PDE isoforms revealed that p54(nrb)/NONO regulates the splicing of a subset of PDE isoforms. Importantly, we also identify a role for p54(nrb)/NONO in regulating the stability of PDE transcripts by facilitating the interaction between the exoribonuclease XRN2 and select PDE transcripts. In summary, we report that p54(nrb)/NONO modulates cAMP-dependent signaling, and ultimately cAMP-stimulated glucocorticoid biosynthesis by regulating the splicing and degradation of PDE transcripts. PMID:25605330

  7. Purification of phospholamban, a 22,000-dalton protein from cardiac sarcoplasmic reticulum that is specifically phosphorylated by cyclic AMP-dependent protein kinase. [Dogs

    SciTech Connect

    Bidlack, J.M.; Ambudkar, I.S.; Shamoo, A.E.

    1982-04-25

    Very low concentrations of the detergent, deoxycholate, have been used to isolate two functionally interesting proteins from canine cardiac sarcoplasmic reticulum. These two proteins are phospholamban, a 22,000-dalton protein, specifically phosphorylated by adenosine 3':5'-monophosphate-dependent protein kinase, and the (Ca/sup 2 +/ + Mg/sup 2 +/)-ATPase, the major protein of the sarcoplasmic reticulum, responsible for the active transport of calcium. The 22,000-dalton protein is first solubilized in a very low concentration of deoxycholate (over 2 orders of magnitude lower than normally employed), and then subjected to column chromatography. After gel filtration through Sephadex G-75, the 22,000-dalton protein appears as a single band on sodium dodecyl sulfate-polyacrylamide gels. The purified protein is specifically phosphorylated by cyclic AMP-dependent protein kinase to a level of 0.15 mol of phosphate/mol of protein. The (Ca/sup 2 +/ + Mg/sup 2 +/)-ATPase is purified by first solubilizing all of the extrinsic proteins with a low concentration of deoxycholate. An increasing amount of the deoxycholate is then added to yield the purified (Ca/sup 2 +/ + Mg/sup 2 +/)-ATPase. This protein is at least 95% pure as determined by sodium dodecyl sulfate-polyacrylamide gels and has an ATP hydrolytic activity of about 1.25 ..mu..mol of Pi/mg/min. Further addition of deoxycholate to the purified enzyme enhances the enzyme's ability to hydrolyze ATP to approximately 2.5 ..mu..mol of Pi/mg/min. The isolation of the 22,000-dalton protein and the (Ca/sup 2 +/ + Mg/sup 2 +/)-ATPase will aid in understanding how these two proteins function and if they specifically interact with one another.

  8. Standardization of the assay for the catalytic subunit of cyclic AMP-dependent protein kinase using a synthetic peptide substrate.

    PubMed

    de la Houssaye, B A; Masaracchia, R A

    1983-01-01

    Optimal assay conditions for analyses of the catalytic subunit activity of the cyclic AMP-dependent protein kinase using a well-defined, commercially available synthetic peptide as the phosphate acceptor are defined. Activity of purified catalytic subunit toward the synthetic peptide Leu-Arg-Arg-Ala-Ser-Leu-Gly (PK-1; Kemptide) was 1.5- to 45-fold greater than activity toward other commonly used substrates such as histone fractions, casein, and protamine. The effects of buffer, pH, Mg2+, and protein kinase concentration on activity toward PK-1 were investigated. The optimal assay conditions determined were as follows: 20 mM Hepes or phosphate buffer, pH 7.5, 100 microM PK-1, 100 microM [gamma-32P]ATP, 3 mM MgCl2, 12 mM KCl, and 20-200 ng of catalytic subunit assayed at 30 degrees C. Since PK-1 is the only commercially available, well-defined substrate for this enzyme, adaption of the proposed standard assay conditions for the analyses of purified catalytic subunit activity will permit direct comparison of kinetic parameters and purity of enzyme preparations from multiple preparations. PMID:6303156

  9. A cyclic AMP receptor protein-regulated cell-cell communication system mediates expression of a FecA homologue in Stenotrophomonas maltophilia.

    PubMed

    Huang, Tzu-Pi; Wong, Amy C Lee

    2007-08-01

    Stenotrophomonas maltophilia WR-C possesses an rpf/diffusible signal factor (DSF) cell-cell communication system. It produces cis-Delta2-11-methyl-dodecenoic acid, a DSF, and seven structural derivatives, which require rpfF and rpfB for synthesis. Acquisition of iron from the environment is important for bacterial growth as well as the expression of virulence genes. We identified a gene homologous to fecA, which encodes a ferric citrate receptor that transports exogenous siderophore ferric citrate from the environment into the bacterial periplasm. Western blot analysis with anti-FecA-His(6) antibody showed that the FecA homologue was induced in the iron-depleted medium supplemented with a low concentration of ferric citrate. Deletion of rpfF or rpfB resulted in reduced FecA expression compared to the wild type. Synthetic DSF restored FecA expression by the DeltarpfF mutant to the wild-type level. Reverse transcription-PCR showed that the fecA transcript was decreased in the DeltarpfF mutant compared to the wild type. These data suggest that DSF affected the level of fecA mRNA. Transposon inactivation of crp, which encodes cyclic AMP (cAMP) receptor protein (CRP) resulted in reduced FecA expression and rpfF transcript level. Putative CRP binding sites were located upstream of the rpfF promoter, indicating that the effect of CRP on FecA is through the rpf/DSF pathway and by directly controlling rpfF. We propose that CRP may serve as a checkpoint for iron uptake, protease activity, and hemolysis in response to environmental changes such as changes in concentrations of glucose, cAMP, iron, or DSF. PMID:17574998

  10. Cyclic AMP-dependent protein kinase (cAPK) regulatory subunits are packaged and secreted by many exocrine and endocrine cells

    SciTech Connect

    Mednieks, M.I.; Hand, A.R.

    1986-05-01

    Regulatory (R) subunits of cAPK were identified by us as components of rat and human saliva by photoaffinity labeling with (/sup 32/P)-8-azido cyclic AMP. Photoaffinity labeling of purified rat parotid granule contents and immunogold labeling of thin sections with monoclonal antibodies showed the presence of R subunits in granules. The authors now report that cAPK R subunits are present in secretory granules and are apparently secreted by many exocrine and endocrine cell types. Labeling of thin sections of rat tissues with antibody to R subunits and protein A-gold shows gold particles over secretory granules of endocrine cells of the pituitary, pancreas and intestine. Zymogen granules of exocrine pancreatic acinar cells, the dense cores of secretory granules of seminal vesicle epithelial cells and secretory product in the seminal vesicle lumina were prominently labeled with gold. Photoaffinity labeling shows that pancreatic secretions and seminal vesicle contents have cAPK components. Phosphorylative modification of cellular proteins by cAMP controls hormonally stimulated protein secretion by many cell types. Although no catalytic activity was detected, identification of R subunits in granules and as secretory products indicates that they may have multiple roles in cellular mechanisms of action of cyclic AMP-mediated events in secretory cells.

  11. Cyclic AMP accelerates calcium waves in pancreatic acinar cells.

    PubMed

    Shah, Ahsan U; Grant, Wayne M; Latif, Sahibzada U; Mannan, Zahir M; Park, Alexander J; Husain, Sohail Z

    2008-06-01

    Cytosolic Ca(2+) (Ca(i)(2+)) flux within the pancreatic acinar cell is important both physiologically and pathologically. We examined the role of cAMP in shaping the apical-to-basal Ca(2+) wave generated by the Ca(2+)-activating agonist carbachol. We hypothesized that cAMP modulates intra-acinar Ca(2+) channel opening by affecting either cAMP-dependent protein kinase (PKA) or exchange protein directly activated by cAMP (Epac). Isolated pancreatic acinar cells from rats were stimulated with carbachol (1 muM) with or without vasoactive intestinal polypeptide (VIP) or 8-bromo-cAMP (8-Br-cAMP), and then Ca(i)(2+) was monitored by confocal laser-scanning microscopy. The apical-to-basal carbachol (1 muM)-stimulated Ca(2+) wave was 8.63 +/- 0.68 microm/s; it increased to 19.66 +/- 2.22 microm/s (*P < 0.0005) with VIP (100 nM), and similar increases were observed with 8-Br-cAMP (100 microM). The Ca(2+) rise time after carbachol stimulation was reduced in both regions but to a greater degree in the basal. Lag time and maximal Ca(2+) elevation were not significantly affected by cAMP. The effect of cAMP on Ca(2+) waves also did not appear to depend on extracellular Ca(2+). However, the ryanodine receptor (RyR) inhibitor dantrolene (100 microM) reduced the cAMP-enhancement of wave speed. It was also reduced by the PKA inhibitor PKI (1 microM). 8-(4-chloro-phenylthio)-2'-O-Me-cAMP, a specific agonist of Epac, caused a similar increase as 8-Br-cAMP or VIP. These data suggest that cAMP accelerates the speed of the Ca(2+) wave in pancreatic acinar cells. A likely target of this modulation is the RyR, and these effects are mediated independently by PKA and Epac pathways. PMID:18388188

  12. Regulation of cyclic AMP phosphodiesterase from human lung tissue by nucleosides and nucleotides

    E-print Network

    Glass, William Fredrick

    1978-01-01

    of +he snake venom 5'-nucleotidase to convert t'!e AMP to adenosine. Many nucleosides inhibit at milli- molar on en. rations, Adenosine inhibits with an sppsrern K of at!out 1. 0!!!M. For reasons discussed, this inhibitory ability may be of regulatory... of Cyclic GNP Phosphodiesterase by Nucleosides iX LIST OF FIGURES FIGURE PAGE Lineweaver-Burk plot showing inhibition of cyclic AMP phosphodiesterase by adenosine 13 Lineweaver-Burk plot showing inhibition of cyclic ANP phosphodiesterase by 2...

  13. Uptake and Degradation of Cyclic AMP by Chloronema Cells.

    PubMed

    Sharma, S; Johri, M M

    1982-06-01

    Suspension cultures of intact chloronema cells of the moss Funaria hygrometrica take up [(3)H]cAMP and degrade it rapidly. The increase in total radioactivity accumulated by the cells was linear up to 30 minutes. Initially, the major degradation products were 5'-AMP and adenosine, but later predominantly ADP and ATP. In spite of rapid degradation, the amount of extracellularly applied cAMP retained by the cells is about 4-fold higher than the maximum endogenous level of cAMP reported previously (Handa, Johri 1977 Plant Physiol 59: 490-496). The uptake showed a distinct dependence on the density of the culture. Cells at a lower cell density (1-2 milligrams per milliliter) accumulated 4 to 6 times more radioactivity than the cells at high density (>10 milligrams per milliliter). The cyclic nucleotide phosphodiesterase (cNPDE) activity of whole cells (18 milliunits per milligram protein) was comparable to that of protoplasts (23 milliunits per milligram protein), but about 4-fold lower than that of lysed protoplasts (80 milliunits per milligram protein), indicating an intracellular degradation of cAMP by chloronema cells. PMID:16662411

  14. REVIEW: Role of cyclic AMP signaling in the production and function of the incretin hormone glucagon-like peptide-1

    NASA Astrophysics Data System (ADS)

    Yu, Zhiwen; Jin, Tianru

    2008-01-01

    Pancreatic cells express the proglucagon gene (gcg) and thereby produce the peptide hormone glucagon, which stimulates hepatic glucose production and thereby increases blood glucose levels. The same gcg gene is also expressed in the intestinal endocrine L cells and certain neural cells in the brain. In the gut, gcg expression leads to the production of glucagon-like peptide-1 (GLP-1). This incretin hormone stimulates insulin secretion when blood glucose level is high. In addition, GLP-1 stimulates pancreatic cell proliferation, inhibits cell apoptosis, and has been utilized in the trans-differentiation of insulin producing cells. Today, a long-term effective GLP-1 receptor agonist has been developed as a drug in treating diabetes and potentially other metabolic disorders. Extensive investigations have shown that the expression of gcg and the production of GLP-1 can be activated by the elevation of the second messenger cyclic AMP (cAMP). Recent studies suggest that in addition to protein kinase A (PKA), exchange protein activated by cAMP (Epac), another effector of cAMP signaling, and the crosstalk between PKA and Wnt signaling pathway, are also involved in cAMP-stimulated gcg expression and GLP-1 production. Furthermore, functions of GLP-1 in pancreatic cells are mainly mediated by cAMP-PKA, cAMP-Epac and Wnt signaling pathways as well.

  15. Elevation of cyclic AMP levels in HL-60 cells accumulated in G1 or G2 by transmethylation inhibitors.

    PubMed

    Prytz, P S; Bang, B E; Endresen, P C; Møller, C; Aarbakke, J

    1991-10-01

    Effects of the transmethylation inhibitors 3-deazaadenosine (c3Ado) and 3-deaza-(+/-)-aristeromycin (c3Ari) on cell cycle and cyclic AMP (cAMP) concentrations in human promyelocytic leukemia cells (HL-60) were studied by flow cytometry and radioimmunoassay techniques. Previously described cell cycle accumulations, after incubation with drugs (25 microM) for two cell doublings (36 hr), were localized to G1 and G2 after incubation with c3Ado and c3Ari, respectively. cAMP levels were elevated in cells treated with c3Ado (35%) and c3Ari (92%) for 36 hr. Addition of the phosphodiesterase (PDE) inhibitor theophylline, increased cAMP levels further, while cAMP responsiveness to the beta-adrenergic stimulator isoproterenol was attenuated after c3Ado and c3Ari incubation. Homocysteine thiolactone (Hcy) alone reduced cell growth slightly (5%) and increased cAMP levels (17%). Hcy increased the growth inhibitory effects of c3Ado, while no modulating effect was seen in combination with c3Ari, nor did Hcy counteract the effects on the cell cycle perturbations. The results suggest that c3Ado- and c3Ari-induced cell cycle accumulation is, at least in part, mediated through cAMP elevation, possibly due to PDE inhibition secondary to S-adenosyl-homocysteine hydrolase inhibition and S-adenosyl-homocysteine build-up. PMID:1656997

  16. Pde1 Phosphodiesterase Modulates Cyclic AMP Levels through a Protein Kinase A-Mediated Negative Feedback Loop in Cryptococcus neoformans

    PubMed Central

    Hicks, Julie K.; Bahn, Yong-Sun; Heitman, Joseph

    2005-01-01

    The virulence of the human pathogenic fungus Cryptococcus neoformans is regulated by a cyclic AMP (cAMP)-dependent protein kinase A (PKA) signaling cascade that promotes mating and the production of melanin and capsule. In this study, genes encoding homologs of the Saccharomyces cerevisiae low- and high-affinity phosphodiesterases, PDE1 and PDE2, respectively, were deleted in serotype A strains of C. neoformans. The resulting mutants exhibited moderately elevated levels of melanin and capsule production relative to the wild type. Epistasis experiments indicate that Pde1 functions downstream of the G? subunit Gpa1, which initiates cAMP-dependent signaling in response to an extracellular signal. Previous work has shown that the PKA catalytic subunit Pka1 governs cAMP levels via a negative feedback loop. Here we show that a pde1? pka1? mutant strain exhibits cAMP levels that are dramatically increased (?15-fold) relative to those in a pka1? single mutant strain and that a site-directed mutation in a consensus PKA phosphorylation site reduces Pde1 function. These data provide evidence that fluctuations in cAMP levels are modulated by both Pka1-dependent regulation of Pde1 and another target that comprise a robust negative feedback loop to tightly constrain intracellular cAMP levels. PMID:16339715

  17. Roles of Intracellular Cyclic AMP Signal Transduction in the Capacitation and Subsequent Hyperactivation of Mouse and Boar Spermatozoa

    PubMed Central

    HARAYAMA, Hiroshi

    2013-01-01

    It is not until accomplishment of a variety of molecular changes during the transit through the female reproductive tract that mammalian spermatozoa are capable of exhibiting highly activated motility with asymmetric whiplash beating of the flagella (hyperactivation) and undergoing acrosomal exocytosis in the head (acrosome reaction). These molecular changes of the spermatozoa are collectively termed capacitation and promoted by bicarbonate, calcium and cholesterol acceptors. Such capacitation-promoting factors can stimulate intracellular cyclic AMP (cAMP) signal transduction in the spermatozoa. Meanwhile, hyperactivation and the acrosome reaction are essential to sperm fertilization with oocytes and are apparently triggered by a sufficient increase of intracellular Ca2+ in the sperm flagellum and head, respectively. Thus, it is necessary to investigate the relationship between cAMP signal transduction and calcium signaling cascades in the spermatozoa for the purpose of understanding the molecular basis of capacitation. In this review, I cover updated insights regarding intracellular cAMP signal transduction, the acrosome reaction and flagellar motility in mammalian spermatozoa and then account for possible roles of intracellular cAMP signal transduction in the capacitation and subsequent hyperactivation of mouse and boar spermatozoa. PMID:24162806

  18. Inhibition of olfactory cyclic nucleotide-activated current by calmodulin antagonists.

    PubMed

    Kleene, S J

    1994-02-01

    1. In amphibian olfactory receptor neurones, much of the depolarizing current in response to odours is carried by cationic channels that are directly gated by cyclic AMP. The effects of four calmodulin antagonists on the cyclic AMP-activated receptor current were studied in single olfactory cilia of the frog. 2. Two antagonists, W-7 and trifluoperazine, were potent and reversible inhibitors of the cyclic AMP-activated current. IC50 values were 5 microM for W-7 and 13 microM for trifluoperazine. A third antagonist, calmidazolium, irreversibly blocked the current. The fourth, mastoparan, had little effect. 3. Calmodulin was unable to reverse the effects of W-7 and trifluoperazine, suggesting that these inhibitors act directly on the cyclic AMP-gated channels. 4. Neither W-7 nor trifluoperazine inhibited a Ca(2+)-activated Cl- current which also contributes to the odorant response. These compounds thus allow the two components of the olfactory receptor current to be discriminated. PMID:7516255

  19. Mechanism of action of hydrogen sulfide on cyclic AMP formation in rat retinal pigment epithelial cells.

    PubMed

    Njie-Mbye, Ya Fatou; Kulkarni, Madhura; Opere, Catherine A; Ohia, Sunny E

    2012-05-01

    Hydrogen sulfide (H(2)S), a colorless gas with the pungent odor of rotten eggs has been reported to produce pharmacological actions in ocular and non-ocular tissues. We have evidence that H(2)S, using sodium hydrosulfide (NaHS) and sodium sulfide (Na(2)S) as donors can increase cyclic AMP (cAMP) production in neural retina. In the present study, we investigated the mechanism of action of H(2)S on cyclic nucleotide production in rat retinal pigment epithelial cells (RPE-J). Cultured RPE-J cells were incubated for 30 min in culture medium containing the cyclic nucleotide phosphodiesterase (PDE) inhibitor, IBMX (2 mM). Cells were exposed to varying concentrations of NaHS, the H(2)S substrate (L-cysteine), cyclooxygenase (COX) inhibitors or the diterpene activator of adenylate cyclase, forskolin in the presence or absence of H(2)S biosynthetic enzymes or the ATP-sensitive potassium (K(ATP)) channel antagonist, glibenclamide. Following drug-treatment at different time intervals, cell homogenates were prepared for cAMP assay using a well established methodology. In RPE-J cells, NaHS (10 nM-1 ?M) produced a time-dependent increase in cAMP concentrations over basal levels which reached a maximum at 20 min. At this time point, both NaHS (1 nM-100 ?M) and L-cysteine (1 nM-10 ?M) produced a concentration-dependent significant (p<0.05) increase in cAMP concentrations over basal level. The effects of NaHS on cAMP levels in RPE-J cells was enhanced significantly (p<0.01) in the presence of the COX inhibitors, indomethacin and flurbiprofen. In RPE-J cells, the effects caused by forskolin (10 ?M) on cAMP production were potentiated by addition of low concentrations of NaHS. Both the inhibitor of cystathionine ?-synthase (CBS), aminooxyacetic acid (AOA, 1 mM) and the inhibitor of cystathionine ?-lyase (CSE), proparglyglycine (PAG, 1mM) significantly attenuated the increased effect of L-cysteine on cAMP production. The K(ATP) channel antagonist, glibenclamide (100 ?M) caused inhibition of NaHS induced-increase of cAMP formation in RPE-J cells. We conclude that, H(2)S (using H(2)S donor and substrate) can increase cAMP production in RPE-J cells, and removal of the apparent inhibitory effect of prostaglandins unmasks an excitatory activity of H(2)S on cAMP. Effects elicited by the H(2)S substrate on cAMP formation are dependent on biosynthesis of H(2)S catalyzed by the biosynthetic enzymes, CBS and CSE. In addition to the adenylyl cylcase pathway, K(ATP) channels are involved in mediating the observed effects of the H(2)S on cAMP production. PMID:22445555

  20. The effect of chronic treatment with trandolapril on cyclic AMP- and cyclic GMP-dependent relaxations in aortic segments of rats with chronic heart failure

    PubMed Central

    Toyoshima, Hiroko; Nasa, Yoshihisa; Kohsaka, Yumi; Isayama, Yoko; Yamaguchi, Fuminari; Sanbe, Atsushi; Takeo, Satoshi

    1998-01-01

    Characteristics of cyclic GMP- and cyclic AMP-mediated relaxation in aortic segments of rats with chronic heart failure (CHF) and the effects of chronic treatment with an angiotensin?I converting enzyme (ACE) inhibitor, trandolapril, were examined 8 weeks after coronary artery ligation.Cardiac output indices of coronary artery-ligated and sham-operated rats were 125±8 and 189±10?ml?min?1?kg?1, respectively (P<0.05), indicating the development of CHF at this period.The maximal relaxant response of aortic segments to 10??M acetylcholine in rats with CHF and sham-operated rats was 64.0±5.7 and 86.9±1.9%, respectively (P<0.05), whereas the relaxant response to sodium nitroprusside (SNP) remained unchanged. Tissue cyclic GMP content in rats with CHF was lower than that of sham-operated rats.In endothelium-intact segments of rats with CHF, the maximal relaxant response to 10??M isoprenaline (44.5±6.7%) was lower that sham-operated rats (81.3±2.5%, P<0.05) and the concentration-response curve for NKH477, a water-soluble forskolin, was shifted to the right without a reduction in the maximal response. Isoprenaline-induced relaxation of aortic segments was attenuated by NG-nitro-L-arginine methyl ester (L-NAME) in sham-operated rats, but not in rats with CHF. Relaxation to 30??M dibutyryl cyclic AMP in rats with CHF (26.8±2.7%) was lower than that in sham-operated rats (63.4±11.8%, P<0.05).Trandolapril (3?mg?kg?1?day?1) was orally administered from the 2nd to 8th week after the operation. Aortic blood flow of rats with CHF (38.5±3.6?ml?min?1) was lower than that of sham-operated rats (55.0±3.0?ml?min?1), and this reduction was reversed (54.1±3.4?ml?min?1) by treatment with trandolapril. The diminished responsiveness described above was normalized in the trandolapril-treated rat with CHF (i.e., the maximal relaxation to acetylcholine, 94.7±1.0%; that to isoprenaline, 80.5±2.8%; that to dibutyryl cyclic AMP, 54.7±6.2%). However, aortic segments of trandolapril-treated rats with CHF, L-NAME did not attenuate isoprenaline-induced relaxation and the tissue cyclic GMP level was not fully restored, suggesting that the ability of the endothelium to produce NO was still partially damaged.The results suggest that vasorelaxation in CHF, diminished mainly due to dysfunction in endothelial nitric oxide (NO) production and cyclic AMP-mediated signal transduction, was partially restored by long-term treatment with trandolapril. The mechanism underlying the restoration may be attributed in part to prevention of CHF-induced endothelial dysfunction. PMID:9489624

  1. The endogenous cyclic AMP antagonist, cyclic PIP: its ubiquity, hormone-stimulated synthesis and identification as prostaglandylinositol cyclic phosphate

    Microsoft Academic Search

    H. K. Wasner; U. Salge; M. Gebel

    1993-01-01

    This report shows that the cyclic AMP antagonist cyclic PIP is present in all organs and tissues of the rat so far examined: brain, heart, lung, intestine, kidney, liver, spleen, skeletal muscle and fat. The synthesis of cyclic PIP is stimulated by insulin or noradrenaline (a-adrenergic action) in a dose-dependent fashion. Increasing cyclic PIP synthesis with increasing insulin concentrations matches

  2. Synthetic hexapeptide substrates and inhibitors of 3':5'-cyclic AMP-dependent protein kinase.

    PubMed Central

    Kemp, B E; Benjamini, E; Krebs, E G

    1976-01-01

    The substrate specificity of the catalytic subunit of rabbit skeletal muscle 3': 5'-cyclic AMP-dependent protein kinase (EC 2.7.1.37; ATP: protein phosphotransferase) has been studied using the synthetic peptide Arg-Gly-Tyr-Ser-Leu-Gly corresponding to the sequence around serine 24, a phosphorylation site in reduced, carboxymethylated, maleylated (RCMM) chicken egg white lysozyme. This peptide served as a substrate for the enzyme and exhibited a 6-fold higher Vmax and a 100-fold higher Km than RCMM-lysozyme. Replacement of the arginine with glycine, histidine, or lysine resulted in a dramatic reduction in the Vmax. These results support the concept that arginine is an important residue in determining the substrate specificity of the protein kinase, predominantly influencing the Vmax of the phosphorylation reaction. Two synthetic peptides in which serine was replaced by an alanine acted as competitive inhibitors of phosphorylation of the synthetic peptide substrate and RCMM-lysozyme. PMID:177970

  3. Cyclic AMP inhibits neuromuscular junction maturation mediated by intracellular Ca(2+).

    PubMed

    Song, Wei; Jin, Xiwan Albert

    2015-03-01

    The neuromuscular junction (NMJ) is established through initial contact of motor neuron axon with a skeletal muscle cell and the subsequent synaptic maturation. Previous studies have shown that cyclic AMP (cAMP) enhanced spinal neurons' survival and growth but inhibited synaptogenesis. Here, we find that elevating intracellular cAMP level of presynaptic neurons prevented NMJs from maturation both physiologically and morphologically. Importantly, cytosolic Ca(2+) is essential for the inhibitory effects of cAMP on NMJ maturation. We show that depletion of intracellular Ca(2+) store, rather than extracellular Ca(2+), abolished the cAMP-dependent inhibition of synaptic maturation. Taken together, we demonstrate that Ca(2+) released from intracellular Ca(2+) stores regulates neurotrophic actions on NMJ maturation. PMID:25596442

  4. Calciproteins regulate cyclic AMP content and melatonin secretion in trout pineal photoreceptors.

    PubMed

    Bégay, V; Collin, J P; Falcón, J

    1994-10-27

    Photoreceptor cells of the fish pineal transduce photoperiodic information into the rhythmic secretion of melatonin. The nocturnal rise in melatonin secretion has been associated with an increase in cyclic AMP (cAMP) production and with an entry of Ca2+ ions through L-type voltage-dependent channels. It is shown here that two inhibitors of calciproteins, W7 and calmidazolium, inhibit melatonin secretion and, to a lesser extent, cAMP levels in cultured trout pineal photoreceptors. Kinetic studies indicated that melatonin secretion was affected earlier than cAMP in cells cultured in the presence of W7. The present results provide evidence that Ca2+ acts through one or more calciproteins to regulate melatonin production. It is suggested that Ca2+/calciprotein complexes might act at two different sites, one involving regulation of cAMP metabolism, and the other being independent from cAMP. PMID:7865734

  5. Cyclic AMP-mediated regulation of striatal glutamate release: interactions of presynaptic ligand- and voltage-gated ion channels and G-protein-coupled receptors.

    PubMed

    Dohovics, Róbert; Janáky, Réka; Varga, Vince; Saransaari, Pirjo; Oja, Simo S

    2003-01-01

    The presynaptic regulation of striatal glutamate transmission was investigated using D-[3H]aspartate and mouse striatal slices. Functional changes in voltage-dependent and glutamate receptor-gated ion channels were elicited by pharmacologically modifying intracellular cyclic AMP formation via G-protein-coupled receptor stimulation. The kainate (KA)-evoked release was potentiated by the stimulatory G-protein (G(s))-coupled beta-adrenoceptor agonist isoproterenol (ISO) in a concentration-dependent manner. This effect was mimicked by the specific calmodulin (CaM) antagonists trifluoperazine and calmidazolium. Tetrodotoxin (TTX), a blocker of Na(+) channels, did not affect the basal release but inhibited to the same degree the releases evoked by kainate alone and by kainate and isoproterenol together. Vinpocetine, a blocker of voltage-dependent Na(+) channels, did not alter the basal or the evoked release. The Na(+) channel activator veratridine enhanced the basal release in a concentration-dependent manner and isoproterenol attenuated this effect. The opposite effects of isoproterenol on the kainate- and veratridine-evoked releases may reflect prevention of the cyclic AMP-protein kinase A (PKA) phosphorylation cascade in striatal glutamatergic signal transduction. In addition, the calmidazolium-induced potentiation of kainate-evoked release was thwarted by LY354740 and L-2-amino-4-phosphonobutanoate, agonists of the inhibitory G-protein (G(i))-coupled metabotropic group II and III glutamate receptors (mGluRs). Vinpocetine, which inhibits the CaM-dependent phosphodiesterase (PDE1), was likewise inhibitory. In turn, selective agonists and antagonists of the G(q)-protein-coupled group I mGluRs and (S)-3,5-dihydroxyphenylglycine (3,5-DHPG) and (RS)-1-aminoindan-1,5-dicarboxylate (AIDA), which modulate the intracellular Ca(2+) levels, did not alter the kainate-evoked release. The beta-adrenoceptor-mediated cyclic AMP accumulation seems to downregulate Na(+) channels but to enhance glutamate release by means of upregulation of kainate receptors. This regulation of presynaptic ligand- and voltage-gated ion channels is affected by the cAMP-protein kinase A-dependent phosphorylation cascade and controlled by G(i)-protein-coupled mGluRs. PMID:12742088

  6. Cross Talk between the Cell Wall Integrity and Cyclic AMP/Protein Kinase A Pathways in Cryptococcus neoformans

    PubMed Central

    Donlin, Maureen J.; Upadhya, Rajendra; Gerik, Kimberly J.; Lam, Woei; VanArendonk, Laura G.; Specht, Charles A.; Sharma, Neil K.

    2014-01-01

    ABSTRACT Cryptococcus neoformans is a fungal pathogen of immunocompromised people that causes fatal meningitis. The fungal cell wall is essential to viability and pathogenesis of C. neoformans, and biosynthesis and repair of the wall is primarily controlled by the cell wall integrity (CWI) signaling pathway. Previous work has shown that deletion of genes encoding the four major kinases in the CWI signaling pathway, namely, PKC1, BCK1, MKK2, and MPK1 results in severe cell wall phenotypes, sensitivity to a variety of cell wall stressors, and for Mpk1, reduced virulence in a mouse model. Here, we examined the global transcriptional responses to gene deletions of BCK1, MKK2, and MPK1 compared to wild-type cells. We found that over 1,000 genes were differentially expressed in one or more of the deletion strains, with 115 genes differentially expressed in all three strains, many of which have been identified as genes regulated by the cyclic AMP (cAMP)/protein kinase A (PKA) pathway. Biochemical measurements of cAMP levels in the kinase deletion strains revealed significantly less cAMP in all of the deletion strains compared to the wild-type strain. The deletion strains also produced significantly smaller capsules than the wild-type KN99 strain did under capsule-inducing conditions, although the levels of capsule they shed were similar to those shed by the wild type. Finally, addition of exogenous cAMP led to reduced sensitivity to cell wall stress and restored surface capsule to levels near those of wild type. Thus, we have direct evidence of cross talk between the CWI and cAMP/PKA pathways that may have important implications for regulation of cell wall and capsule homeostasis. PMID:25118241

  7. Expression of a Subset of Heat Stress Induced Genes of Mycobacterium tuberculosis Is Regulated by 3',5'-Cyclic AMP

    PubMed Central

    Choudhary, Eira; Bishai, William; Agarwal, Nisheeth

    2014-01-01

    Mycobacterium tuberculosis (Mtb) secretes excess of a second messenger molecule, 3',5'-cyclic AMP (cAMP), which plays a critical role in the survival of Mtb in host macrophages. Although Mtb produces cAMP in abundance, its exact role in the physiology of mycobacteria is elusive. In this study we have analyzed the expression of 16 adenylate cyclases (ACs) and kinetics of intracellular cAMP levels in Mtb during in vitro growth under the regular culture conditions, and after exposure to different stress agents. We observed a distinct expression pattern of these ACs which is correlated with intracellular cAMP levels. Interestingly cAMP levels are significantly elevated in Mtb following heat stress, whereas other stress conditions such as oxidative, nitrosative or low pH do not affect intracellular cAMP pool in vitro. A significant increase in expression by >2-fold of five ACs namely Rv1647, Rv2212, Rv1625c, Rv2488c and Rv0386 after heat stress further suggested that cAMP plays an important role in controlling Mtb response to heat stress. In the light of these observations, effect of exogenous cAMP on global gene expression profile was examined by using microarrays. The microarray gene expression analysis demonstrated that cAMP regulates expression of a subset of heat stress-induced genes comprising of dnaK, grpE, dnaJ, and Rv2025c. Further we performed electrophoretic mobility shift assay by using cAMP-receptor protein of Mtb (CRPM), which demonstrated that CRPM specifically recognizes a sequence ?301AGCGACCGTCAGCACG?286 in 5'-untranslated region of dnaK. PMID:24587015

  8. Regulation of the inflammatory response of vascular endothelial cells by EPAC1

    PubMed Central

    Parnell, Euan; Smith, Brian O; Palmer, Timothy M; Terrin, Anna; Zaccolo, Manuela; Yarwood, Stephen J

    2012-01-01

    Life-threatening diseases of the cardiovascular system, like atherosclerosis, are exacerbated by unwanted inflammation within the structures of large blood vessels. This inflammation involves increased permeability of the vascular endothelial cells (VECs) that form the lining of blood vessels, leading to exaggerated extravasation of blood components and accumulation of fluid in the extravascular space. This results in tissue dysfunction and increased secretion of chemokines that attract leukocytes and monocytes to the inflamed endothelium. Cyclic AMP is synthesized in VECs in response to endogenous Gs-coupled receptors and is known to limit cytokine action and reduce endothelial hyperpermeability induced by multiple pro-inflammatory stimuli. The mechanisms underlying this anti-inflammatory action of cyclic AMP are now being elucidated and it is becoming clear that the cyclic AMP sensor, exchange protein activated by cyclic AMP (EPAC1), appears to play a key role in suppressing unwanted inflammation. EPAC1 mediates at least three anti-inflammatory pathways in VECs by down-regulating inflammatory signalling through the induction of the suppressors of cytokine signalling 3 (SOCS-3) gene, limiting integrin-dependent vascular permeability and enhancing endothelial barrier function through the stabilization of VE-cadherin junctions. Given that manipulation of cellular cyclic AMP levels currently forms the basis of many effective pharmaceuticals and that EPAC1 is involved in multiple anti-inflammatory protective processes in VECs, does this make EPAC1 an attractive target for the development of activators capable of eliciting a coordinated programme of ‘protection’ against the development of endothelial dysfunction? Here we discuss whether EPAC1 represents an attractive therapeutic target for limiting endothelial dysfunction associated with cardiovascular diseases like atherosclerosis. LINKED ARTICLES This article is part of a themed section on Novel cAMP Signalling Paradigms. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2012.166.issue-2 PMID:22145651

  9. Thyroid-stimulating hormone-regulated growth and cell cycle distribution of thyroid cells involve type I isozyme of cyclic AMP-dependent protein kinase.

    PubMed

    Tortora, G; Pepe, S; Cirafici, A M; Ciardiello, F; Porcellini, A; Clair, T; Colletta, G; Cho-Chung, Y S; Bianco, A R

    1993-05-01

    Optimal growth and differentiation of normal rat thyroid FRTL5 cells depend strictly on the presence of thyroid-stimulating hormone (TSH). FRTL5 cells deprived of TSH cease dividing and become quiescent. Addition of TSH to quiescent cells, which activates the cyclic AMP-mediated pathway, is sufficient to stimulate cell entry into S phase of the cell cycle. We have previously shown that the differential expression of the two isozymes, type I and type II, of the cyclic AMP-dependent protein kinase (PKA) correlates with cell growth and differentiation of several rodent and human cell lines. We have studied the role of PKA in the TSH-regulated growth and cell cycle distribution of FRTL5 cells. Upon addition of TSH to FRTL5 cells deprived of hormone, a rapid induction of RI alpha mRNA species occurred within 30 min after treatment, reaching the levels of proliferating FRTL5 cells at 12 h. RII alpha mRNA levels slightly increased after TSH addition, whereas C alpha mRNA levels did not show major changes. Photoaffinity labeling of PKA receptor proteins showed that addition of TSH to quiescent FRTL5 cells induced a progressive increase in RI alpha levels starting at 6 h after stimulation, whereas RII alpha receptor levels increased only slightly. When FRTL5 cells were treated with an antisense oligodeoxynucleotide targeted against the RI alpha regulatory subunit, their growth was arrested, whereas an antisense against the RII alpha regulatory subunit produced only a mild growth inhibition. Moreover, exposure to the antisense RI alpha oligomer resulted in accumulation of cells in the G0-G1 compartment, as during TSH deprivation.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8518230

  10. Dibutyryl cyclic AMP induces differentiation of human neuroblastoma SH-SY5Y cells into a noradrenergic phenotype.

    PubMed

    Kume, Toshiaki; Kawato, Yuka; Osakada, Fumitaka; Izumi, Yasuhiko; Katsuki, Hiroshi; Nakagawa, Takayuki; Kaneko, Shuji; Niidome, Tetsuhiro; Takada-Takatori, Yuki; Akaike, Akinori

    2008-10-10

    Dibutyryl cyclic AMP (dbcAMP) and retinoic acid (RA) have been demonstrated to be the inducers of morphological differentiation in SH-SY5Y cells, a human catecholaminergic neuroblastoma cell line. However, it remains unclear whether morphologically differentiated SH-SY5Y cells by these compounds acquire catecholaminergic properties. We focused on the alteration of tyrosine hydroxylase (TH) expression and intracellular content of noradrenaline (NA) as the indicators of functional differentiation. Three days treatment with dbcAMP (1mM) and RA (10microM) induced morphological changes and an increase of TH-positive cells using immunocytochemical analysis in SH-SY5Y cells. The percentage of TH-expressing cells in dbcAMP (1mM) treatment was larger than that in RA (10microM) treatment. In addition, dbcAMP increased intracellular NA content, whereas RA did not. The dbcAMP-induced increase in TH-expressing cells is partially inhibited by KT5720, a protein kinase A (PKA) inhibitor. We also investigated the effect of butyrate on SH-SY5Y cells, because dbcAMP is enzymatically degraded by intracellular esterase, thereby resulting in the formation of butyrate. Butyrate induced the increase of NA content at lower concentrations than dbcAMP, although the increase in TH-expressing cells by butyrate was smaller than that by dbcAMP. The dbcAMP (1mM)- and butyrate (0.3mM)-induced increase in NA content was completely suppressed by alpha-methyl-p-tyrosine (1mM), an inhibitor of TH. These results suggest that dbcAMP induces differentiation into the noradrenergic phenotype through both PKA activation and butyrate. PMID:18691633

  11. Cloning and expression of cDNA for a human low-Km, rolipram-sensitive cyclic AMP phosphodiesterase.

    PubMed

    Livi, G P; Kmetz, P; McHale, M M; Cieslinski, L B; Sathe, G M; Taylor, D P; Davis, R L; Torphy, T J; Balcarek, J M

    1990-06-01

    We have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and Drosophila cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH2 terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding region of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-Km cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product. Human genomic Southern blot analysis suggests that this enzyme is likely to be encoded by a single gene. The presence of the enzyme in monocytes may be important for cell function in inflammation. Rolipram sensitivity, coupled with homology to the Drosophila cAMP PDEase, which is required for learning and memory in flies, suggests an additional function for this enzyme in neurobiochemistry. PMID:2160582

  12. A catalytic subunit of cyclic AMP-dependent protein kinase, PKAC-1, regulates asexual differentiation in Neurospora crassa.

    PubMed

    Banno, Shinpei; Ochiai, Noriyuki; Noguchi, Rieko; Kimura, Makoto; Yamaguchi, Isamu; Kanzaki, Sei-ichi; Murayama, Tadako; Fujimura, Makoto

    2005-02-01

    A cyclic AMP (cAMP)-dependent protein kinase pathway has been shown to regulate growth, morphogenesis and virulence in filamentous fungi. However, the precise mechanisms of regulation through the pathway remain poorly understood. In Neurospora crassa, the cr-1 adenylate cyclase mutant exhibits colonial growth with short aerial hyphae bearing conidia, and the mcb mutant, a mutant of the regulatory subunit of cAMP-dependent protein kinase (PKA), shows the loss of growth polarity at the restrictive temperature. In the present study, we isolated mutants of the catalytic subunit of the PKA gene pkac-1 through the process of repeat-induced point mutation (RIP). PKA activity of the mutants obtained through RIP was undetectable. The genome sequence predicts two distinct catalytic subunit genes of PKA, named pkac-1 (NCU06240.1, AAF75276) and pkac-2 (NCU00682.1), as is the case in most filamentous fungi. The results suggest that PKAC-1 works as the major PKA in N. crassa. The phenotype of the pkac-1 mutants included colonial growth, short aerial hyphae, premature conidiation on solid medium, inappropriate conidiation in submerged culture, and increased thermotolerance. This phenotype of pkac-1 mutants resembled to that of cr-1 mutants, except that the addition of cAMP did not rescue the abnormal morphology of pkac-1 mutants. The loss of growth polarity at the restrictive temperature in the mcb mutant was suppressed by pkac-1 mutation. These results suggest that the signal transduction pathway mediated by PKAC-1 plays an important role in regulation of aerial hyphae formation, conidiation, and hyphal growth with polarity. PMID:15824453

  13. The Paired-Domain Transcription Factor Pax8 Binds to the Upstream Enhancer of the Rat Sodium/Iodide Symporter Gene and Participates in Both Thyroid-Specific and Cyclic-AMP-Dependent Transcription

    PubMed Central

    Ohno, Makoto; Zannini, Mariastella; Levy, Orlie; Carrasco, Nancy; di Lauro, Roberto

    1999-01-01

    The gene encoding the Na/I symporter (NIS) is expressed at high levels only in thyroid follicular cells, where its expression is regulated by the thyroid-stimulating hormone via the second messenger, cyclic AMP (cAMP). In this study, we demonstrate the presence of an enhancer that is located between nucleotides ?2264 and ?2495 in the 5?-flanking region of the NIS gene and that recapitulates the most relevant aspects of NIS regulation. When fused to either its own or a heterologous promoter, the NIS upstream enhancer, which we call NUE, stimulates transcription in a thyroid-specific and cAMP-dependent manner. The activity of NUE depends on the four most relevant sites, identified by mutational analysis. The thyroid-specific transcription factor Pax8 binds at two of these sites. Mutations that interfere with Pax8 binding also decrease transcriptional activity of the NUE. Furthermore, expression of Pax8 in nonthyroid cells results in transcriptional activation of NUE, strongly suggesting that the paired-domain protein Pax8 plays an important role in NUE activity. The NUE responds to cAMP in both protein kinase A-dependent and -independent manners, indicating that this enhancer could represent a novel type of cAMP responsive element. Such a cAMP response requires Pax8 but also depends on the integrity of a cAMP responsive element (CRE)-like sequence, thus suggesting a functional interaction between Pax8 and factors binding at the CRE-like site. PMID:10022892

  14. Covalent labelling of ligand binding sites of human placental S-adenosylhomocysteine hydrolase with 8-azido derivatives of adenosine and cyclic AMP.

    PubMed Central

    Aiyar, V N; Hershfield, M S

    1985-01-01

    S-Adenosylhomocysteine hydrolase (AdoHcyase) has previously been identified as a cytoplasmic adenosine and cyclic AMP binding protein. In order to examine the relationship between the adenosine and cyclic AMP binding sites on this enzyme we have explored the use of 8-azido analogues of adenosine and cyclic AMP as photoaffinity reagents for covalently labelling AdoHcyase purified from human placenta. 8-Azidoadenosine (8-N3-Ado), like adenosine, inactivated AdoHcyase, and the rate of inactivation was greatly increased by periodate oxidation. In addition, 8-N3-Ado was found to participate in the first step in the catalytic mechanism for AdoHcyase, resulting in conversion of enzyme-bound NAD+ to NADH, although it was not a substrate for the full enzyme-catalysed reaction. Radioactively labelled 8-N3-Ado, its periodate-oxidized derivative and 8-azidoadenosine 3', 5'-phosphate (8-N3-cAMP) bound specifically to adenosine binding sites on AdoHcyase and, after irradiation, became covalently linked to the enzyme. Photoaffinity-labelled enzyme could be precipitated by monoclonal antibody to human AdoHcyase. Two observations suggested that cyclic AMP and adenosine bind to the same sites on AdoHcyase. First cyclic AMP and adenosine each blocked binding of both radioactively labelled 8-N3-Ado and 8-N3-cAMP, and second, digestion with V8 proteinase generated identical patterns of peptides from AdoHcyase that had been photolabelled with [32P]8-N3-cAMP and [3H]8-N3-Ado. Binding sites for cyclic AMP on AdoHcyase were found to differ functionally and structurally from cyclic AMP binding sites on the R1 regulatory subunit of cyclic AMP-dependent protein kinase. Images Fig. 2. Fig. 3. PMID:3004411

  15. Action of various antidepressant treatments reduces reactivity of noradrenergic cyclic AMP-generating system in limbic forebrain

    Microsoft Academic Search

    Jerzy Vetulani; Fridolin Sulser

    1975-01-01

    STUDIES on the pharmacology of the noradrenergic cyclic AMP-generating system in slices from the limbic forebrain of the rat1 and on adaptive properties of this system in conditions of persistent changes in the availability of nor-adrenaline (NA) have revealed that the system may serve as a model for the central NA receptor in this area, and that its sensitivity to

  16. Cyclic AMP restores a normal phenotype to sis oncogene transformed cells and inhibits inositol phospholipid turnover

    SciTech Connect

    Murphy, S.K.; Lazarus, A.; Pendergas, M.; Lockwood, A.H.

    1987-05-01

    The sis oncogene encodes the A chain of platelet-derived growth factor (PDGF). NIH3T3 fibroblasts transfected with the cloned sis oncogene display a malignant phenotype and have enhanced turnover of the regulatory phospholipid phosphatidylinositol 4,5 biphosphate (PIP2). They have found that elevation of intracellular cyclic AMP can restore many aspects of normal growth and morphology to sis-transformed cells. Cells rapidly become less refractile, flatten on the substratum, develop actomyosin bundles, and acquire a more tranquil membrane. Growth rate and saturation density are reduced. Cultures become contact-inhibited and, at confluence, assume a normal fibrobastic morphology. The ability to grow in low serum or suspension is lost. Following addition of 8-Br-cAMP, cellular levels of PIP and PIP2 increase to those in untransformed cells. Concurrently, the steady-state levels of inositol phosphates are reduced to normal values. They have found a similar effect of cAMP on inositol phospholipid metabolism in cells transformed by the human H-ras oncogene. These results suggest that cAMP, acting through the cAMP-dependent protein kinase, antagonizes ras and sis oncogene expression by inhibiting polyphosphoinositide turnover. Such action might occur by phosphorylation of the PDGF (sis) receptor or of a ras-stimulated phospholipase C.

  17. Cyclic AMP-dependent Protein Kinase Regulates the Alternative Splicing of Tau Exon 10

    PubMed Central

    Shi, Jianhua; Qian, Wei; Yin, Xiaomin; Iqbal, Khalid; Grundke-Iqbal, Inge; Gu, Xiaosong; Ding, Fei; Gong, Cheng-Xin; Liu, Fei

    2011-01-01

    Hyperphosphorylation and deposition of tau into neurofibrillary tangles is a hallmark of Alzheimer disease (AD). Alternative splicing of tau exon 10 generates tau isoforms containing three or four microtubule binding repeats (3R-tau and 4R-tau), which are equally expressed in adult human brain. Dysregulation of exon 10 causes neurofibrillary degeneration. Here, we report that cyclic AMP-dependent protein kinase, PKA, phosphorylates splicing factor SRSF1, modulates its binding to tau pre-mRNA, and promotes tau exon 10 inclusion in cultured cells and in vivo in rat brain. PKA-C?, but not PKA-C?, interacts with SRSF1 and elevates SRSF1-mediated tau exon 10 inclusion. In AD brain, the decreased level of PKA-C? correlates with the increased level of 3R-tau. These findings suggest that a down-regulation of PKA dysregulates the alternative splicing of tau exon 10 and contributes to neurofibrillary degeneration in AD by causing an imbalance in 3R-tau and 4R-tau expression. PMID:21367856

  18. Cyclic AMP in oocytes controls meiotic prophase I and primordial folliculogenesis in the perinatal mouse ovary.

    PubMed

    Wang, Yijing; Teng, Zhen; Li, Ge; Mu, Xinyi; Wang, Zhengpin; Feng, Lizhao; Niu, Wanbao; Huang, Kun; Xiang, Xi; Wang, Chao; Zhang, Hua; Xia, Guoliang

    2015-01-15

    In mammalian ovaries, a fixed population of primordial follicles forms during the perinatal stage and the oocytes contained within are arrested at the dictyate stage of meiotic prophase I. In the current study, we provide evidence that the level of cyclic AMP (cAMP) in oocytes regulates oocyte meiotic prophase I and primordial folliculogenesis in the perinatal mouse ovary. Our results show that the early meiotic development of oocytes is closely correlated with increased levels of intra-oocyte cAMP. Inhibiting cAMP synthesis in fetal ovaries delayed oocyte meiotic progression and inhibited the disassembly and degradation of synaptonemal complex protein 1. In addition, inhibiting cAMP synthesis in in vitro cultured fetal ovaries prevented primordial follicle formation. Finally, using an in situ oocyte chromosome analysis approach, we found that the dictyate arrest of oocytes is essential for primordial follicle formation under physiological conditions. Taken together, these results suggest a role for cAMP in early meiotic development and primordial follicle formation in the mouse ovary. PMID:25503411

  19. Agonist trafficking of Gi/o-mediated ?2A-adrenoceptor responses in HEL 92.1.7 cells

    PubMed Central

    Kukkonen, Jyrki P; Jansson, Christian C; Åkerman, Karl E O

    2001-01-01

    The ability of 19 agonists to elevate Ca2+ and inhibit forskolin-induced cyclic AMP elevation through ?2A-adrenoceptors in HEL 92.1.7 cells was investigated. Ligands of catecholamine-like- (five), imidazoline- (nine) and non-catecholamine-non-imidazoline-type (five) were included. The relative maximum responses were similar in both assays. Five ligands were full or nearly full agonists, six produced 20?–?70% of the response to a full agonist and the remaining eight gave lower responses (<20%) so that their potencies were difficult to evaluate. Marked differences in the potencies of the agonists with respect to the two measured responses were seen. The catecholamines were several times less potent in decreasing cyclic AMP than in increasing Ca2+, whereas the other, both imidazoline and ox-/thiazoloazepine ligands, were several times more potent with respect to the former than the latter response. For instance, UK14,304 was more potent than adrenaline with respect to the cyclic AMP response but less potent than adrenaline with respect to the Ca2+ response. All the responses were sensitive to pertussis toxin-pretreatment. Also the possible role of PLA2, ?-adrenoceptors or ligand transport or metabolism as a source of error could be excluded. The results suggest that the active receptor states produced by catecholamines and the other agonists are markedly different and therefore have different abilities to activate different signalling pathways. PMID:11264241

  20. Further evidence of the role of cyclic AMP as a mediator of the depressant effects of beta-adrenoceptor agonists and phosphodiesterase inhibitors on slow-contracting mammalian skeletal muscles.

    PubMed

    Merican, Z; Morat, P; Dan, R; Khalid, B A

    1986-06-01

    The depressant effects of beta-adrenoceptor agonists and phosphodiesterase inhibitors on contractions of slow-contracting mammalian skeletal muscles are associated with increased muscular cyclic AMP levels. A strong correlation was found to exist between the percentage depression of contraction and the percentage increase in cyclic AMP level, irrespective of the drug used and regardless of the mechanism of cyclic AMP production. The results strongly support the mediatory role of cyclic AMP in the depressant effects of beta-adrenoceptor agonists and phosphodiesterase inhibitors on slow-contracting mammalian skeletal muscle contractions. PMID:2875818

  1. Effects of prostaglandin E2, cholera toxin and 8-bromo-cyclic AMP on lipopolysaccharide-induced gene expression of cytokines in human macrophages.

    PubMed Central

    Zhong, W W; Burke, P A; Drotar, M E; Chavali, S R; Forse, R A

    1995-01-01

    Prostaglandin E2 (PGE2) appears to regulate macrophage cytokine production through the stimulatory GTP-binding protein (Gs protein)-mediated cyclic AMP (cAMP)-dependent transmembrane signal transduction pathway. In this study, we used PGE2, cholera toxin (CT; a direct G alpha s protein stimulator) and 8-bromo-cAMP (a membrane permeable cAMP analogue) to stimulate this pathway, and investigated their influence on cytokine gene expression in lipopolysaccharide (LPS)-activated human macrophages. The mRNA expression for interleukin-1 alpha (IL-1 alpha), IL-1 beta, tumour necrosis factor-alpha (TNF-alpha), IL-6 and IL-8 were determined employing reverse transcription polymerase chain reaction (RT-PCR) using specific primers. We demonstrated that PGE2, CT and 8-bromo-cAMP inhibited the LPS-induced gene activation of TNF-alpha and IL-1 alpha, and had no effect on the gene activation of IL-1 beta and IL-8. Further, our data indicate that PGE2 suppressed the gene activation of IL-6 following LPS stimulation, but neither CT nor 8-bromo-cAMP had an effect. These data suggest that PGE2 alters LPS-stimulated gene activation of only some of the early macrophage cytokines, and does so either by a Gs transmembrane cAMP-dependent or an independent system. Images Figure 1 PMID:7751029

  2. Possible role of cyclic AMP phosphodiesterases in the actions of ibudilast on eosinophil thromboxane generation and airways smooth muscle tone.

    PubMed Central

    Souness, J. E.; Villamil, M. E.; Scott, L. C.; Tomkinson, A.; Giembycz, M. A.; Raeburn, D.

    1994-01-01

    1. The possible role of cyclic AMP phosphodiesterase (PDE) in the inhibitory actions of ibudilast on tracheal smooth muscle contractility and eosinophil thromboxane generation was investigated. 2. Ibudilast was a non-selective inhibitor of partially purified cyclic nucleotide PDE isoenzymes from pig aorta and bovine tracheal smooth muscle, exhibiting only moderate potency against bovine tracheal PDE IV (IC50 = 12 +/- 4 microM, n = 3). Similar or slightly lower potencies were displayed against PDEs I, II, III and V. In contrast, rolipram exhibited selectivity for PDE IV (3 +/- 0.5 microM, n = 3). 3. Ibudilast (IC50 = 0.87 +/- 0.37 microM, n = 3), like rolipram (IC50 = 0.20 +/- 0.04 microM, n = 3), was a more potent inhibitor of membrane-bound PDE IV from guinea-pig eosinophils than of partially purified PDE IV from bovine tracheal smooth muscle. The potency of ibudilast increased when the eosinophil enzyme was solubilised with deoxycholate and NaCl (IC50 = 0.11 +/- 0.05 microM, n = 3) or exposed to vanadate/glutathione complex (V/GSH) (IC50 = 0.11 +/- 0.02 microM, n = 3). The potency of rolipram was also increased by solubilization (IC50 = 0.012 +/- 0.003, n = 3) or V/GSH (IC50 = 0.012 +/- 0.003, n = 3). 4. In intact eosinophils, ibudilast (0.032 microM-20 microM) potentiated isoprenaline-induced cyclic AMP accumulation in a concentration-dependent manner, being approximately 20 fold less potent than rolipram. Little or no effect on basal cyclic AMP levels was observed with either compound.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8032594

  3. Melanocyte-stimulating hormone promotes activation of pre-existing tyrosinase molecules in Cloudman S91 melanoma cells

    Microsoft Academic Search

    Glenda Wong; JOHN PAWELEK

    1975-01-01

    TYROSINASE activity is greatly enhanced in cultured Cloudman S91 melanoma cells following addition of melanocyte-stimulating hormone (MSH) to the culture medium1. The increased activity occurs in the G2 phase of the cell cycle2 because membrane receptors for MSH are available only in this phase3. The response to MSH is mediated through cyclic AMP (refs 1-4). It is well documented that

  4. Protein kinase C and cyclic AMP-dependent protein kinase phosphorylate phospholemman, an insulin and adrenaline-regulated membrane phosphoprotein, at specific sites in the carboxy terminal domain.

    PubMed Central

    Walaas, S I; Czernik, A J; Olstad, O K; Sletten, K; Walaas, O

    1994-01-01

    Phospholemman, a transmembrane, 72 residue protein enriched in striated muscle and heart [Palmer, Scott and Jones (1991) J. Biol. Chem. 266, 11126-11130], is phosphorylated in response to insulin [Walaas, Horn and Walaas (1991) Biochim. Biophys. Acta 1094, 92-102]. The present study is aimed at identifying the phosphorylation sites of this protein. A synthetic peptide, GTFRSS63IRRLS68TRRR (in the single letter code) and consisting of phospholemman residues 58-72, is a substrate for both protein kinase C and cyclic AMP (cAMP)-dependent protein kinase, with Km values of 6-7 microM for both enzymes. Amino acid sequencing of the phosphopeptide shows that protein kinase C phosphorylates both Ser-63 and Ser-68, while cAMP-dependent protein kinase phosphorylates Ser-68. Thermolytic phosphopeptide mapping of 32P-labelled phospholemman from rat diaphragms shows that treatment with insulin results in labelling of phosphopeptides containing both Ser-63 and Ser-68, whereas treatment with adrenaline results in labelling of the phosphopeptide containing Ser-68. Hence, insulin and adrenaline regulate the phosphorylation of phospholemman, presumably through protein kinase C and cAMP-dependent protein kinase, respectively, on partly overlapping phosphorylation sites. Images Figure 3 Figure 4 Figure 5 PMID:7999001

  5. Dibutyryl cyclic AMP inhibits the progression of experimental autoimmune encephalomyelitis and potentiates recruitment of endogenous neural stem cells.

    PubMed

    Khezri, Shiva; Javan, Mohammad; Goudarzvand, Mahdi; Semnanian, Saeed; Baharvand, Hossein

    2013-10-01

    Multiple sclerosis is a chronic inflammatory demyelinating disease of the central nervous system. Cyclic AMP and its analogs enhance regeneration of adult mammalian central nervous system (CNS). Endogenous neural stem cells (NSCs) play a pivotal role in CNS regeneration, producing new neuron and glial cells. Here, we examined the effect of dibutyryl cyclic AMP (dbcAMP) on experimental autoimmune encephalomyelitis (EAE) symptoms, endogenous remyelination, and recruitment of NSCs. EAE was induced by immunizing mice using myelin oligodendrocyte glycoprotein peptide and pertussis toxin. Proliferative cells within CNS were labeled using repetitive systemic injections of 5-bromo-2-deoxyuridine (BrdU) before EAE induction. Myelin staining was performed using Luxol fast blue. The number of nestin(+) and BrdU(+) cells in subventricular zone (SVZ) and olfactory bulb (OB) was evaluated using immunohistochemistry. dbcAMP suppressed EAE progression and decreased the extent of demyelinated plaques in the lumbar spinal cord. EAE induction reduced the number of proliferative cells in SVZ and increased their population in OB. EAE also increased the number of nestin(+) cells in OB. We also found that dbcAMP increased the recruitment of NSCs into the OB and brain parenchyma of EAE mice. Our results suggest dbcAMP as a potential therapy for inducing myelin repair in the context of demyelinating diseases like multiple sclerosis. Its positive effect seems to be mediated, at least partially, by endogenous neural stem cells and their increased recruitment. PMID:23335001

  6. Phorbol ester stimulates calcitonin secretion synergistically with A23187, and additively with dibutyryl cyclic AMP in a rat C-cell line.

    PubMed

    Hishikawa, R; Fukase, M; Yamatani, T; Kadowaki, S; Fujita, T

    1985-10-15

    The mechanism of action of 12-O-tetradecanoyl phorbol-13-acetate (TPA) on calcitonin secretion was studied in a rat C-cell line, rMTC 6-23. TPA stimulated calcitonin secretion at the concentration of 16nM. This effect was synergistically enhanced with calcium ionophore, A23187. Synthetic diacylglycerol, 1-oleoyl-2-acetyl-glycerol (OAG), also showed a synergism with A23187 on calcitonin secretion. When dibutyryl cyclic AMP was added with TPA, an additive effect was obtained. These data suggest that C-kinase might be a possible regulator of calcitonin secretion in addition to the cyclic AMP-mediated pathway. PMID:2998363

  7. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    SciTech Connect

    Livi, G.P.; McHale, M.J.; Sathe, G.M.; Taylor, D.P. (Dept. of Gene Expression Sciences, Smithkline Beecham Pharmaceuticals, King of Prussia, PA (US)); Kmetz, P.; Balcarek, J.M. (Dept. of Molecular Genetics, Smithkline Beecham Pharmaceuticals, King of Prussia, PA (US)); Cieslinski, L.B.; Torphy, T.J. (Dept. of Pharmacology, Smithkline Beecham Pharmaceuticals, King of Prussia, PA (US)); Davis, R.L. (Baylor Univ., Houston, TX (USA). Dept. of Cell Biology)

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding region of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.

  8. Genome-Wide Identification of In Vivo Binding Sites of GlxR, a Cyclic AMP Receptor Protein-Type Regulator in Corynebacterium glutamicum?†

    PubMed Central

    Toyoda, Koichi; Teramoto, Haruhiko; Inui, Masayuki; Yukawa, Hideaki

    2011-01-01

    Corynebacterium glutamicum GlxR is a cyclic AMP (cAMP) receptor protein-type regulator. Although over 200 GlxR-binding sites in the C. glutamicum genome are predicted in silico, studies on the physiological function of GlxR have been hindered by the severe growth defects of a glxR mutant. This study identified the GlxR regulon by chromatin immunoprecipitation in conjunction with microarray (ChIP-chip) analyses. In total, 209 regions were detected as in vivo GlxR-binding sites. In vitro binding assays and promoter-reporter assays demonstrated that GlxR directly activates expression of genes for aerobic respiration, ATP synthesis, and glycolysis and that it is required for expression of genes for cell separation and mechanosensitive channels. GlxR also directly represses a citrate uptake gene in the presence of citrate. Moreover, ChIP-chip analyses showed that GlxR was still able to interact with its target sites in a mutant with a deletion of cyaB, the sole adenylate cyclase gene in the genome, even though binding affinity was markedly decreased. Thus, GlxR is physiologically functional at the relatively low cAMP levels in the cyaB mutant, allowing the cyaB mutant to grow much better than the glxR mutant. PMID:21665967

  9. Circadian responses of teleostean oocytes to gonadotropins and prostaglandins determined by cyclic AMP concentration

    E-print Network

    Paris-Sud XI, Université de

    rhythm of pituitary gonadotropin synthesis and release has been demons- trated in the teleosts Salvelinus fontinalis, Salmo gairdneri and Notemigonus crysoleucas (O'Connor, 1972 ; De Vlaming and Vodicnik, 1977

  10. Increased intracellular cyclic AMP levels suppress the mitogenic responses of human astrocytoma cells to growth factors

    Microsoft Academic Search

    Chon-Haw Tsai; Li-Man Hung; Ho-Ping Cheng; Jan-Kan Chen

    1995-01-01

    Summary It has been shown that the intracellular cAMP levels were decreased in human malignant astrocytomas. On the other hand, various growth factors and their receptors were found to be overexpressed in these tumors. It is therefore intriguing as to whether there is interplay between the two phenomena in the modulation of the astrocytoma cell growth. In a basal medium

  11. Cyclic AMP-Dependent Protein Kinase Catalytic Subunits Have Divergent Roles in Virulence Factor Production in Two Varieties of the Fungal Pathogen Cryptococcus neoformans

    Microsoft Academic Search

    Julie K. Hicks; Cletus A. D'Souza; Gary M. Cox; Joseph Heitman

    2004-01-01

    Our earlier findings established that cyclic AMP-dependent protein kinase functions in a signaling cascade that regulates mating and virulence of Cryptococcus neoformans var. grubii (serotype A). Mutants lacking the serotype A protein kinase A (PKA) catalytic subunit Pka1 are unable to mate, fail to produce melanin or capsule, and are avirulent in animal models, whereas mutants lacking the PKA regulatory

  12. Association of mouse liver adenosine 3':5'-cyclic monophosphate (cyclic AMP) levels with histocompatibility-2 genotype.

    PubMed Central

    Meruelo, D; Edidin, M

    1975-01-01

    When the content of cyclic AMP (cAMP) was compared in livers of a series of congenic mouse strains differing at the H-2 locus, significant variation in concentration of cAMP per unit wet weight was found among strains, and also for animals of a given strain with increasing age. For a given age, from 8 to 22 weeks, cAMP levels in liver of H-2a and H-2b genotype animals were significantly higher than that in liver of H-2k type animals. This difference was seen whether the H-2 gene was on the genetic background of strain C57BL/10, C3H, or A. Levels of cAMP in livers of H-2d animals were between those of H-2a and H-2k animals. PMID:170610

  13. Steady-State Modulation of Voltage-Gated K+ Channels in Rat Arterial Smooth Muscle by Cyclic AMP-Dependent Protein Kinase and Protein Phosphatase 2B

    PubMed Central

    Brignell, Jennifer L.; Perry, Matthew D.; Nelson, Carl P.; Willets, Jonathon M.; Challiss, R. A. John; Davies, Noel W.

    2015-01-01

    Voltage-gated potassium channels (Kv) are important regulators of membrane potential in vascular smooth muscle cells, which is integral to controlling intracellular Ca2+ concentration and regulating vascular tone. Previous work indicates that Kv channels can be modulated by receptor-driven alterations of cyclic AMP-dependent protein kinase (PKA) activity. Here, we demonstrate that Kv channel activity is maintained by tonic activity of PKA. Whole-cell recording was used to assess the effect of manipulating PKA signalling on Kv and ATP-dependent K+ channels of rat mesenteric artery smooth muscle cells. Application of PKA inhibitors, KT5720 or H89, caused a significant inhibition of Kv currents. Tonic PKA-mediated activation of Kv appears maximal as application of isoprenaline (a ?-adrenoceptor agonist) or dibutyryl-cAMP failed to enhance Kv currents. We also show that this modulation of Kv by PKA can be reversed by protein phosphatase 2B/calcineurin (PP2B). PKA-dependent inhibition of Kv by KT5720 can be abrogated by pre-treatment with the PP2B inhibitor cyclosporin A, or inclusion of a PP2B auto-inhibitory peptide in the pipette solution. Finally, we demonstrate that tonic PKA-mediated modulation of Kv requires intact caveolae. Pre-treatment of the cells with methyl-?-cyclodextrin to deplete cellular cholesterol, or adding caveolin-scaffolding domain peptide to the pipette solution to disrupt caveolae-dependent signalling each attenuated PKA-mediated modulation of the Kv current. These findings highlight a novel, caveolae-dependent, tonic modulatory role of PKA on Kv channels providing new insight into mechanisms and the potential for pharmacological manipulation of vascular tone. PMID:25793374

  14. Putting on the Brakes: Cyclic AMP as a Multipronged Controller of Macrophage Function

    NSDL National Science Digital Library

    Marc Peters-Golden (Ann Arbor; University of Michigan Medical School REV)

    2009-06-16

    Macrophages orchestrate innate immune responses in tissues by activating various proinflammatory signaling programs. A key mechanism for preventing inflammatory disease states that result from excessive activation of such programs is the generation of the second messenger cyclic adenosine monophosphate (cAMP) by ligation of certain guanine nucleotide–binding protein (G protein)–coupled receptors (GPCRs). The pleiotropic actions of this cyclic nucleotide on various inflammatory functions of macrophages are mediated by diverse molecular mechanisms, including the assembly of distinct multiprotein complexes. A better understanding of crosstalk between cAMP signaling and proinflammatory pathways in macrophages may provide a basis for improved immunomodulatory strategies.

  15. Cyclic AMP functions as a primary sexual signal in gametes of Chlamydomonas reinhardtii

    PubMed Central

    1987-01-01

    When Chlamydomonas reinhardtii gametes of opposite mating type are mixed together, they adhere by a flagella-mediated agglutination that triggers three rapid mating responses: flagellar tip activation, cell wall loss, and mating structure activation accompanied by actin polymerization. Here we show that a transient 10-fold elevation of intracellular cAMP levels is also triggered by sexual agglutination. We further show that gametes of a single mating type can be induced to undergo all three mating responses when presented with exogenous dibutyryl-cAMP (db-cAMP). These events are also induced by cyclic nucleotide phosphodiesterase inhibitors, which elevate endogenous cAMP levels and act synergistically with db-cAMP. Non-agglutinating mutants of opposite mating type will fuse efficiently in the presence of db- cAMP. No activation of mating events is induced by calcium plus ionophores, 8-bromo-cGMP, dibutyryl-cGMP, nigericin at alkaline pH, phorbol esters, or forskolin. H-8, an inhibitor of cyclic nucleotide- dependent protein kinase, inhibits mating events in agglutinating cells and antagonizes the effects of cAMP on non-agglutinating cells. Adenylate cyclase activity was detected in both the gamete cell body and flagella, with the highest specific activity displayed in flagellar membrane fractions. The flagellar membrane adenylate cyclase is preferentially stimulated by Mn++, unresponsive to NaF, GTP, GTP gamma S, AlF4-, and forskolin, and is inhibited by trifluoperazine. Cyclic nucleotide phosphodiesterase activity is also present in flagella. Our observations indicate that cAMP is a sufficient initial signal for all of the known mating reaction events in C. reinhardtii, and suggest that the flagellar cyclase and/or phosphodiesterase may be important loci of control for the agglutination-stimulated production of this signal. PMID:2824527

  16. Effects of the novel (Pro 3 )GIP antagonist and exendin(9–39)amide on GIP and GLP-1-induced cyclic AMP generation, insulin secretion and postprandial insulin release in obese diabetic ( ob \\/ ob ) mice: evidence that GIP is the major physiological incretin

    Microsoft Academic Search

    V. A. Gault; F. P. M. O'Harte; P. Harriott; M. H. Mooney; B. D. Green; P. R. Flatt

    2003-01-01

      \\u000a \\u000a Aims\\/hypothesis. This study examined the biological effects of the GIP receptor antagonist, (Pro3)GIP and the GLP-1 receptor antagonist, exendin(9–39)amide.\\u000a \\u000a \\u000a \\u000a \\u000a Methods. Cyclic AMP production was assessed in Chinese hamster lung fibroblasts transfected with human GIP or GLP-1 receptors, respectively.\\u000a In vitro insulin release studies were assessed in BRIN-BD11 cells while in vivo insulinotropic and glycaemic responses were\\u000a measured in obese

  17. Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.

    PubMed

    Ghosh-Roy, Anindya; Wu, Zilu; Goncharov, Alexandr; Jin, Yishi; Chisholm, Andrew D

    2010-03-01

    Axons of adult Caenorhabditis elegans neurons undergo robust regenerative growth after laser axotomy. Here we show that axotomy of PLM sensory neurons triggers axonal calcium waves whose amplitude correlates with the extent of regeneration. Genetic elevation of Ca(2+) or cAMP accelerates formation of a growth cone from the injured axon. Elevated Ca(2+) or cAMP also facilitates apparent fusion of axonal fragments and promotes branching to postsynaptic targets. Conversely, inhibition of voltage-gated calcium channels or calcium release from internal stores reduces regenerative growth. We identify the fusogen EFF-1 as critical for axon fragment fusion and the basic leucine zipper domain (bZip) protein CREB (cAMP response element-binding protein) as a key effector for branching. The effects of elevated Ca(2+) or cAMP on regrowth require the MAPKKK (mitogen-activated protein kinase kinase kinase) DLK-1. Increased cAMP signaling can partly bypass the requirement for the bZip protein CEBP-1, a downstream factor of the DLK-1 kinase cascade. These findings reveal the relationship between Ca(2+)/cAMP signaling and the DLK-1 MAPK (mitogen-activated protein kinase) cascade in regeneration. PMID:20203177

  18. Cyclic AMP mediates the direct antiproliferative action of mismatched double-stranded RNA.

    PubMed

    Hubbell, H R; Boyer, J E; Roane, P; Burch, R M

    1991-02-01

    Previous experiments have demonstrated that double-stranded RNAs (dsRNAs) can exert an antiproliferative effect on human tumor cells, independent of interferon (IFN) induction. However, the mechanism by which dsRNAs inhibit tumor growth has not been elucidated. As a first step in determining the molecular events responsible for growth arrest, we have explored the role of signal transduction through the cAMP system in the antiproliferative effect of the mismatched dsRNA, r(I)n.r(C12,U)n (Ampligen). These studies utilized the human glioma cell line A1235, which does not produce detectable levels of IFN-alpha, -beta, or -gamma in response to mismatched dsRNA treatment. Treatment of A1235 cells with mismatched dsRNA in combination with either 1-(5-isoquinolinesulfonyl)-2-methylpiperazine (H-7), which inhibits cAMP-dependent protein kinase and protein kinase C, or N-(2-guanidinoethyl)-5-isoquinolinesulfonamide (HA1004), which preferentially inhibits the cAMP-dependent protein kinase, yielded an antagonism of the mismatched dsRNA-induced antiproliferative effect. Measurement of adenylate cyclase activation showed a dose-dependent increase in activity at antiproliferative mismatched dsRNA concentrations, but not at lower, nonantiproliferative doses. This increase in activity was rapid, seen as early as 30 sec after initiation of treatment, and it was sustained at peak levels for 1-2 hr. Analysis of the intracellular cAMP concentration gave similar kinetics of induction. Exposure of cells to the stable cAMP analogue dibutyryl cAMP yielded dose-dependent inhibition of cell growth. The cAMP phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine also inhibited proliferation. In contrast, neither H-7 nor HA1004 had an effect on growth inhibition induced by human natural IFN-alpha treatment. In addition, antiproliferative doses of IFN-alpha did not increase cAMP concentrations. These results indicate that the cAMP system is utilized by mismatched dsRNA as an early signal transduction mechanism for growth control. Furthermore, the antiproliferative effects induced by mismatched dsRNA and IFN can occur by different mechanisms of action. PMID:1846967

  19. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    Microsoft Academic Search

    G. P. Livi; M. J. McHale; G. M. Sathe; D. P. Taylor; P. Kmetz; J. M. Balcarek; L. B. Cieslinski; T. J. Torphy; R. L. Davis

    1990-01-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270

  20. Cyclic AMP-mediated regulation of the resting membrane potential in myelin-forming oligodendrocytes in the isolated intact rat optic nerve

    Microsoft Academic Search

    Sally Bolton; Arthur M. Butt

    2006-01-01

    Myelin formation by oligodendrocytes has been shown to be regulated by cyclic AMP (cAMP) signaling pathways and to depend on the resting membrane potential (RMP). We therefore examined whether cAMP regulates the RMP of myelin-forming oligodendrocytes in isolated intact optic nerves of rats. Oligodendrocytes exhibited a significant developmental shift in the RMP from ?37 mV at postnatal day (P)6–8 to ?67 mV

  1. Activation of cAMP and mitogen responsive genes relies on a common nuclear factor

    Microsoft Academic Search

    J. Arias; A. S. Alberts; P. Brindle; F. X. Claret; T. Smeal; M. Karin; J. Feramisco; M. Montminy

    1994-01-01

    A NUMBER of signalling pathways stimulate transcription of target genes through nuclear factors whose activities are primarily regul-ated by phosphorylation. Cyclic AMP regulates the expression of numerous genes, for example, through the protein kinase-A (PKA)-mediated phosphorylation of transcription factor CREB at Ser 1331,2. Although phosphorylation may stimulate transcrip-tional activators by modulating their nuclear transport or DNA-binding affinity3, CREB belongs to

  2. Cyclic AMP mediates serotonin-induced synaptic enhancement of lateral giant interneuron of the crayfish.

    PubMed

    Araki, Makoto; Nagayama, Toshiki; Sprayberry, Jordanna

    2005-10-01

    The lateral giant (LG)-mediated escape behavior of the crayfish habituates readily on repetitive sensory stimulation. Recent studies suggested that the biogenic amines serotonin and octopamine modulate the time course of recovery and/or re-depression of the LG response after habituation. However, little is known of how serotonin and octopamine effect LG habituation and what second-messenger cascades they may activate. To investigate the effect of biogenic amines on LG habituation, serotonin and octopamine were superfused before presenting repetitive sensory stimulation. Serotonin and octopamine increased the number of stimuli needed to habituate the LG response. Their effects were mimicked by mixed application of a cAMP analogue [8-(4-chlorophenylthio)-cAMP (CPT-cAMP)] and a phosphodiesterase inhibitor [3-isobutyl-1-methylxanthine (IBMX)] but not by a cGMP analogue (8-bromoguanosine 3',5'-cyclic monophosphate). Perfusion of the adenylate cyclase inhibitor (SQ22536) abolished the effect of serotonin but not that of octopamine. To investigate the site of action of each biogenic amines in the neural circuit meditating LG escape, the effect of drugs on directly and indirectly elicited postsynaptic potentials in LG was investigated. Serotonin, octopamine, and a mixture of CPT-cAMP and IBMX increased both the direct and indirect synaptic inputs. Simultaneous application of SQ22536 abolished the effect of serotonin on both inputs but did not block the effect of octopamine. Direct injection of the cAMP analogue (Sp-isomer of adenosine-3',5'-cyclic monophosphorothioate) into LG increased both the direct and indirect inputs to LG. These results indicate that serotonin mediates an increase in cAMP levels in LG, but octopamine acts independently of cAMP and cGMP. PMID:16160094

  3. Loss of CARM1 results in hypomethylation of thymocyte cyclic AMP-regulated phosphoprotein and deregulated early T cell development.

    PubMed

    Kim, Jeesun; Lee, Jaeho; Yadav, Neelu; Wu, Qi; Carter, Carla; Richard, Stéphane; Richie, Ellen; Bedford, Mark T

    2004-06-11

    The coactivator-associated arginine methyltransferase, CARM1, is a positive regulator of transcription. Using high density protein arrays, we have previously identified in vitro substrates for CARM1. One of these substrates, TARPP (thymocyte cyclic AMP-regulated phosphoprotein), is expressed specifically in immature thymocytes. Here, we have demonstrated that TARPP is arginine-methylated at a single residue, Arg(650), both in vitro and in vivo. In addition, recombinant TARPP is not methylated by extracts from Carm1(-/-) cells, indicating that there is no redundancy in this pathway. We show that thymi from Carm1(-/-) embryos (E18.5) have a 5-10-fold reduction in cellularity compared with wild type littermates. Flow cytometric analysis of thymocytes revealed a decrease in the relative proportion of double negative thymocytes in Carm1(-/-) embryos because of a partial developmental arrest in the earliest thymocyte progenitor subset. These results demonstrate that CARM1 plays a significant role in promoting the differentiation of early thymocyte progenitors, possibly through its direct action on TARPP. PMID:15096520

  4. Cloning and DNA sequence analysis of the wild-type and mutant cyclic AMP receptor protein genes from Salmonella typhimurium.

    PubMed Central

    Schroeder, C J; Dobrogosz, W J

    1986-01-01

    The crp gene from Salmonella typhimurium, as well as two mutant adenylate cyclase regulation genes designated crpacr-3 and crpacr-4, were cloned into the EcoRI site of plasmid pUC8. Initially cloned on 5.6-kilobase fragments isolated from EcoRI digests of chromosomal DNA, these genes were further subcloned into the BamHI-EcoRI site of plasmid pBR322. When tested, Escherichia coli crp deletion strains harboring the clones regained their ability to pleiotropically ferment catabolite-repressible sugars. Also, the crpacr-containing strains displayed sensitivity to exogenous cyclic AMP (cAMP) when grown on eosin-methylene blue medium with xylose as the carbon source. The proteins encoded by the S. typhimurium wild-type and mutant crp genes were found to have similar molecular weights when compared with the wild-type cAMP receptor protein (CRP) from E. coli. DNA sequence analysis of the wild-type crp gene showed only a three-nucleotide difference from the E. coli sequence, suggesting little divergence of the crp gene between these organisms. The crpacr sequences, however, each contained single nucleotide changes resulting in amino acid substitutions at position 130 of the CRP. Based on the site at which these substitutions occur, the crpacr mutations are believed to affect CRP-cAMP interactions. Images PMID:3015882

  5. Cyclic AMP and Acyl Homoserine Lactones Increase the Cultivation Efficiency of Heterotrophic Bacteria from the Central Baltic Sea

    PubMed Central

    Bruns, Alke; Cypionka, Heribert; Overmann, Jörg

    2002-01-01

    The effect of signal molecules on the cultivation efficiency of bacteria from the Gotland Deep in the central Baltic Sea was investigated. Numbers of cultivated cells were determined by the most-probable-number (MPN) technique. Artificial brackish water supplemented with different carbon substrates at low concentrations (200 ?M each) was employed as the growth medium. Compared to the results of previous studies, this approach yielded significantly higher cultivation efficiencies (up to 11% in fluid media). A further and pronounced increase in cultivation success was accomplished by the addition of cyclic AMP (cAMP), N-butyryl homoserine lactone, or N-oxohexanoyl-dl-homoserine lactone at a low concentration of 10 ?M. The most effective inducer was cAMP, which led to cultivation efficiencies of up to 100% of total bacterial counts. From the highest positive dilutions of these latter MPN series, several strains were isolated in pure culture and one strain (G100) was used to study the physiological effect of cAMP. Dot blot hybridization revealed, however, that strain G100 represented only a small fraction of the total bacterial community. This points towards an inherent limitation of the MPN approach, which does not necessarily recover abundant species from highly diverse communities. Bacterial cells of strain G100 that were starved for 6 weeks attained a higher growth rate and a higher biomass yield when resuscitated in the presence of cAMP instead of AMP. PMID:12147499

  6. Effect of interleukin-1. alpha. on striatal prostaglandin E2, cyclic AMP, and dopamine release in irradiated and nonirradiated rats

    SciTech Connect

    Kandasamy, S.B.; Chen, H.T.; Blakley, S.; Dalton, T.K.; Harris, A.H. (Armed Forces Radiobiology Research Inst., Bethesda, MD (United States))

    1991-03-11

    The purpose of this study was to determine the effect of pretreatment with IL-1{alpha} on irradiated and nonirradiated rats striatal prostaglandin E2 (PGE2) and cyclic AMP (cAMP) levels and in vitro release of dopamine (DA) stimulated by KCl. Rats were irradiated using a LINAC. Striatal PGE2 and cAMP were estimated by radioimmunoassay, and DA was measured by HPLC coupled to electrochemical detection. A 20-hr pretreatment with 10-50 {mu}/kg IP of IL-1{alpha} increased striatal PGE2, had no significant effect on cAMP, but enhanced 30 mM KCl-stimulated DA release in irradiated and nonirradiated animals, although there was no significant difference between them. However, 1-hr pretreatment with IL-1{alpha} had no significant effect on PGE2 and cAMP levels and DA release. IL-1{alpha} enhanced PGE2, and DA releases were attenuated by 1-3 mg/kg IP of indomethacin, a cyclooxygenase inhibitor. Exogenous administration of 500 mM to 5 {mu}M of PGE2 increased 30 mM KCl-stimulated DA release in irradiated and nonirradiated animals. These results suggest that IL-1{alpha} increased KCl-stimulated DA release in striatum is mediated by PGE2 because IL-1{alpha} increased PGE2 levels in vivo and exogenous administration of PGE2 enhanced DA release.

  7. GTP cyclohydrolase I expression is regulated by nitric oxide: role of cyclic AMP

    PubMed Central

    Kumar, Sanjiv; Sun, Xutong; Sharma, Shruti; Aggarwal, Saurabh; Ravi, Kandasamy; Fineman, Jeffery R.; Black, Stephen M.

    2009-01-01

    Our previous studies have demonstrated that nitric oxide (NO) leads to nitric oxide synthase (NOS) uncoupling and an increase in NOS-derived superoxide. However, the cause of this uncoupling has not been adequately resolved. The pteridine cofactor tetrahydrobiopterin (BH4) is a critical determinant of endothelial NOS (eNOS) activity and coupling, and GTP cyclohydrolase I (GCH1) is the rate-limiting enzyme in its generation. Thus the initial purpose of this study was to determine whether decreases in BH4 could underlie, at least in part, the NO-mediated uncoupling of eNOS we have observed both in vitro and in vivo. Initially we evaluated the effect of inhaled NO levels on GCH1 expression and BH4 levels in the intact lamb. Contrary to our hypothesis, we found that there was a significant increase in both plasma BH4 levels and peripheral lung GCH1 protein levels. Furthermore, in vitro, we found that exposure to the NO donor spermine NONOate (SPNONO) led to an increase in GCH1 protein and BH4 levels in both COS-7 and pulmonary arterial endothelial cells. However, SPNONO treatment also caused a significant increase in phospho-cAMP response element binding protein (CREB) levels, as detected by Western blot analysis, and significantly increased cAMP levels, as detected by enzyme immunoassay. Furthermore, utilizing GCH1 promoter fragments fused to a luciferase reporter gene, we found that GCH1 promoter activity was enhanced by SPNONO in a CREB-dependent manner, and electromobility shift assays revealed an NO-dependent increase in the nuclear binding of CREB. These data suggest that NO increases BH4 levels through a cAMP/CREB-mediated increase in GCH1 transcription and that the eNOS uncoupling associated with exogenous NO does not involved reduced BH4 levels. PMID:19447893

  8. Purification, characterization and analysis of rolipram inhibition of a human type-IVA cyclic AMP-specific phosphodiesterase expressed in yeast.

    PubMed Central

    Wilson, M; Sullivan, M; Brown, N; Houslay, M D

    1994-01-01

    Analyses were done on a human type-IV cyclic AMP (cAMP) phosphodiesterase (hPDE-IVA-h6.1) expressed in an engineered strain of Saccharomyces cerevisiae. This strain (YMS6) expressed soluble PDE activity, together with an insoluble activity which was not released by re-homogenization, treatment with high-ionic-strength solutions or with the detergent Triton X-100. Pellet and soluble PDE activities were typical of type-IV PDE. They were cAMP-specific, insensitive to the addition of either cGMP (1 microM) or Ca2+/calmodulin, and inhibited by rolipram. Thermostability studies showed both activities to decay as single exponentials, indicating the presence of homogeneous PDE protein species in each fraction. Pellet PDE activity was more thermostable than the soluble enzyme. Mg2+ and Mn2+ dose-dependently increased PDE activity and reversed the inactivating effect of EDTA.h6.1 was engineered to express a C-terminal five-histidine motif (h6.1his5). This allowed purification of the PDE to apparent homogeneity in a simple two-step process involving a rolipram affinity column and a Ni2(+)-chelate column. A single monomeric protein of subunit molecular mass approximately 73 kDa and native molecular mass approximately 74 kDa resulted after a approximately 53000-fold purification. This exhibited a Km for cAMP of 8 microM, a true Vmax. of 0.8 mumol of cAMP hydrolysed/min per mg of PDE protein, a kcat. of 3702 s-1, and a value of the specificity constant kcat/Km of 4.6 x 10(8) M-1.s-1, the last implying a diffusion controlled reaction. Rolipram (Ki 0.4 soluble; 0.7 microM pellet) and 3-isobutyl-1-methylxanthine (Ki 15 soluble; 19 microM pellet) served as simple competitive inhibitors for both soluble and pellet forms of h6.1, respectively. Images Figure 1 PMID:7528009

  9. Purification, characterization and analysis of rolipram inhibition of a human type-IVA cyclic AMP-specific phosphodiesterase expressed in yeast.

    PubMed

    Wilson, M; Sullivan, M; Brown, N; Houslay, M D

    1994-12-01

    Analyses were done on a human type-IV cyclic AMP (cAMP) phosphodiesterase (hPDE-IVA-h6.1) expressed in an engineered strain of Saccharomyces cerevisiae. This strain (YMS6) expressed soluble PDE activity, together with an insoluble activity which was not released by re-homogenization, treatment with high-ionic-strength solutions or with the detergent Triton X-100. Pellet and soluble PDE activities were typical of type-IV PDE. They were cAMP-specific, insensitive to the addition of either cGMP (1 microM) or Ca2+/calmodulin, and inhibited by rolipram. Thermostability studies showed both activities to decay as single exponentials, indicating the presence of homogeneous PDE protein species in each fraction. Pellet PDE activity was more thermostable than the soluble enzyme. Mg2+ and Mn2+ dose-dependently increased PDE activity and reversed the inactivating effect of EDTA.h6.1 was engineered to express a C-terminal five-histidine motif (h6.1his5). This allowed purification of the PDE to apparent homogeneity in a simple two-step process involving a rolipram affinity column and a Ni2(+)-chelate column. A single monomeric protein of subunit molecular mass approximately 73 kDa and native molecular mass approximately 74 kDa resulted after a approximately 53000-fold purification. This exhibited a Km for cAMP of 8 microM, a true Vmax. of 0.8 mumol of cAMP hydrolysed/min per mg of PDE protein, a kcat. of 3702 s-1, and a value of the specificity constant kcat/Km of 4.6 x 10(8) M-1.s-1, the last implying a diffusion controlled reaction. Rolipram (Ki 0.4 soluble; 0.7 microM pellet) and 3-isobutyl-1-methylxanthine (Ki 15 soluble; 19 microM pellet) served as simple competitive inhibitors for both soluble and pellet forms of h6.1, respectively. PMID:7528009

  10. Cyclic AMP distinguishes between two functions of acidic FGF in a rat bladder carcinoma cell line.

    PubMed

    Boyer, B; Thiery, J P

    1993-02-01

    The rat bladder carcinoma cell line NBT-II exhibits two completely different responses to acidic FGF (aFGF): at high cell density, aFGF is a potent mitogen whereas at low cell density, aFGF acts as a scattering agent that can convert the epithelial NBT-II cells into fibroblastic-like, motile cells. The basis of the dual action of aFGF has been approached by using substances interfering with the transducing pathways known to be activated by growth factors. Genistein and tyrphostin, two inhibitors of tyrosine kinases, inhibit both cell scattering and mitogenesis induced by aFGF. Conversely, sodium orthovanadate, a potent inhibitor of tyrosine phosphatases can reproduce the two effects of aFGF, indicating that protein tyrosine phosphorylations are determinant in the two pathways. In contrast, transforming growth factor (TGF)-beta 1 is a strong inhibitor of DNA synthesis induced by aFGF but has no effect on cell scattering, providing evidence that the two pathways are divergent. In an attempt to determine the specificity of the pathways of aFGF we found that the level of cAMP, which can be externally elevated, is of pivotal importance in distinguishing between the two transducing pathways leading to either DNA replication or cell dispersion. Forskolin, 8-bromo cAMP, dibutyryl-cAMP, and cholera toxin are all capable of potentiating the mitogenic effect of aFGF while strongly inhibiting its scattering action. Moreover, addition of any of these substances to NBT-II cells converted into fibroblasts immediately induces their reversion towards an epithelial phenotype. These findings support a role for cAMP as a modulator of the effects of aFGF. Moreover, basal cAMP synthesis, which is not affected by aFGF, is higher in sparse than in dense cultures indicating that the level of cAMP depends on the status of the cell. Altogether, these results suggest that establishment and maintenance of the epithelial state require a precise regulation of cAMP level. PMID:7678836

  11. Cyclic nucleotide responses and radiation-induced mitotic delay in Physarum polycephalum

    SciTech Connect

    Daniel, J.W.; Oleinick, N.L.

    1984-02-01

    The response of the plasmodial levels of cyclic AMP and cyclic GMP in Physarum polycephalum to several putative phosphodiesterase inhibitors and to ionizing radiation has been measured. Isobutylmethylxanthine (2 mM) induces a rapid transient threefold elevation of cyclic AMP alone, with maximum response in about 10 min and return to the base line in about 30 min. Theophylline (2 mM) induces a rapid, sustained twofold elevation of cyclic GMP only. Caffeine (2mM) and Ro-20-1724 (18 ..mu..M) both elicit a rapid transient rise in cyclic AMP, resembling the isobutylmethylxanthine response, and a slow transient elevation of the cyclic GMP level. Of particular interest is the rapid threefold transient elevation of the cyclic AMP, but not of the cyclic GMP, level by ..gamma.. radiation.

  12. Cyclic AMP-Rap1A signaling mediates cell surface translocation of microvascular smooth muscle ?2C-adrenoceptors through the actin-binding protein filamin-2

    PubMed Central

    Motawea, Hanaa K. B.; Jeyaraj, Selvi C.; Eid, Ali H.; Mitra, Srabani; Unger, Nicholas T.; Ahmed, Amany A. E.; Flavahan, Nicholas A.

    2013-01-01

    The second messenger cyclic AMP (cAMP) plays a vital role in vascular physiology, including vasodilation of large blood vessels. We recently demonstrated cAMP activation of Epac-Rap1A and RhoA-Rho-associated kinase (ROCK)-F-actin signaling in arteriolar-derived smooth muscle cells increases expression and cell surface translocation of functional ?2C-adrenoceptors (?2C-ARs) that mediate vasoconstriction in small blood vessels (arterioles). The Ras-related small GTPAse Rap1A increased expression of ?2C-ARs and also increased translocation of perinuclear ?2C-ARs to intracellular F-actin and to the plasma membrane. This study examined the mechanism of translocation to better understand the role of these newly discovered mediators of blood flow control, potentially activated in peripheral vascular disorders. We utilized a yeast two-hybrid screen with human microvascular smooth muscle cells (microVSM) cDNA library and the ?2C-AR COOH terminus to identify a novel interaction with the actin cross-linker filamin-2. Yeast ?-galactosidase assays, site-directed mutagenesis, and coimmunoprecipitation experiments in heterologous human embryonic kidney (HEK) 293 cells and in human microVSM demonstrated that ?2C-ARs, but not ?2A-AR subtype, interacted with filamin. In Rap1-stimulated human microVSM, ?2C-ARs colocalized with filamin on intracellular filaments and at the plasma membrane. Small interfering RNA-mediated knockdown of filamin-2 inhibited Rap1-induced redistribution of ?2C-ARs to the cell surface and inhibited receptor function. The studies suggest that cAMP-Rap1-Rho-ROCK signaling facilitates receptor translocation and function via phosphorylation of filamin-2 Ser2113. Together, these studies extend our previous findings to show that functional rescue of ?2C-ARs is mediated through Rap1-filamin signaling. Perturbation of this signaling pathway may lead to alterations in ?2C-AR trafficking and physiological function. PMID:23864608

  13. Metabotropic Glutamate Receptors Increase Amyloid Precursor Protein Processing in Astrocytes: Inhibition by Cyclic AMP

    Microsoft Academic Search

    Robert K. K. Lee; Richard J. Wurtman

    2002-01-01

    Neurotransmitterreceptors that increase phos- phatidylinositol hydrolysis generate second messengers that activate protein kinase C. Here, we used metabotro- pic glutamate receptor agonists to increase both phos- phatidylinositol hydrolysis and secretion of the soluble extracellular fragment of amyloid precursor protein (APPs) from cortical astrocyte cultures. The increase in APPs secretion was mimicked by direct activation of pro- tein kinase C with

  14. Elevated Cyclic AMP Levels in T Lymphocytes Transformed by Human T-Cell Lymphotropic Virus Type 1?

    PubMed Central

    Kress, Andrea K.; Schneider, Grit; Pichler, Klemens; Kalmer, Martina; Fleckenstein, Bernhard; Grassmann, Ralph

    2010-01-01

    Human T-cell lymphotropic virus type 1 (HTLV-1), the cause of adult T-cell leukemia/lymphoma (ATLL), transforms CD4+ T cells to permanent growth through its transactivator Tax. HTLV-1-transformed cells share phenotypic properties with memory and regulatory T cells (T-reg). Murine T-reg-mediated suppression employs elevated cyclic AMP (cAMP) levels as a key regulator. This led us to determine cAMP levels in HTLV-1-transformed cells. We found elevated cAMP concentrations as a consistent feature of all HTLV-1-transformed cell lines, including in vitro-HTLV-1-transformed, Tax-transformed, and patient-derived cells. In transformed cells with conditional Tax expression, high cAMP levels coincided with the presence of Tax but were lost without it. However, transient ectopic expression of Tax alone was not sufficient to induce cAMP. We found specific downregulation of the cAMP-degrading phosphodiesterase 3B (PDE3B) in HTLV-1-transformed cells, which was independent of Tax in transient expression experiments. This is in line with the notion that PDE3B transcripts and cAMP levels are inversely correlated. Overexpression of PDE3B led to a decrease of cAMP in HTLV-1-transformed cells. Decreased expression of PDE3B was associated with inhibitory histone modifications at the PDE3B promoter and the PDE3B locus. In summary, Tax transformation and its continuous expression contribute to elevated cAMP levels, which may be regulated through PDE3B suppression. This shows that HTLV-1-transformed cells assume biological features of long-lived T-cell populations that potentially contribute to viral persistence. PMID:20573814

  15. Parathyroid hormone promotes the disassembly of cytoskeletal actin and myosin in cultured osteoblastic cells: Mediation by cyclic AMP

    SciTech Connect

    Egan, J.J.; Gronowicz, G.; Rodan, G.A. (National Institutes of Diabetes, Digestive, and Kidney Diseases, Bethesda, MD (USA))

    1991-01-01

    Parathyroid hormone (PTH) alters the shape of osteoblastic cells both in vivo and in vitro. In this study, we examined the effect of PTH on cytoskeletal actin and myosin, estimated by polyacrylamide gel electrophoresis of Triton X-100 (1%) nonextractable proteins. After 2-5 minutes, PTH caused a rapid and transient decrease of 50-60% in polymerized actin and myosin associated with the Triton X-100 nonextractable cytoskeleton. Polymerized actin returned to control levels by 30 min. The PTH effect was dose-dependent with an IC50 of about 1 nM, and was partially inhibited by the (3-34) PTH antagonist. PTH caused a rapid transient rise in cyclic AMP (cAMP) in these cells that peaked at 4 min, while the nadir in cytoskeletal actin and myosin was recorded around 5 min. The intracellular calcium chelator Quin-2/AM (10 microM) also decreased cytoskeletal actin and myosin, to the same extent as did PTH (100 nM). To distinguish between cAMP elevation and Ca++ reduction as mediators of PTH action, we measured the phosphorylation of the 20 kD (PI 4.9) myosin light chain in cells preincubated with (32P)-orthophosphate. The phosphorylation of this protein decreased within 2-3 min after PTH addition and returned to control levels after 5 min. The calcium ionophore A-23187 did not antagonize this PTH effect. Visualization of microfilaments with rhodamine-conjugated phalloidin showed that PTH altered the cytoskeleton by decreasing the number of stress fibers. These changes in the cytoskeleton paralleled changes in the shape of the cells from a spread configuration to a stellate form with retracting processes. The above findings indicate that the alteration in osteoblast shape produced by PTH involve relatively rapid and transient changes in cytoskeletal organization that appear to be mediated by cAMP.

  16. Cross Talk between a Fungal Blue-Light Perception System and the Cyclic AMP Signaling Pathway

    Microsoft Academic Search

    Sergio Casas-Flores; Mauricio Rios-Momberg; Teresa Rosales-Saavedra; P. Martinez-Hernandez; Vianey Olmedo-Monfil; Alfredo Herrera-Estrella

    2006-01-01

    The influence of light on living organisms is critical, not only because of its importance as the main source of energy for the biosphere but also due to its capacity to induce changes in the behavior and morphology of nearly all forms of life. In particular, physiological responses to blue light have been studied in a wide variety of organisms

  17. Enhancement of synaptic transmission by cyclic AMP modulation of presynaptic Ih channels.

    PubMed

    Beaumont, V; Zucker, R S

    2000-02-01

    Presynaptic activation of adenylyl cyclase and subsequent generation of cAMP represent an important mechanism in the modulation of synaptic transmission. In many cases, short- to medium-term modulation of synaptic strength by cAMP is due to activation of protein kinase A and subsequent covalent modification of presynaptic ion channels or synaptic proteins. Here we show that presynaptic cAMP generation via serotonin receptor activation directly modulated hyperpolarization-activated cation channels (Ih channels) in axons. This modulation of Ih produced an increase in synaptic strength that could not be explained solely by depolarization of the presynaptic membrane. These studies identify a mechanism by which cAMP and Ih regulate synaptic plasticity. PMID:10649568

  18. Cyclic AMP Mediates the Direct Antiproliferative Action of Mismatched Double-Stranded RNA

    Microsoft Academic Search

    Howard R. Hubbell; John E. Boyer; Philip Roane; Ronald M. Burch

    1991-01-01

    Previous experiments have demonstrated that double-stranded RNAs (dsRNAs) can exert an antiproliferative effect on human tumor cells, independent of interferon (IFN) induction. However, the mechanism by which dsRNAs inhibit tumor growth has not been elucidated. As a first step in determining the molecular events responsible for growth arrest, we have explored the role of signal transduction through the cAMP system

  19. Cyclic AMP Stimulates Neurite Outgrowth of Lamprey Reticulospinal Neurons without Substantially Altering Their Biophysical Properties

    PubMed Central

    Pale, Timothée; Frisch, Emily B.; McClellan, Andrew D.

    2013-01-01

    Reticulospinal (RS) neurons are critical for initiation of locomotor behavior, and following spinal cord injury (SCI) in the lamprey, the axons of these neurons regenerate and restore locomotor behavior within a few weeks. For lamprey RS neurons in culture, experimental induction of calcium influx, either in the growth cone or cell body, is inhibitory for neurite outgrowth. Following SCI, these neurons partially downregulate calcium channel expression, which would be expected to reduce calcium influx and possibly provide supportive conditions for axonal regeneration. In the present study, it was tested whether activation of second messenger signaling pathways stimulates neurite outgrowth of lamprey RS neurons without altering their electrical properties (e.g. spike broadening) so as to possibly increase calcium influx and compromise axonal growth. First, activation of cAMP pathways with forskolin or dbcAMP stimulated neurite outgrowth of RS neurons in culture in a PKA-dependent manner, while activation of cGMP signaling pathways with dbcGMP inhibited outgrowth. Second, neurophysiological recordings from uninjured RS neurons in isolated lamprey brain-spinal cord preparations indicated that dbcAMP or dbcGMP did not significantly affect any of the measured electrical properties. In contrast, for uninjured RS neurons, forskolin increased action potential duration, which might have increased calcium influx, but did not significantly affect most other electrical properties. Importantly, for injured RS neurons during the period of axonal regeneration, forskolin did not significantly alter their electrical properties. Taken together, these results suggest that activation of cAMP signaling by dbcAMP stimulates neurite outgrowth, but does not alter the electrical properties of lamprey RS neurons in such a way that would be expected to induce calcium influx. In conclusion, our results suggest that activation of cAMP pathways alone, without compensation for possible deleterious effects on electrical properties, is an effective approach for stimulating axonal regeneration of RS neuron following SCI. PMID:23603516

  20. Cyclic Amp-Dependent Resuscitation of Dormant Mycobacteria by Exogenous Free Fatty Acids

    PubMed Central

    Shleeva, Margarita; Goncharenko, Anna; Kudykina, Yuliya; Young, Danielle; Young, Michael; Kaprelyants, Arseny

    2013-01-01

    One third of the world population carries a latent tuberculosis (TB) infection, which may reactivate leading to active disease. Although TB latency has been known for many years it remains poorly understood. In particular, substances of host origin, which may induce the resuscitation of dormant mycobacteria, have not yet been described. In vitro models of dormant (“non-culturable”) cells of Mycobacterium smegmatis (mc2155) and Mycobacterium tuberculosis H37Rv were used. We found that the resuscitation of dormant M. smegmatis and M. tuberculosis cells in liquid medium was stimulated by adding free unsaturated fatty acids (FA), including arachidonic acid, at concentrations of 1.6–10 µM. FA addition enhanced cAMP levels in reactivating M. smegmatis cells and exogenously added cAMP (3–10 mM) or dibutyryl-cAMP (0.5–1 mM) substituted for FA, causing resuscitation of M. smegmatis and M. tuberculosis dormant cells. A M. smegmatis null-mutant lacking MSMEG_4279, which encodes a FA-activated adenylyl cyclase (AC), could not be resuscitated by FA but it was resuscitated by cAMP. M. smegmatis and M. tuberculosis cells hyper-expressing AC were unable to form non-culturable cells and a specific inhibitor of AC (8-bromo-cAMP) prevented FA-dependent resuscitation. RT-PCR analysis revealed that rpfA (coding for resuscitation promoting factor A) is up-regulated in M. smegmatis in the beginning of exponential growth following the cAMP increase in lag phase caused by FA-induced cell activation. A specific Rpf inhibitor (4-benzoyl-2-nitrophenylthiocyanate) suppressed FA-induced resuscitation. We propose a novel pathway for the resuscitation of dormant mycobacteria involving the activation of adenylyl cyclase MSMEG_4279 by FAs resulted in activation of cellular metabolism followed later by increase of RpfA activity which stimulates cell multiplication in exponential phase. The study reveals a probable role for lipids of host origin in the resuscitation of dormant mycobacteria, which may function during the reactivation of latent TB. PMID:24376605

  1. Glucocorticoids and cyclic AMP selectively increase hepaticlipin-1 expression, andinsulin actsantagonistically

    Microsoft Academic Search

    Boripont Manmontri; Meltem Sariahmetoglu; Jimmy Donkor; Maroun Bou Khalil; Meenakshi Sundaram; Zemin Yao; Karen Reue; Richard Lehner; David N. Brindley

    Glucocorticoids (GCs) increase hepatic phospha- tidate phosphatase (PAP1) activity. This is important in enhancing the liver's capacity for storing fatty acids as triacylglycerols (TAGs) that can be used subsequently for b-oxidation or VLDL secretion. PAP1 catalyzes the conver- sion of phosphatidate to diacylglycerol, a key substrate for TAG and phospholipid biosynthesis. PAP1 enzymes in liver include lipin-1A and -1B (alternatively

  2. GABAB receptor-mediated inhibition of forskolin-stimulated cyclic AMP accumulation in rat spinal cord.

    PubMed

    Malcangio, M; Bowery, N G

    1993-08-20

    GABA (30-1000 microM) and the GABAB agonist, (-)baclofen (10-100 microM), but not (+)baclofen, inhibited forskolin-induced cAMP formation in rat spinal cord slices. In contrast, GABA and (-)baclofen failed to enhance the stimulation of cAMP induced by noradrenaline in the same tissue, even though they both increased the response to noradrenaline in cerebral cortex slices. Neonatal capsaicin treatment, which reduces the density of GABAB binding sites in the cord, did not modify the effect of GABA or (-)baclofen on the forskolin-induced elevation of cAMP. (-)Baclofen and GABA inhibition of forskolin effects were insensitive to the GABAB antagonists CGP 35348 and CGP 36742 in the spinal cord. Since CGP 35348 antagonizes baclofen-induced antinociception, it seems unlikely that this effect stems from any change in cAMP within the spinal cord. PMID:8233093

  3. Cyclic-AMP Mediated Regulation of ABCB mRNA Expression in Mussel Haemocytes

    PubMed Central

    Franzellitti, Silvia; Fabbri, Elena

    2013-01-01

    Background The multixenobiotic resistance system (MXR) allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp). In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. Methodology/Principal Findings cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis) exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX) alone or in combination with 0.3 ng/L propranolol (PROP). FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin) and pharmacological modulators (PROP, forskolin, dbcAMP, and H89) of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT) decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. Conclusions This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels. PMID:23593491

  4. Cyclic AMP dysregulates intestinal epithelial cell restitution through PKA and RhoA

    PubMed Central

    Zimmerman, Noah P.; Kumar, Suresh N.; Turner, Jerrold R.; Dwinell, Michael B.

    2011-01-01

    Mucosal homeostasis is dependent upon the establishment and maintenance of the cell-cell contacts that comprise the physiological barrier. Breaks in the barrier are linked to multiple diseases such as the inflammatory bowel diseases. While increased cAMP levels limit inflammation by decreasing leukocyte infiltration, the effects of elevated cAMP on intestinal epithelial repair are unknown. Methods Restitution in animals administered rolipram was monitored by microscopic examination after laser wounding of the intestinal epithelium or in mice treated with dextran sodium sulfate (DSS). In vitro analysis was conducted using IEC6 and T84 cells to determine the role for elevated cAMP in altering Rho-dependent cellular migration signaling pathways. Results We show that treatment with rolipram, forskolin, and cAMP-analogs decrease intestinal epithelial cell migration in vitro. In vivo cell imaging revealed that increased cAMP resulted in a decreased cellular migration rate, with cells at the edge displaying the highest activity. As expected, elevated cAMP elicited increased protein kinase A (PKA) activity, in turn resulting in the inactivation and sequestration of RhoA and decreased actin reorganization. The ablation of restitution by cAMP was not restricted to cell culture as forskolin and rolipram treatment significantly decreased epithelial microwound closure induced by the two photon confocal injury model. Conclusion Together, these data suggest that administration of cAMP elevating agents paradoxically decrease infiltration of damage-causing leukocytes while also preventing epithelial repair and barrier maintenance. We propose that treatment with cAMP elevating agents severely limits mucosal re-epithelialization and should be contraindicated for use in chronic inflammatory bowel disorders. PMID:21993975

  5. Cyclic AMP-dependent Protein Lysine Acylation in Mycobacteria Regulates Fatty Acid and Propionate Metabolism*

    PubMed Central

    Nambi, Subhalaxmi; Gupta, Kallol; Bhattacharyya, Moitrayee; Ramakrishnan, Parvathy; Ravikumar, Vaishnavi; Siddiqui, Nida; Thomas, Ann Terene; Visweswariah, Sandhya S.

    2013-01-01

    Acetylation of lysine residues is a posttranslational modification that is used by both eukaryotes and prokaryotes to regulate a variety of biological processes. Here we identify multiple substrates for the cAMP-dependent protein lysine acetyltransferase from Mycobacterium tuberculosis (KATmt). We demonstrate that a catalytically important lysine residue in a number of FadD (fatty acyl CoA synthetase) enzymes is acetylated by KATmt in a cAMP-dependent manner and that acetylation inhibits the activity of FadD enzymes. A sirtuin-like enzyme can deacetylate multiple FadDs, thus completing the regulatory cycle. Using a strain deleted for the KATmt ortholog in Mycobacterium bovis Bacillus Calmette-Guérin (BCG), we show for the first time that acetylation is dependent on intracellular cAMP levels. KATmt can utilize propionyl CoA as a substrate and, therefore, plays a critical role in alleviating propionyl CoA toxicity in mycobacteria by inactivating acyl CoA synthetase (ACS). The precision by which mycobacteria can regulate the metabolism of fatty acids in a cAMP-dependent manner appears to be unparalleled in other biological organisms and is ideally suited to adapt to the complex environment that pathogenic mycobacteria experience in the host. PMID:23553634

  6. Cyclic AMP-dependent protein kinase enhances SC35-promoted Tau exon 10 inclusion.

    PubMed

    Chen, Caoyi; Jin, Nana; Qian, Wei; Liu, Wen; Tan, Xiangling; Ding, Fei; Gu, Xiaosong; Iqbal, Khalid; Gong, Cheng-Xin; Zuo, Ji; Liu, Fei

    2014-02-01

    Alternative splicing of tau exon 10 generates tau with three or four microtubule-binding repeats (3R-tau or 4R-tau). The ratio of 3R-tau to 4R-tau is approximately 1:1 in the adult normal human brain. Disturbances in the ratio result in neurodegenerative tauopathies. Splicing factor SC35 acts on a SC35-like element located at the 5' end of tau exon 10 and promotes tau exon 10 inclusion. Here, we report that protein kinase (PKA) was able to interact and phosphorylate SC35. Activation or overexpression of PKA catalytic subunits promoted SC35-mediated tau exon 10 inclusion. Four PKA catalytic subunits, ?1, ?2, ?1, and ?2, all enhanced SC35-promoted tau exon 10 inclusion. SC35 has four putative PKA phosphorylation sites, Ser121, Ser128, Ser130, and Ser171. Pseudophosphorylation (SC354E) and blockage (SC354A) of phosphorylation of SC35 at these four sites increased and decreased, respectively, SC35's ability to promote tau exon 10 inclusion. Moreover, PKA catalytic subunits no longer further enhanced tau exon 10 inclusion when these four were mutated to either alanine or glutamate. These results suggest that PKA interacts with and phosphorylates SC35 and enhances SC35-promoted tau exon 10 inclusion. In Alzheimer's brain, down-regulation of the PKA pathway could lead to dysregulation of tau exon 10, contributing to tau pathogenesis. PMID:24037441

  7. Cyclic AMP efflux, via MRPs and A1 adenosine receptors, is critical for bovine sperm capacitation.

    PubMed

    Osycka-Salut, Claudia; Diez, Federico; Burdet, Juliana; Gervasi, María Gracia; Franchi, Ana; Bianciotti, Liliana G; Davio, Carlos; Perez-Martinez, Silvina

    2014-01-01

    Sperm capacitation has been largely associated with an increase in cAMP, although its relevance in the underlying mechanisms of this maturation process remains elusive. Increasing evidence shows that the extrusion of cAMP through multidrug resistance associated protein 4 (MRP4) regulates cell homeostasis not only in physiological but also in pathophysiological situations and studies from our laboratory strongly support this assumption. In the present work we sought to establish the role of cAMP efflux in the regulation of sperm capacitation. Sperm capacitation was performed in vitro by exposing bovine spermatozoa to bicarbonate 40 and 70 mM; cAMP; probenecid (a MRPs general inhibitor) and an adenosine type 1 receptor (A1 adenosine receptor) selective antagonist (DPCPX). Capacitation was assessed by chlortetracycline assay and lysophosphatidylcholine-induced acrosome reaction assessed by PSA-FITC staining. Intracellular and extracellular cAMP was measured by radiobinding the regulatory subunit of PKA under the same experimental conditions. MRP4 was detected by western blot and immunohistochemistry assays. Results showed that the inhibition of soluble adenylyl cyclase significantly inhibited bicarbonate-induced sperm capacitation. Furthermore, in the presence of 40 and 70 mM bicarbonate bovine spermatozoa synthesized and extruded cAMP. Interestingly, in the absence of IBMX (a PDEs inhibitor) cAMP efflux still operated in sperm cells, suggesting that cAMP extrusion would be a physiological process in the spermatozoa complementary to the action of PDE. Blockade of MRPs by probenecid abolished the efflux of the cyclic nucleotide resulting not only in the accumulation of intracellular cAMP but also in the inhibition of bicarbonate-induced sperm capacitation. The effect of probenecid was abolished by exposing sperm cells to cAMP. The high-affinity efflux pump for cAMP, MRP4 was expressed in bovine spermatozoa and localized to the midpiece of the tail as previously reported for soluble adenylyl cyclase and A1 adenosine receptor. Additionally, blockade of A1 adenosine receptor abolished not only bicarbonate-induced sperm capacitation but also that stimulated by cAMP. Present findings strongly support that cAMP efflux, presumably through MRP4, and the activation of A1 adenosine receptor regulate some events associated with bicarbonate-induced sperm capacitation, and further suggest a paracrine and/or autocrine role for cAMP. PMID:23907162

  8. Cyclic AMP receptor protein (CRP) regulates the expression of cspA, cspB, cspG and cspI, members of cspA family, in Escherichia coli.

    PubMed

    Uppal, Sheetal; Jawali, Narendra

    2015-04-01

    Escherichia coli K-12 contains nine paralogs of CspA, CspA-CspI, collectively known as CspA family of cold-shock proteins (CSPs). In spite of the high degree of similarity among themselves, only five (cspA, B, E, G and I) are induced during cold-stress. In the present study, we show that cspB, cspG and cspI, the members of cspA family, known to be induced in response to cold shock, are regulated by cyclic AMP receptor protein (CRP) , a global regulator involved in sugar metabolism, during growth at 37 °C as well as at 15 °C, as seen by green fluorescent protein (gfp) promoter fusions assays. Interestingly, cspA is selectively regulated by CRP during growth at 15 °C but not at 37 °C. The regulation of cspA, cspB, cspG and cspI by CRP was found to be through an indirect mechanism as determined by electrophoretic mobility shift assay (EMSA). These results substantiate our earlier study demonstrating a role for CRP during growth at low temperature. PMID:25637299

  9. Molecular characterization of a thyroid tumor-specific transforming sequence formed by the fusion of ret tyrosine kinase and the regulatory subunit RI alpha of cyclic AMP-dependent protein kinase A.

    PubMed Central

    Bongarzone, I; Monzini, N; Borrello, M G; Carcano, C; Ferraresi, G; Arighi, E; Mondellini, P; Della Porta, G; Pierotti, M A

    1993-01-01

    The ret oncogene frequently has been found activated in papillary thyroid carcinomas. A previous characterization of ret activation revealed recombination of its tyrosine kinase domain and sequences derived from an uncharacterized locus (D10S170). The mechanism leading to this recombination was identified as a paracentric inversion of the long arm of chromosome 10, inv(10)(q11.2q21), with the breakpoints occurring where ret and D10S170 were mapped. To further characterize the activation of ret in papillary thyroid carcinomas, we have now isolated and sequenced a second type of ret oncogenic rearrangement not involving the D10S170 locus. The nucleotide sequence indicated that the transforming activity was created by the fusion of the ret tyrosine kinase domain with part of the RI alpha regulatory subunit of protein kinase A (PKA). This is the first example of an oncogenic activity involving a PKA gene. PKA is the main intracellular cyclic AMP receptor, and its RI alpha subunit gene is located on chromosome 17q. RI alpha-ret transcripts encode two isoforms of the chimeric protein (p76 and p81), which display constitutive tyrosine phosphorylation as well as a tyrosine kinase enzymatic activity. Under nonreducing conditions, both isoforms are found in a dimeric configuration because of both homo- and heterodimer formation. Thus, the in vivo activation of ret in human papillary thyroid carcinomas is provided by the fusion of its tyrosine kinase domain with different genes and can be mediated by different mechanisms of gene rearrangement. Images PMID:7678053

  10. Cyclic AMP stimulation of transferrin secretion by breast cancer cell grown on extracellular matrix or in two-compartment culture chambers

    SciTech Connect

    Vandewalle, B.; Hornez, L.; Revillion, F.; Lefebvre, J. (Lab. d'Endocrinologie Experimentale, Centre Oscar Lambret, Lille (France))

    1991-06-28

    Extrahepatic synthesis and secretion of transferrin (Tf), the major iron-carrying protein, have been described in normal and tumoral tissues suggesting a potential role for paracrine or autocrine function. In breast tumor cell MCF-7, we have previously shown a Tf secretion stimulated by estradiol which might confer selective growth advantages of these rapidly proliferating cells. The present work refers to possible additional Tf functions related to differentiation of breast tumor cells. We induced MCF-7 cell differentiation by the cyclic AMP derivative, dibutyryl cAMP (dB cAMP) and studied Tf secretion in different culture conditions after labeling with (35S) methionine. Our results demonstrate that dB cAMP stimulates Tf secretion only in culture environment that permits access to the basolateral surface and caters to the polarity requirements of the cell. These results suggest that Tf may also act as a modulator of cellular differentiation in breast cancer cells.

  11. Phorbol ester stimulates secretory activity while inhibiting receptor-activated aminopyrine uptake by gastric glands

    SciTech Connect

    Brown, M.R.; Chew, C.S.

    1986-03-05

    Both cyclic AMP-dependent and -independent secretagogues stimulate pepsinogen release, respiration and H/sup +/ secretory activity (AP uptake) in rabbit gastric glands. 12-O-tetradecanoylphorbol-13-acetate (T), a diacyglycerol analog, activates protein kinase C (PKC) and stimulates secretion in many systems. T stimulated respiration and pepsinogen release by glands and increased AP uptake by both glands and purified parietal cells. However, T reduced AP uptake by glands stimulated with carbachol (C) or histamine (H) with an apparent IC/sub 50/ of 1 nM. Preincubation with T for 30 min produced maximum inhibition which was not reversed by removal of T. T accelerated the decline of the transient C peak while the late steady state response to H was most inhibited. H-stimulated AP uptake was also inhibited by 50 ..mu..g/ml 1-oleoyl-2-acetyl-glycerol, a reported PKC activator, but not by the inactive phorbol, 4..cap alpha..-phorbol-12,13-didecanoate. In contrast, T potentiated AP uptake by glands stimulated with submaximal doses of dibutyryl cyclic AMP. These results suggest inhibition by T is a specific effect of PKC activators. The differing effects of T on secretion indicators may result from a dual action of T on receptor and post-receptor intracellular events.

  12. Estrogen and cyclic amp action, and the involvement of the cytoskeleton on gap junction formation in rat myometrium

    E-print Network

    Gaddy, Dana

    1985-01-01

    the myosin light chain kinase-calmodulin complex. This enzyme complex phosphorylates myosin light chains permitting actin-myosin interaction culminating in myometrial contraction. The balance between alpha- and beta-adrenergic receptor activation... of gap junctions in 48 hr organ culture. Page 15 23 3. Presence of gap junctions in response to E28 priming or cAIIP/CSK-altering agent controls. 4. Number of gap junctions in the circular layer of myometrium . 5. Number of gap junctions...

  13. Activation of melanoma tyrosinase by a cyclic AMP-dependent protein kinase in a cell-free system

    Microsoft Academic Search

    Ann Körner; John Pawelek

    1977-01-01

    REGULATION of pigmentation is of considerable importance throughout the animal kingdom. Photoprotection, social behaviour, and a number of disorders like albinism, vitiligo, and melanoma are affected by the amount and distribution of melanin in the organism. Melanin is synthesised in melanosomes beginning with the oxidation of tyrosine to dihydroxy-phenyalanine (DOPA) by the enzyme tyrosinase. In Cloudman S91 melanoma cells, tyrosinase

  14. Differential regulation of human 3?-hydroxysteroid dehydrogenase type 2 for steroid hormone biosynthesis by starvation and cyclic AMP stimulation: studies in the human adrenal NCI-H295R cell model.

    PubMed

    Udhane, Sameer; Kempna, Petra; Hofer, Gaby; Mullis, Primus E; Flück, Christa E

    2013-01-01

    Human steroid biosynthesis depends on a specifically regulated cascade of enzymes including 3?-hydroxysteroid dehydrogenases (HSD3Bs). Type 2 HSD3B catalyzes the conversion of pregnenolone, 17?-hydroxypregnenolone and dehydroepiandrosterone to progesterone, 17?-hydroxyprogesterone and androstenedione in the human adrenal cortex and the gonads but the exact regulation of this enzyme is unknown. Therefore, specific downregulation of HSD3B2 at adrenarche around age 6-8 years and characteristic upregulation of HSD3B2 in the ovaries of women suffering from the polycystic ovary syndrome remain unexplained prompting us to study the regulation of HSD3B2 in adrenal NCI-H295R cells. Our studies confirm that the HSD3B2 promoter is regulated by transcription factors GATA, Nur77 and SF1/LRH1 in concert and that the NBRE/Nur77 site is crucial for hormonal stimulation with cAMP. In fact, these three transcription factors together were able to transactivate the HSD3B2 promoter in placental JEG3 cells which normally do not express HSD3B2. By contrast, epigenetic mechanisms such as methylation and acetylation seem not involved in controlling HSD3B2 expression. Cyclic AMP was found to exert differential effects on HSD3B2 when comparing short (acute) versus long-term (chronic) stimulation. Short cAMP stimulation inhibited HSD3B2 activity directly possibly due to regulation at co-factor or substrate level or posttranslational modification of the protein. Long cAMP stimulation attenuated HSD3B2 inhibition and increased HSD3B2 expression through transcriptional regulation. Although PKA and MAPK pathways are obvious candidates for possibly transmitting the cAMP signal to HSD3B2, our studies using PKA and MEK1/2 inhibitors revealed no such downstream signaling of cAMP. However, both signaling pathways were clearly regulating HSD3B2 expression. PMID:23874725

  15. The responsiveness of cerebral cortical adrenergic receptors after chronic administration of atypical antidepressant mianserin.

    PubMed Central

    Nalepa, I; Vetulani, J

    1994-01-01

    The aim of this study was to evaluate the effect of mianserin, a second generation tetracyclic antidepressant agent, on the receptors' and second messenger systems related to noradrenergic transmission in the cerebral cortex of the rat. In in vitro experiments we confirmed that mianserin binds with equal potency to alpha 1- and alpha 2-adrenoceptors and does not affect beta 1-adrenoceptors. It inhibited the noradrenaline-stimulated inositol phosphate accumulation and did not change the cyclic AMP responses to noradrenaline and isoproterenol. The drug attenuated the inhibitory action of PKC activator, TPA, on the noradrenergic response from alpha 1-adrenoceptor and the potentiating action of TPA on the cyclic AMP stimulated with noradrenaline and isoproterenol. In chronic experiments we have found that, in contrast to most antidepressants, chronic treatment with mianserin does not produce strong beta-downregulation, but increases the maximal inositol phosphate response from alpha 1-adrenoceptor. The results indicate that alpha 1-upregulation might be a characteristic of those efficient antidepressant drugs which do not produce a strong beta-downregulatory effect. PMID:8204564

  16. Effect of beta-ADrenergic Agonist on Cyclic AMP Synthesis in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    Several beta-adrenergic receptor (bAR) agonists are known to cause hypertrophy of skeletal muscle tissue. Because it seems logical that these agonists exert their action on muscle through stimulation of cAMP synthesis, five bAR agonists encompassing a range in activity from strong to weak were evaluated for their ability to stimulate cAMP accumulation in embryonic chicken skeletal muscle cells in culture. Two strong agonists (epinephrine and isoproterenol), one moderate agonist (albuterol), and two weak agonists known to cause hypertrophy in animals (clenbuterol and cimaterol) were studied. Dose response curves were determined over six orders of magnitude in concentration for each agonist, and values were determined for their maximum stimulation of cAMP synthesis rate (Bmax) and the agonist concentration at which 50% stimulation of cAMP synthesis (EC50) occurred. Bmax values decreased in the following order: isoproterenol, epinephrine, albuterol, cimaterol, clenbuterol. Cimaterol and clenbuterol at their Bmax levels were approximately 15-fold weaker than isoproterenol in stimulating the rate of cAMP synthesis. In addition, the EC50 values for isoproterenol, cimaterol, clenbuterol, epinephrine, and albuterol were 360 nM, 630 nM, 900 nM, 2,470 nM, and 3,650 nM, respectively. Finally, dose response curves show that the concentrations of cimaterol and clenbuterol in culture media at concentrations known to cause significant muscle hypertrophy in animals had no detectable effect on stimulation of CAMP accumulation in chicken skeletal muscle cells.

  17. Cyclic AMP directs inositol (1,4,5)-trisphosphate-evoked Ca2+ signalling to different intracellular Ca2+ stores

    PubMed Central

    Tovey, Stephen C.; Taylor, Colin W.

    2013-01-01

    Summary Cholesterol depletion reversibly abolishes carbachol-evoked Ca2+ release from inositol (1,4,5)-trisphosphate (IP3)-sensitive stores, without affecting the distribution of IP3 receptors (IP3R) or endoplasmic reticulum, IP3 formation or responses to photolysis of caged IP3. Receptors that stimulate cAMP formation do not alone evoke Ca2+ signals, but they potentiate those evoked by carbachol. We show that these potentiated signals are entirely unaffected by cholesterol depletion and that, within individual cells, different IP3-sensitive Ca2+ stores are released by carbachol alone and by carbachol combined with receptors that stimulate cAMP formation. We suggest that muscarinic acetylcholine receptors in lipid rafts deliver IP3 at high concentration to associated IP3R, stimulating them to release Ca2+. Muscarinic receptors outside rafts are less closely associated with IP3R and provide insufficient local IP3 to activate IP3R directly. These IP3R, probably type 2 IP3R within a discrete Ca2+ store, are activated only when their sensitivity is increased by cAMP. Sensitization of IP3R by cAMP extends the effective range of signalling by phospholipase C, allowing muscarinic receptors that are otherwise ineffective to recruit additional IP3-sensitive Ca2+ stores. PMID:23525004

  18. Cyclic AMP signaling control of action potential firing rate and molecular circadian pacemaking in the suprachiasmatic nucleus.

    PubMed

    Atkinson, Susan E; Maywood, Elizabeth S; Chesham, Johanna E; Wozny, Christian; Colwell, Christopher S; Hastings, Michael H; Williams, Stephen R

    2011-06-01

    Circadian pacemaking in suprachiasmatic nucleus (SCN) neurons revolves around transcriptional/posttranslational feedback loops, driven by protein products of "clock" genes. These loops are synchronized and sustained by intercellular signaling, involving vasoactive intestinal peptide (VIP) via its VPAC2 receptor, which positively regulates cAMP synthesis. In turn, SCN cells communicate circadian time to the brain via a daily rhythm in electrophysiological activity. To investigate the mechanisms whereby VIP/VPAC2/cAMP signaling controls SCN molecular and electrical pacemaking, we combined bioluminescent imaging of circadian gene expression and whole-cell electrophysiology in organotypic SCN slices. As a potential direct target of cAMP, we focused on hyperpolarization-activated, cyclic nucleotide-gated (HCN) channels. Mutations of VIP-ergic signaling compromised the SCN molecular pacemaker, diminishing the amplitude and intercellular synchrony of circadian gene expression. These deficits were transiently reversed by elevation of cAMP. Similarly, cellular synchrony in electrical firing rates was lost in SCN slices lacking the VPAC2 receptor for VIP. Whole-cell current-clamp recordings in wild-type (WT) slices revealed voltage responses shaped by the conductance I(h), which is mediated by HCN channel activity. The influence of I(h) on voltage responses showed a modest peak in early circadian day, identifying HCN channels as a putative mediator of cAMP-dependent circadian effects on firing rate. I(h), however, was unaffected by loss of VIP-ergic signaling in VPAC2-null slices, and inhibition of cAMP synthesis had no discernible effect on I(h) but did suppress gene expression and SCN firing rates. Moreover, only sustained but not acute, pharmacological blockade of HCN channels reduced action potential (AP) firing. Thus, our evidence suggests that in the SCN, cAMP-mediated signaling is not a principal regulator of HCN channel function and that HCN is not a determinant of AP firing rate. VIP/cAMP-dependent signaling sustains the SCN molecular oscillator and action potential firing via mechanisms yet to be identified. PMID:21628548

  19. Transcriptome analysis of cyclic AMP-dependent protein kinase A-regulated genes reveals the production of the novel natural compound fumipyrrole by Aspergillus fumigatus.

    PubMed

    Macheleidt, Juliane; Scherlach, Kirstin; Neuwirth, Toni; Schmidt-Heck, Wolfgang; Straßburger, Maria; Spraker, Joseph; Baccile, Joshua A; Schroeder, Frank C; Keller, Nancy P; Hertweck, Christian; Heinekamp, Thorsten; Brakhage, Axel A

    2015-04-01

    Aspergillus fumigatus is an opportunistic human pathogenic fungus causing life-threatening infections in immunocompromised patients. Adaptation to different habitats and also virulence of the fungus depends on signal perception and transduction by modules such as the cyclic AMP-dependent protein kinase A (PKA) pathway. Here, by transcriptome analysis, 632 differentially regulated genes of this important signaling cascade were identified, including 23 putative transcriptional regulators. The highest upregulated transcription factor gene was located in a previously unknown secondary metabolite gene cluster, which we named fmp, encoding an incomplete non-ribosomal peptide synthetase, FmpE. Overexpression of the regulatory gene fmpR using the Tet(O) (n) system led to the specific expression of the other six genes of the fmp cluster. Metabolic profiling of wild type and fmpR overexpressing strain by HPLC-DAD and HPLC-HRESI-MS and structure elucidation by NMR led to identification of 5-benzyl-1H-pyrrole-2-carboxylic acid, which we named fumipyrrole. Fumipyrrole was not described as natural product yet. Chemical synthesis of fumipyrrole confirmed its structure. Interestingly, deletion of fmpR or fmpE led to reduced growth and sporulation of the mutant strains. Although fmp cluster genes were transcribed in infected mouse lungs, deletion of fmpR resulted in wild-type virulence in a murine infection model. PMID:25582336

  20. Effect of Increased Cyclic AMP Concentration on Muscle Protein Synthesis and Beta-Adrenergic Receptor Expression in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Vaughn, J. R.; Bridge, K. Y.; Smith, C. K.

    1998-01-01

    Analogies of epinephrine are known to cause hypertrophy of skeletal muscle when fed to animals. These compounds presumably exert their physiological action through interaction with the P-adrenergic receptor. Since the intracellular signal generated by the Beta-adrenergic receptor is cyclic AMP (cAMP), experiments were initiated in cell culture to determine if artificial elevation of cAMP by treatment with forskolin would alter muscle protein metabolism and P-adrenergic receptor expression. Chicken skeletal muscle cells after 7 days in culture were treated with 0.2-30 micrometers forskolin for a total of three days. At the end of the treatment period, both the concentration of cAMP and the quantity of myosin heavy chain (MHC) were measured. Concentration of cAMP in forskolin-treated cells increased up to 10-fold in a dose dependent manner. In contrast, the quantity of MHC was increased approximately 50% above control cells at 0.2 micrometers forskolin, but exhibited a gradual decline at higher levels of forskolin so that the quantity of MHC in cells treated with 30 micrometers forskolin was not significantly different from controls. Curiously, the intracellular concentration of cAMP which elicited the maximum increase in the quantity of MHC was only 40% higher than cAMP concentration in control cells.

  1. The effects of phosphodiesterase inhibition on cyclic GMP and cyclic AMP accumulation in the hippocampus of the rat.

    PubMed

    van Staveren WC; Markerink-van Ittersum M; Steinbusch, H W; de Vente J

    2001-01-12

    The effects of selective and non-selective 3',5'-cyclic nucleotide phosphodiesterase (PDE) inhibitors on cGMP and cAMP accumulation were studied in rat hippocampal slices incubated in vitro. The following PDE inhibitors were used: vinpocetine and calmidazolium (PDE1 selective), erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA, PDE2 selective), SK&F 95654 (PDE3 selective), rolipram (PDE4 selective), SK&F 96231 (PDE5 selective), the mixed type inhibitors zaprinast and dipyridamole, and the non-selective inhibitors 3-isobutyl-1-metylxanthine (IBMX) and caffeine. cGMP levels were increased in the presence of different concentrations of IBMX, EHNA, dipyridamole, vinpocetine and rolipram. cGMP immunocytochemistry showed that incubation with different inhibitors in the presence and/or absence of sodium nitroprusside resulted in pronounced differences in the extent and regional localization of the cGMP response and indicate that PDE activity in the hippocampus is high and diverse in nature. The results suggest an interaction between cGMP and cAMP signalling pathways in astrocytes of the rat hippocampus. PMID:11150485

  2. A polysaccharide from Ganoderma atrum inhibits tumor growth by induction of apoptosis and activation of immune response in CT26-bearing mice.

    PubMed

    Zhang, Shenshen; Nie, Shaoping; Huang, Danfei; Huang, Jianqin; Feng, Yanling; Xie, Mingyong

    2014-09-24

    Ganoderma atrum is one species of edible and pharmaceutical mushroom with various biological activities. Recently, a novel polysaccharide, PSG-1, was purified from G. atrum. The antitumor activity and its mechanism of action were studied. In vitro, PSG-1 has little effect on inhibiting proliferation of CT26 tumor cells. However, the tumor size was significantly decreased in PSG-1-treated mice. The results showed that PSG-1 induced apoptosis in CT26 cells. Moreover, the intracellular cyclic AMP (cAMP) level and protein kinase A (PKA) activity were markedly increased in PSG-1-treated mice. In contrast, the contents of cyclic GMP and DAG and the PKC activity were decreased. Similarly, the expression of PKA protein was upregulated, while PKC protein expression in PSG-1-treated group was lowered. Additionally, PSG-1 increased the immune organ index and serum biochemistry parameter. In general, PSG-1 enhances the antitumor immune response, induces apoptosis in CT26-bearing mice, and could be a safe and effective adjuvant for tumor therapy or functional food. PMID:25179589

  3. Beta-Adrenergic Receptor Population is Up-Regulated by Increased Cyclic Amp Concentration in Chicken Skeletal Muscle Cells in Culture

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Vaughn, Jeffrey R.

    1999-01-01

    Skeletal muscle hypertrophy is promoted in vivo by administration of beta-drenergic receptor (bAR) agonists. Chicken skeletal muscle cells were treated with 1 (mu)M isoproterenol, a strong bAR agonist, between days 7 and 10 in culture. bAR population increased by approximately 40% during this treatment; however, the ability of the cells to synthesize cyclic AMP (cAMP) was diminished by two-fold. The quantity of myosin heavy chain (MHC) was not affected. To understand further the relationship between intracellular cAMP levels, bAR population, and muscle protein accumulation, intracellular cAMP levels were artificially elevated by treatment with 0-10 uM forskolin for up to three days. The basal concentration of CAMP in forskolin-treated cells increased up to 7-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in bAR population, with a maximum increase of approximately 40-60% at 10 uM forskolin. A maximum increase of 40-50% in the quantity of MHC was observed at 0.2 uM forskolin, but higher concentrations of forskolin reduced the quantity of MHC back to control levels. At 0.2 uM forskolin, intracellular levels of cAMP were higher by approximately 35%, and the (beta)AR population was higher by approximately 30%. Neither the number of muscle nuclei fused into myotubes nor the percentage of nuclei in myotubes were affected by forskolin at any of the concentrations studied.

  4. DOS(Ec), a heme-regulated phosphodiesterase, plays an important role in the regulation of the cyclic AMP level in Escherichia coli.

    PubMed

    Yoshimura-Suzuki, Tokiko; Sagami, Ikuko; Yokota, Nao; Kurokawa, Hirofumi; Shimizu, Toru

    2005-10-01

    Heme-regulated phosphodiesterase from Escherichia coli (DOS(Ec)) catalyzes the hydrolysis of cyclic AMP (cAMP) in vitro and is regulated by the redox state of the bound heme. Changes in the redox state result in alterations in the three-dimensional structure of the enzyme, which is then transmitted to the functional domain to switch catalysis on or off. Because DOS(Ec) was originally cloned from E. coli genomic DNA, it has not been known whether it is actually expressed in wild-type E. coli. In addition, the turnover number of DOS(Ec) using cAMP as a substrate is only 0.15 min(-1), which is relatively low for a physiologically relevant enzyme. In the present study, we demonstrated for the first time that the DOS(Ec) gene and protein are expressed in wild-type E. coli, especially under aerobic conditions. We also developed a DOS(Ec) gene knockout strain (Deltados). Interestingly, the knockout of dos caused excess accumulation of intracellular cAMP (26-fold higher than in the wild-type strain) under aerobic conditions, whereas accumulation of cAMP was not observed under anaerobic conditions. We also found differences in cell morphology and growth rate between the mutant cells and the wild-type strain. The changes in the knockout strain were partially complemented by introducing an expression plasmid for dos. Thus, the present study revealed that expression of DOS(Ec) is regulated according to environmental O2 availability at the transcriptional level and that the concentration of cAMP in cells is regulated by DOS(Ec) expression. PMID:16166529

  5. DOSEc, a Heme-Regulated Phosphodiesterase, Plays an Important Role in the Regulation of the Cyclic AMP Level in Escherichia coli

    PubMed Central

    Yoshimura-Suzuki, Tokiko; Sagami, Ikuko; Yokota, Nao; Kurokawa, Hirofumi; Shimizu, Toru

    2005-01-01

    Heme-regulated phosphodiesterase from Escherichia coli (DOSEc) catalyzes the hydrolysis of cyclic AMP (cAMP) in vitro and is regulated by the redox state of the bound heme. Changes in the redox state result in alterations in the three-dimensional structure of the enzyme, which is then transmitted to the functional domain to switch catalysis on or off. Because DOSEc was originally cloned from E. coli genomic DNA, it has not been known whether it is actually expressed in wild-type E. coli. In addition, the turnover number of DOSEc using cAMP as a substrate is only 0.15 min?1, which is relatively low for a physiologically relevant enzyme. In the present study, we demonstrated for the first time that the DOSEc gene and protein are expressed in wild-type E. coli, especially under aerobic conditions. We also developed a DOSEc gene knockout strain (?dos). Interestingly, the knockout of dos caused excess accumulation of intracellular cAMP (26-fold higher than in the wild-type strain) under aerobic conditions, whereas accumulation of cAMP was not observed under anaerobic conditions. We also found differences in cell morphology and growth rate between the mutant cells and the wild-type strain. The changes in the knockout strain were partially complemented by introducing an expression plasmid for dos. Thus, the present study revealed that expression of DOSEc is regulated according to environmental O2 availability at the transcriptional level and that the concentration of cAMP in cells is regulated by DOSEc expression. PMID:16166529

  6. G(alpha) and Gbeta proteins regulate the cyclic AMP pathway that is required for development and pathogenicity of the phytopathogen Mycosphaerella graminicola.

    PubMed

    Mehrabi, Rahim; Ben M'Barek, Sarrah; van der Lee, Theo A J; Waalwijk, Cees; de Wit, Pierre J G M; Kema, Gerrit H J

    2009-07-01

    We identified and functionally characterized genes encoding three Galpha proteins and one Gbeta protein in the dimorphic fungal wheat pathogen Mycosphaerella graminicola, which we designated MgGpa1, MgGpa2, MgGpa3, and MgGpb1, respectively. Sequence comparisons and phylogenetic analyses showed that MgGPA1 and MgGPA3 are most related to the mammalian Galpha(i) and Galpha(s) families, respectively, whereas MgGPA2 is not related to either of these families. On potato dextrose agar (PDA) and in yeast glucose broth (YGB), MgGpa1 mutants produced significantly longer spores than those of the wild type (WT), and these developed into unique fluffy mycelia in the latter medium, indicating that this gene negatively controls filamentation. MgGpa3 mutants showed more pronounced yeast-like growth accompanied with hampered filamentation and secreted a dark-brown pigment into YGB. Germ tubes emerging from spores of MgGpb1 mutants were wavy on water agar and showed a nested type of growth on PDA that was due to hampered filamentation, numerous cell fusions, and increased anastomosis. Intracellular cyclic AMP (cAMP) levels of MgGpb1 and MgGpa3 mutants were decreased, indicating that both genes positively regulate the cAMP pathway, which was confirmed because the WT phenotype was restored by adding cAMP to these mutant cultures. The cAMP levels in MgGpa1 mutants and the WT were not significantly different, suggesting that this gene might be dispensable for cAMP regulation. In planta assays showed that mutants of MgGpa1, MgGpa3, and MgGpb1 are strongly reduced in pathogenicity. We concluded that the heterotrimeric G proteins encoded by MgGpa3 and MgGpb1 regulate the cAMP pathway that is required for development and pathogenicity in M. graminicola. PMID:19411619

  7. Cloning and molecular characterization of csm mutations allowing expression of catabolite-repressible operons in the absence of exogenous cyclic AMP.

    PubMed Central

    George, S E; Melton, T

    1986-01-01

    The cyclic AMP (cAMP) suppressor mutation (csm) of Escherichia coli has been cloned from strain NCR30 in the HindIII-EcoRI site of pBR322. This mutation has been mapped in or near the crp gene. Wild-type crp DNA hybridized to recombinant plasmids pGM5 and pGM25 containing the cloned csm mutation. These recombinant plasmids encoded a protein product of identical molecular weight and charge as that of the wild-type cAMP receptor protein. Transformants of cya crp deletion strains harboring pBM5 or pGM25 exhibited phenotypic characteristics common to strain NCR30. These included the expression of catabolite-repressible enzymes, such as arabinose isomerase, tryptophanase, beta-galactosidase, and threonine deaminase; the expression of chemotactic and motility genes; cAMP sensitivity; and the accumulation of toxic levels of methylglyoxal. DNA sequence analysis indicated that the Csm suppressor phenotype was attributable to the insertion of a guanosine residue 17 base pairs downstream from the termination codon of the crp structural gene. The guanosine insertion is located in the stem region of the presumed transcriptional termination loop. This stem region contained a unique BssHII restriction site which was used to construct an in vitro deletion in the wild-type crp insert in plasmid pHA7. The resulting plasmid, pGM459, renders transformants having a phenotype common to that conferred by the chromosomal or cloned csm mutation. Our results indicate a novel role for the 3' flanking region of the crp structural gene in the expression of the cAMP receptor protein. Images PMID:3009405

  8. DOSE-DEPENDENT EFFECT OF PRENATAL DEXAMETHASONE TREATMENT ON B-ADRENERGIC RECEPTOR COUPLING TO ORNITHINE DECARBOXYLASE AND CYCLIC AMP

    EPA Science Inventory

    Glucocorticoids regulate the coupling of B-adrenergic receptors to cell function. n the current study, the potential role of these agents in the development of adrenergic responses was evaluated in the offspring of pregnant rats given 0.8 mg/kg of dexamethasone on gestational day...

  9. Effects of selective inhibition of protein kinase C, cyclic AMP-dependent protein kinase, and Ca(2+)-calmodulin-dependent protein kinase on neurite development in cultured rat hippocampal neurons.

    PubMed

    Cabell, L; Audesirk, G

    1993-06-01

    A variety of experimental evidence suggests that calmodulin and protein kinases, especially protein kinase C, may participate in regulating neurite development in cultured neurons, particularly neurite initiation. However, the results are somewhat contradictory. Further, the roles of calmodulin and protein kinases on many aspects of neurite development, such as branching or elongation of axons vs dendrites, have not been extensively studied. Cultured embryonic rat hippocampal pyramidal neurons develop readily identifiable axons and dendrites. We used this culture system and the new generation of highly specific protein kinase inhibitors to investigate the roles of protein kinases and calmodulin in neurite development. Neurons were cultured for 2 days in the continuous presence of calphostin C (a specific inhibitor of protein kinase C), KT5720 (inhibitor of cyclic AMP-dependent protein kinase), KN62 (inhibitor of Ca(2+)-calmodulin-dependent protein kinase II), or calmidazolium (inhibitor of calmodulin), each at concentrations from approximately 1 to 10 times the concentration reported in the literature to inhibit each kinase by 50%. The effects of phorbol 12-myristate 13-acetate (an activator of protein kinase C) and 4 alpha-phorbol 12,13-didecanoate (an inactive phorbol ester) were also tested. At concentrations that had no effect on neuronal viability, calphostin C reduced neurite initiation and axon branching without significantly affecting the number of dendrites per neuron, dendrite branching, dendrite length, or axon length. Phorbol 12-myristate 13-acetate increased axon branching and the number of dendrites per cell, compared to the inactive 4 alpha-phorbol 12,13-didecanoate. KT5720 inhibited only axon branching. KN62 reduced axon length, the number of dendrites per neuron, and both axon and dendrite branching. At low concentrations, calmidazolium had no effect on any aspect of neurite development, but at high concentrations, calmidazolium inhibited every parameter that was measured (including viability). These results suggest that these three protein kinases selectively modulate different aspects of neurite development. The university of effects caused by calmodulin inhibition make it impossible to determine if there are specific targets of calmodulin action involved in neurite development. Finally, our data indicate that some superficially similar characteristics of neuronal differentiation, such as neurite initiation and branching, may be controlled by quite different molecular mechanisms. PMID:7689287

  10. Boron and silicon: Effects on growth, plasma lipids, urinary cyclic AMP and bone and brain mineral composition of male rats

    SciTech Connect

    Seaborn, C.D.; Nielsen, F.H. (Dept. of Agriculture, Grand Forks, ND (United States). Grand Forks Human Nutrition Research Center)

    1994-06-01

    Because boron resembles silicon in its chemical properties, an experiment was performed to determine if excessive dietary boron would affect the response to silicon deprivation and, conversely, if silicon would influence the effects of an excessive intake of boron. Male weanling Sprague-Dawley rats were assigned to groups of 6 or 12 in a two-by-two factorially arranged experiment. Supplemented to a ground corn/casein diet containing 1.2 [mu]g silicon and 3 [mu]g boron per gram were silicon as sodium metasilicate at 0 or 50 [mu]g/g and boron as orthoboric acid at 0 or 500 [mu]g/g diet. At nine weeks, animals fed high dietary boron had significantly decreased final body weights, liver-weight-to-body-weight ratios, urinary cAMP concentrations, plasma triglyceride, cholesterol, glycine, valine, leucine, and lysine concentrations and skull copper, sodium, and manganese concentrations. High dietary boron also significantly increased brain-weight-to-body-weight ratios, magnesium concentrations of femur, brain, and plasma, zinc concentration of femur, and iron concentration of skull. The bone mineral findings suggest that excess dietary boron exerts subtle effects on bone composition. Dietary silicon affected blood urea nitrogen, hematocrit, hemoglobin, and the concentrations of plasma threonine and aspartic acid in animals fed excess boron. Depression of the testes-weight-to-body-weight ratio of animals fed 500 [mu]g boron per gram diet was most marked in animals not fed silicon. Although excessive dietary boron did not markedly enhanced the response of rats to silicon deprivation, dietary silicon affected their response to high dietary boron. Thus, dietary silicon apparently can influence boron toxicity.

  11. Cardiac pacemaker function of HCN4 channels in mice is confined to embryonic development and requires cyclic AMP

    Microsoft Academic Search

    Dagmar Harzheim; K Holger Pfeiffer; Larissa Fabritz; Elisabeth Kremmer; Thorsten Buch; Ari Waisman; Paulus Kirchhof; U Benjamin Kaupp; Reinhard Seifert

    2008-01-01

    Important targets for cAMP signalling in the heart are hyperpolarization-activated and cyclic nucleotide-gated (HCN) channels that underlie the depolarizing 'pace- maker' current, If. We studied the role of If in mice, in which binding of cAMP to HCN4 channels was abolished by a single amino-acid exchange (R669Q). Homozygous HCN4R669Q\\/R669Q mice die during embryonic development. Prior to E12, homozygous and heterozygous

  12. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and highlight biological processes important for pathogenicity. PMID:23665591

  13. Low doses of cyclic AMP-phosphodiesterase inhibitors rapidly evoke opioid receptor-mediated thermal hyperalgesia in naïve mice which is converted to prominent analgesia by cotreatment with ultra-low-dose naltrexone

    Microsoft Academic Search

    Stanley M. Crain; Ke-Fei Shen

    2008-01-01

    Systemic (s.c.) injection in naïve mice of cyclic AMP-phosphodiesterase (cAMP-PDE) inhibitors, e.g. 3-isobutyl-1-methylxanthine [(IBMX) or caffeine, 10 mg\\/kg] or the more specific cAMP-PDE inhibitor, rolipram (1 ?g\\/kg), rapidly evokes thermal hyperalgesia (lasting >5 h). These effects appear to be mediated by enhanced excitatory opioid receptor signaling, as occurs during withdrawal in opioid-dependent mice. Cotreatment of these mice with ultra-low-dose naltrexone (NTX, 0.1 ng\\/kg–1 pg\\/kg, s.c.)

  14. (S)-?-chlorohydrin inhibits protein tyrosine phosphorylation through blocking cyclic AMP - protein kinase A pathway in spermatozoa.

    PubMed

    Zhang, Hao; Yu, Huan; Wang, Xia; Zheng, Weiwei; Yang, Bei; Pi, Jingbo; He, Gengsheng; Qu, Weidong

    2012-01-01

    ?-Chlorohydrin is a common contaminant in food. Its (S)-isomer, (S)-?-chlorohydrin (SACH), is known for causing infertility in animals by inhibiting glycolysis of spermatozoa. The aim of present work was to examine the relationship between SACH and protein tyrosine phosphorylation (PTP), which plays a critical role in regulating mammalian sperm capacitation. In vitro exposure of SACH 50 µM to isolated rat epididymal sperm inhibited PTP. Sperm-specific glyceraldehyde 3-phosphate dehydrogenase (GAPDS) activities, the intracellular adenosine 5'-triphosphate (ATP) levels, 3'-5'-cyclic adenosine monophosphate (cAMP) levels and phosphorylation of protein kinase A (PKA) substrates in rat sperm were diminished dramatically, indicating that both glycolysis and the cAMP/PKA signaling pathway were impaired by SACH. The inhibition of both PTP and phosphorylation of PKA substrates by SACH could be restored by addition of cAMP analog dibutyryl-cAMP (dbcAMP) and phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX). Moreover, addition of glycerol protected glycolysis, ATP levels, phosphorylation of PKA substrates and PTP against the influence of SACH. These results suggested SACH inhibited PTP through blocking cAMP/PKA pathway in sperm, and PTP inhibition may play a role in infertility associated with SACH. PMID:22916194

  15. (S)-?-Chlorohydrin Inhibits Protein Tyrosine Phosphorylation through Blocking Cyclic AMP - Protein Kinase A Pathway in Spermatozoa

    PubMed Central

    Zheng, Weiwei; Yang, Bei; Pi, Jingbo; He, Gengsheng; Qu, Weidong

    2012-01-01

    ?-Chlorohydrin is a common contaminant in food. Its (S)-isomer, (S)-?-chlorohydrin (SACH), is known for causing infertility in animals by inhibiting glycolysis of spermatozoa. The aim of present work was to examine the relationship between SACH and protein tyrosine phosphorylation (PTP), which plays a critical role in regulating mammalian sperm capacitation. In vitro exposure of SACH 50 µM to isolated rat epididymal sperm inhibited PTP. Sperm-specific glyceraldehyde 3-phosphate dehydrogenase (GAPDS) activities, the intracellular adenosine 5?-triphosphate (ATP) levels, 3?-5?-cyclic adenosine monophosphate (cAMP) levels and phosphorylation of protein kinase A (PKA) substrates in rat sperm were diminished dramatically, indicating that both glycolysis and the cAMP/PKA signaling pathway were impaired by SACH. The inhibition of both PTP and phosphorylation of PKA substrates by SACH could be restored by addition of cAMP analog dibutyryl-cAMP (dbcAMP) and phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX). Moreover, addition of glycerol protected glycolysis, ATP levels, phosphorylation of PKA substrates and PTP against the influence of SACH. These results suggested SACH inhibited PTP through blocking cAMP/PKA pathway in sperm, and PTP inhibition may play a role in infertility associated with SACH. PMID:22916194

  16. Requirements of class II-mediated B cell differentiation for class II cross-linking and cyclic AMP.

    PubMed

    Bishop, G A

    1991-08-15

    Cells of the mouse B cell clone, CH12.LX, receive Ag-dependent differentiative signals through their surface membrane class II molecules. The present study was performed to determine the role of class II cross-linking and cAMP in the successful delivery of these signals. Delivery of differentiative signals by anti-Ek mAb was increased by further cross-linking with a secondary anti-isotype antibody. Intact or (Fab')2, but not Fab forms of anti-Ek successfully delivered the Ag-dependent differentiative signal. Inability of monovalent Fab fragments to deliver the signal could not be attributed to an inability to adequately bind Ek molecules. The requirement for cAMP for class II-mediated signaling was also examined, because previous studies have implicated elevated cAMP levels as necessary for class II signaling. Both Ag-dependent, Ek-mediated differentiation and the Ek-mediated inhibition of Ag-independent LPS-induced differentiation were inhibited by the adenyl cyclase inhibitor 2'5'ddA, although elevation of cAMP was not in itself sufficient to deliver the differentiative signal. Inhibition of LPS-induced differentiation could be mediated by mAb binding to either Ek, Abk, or Abb on CH12.LX or an Ab-bearing transfectant, CH12.ABB1. This inhibition was abrogated by 2'5'ddA in the case of Ek or Abb, both of which deliver Ag-dependent differentiative signals to CH12.LX cells. In the case of Abk, which does not deliver such signals to CH12.LX, 2'5'ddA did not abrogate anti-Abk-mediated inhibition of the LPS response. The effects of 2'5'ddA were reversed by the cAMP analog, dibutyryl cAMP, and Ag-dependent-induced differentiation of CH12.LX or CH12.ABB1 was accompanied by an increase in cAMP levels. PMID:1651356

  17. Regulation of vascular smooth muscle cell calcification by extracellular pyrophosphate homeostasis: synergistic modulation by cyclic AMP and hyperphosphatemia

    PubMed Central

    Prosdocimo, Domenick A.; Wyler, Steven C.; Romani, Andrea M.; O'Neill, W. Charles

    2010-01-01

    Vascular calcification is a multifaceted process involving gain of calcification inducers and loss of calcification inhibitors. One such inhibitor is inorganic pyrophosphate (PPi), and regulated generation and homeostasis of extracellular PPi is a critical determinant of soft-tissue mineralization. We recently described an autocrine mechanism of extracellular PPi generation in cultured rat aortic vascular smooth muscle cells (VSMC) that involves both ATP release coupled to the ectophosphodiesterase/pyrophosphatase ENPP1 and efflux of intracellular PPi mediated or regulated by the plasma membrane protein ANK. We now report that increased cAMP signaling and elevated extracellular inorganic phosphate (Pi) act synergistically to induce calcification of these VSMC that is correlated with progressive reduction in ability to accumulate extracellular PPi. Attenuated PPi accumulation was mediated in part by cAMP-dependent decrease in ANK expression coordinated with cAMP-dependent increase in expression of TNAP, the tissue nonselective alkaline phosphatase that degrades PPi. Stimulation of cAMP signaling did not alter ATP release or ENPP1 expression, and the cAMP-induced changes in ANK and TNAP expression were not sufficient to induce calcification. Elevated extracellular Pi alone elicited only minor calcification and no significant changes in ANK, TNAP, or ENPP1. In contrast, combined with a cAMP stimulus, elevated Pi induced decreases in the ATP release pathway(s) that supports ENPP1 activity; this resulted in markedly reduced rates of PPi accumulation that facilitated robust calcification. Calcified VSMC were characterized by maintained expression of multiple SMC differentiation marker proteins including smooth muscle (SM) ?-actin, SM22?, and calponin. Notably, addition of exogenous ATP (or PPi per se) rescued cAMP + phosphate-treated VSMC cultures from progression to the calcified state. These observations support a model in which extracellular PPi generation mediated by both ANK- and ATP release-dependent mechanisms serves as a critical regulator of VSMC calcification. PMID:20018951

  18. Characterization of the non-nitrergic NANC relaxation responses in the rabbit vaginal wall

    PubMed Central

    Ziessen, Tom; Moncada, Salvador; Cellek, Selim

    2002-01-01

    Electrical field stimulation (EFS)-induced non-adrenergic non-cholinergic (NANC) relaxation responses in the rabbit vaginal wall were investigated. These NANC responses were partially inhibited with the nitric oxide synthase (NOS) inhibitors NG-nitro-L-arginine methyl ester (L-NAME; 500??M), NG-nitro-L-arginine (300??M) or N-iminoethyl-L-ornithine (500??M) or the selective soluble guanylate cyclase inhibitor 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one (ODQ, 10??M). Application of L-NAME and ODQ concomitantly did not increase the degree of inhibition. L-NAME or ODQ were observed to be more effective at low frequencies. The resistant part of the responses was more pronounced at higher frequencies and was completely inhibited by tetrodotoxin (1??M). Exogenous application of the peptides vasoactive intestinal peptide (VIP), pituitary adenylate cyclase activating peptide (PACAP-27 and PACAP-38), peptide histidine methionine (PHM), peptide histidine valine (PHV), helospectin-I or -II induced a relaxation response. Calcitonin gene-related peptide or substance P did not cause any relaxation. The peptidase ?-chymotrypsin (type II; 2 units?ml?1) did not affect non-nitrergic NANC responses, although it did inhibit relaxation responses elicited by exogenous VIP, PACAP-27, PACAP-38, PHM, PHV, helospectin-I or -II. K+ channel inhibitors apamin (1??M) or charybdotoxin (100?nM) when used alone or in conjunction did not affect non-nitrergic NANC responses. The non-nitrergic NANC responses were not associated with any increase in intracellular cyclic adenosine-3?, 5?-monophosphate (cyclic AMP) or cyclic guanosine-3?, 5?-monophosphate (cyclic GMP) concentrations. The peptide-induced relaxations were all associated with increases in cyclic AMP concentrations. These results suggest that a neuronal factor elicits non-nitrergic NANC responses in the rabbit vaginal wall. The identity of this factor remains to be established. PMID:11815390

  19. Activation of trehalase by membrane-depolarizing agents in yeast vegetative cells and ascospores.

    PubMed Central

    Thevelein, J M

    1984-01-01

    The membrane-depolarizing agents 2,4-dinitrophenol, carbonylcyanide m-chlorophenylhydrazone, and nystatin are known to cause a rapid increase in the cyclic AMP level in fungal cells. Addition of these proton ionophores to yeast stationary-phase cells or ascospores causes an immediate 10-fold increase in trehalase activity. This observation is in agreement with a role for cyclic AMP-induced phosphorylation in the activation process of trehalase. It also provides an explanation for previous results on the induction of trehalose breakdown by 2,4-dinitrophenol in resting yeast cells. PMID:6370962

  20. Effect of purified protein derivative and sonicates of Mycobacterium leprae and Mycobacterium bovis BCG on thromboplastin response in human monocytes in vitro.

    PubMed

    Lyberg, T; Closs, O; Prydz, H

    1982-12-01

    Human monocytes isolated from peripheral blood responded with increased thromboplastin expression upon stimulation in vitro with three mycobacterial antigens: tuberculin purified protein derivative and sonicates of Mycobacterium boviS BCG and Mycobacterium leprae. The stimulating principle of mycobacteria is probably a cell wall constituent since crude extracts of cell walls were 2.5 to 25 times more potent in stimulating thromboplastin synthesis than were whole sonicates. This thromboplastin response was inhibited by inhibitors of RNA and protein synthesis, dexamethasone, and agents that caused elevation of intracellular cyclic AMP. The presence of lymphocytes did not enhance the monocyte thromboplastin response significantly during the first 24 h of incubation. For M. bovis BCG and M. leprae sonicates, the thromboplastin response correlated with general activating effects measured by determining the release of lysozyme and beta-glucuronidase. The role of thromboplastin in chronic inflammatory reactions is discussed. PMID:6185426

  1. Accelerated resequestration of cytosolic calcium and suppression of the pro-inflammatory activities of human neutrophils by CGS 21680 in vitro

    PubMed Central

    Anderson, R; Visser, S S; Ramafi, G; Theron, A J

    2000-01-01

    We have investigated the effects of the adenosine A2A receptor agonist CGS 21680 (0.01–1??M) on reactive oxidant production by, and elastase release from FMLP-activated human neutrophils, as well as on cytosolic Ca2+ fluxes and intracellular concentrations of cyclic AMP. Oxidant production, elastase release and cyclic AMP were assayed using lucigenin-enhanced chemiluminescence, colourimetric and radioimmunoassay procedures respectively, while cytosolic Ca2+ fluxes were measured by fura-2 spectrofluorimetry in combination with radiometric procedures which distinguish between net efflux and influx of the cation. Treatment of neutrophils with CGS 21680 did not affect the FMLP-activated release of Ca2+ from intracellular stores, but resulted in dose-related acceleration of the rate of decline in fura-2 fluorescence, as well as decreases in both efflux and store-operated influx of Ca2+, compatible with enhancement of resequestration of the cation by the endo-membrane Ca2+-ATPase. These effects on neutrophil Ca2+ handling were associated with increased intracellular cyclic AMP and with inhibition of oxidant production and release of elastase. In contrast, treatment of neutrophils with the selective A2A receptor antagonist, ZM 241385 (2.5??M), prevented the transient increase in cyclic AMP in FMLP-activated neutrophils which was associated with delayed sequestration of incoming Ca2+ during store-operated influx. The CGS 21680-mediated reduction of Ca2+ efflux from FMLP-activated neutrophils was also antagonized by pretreatment of the cells with ZM 241385 (2.5??M), as well as by thapsigargin (1??M), an inhibitor of the endo-membrane Ca2+-ATPase. ZM 241385 also neutralized the cyclic AMP-elevating and anti-inflammatory interactions of CGS 21680 with neutrophils. We conclude that A2A receptors regulate the pro-inflammatory activities of human neutrophils by promoting cyclic AMP-dependent sequestration of cytosolic Ca2+. PMID:10864876

  2. Evidence for a role for cyclic AMP in modulating the action of 5-HT and an excitatory neuropeptide, FLP17A, in the pharyngeal muscle of Caenorhabditis elegans.

    PubMed

    Papaioannou, Sylvana; Holden-Dye, Lindy; Walker, Robert J

    2008-06-01

    The feeding activity of the nematode Caenorhabditis elegans is regulated by an anatomically well-defined network of 20 enteric neurones that employs small molecule and neuropeptidergic signalling. Two of the most potent excitatory agents are 5-HT and the neuropeptide FLP17A. Here we have examined the role of cAMP in modulating their excitatory actions by pharmacological manipulation of the level of cAMP. Application of the membrane permeable cAMP analogue, dibutyryl-cAMP (1 microM), enhanced the excitatory response to both FLP17A and 5-HT. Furthermore, the adenylyl cyclase activator, forskolin (50 nM), significantly enhanced the excitatory response to both FLP17A and 5-HT. The phosphodiesterase inhibitor, ibudilast (10 microM), enhanced the excitatory response to FLP17A. The protein kinase inhibitor, H-9 dihydrochloride (10 microM) significantly reduced the excitatory response to 5-HT. H-9 dihydrochloride also had a direct effect on pharyngeal activity. The effect of FLP17A and 5-HT on two mutants, egl-8 (loss-of-function phospholipase-Cbeta) and egl-30 (loss-of-function Galphaq) was also investigated. Both these mutants have a lower pharyngeal pumping rate than wild-type which has to be considered when interpreting the effects of these mutations on the excitatory responses to FLP17A and 5HT. However, even taking into consideration the lower basal activity of these mutants, it is clear that the percentage increase in pharyngeal pumping rate induced by FLP17A is greatly reduced in both mutants compared to wild-type. In the case of 5-HT, the effect of the mutant backgrounds on the response was less pronounced. Overall, the data support a role for cAMP in modulating the excitatory action of both FLP17A and 5-HT on C. elegans pharyngeal pumping and furthermore implicate an EGL-30 dependent pathway in the regulation of the response to FLP17A. PMID:18463910

  3. Repression of Protein Kinase C and Stimulation of Cyclic AMP Response Elements by Fumonisin, a Fungal Encoded Toxin Which Is a Carcinogen1

    Microsoft Academic Search

    Chongxi Huang; Martin Dickman; Gail Henderson; Clinton Jones

    1995-01-01

    Fusarium monili\\/orme (FM) is a major fungal pathogen of corn and is involved with stalk rot disease. FM is widely spread throughout the world, including the United States. Most strains of FM produce several nij co- toxins, the most prominent of which is called fumonisin. Recent epidemi ológica! studies indicated that ingestion of fumonisin correlates with a higher incidence of

  4. Long-Term Memory for Place Learning Is Facilitated by Expression of cAMP Response Element-Binding Protein in the Dorsal Hippocampus

    ERIC Educational Resources Information Center

    Brightwell, Jennifer J.; Smith, Clayton A.; Neve, Rachael L.; Colombo, Paul J.

    2007-01-01

    Extensive research has shown that the hippocampus is necessary for consolidation of long-term spatial memory in rodents. We reported previously that rats using a place strategy to solve a cross maze task showed sustained phosphorylation of hippocampus cyclic AMP response element-binding protein (CREB), a transcription factor implicated in…

  5. Neural Activation During Response Competition

    E-print Network

    Poldrack, Russ

    response. This reaction time effect was accompanied by increases in activity in four regions: the right the correct response. The effect of the irrelevant information can be assessed by comparing reaction times.g., shape or color) to which they respond, and the Stroop task, which requires that they name the color

  6. Appetitive Cue-Evoked ERK Signaling in the Nucleus Accumbens Requires NMDA and D1 Dopamine Receptor Activation and Regulates CREB Phosphorylation

    ERIC Educational Resources Information Center

    Kirschmann, Erin K. Z.; Mauna, Jocelyn C.; Willis, Cory M.; Foster, Rebecca L.; Chipman, Amanda M.; Thiels, Edda

    2014-01-01

    Conditioned stimuli (CS) can modulate reward-seeking behavior. This modulatory effect can be maladaptive and has been implicated in excessive reward seeking and relapse to drug addiction. We previously demonstrated that exposure to an appetitive CS causes an increase in the activation of extracellular signal-regulated kinase (ERK) and cyclic-AMP

  7. Neural activation during response competition

    NASA Technical Reports Server (NTRS)

    Hazeltine, E.; Poldrack, R.; Gabrieli, J. D.

    2000-01-01

    The flanker task, introduced by Eriksen and Eriksen [Eriksen, B. A., & Eriksen, C. W. (1974). Effects of noise letters upon the identification of a target letter in a nonsearch task. Perception & Psychophysics, 16, 143--149], provides a means to selectively manipulate the presence or absence of response competition while keeping other task demands constant. We measured brain activity using functional magnetic resonance imaging (fMRI) during performance of the flanker task. In accordance with previous behavioral studies, trials in which the flanking stimuli indicated a different response than the central stimulus were performed significantly more slowly than trials in which all the stimuli indicated the same response. This reaction time effect was accompanied by increases in activity in four regions: the right ventrolateral prefrontal cortex, the supplementary motor area, the left superior parietal lobe, and the left anterior parietal cortex. The increases were not due to changes in stimulus complexity or the need to overcome previously learned associations between stimuli and responses. Correspondences between this study and other experiments manipulating response interference suggest that the frontal foci may be related to response inhibition processes whereas the posterior foci may be related to the activation of representations of the inappropriate responses.

  8. Overexpression of an activated rasG gene during growth blocks the initiation of Dictyostelium development.

    PubMed

    Khosla, M; Spiegelman, G B; Weeks, G

    1996-08-01

    Transformants that expressed either the wild-type rasG gene, an activated rasG-G12T gene, or a dominant negative rasG-S17N gene, all under the control of the folate-repressible discoidin (dis1gamma) promoter, were isolated. All three transformants expressed high levels of Ras protein which were reduced by growth in the presence of folate. All three transformants grew slowly, and the reduction in growth rate correlated with the amount of RasG protein produced, suggesting that RasG is important in regulating cell growth. The pVEII-rasG transformant containing the wild-type rasG gene developed normally despite the presence of high levels of RasG throughout development. This result indicates that the down regulation of rasG that normally occurs during aggregation of wild-type strains is not essential for the differentiation process. Dictyostelium transformants expressing the dominant negative rasG-S17N gene also differentiated normally. Dictyostelium transformants that overexpressed the activated rasG-G12T gene did not aggregate. The defect occurred very early in development, since the expression of car1 and pde, genes that are normally induced soon after the initiation of development, was repressed. However, when the transformant cells were pulsed with cyclic AMP, expression of both genes returned to wild-type levels. The transformants exhibited chemotaxis to cyclic AMP, and development was synergized by mixing with wild-type cells. Furthermore, cells that were pulsed with cyclic AMP for 4 h before being induced to differentiate by plating on filters produced small, but otherwise normal, fruiting bodies. These results suggest that the rasG-G12T transformants are defective in cyclic AMP production and that RasG - GTP blocks development by interfering with the initial generation of cyclic AMP pulses. PMID:8754814

  9. A specific adenylyl cyclase inhibitor (DDA) and a cyclic AMP-dependent protein kinase inhibitor (H-89) block the action of equine growth hormone on in vitro maturation of equine oocytes.

    PubMed

    Pereira, Gabriel Ribas; Lorenzo, Pedro Luis; Carneiro, Gustavo Ferrer; Bilodeau-Goeseels, Sylvie; Kastelic, John; Liu, Irwin K M

    2014-09-26

    Summary The objectives of this study were firstly to determine whether the stimulatory function of equine growth hormone (eGH) on equine oocyte maturation in vitro is mediated via cyclic adenosine monophosphate (cAMP); and secondly if the addition of eGH in vitro influences oocyte nuclear maturation and if this effect is removed when GH inhibitors are added to the culture. Cumulus-oocyte complexes (COCs) were recovered from follicles <25 mm in diameter and randomly allocated as follows: (i) control (no additives); and (ii) 400 ng/ml of eGH. A specific inhibitor against cyclic AMP-dependent protein kinase (H-89; 10-9, 10-11 or 10-15 M concentration) and a specific adenylate cyclase inhibitor, 2',3'-dideoxyadenosine (DDA; 10-8, 10-10 or 10-14 M concentration) were used to observe whether they could block the eGH effect. After 30 h of in vitro maturation at 38.5°C with 5% CO2 in air, oocytes were stained with 10 ?g/ml of Hoechst to evaluate nuclear status. More mature oocytes (P < 0.05) were detected when COCs were incubated with eGH (29 of 84; 34.5%) than in the control group (18 of 82; 21.9%). The H-89 inhibitor used at a concentration of 10-9 M (4 of 29; 13.8%) decreased (P < 0.05) the number of oocytes reaching nuclear maturation when compared with eGH (11 of 29; 38%). The DDA inhibitor at a concentration of 10-8 M (2 of 27; 7.4%) also reduced (P < 0.05) the number of oocytes reaching maturity when compared with the eGH group (9 of 30; 30%). Results from the present study show that H-89 and DDA can be used in vitro to block the eGH effect on equine oocyte maturation. PMID:25257826

  10. CYCLIC AMP-DEPENDENT PROTEIN KINASE INDUCTION BY POLYCHLORINATED BIPHENYLS (PCBS) STIMULATES CREB PHOSPHORYLATION VIA A CALCIUM-DEPENDENT, PKC-INDEPENDENT PATHWAY IN CORTICAL NEURONS.

    EPA Science Inventory

    We have previously demonstrated that the PCB mixture, Aroclor 1254 (A1254), increases the phosphorylated form of CREB (pCREB), the cAMP-responsive element binding protein. This transcription factor is important in nervous system development and plasticity. Phosphorylation of C...

  11. Dopamine-induced depolarizing responses associated with negative slope conductance in LB-cluster neurones of Aplysia.

    PubMed Central

    Matsumoto, M; Sasaki, K; Sato, M; Shozushima, M; Takashima, K

    1988-01-01

    1. Current- and voltage-clamp methods were used to evaluate the intracellular and ionic mechanisms involved in dopamine-induced slow depolarizations recorded from neurones of the LB cluster in the abdominal ganglion of Aplysia kurodai. 2. In voltage-clamped cells, dopamine induced a slow inward current that, over the range studied (-40 to -110 mV), decreased in amplitude with hyperpolarization of the cell, but failed to invert when the cell was hyperpolarized beyond the reversal potential for K+,(E)K. 3. Bathing the ganglion in 3-isobutyl-1-methylxanthine (IBMX) caused a significant increase in the dopamine response. 4. Most of the responses to dopamine were markedly augmented in Ca2+-free media, but were depressed in Na+-free media. 5. An intracellular injection of cyclic adenosine 3',5'-monophosphate (cyclic AMP) into the same cell type produced an inward current which, like the response to dopamine, diminished in amplitude with hyperpolarization of the cell. 6. Like the dopamine response, the cyclic AMP response increased in the presence of IBMX, was enhanced in Ca2+-free media, was depressed in Na+-free media, and was unaffected by changes in external potassium. 7. In a few cells, although the cyclic AMP-induced responses disappeared in Na+-free media, the dopamine-induced slow inward current responses did not. However, these Na+-free resistant responses disappeared completely in Na+- and Ca2+-free media. 8. It was concluded that most of the dopamine-induced inward current responses were produced by an increase in permeability, mainly to Na+, triggered by a receptor-controlled increase in intracellular cyclic AMP. PMID:2476551

  12. Insulin and isoproterenol induce phosphorylation of the particulate cyclic GMP-inhibited, low Km cyclic AMP phosphodiesterase (cGI PDE) in 3T3-L1 adipocytes.

    PubMed

    Vasta, V; Smith, C J; Calvo, J; Belfrage, P; Manganiello, V C

    1992-03-31

    The cGI PDE in particulate fractions of differentiated adipocytes (but not control 3T3-L1 fibroblasts) was cross-reactive with a polyclonal antibody raised against the bovine adipose cGI PDE. The 3T3-L1 adipocyte cGI PDE is a 135 kDa protein which is phosphorylated in 32P-labeled cells in response to beta-agonist or insulin. These results indicate that the 3T3-L1 cGI PDE is similar in structure and hormonal regulation to the analogous enzyme in the rat adipocyte. PMID:1314573

  13. Evidence for a role for cyclic AMP in modulating the action of 5HT and an excitatory neuropeptide, FLP17A, in the pharyngeal muscle of Caenorhabditis elegans

    Microsoft Academic Search

    Sylvana Papaioannou; Lindy Holden-Dye; Robert J. Walker

    2008-01-01

    The feeding activity of the nematode Caenorhabditis elegans is regulated by an anatomically well-defined network of 20 enteric neurones that employs small molecule and neuropeptidergic\\u000a signalling. Two of the most potent excitatory agents are 5-HT and the neuropeptide FLP17A. Here we have examined the role\\u000a of cAMP in modulating their excitatory actions by pharmacological manipulation of the level of cAMP.

  14. IP receptor-dependent activation of PPAR? by stable prostacyclin analogues

    PubMed Central

    Falcetti, Emilia; Flavell, David M.; Staels, Bart; Tinker, Andrew; Haworth, Sheila. G.; Clapp, Lucie H.

    2007-01-01

    Stable prostacyclin analogues can signal through cell surface IP receptors or by ligand binding to nuclear peroxisome proliferator-activated receptors (PPARs). So far these agents have been reported to activate PPAR? and PPAR? but not PPAR?. Given PPAR? agonists and prostacyclin analogues both inhibit cell proliferation, we postulated that the IP receptor might elicit PPAR? activation. Using a dual luciferase reporter gene assay in HEK-293 cells stably expressing the IP receptor or empty vector, we found that prostacyclin analogues only activated PPAR? in the presence of the IP receptor. Moreover, the novel IP receptor antagonist, RO1138452, but not inhibitors of the cyclic AMP pathway, prevented activation. Likewise, the anti-proliferative effects of treprostinil observed in IP receptor expressing cells, were partially inhibited by the PPAR? antagonist, GW9662. We conclude that PPAR? is activated through the IP receptor via a cyclic AMP-independent mechanism and contributes to the anti-growth effects of prostacyclin analogues. PMID:17624303

  15. Characterization of phosphodiesterase 4 in guinea-pig macrophages: multiple activities, association states and sensitivity to selective inhibitors

    PubMed Central

    Kelly, John J; Barnes, Peter J; Giembycz, Mark A

    1998-01-01

    The cyclic AMP phosphodiesterases (PDE) in guinea-pig peritoneal macrophages were isolated, partially characterized and their role in regulating the cyclic AMP content in intact cells evaluated.Differential centrifugation of macrophage lysates revealed that ?90% of the PDE activity was membrane-bound and exclusively hydrolyzed cyclic AMP. This activity was not removed by KCl (200?mM) but was readily solubilized by the non-ionic detergent, Triton X-100 (1% v/v). Greater than 80% of the hydrolytic activity was suppressed by the PDE4 inhibitors, R-rolipram and nitraquazone with IC50s of 240 and 540?nM, respectively.Anion-exchange chromatography of the total protein extracted from macrophages resolved two major peaks of cyclic AMP PDE activity that were insensitive to cyclic GMP (10??M), calmodulin (50 units plus 2?mM CaCl2) and a PDE3 inhibitor, SK&F 95654 (10??M), but were markedly suppressed by RS-rolipram (10??M). The two peaks of PDE activity were arbitrarily designated CPPDE4? and CPPDE4? with respect to the order from which they were eluted from the column where the prefix, CP, refers to the species, Cavia porcellus.The hydrolysis of cyclic AMP catalyzed by CPPDE4? and CPPDE4? conformed to Michaelis-Menten kinetic behaviour with similar Kms (13.4 and 6.4??M, respectively).Thermal denaturation of membrane-bound PDE4 at 50°C followed bi-exponential kinetics with t1/2 values of 1.5 and 54.7?min for the first and second components, respectively. In contrast, CPPDE4? and CPPDE4? each decayed mono-exponentially with significantly different thermostabilities (t1/2=2.77 and 1.15?min, respectively).Gel filtration of CPPDE4? separated two peaks of rolipram-sensitive PDE activity. The main peak eluted at a volume indicative of a ?180?kDa protein but was preceded by a much larger form of the enzyme that had an estimated weight of 750?kDa. Size exclusion chromatography of CPPDE4? resolved a broad peak of activity with molecular weights spanning 50 to 200?kDa.Of ten PDE inhibitors examined, none distinguished CPPDE4? from CPPDE4? with respect to their IC50 values or their rank order of potency. RS-rolipram acted as a purely competitive inhibitor of cyclic AMP hydrolysis with Kis of 2??M and 1.5??M for CPPDE4? and CPPDE4?, respectively. In contrast to the membrane-associated enzyme(s), R-rolipram and nitraquazone were 4 to 19 fold less potent as inhibitors of CPPDE4? and CPPDE4?.In intact macrophages, Ro 20-1724 and RS-rolipram potentiated isoprenaline-induced cyclic AMP accumulation under conditions where a PDE3 inhibitor, SK&F 94120, was essentially inactive.These data demonstrate that the predominant cyclic AMP hydrolyzing activity in guinea-pig macrophages is a PDE4. Moreover, thermostability studies and size exclusion chromatography indicates the possible expression of two intrinsic, membrane-associated isoenzymes which can regulate the cyclic AMP content in intact cells. The finding that soluble and particulate forms of the same enzyme exhibit different sensitivities to rolipram and nitraquazone implies that PDE4 can change conformation. Finally, the identification of multiple molecular weight species of CPPDE4 suggests that this enzyme(s) might form multimeric complexes of variable association states. PMID:9630352

  16. In the thyroid cells proliferation, differentiated and metabolic functions are under the control of different steps of the cyclic AMP cascade.

    PubMed

    Villone, G; Veneziani, B M; Picone, R; De Amicis, F; Perrotti, N; Tramontano, D

    1993-09-01

    In the course of studies to elucidate the complex network of interactions controlling FRTL5 cell proliferation, thyroid stimulating hormone (TSH)-independent mutants (M cells), have been obtained from FRTL5 cells by chemical mutagenesis. In the present studies, the role of TSH on the proliferation and on differentiated and metabolic functions in these mutant cells have been investigated and compared to their response to insulin-like growth factor I (IGF-I). The addition of IGF-I to M cells leads to normal stimulation of DNA synthesis. However, inspite of the fact that mutant cells display normal TSH receptors, TSH is unable to stimulate the proliferation of the M cells. Nevertheless, TSH is able to increase intracellular levels of cAMP leading to regulation of TSH function in the M cells. On the other hand, TSH does not influence iodide transport and actin filaments depolimerization in these cells. However, aminoacid transport, stimulated in wild-type FRTL5 cells by both TSH and IGFs, is under the control of IGFs but not of TSH in the mutant cells. Neither TSH or IGF-I modified the expression of c-fos proto-oncogene in the M cells, probably because of high constitutive expression. These data suggest that a crucial signalling step(s) required for TSH induced mitogenesis is impaired in the M cells, and that this signalling step is not required for IGF-I induced mitogenesis. PMID:8243811

  17. Active Response Gravity Offload System

    NASA Technical Reports Server (NTRS)

    Valle, Paul; Dungan, Larry; Cunningham, Thomas; Lieberman, Asher; Poncia, Dina

    2011-01-01

    The Active Response Gravity Offload System (ARGOS) provides the ability to simulate with one system the gravity effect of planets, moons, comets, asteroids, and microgravity, where the gravity is less than Earth fs gravity. The system works by providing a constant force offload through an overhead hoist system and horizontal motion through a rail and trolley system. The facility covers a 20 by 40-ft (approximately equals 6.1 by 12.2m) horizontal area with 15 ft (approximately equals4.6 m) of lifting vertical range.

  18. Perilipin 5 regulates islet lipid metabolism and insulin secretion in a cyclic AMP dependent manner: Implication of its role in the postprandial insulin secretion.

    PubMed

    Trevino, Michelle B; Machida, Yui; Hallinger, Daniel R; Garcia, Eden; Christensen, Aaron; Dutta, Sucharita; Peake, David A; Ikeda, Yasuhiro; Imai, Yumi

    2014-11-12

    Elevation of circulating fatty acids (FA) during fasting supports postprandial (PP) insulin secretion that is critical for glucose homeostasis and impaired in diabetes. We tested our hypothesis that lipid droplet (LD) protein perilipin 5 (PLIN5) in beta cells aids PP insulin secretion by regulating intracellular lipid metabolism. We demonstrated that PLIN5 serves as a LD protein in human islets. In vivo, Plin5 and triglycerides were increased by fasting in mouse islets. MIN6 expressing PLIN5 (Ad-PLIN5) and those expressing perilipin 2 (PLIN2) (Ad-PLIN2) had higher [(3)H]FA incorporation into triglycerides than Ad-GFP control, which support their roles as LD proteins. However, AD-PLIN5 cells had higher lipolysis than Ad-PLIN2 cells, which increased further by 8-Br-cAMP, indicating that PLIN5 facilitates FA mobilization upon cAMP stimulation as seen postprandially. Ad-PLIN5 in islets enhanced the augmentation of glucose stimulated insulin secretion by FA and 8-Br-cAMP in G-protein-coupled receptor 40 (GPR40) and cAMP activated protein kinase dependent manners respectively. When PLIN5 was increased in mouse beta cells in vivo, glucose tolerance following acute exenatide challenge was improved. Therefore, the elevation of islet PLIN5 during fasting allows partitioning of FA into LD that is released upon re-feeding to support PP insulin secretion in cAMP and GPR40 dependent manners. PMID:25392244

  19. Mechanism of NaCl secretion in rectal gland tubules of spiny dogfish (Squalus acanthias). III. Effects of stimulation of secretion by cyclic AMP.

    PubMed

    Greger, R; Schlatter, E; Wang, F; Forrest, J N

    1984-12-01

    Segments of rectal gland tubules (RGT) the spiny dogfish (Squalus acanthias) were perfused in vitro to study the cellular mechanism by which NaCl secretion is stimulated. Transepithelial PD (PDte), transepithelial resistance (Rte), the PD across the basolateral membrane (PDbl), the fractional resistance of the lumen membrane (FR1), and the cellular activities for Cl-, Na+, and K+ (alpha cell x) were measured. In series 1 the effects of stimulation (S) (dbcAMP 10(-4, adenosine 10(-4), and forskolin 10(-6) mol x 1(-1) on these parameters were recorded and compared to nonstimulated state (NS). PDte increased from -1.9 +/- 0.2 mV to -11.0 +/- 0.9 mV (n = 51). PDbl depolarized from -86 +/- 1 to -74 +/- 1.4 mV (n =52), Rte fell from 29 +/- 2.8 to 21 +/- 2 omega cm2 (n = 23), and FR1 fell from 0.96 +/- 0.005 to 0.79 +/- 0.04 (n = 9). alpha cell K+ was constant (123 +/- 13 versus 128 +/- 17 mmol x 1(-1) (n = 6), but alpha cell cl- fell significantly from 48 +/- 4 to 41 +/- 3 mmol x 1(-1) (n = 7). alpha cell Na+ increased from 11 +/- 2.1 to 29.5 +/- 6.6 mmol x 1(-1) (n = 4). In series 2 the conductivity properties were examined by rapid K+, and Cl- concentration steps on the basolateral and luminal cell side respectively in NS and S states. In NS-segments reduction of bath K+ led to a hyperpolarization of PDbl with a mean slope of 28 +/- 1.3 mV/decade (n = 9) (as compared to 19 mV/decade for S-state).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6097873

  20. Resveratrol Inhibits LPS-Induced MAPKs Activation via Activation of the Phosphatidylinositol 3-Kinase Pathway in Murine RAW 264.7 Macrophage Cells

    PubMed Central

    Liu, Bin; Deng, Yi-Shu; Zhan, Dong; Chen, Yuan-Li; He, Ying; Liu, Jing; Zhang, Zong-Ji; Sun, Jun; Lu, Di

    2012-01-01

    Background Resveratrol is a natural polyphenolic compound that has cardioprotective, anticancer and anti-inflammatory properties. We investigated the capacity of resveratrol to protect RAW 264.7 cells from inflammatory insults and explored mechanisms underlying inhibitory effects of resveratrol on RAW 264.7 cells. Methodology/Principal Findings Murine RAW 264.7 cells were treated with resveratrol (1, 5, and 10 µM) and/or LPS (5 µg/ml). Nitric oxide (NO) and prostaglandin E2 (PGE2) were measured by Griess reagent and ELISA. The mRNA and protein levels of proinflammatory proteins and cytokines were analysed by ELISA, RT-PCR and double immunofluorescence labeling, respectively. Phosphorylation levels of Akt, cyclic AMP-responsive element-binding protein (CREB), mitogen-activated protein kinases (MAPKs) cascades, AMP-activated protein kinase (AMPK) and expression of SIRT1(Silent information regulator T1) were measured by western blot. Wortmannin (1 µM), a specific phosphatidylinositol 3-kinase (PI3-K) inhibitor, was used to determine if PI3-K/Akt signaling pathway might be involved in resveratrol’s action on RAW 264.7 cells. Resveratrol significantly attenuated the LPS-induced expression of nitric oxide (NO), prostaglandin E2 (PGE2), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor-? (TNF-?) and interleukin-1? (IL-1?) in RAW 264.7 cells. Resveratrol increased Akt phosphorylation in a time-dependent manner. Wortmannin, a specific phosphatidylinositol 3-kinase (PI3-K) inhibitor, blocked the effects of resveratrol on LPS-induced RAW 264.7 cells activation. In addition, PI3-K inhibition partially abolished the inhibitory effect of resveratrol on the phosphorylation of cyclic AMP-responsive element-binding protein (CREB) and mitogen-activated protein kinases (MAPKs) cascades. Meanwhile, PI3-K is essential for resveratrol-mediated phosphorylation of AMPK and expression of SIRT1. Conclusion and Implications This investigation demonstrates that PI3-K/Akt activation is an important signaling in resveratrol-mediated activation of AMPK phosphorylation and SIRT1 expression, and inhibition of phosphorylation of CREB and MAPKs activation, proinflammatory mediators and cytokines production in response to LPS in RAW 264.7 cells. PMID:22952890

  1. Chloride conductance activated by external agonists and internal messengers in rat peritoneal mast cells.

    PubMed Central

    Matthews, G; Neher, E; Penner, R

    1989-01-01

    1. Stimulation of mast cells by externally applied secretagogues activated a slowly developing membrane current. With high external and low internal chloride (Cl-) concentrations, the current reversed at about -40 mV, but when external Cl- was made equal to internal Cl-, the reversal potential shifted to about 0 mV, demonstrating that the current carrier was Cl-. 2. In addition to external agonists, internally applied cyclic AMP and high concentrations of intracellular calcium [Ca2+]i could also activate the Cl- current. However, elevated [Ca2+]i produced only slow and incomplete activation. This suggests that the Cl- current is not directly Ca2+ activated. Also, activation of Cl- current by external agonists and by cyclic AMP was unimpaired when [Ca2+]i was clamped to low levels with internal ethylene glycol bis-N,N,N',N'-tetraacetic acid (EGTA), indicating that elevated [Ca2+]i is not necessary for activation of the Cl- current. Although activation by cyclic AMP was faster than that produced by elevated [Ca2+]i, it still required tens of seconds; thus the effect of cyclic AMP was also likely to be indirect. 3. Internal guanosine 5'-O-(3-thiotriphosphate) (GTP-gamma-S) could also activate the Cl- current, suggesting the involvement of a G protein in the control of the current. 4. The variance associated with the Cl- current was small, and noise analysis gave a lower limit of about 1-2 pS for the single-channel conductance. The Cl- current was reduced by 4,4'-diisothiocyano-2,2'-stilbenedisulphonate (DIDS), and during DIDS blockade, the variance of the current increased. This suggests that DIDS enters and blocks the open channel. 5. Activation of the Cl- current would make the membrane potential negative following stimulation of a mast cell, thus providing a driving force for entry of external calcium via the stimulation-induced influx pathways described in the preceding paper (Matthews, Neher & Penner, 1989). PMID:2559969

  2. Dopamine stimulated L-fucose incorporation into brain proteins is related to an increase in fucokinase activity.

    PubMed

    Jork, R; Schmitt, M; Lössner, B; Matthies, H

    1984-01-01

    Fucokinase (E.C. 2.7.1.52) activity was estimated in supernatant of homogenate from hippocampal slices. After an incubation of the slices in the presence of 0.5 mM dopamine a significant increase in the enzyme activity was observed. Under these conditions also an increase in the incorporation of [3H]fucose into hippocampal glycoproteins was observed. Thereby, the dopamine elicited changes in both fucokinase activity and fucose incorporation are similar in their time dependence. Moreover, dibutyryl-cyclic AMP led also to an increase in both fucokinase activity and sugar incorporation in hippocampal slices whereas cyclic AMP was without effect when added to the incubation mixture of the enzyme. The observed changes in fucokinase activity and its regulation by Ca2+ are discussed in terms of possible mechanisms realizing the dopamine stimulated fucosylation of rat hippocampal glycoproteins. PMID:6331424

  3. Characterization of the muscarinic receptor subtype that mediates the contractile response of acetylcholine in the swine myometrium

    Microsoft Academic Search

    Takio Kitazawa; Fumikazu Uchiyama; Kayo Hirose; Tetsuro Taneike

    1999-01-01

    The aim of the present study was to characterize the subtype of muscarinic receptor that mediates acetylcholine-induced contractions in the nonpregnant proestrus swine myometrium by means of mechanical, radioligand ([3H]quinuclidinyl benzilate) binding and biochemical (measurement of cyclic AMP) approaches. Acetylcholine (?logEC50, 6.12), oxotremorine-methiodide (6.47), methacholine (6.35), carbachol (6.18) and muscarine (6.33) caused contractile responses of the uterine circular muscle, with

  4. Activation by cyclic 3':5'-adenosine monophosphate of tyrosine hydroxylase in the rat brain.

    PubMed Central

    Harris, J E; Baldessarini, R J; Morgenroth, V H; Roth, R H

    1975-01-01

    Membrane-permeable derivatives of cyclic AMP (cAMP) produced concentration-dependent increases in activity of tyrosine hydroxylase (L-tyrosine, tetrahydropteridine:oxygen oxidoreductase (3-hydroxylating), EC 1.14.16.2) in membrane-limited nerve endings (synaptosomes) prepared from three regions of rat brain. Increased hydroxylation occurred even after preincubation and removal of dibutyryl cyclic AMP. In all brain regions, the hydroxylation of phenylalanine and tyrosine was increased, but dibutyryl cAMP had little effect on activity of tryptophan hydroxylase, no effect on aromatic amino-acid decarboxylase, on uptake of tyrosine or phenylalanine, uptake or efflux of dopamine, or distribution of hydroxylase between cytoplasmic and particulate components of the synaptosomes. Dibutyryl cAMP decreased inhibition of catecholamine synthesis in synaptosomes by dopamine and apomorphine. In a soluble preparation of striatal tyrosine hydroxylase, activity was increased by addition of lower concentrations of cAMP or dibutyryl cAMP than with unbroken nerve endings, when subsaturating concentrations of tyrosine and cofactor were employed, while butyrate, chloride, 5'-AMP, ADP, ATP, and cyclic GMP had no activating effect. Increased activity of soluble tyrosine hydroxylase was reflected in increased affinity (Km) for substrate and cofactor and decreased affinity (Ki) for inhibitory end-product (dopamine), suggesting a change in the physical-chemical state of the enzyme or an activator molecule. Cyclic AMP may activate tyrosine hydroxylase during periods of increased neuronal activity. PMID:236558

  5. Activating transcription factor 2 controls Bcl-2 promoter activity in growth plate chondrocytes.

    PubMed

    Ma, Qin; Li, Xinying; Vale-Cruz, Dustin; Brown, Mark L; Beier, Frank; LuValle, Phyllis

    2007-05-15

    Activating transcription factor 2 (ATF-2) is expressed ubiquitously in mammals. Mice deficient in ATF-2 (ATF-2 m/m) are slightly smaller than their normal littermates at birth. Approximately 50% of mice born mutant in both alleles die within the first month. Those that survive develop a hypochondroplasia-like dwarfism, characterized by shortened growth plates and kyphosis. Expression of ATF-2 within the growth plate is limited to the resting and proliferating zones. We have previously shown that ATF-2 targets the cyclic AMP response element (CRE) in the promoters of cyclin A and cyclin D1 in growth plate chondrocytes to activate their expression. Here, we demonstrate that Bcl-2, a cell death inhibitor that regulates apoptosis, is expressed within the growth plate in proliferative and prehypertrophic chondrocytes. However, Bcl-2 expression declines in hypertrophic chondrocytes. The Bcl-2 promoter contains a CRE at -1,552 bp upstream of the translation start. Mutations within this CRE cause reduced Bcl-2 promoter activity. We show here that the absence of ATF-2 in growth plate chondrocytes corresponds to a decline in Bcl-2 promoter activity, as well as a reduction in Bcl-2 protein levels. In addition, we show that ATF-2 as well as CREB, a transcription factor that can heterodimerize with ATF-2, bind to the CRE within the Bcl-2 promoter. These data identify the Bcl-2 gene as a novel target of ATF-2 and CREB in growth plate chondrocytes. PMID:17219413

  6. Structure-activity relationships of the hypertrehalosemic hormone from the cockroach Blaberus discoidalis Serville

    E-print Network

    Ford, Mary Stahlschmidt

    1988-01-01

    AMP in the fat body and activated the enzyme glycogen phosphorylase resulting in a breakdown of glycogen in the fat body and elevation of trehalose in the haemolymph (13). These results indicate that these factors act through the classical cyclic AMP... 50 GPAH glycogen phosphorylase activating hormone H-AKH Heliothis adipokinetic hormone HF hydrogen fluoride HGH1 hyperglycemic hormone I HGH2 hyperglycemic hormone 2 HOBT hydroxybenzotriazole HPLC high performance liquid chromatography HTH...

  7. Sex differences in feeding behavior in rats: the relationship with neuronal activation in the hypothalamus

    PubMed Central

    Fukushima, Atsushi; Hagiwara, Hiroko; Fujioka, Hitomi; Kimura, Fukuko; Akema, Tatsuo; Funabashi, Toshiya

    2015-01-01

    There is general agreement that the central nervous system in rodents differs between sexes due to the presence of gonadal steroid hormone during differentiation. Sex differences in feeding seem to occur among species, and responses to fasting (i.e., starvation), gonadal steroids (i.e., testosterone and estradiol), and diet (i.e., western-style diet) vary significantly between sexes. The hypothalamus is the center for controlling feeding behavior. We examined the activation of feeding-related peptides in neurons in the hypothalamus. Phosphorylation of cyclic AMP response element-binding protein (CREB) is a good marker for neural activation, as is the Fos antigen. Therefore, we predicted that sex differences in the activity of melanin-concentrating hormone (MCH) neurons would be associated with feeding behavior. We determined the response of MCH neurons to glucose in the lateral hypothalamic area (LHA) and our results suggested MCH neurons play an important role in sex differences in feeding behavior. In addition, fasting increased the number of orexin neurons harboring phosphorylated CREB in female rats (regardless of the estrous day), but not male rats. Glucose injection decreased the number of these neurons with phosphorylated CREB in fasted female rats. Finally, under normal spontaneous food intake, MCH neurons, but not orexin neurons, expressed phosphorylated CREB. These sex differences in response to fasting and glucose, as well as under normal conditions, suggest a vulnerability to metabolic challenges in females. PMID:25870535

  8. Response of fibrinolytic activity to venous occlusion.

    PubMed Central

    Shaper, A G; Marsh, N A; Patel, I; Kater, F

    1975-01-01

    Resting fibrinolytic activity and the response of the fibrinolytic system to venous occlusion were studied in a group of healthy middle-aged men. All subjects showed increased fibrinolytic activity but of varying degrees. There was a linear relationship between resting and occluded levels of fibrinolytic activity but many subjects with lower levels of fibrinolytic activity showed an anomalous response. Responses over the expected level were more common than unexpectedly low levels of response. Fibrinogen and plasminogen concentrations were inversely correlated with fibrinolytic activity. PMID:1174826

  9. Properties of fish liver acetyl coenzyme A carboxylase and fatty acid synthetase: Lack of response to dietary changes.

    E-print Network

    Warman, Arthur William

    1975-01-01

    ) that this is caused by a reduction in the amount of enzyme synthesized. Injection of insulin to diabetic animals increases the enzyme activities by restoring enzyme synthesis (58) to their normal levels. Glucagon and cyclic AMP have the reverse effect (59), because..., etc. ) or hormonal levels (i. e. , injection of insulin, glucagon, etc. ) are manipulated. These changes are brought about mostly by changes in enzyme synthesis and not by enzyme degradation. Experimentation on fish lipogenesis in the past has been...

  10. Comparison of cellular responses induced by low level light in different cell types

    NASA Astrophysics Data System (ADS)

    Huang, Ying-Ying; Chen, Aaron C.-H.; Sharma, Sulbha K.; Wu, Qiuhe; Hamblin, Michael R.

    2010-02-01

    Discoveries are rapidly being made in multiple laboratories that shed "light" on the fundamental molecular and cellular mechanisms underlying the use of low level light therapy (LLLT) in vitro, in animal models and in clinical practice. Increases in cellular levels of respiration, in cytochrome c oxidase activity, in ATP levels and in cyclic AMP have been found. Increased expression of reactive oxygen species and release of nitric oxide have also been shown. In order for these molecular changes to have a major effect on cell behavior, it is likely that various transcription factors will be activated, possibly via different signal transduction pathways. In this report we compare and contrast the effects of LLLT in vitro on murine embryonic fibroblasts, primary cortical neurons, cardiomyocytes and bone-marrow derived dendritic cells. We also examined two human cell lines, HeLa cancer cells and HaCaT keratinocytes. The effects of 810-nm near-infra-red light delivered at low and high fluences were addressed. Reactive oxygen species generation, transcription factor activation and ATP increases are reported. The data has led to the hypothesis that cells with a high level of mitochondrial activity (mitochondrial membrane potential) have a higher response to light than cells with low mitochondrial activity.

  11. Combined effects of adrenaline and insulin on active electrogenic Na+-K+ transport in rat soleus muscle

    Microsoft Academic Search

    J. A. Flatman; T. Clausen

    1979-01-01

    Both beta2-adrenoreceptor stimulants (such as adrenaline and salbutamol) and insulin can increase active Na+-K+ transport1-6 and hyperpolarise skeletal muscle cells1,2,7-9. Thus, adrenaline and insulin, which are otherwise antagonistic regulators of several metabolic processes, have one action in common, namely, stimulation of active ion translocation. This is especially interesting as cyclic AMP stimulates Na+-K+ transport2, whereas a lowering of the cytoplasmic

  12. Muscarinic control of the hyperpolarization-activated current (if) in rabbit sino-atrial node myocytes.

    PubMed Central

    DiFrancesco, D; Tromba, C

    1988-01-01

    1. The mechanism by which acetylcholine (ACh), by stimulation of muscarinic receptors, acts to inhibit activation of the hyperpolarization-activated 'pacemaker' current, if was investigated in isolated rabbit sino-atrial (SA) node myocytes. 2. Intracellular loading with GTP gamma S, a non-hydrolysable analogue of GTP, did not impair the ACh action on if, but made it irreversible. On the other hand, the ACh action on if disappeared after a few minutes of cell loading with GDP beta S, a GDP analogue known to bind to G-proteins and prevent their receptor-stimulated action. Furthermore, incubation of cells in a solution containing pertussis toxin (PTX) led to abolition of the if response to ACh. These results indicate that the inhibitory effect of ACh on if is mediated by G-proteins activated by muscarinic receptors. 3. Intracellular loading with phosphodiesterase (PDE) increased the rate of if current run-down, but did not abolish the inhibitory action of ACh on if. 4. Extracellular perfusion with isobutylmethylxanthine (IBMX), a PDE inhibitor, increased if activation by shifting the current activation range to more positive voltages, as inferred by a three-pulse protocol analysis; in the presence of IBMX, the inhibition of if by ACh was not abolished. 5. The ACh-induced if depression persisted also in cells loaded with cyclic GMP. In these cells, as in those loaded with PDE, the if run-down was fast. 6. Oxotremorine, a muscarinic agonist coupled to adenylate cyclase but not to phosphoinositide turnover in cardiac cells, simulated ACh in its inhibitory action on if. The above results rule against the ACh action being mediated by PDE or by phosphoinositide turnover. 7. To investigate the possible involvement of cyclic AMP as a second messenger in the ACh action on if, we loaded cells with cyclic AMP and IBMX; under these conditions the action of ACh disappeared within a few minutes of whole-cell recording. 8. In cells where the slow inward Ca2+ current (isi) was measured together with if, ACh was seen to depress both currents. 9. In cells superfused with forskolin, the if amplitude on stepping to the half-activation voltage range was enhanced as a consequence of a depolarizing shift of the activation curve; ACh was not effective on if following stimulation by forskolin, but strongly depressed in the same cell the if current stimulated to a similar degree by isoprenaline.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:2475609

  13. The Epithelial Sodium Channel (ENaC) Establishes a Trafficking Vesicle Pool Responsible for Its Regulation

    PubMed Central

    Edinger, Robert S.; Bertrand, Carol A.; Rondandino, Christine; Apodaca, Gerard A.; Johnson, John P.; Butterworth, Michael B.

    2012-01-01

    The epithelial sodium channel (ENaC) is the rate-limiting step for sodium reabsorption across tight epithelia. Cyclic-AMP (cAMP) stimulation promotes ENaC trafficking to the apical surface to increase channel number and transcellular Na+ transport. Removal of corticosteroid supplementation in a cultured cortical collecting duct cell line reduced ENaC expression. Concurrently, the number of vesicles trafficked in response to cAMP stimulation, as measured by a change in membrane capacitance, also decreased. Stimulation with aldosterone restored both the basal and cAMP-stimulated ENaC activity and increased the number of exocytosed vesicles. Knocking down ENaC directly decreased both the cAMP-stimulated short-circuit current and capacitance response in the presence of aldosterone. However, constitutive apical recycling of the Immunoglobulin A receptor was unaffected by alterations in ENaC expression or trafficking. Fischer Rat Thyroid cells, transfected with ?,?,?-mENaC had a significantly greater membrane capacitance response to cAMP stimulation compared to non-ENaC controls. Finally, immunofluorescent labeling and quantitation revealed a smaller number of vesicles in cells where ENaC expression was reduced. These findings indicate that ENaC is not a passive passenger in regulated epithelial vesicle trafficking, but plays a role in establishing and maintaining the pool of vesicles that respond to cAMP stimulation. PMID:23029554

  14. M(r) 6,400 aurin tricarboxylic acid directly activates platelets.

    PubMed

    Guo, Z; Weinstein, M J; Phillips, M D; Kroll, M H

    1993-07-01

    ATA is a novel anticoagulant polymeric anionic aromatic compound that inhibits von Willebrand factor binding to platelet glycoprotein Ib and thereby prevents ristocetin- and shear stress-induced platelet aggregation. To investigate its mechanism of action, ATA fractions of homogeneous M(r) have been prepared by size exclusion chromatography. ATA fractions of M(r) > or = 2,500 are most effective at inhibiting vWF-mediated platelet aggregation, and ATA of M(r) = 2,500 also inhibits thrombin-induced platelet activation. Paradoxical results were observed in studies of ATA with M(r) = 6,400. This fraction of ATA stimulates aggregation of washed platelets or platelet-rich-plasma. The dose/response of aggregation shows a bell-shaped curve with maximal aggregation at approximately 2 micrograms/ml. Platelet aggregation is associated with phosphoinositide turnover and protein kinase C- and calcium-dependent protein phosphorylation. Platelet signalling responses to ATA are inhibited by platelet pretreatment with PGI2 or dibutyryl-cyclic AMP, but are unaffected by inhibiting platelet cyclooxygenase with aspirin. These results suggest that M(r) 6,400 ATA directly activates platelet phospholipase C to initiate platelet aggregation. This effect, unique to M(r) 6,400 ATA, could potentially mitigate ATA's beneficial anti-thrombotic effect on vWF-mediated platelet responses, and should be considered when analyzing results of experiments that utilize unfractionated ATA. PMID:8367837

  15. Glutamate Induces Phosphorylation of Elk1 and CREB, Along with c-fos Activation, via an Extracellular Signal-Regulated Kinase-Dependent Pathway in Brain Slices

    Microsoft Academic Search

    PETER VANHOUTTE; JEAN-VIANNEY BARNIER; BERNARD GUIBERT; CHRISTIANE PAGES; MARIE-JO BESSON; ROBERT A. HIPSKIND; JOCELYNE CABOCHE

    of the ERK and JNK\\/SAPK MAPK cascades. This corresponds kinetically to a significant increase in Ser383- phosphorylated Elk-1 and the appearance of c-fos mRNA. Glutamate also causes increased levels of Ser133- phosphorylated cyclic AMP-responsive element-binding protein (CREB) but only transiently relative to Elk-1 and c-fos. ERK and Elk-1 phosphorylation are blocked by the MAPK kinase inhibitor PD98059, indicating the primary

  16. Human T-Cell Leukemia Virus Type 1 Tax Requires Direct Access to DNA for Recruitment of CREB Binding Protein to the Viral Promoter

    Microsoft Academic Search

    BRIAN A. LENZMEIER; HOLLI A. GIEBLER; JENNIFER K. NYBORG

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in

  17. 14 -3-3 Inhibits the Dictyostelium Myosin II Heavy Chain-specific Protein Kinase C Activity by a Direct Interaction: Identification of the 14 -3-3 Binding Domain

    Microsoft Academic Search

    Meirav Matto-Yelin; Alastair Aitken; Shoshana Ravid

    Myosin II heavy chain (MHC) specific protein kinase C (MHC-PKC), isolated from Dictyostelium discoideum, regulates myosin II assembly and localization in response to the chemoattractant cyclic AMP. Immunoprecipitation of MHC-PKC revealed that it resides as a complex with several proteins. We show herein that one of these proteins is a homologue of the 14 -3-3 protein (Dd14 -3-3). This protein

  18. Ibudilast, a pharmacologic phosphodiesterase inhibitor, prevents human immunodeficiency virus-1 Tat-mediated activation of microglial cells.

    PubMed

    Kiebala, Michelle; Maggirwar, Sanjay B

    2011-01-01

    Human Immunodeficiency Virus-1 (HIV-1)-associated neurocognitive disorders (HAND) occur, in part, due to the inflammatory response to viral proteins, such as the HIV-1 transactivator of transcription (Tat), in the central nervous system (CNS). Given the need for novel adjunctive therapies for HAND, we hypothesized that ibudilast would inhibit Tat-induced excess production of pro-inflammatory cytokines, such as tumor necrosis factor-alpha (TNF?) in microglial cells. Ibudilast is a non-selective cyclic AMP phosphodiesterase inhibitor that has recently shown promise as a treatment for neuropathic pain via its ability to attenuate glial cell activation. Accordingly, here we demonstrate that pre-treatment of both human and mouse microglial cells with increasing doses of ibudilast inhibited Tat-induced synthesis of TNF? by microglial cells in a manner dependent on serine/threonine protein phosphatase activity. Ibudilast had no effect on Tat-induced p38 MAP kinase activation, and blockade of adenosine A(2A) receptor activation did not reverse ibudilast's inhibition of Tat-induced TNF? production. Interestingly, ibudilast reduced Tat-mediated transcription of TNF?, via modulation of nuclear factor-kappa B (NF-?B) signaling, as shown by transcriptional activity of NF-?B and analysis of inhibitor of kappa B alpha (I?B?) stability. Together, our findings shed light on the mechanism of ibudilast's inhibition of Tat-induced TNF? production in microglial cells and may implicate ibudilast as a potential novel adjunctive therapy for the management of HAND. PMID:21494611

  19. Physiological Response to Physical Activity in Children.

    ERIC Educational Resources Information Center

    Gilliam, Thomas B.

    This is a report on research in the field of physical responses of children to strenuous activity. The paper is divided into three subtopics: (1) peak performance measure in children; (2) training effects on children; and (3) importance of physical activity for children. Measurements used are oxygen consumption, ventilation, heart rate, cardiac…

  20. Hypoxia-activated metabolic pathway stimulates phosphorylation of p300 and CBP in oxygen-sensitive cells

    PubMed Central

    Zakrzewska, Adriana; Schnell, Phillip O.; Striet, Justin B.; Hui, Anna; Robbins, Jennifer R.; Petrovic, Milan; Conforti, Laura; Gozal, David; Wathelet, Marc G.; Czyzyk-Krzeska, Maria F.

    2006-01-01

    Transcription co-activators and histone acetyltransferases, p300 and cyclic AMP responsive element-binding protein-binding protein (CBP), participate in hypoxic activation of hypoxia-inducible genes. Here, we show that exposure of PC12 and cells to 1–10% oxygen results in hyperphosphorylation of p300/CBP. This response is fast, long lasting and specific for hypoxia, but not for hypoxia-mimicking agents such as desferioxamine or Co2+ ions. It is also cell-type specific and occurs in pheochromocytoma PC12 cells and the carotid body of rats but not in hepatoblastoma cells. The p300 hyperphosphorylation specifically depends on the release of intracellular calcium from inositol 1,4,5-triphosphate (IP3)-sensitive stores. However, it is not inhibited by pharmacological inhibitors of any of the kinases traditionally known to be directly or indirectly calcium regulated. On the other hand, p300 hyperphosphorylation is inhibited by several different inhibitors of the glucose metabolic pathway from generation of NADH by glyceraldehyde 3-phosphate dehydrogenase, through the transfer of NADH through the glycerol phosphate shuttle to ubiquinone and complex III of the mitochondrial respiratory chain. Inhibition of IP3-sensitive calcium stores decreases generation of ATP, and this inhibition is significantly stronger in hypoxia than in normoxia. We propose that the NADH glycerol phosphate shuttle participates in generating a pool of ATP that serves either as a co-factor or a modulator of the kinases involved in the phosphorylation of p300/CBP during hypoxia. PMID:16000154

  1. Effects of the cell type-specific ablation of the cAMP-responsive transcription factor in noradrenergic neurons on locus coeruleus firing and withdrawal behavior after chronic exposure to morphine.

    PubMed

    Parlato, Rosanna; Cruz, Hans; Otto, Christiane; Murtra, Patricia; Parkitna, Jan Rodriguez; Martin, Miquel; Bura, Simona A; Begus-Nahrmann, Yvonne; von Bohlen und Halbach, Oliver; Maldonado, Rafael; Schütz, Günther; Lüscher, Christian

    2010-11-01

    Repeated exposure to opiates leads to cellular and molecular changes and behavioral alterations reflecting a state of dependence. In noradrenergic neurons, cyclic AMP (cAMP)-dependent pathways are activated during opiate withdrawal, but their contribution to the activity of locus coeruleus noradrenergic neurons and behavioral manifestations remains controversial. Here, we test whether the cAMP-dependent transcription factors cAMP responsive element binding protein (CREB) and cAMP-responsive element modulator (CREM) in noradrenergic neurons control the cellular markers and the physical signs of morphine withdrawal in mice. Using the Cre/loxP system we ablated the Creb1 gene in noradrenergic neurons. To avoid adaptive effects because of compensatory up-regulation of CREM, we crossed the conditional Creb1 mutant mice with a Crem-/- line. We found that the enhanced expression of tyrosine hydroxylase normally observed during withdrawal was attenuated in CREB/CREM mutants. Moreover, the withdrawal-associated cellular hyperactivity and c-fos expression was blunted. In contrast, naloxone-precipitated withdrawal signs, such as jumping, paw tremor, tremor and mastication were preserved. We conclude by a specific genetic approach that the withdrawal-associated hyperexcitability of noradrenergic neurons depends on CREB/CREM activity in these neurons, but does not mediate several behavioral signs of morphine withdrawal. PMID:20367754

  2. Adenylyl Cyclase VI Mediates Vasopressin-Stimulated ENaC Activity

    PubMed Central

    Roos, Karl P.; Bugaj, Vladislav; Mironova, Elena; Stockand, James D.; Ramkumar, Nirupama; Rees, Sara

    2013-01-01

    Vasopressin modulates sodium reabsorption in the collecting duct through adenylyl cyclase-stimulated cyclic AMP, which exists as multiple isoforms; the specific isoform involved in vasopressin-stimulated sodium transport is unknown. To assess this, we studied mice deficient in adenylyl cyclase type VI specifically in the principal cells of the collecting duct. Knockout mice had increased urine volume and reduced urine sodium concentration, but regardless of the level of sodium intake, they did not exhibit significant alterations in urinary sodium excretion, arterial pressure, or pulse rate. Plasma renin concentration was elevated in knockout mice, however, suggesting a compensatory response. Valsartan significantly reduced arterial pressure in knockout mice but not in controls. Knockout mice had decreased renal cortical mRNA content of all three epithelial sodium channel (ENaC) isoforms, and total cell sodium channel isoforms ? and ? were reduced in these animals. Patch-clamp analysis of split-open cortical collecting ducts revealed no difference in baseline activity of sodium channels, but knockout mice had abolished vasopressin-stimulated ENaC open probability and apical membrane channel number. In summary, these data suggest that adenylyl cyclase VI mediates vasopressin-stimulated ENaC activity in the kidney. PMID:23264685

  3. Active thermal isolation for temperature responsive sensors

    NASA Technical Reports Server (NTRS)

    Martinson, Scott D. (inventor); Gray, David L. (inventor); Carraway, Debra L. (inventor); Reda, Daniel C. (inventor)

    1994-01-01

    A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specified surface of the body. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes: (1) operating the isolator at the same temperature as the constant temperature of the sensor and (2) establishing a fixed boundary temperature which is either less than or equal to or slightly greater than the sensor constant temperature.

  4. The Dual-Specificity Protein Phosphatase Yvh1p Regulates Sporulation, Growth, and Glycogen Accumulation Independently of Catalytic Activity in Saccharomyces cerevisiae via the Cyclic AMP-Dependent Protein Kinase Cascade

    Microsoft Academic Search

    ALEXANDER E. BEESER; TERRANCE G. COOPER

    2000-01-01

    Yvh1p, a dual-specific protein phosphatase induced specifically by nitrogen starvation, regulates cell growth as well as initiation and completion of sporulation. We demonstrate that yvh1 disruption mutants are also unable to accumulate glycogen in stationary phase. A catalytically inactive variant of yvh1 (C117S) and a DNA fragment encoding only the Yvh1p C-terminal 159 amino acids (which completely lacks the phosphatase

  5. Diverse signaling systems activated by the sweet taste receptor in human GLP-1-secreting cells.

    PubMed

    Ohtsu, Yoshiaki; Nakagawa, Yuko; Nagasawa, Masahiro; Takeda, Shigeki; Arakawa, Hirokazu; Kojima, Itaru

    2014-08-25

    Sweet taste receptor regulates GLP-1 secretion in enteroendocrine L-cells. We investigated the signaling system activated by this receptor using Hutu-80 cells. We stimulated them with sucralose, saccharin, acesulfame K and glycyrrhizin. These sweeteners stimulated GLP-1 secretion, which was attenuated by lactisole. All these sweeteners elevated cytoplasmic cyclic AMP ([cAMP]c) whereas only sucralose and saccharin induced a monophasic increase in cytoplasmic Ca(2+) ([Ca(2+)]c). Removal of extracellular calcium or sodium and addition of a Gq/11 inhibitor greatly reduced the [Ca(2+)]c responses to two sweeteners. In contrast, acesulfame K induced rapid and sustained reduction of [Ca(2+)]c. In addition, glycyrrhizin first reduced [Ca(2+)]c which was followed by an elevation of [Ca(2+)]c. Reductions of [Ca(2+)]c induced by acesulfame K and glycyrrhizin were attenuated by a calmodulin inhibitor or by knockdown of the plasma membrane calcium pump. These results indicate that various sweet molecules act as biased agonists and evoke strikingly different patterns of intracellular signals. PMID:25017733

  6. Structural basis for cyclic-nucleotide selectivity and cGMP-selective activation of PKG I.

    PubMed

    Huang, Gilbert Y; Kim, Jeong Joo; Reger, Albert S; Lorenz, Robin; Moon, Eui-Whan; Zhao, Chi; Casteel, Darren E; Bertinetti, Daniela; Vanschouwen, Bryan; Selvaratnam, Rajeevan; Pflugrath, James W; Sankaran, Banumathi; Melacini, Giuseppe; Herberg, Friedrich W; Kim, Choel

    2014-01-01

    Cyclic guanosine monophosphate (cGMP) and cyclic AMP (cAMP)-dependent protein kinases (PKG and PKA) are closely related homologs, and the cyclic nucleotide specificity of each kinase is crucial for keeping the two signaling pathways segregated, but the molecular mechanism of cyclic nucleotide selectivity is unknown. Here, we report that the PKG I? C-terminal cyclic nucleotide binding domain (CNB-B) is highly selective for cGMP binding, and we have solved crystal structures of CNB-B with and without bound cGMP. These structures, combined with a comprehensive mutagenic analysis, allowed us to identify Leu296 and Arg297 as key residues that mediate cGMP selectivity. In addition, by comparing the cGMP bound and unbound structures, we observed large conformational changes in the C-terminal helices in response to cGMP binding, which were stabilized by recruitment of Tyr351 as a "capping residue" for cGMP. The observed rearrangements of the C-terminal helices provide a mechanical insight into release of the catalytic domain and kinase activation. PMID:24239458

  7. Modulation of thapsigargin-induced calcium mobilisation by cyclic AMP-elevating agents in human lymphocytes is insensitive to the action of the protein kinase A inhibitor H-89.

    PubMed

    de la Rosa, L A; Vilariño, N; Vieytes, M R; Botana, L M

    2001-06-01

    Ca2+ mobilisation from internal stores and from the extracellular medium is one of the primary events involved in lymphocyte activation and proliferation. Regulation of these processes by adenosine 3',5'-cyclic monophosphate (cAMP) and cAMP-dependent protein kinase (PKA) was studied in Fura2-loaded human peripheral blood lymphocytes. Cytosolic Ca2+ concentration ([Ca2+]i) was measured in single cells by the use of a ratio imaging fluorescence microscope and Ca2+ mobilisation was achieved by the use of the endoplasmic reticulum (ER) Ca2+ ATPase inhibitor, thapsigargin (Thg). Our results show that both activation and inhibition of PKA, with forskolin (FSK) and N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide.2HCl (H-89), respectively, inhibited the Thg-induced Ca2+ entry. Furthermore, FSK also reduced the ability of Thg to release Ca2+ from internal stores. This reduction was inhibited by the adenylyl cyclase (AC) inhibitor 9-(tetrahydro-2-furanyl)-9-H-purin-6-amine (SQ22,536), but not by the PKA inhibitor H89, indicating that cAMP but not PKA is responsible for this effect. FSK effect was mimicked by dibutyryl cAMP (dbcAMP) and by inhibition of phosphodiesterases (PDEs) with rolipram (ROL) and milrinone (MIL). We also showed that a very high concentration of H-89 (100 microM) releases Ca2+ from an intracellular pool, although this action is probably independent of PKA inhibition. Neither 10 microM H-89 nor other cAMP/PKA-modulating drugs had any effect on the basal [Ca2+]i of human lymphocytes. We conclude that PKA may act as a fine modulator of capacitative Ca2+ entry, while cAMP has a PKA-independent interaction with the Ca2+ stores of human lymphocytes. PMID:11384843

  8. Active thermal isolation for temperature responsive sensors

    NASA Technical Reports Server (NTRS)

    Martinson, Scott D. (inventor); Gray, David L. (inventor); Carraway, Debra L. (inventor); Reda, Daniel C. (inventor)

    1994-01-01

    The detection of flow transition between laminar and turbulent flow and of shear stress or skin friction of airfoils is important in basic research for validation of airfoil theory and design. These values are conventionally measured using hot film nickel sensors deposited on a polyimide substrate. The substrate electrically insulates the sensor and underlying airfoil but is prevented from thermally isolating the sensor by thickness constraints necessary to avoid flow contamination. Proposed heating of the model surface is difficult to control, requires significant energy expenditures, and may alter the basic flow state of the airfoil. A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specific surface of the body. The total thickness of the isolator and sensor avoid any contamination of the flow. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes (1) operating the isolator at the same temperature as the constant temperature of the sensor; and (2) establishing a fixed boundary temperature which is either less than or equal to, or slightly greater than the sensor constant temperature. The present invention accordingly thermally isolates a temperature responsive sensor in an energy efficient, controllable manner while avoiding any contamination of the flow.

  9. Rapamycin Induces Mitogen-activated Protein (MAP) Kinase Phosphatase-1 (MKP-1) Expression through Activation of Protein Kinase B and Mitogen-activated Protein Kinase Kinase Pathways*

    PubMed Central

    Rastogi, Ruchi; Jiang, Zhongliang; Ahmad, Nisar; Rosati, Rita; Liu, Yusen; Beuret, Laurent; Monks, Robert; Charron, Jean; Birnbaum, Morris J.; Samavati, Lobelia

    2013-01-01

    Mitogen-activated protein kinase phosphatase-1 (MKP-1), also known as dual specificity phosphatase-1 (DUSP-1), plays a crucial role in the deactivation of MAPKs. Several drugs with immune-suppressive properties modulate MKP-1 expression as part of their mechanism of action. We investigated the effect of mTOR inhibition through rapamycin and a dual mTOR inhibitor (AZD2014) on MKP-1 expression. Low dose rapamycin led to a rapid activation of both AKT and ERK pathways with a subsequent increase in MKP-1 expression. Rapamycin treatment led to phosphorylation of CREB, transcription factor 1 (ATF1), and ATF2, three transcription factors that bind to the cyclic AMP-responsive elements on the Mkp-1 promoter. Inhibition of either the MEK/ERK or the AKT pathway attenuated rapamycin-mediated MKP-1 induction. AZD2014 did not activate AKT but activated the ERK pathway, leading to a moderate MKP-1 induction. Using bone marrow-derived macrophages (BMDMs) derived from wild-type (WT) mice or mice deficient in AKT1 and AKT2 isoforms or BMDM from targeted deficiency in MEK1 and MEK2, we show that rapamycin treatment led to an increased MKP1 expression in BMDM from WT but failed to do so in BMDMs lacking the AKT1 isoform or MEK1 and MEK2. Importantly, rapamycin pretreatment inhibited LPS-mediated p38 activation and decreased nitric oxide and IL-6 production. Our work provides a conceptual framework for the observed immune modulatory effect of mTOR inhibition. PMID:24126911

  10. Metabolic responses to simulated extravehicular activity

    NASA Technical Reports Server (NTRS)

    Williamson, Rebecca C.; Sharer, Peter J.; Webbon, Bruce W.; Rendon, Lisa R.

    1992-01-01

    Automatic control of the liquid cooling garment (LCG) worn by astronauts during extravehicular activity (EVA) would more efficiently regulate astronaut thermal comfort and improve astronaut productivity. An experiment was conducted in which subjects performed exercise profiles on a unique, supine upper body ergometer to elicit physiological and thermal responses similar to those achieved during zero-g EVAs. Results were analyzed to quantify metabolic rate, various body temperatures, and other heat balance parameters. Such data may lead to development of a microprocessor-based system to automatically maintain astronaut heat balance during extended EVAs.

  11. A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging

    PubMed Central

    Chen, Yao; Saulnier, Jessica L.; Yellen, Gary; Sabatini, Bernardo L.

    2014-01-01

    Neuromodulators have profound effects on behavior, but the dynamics of their intracellular effectors has remained unclear. Most neuromodulators exert their function via G-protein-coupled receptors (GPCRs). One major challenge for understanding neuromodulator action is the lack of dynamic readouts of the biochemical signals produced by GPCR activation. The adenylate cyclase/cyclic AMP/protein kinase A (PKA) module is a central component of such biochemical signaling. This module is regulated by several behaviorally important neuromodulator receptors. Furthermore, PKA activity is necessary for the induction of many forms of synaptic plasticity as well as for the formation of long-term memory. In order to monitor PKA activity in brain tissue, we have developed a 2-photon fluorescence lifetime imaging microscopy (2pFLIM) compatible PKA sensor termed FLIM-AKAR, which is based on the ratiometric FRET sensor AKAR3. FLIM-AKAR shows a large dynamic range and little pH sensitivity. In addition, it is a rapidly diffusible cytoplasmic protein that specifically reports net PKA activity in situ. FLIM-AKAR expresses robustly in various brain regions with multiple transfection methods, can be targeted to genetically identified cell types, and responds to activation of both endogenous GPCRs and spatial-temporally specific delivery of glutamate. Initial experiments reveal differential regulation of PKA activity across subcellular compartments in response to neuromodulator inputs. Therefore, the reporter FLIM-AKAR, coupled with 2pFLIM, enables the study of PKA activity in response to neuromodulator inputs in genetically identified neurons in the brain, and sheds light on the intracellular dynamics of endogenous GPCR activation. PMID:24765076

  12. Protein kinase activators alter glial cholesterol esterification

    SciTech Connect

    Jeng, I.; Dills, C.; Klemm, N.; Wu, C.

    1986-05-01

    Similar to nonneural tissues, the activity of glial acyl-CoA cholesterol acyltransferase is controlled by a phosphorylation and dephosphorylation mechanism. Manipulation of cyclic AMP content did not alter the cellular cholesterol esterification, suggesting that cyclic AMP is not a bioregulator in this case. Therefore, the authors tested the effect of phorbol-12-myristate 13-acetate (PMA) on cellular cholesterol esterification to determine the involvement of protein kinase C. PMA has a potent effect on cellular cholesterol esterification. PMA depresses cholesterol esterification initially, but cells recover from inhibition and the result was higher cholesterol esterification, suggesting dual effects of protein kinase C. Studies of other phorbol analogues and other protein kinase C activators such as merezein indicate the involvement of protein kinase C. Oleoyl-acetyl glycerol duplicates the effect of PMA. This observation is consistent with a diacyl-glycerol-protein kinase-dependent reaction. Calcium ionophore A23187 was ineffective in promoting the effect of PMA. They concluded that a calcium-independent and protein C-dependent pathway regulated glial cholesterol esterification.

  13. Protein kinase A regulates caspase-1 via Ets-1 in bone stromal cell-derived lesions: a link between cyclic AMP and pro-inflammatory pathways in osteoblast progenitors.

    PubMed

    Almeida, Madson Q; Tsang, Kit Man; Cheadle, Chris; Watkins, Tonya; Grivel, Jean-Charles; Nesterova, Maria; Goldbach-Mansky, Raphaela; Stratakis, Constantine A

    2011-01-01

    Patients with genetic defects of the cyclic (c) adenosine-monophosphate (AMP)-signaling pathway and those with neonatal-onset multisystem inflammatory disease (NOMID) develop tumor-like lesions of the long bones. The molecular basis of this similarity is unknown. NOMID is caused by inappropriate caspase-1 activity, which in turn activates the inflammasome. The present study demonstrates that NOMID bone lesions are derived from the same osteoblast progenitor cells that form fibroblastoid tumors in mice and humans with defects that lead to increased cAMP-dependent protein kinase A (PKA) signaling. NOMID tumor cells showed high PKA activity, and an increase in their cAMP signaling led to PKA-specific activation of caspase-1. Increased PKA led to inflammation-independent activation of caspase-1 via over-expression of the proto-oncogene (and early osteoblast factor) Ets-1. In NOMID tumor cells, as in cells with defective PKA regulation, increased prostaglandin E2 (PGE2) led to increased cAMP levels and activation of Wnt signaling, like in other states of inappropriate PKA activity. Caspase-1 and PGE2 inhibition led to a decrease in cell proliferation of both NOMID and cells with abnormal PKA. These data reveal a previously unsuspected link between abnormal cAMP signaling and defective regulation of the inflammasome and suggest that caspase-1 and PGE2 inhibition may be therapeutic targets in bone lesions associated with defects of these two pathways. PMID:20940146

  14. Role of cytoskeletal elements in expression of monocyte urokinase plasminogen activator receptor, activation-associated antigen Mo3.

    PubMed Central

    Washington, R; Dore-Duffy, P

    1994-01-01

    Peripheral blood monocytes exposed to bacterial products, phorbol esters, cyclic AMP, and cyclic AMP analogs express cell surface activation protein Mo3, which is the human urokinase plasminogen activator receptor (uPA-R). uPA-R is expressed by circulating monocytes from patients with multiple sclerosis (MS). We examined the role of cytoskeletal elements in the surface expression and subcellular distribution of uPA-R in nonactivated and lipopolysaccharide-activated monocytes and in monocytes from patients with MS. By using immunofluorescence techniques and confocal laser microscopy, we found that in unactivated monocytes, cytoplasmic uPA-R is found to one side of the nucleus, colocalizing with the Golgi. Upon activation with lipopolysaccharide, cytoplasmic Mo3-uPA-R becomes dispersed throughout the cytoplasm and projections concomitant with an increase in the monocyte perimeter (spreading). Cytoplasmic dispersion, as well as cell surface deposition, is dependent on microtubule integrity. Cell surface deposition of uPA-R upon activation is reduced by colchicine, which disrupts microtubules; however, once associated at the cell surface, uPA-R becomes associated with microfilaments via vinculin. Disruption of microfilaments with cytochalasin also alters surface expression of immunologically reactive uPA-R, as well as the distribution pattern. Monocytes from patients with MS display the uPA-R distribution pattern characteristic of an activated monocyte. Images PMID:8556526

  15. Adenosine modulates light responses of rat retinal ganglion cell photoreceptors througha cAMP-mediated pathway.

    PubMed

    Sodhi, Puneet; Hartwick, Andrew T E

    2014-10-01

    Adenosine is an established neuromodulator in the mammalian retina, with A1 adenosine receptors being especially prevalent in the innermost ganglion cell layer. Activation of A1 receptors causes inhibition of adenylate cyclase, decreases in intracellular cyclic AMP (cAMP) levels and inhibition of protein kinase A (PKA). In this work, our aim was to characterize the effects of adenosine on the light responses of intrinsically photosensitive retinal ganglion cells (ipRGCs) and to determine whether these photoreceptors are subject to neuromodulation through intracellular cAMP-related signalling pathways. Using multielectrode array recordings from postnatal and adult rat retinas, we demonstrated that adenosine significantly shortened the duration of ipRGC photoresponses and reduced the number of light-evoked spikes fired by these neurons. The effects were A1 adenosine receptor-mediated, and the expression of this receptor on melanopsin-containing ipRGCs was confirmed by calcium imaging experiments on isolated cells in purified cultures. While inhibition of the cAMP/PKA pathway by adenosine shortened ipRGC light responses, stimulation of this pathway with compounds such as forskolin had the opposite effect and lengthened the duration of ipRGC spiking. Our findings reveal that the modification of ipRGC photoresponses through a cAMP/PKA pathway is a general feature of rat ganglion cell photoreceptors, and this pathway can be inhibited through activation of A1 receptors by adenosine. As adenosine levels in the retina rise at night, adenosinergic modulation of ipRGCs may serve as an internal regulatory mechanism to limit transmission of nocturnal photic signals by ipRGCs to the brain. Targeting retinal A1 adenosine receptors for ipRGC inhibition represents a potential therapeutic target for sleep disorders and migraine-associated photophobia. PMID:25038240

  16. Differential effects of interleukin-2 and interleukin-4 on immunomodulatory role of platelet-activating factor in human B cells.

    PubMed Central

    Patke, C L; Green, C G; Shearer, W T

    1994-01-01

    Platelet-activating factor (PAF), a naturally occurring phospholipid cytokine, is a potent mediator of allergic and inflammatory reactions, as well as a modulator of immune responses. In the present study we showed that PAF is involved in early B-cell activation, as demonstrated by the increased cyclic AMP (cAMP) generation by PAF in a time- and dose-dependent manner in anti-mu antibody- plus B-cell growth factor-activated normal human peripheral blood B lymphocytes. PAF also regulated differentiation by causing a biphasic response on immunoglobulin M (IgM) production with an inhibitory signal generated at 10(-6) M and a stimulatory signal generated at 10(-8) to 10(-10) M. PAF enhanced IgA secretion. The regulation exerted by PAF was shown to be specific because the addition of the PAR antagonist CV-3988 abrogated these effects and the inactive form of PAF, lyso-PAF, induced neither cAMP generation nor immunoglobulin secretion in normal human B cells. Other cytokines, interleukin-2 (IL-2) and IL-4, potent mediators of the immune response, were unable to elicit a cAMP response in B cells. However, the addition of PAF (10(-6) M) with wither IL-2 or IL-4 enhanced cAMP production above the levels enhanced by the addition of PAF alone. IL-2 or IL-4, individually, stimulated IgM production, yet costimulation with PAF resulted in a differential effect between IL-2 and IL-4. PAF down-regulated the IL-4-induced IgM secretion, whereas the IL-2-induced IgM secretion was enhanced. The presence of CV-3988 returned all valued to those obtained with IL-2 or IL-4 alone, demonstrating the specificity of PAF. These data suggest that PAF is an important B-cell immunomodulator which can interact with other leukocyte cell mediators. PMID:8556480

  17. Activation and Repression of Transcription by Auxin-Response Factors

    Microsoft Academic Search

    Tim Ulmasov; Gretchen Hagen; Tom J. Guilfoyle

    1999-01-01

    Auxin-response factors (ARFs) bind with specificity to TGTCTC auxin-response elements (AuxREs), which are found in promoters of primary\\/early auxin-response genes. Nine different ARFs have been analyzed for their capacity to activate or repress transcription in transient expression assays employing auxin-responsive GUS reporter genes. One ARF appears to act as a repressor. Four ARFs function as activators and contain glutamine-rich activation

  18. T3-induced liver AMP-activated protein kinase signaling: Redox dependency and upregulation of downstream targets

    PubMed Central

    Videla, Luis A; Fernández, Virginia; Cornejo, Pamela; Vargas, Romina; Morales, Paula; Ceballo, Juan; Fischer, Alvaro; Escudero, Nicolás; Escobar, Oscar

    2014-01-01

    AIM: To investigate the redox dependency and promotion of downstream targets in thyroid hormone (T3)-induced AMP-activated protein kinase (AMPK) signaling as cellular energy sensor to limit metabolic stresses in the liver. METHODS: Fed male Sprague-Dawley rats were given a single ip dose of 0.1 mg T3/kg or T3 vehicle (NaOH 0.1 N; controls) and studied at 8 or 24 h after treatment. Separate groups of animals received 500 mg N-acetylcysteine (NAC)/kg or saline ip 30 min prior T3. Measurements included plasma and liver 8-isoprostane and serum ?-hydroxybutyrate levels (ELISA), hepatic levels of mRNAs (qPCR), proteins (Western blot), and phosphorylated AMPK (ELISA). RESULTS: T3 upregulates AMPK signaling, including the upstream kinases Ca2+-calmodulin-dependent protein kinase kinase-? and transforming growth factor-?-activated kinase-1, with T3-induced reactive oxygen species having a causal role due to its suppression by pretreatment with the antioxidant NAC. Accordingly, AMPK targets acetyl-CoA carboxylase and cyclic AMP response element binding protein are phosphorylated, with the concomitant carnitine palmitoyltransferase-1? (CPT-1?) activation and higher expression of peroxisome proliferator-activated receptor-? co-activator-1? and that of the fatty acid oxidation (FAO)-related enzymes CPT-1?, acyl-CoA oxidase 1, and acyl-CoA thioesterase 2. Under these conditions, T3 induced a significant increase in the serum levels of ?-hydroxybutyrate, a surrogate marker for hepatic FAO. CONCLUSION: T3 administration activates liver AMPK signaling in a redox-dependent manner, leading to FAO enhancement as evidenced by the consequent ketogenic response, which may constitute a key molecular mechanism regulating energy dynamics to support T3 preconditioning against ischemia-reperfusion injury. PMID:25516653

  19. Influence of morphine anaesthesia on the endocrine-metabolic response to open-heart surgery.

    PubMed

    Brandt, M R; Korshin, J; Hansen, A P; Hummer, L; Madsen, S N; Rygg, I; Kehlet, H

    1978-01-01

    Twelve patients scheduled for aortic valve replacement during extracorporal circulation were randomly allocated to either morphine anaesthesia or fluroxene anaesthesia. Morphine in a total dose of 4 mg/kg was administered before skin incision. At the start of extracorporal circulation all patients received 25 g glucose intravascularly. The endocrine-metabolic response to surgery, as expressed by changes in plasma ACTH, cortisol, insulin, growth hormone, cyclic adenosine-3',-5'-monophosphate (cyclic AMP), glucose, free fatty acids, blood b-hydroxybutyrate and cumulative nitrogen balance was measured before and during anaesthesia and surgery, and on the first five post-operative days. It was found that morphine anaesthesia blocked the increase in ACTH, cortisol, growth hormone, cyclic AMP, and glucose during surgery. However, after initiation of extracorporal circulation only ACTH, cortisol, and, to a lesser degree, the glucose and insulin response to glucose were lowered by morphine anaesthesia. From the first to the fifth days after operation no differences between the two groups could be demonstrated in any parameter. Cumulative nitrogen balance was similar in the two groups. It is concluded that morphine in large doses administered before skin incision inhibits the initial endocrine-metabolic response to open-heart surgery, but that the effect is short-lasting and without effect on overall postoperative protein catabolism. PMID:31757

  20. Signaling by intracellular Ca2+ and H+ in larval mosquito (Aedes aegypti) midgut epithelium in response to serosal serotonin and lumen pH.

    PubMed

    Moffett, David F; Jagadeshwaran, Urmila; Wang, Zeping; Davis, Hana M; Onken, Horst; Goss, Greg G

    2012-04-01

    The midgut of larval mosquitoes (Aedes aegypti) mediates a cycle of alkali secretion in the anterior segment (AMG) followed by partial reacidification in the posterior segment (PMG); both processes are serotonin-dependent. Here we report that intracellular Ca(2+)(Ca(i)(2+)) as indicated by Fura-2 fluorescence, is elevated in both tissues in response to serotonin, but the time courses differ characteristically in the two gut segments, and Ca(2+)-free solution abolishes the serotonin response in AMG, but not in PMG, whereas Thapsigargin, an inhibitor of endoplasmic Ca(2+) transport, abolished responsiveness to 5-HT in PMG. These results suggest the origins for the Ca(2+) signal differ between the two tissues. Quantitative real-time RT-PCR revealed expression of 5 putative 5-HT receptor types in AMG, including 5-HT(2)-like receptors which would be expected to initiate a Ca(2+) signal. None of these receptors were highly expressed in PMG. Cyclic AMP (cAMP) is a secretagogue for both tissues, but H89, an inhibitor of Protein Kinase A (PKA), is also a secretagogue, suggesting that the stimulatory effect of cAMP involves a non-PKA pathway. Cytochalasins B and D block the effect of 5-HT in AMG, suggesting a vesicle-fusion mechanism of activation of the basal V-ATPase in this tissue. Finally, in PMG, elevation of luminal pH increases (Ca(i)(2+)) and decreases intracellular pH as measured by BCECF fluorescence. These responses suggest that the rate of acid secretion by PMG might be responsive to local demand for luminal reacidification as well as to serosal serotonin. PMID:22172381

  1. Characterization of a CREB Gain-of-Function Mutant with Constitutive Transcriptional Activity In Vivo

    PubMed Central

    Du, Keyong; Asahara, Hiroshi; Jhala, Ulupi S.; Wagner, Brandee L.; Montminy, Marc

    2000-01-01

    The cyclic AMP (cAMP)-responsive factor CREB promotes cellular gene expression, following its phosphorylation at Ser133, via recruitment of the coactivator paralogs CREB-binding protein (CBP) and p300. CBP and p300, in turn, appear to mediate target gene induction via their association with RNA polymerase II complexes and via intrinsic histone acetyltransferase activities that mobilize promoter-bound nucleosomes. In addition to cAMP, a wide variety of stimuli, including hypoxia, UV irradiation, and growth factor addition, induce Ser133 phosphorylation with stoichiometry and kinetics comparable to those induced by cAMP. Yet a number of these signals are incapable of promoting target gene activation via CREB phosphorylation per se, suggesting the presence of additional regulatory events either at the level of CREB-CBP complex formation or in the subsequent recruitment of the transcriptional apparatus. Here we characterize a Tyr134Phe CREB mutant that behaves as a constitutive activator in vivo. Like protein kinase A (PKA)-stimulated wild-type CREB, the Tyr134Phe polypeptide was found to stimulate target gene expression via the Ser133-dependent recruitment of CBP and p300. Biochemical studies reveal that mutation of Tyr134 to Phe lowers the Km for PKA phosphorylation and thereby induces high levels of constitutive Ser133 phosphorylation in vivo. Consistent with its constitutive activity, Tyr134Phe CREB strongly promoted differentiation of PC12 cells in concert with suboptimal doses of nerve growth factor. Taken together, these results demonstrate that Ser133 phosphorylation is sufficient for cellular gene activation and that additional signal-dependent modifications of CBP or p300 are not required for recruitment of the transcriptional apparatus to the promoter. PMID:10825195

  2. A-kinase-anchoring proteins coordinate inflammatory responses to cigarette smoke in airway smooth muscle.

    PubMed

    Poppinga, Wilfred J; Heijink, Irene H; Holtzer, Laura J; Skroblin, Philipp; Klussmann, Enno; Halayko, Andrew J; Timens, Wim; Maarsingh, Harm; Schmidt, Martina

    2015-04-15

    ?2-Agonist inhibitors can relieve chronic obstructive pulmonary disease (COPD) symptoms by stimulating cyclic AMP (cAMP) signaling. A-kinase-anchoring proteins (AKAPs) compartmentalize cAMP signaling by establishing protein complexes. We previously reported that the ?2-agonist fenoterol, direct activation of protein kinase A (PKA), and exchange factor directly activated by cAMP decrease cigarette smoke extract (CSE)-induced release of neutrophil attractant interleukin-8 (IL-8) from human airway smooth muscle (ASM) cells. In the present study, we tested the role of AKAPs in CSE-induced IL-8 release from ASM cells and assessed the effect of CSE on the expression levels of different AKAPs. We also studied mRNA and protein expression of AKAPs in lung tissue from patients with COPD. Our data show that CSE exposure of ASM cells decreases AKAP5 and AKAP12, both capable of interacting with ?2-adrenoceptors. In lung tissue of patients with COPD, mRNA levels of AKAP5 and AKAP12 were decreased compared with lung tissue from controls. Using immunohistochemistry, we detected less AKAP5 protein in ASM of patients with COPD Global Initiative for Chronic Obstructive Lung Disease (GOLD) stage II compared with control subjects. St-Ht31, which disrupts AKAP-PKA interactions, augmented CSE-induced IL-8 release from ASM cells and diminished its suppression by fenoterol, an effect mediated by disturbed ERK signaling. The modulatory role of AKAP-PKA interactions in the anti-inflammatory effects of fenoterol in ASM cells and the decrease in expression of AKAP5 and AKAP12 in response to cigarette smoke and in lungs of patients with COPD suggest that cigarette smoke-induced changes in AKAP5 and AKAP12 in patients with COPD may affect efficacy of pharmacotherapy. PMID:25637608

  3. Molecular cloning and expression, in both COS-1 cells and S. cerevisiae, of a human cytosolic type-IVA, cyclic AMP specific phosphodiesterase (hPDE-IVA-h6.1).

    PubMed

    Sullivan, M; Egerton, M; Shakur, Y; Marquardsen, A; Houslay, M D

    1994-09-01

    Screening a human T lymphocyte cDNA library with a phosphodiesterase (PDE) specific probe resulted in the isolation of two overlapping cDNA clones, h2.2 and h6.1, that encode a type IV, rolipram inhibited cAMP-specific PDE. Clones h2.2 and h6.1 were 1015 bp and 2288 bp in length, respectively, and overlapped for 984 bp with only one nucleotide difference. The h6.1 cDNA was extended at the 5'-end by 1304 bp, with respect to h2.2, and encoded an incomplete ORF (lacking an initiation codon) of 668 amino acids. The merged nucleotide sequence of h6.1/h2.2 exhibited 99.5% homology in the ORF (ten nucleotide changes resulting in six amino acid changes), and 95% homology in the 3'-untranslated region, with the previously reported human PDE-IVA cDNA [Livi G. P., Kmetz P., Mchale M. M., Cieslinski L. B., Sathe G. M., Taylor D. P., Davis R. L., Torphy T. J. and Balcarek J. M. (1990) Mol. Cell Biol. 10, 2678-2686]. The sequence reported for h6.1/h2.2 matched that found for IVA clones isolated from three other human cDNA libraries, a human genomic cosmid clone and pcr amplified products of the exon covering these differences in two individuals. The h6.1 cDNA was engineered to generate a complete ORF by building in the 56 bp, including the initiation codon, present in hPDE-IVA-Livi and missing from the 5'-end of h6.1, producing a cognate ORF encoding a protein of 687 amino acids but differing in five amino acids which lay in or adjacent to the putative catalytic domain. The complete h6.1 ORF was engineered for expression in both Saccharomyces cerevisiae and in COS-1 cells. Integration of a single copy of the engineered ORF of h6.1, under the transcriptional control of a constitutive yeast promoter, at the pep4 locus of a S. cerevisiae strain lacking both yeast PDE genes resulted in functional complementation of the yeast pde-phenotype. Yeast strains with functional PDE were a light creamy white colour, while strains devoid of PDE activity were a dull brown colour. Expression of h6.1 in COS-1 cells led to the production of a typical type IV PDE activity in that cAMP, but not cGMP, served as substrate and its activity was insensitive to either Ca2+/CaM or cGMP but was inhibited by low concentrations of rolipram.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7888306

  4. Increased Pancreatic ?-Cell Proliferation Mediated by CREB Binding Protein Gene Activation?

    PubMed Central

    Hussain, Mehboob A.; Porras, Delia L.; Rowe, Matthew H.; West, Jason R.; Song, Woo-Jin; Schreiber, Weston E.; Wondisford, Fredric E.

    2006-01-01

    The cyclic AMP (cAMP) signaling pathway is central in ?-cell gene expression and function. In the nucleus, protein kinase A (PKA) phosphorylates CREB, resulting in recruitment of the transcriptional coactivators p300 and CREB binding protein (CBP). CBP, but not p300, is phosphorylated at serine 436 in response to insulin action. CBP phosphorylation disrupts CREB-CBP interaction and thus reduces nuclear cAMP action. To elucidate the importance of the cAMP-PKA-CREB-CBP pathway in pancreatic ? cells specifically at the nuclear level, we have examined mutant mice lacking the insulin-dependent phosphorylation site of CBP. In these mice, the CREB-CBP interaction is enhanced in both the absence and presence of cAMP stimulation. We found that islet and ?-cell masses were increased twofold, while pancreas weights were not different from the weights of wild-type littermates. ?-Cell proliferation was increased both in vivo and in vitro in isolated islet cultures. Surprisingly, glucose-stimulated insulin secretion from perfused, isolated mutant islets was reduced. However, ?-cell depolarization with KCl induced similar levels of insulin release from mutant and wild-type islets, indicating normal insulin synthesis and storage. In addition, transcripts of pgc1a, which disrupts glucose-stimulated insulin secretion, were also markedly elevated. In conclusion, sustained activation of CBP-responsive genes results in increased ?-cell proliferation. In these ? cells, however, glucose-stimulated insulin secretion was diminished, resulting from concomitant CREB-CBP-mediated pgc1a gene activation. PMID:16908541

  5. Activities for Teaching Responsibility: Teaching Responsibility in the Elementary School Curriculum.

    ERIC Educational Resources Information Center

    North Carolina State Dept. of Public Instruction, Raleigh.

    The activities in this book are idea starters for teaching about responsible behavior. The activities provide opportunities to discuss and reflect on personal and group responsibilities during daily activities in ordinary, familiar situations at home, school, in neighborhoods and communities. The ideas can be adapted and used appropriately in…

  6. The CREB, ATF-1, and ATF-2 transcription factors from bovine leukemia virus-infected B lymphocytes activate viral expression.

    PubMed Central

    Adam, E; Kerkhofs, P; Mammerickx, M; Burny, A; Kettman, R; Willems, L

    1996-01-01

    Efficient transcription and replication of the bovine leukemia virus (BLV) genome require both the viral long terminal repeat (LTR) and the virus-coded transcriptional activator Tax, which functions through a 21-bp sequence (Tax-responsive element [TxRE]) which is repeated three times within the LTR. Since Tax does not bind directly to DNA, host cell transcription factors play a central role in BLV expression. Electrophoretic mobility shift assays with nuclear extracts prepared with infected bovine B lymphocytes revealed five TxRE-specific complexes (C1, C2, C3, C4, and C5). Here, by using a UV-induced indirect labeling technique (UV cross-linking) in conjunction with mobility shift assays, eight major polypeptides of 31, 33, 42, 46, 51, 57, 87, and 119 kDa were identified within these five complexes. Immunoprecipitation experiments identified the 57- and 119-kDa proteins as cyclic AMP response element-binding (CREB) proteins, the 46- and 51-kDa proteins as activating transcription factor-1 (ATF-1), and the 87-kDa as protein ATF-2. All of these proteins (except the ATF-1 protein of 51 kDa) belong to the complex C1, which is the major complex identified in freshly isolated BLV-infected lymphocytes from cattle with persistent lymphocytosis. In transient-cotransfection experiments, these three transcription factors were able to activate LTR-directed gene expression in the presence of protein kinase A or Ca2+/calmodulin-dependent protein kinase IV. CREB protein, ATF-1, and ATF-2 thus appear to be the major transcription factors involved in the early stages of viral expression. PMID:8627725

  7. Activation of codependent transcription factors is required for transcriptional induction of the vgf gene by nerve growth factor and Ras.

    PubMed Central

    D'Arcangelo, G; Habas, R; Wang, S; Halegoua, S; Salton, S R

    1996-01-01

    Nerve growth factor (NGF) treatment of PC12 cells leads to the elaboration of a neuronal phenotype, including the induction of neuronally expressed genes such as vgf. To study vgf transcription, we have created chimeric vgf/beta-globin genes in which vgf promoter sequences drive the expression of the beta-globin reporter gene or of a chimeric beta-globin gene fused to 3' untranslated vgf gene sequences. We have found that the level of inducibility of the latter construct by NGF resembles that of the endogenous vgf gene. Using transient transfection of the chimeric reporter genes into PC12 cells, into PC12 subclones expressing activated or dominantly interfering mutant Ras proteins, and into PC12 variants expressing specific NGF receptor/Trk mutants, we show that transcriptional regulation of the vgf promoter by NGF is mediated through a Ras-dependent signaling pathway. By mutational analysis of the vgf promoter, we have identified three promoter elements involved in mediating transcriptional induction by NGF and Ras. In addition to the cyclic AMP-responsive element (CRE), which binds to ATF-1, ATF-2, and CRE-binding protein in PC12 nuclear extracts, a novel CCAAT element and its binding proteins were identified, which, like the CRE, is necessary but not sufficient for the Ras-dependent induction of the vgf gene by NGF. We also identify a G(S)G element unusually located between the TATA box and transcriptional start site, which binds the NGF- and Ras-induced transcription factor, NGFI-A, and amplifies the transcriptional response. Integrating data from studies of vgf promoter regulation and NGF signal transduction, we present a model for vgf gene induction in which transcriptional activation is achieved through the persistent, direct activation of multiple interacting transcription factors binding to CRE and CCAAT elements, coordinated with the delayed transcription factor action at a G(S)G element resulting from the induced expression of NGFI-A. PMID:8756618

  8. Human muscarinic receptors expressed in A9L and CHO cells: activation by full and partial agonists.

    PubMed Central

    Richards, M H; van Giersbergen, P L

    1995-01-01

    1. A comparative study of receptor activation by ten full and partial muscarinic agonists was undertaken on the five subtypes of human muscarinic receptors expressed at similar receptor densities in Chinese hamster ovary (CHO-K1) cells. In addition, m1, m2 and m3 receptors were expressed in mouse fibroblast A9L cells in order to compare the influences of cell type on agonist activation of these receptors. 2. Receptor-effector coupling efficiencies were greater in CHO than A9L cells and agonists displayed greater potencies and similar or greater intrinsic activities at CHOm1 and CHOm3 than A9Lm1 and A9Lm3 receptors. Although m2 receptor density was 6 fold higher in A9L than CHO cells, carbachol elicited significantly greater inhibition of adenosine 3':5'-cyclic monophosphate (cyclic AMP) formation in CHOm2 cells. These data suggest that not only receptor density but receptor-effector coupling and/or coupling efficiencies play significant roles in agonist-induced responses. 3. In CHO cells, receptor-effector coupling efficiencies were m3 = m1 > m5. Although CHOm5 receptors were the least efficiently coupled, some partial agonists displayed higher intrinsic efficacies at m5 than m3 receptors suggesting that, in CHO cells, m5 and m3 receptors may activate different G proteins and/or effectors to stimulate inositol monophosphate (IP1) formation. 4. McN-A-343 was a functionally selective m4 agonist. It had little or no agonist activity at m3 receptors expressed in either A9L or CHO cells.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7620715

  9. Synaptic Background Activity Enhances the Responsiveness of Neocortical Pyramidal Neurons

    E-print Network

    Destexhe, Alain

    Synaptic Background Activity Enhances the Responsiveness of Neocortical Pyramidal Neurons NICOLAS H the responsiveness of neocortical pyramidal neurons. J Neu- rophysiol 84: 1488­1496, 2000. Neocortical pyramidal in morphologically reconstructed neocortical pyramidal neurons in which synaptic back- ground activity was simulated

  10. Influence of cations on activity and distribution of protein kinase C in S49 lymphoma cells

    SciTech Connect

    Brunton, L.; Watson, M.; Schultz, M.; Trejo, J.; Speizer, L.

    1987-05-01

    In S49 lymphoma cells, the distribution of protein kinase C (PKC) between soluble and membrane fractions can be regulated by the concentration of Ca in the homogenization buffer. When cells are fractionated with 10 M Ca and low Mg (0.3mM), PKC is largely (56%) membrane-bound. Mg inhibits this effect of Ca by 75%; the EC50 for Mg reducing the translocation induced by 10 M Ca is 1mM, as detected by binding of (TH) phorbol dibutyrate ((TH)PDB). Other divalent cations have different effects. When Cu (1mM) is included in the homogenization buffer, both the enzymic activity of PKC and its capacity to bind (TH)PDB are lost in both the cytosolic and membrane fractions. Cd and Zn (at 1mM) also inhibit the binding of (TH)PDB to PKC in cytosolic fractions. K , Li , Co and Mn at 1mM do not mimic these effects. With Ca at 500 M, the EC50 for inhibition by Cu of (TH)PDB binding and enzymic activity of PKC are 25 M and 75 M, respectively. These effects of Cu are also noticeable when the cation is added to intact S49 cells. The effect of Cu on PKC is only relatively specific: (Cu ) greater than or equal to 100 M inhibits the activity of cyclic AMP-dependent protein kinase in vitro. Knowledge of these effects of heavy metals on PKC may prove helpful in manipulation of the enzyme pharmacologically as well as in determining the role of PKC in the cellular responses to heavy metals.

  11. Fractalkine/CX3CL1 engages different neuroprotective responses upon selective glutamate receptor overactivation

    PubMed Central

    Lauro, Clotilde; Catalano, Myriam; Di Paolo, Eleonora; Chece, Giuseppina; de Costanzo, Ida; Trettel, Flavia; Limatola, Cristina

    2015-01-01

    Neuronal death induced by overactivation of N-methyl-d-aspartate receptors (NMDARs) is implicated in the pathophysiology of many neurodegenerative diseases such as stroke, epilepsy and traumatic brain injury. This toxic effect is mainly mediated by NR2B-containing extrasynaptic NMDARs, while NR2A-containing synaptic NMDARs contribute to cell survival, suggesting the possibility of therapeutic approaches targeting specific receptor subunits. We report that fractalkine/CX3CL1 protects hippocampal neurons from NMDA-induced cell death with a mechanism requiring the adenosine receptors type 2A (A2AR). This is different from CX3CL1-induced protection from glutamate (Glu)-induced cell death, that fully depends on A1R and requires in part A3R. We show that CX3CL1 neuroprotection against NMDA excitotoxicity involves D-serine, a co-agonist of NR2A/NMDAR, resulting in cyclic AMP-dependent transcription factor cyclic-AMP response element-binding protein (CREB) phosphorylation. PMID:25653593

  12. CYCLIC AMP AND THE MECHANISM OF ACTION OF GONADOTROPIN

    E-print Network

    Boyer, Edmond

    to two main problems : first the binding of LH-RH to the receptor sites of the pituitary gland. - STUDIES ON THE BINDING OF I,H-RH TO THE RECEPTOR SITES OF THE PITUITARY GLAND Many experimental results ovine anterior pituitary glands were prepared by a simple and rapid method schematized in figure i

  13. Thermoregulatory effects of N6-2'-Q-dibutyryl adenosine 3',5'-monophosphate in the restrained mouse.

    PubMed Central

    Dascombe, M. J.; Milton, A. S.; Nyemitei-Addo, I.; Pertwee, R. G.

    1980-01-01

    1 The N6-2-O-dibutyryl derivative of adenosine 3',5'-monophosphate (db cyclic AMP) has been micro-injected into the third cerebral ventricle of the unanaesthetized, restrained mouse and the effects on body temperature and thermoregulatory activities observed. 2 Db cyclic AMP (4, 16 and 32 micrograms) injected intracerebroventricularly produced hypothermia when compared with temperature responses to sodium n-butyrate (6.8 micrograms). 3 Hypothermia induced by db cyclic AMP in mice was associated with a fall in oxygen consumption together with behavioural and autonomic heat loss activities but not cutaneous vasodilatation. The effects on rectal temperature and oxygen consumption were dose-dependent. 4 The falls in rectal temperature and oxygen consumption induced by db cyclic AMP (4 micrograms) were decreased by elevation of the environmental temperature from 22 to 32 degrees C and abolished at 36 degrees C. 5 It is concluded db cyclic AMP may inhibit central events mediating the rise in metabolic heat production in mice upon exposure to cold environments. PMID:6254600

  14. Inhibition of cAMP accumulation by kappa-receptor activation in isolated iris-ciliary bodies: role of phosphodiesterase and protein kinase C.

    PubMed

    Dortch-Carnes, Juanita; Potter, David E

    2002-05-01

    The present study was designed to examine the roles of protein kinase C (PKC) and phosphodiesterase (PDE) in modulating the action of kappa receptor stimulation on cAMP accumulation in isolated iris-ciliary bodies (ICBs) of New Zealand White rabbits. The kappa receptor agonist, (+/-)-1-(3,4-dichlorophenyl)acetyl-2-(1-pyrrolidinyl)methylpiperidine (BRL-52537) (BRL), and the PKC activator, phorbol 12,13-dibutyrate (PDBu), both caused a concentration-dependent inhibition of forskolin-stimulated cAMP production. The inhibitory effect of BRL on cAMP levels was significantly reduced in the presence of the selective kappa receptor antagonist, norbinaltorphimine (10(-6) M), but the effect of PDBu was not, thus supporting the involvement of kappa-opioid receptors in the response to BRL. In the presence of 3-isobutyl-1-methylxanthine or rolipram (10(-5) M), the inhibitory effect of BRL or PDBu (10(-6) M) on cyclic AMP accumulation was abolished. In the presence of the selective PKC antagonist, chelerythrine (10(-6) M), the inhibitory effect of PDBu or BRL (10(-6) M) was significantly reduced. Direct measurement of PDE activity demonstrated the ability of BRL and PDBu (10(-6) M) to augment the activity of these enzymes. Preincubation of ICBs with rolipram (10(-5) M) or chelerythrine (10(-6) M) caused significant reversal of both BRL- and PDBu-induced increases in PDE activity. These results indicate that stimulation of PKC and PDE4 activity is part of the complex mechanism whereby kappa-opioid receptor agonists reduce levels of cAMP in the rabbit ICB. This mechanism of action could contribute to the ability of kappa-opioid agonists to suppress aqueous flow rate and to lower intraocular pressure. PMID:11961062

  15. Structure–activity relationship studies of naphthol AS-E and its derivatives as anticancer agents by inhibiting CREB-mediated gene transcription

    PubMed Central

    Li, Bingbing X.; Yamanaka, Kinrin; Xiao, Xiangshu

    2012-01-01

    CREB (cyclic AMP-response element binding protein) is a downstream transcription factor of a multitude of signaling pathways emanating from receptor tyrosine kinases or G-protein coupled receptors. CREB is not activated until it is phosphorylated at Ser133 and its subsequent binding to CREB-binding protein (CBP) through kinase-inducible domain (KID) in CREB and KID-interacting (KIX) domain in CBP. Tumor tissues from various organs present higher level of expression and activation of CREB. Thus CREB has been proposed as a promising cancer drug target. We previously described naphthol AS-E (1a) as a small molecule inhibitor of CREB-mediated gene transcription in living cells. Here we report the structure–activity relationship (SAR) studies of 1a by modifying the appendant phenyl ring. All the compounds were evaluated for in vitro inhibition of KIX–KID interaction, cellular inhibition of CREB-mediated gene transcription and inhibition of proliferation of four cancer cell lines (A549, MCF-7, MDA-MB-231 and MDA-MB-468). SAR indicated that a small and electron-withdrawing group was preferred at the para-position for KIX–KID interaction inhibition. Compound 1a was selected for further biological characterization and it was found that 1a down-regulated the expression of endogenous CREB target genes. Expression of a constitutively active CREB mutant, VP16-CREB in MCF-7 cells rendered the cells resistant to 1a, suggesting that CREB was critical in mediating its anticancer activity. Furthermore, 1a was not toxic to normal human cells. Collectively, these data support that 1a represents a structural template for further development into potential cancer therapeutics with a novel mechanism of action. PMID:23102993

  16. Targeted Activation of Conventional and Novel Protein Kinases C through Differential Translocation Patterns

    PubMed Central

    Hui, Xin; Reither, Gregor; Kaestner, Lars

    2014-01-01

    Activation of the two ubiquitous families of protein kinases, protein kinase A (PKA) and protein kinase C (PKC), is thought to be independently coupled to stimulation of G?s and G?q, respectively. Live-cell confocal imaging of protein kinase C fluorescent protein fusion constructs revealed that simultaneous activation of G?s and G?q resulted in a differential translocation of the conventional PKC? to the plasma membrane while the novel PKC? was recruited to the membrane of the endoplasmic reticulum (ER). We demonstrate that the PKC? translocation was driven by a novel G?s-cyclic AMP-EPAC-RAP-PLC? pathway resulting in specific diacylglycerol production at the membrane of the ER. Membrane-specific phosphorylation sensors revealed that directed translocation resulted in phosphorylation activity confined to the target membrane. Specific stimulation of PKC? caused phosphorylation of the inositol-1,4,5-trisphosphate receptor and dampening of global Ca2+ signaling revealed by graded flash photolysis of caged inositol-1,4,5-trisphosphate. Our data demonstrate a novel signaling pathway enabling differential decoding of incoming stimuli into PKC isoform-specific membrane targeting, significantly enhancing the versatility of cyclic AMP signaling, thus demonstrating the possible interconnection between the PKA and PKC pathways traditionally treated independently. We thus provide novel and elementary understanding and insights into intracellular signaling events. PMID:24732802

  17. Cyclic nucleotides and mitogen-activated protein kinases: regulation of simvastatin in platelet activation

    PubMed Central

    2010-01-01

    Background 3-Hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) have been widely used to reduce cardiovascular risk. These statins (i.e., simvastatin) may exert other effects besides from their cholesterol-lowering actions, including inhibition of platelet activation. Platelet activation is relevant to a variety of coronary heart diseases. Although the inhibitory effect of simvastatin in platelet activation has been studied; the detailed signal transductions by which simvastatin inhibit platelet activation has not yet been completely resolved. Methods The aim of this study was to systematically examine the detailed mechanisms of simvastatin in preventing platelet activation. Platelet aggregation, flow cytometric analysis, immunoblotting, and electron spin resonance studies were used to assess the antiplatelet activity of simvastatin. Results Simvastatin (20-50 ?M) exhibited more-potent activity of inhibiting platelet aggregation stimulated by collagen than other agonists (i.e., thrombin). Simvastatin inhibited collagen-stimulated platelet activation accompanied by [Ca2+]i mobilization, thromboxane A2 (TxA2) formation, and phospholipase C (PLC)?2, protein kinase C (PKC), and mitogen-activated protein kinases (i.e., p38 MAPK, JNKs) phosphorylation in washed platelets. Simvastatin obviously increased both cyclic AMP and cyclic GMP levels. Simvastatin markedly increased NO release, vasodilator-stimulated phosphoprotein (VASP) phosphorylation, and endothelial nitric oxide synthase (eNOS) expression. SQ22536, an inhibitor of adenylate cyclase, markedly reversed the simvastatin-mediated inhibitory effects on platelet aggregation, PLC?2 and p38 MAPK phosphorylation, and simvastatin-mediated stimulatory effects on VASP and eNOS phosphorylation. Conclusion The most important findings of this study demonstrate for the first time that inhibitory effect of simvastatin in platelet activation may involve activation of the cyclic AMP-eNOS/NO-cyclic GMP pathway, resulting in inhibition of the PLC?2-PKC-p38 MAPK-TxA2 cascade, and finally inhibition of platelet aggregation. PMID:20525309

  18. Macroscopic response in active nonlinear photonic crystals.

    PubMed

    Alagappan, Gandhi; John, Sajeev; Li, Er Ping

    2013-09-15

    We derive macroscopic equations of motion for the slowly varying electric field amplitude in three-dimensional active nonlinear optical nanostructures. We show that the microscopic Maxwell equations and polarization dynamics can be simplified to a macroscopic one-dimensional problem in the direction of group velocity. For a three-level active material, we derive the steady-state equations for normal mode frequency, threshold pumping, nonlinear Bloch mode amplitude, and lasing in photonic crystals. Our analytical results accurately recapture the results of exact numerical methods. PMID:24104802

  19. Rotor Flapping Response to Active Control

    NASA Technical Reports Server (NTRS)

    Nguyen, Khanh; Johnson, Wayne

    2004-01-01

    Rotor active control using higher harmonic blade pitch has been proposed as a means to reduce both rotor radiated noise and airframe vibration and to enhance rotor performance. The higher harmonic input, however, can affect rotor thrust and cyclic flapping - the basic trim characteristics of the rotor. Some of the trim changes can negate the active control benefits. For example, wind tunnel test results of a full scale BO-105 rotor with individual-blade control indicate some rotor performance improvements, accompanied with changes in rotor trim, using two-per-rev blade pitch input. The observed performance benefits could therefore be a simple manifestation of the trim change rather than an efficient redistribution of the rotor airloads. More recently, the flight test of the BO-105 helicopter equip,ped with individual-blade-control actuators also reported trim changes whenever the two-per-rev blade pitch for noise reduction was activated. The pilot had to adjust the trim control to maintain the aircraft under a constant flight path. These two cases highlight the, importance of trim considerations in the application of active control to rotorcraft.

  20. George Arcement Explains USGS Flood Response Activities

    USGS Multimedia Gallery

    USGS Louisiana Water Science Center Director George Arcement explains USGS' activities during the 2011 to WAFB Meteorologist Jay Grymes. USGS has crews measuring streamflow, sediment and water quality throughout South Louisiana, including daily measurements at the Morganza and Bonnet Carre Spillways...

  1. Contractile responses to selective phosphodiesterase inhibitors following chronic ?-adrenoreceptor activation

    Microsoft Academic Search

    Oleg E. Osadchii; Angela J. Woodiwiss; Gavin R. Norton

    2006-01-01

    Contractile responses to phosphodiesterase (PDE) inhibitors are attenuated in heart failure, an effect limiting the clinical value of these agents. In this study, we sought to determine whether abnormalities in the ?-adrenoreceptor (?-AR)–cyclic adenosine monophosphate (cAMP) signal transduction are sufficient to account for downregulation of PDE inhibitor-induced inotropic responses following chronic sympathetic activation. Sustained ?-AR activation produced by administration of

  2. Emergency response of Mumbai terror attacks: An activity theory analysis

    Microsoft Academic Search

    Divya Shankar; Manish Agrawal; H. R. Rao

    The Mumbai terror attacks of November 2008 resulted in the death of over 172 people and lasted for over 60 hours. The attack revealed several shortcomings of the emergency response preparedness in Mumbai. This paper concentrates on the emergency response provided and uses activity theory to analyze it. We explore the diverse dimensions of emergency, determine the lessons learned from

  3. SHORT REPORT Open Access Immunological response to highly active

    E-print Network

    Paris-Sud XI, Université de

    SHORT REPORT Open Access Immunological response to highly active antiretroviral therapy following-month immunological response to HAART in HIV-1 infected women in Côte d'Ivoire. The women were the immunological failure criteria at least once during follow up. The overall probability of immunological failure

  4. Analysis of Thyroid Response Element Activity during Retinal Development

    E-print Network

    Tabin, Cliff

    Medical School, Boston, Massachusetts, United States of America Abstract Thyroid hormone (TH) signalingAnalysis of Thyroid Response Element Activity during Retinal Development Nathan A. Billings1 , Mark the competence of retinal cells to mount a transcriptional response to TH, reporters that included thyroid

  5. SILENT STORM Distributed Active Response System for Cyber Defense

    E-print Network

    intrusion detection incidents to enable faster-than-human response to network attacks; and hasSILENT STORM ­ Distributed Active Response System for Cyber Defense Traditional intrusion detection traffic or host behavior and generate alerts to a centralized user. Our approach to intrusion detection

  6. An extract of Withania somnifera attenuates endothelin-1-stimulated pigmentation in human epidermal equivalents through the interruption of PKC activity within melanocytes.

    PubMed

    Nakajima, Hiroaki; Wakabayashi, Yuki; Wakamatsu, Kazumasa; Imokawa, Genji

    2011-09-01

    Redox imbalances have been shown to be closely linked to a variety of altered cellular responses and profoundly affect intracellular signaling pathways, especially the PKC/MAPK pathway which is a major pathway involved in regulating melanogenesis within human melanocytes. To elucidate the effects of redox balance regulation on epidermal hyperpigmentary disorders, an antioxidant-rich herb extract of Withania somnifera was used to assess its effect on endothelin-1 (EDN1)-stimulated pigmentation in human epidermis equivalents and its biological mechanisms analysed. Addition of the Withania somnifera extract (10?µg/mL) elicited a marked depigmenting effect on EDN1 (10?nm)-stimulated pigmentation which was accompanied by a significant decrease in eumelanin content. Real-time RT-PCR and western blotting revealed that the stimulated expression of melanocyte-specific mRNAs and proteins, including microphthalmia associated transcription factor (MITF), was significantly suppressed at days 7-10 of culture by the Withania somnifera extract (10?µg/mL), suggesting an impairment in intracellular signaling upstream of gene expression. Signaling analysis revealed that in Withania somnifera extract (10?µg/mL)-treated human melanoma cells in culture, there was a marked deficiency in EDN1 (10?nm)-stimulated phosphorylation of Raf-1, MEK, ERK, MITF and Cyclic AMP responsive element binding protein (CREB) at 15?min after EDN1 treatment. Consistently, treatment with withaferin A, a major component of the Withania somnifera extract, at concentrations of 10-50?µm also significantly down-regulated the EDN1 stimulated phosphorylation of Raf-1, MEK, ERK, MITF and CREB at 15?min after EDN1 treatment. Since Raf-1 is phosphorylated by protein kinase C (PKC) activity, these findings indicate that the Withania somnifera extract attenuates EDN1-stimulated pigmentation by preferentially inhibiting EDN1-triggered PKC activity. PMID:21678520

  7. Activation of the renin-angiotensin system, specifically in the subfornical organ is sufficient to induce fluid intake.

    PubMed

    Coble, Jeffrey P; Cassell, Martin D; Davis, Deborah R; Grobe, Justin L; Sigmund, Curt D

    2014-08-15

    Increased activity of the renin-angiotensin system within the brain elevates fluid intake, blood pressure, and resting metabolic rate. Renin and angiotensinogen are coexpressed within the same cells of the subfornical organ, and the production and action of ANG II through the ANG II type 1 receptor in the subfornical organ (SFO) are necessary for fluid intake due to increased activity of the brain renin-angiotensin system. We generated an inducible model of ANG II production by breeding transgenic mice expressing human renin in neurons controlled by the synapsin promoter with transgenic mice containing a Cre-recombinase-inducible human angiotensinogen construct. Adenoviral delivery of Cre-recombinase causes SFO-selective induction of human angiotensinogen expression. Selective production of ANG II in the SFO results in increased water intake but did not change blood pressure or resting metabolic rate. The increase in water intake was ANG II type 1 receptor-dependent. When given a choice between water and 0.15 M NaCl, these mice increased total fluid and sodium, but not water, because of an increased preference for NaCl. When provided a choice between water and 0.3 M NaCl, the mice exhibited increased fluid, water, and sodium intake, but no change in preference for NaCl. The increase in fluid intake was blocked by an inhibitor of PKC, but not ERK, and was correlated with increased phosphorylated cyclic AMP response element binding protein in the subfornical organ. Thus, increased production and action of ANG II specifically in the subfornical organ are sufficient on their own to mediate an increase in drinking through PKC. PMID:24965793

  8. Ginger improves cognitive function via NGF-induced ERK/CREB activation in the hippocampus of the mouse.

    PubMed

    Lim, Soonmin; Moon, Minho; Oh, Hyein; Kim, Hyo Geun; Kim, Sun Yeou; Oh, Myung Sook

    2014-10-01

    Ginger (the rhizome of Zingiber officinale Roscoe) has been used worldwide for many centuries in cooking and for treatment of several diseases. The main pharmacological properties of ginger include anti-inflammatory, antihyperglycemic, antiarthritic, antiemetic and neuroprotective actions. Recent studies demonstrated that ginger significantly enhances cognitive function in various cognitive disorders as well as in healthy brain. However, the biochemical mechanisms underlying the ginger-mediated enhancement of cognition have not yet been studied in normal or diseased brain. In the present study, we assessed the memory-enhancing effects of dried ginger extract (GE) in a model of scopolamine-induced memory deficits and in normal animals by performing a novel object recognition test. We found that GE administration significantly improved the ability of mice to recognize novel objects, indicating improvements in learning and memory. Furthermore, to elucidate the mechanisms of GE-mediated cognitive enhancement, we focused on nerve growth factor (NGF)-induced signaling pathways. NGF enzyme-linked immunosorbent assay analysis revealed that GE administration led to elevated NGF levels in both the mouse hippocampus and rat glioma C6 cells. GE administration also resulted in phosphorylation of extracellular-signal-regulated kinase (ERK) and cyclic AMP response element-binding protein (CREB), as revealed by Western blotting analysis. Neutralization of NGF with a specific NGF antibody inhibited GE-triggered activation of ERK and CREB in the hippocampus. Also, GE treatment significantly increased pre- and postsynaptic markers, synaptophysin and PSD-95, which are related to synapse formation in the brain. These data suggest that GE has a synaptogenic effect via NGF-induced ERK/CREB activation, resulting in memory enhancement. PMID:25049196

  9. Effect of foreknowledge on neural activity of primary “go” responses relates to response stopping and switching

    PubMed Central

    Xu, Benjamin; Levy, Sarah; Butman, John; Pham, Dzung; Cohen, Leonardo G.; Sandrini, Marco

    2015-01-01

    Being able to stop (or inhibit) an action rapidly as in a stop-signal task (SST) is an essential human ability. Previous studies showed that when a pre-stimulus cue warned of the possible need to stop a response in an upcoming trial, participants’ response time (RT) increased if the subsequent trial required a “go” response (i.e., “go” RT cost) relative to a trial where this uncertainty was not present. This increase of the “go” RT correlated with more efficient response stopping. However, it remains a question whether foreknowledge of upcoming inhibition trials given prior to the task is sufficient to modulate neural activity associated with the primary “go” responses irrespective of whether stopping an overt response is required. We presented three task conditions with identical primary (i.e., “go”) response trials but without pre-stimulus cues. Participants were informed that Condition 1 had only “go” trials (All-go condition), Condition 2 required a “stop” response for some trials (Stop condition), and Condition 3 required a response incongruent with the primary response (i.e., Switch response) for some trials (Switch condition). Participants performed the tasks during functional magnetic resonance imaging (fMRI) scans. Results showed a significant increase in the “go” RT (cost) in the Stop and Switch conditions relative to the All-go condition. The “go” RT cost was correlated with decreased inhibition time. fMRI activation in the frontal-basal-ganglia regions during the “go” responses in the Stop and Switch conditions was also correlated with the efficiency of Stop and Switch responses. These results suggest that foreknowledge prior to the task is sufficient to influence neural activity associated with the primary response and modulate inhibition efficiency, irrespective of whether stopping an overt response is required. PMID:25698959

  10. ON THE ACTIVE RESPONSE OF SOFT LIVING TISSUES P. Nardinocchi

    E-print Network

    the contraction of muscle fibres is well understood. The excitation-contraction coupling (ECC) in cardiac muscular of activation of a cardiac muscle cell) and on the time­varying muscle fibre extension ratio. In [9 incompressible (visco-) elastic response; a key issue is the active nature of muscle fibres, in other words

  11. P-glycoprotein activity and biological response

    SciTech Connect

    Vaalburg, W. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands)]. E-mail: w.vaalburg@pet.umcg.nl; Hendrikse, N.H. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Elsinga, P.H. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Bart, J. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Waarde, A. van [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands)

    2005-09-01

    P-glycoprotein (P-gp) is a transmembrane drug efflux pump encoded by the MDR-1 gene in humans. Most likely P-gp protects organs against endogenous and exogenous toxins by extruding toxic compounds such as chemotherapeutics and other drugs. Many drugs are substrates for P-gp. Since P-gp is also expressed in the blood-brain barrier, P-gp substrates reach lower concentrations in the brain than in P-gp-negative tissues. Failure of response to chemotherapy of malignancies can be due to intrinsic or acquired drug resistance. Many tumors are multidrug resistant (MDR); resistant to several structurally unrelated chemotherapeutic agents. Several mechanisms are involved in MDR of which P-gp is studied most extensively. P-gp extrudes drugs out of tumor cells resulting in decreased intracellular drug concentrations, leading to the MDR phenotype. Furthermore, the MDR-1 gene exhibits several single nucleotide polymorphisms, some of which result in different transport capabilities. P-gp functionality and the effect of P-gp modulation on the pharmacokinetics of novel and established drugs can be studied in vivo by positron emission tomography (PET) using carbon-11 and fluorine-18-labeled P-gp substrates and modulators. PET may demonstrate the consequences of genetic differences on tissue pharmacokinetics. Inhibitors such as calcium-channel blockers (verapamil), cyclosporin A, ONT-093, and XR9576 can modulate the P-gp functionality. With PET the effect of P-gp modulation on the bioavailability of drugs can be investigated in humans in vivo. PET also allows the measurement of the efficacy of newly developed P-gp modulators.

  12. Differences in wearer response to garments for outdoor activity

    Microsoft Academic Search

    R. M. Laing; S. T. Sims; C. A. Wilson; B. E. Niven; N. M. Cruthers

    2008-01-01

    The performance of garments for outdoor activity was compared. Three fabrics, each in garments for the upper body, matched garment\\/wearer dimensions, were worn by 10 athletically ‘well-trained’ males under controlled conditions (hot 32 ± 2°C, 20 ± 2% relative humidity (RH); cold 8 ± 2°C, 40 ± 2% RH) with physical (instrumental) and sensory responses obtained during the trials. Differences in human responses to the fabrics\\/garments included heart

  13. Patterning of sympathetic nerve activity in response to vestibular stimulation

    NASA Technical Reports Server (NTRS)

    Kerman, I. A.; McAllen, R. M.; Yates, B. J.

    2000-01-01

    Growing evidence suggests a role for the vestibular system in regulation of autonomic outflow during postural adjustments. In the present paper we review evidence for the patterning of sympathetic nerve activity elicited by vestibular stimulation. In response to electrical activation of vestibular afferents, firing of sympathetic nerves located throughout the body is altered. However, activity of the renal nerve is most sensitive to vestibular inputs. In contrast, high-intensity simultaneous activation of cutaneous and muscle inputs elicits equivalent changes in firing of the renal, superior mesenteric and lumbar colonic nerves. Responses of muscle vasoconstrictor (MVC) efferents to vestibular stimulation are either inhibitory (Type I) or are comprised of a combination of excitation and inhibition (Type II). Interestingly, single MVC units located in the hindlimb exhibited predominantly Type I responses while those located in the forelimb and face exhibited Type II responses. Furthermore, brachial and femoral arterial blood flows were dissociated in response to vestibular stimulation, such that brachial vascular resistance increased while femoral resistance decreased. These studies demonstrate that vestibulosympathetic reflexes are patterned according to both the anatomical location and innervation target of a particular sympathetic nerve, and can lead to distinct changes in local blood flow.

  14. Dynamics of lung macrophage activation in response to helminth infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most of our understanding of the development and phenotype of alternatively activated macrophages (AAM) has been obtained from studies investigating the response of bone marrow- and peritoneal-derived cells to IL-4 or IL-13 stimulation. Comparatively little is known about the development of the AAM...

  15. Rights, Responsibility, and Relationship: Motivations for Women's Social Activism

    Microsoft Academic Search

    Catherine A. Faver

    2001-01-01

    A narrative analysis of interviews with 50 women who were working for social change as professionals or volunteers revealed three motivations for activism: (a) to ensure rights, (b) to fulfill responsibilities, and (c) to restore relationships and build community. The three motivations reflect amodified ethic of care, which includes concern for distant and unfamiliar others. The women's spirituality supports the

  16. ORIGINAL PAPER Activity of protein kinase A and gustatory responsiveness

    E-print Network

    Menzel, Randolf - Institut für Biologie

    - vator adenosine 3'5'-cyclic monophosphate 8-bromo- sodium salt or of the protein kinase A inhibitor KT PER Ã? Protein kinase A Abbreviations 8-Br-cAMP adenosine 3'5'-cyclic monophosphate 8-bromo-sodium saltORIGINAL PAPER Activity of protein kinase A and gustatory responsiveness in the honey bee (Apis

  17. Recognition of microorganisms and activation of the immune response

    Microsoft Academic Search

    Ruslan Medzhitov

    2007-01-01

    The mammalian immune system has innate and adaptive components, which cooperate to protect the host against microbial infections. The innate immune system consists of functionally distinct 'modules' that evolved to provide different forms of protection against pathogens. It senses pathogens through pattern-recognition receptors, which trigger the activation of antimicrobial defences and stimulate the adaptive immune response. The adaptive immune system,

  18. Activation of DNA damage response signaling by condensed chromatin.

    PubMed

    Burgess, Rebecca C; Burman, Bharat; Kruhlak, Michael J; Misteli, Tom

    2014-12-11

    The DNA damage response (DDR) occurs in the context of chromatin, and architectural features of chromatin have been implicated in DNA damage signaling and repair. Whereas a role of chromatin decondensation in the DDR is well established, we show here that chromatin condensation is integral to DDR signaling. We find that, in response to DNA damage chromatin regions transiently expand before undergoing extensive compaction. Using a protein-chromatin-tethering system to create defined chromatin domains, we show that interference with chromatin condensation results in failure to fully activate DDR. Conversely, forced induction of local chromatin condensation promotes ataxia telangiectasia mutated (ATM)- and ATR-dependent activation of upstream DDR signaling in a break-independent manner. Whereas persistent chromatin compaction enhanced upstream DDR signaling from irradiation-induced breaks, it reduced recovery and survival after damage. Our results demonstrate that chromatin condensation is sufficient for activation of DDR signaling and is an integral part of physiological DDR signaling. PMID:25464843

  19. Delphinid behavioral responses to incidental mid-frequency active sonar.

    PubMed

    Henderson, E Elizabeth; Smith, Michael H; Gassmann, Martin; Wiggins, Sean M; Douglas, Annie B; Hildebrand, John A

    2014-10-01

    Opportunistic observations of behavioral responses by delphinids to incidental mid-frequency active (MFA) sonar were recorded in the Southern California Bight from 2004 through 2008 using visual focal follows, static hydrophones, and autonomous recorders. Sound pressure levels were calculated between 2 and 8?kHz. Surface behavioral responses were observed in 26 groups from at least three species of 46 groups out of five species encountered during MFA sonar incidents. Responses included changes in behavioral state or direction of travel, changes in vocalization rates and call intensity, or a lack of vocalizations while MFA sonar occurred. However, 46% of focal groups not exposed to sonar also changed their behavior, and 43% of focal groups exposed to sonar did not change their behavior. Mean peak sound pressure levels when a behavioral response occurred were around 122?dB re: 1??Pa. Acoustic localizations of dolphin groups exhibiting a response gave insight into nighttime movement patterns and provided evidence that impacts of sonar may be mediated by behavioral state. The lack of response in some cases may indicate a tolerance of or habituation to MFA sonar by local populations; however, the responses that occur at lower received levels may point to some sensitization as well. PMID:25324099

  20. Nonconscious activation of placebo and nocebo pain responses.

    PubMed

    Jensen, Karin B; Kaptchuk, Ted J; Kirsch, Irving; Raicek, Jacqueline; Lindstrom, Kara M; Berna, Chantal; Gollub, Randy L; Ingvar, Martin; Kong, Jian

    2012-09-25

    The dominant theories of human placebo effects rely on a notion that consciously perceptible cues, such as verbal information or distinct stimuli in classical conditioning, provide signals that activate placebo effects. However, growing evidence suggest that behavior can be triggered by stimuli presented outside of conscious awareness. Here, we performed two experiments in which the responses to thermal pain stimuli were assessed. The first experiment assessed whether a conditioning paradigm, using clearly visible cues for high and low pain, could induce placebo and nocebo responses. The second experiment, in a separate group of subjects, assessed whether conditioned placebo and nocebo responses could be triggered in response to nonconscious (masked) exposures to the same cues. A total of 40 healthy volunteers (24 female, mean age 23 y) were investigated in a laboratory setting. Participants rated each pain stimulus on a numeric response scale, ranging from 0 = no pain to 100 = worst imaginable pain. Significant placebo and nocebo effects were found in both experiment 1 (using clearly visible stimuli) and experiment 2 (using nonconscious stimuli), indicating that the mechanisms responsible for placebo and nocebo effects can operate without conscious awareness of the triggering cues. This is a unique experimental verification of the influence of nonconscious conditioned stimuli on placebo/nocebo effects and the results challenge the exclusive role of awareness and conscious cognitions in placebo responses. PMID:23019380

  1. Characterizing wind turbine system response to lightning activity

    SciTech Connect

    McNiff, B.; LaWhite, N. [McNiff Light Industry, Harborside, ME (United States); Muljadi, E. [National Renewable Energy Lab., Golden, CO (United States)

    1998-07-01

    A lightning protection research program was instituted by National Renewable Energy Laboratory to minimize lightning damage to wind turbines and to further the understanding of effective damage mitigation techniques. To that end, a test program is under way to observe lightning activity, protection system response, and damage at a wind power plant in the Department of Energy (DOE) and Electric Power Research Institute (EPRI) Turbine Verification Program. The authors installed Lightning activated surveillance cameras along with a special storm tracking device to observe the activity in the wind plant area. They instrumented the turbines with lightning and ground current detection devices to log direct and indirect strike activity at each unit. They installed a surge monitor on the utility interface to track incoming activity from the transmission lines. Maintenance logs are used to verify damage and determine downtime and repair costs. Actual strikes to turbines were recorded on video and ancillary devices. The test setup and some results are discussed in this paper.

  2. Activation of the Acquired Immune Response Reduces Coupled Bone Formation in Response to a Periodontal Pathogen

    PubMed Central

    Behl, Yugal; Siquiera, Michelle; Ortiz, Javier; Desta, Tesfahun; Faibish, Dan; Graves, Dana T.

    2009-01-01

    Osteoimmunology involves the interaction of the immune system with skeletal elements. This interaction can lead to the formation of osseous lesions. To investigate how the acquired immune response could contribute to osteolytic lesions we injected the periodontal pathogen Porphyromonas gingivalis adjacent to calvarial bone with or without prior immunization against the bacterium. Activation of the acquired immune response increased osteoclastogenesis and decreased coupled bone formation. The latter was accompanied by an increase in nuclear translocation of the transcription factor FOXO1 in vivo, increased apoptosis of bone-lining cells and a decrease in bone lining cell density. Further studies were carried out with MC3T3 osteoblastic cells. Apoptosis and increased FOXO1 DNA binding activity were induced when a combination of cytokines was tested, IL-?, TNF-?, and IFN-?. Knockdown of FOXO1 by siRNA significantly reduced cytokine stimulated apoptosis, cleaved caspase-3/7 activity and decreased mRNA levels of the proapoptotic genes, TNF-?, FADD, caspase-3, -8 and -9. These results indicate that activation of the acquired immunity by a periodontal pathogen reduces the coupling of bone formation and resorption. This may occur by enhancing bone lining cell apoptosis through a mechanism that involves increased FOXO1 activation. These studies give insight into inflammatory bone diseases such as periodontal disease and arthritis were the formation of lytic lesions occurs in conjunction with deficient bone formation and activation of an acquired immune response. PMID:19050291

  3. Amarogentin, a Secoiridoid Glycoside, Abrogates Platelet Activation through PLC?2-PKC and MAPK Pathways

    PubMed Central

    Yen, Ting-Lin; Lu, Wan-Jung; Lien, Li-Ming; Thomas, Philip Aloysius; Lee, Tzu-Yin; Chiu, Hou-Chang; Sheu, Joen-Rong

    2014-01-01

    Amarogentin, an active principle of Gentiana lutea, possess antitumorigenic, antidiabetic, and antioxidative properties. Activation of platelets is associated with intravascular thrombosis and cardiovascular diseases. The present study examined the effects of amarogentin on platelet activation. Amarogentin treatment (15~60??M) inhibited platelet aggregation induced by collagen, but not thrombin, arachidonic acid, and U46619. Amarogentin inhibited collagen-induced phosphorylation of phospholipase C (PLC)?2, protein kinase C (PKC), and mitogen-activated protein kinases (MAPKs). It also inhibits in vivo thrombus formation in mice. In addition, neither the guanylate cyclase inhibitor ODQ nor the adenylate cyclase inhibitor SQ22536 affected the amarogentin-mediated inhibition of platelet aggregation, which suggests that amarogentin does not regulate the levels of cyclic AMP and cyclic GMP. In conclusion, amarogentin prevents platelet activation through the inhibition of PLC?2-PKC cascade and MAPK pathway. Our findings suggest that amarogentin may offer therapeutic potential for preventing or treating thromboembolic disorders. PMID:24868545

  4. T-Cell Activation and Early Gene Response in Dogs

    PubMed Central

    Mortlock, Sally-Anne; Wei, Jerry; Williamson, Peter

    2015-01-01

    T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR), and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA) (5?g/ml), including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2), early growth response 1 (EGR1), growth arrest and DNA damage-inducible gene (GADD45B), phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1), V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS), early growth response 2 (EGR2), hemogen (HEMGN), polo-like kinase 2 (PLK2) and polo-like kinase 3 (PLK3). Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in cell cycle regulation. This study provides a comprehensive analysis of the early T-cell gene response to activation in dogs. PMID:25803042

  5. Phorbol esters alter adenylate cyclase responses to vasoactive intestinal peptide and forskolin in the GH cell line

    SciTech Connect

    Summers, S.; Florio, T.; Cronin, M.

    1986-05-01

    Activation of protein kinase C with phorbol ester modifies cyclic AMP production in several anterior pituitary cell systems. In the GH cell line from a rat pituitary tumor, exposure to phorbol 12-myristate 13-acetate (PMA: 100 nM) for 30 minutes significantly reduces vasoactive intestinal peptide (VIP: 100 nM) stimulated adenylate cyclase (AC) activity in subsequent membrane preparations to 62 + 4% of control (n = 6 independent studies). In contrast, these same membrane preparations respond to forskolin (1 ..mu..M) with significantly more activity, 130 +/- 6% of controls (n = 6 independent studies). Finally, phorbol ester does not block an inhibitory hormone input into the AC system; somatostatin (100 nM) reduction of VIP-stimulated AC activity is not significantly different in membrane preparations from PMA treated and control cells (n = 3 independent studies). These other findings lead the authors to propose that protein kinase C can modify several sites in the AC complex in anterior pituitary cells.

  6. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding

    E-print Network

    Breedlove, Marc

    Testosterone activates mitogen-activated protein kinase and the cAMP response element binding for review January 23, 2004) The androgen testosterone is essential for the Sertoli cell to support- latory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can

  7. Discordant biological and toxicological species responses to TLR3 activation.

    PubMed

    Mitchell, William M; Nicodemus, Christopher F; Carter, William A; Horvath, Joseph C; Strayer, David R

    2014-04-01

    Toll-like receptors (TLRs) are highly conserved type 1 membrane proteins that initiate a multiplicity of transient gene transcriptions, resulting in innate and adaptive immune responses. These essential immune responses are triggered by common TLR pattern recognition receptors of microbial products expressed through the cytoplasmic carboxy-terminal Toll/IL-1 domain. Toll/IL-1 adapter protein cascades are induced by an activated Toll/IL-1 to induce transient transcription responses. All TLRs, with the exception of TLR3, use an MyD88 adapter to Toll/IL-1 to initiate a proinflammatory cascade. TLR3 uses the toll receptor 3/4 induction factor adapter to initiate a different cytosolic adapter cascade with double-stranded RNA agonists. This non-MyD88 pathway induces both NF-?B and type 1 interferon responses. By using a TLR3-restricted double-stranded RNA agonist, rintatolimod, we demonstrate significant unexpected differences in toxic responses between rats and primates. The mechanism of this differential response is consistent with a relative down-regulation of the NF-?B inflammatory cytokine induction pathway in the cynomolgus monkey and humans, but not observed systemically in rat. Our findings suggest evaluation of TLR3 agonists in drug therapy. PMID:24486326

  8. Response Activation in Overlapping Tasks and the Response-Selection Bottleneck

    ERIC Educational Resources Information Center

    Schubert, Torsten; Fischer, Rico; Stelzel, Christine

    2008-01-01

    The authors investigated the impact of response activation on dual-task performance by presenting a subliminal prime before the stimulus in Task 2 (S2) of a psychological refractory period (PRP) task. Congruence between prime and S2 modulated the reaction times in Task 2 at short stimulus onset asynchrony despite a PRP effect. This Task 2…

  9. Adrenalectomy mediated alterations in adrenergic activation of adenylate cyclase in rat liver

    SciTech Connect

    El-Refai, M.; Chan, T.

    1986-05-01

    Adrenalectomy caused a large increase in the number of ..beta..-adrenergic binding sites on liver plasma membranes as measured by /sup 125/I-iodocyanopindolol (22 and 102 fmol/mg protein for control and adrenalectomized (ADX) rats). Concomitantly an increase in the number of binding sites for /sup 3/H-yohimbine was also observed (104 and 175 fmol/mg protein for control and adx membranes). Epinephrine-stimulated increase in cyclic AMP accumulation in isolated hepatocytes were greater in cells from ADX rats. This increase in ..beta..-adrenergic mediated action was much less than what may be expected as a result of the increase in the ..beta..-adrenergic binding in ADX membranes. In addition phenoxybenzamine (10 ..mu..M) further augmented this action of epinephrine in both control and ADX cells. To test the hypothesis that the increase in the number of the inhibitory ..cap alpha../sub 2/-adrenergic receptors in adrenalectomy is responsible for the muted ..beta..-adrenergic response, the authors injected rats with pertussis toxin (PT). This treatment may cause the in vivo ribosylation of the inhibitory binding protein (Ni). Adenylate cyclase (AC) activity in liver plasma membranes prepared from treated and untreated animals was measured. In contrast with control rats, treatment of ADX rats with PT resulted in a significant increase in the basal activity of AC (5.5 and 7.7 pmol/mg protein/min for untreated and treated rats respectively). Isoproterenol (10 ..mu..M), caused AC activity to increase to 6.5 and 8.4 pmol/mg protein/min for membranes obtained from ADX untreated and ADX treated rats respectively. The ..cap alpha..-adrenergic antagonists had no significant effect on the ..beta..-adrenergic-mediated activation of AC in liver plasma membranes from PT treated control and ADX rats. The authors conclude that the ..beta..-adrenergic activation of AC is attenuated by Ni protein both directly and as a result of activation of ..cap alpha..-adrenergic receptors.

  10. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

    2010-02-01

    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  11. Sulforaphane Activates Heat Shock Response and Enhances Proteasome Activity through Up-regulation of Hsp27*

    PubMed Central

    Gan, Nanqin; Wu, Yu-Chieh; Brunet, Mathilde; Garrido, Carmen; Chung, Fung-Lung; Dai, Chengkai; Mi, Lixin

    2010-01-01

    It is conceivable that stimulating proteasome activity for rapid removal of misfolded and oxidized proteins is a promising strategy to prevent and alleviate aging-related diseases. Sulforaphane (SFN), an effective cancer preventive agent derived from cruciferous vegetables, has been shown to enhance proteasome activities in mammalian cells and to reduce the level of oxidized proteins and amyloid ?-induced cytotoxicity. Here, we report that SFN activates heat shock transcription factor 1-mediated heat shock response. Specifically, SFN-induced expression of heat shock protein 27 (Hsp27) underlies SFN-stimulated proteasome activity. SFN-induced proteasome activity was significantly enhanced in Hsp27-overexpressing cells but absent in Hsp27-silenced cells. The role of Hsp27 in regulating proteasome activity was further confirmed in isogenic REG cells, in which SFN-induced proteasome activation was only observed in cells stably overexpressing Hsp27, but not in the Hsp27-free parental cells. Finally, we demonstrated that phosphorylation of Hsp27 is irrelevant to SFN-induced proteasome activation. This study provides a novel mechanism underlying SFN-induced proteasome activity. This is the first report to show that heat shock response by SFN, in addition to the antioxidant response mediated by the Keap1-Nrf2 pathway, may contribute to cytoprotection. PMID:20833711

  12. Cryopyrin activates the inflammasome in response to toxins and ATP

    Microsoft Academic Search

    Sanjeev Mariathasan; David S. Weiss; Kim Newton; Jacqueline McBride; Karen O'Rourke; Meron Roose-Girma; Wyne P. Lee; Yvette Weinrauch; Denise M. Monack; Vishva M. Dixit

    2006-01-01

    A crucial part of the innate immune response is the assembly of the inflammasome, a cytosolic complex of proteins that activates caspase-1 to process the proinflammatory cytokines interleukin (IL)-1beta and IL-18. The adaptor protein ASC is essential for inflammasome function, binding directly to caspase-1 (refs 3, 4), but the triggers of this interaction are less clear. ASC also interacts with

  13. Astragalus embranaceus extract activates immune response in macrophages via heparanase.

    PubMed

    Qin, Qiaojing; Niu, Jianying; Wang, Zhaoxia; Xu, Wangjie; Qiao, Zhongdong; Gu, Yong

    2012-01-01

    Astragalus membranaceus (AM), a traditional Chinese medicinal herb, has immunoregulatory properties in many diseases. We investigated the effects and mechanism of Astragalus membranaceus extract (AME) in the macrophage migration and immune response mediator release. The viability of Ana-1 macrophages treated with AME was evaluated by the MTT method. The secretion and mRNA levels of IL-1? and TNF-a were measured by ELISA and RT-PCR, respectively. Macrophage migration was assayed by transwell assay. The activity of heparanase (HPA) was determined by a heparin-degrading enzyme assay. Our results didn't show any toxicity of AME in macrophages. AME increased the activity of HPA, cell migration, mRNA levels and secretion of IL-1? and TNF-a in macrophages. Pretreatment with anti-HPA antibody reduced cell migration, secretion of IL-1? and TNF-a did not change the mRNA levels of IL-1? and TNF-a significantly in AME-treated macrophages. This suggests that AME may increase the release of immune response mediator and cell migration via HPA to activate immune response in macrophages. PMID:22695229

  14. Paramyxovirus Activation and Inhibition of Innate Immune Responses

    PubMed Central

    Parks, Griffith D.; Alexander-Miller, Martha A.

    2014-01-01

    Paramyxoviruses represent a remarkably diverse family of enveloped nonsegmented negative-strand RNA viruses, some of which are the most ubiquitous disease-causing viruses of humans and animals. This review focuses on paramyxovirus activation of innate immune pathways, the mechanisms by which these RNA viruses counteract these pathways, and the innate response to paramyxovirus infection of dendritic cells (DC). Paramyxoviruses are potent activators of extracellular complement pathways, a first line of defense that viruses must face during natural infections. We discuss mechanisms by which these viruses activate and combat complement to delay neutralization. Once cells are infected, virus replication drives type I interferon (IFN) synthesis that has the potential to induce a large number of antiviral genes. Here we describe four approaches by which paramyxoviruses limit IFN induction: by limiting synthesis of IFN-inducing aberrant viral RNAs, through targeted inhibition of RNA sensors, by providing viral decoy substrates for cellular kinase complexes, and through direct blocking of the IFN promoter. In addition, paramyxoviruses have evolved diverse mechanisms to disrupt IFN signaling pathways. We describe three general mechanisms, including targeted proteolysis of signaling factors, sequestering cellular factors, and upregulation of cellular inhibitors. DC are exceptional cells with the capacity to generate adaptive immunity through the coupling of innate immune signals and T cell activation. We discuss the importance of innate responses in DC following paramyxovirus infection and their consequences for the ability to mount and maintain antiviral T cells. PMID:24056173

  15. IL-12 as a therapeutic target for pharmacological modulation in immune-mediated and inflammatory diseases: regulation of T helper 1/T helper 2 responses

    PubMed Central

    Haskó, György; Szabó, Csaba

    1999-01-01

    Interleukin-12 (IL-12) is a pivotal cytokine in driving the immune system towards a T helper (Th)1 type response and preventing a Th2 type immune profile. Therefore, IL-12 is indispensable in the defense against certain, mainly intracellular pathogens, but overproduction of this cytokine is crucially involved in the etiology of several inflammatory and autoimmune diseases.Hence, IL-12 is an ideal target for pharmacological intervention in the therapy of autoimmune and inflammatory diseases.The production of IL-12 and a resultant Th1 type immune response can be suppressed with several pharmacological approaches including modulation of intracellular cyclic AMP levels, glucocorticoids and nuclear factor-?B inhibition. IL-12 responsiveness may be inhibited using anti-IL-12 antibodies, soluble IL-12 receptors or the IL-12 p40 homodimer.Exploitation of these approaches may provide novel means for the experimental therapy of a variety of pathophysiological states. PMID:10455278

  16. AMP-activated protein kinase, stress responses and cardiovascular diseases

    PubMed Central

    WANG, Shaobin; SONG, Ping; ZOU, Ming-Hui

    2012-01-01

    AMPK (AMP-activated protein kinase) is one of the key players in maintaining intracellular homoeostasis. AMPK is well known as an energy sensor and can be activated by increased intracellular AMP levels. Generally, the activation of AMPK turns on catabolic pathways that generate ATP, while inhibiting cell proliferation and biosynthetic processes that consume ATP. In recent years, intensive investigations on the regulation and the function of AMPK indicates that AMPK not only functions as an intracellular energy sensor and regulator, but is also a general stress sensor that is important in maintaining intracellular homoeostasis during many kinds of stress challenges. In the present paper, we will review recent literature showing that AMPK functions far beyond its proposed energy sensor and regulator function. AMPK regulates ROS (reactive oxygen species)/redox balance, autophagy, cell proliferation, cell apoptosis, cellular polarity, mitochondrial function and genotoxic response, either directly or indirectly via numerous downstream pathways under physiological and pathological conditions. PMID:22390198

  17. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.

    PubMed

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  18. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis

    PubMed Central

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  19. Optimization of an Active Twist Rotor Blade Planform for Improved Active Response and Forward Flight Performance

    NASA Technical Reports Server (NTRS)

    Sekula, Martin K; Wilbur, Matthew L.

    2014-01-01

    A study was conducted to identify the optimum blade tip planform for a model-scale active twist rotor. The analysis identified blade tip design traits which simultaneously reduce rotor power of an unactuated rotor while leveraging aeromechanical couplings to tailor the active response of the blade. Optimizing the blade tip planform for minimum rotor power in forward flight provided a 5 percent improvement in performance compared to a rectangular blade tip, but reduced the vibration control authority of active twist actuation by 75 percent. Optimizing for maximum blade twist response increased the vibration control authority by 50 percent compared to the rectangular blade tip, with little effect on performance. Combined response and power optimization resulted in a blade tip design which provided similar vibration control authority to the rectangular blade tip, but with a 3.4 percent improvement in rotor performance in forward flight.

  20. 14-Deoxyandrographolide alleviates ethanol-induced hepatosteatosis through stimulation of AMP-activated protein kinase activity in rats.

    PubMed

    Mandal, Samir; Mukhopadhyay, Sibabrata; Bandhopadhyay, Sukdeb; Sen, Gargi; Biswas, Tuli

    2014-03-01

    Andrographis paniculata (AP) is a traditional medicinal plant of Ayurveda. It grows widely in Asia and is prescribed in the treatment of liver diseases. Here we have investigated the beneficial role of 14-deoxyandrographolide (14-DAG), a bioactive diterpenoid from AP, against alcoholic steatosis in rats. 14-DAG was extracted from aerial parts (leaves and stems) of AP. Rats were fed with ethanol for 8 weeks. Animals were treated with 14-DAG during the last 4 weeks of ethanol treatment. In vitro studies were undertaken in a human hepatocellular liver carcinoma cell line culture. Hepatosteatosis was assessed from histopathological studies of liver sections. Acetyl-CoA, malonyl-CoA, and triglyceride contents were determined using commercially available kits. Fatty acid synthesis was evaluated from incorporation of 1-(14)C acetate. Regulation of fatty acid oxidation and lipogenesis were monitored with immunoblotting and immunoprecipitation studies. Ethanol exposure led to hepatotoxicity, as evident from the marked enhancement in the levels of AST and ALT. The values decreased almost to control levels in response to 14-DAG treatment. Results showed that ethanol feeding induced deactivation of AMP-activated protein kinase (AMPK) that led to enhanced lipid synthesis and decreased fatty acid oxidation, culminating in hepatic fat accumulation. Treatment with 14-DAG activated AMPK through induction of cyclic AMP-protein kinase A pathway. Activation of AMPK was followed by down-regulation of sterol regulatory element binding protein-1c, acetyl-CoA carboxylase, and fatty acid synthase, leading to suppression of lipogenesis. This was associated with up-regulation of sirtuin 1 and depletion of malonyl-CoA, in favor of increased fatty acid oxidation. 14-DAG controlled ethanol-induced hepatosteatosis by interfering with dysregulation of lipid metabolism. In conclusion, our results indicated that 14-DAG was capable of preventing the development of fatty liver through AMPK-mediated regulation of lipid metabolism. This finding supported the hepatoprotective role of 14-DAG, which might serve as a therapeutic option to alleviate hepatosteatosis in chronic alcoholism. PMID:24507479

  1. Analysis of Thyroid Response Element Activity during Retinal Development

    PubMed Central

    Billings, Nathan A.; Emerson, Mark M.; Cepko, Constance L.

    2010-01-01

    Thyroid hormone (TH) signaling components are expressed during retinal development in dynamic spatial and temporal patterns. To probe the competence of retinal cells to mount a transcriptional response to TH, reporters that included thyroid response elements (TREs) were introduced into developing retinal tissue. The TREs were placed upstream of a minimal TATA-box and two reporter genes, green fluorescent protein (GFP) and human placental alkaline phosphatase (PLAP). Six of the seven tested TREs were first tested in vitro where they were shown to drive TH-dependent expression. However, when introduced into the developing retina, the TREs reported in different cell types in both a TH-dependent and TH-independent manner, as well as revealed specific spatial patterns in their expression. The role of the known thyroid receptors (TR), TR? and TR?, was probed using shRNAs, which were co-electroporated into the retina with the TREs. Some TREs were positively activated by TR+TH in the developing outer nuclear layer (ONL), where photoreceptors reside, as well as in the outer neuroblastic layer (ONBL) where cycling progenitor cells are located. Other TREs were actively repressed by TR+TH in cells of the ONBL. These data demonstrate that non-TRs can activate some TREs in a spatially regulated manner, whereas other TREs respond only to the known TRs, which also read out activity in a spatially regulated manner. The transcriptional response to even simple TREs provides a starting point for understanding the regulation of genes by TH, and highlights the complexity of transcriptional regulation within developing tissue. PMID:21060789

  2. Peripheral nerve activity in response to heating the cat's skin

    PubMed Central

    Stolwijk, Jan A. J.; Wexler, Ira

    1971-01-01

    1. The sensitivity of the cat hind-limb skin to non-noxious heating was studied. Neural activity was recorded with micro-electrodes from intact multifibre fascicles of the saphenous nerve while the skin was actively heated or passively cooled. 2. Moderate warming from indifferent temperatures of 30-34° C to temperatures of 38-39° C produced a reduction in the total rate of firing of the integrated discharge. Firing picked up sharply again at skin temperatures above 39° C. A considerable fraction of the impulse activity elicited above 39° C was carried by C-fibre afferents. 3. Prolonged heating to temperatures in excess of 45° C rendered the skin insensitive to further non-noxious heating or to touch. 4. The neural response to a step increase in skin temperature consisted of a delayed overshoot and then a steady-state level of firing. Steady-state firing was proportional to the level of skin temperature. 5. Nerves whose C-fibre input to the spinal cord had been selectively blocked showed a potentiation of the neural response to skin heating. 6. The sensitivity of hind-limb skin to heating, as judged by the character of the multifibre discharge, appears similar to that reported for a highly warm-sensitive region of the nose. PMID:5580859

  3. The visual accommodation response during concurrent mental activity

    NASA Technical Reports Server (NTRS)

    Malmstrom, F. V.; Randle, R. J.; Bendix, J. S.; Weber, R. J.

    1980-01-01

    The direction and magnitude of the human visual accommodation response during concurrent mental activity are investigated. Subject focusing responses to targets at distances of 0.0 D, 3.0 D and an indeterminate distance were monitored by means of an optometer during the performance of a backwards counting task and a visual imagery task (thinking near and thinking far). In both experiments a shift in accommodation towards the visual far point is observed particularly for the near target, which increases with the duration of the task. The results can be interpreted in terms of both the capacity model of Kahneman (1973) and the autonomic arousal model of Hess and Polt (1964), and are not inconsistent with the possibility of an intermediate resting position.

  4. Elucidating GPR Response to Biological Activity: Field and Laboratory Experiments

    NASA Astrophysics Data System (ADS)

    Tsoflias, G. P.; Schillig, P. C.; McGlashan, M. A.; Roberts, J. A.; Devlin, J. F.

    2010-12-01

    Recent studies of the geophysical signatures of biological processes in earth environments have resulted in the emergent field of “biogeophysics”. The ability to monitor remotely and to quantify active biological processes in the subsurface can have transformative implications to a wide range of investigations, including the bioremediation of contaminated sites. Previous studies have demonstrated that ground-penetrating radar (GPR) can be used to detect the products of microbial activity in the subsurface, such as changes in bulk electrical conductivity, mineral dissolution and precipitation, and the formation of biogenic gas. We present field and laboratory experiments that offer insights to the response of GPR signals to microbial activity. In the field, time-lapse borehole radar tomography was used to monitor biodegradation of a hydrocarbon plume over a period of two years. A dense grid of fourteen borehole pairs monitoring the bioactive region showed radar wave velocity changes of +/-4% and signal attenuation changes of +/-25%. These GPR observations correlated spatially and temporally to independent measurements of groundwater velocity and geochemical variations that occurred in response to microbial activity. The greatest relative changes in radar wave velocity of propagation and attenuation were observed in the region of enhanced bacterial stimulation where biomass growth was the greatest. Radar wave velocity and attenuation decreased during periods of enhanced biostimulation. Two laboratory experiments were conducted to further assess radar response to biomass growth. The first experiment monitored GPR wave transmission through a water-saturated quartz-sand reactor during the course of enhanced biostimulation. Radar wave velocity initially decreased as a result of bacterial activity and subsequently increased rapidly as biogenic gas formed in the pore space. Radar signal attenuation increased during the course of the experiment as a result of an increase in pore fluid electrical conductivity. The second experiment examined GPR wave transmission through incrementally increasing concentrations of Shewanella putrefaciens strain 200R in a fluid suspension. Recorded GPR waveforms exhibited dispersion as the concentration of suspended cells increased. The radar wave velocity decrease observed in the field and laboratory measurements provide direct evidence of saturated sand bulk dielectric constant increase when biomass forms in the pore space, suggesting biomass dielectric constant being greater than that of pore water. The decrease in radar signal attenuation observed in the field during enhanced biodegradation is in contrast to high GPR attenuation observed in mature hydrocarbon contaminated sites where high conductivity pore fluids do not allow direct assessment of biomass effect on GPR signal attenuation. We conclude that field and laboratory GPR observations of enhanced biological activity in saturated porous media and in fluid suspension offer evidence that GPR can be used to monitor biostimulation in earth environments.

  5. Activity enhances dopaminergic long-duration response in Parkinson disease

    PubMed Central

    Auinger, Peggy; Fahn, Stanley; Oakes, David; Shoulson, Ira; Kieburtz, Karl; Rudolph, Alice; Marek, Kenneth; Seibyl, John; Lang, Anthony; Olanow, C. Warren; Tanner, Caroline; Schifitto, Giovanni; Zhao, Hongwei; Reyes, Lydia; Shinaman, Aileen; Comella, Cynthia L.; Goetz, Christopher; Blasucci, Lucia M.; Samanta, Johan; Stacy, Mark; Williamson, Kelli; Harrigan, Mary; Greene, Paul; Ford, Blair; Moskowitz, Carol; Truong, Daniel D.; Pathak, Mayank; Jankovic, Joseph; Ondo, William; Atassi, Farah; Hunter, Christine; Jacques, Carol; Friedman, Joseph H.; Lannon, Margaret; Russell, David S.; Jennings, Danna; Fussell, Barbara; Standaert, David; Schwarzschild, Michael A.; Growdon, John H.; Tennis, Marsha; Gauthier, Serge; Panisset, Michel; Hall, Jean; Gancher, Stephen; Hammerstad, John P.; Stone, Claudia; Alexander-Brown, Barbara; Factor, Stewart A.; Molho, Eric; Brown, Diane; Evans, Sharon; Clark, Jeffrey; Manyam, Bala; Simpson, Patricia; Wulbrecht, Brian; Whetteckey, Jacqueline; Martin, Wayne; Roberts, Ted; King, Pamela; Hauser, Robert; Zesiewicz, Theresa; Gauger, Lisa; Trugman, Joel; Wooten, G. Frederick; Rost-Ruffner, Elke; Perlmutter, Joel; Racette, Brad A.; Suchowersky, Oksana; Ranawaya, Ranjit; Wood, Susan; Pantella, Carol; Kurlan, Roger; Richard, Irene; Pearson, Nancy; Caviness, John N.; Adler, Charles; Lind, Marlene; Simuni, Tanya; Siderowf, Andrew; Colcher, Amy; Lloyd, Mary; Weiner, William; Shulman, Lisa; Koller, William; Lyons, Kelly; Feldman, Robert G.; Saint-Hilaire, Marie H.; Ellias, Samuel; Thomas, Cathi-Ann; Juncos, Jorge; Watts, Ray; Partlow, Anna; Tetrud, James; Togasaki, Daniel M.; Stewart, Tracy; Mark, Margery H.; Sage, Jacob I.; Caputo, Debbie; Gould, Harry; Rao, Jayaraman; McKendrick, Ann; Brin, Mitchell; Danisi, Fabio; Benabou, Reina; Hubble, Jean; Paulson, George W.; Reider, Carson; Birnbaum, Alex; Miyasaki, Janis; Johnston, Lisa; So, Julie; Pahwa, Rajesh; Dubinsky, Richard M.; Wszolek, Zbigniew; Uitti, Ryan; Turk, Margaret; Tuite, Paul; Rottenberg, David; Hansen, Joy; Ramos, Serrano; Waters, Cheryl; Lew, Mark; Welsh, Mickie; Kawai, Connie; O'Brien, Christopher; Kumar, Rajeev; Seeberger, Lauren; Judd, Deborah; Barclay, C. Lynn; Grimes, David A.; Sutherland, Laura; Dawson, Ted; Reich, Stephen; Dunlop, Rebecca; Albin, Roger; Frey, Kirk; Wernette, Kristine; Fahn, Stanley; Oakes, David; Shoulson, Ira; Kieburtz, Karl; Rudolph, Alice; Marek, Kenneth; Seibyl, John; Lang, Anthony; Olanow, C. Warren; Tanner, Caroline; Schifitto, Giovanni; Zhao, Hongwei; Reyes, Lydia; Shinaman, Aileen; Comella, Cynthia L.; Goetz, Christopher; Blasucci, Lucia M.; Samanta, Johan; Stacy, Mark; Williamson, Kelli; Harrigan, Mary; Greene, Paul; Ford, Blair; Moskowitz, Carol; Truong, Daniel D.; Pathak, Mayank; Jankovic, Joseph; Ondo, William; Atassi, Farah; Hunter, Christine; Jacques, Carol; Friedman, Joseph H.; Lannon, Margaret; Russell, David S.; Jennings, Danna; Fussell, Barbara; Standaert, David; Schwarzschild, Michael A.; Growdon, John H.; Tennis, Marsha; Gauthier, Serge; Panisset, Michel; Hall, Jean; Gancher, Stephen; Hammerstad, John P.; Stone, Claudia; Alexander-Brown, Barbara; Factor, Stewart A.; Molho, Eric; Brown, Diane; Evans, Sharon; Clark, Jeffrey; Manyam, Bala; Simpson, Patricia; Wulbrecht, Brian; Whetteckey, Jacqueline; Martin, Wayne; Roberts, Ted; King, Pamela; Hauser, Robert; Zesiewicz, Theresa; Gauger, Lisa; Trugman, Joel; Wooten, G. Frederick; Rost-Ruffner, Elke; Perlmutter, Joel; Racette, Brad A.; Suchowersky, Oksana; Ranawaya, Ranjit; Wood, Susan; Pantella, Carol; Kurlan, Roger; Richard, Irene; Pearson, Nancy; Caviness, John N.; Adler, Charles; Lind, Marlene; Simuni, Tanya; Siderowf, Andrew; Colcher, Amy; Lloyd, Mary; Weiner, William; Shulman, Lisa; Koller, William; Lyons, Kelly; Feldman, Robert G.; Saint-Hilaire, Marie H.; Ellias, Samuel; Thomas, Cathi-Ann; Juncos, Jorge; Watts, Ray; Partlow, Anna; Tetrud, James; Togasaki, Daniel M.; Stewart, Tracy; Mark, Margery H.; Sage, Jacob I.; Caputo, Debbie; Gould, Harry; Rao, Jayaraman; McKendrick, Ann; Brin, Mitchell; Danisi, Fabio; Benabou, Reina; Hubble, Jean; Paulson, George W.; Reider, Carson; Birnbaum, Alex; Miyasaki, Janis; Johnston, Lisa; So, Julie; Pahwa, Rajesh; Dubinsky, Richard M.; Wszolek, Zbigniew; Uitti, Ryan; Turk, Margaret; Tuite, Paul; Rottenberg, David; Hansen, Joy; Ramos, Serrano; Waters, Cheryl; Lew, Mark; Welsh, Mickie; Kawai, Connie; O'Brien, Christopher; Kumar, Rajeev; Seeberger, Lauren; Judd, Deborah; Barclay, C. Lynn; Grimes, David A.; Sutherland, Laura; Dawson, Ted; Reich, Stephen; Dunlop, Rebecca; Albin, Roger; Frey, Kirk; Wernette, Kristine; Mendis, Tilak

    2012-01-01

    Objective: We tested the hypothesis that dopamine-dependent motor learning mechanism underlies the long-duration response to levodopa in Parkinson disease (PD) based on our studies in a mouse model. By data-mining the motor task performance in dominant and nondominant hands of the subjects in a double-blind randomized trial of levodopa therapy, the effects of activity and dopamine therapy were examined. Methods: We data-mined the Earlier versus Later Levodopa Therapy in Parkinson's Disease (ELLDOPA) study published in 2005 and performed statistical analysis comparing the effects of levodopa and dominance of handedness over 42 weeks. Results: The mean change in finger-tapping counts from baseline before the initiation of therapy to predose at 9 weeks and 40 weeks increased more in the dominant compared to nondominant hand in levodopa-treated subjects in a dose-dependent fashion. There was no significant difference in dominant vs nondominant hands in the placebo group. The short-duration response assessed by the difference of postdose performance compared to predose performance at the same visit did not show any significant difference between dominant vs nondominant hands. Conclusions: Active use of the dominant hand and dopamine replacement therapy produces synergistic effect on long-lasting motor task performance during “off” medication state. Such effect was confined to dopamine-responsive symptoms and not seen in dopamine-resistant symptoms such as gait and balance. We propose that long-lasting motor learning facilitated by activity and dopamine is a form of disease modification that is often seen in trials of medications that have symptomatic effects. PMID:22459675

  6. Atorvastatin activates heme oxygenase-1 at the stress response elements

    PubMed Central

    Kwok, Simon CM; Samuel, Solomon P; Handal, John

    2012-01-01

    Abstract Statins are known to inhibit growth of a number of cancer cells, but their mechanism of action is not well established. In this study, human prostate adenocarcinoma PC-3 and breast adenocarcinoma MCF-7 cell lines were used as models to investigate the mechanism of action of atorvastatin, one of the statins. Atorvastatin was found to induce apoptosis in PC-3 cells at a concentration of 1 ?M, and in MCF-7 cells at 50 ?M. Initial survey of possible pathway using various pathway-specific luciferase reporter assays showed that atorvastatin-activated antioxidant response element (ARE), suggesting oxidative stress pathway may play a role in atorvastatin-induced apoptosis in both cell lines. Among the antioxidant response genes, heme oxygenase-1 (HO-1) was significantly up-regulated by atorvastatin. Pre-incubation of the cells with geranylgeranyl pyrophosphate blocked atorvastatin-induced apoptosis, but not up-regulation of HO-1, suggesting that atorvastatin-induced apoptosis is dependent on GTPase activity and up-regulation of HO-1 gene is not. Six ARE-like elements (designated StRE1 [stress response element] through StRE6) are present in the HO-1 promoter. Atorvastatin was able to activate all of the elements. Because these StRE sites are present in clusters in HO-1 promoter, up-regulation of HO-1 by atorvastatin may involve multiple StRE sites. The role of HO-1 in atorvastatin-induced apoptosis in PC-3 and MCF-7 remains to be studied. PMID:21447045

  7. Identification of a large bent DNA domain and binding sites for serum response factor adjacent to the NFI repeat cluster and enhancer region in the major IE94 promoter from simian cytomegalovirus.

    PubMed Central

    Chang, Y N; Jeang, K T; Chiou, C J; Chan, Y J; Pizzorno, M; Hayward, G S

    1993-01-01

    The major immediate-early (MIE) transactivator proteins of cytomegaloviruses (CMV) play a pivotal role in the initiation of virus-host cell interactions. Therefore, cis- and trans-acting factors influencing the expression of these proteins through their upstream promoter-enhancer regions are important determinants of the outcome of virus infection. S1 nuclease analysis and in vitro transcription assays with the MIE (or IE94) transcription unit of simian CMV (SCMV) (Colburn) revealed a single prominent mRNA start site associated with a canonical TATATAA motif. This initiator region lies adjacent to a 2,400-bp 5'-upstream noncoding sequence that encompasses a newly identified 1,000-bp (A+T)-rich segment containing intrinsically bent DNA (domain C), together with the previously described proximal cyclic AMP response element locus (domain A) and a tandemly repeated nuclear factor I binding site cluster (domain B). Deleted MIE reporter gene constructions containing domain A sequences only yield up to 4-fold stronger basal expression in Vero cells than the intact simian virus 40 promoter-enhancer region, and sequences from position -405 to -69 (ENH-A1) added to a minimal heterologous promoter produced a 50-fold increase of basal expression in an enhancer assay. In contrast, neither the nuclear factor I cluster nor the bent DNA region possessed basal enhancer properties and neither significantly modulated the basal activity of the ENH-A1 segment. A second segment of domain A from position -580 to -450 was also found to possess basal enhancer activity in various cell types. This ENH-A2 region contains three copies of a repeated element that includes the 10-bp palindromic sequence CCATATATGG, which resembles the core motif of serum response elements and proved to bind specifically to the cellular nuclear protein serum response transcription factor. Reporter gene constructions containing four tandem copies of these elements displayed up to 13-fold increased basal enhancer activity and 18-fold tetradecanoyl phorbol acetate responsiveness in U937 cells, but an ENH-A2 DNA segment encompassing two of the core serum response transcription factor binding sites failed to respond to serum induction in NIH 3T3 cells. Although there are overall similarities in the organizations of both the MIE enhancers and MIE transcription units among human CMV, SCMV, and murine CMV, the specific arrangements of repetitive motifs are quite different, and the bent DNA and ENH-A2 domains appear to be unique to SCMV. Images PMID:8380090

  8. Activation of innate immune antiviral response by NOD2

    PubMed Central

    Sabbah, Ahmed; Chang, Te Hung; Harnack, Rosalinda; Frohlich, Victoria; Tominaga, Kaoru; Dube, Peter H.; Xiang, Yan; Bose, Santanu

    2009-01-01

    Pattern recognition receptors (PRRs) including Toll-like receptors (TLRs) and RIG like helicase (RLH) receptors are involved in innate immune antiviral responses. Here we show that nucleotide-binding oligomerization domain 2 (NOD2) can also function as a cytoplasmic viral PRR by triggering activation of interferon regulatory factor-3 (IRF3) and production of interferon-? (IFN). Following recognition of viral ssRNA genome, NOD2 utilized the adaptor protein MAVS (mitochondrial antiviral signaling) to activate IRF3. NOD2-deficient mice failed to produce IFN efficiently and exhibited enhanced susceptibility to virus-induced pathogenesis. Thus, the function of NOD2 as a viral PRR highlights the important role of NOD2 in host antiviral defense mechanisms. PMID:19701189

  9. Active microwave responses - An aid in improved crop classification

    NASA Technical Reports Server (NTRS)

    Rosenthal, W. D.; Blanchard, B. J.

    1984-01-01

    A study determined the feasibility of using visible, infrared, and active microwave data to classify agricultural crops such as corn, sorghum, alfalfa, wheat stubble, millet, shortgrass pasture and bare soil. Visible through microwave data were collected by instruments on board the NASA C-130 aircraft over 40 agricultural fields near Guymon, OK in 1978 and Dalhart, TX in 1980. Results from stepwise and discriminant analysis techniques indicated 4.75 GHz, 1.6 GHz, and 0.4 GHz cross-polarized microwave frequencies were the microwave frequencies most sensitive to crop type differences. Inclusion of microwave data in visible and infrared classification models improved classification accuracy from 73 percent to 92 percent. Despite the results, further studies are needed during different growth stages to validate the visible, infrared, and active microwave responses to vegetation.

  10. Assessing estrogenic activity of phytochemicals using transcriptional activation and immature mouse uterotrophic responses

    Microsoft Academic Search

    Wendy N Jefferson; Elizabeth Padilla-Banks; George Clark; Retha R Newbold

    2002-01-01

    The estrogenic responses of several phytoestrogens including genistein, daidzein, coumestrol, ?-zearalanol, zearalenone, naringenin, taxifolin and biochanin A were compared over a wide dose range using an in vitro assay that measures transcriptional activation of the estrogen receptor (ER) and an in vivo immature mouse uterotrophic assay consisting of measuring uterine wet weight increase plus sensitive morphological and biochemical endpoints in

  11. [The response of EEG activation in different neurohumoral conditions].

    PubMed

    Bazanova, O M; Kuz'minova, O I; Nikolenko, E D; Petrova, S Iu

    2014-01-01

    In order to examine under what neurohumoral condition response to the usual opening of the eyes is an incentive for the activation, electroencephalographic, electrocardiographic and electromyographic characteristics of the eyes open reaction in relation to the psychometric indicators of emotional stress and cognitive performance were recorded in 59 healthy women aged 18-27 every 2-3 days for 1-2 menstrual cycles, established in accordance with the morning levels of progesterone. For excluding NOVELTY factor influence one 29 women started monitoring at menstrual phase and other 30--at luteal phase of menstrual cycle. 30 women participated in a one-time monitoring, in which the relationship of these parameters with the current level of progesterone and cortisol in saliva was studied. Two factors ANOVA showed that the depth of the power suppression and the width of the individually determined low frequency alpha EEG range on follicular is more than on the luteal phase of the menstrual cycle of women and are influenced the NOVELTY. "Berger effect" indices of the upper alpha range are not changed depending on the neurohumoral status. Depth of the amplitude decrease and width of merely low-frequency alpha band could predict the activation in the eyes open response due to unidirectional changes and relationship to vegetative and hormonal characteristics of the activation. It was firstly established that eyes opening is an incentive factor to the activaition only when neurohumoral state corresponds to the follicular phase of the women mensrual cycle. This study reviles the dependence of the neuronal and vegetative activation mechanisms of the individual alpha frequency profile EEG and neurohumoral status. PMID:25707216

  12. Development of Antiproliferative Phenylmaleimides that Activate the Unfolded Protein Response

    PubMed Central

    Muus, Ulrike; Hose, Curtis; Yao, Wei; Kosakowska-Cholody, Teresa; Farnsworth, David; Dyba, Marzena; Lountos, George T.; Waugh, David S.; Monks, Anne; Burke, Terrence R.; Michejda, Christopher J.

    2010-01-01

    The current paper presents the synthesis and evaluation of a series of maleimides that were designed to inhibit the Cdc25 phosphatase by alkylation of catalytically essential cysteine residues. Although in HepB3 cell culture assays the analogues did exhibit antiproliferative IC50 values ranging from sub-micromolar to greater than 100 µM, inhibition of Cdc25 through cysteine alkylation could not be demonstrated. It was also found that analysis using fluorescence activated cell sorting (FACS) following treatment with the most potent analogue (1t) did not provide data consistent with inhibition at one specific point in the cell cycle, as would be expected if Cdc25A were inhibited. Further studies with a subset of analogues resulted in a correlation of antiproliferative potencies with activation of the unfolded protein response (UPR). The UPR is a regulatory pathway that temporarily suspends protein production when misfolding of proteins occurs within the endoplastic reticulum (ER). In addition, ER chaperones that promote proper refolding become upregulated. If cellular damage cannot be resolved by these mechanisms, then the UPR can initiate apoptosis. The current study indicates that these maleimide analogues lead to UPR activation, which is predictive of the selective antiproliferative activity of the series. PMID:20472436

  13. EXPERIMENTAL MASTITIS WITH ESCHERICHIA COLI: SEQUENTIAL RESPONSE OF LEUKOCYTES AND OPSONIC ACTIVITY

    E-print Network

    Paris-Sud XI, Université de

    EXPERIMENTAL MASTITIS WITH ESCHERICHIA COLI: SEQUENTIAL RESPONSE OF LEUKOCYTES AND OPSONIC ACTIVITY infusion of bacteria (Hill, 1979); b) opsonic activity is required in milk to enable polymorphonuclear

  14. 75 FR 21648 - MMS Information Collection Activity: 1010-0106, Oil Spill Financial Responsibility for Offshore...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    ...Collection Activity: 1010-0106, Oil Spill Financial Responsibility for Offshore...regulations under ``30 CFR Part 253, Oil Spill Financial Responsibility for Offshore...INFORMATION: Title: 30 CFR Part 253, Oil Spill Financial Responsibility for...

  15. 77 FR 33479 - Information Collection Activities: Oil-Spill Response Requirements for Facilities Located Seaward...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-06

    ...Information Collection Activities: Oil-Spill Response Requirements for Facilities...regulations under Part 254, ``Oil-Spill Response Requirements for Facilities...INFORMATION: Title: 30 CFR 254, Oil-Spill Response Requirements for...

  16. 75 FR 54354 - BOEMRE Information Collection Activity: 1010-0106, Oil Spill Financial Responsibility for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-07

    ...Collection Activity: 1010-0106, Oil Spill Financial Responsibility for Offshore...regulations under 30 CFR part 253, ``Oil Spill Financial Responsibility for Offshore...INFORMATION: Title: 30 CFR 253, Oil Spill Financial Responsibility for...

  17. Activation of Innate Immune Responses by Haemophilus influenzae Lipooligosaccharide

    PubMed Central

    Choi, Joshua; Cox, Andrew D.; Li, Jianjun; McCready, William

    2014-01-01

    A Gram-negative pathogen Haemophilus influenzae has a truncated endotoxin known as lipooligosaccharide (LOS). Recent studies on H. influenzae LOS highlighted its structural and compositional implications for bacterial virulence; however, the role of LOS in the activation of innate and adaptive immunity is poorly understood. THP-1 monocytes were stimulated with either lipopolysaccharide (LPS) from Escherichia coli or LOS compounds derived from H. influenzae Eagan, Rd, and Rd lic1 lpsA strains. Cell surface expression of key antigen-presenting, costimulatory, and adhesion molecules, as well as gene expression of some cytokines and pattern recognition receptors, were studied. Eagan and Rd LOS had a lower capacity to induce the expression of ICAM-1, CD40, CD58, tumor necrosis factor alpha (TNF-?), and interleukin-1? (IL-1?) compared to LPS. In contrast, antigen-presenting (HLA-ABC or HLA-DR) and costimulatory (CD86) molecules and NOD2 were similarly upregulated in response to LOS and LPS. LOS from a mutant Rd strain (Rd lic1 lpsA) consistently induced higher expression of innate immune molecules than the wild-type LOS, suggesting the importance of phosphorylcholine and/or oligosaccharide extension in cellular responses to LOS. An LOS compound with a strong ability to upregulate antigen-presenting and costimulatory molecules combined with a low proinflammatory activity may be considered a vaccine candidate to immunize against H. influenzae. PMID:24671554

  18. A supramolecular microgel glutathione peroxidase mimic with temperature responsive activity.

    PubMed

    Yin, Yanzhen; Jiao, Shufei; Lang, Chao; Liu, Junqiu

    2014-05-21

    Glutathione peroxidase (GPx) protects cells from oxidative damage by scavenging surplus reactive oxygen species (ROS). Commonly, an appropriate amount of ROS acts as a signal molecule in the metabolism. A smart artificial GPx exhibits adjustable catalytic activity, which can potentially reduce the amount of ROS to an appropriate degree and maintain its important physiological functions in metabolism. To construct an optimum and excellent smart artificial GPx, a novel supramolecular microgel artificial GPx (SM-Te) was prepared based on the supramolecular host-guest interaction employing the tellurium-containing guest molecule (ADA-Te-ADA) and the cyclodextrin-containing host block copolymer (poly(N-isopropylacrylamide)-b-[polyacrylamides-co-poly(6-o-(triethylene glycol monoacrylate ether)-?-cyclodextrin)], PPAM-CD) as building blocks. Subsequently, based on these building blocks, SM-Te was constructed and the formation of its self-assembled structure was confirmed by dynamic light scattering, NMR, SEM, TEM, etc. Typically, benefitting from the temperature responsive properties of the PNIPAM scaffold, SM-Te also exhibited similar temperature responsive behaviour. Importantly, the GPx catalytic rates of SM-Te displayed a noticeable temperature responsive characteristic. Moreover, SM-Te exhibited the typical saturation kinetics behaviour of a real enzyme catalyst. It was proved that the changes of the hydrophobic microenvironment and the pore size in the supramolecular microgel network of SM-Te played significant roles in altering the temperature responsive catalytic behaviour. The successful construction of SM-Te not only overcomes the insurmountable disadvantages existing in previous covalent bond crosslinked microgel artificial GPx but also bodes well for the development of novel intelligent antioxidant drugs. PMID:24652520

  19. Sulforaphane prevents pulmonary damage in response to inhaled arsenic by activating the Nrf2-defense response

    SciTech Connect

    Zheng, Yi [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China) [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China); Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Tao, Shasha [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States)] [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Lian, Fangru [Department of Pathology, University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States)] [Department of Pathology, University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Chau, Binh T. [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States)] [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Chen, Jie; Sun, Guifan [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China)] [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China); Fang, Deyu [Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States)] [Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States); Lantz, R. Clark [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States) [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Arizona Cancer Center, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724 (United States); Zhang, Donna D., E-mail: dzhang@pharmacy.arizona.edu [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Arizona Cancer Center, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724 (United States)

    2012-12-15

    Exposure to arsenic is associated with an increased risk of lung disease. Novel strategies are needed to reduce the adverse health effects associated with arsenic exposure in the lung. Nrf2, a transcription factor that mediates an adaptive cellular defense response, is effective in detoxifying environmental insults and prevents a broad spectrum of diseases induced by environmental exposure to harmful substances. In this report, we tested whether Nrf2 activation protects mice from arsenic-induced toxicity. We used an in vivo arsenic inhalation model that is highly relevant to low environmental human exposure to arsenic-containing dusts. Two-week exposure to arsenic-containing dust resulted in pathological alterations, oxidative DNA damage, and mild apoptotic cell death in the lung; all of which were blocked by sulforaphane (SF) in an Nrf2-dependent manner. Mechanistically, SF-mediated activation of Nrf2 alleviated inflammatory responses by modulating cytokine production. This study provides strong evidence that dietary intervention targeting Nrf2 activation is a feasible approach to reduce adverse health effects associated with arsenic exposure. -- Highlights: ? Exposed to arsenic particles and/or SF have elevated Nrf2 and its target genes. ? Sulforaphane prevents pathological alterations, oxidative damage and cell death. ? Sulforaphane alleviates infiltration of inflammatory cells into the lungs. ? Sulforaphane suppresses arsenic-induced proinflammatory cytokine production.

  20. Listening as a Perceived and Interactive Activity: Understanding the Impact of Verbal Listening Responses

    ERIC Educational Resources Information Center

    Hall, Bradford

    2012-01-01

    This sequenced activity encourages active engagement with the idea that listening and speaking are not inherently separate or one-way activities. Listening involves both verbal, and nonverbal responses and perceptions of effective listening are tied to these patterns of response. These patterns of response impact both the immediate communication…

  1. Activation of the unfolded protein response in aged human lenses.

    PubMed

    Tang, He-Zhen; Yang, Li-Min

    2015-07-01

    Cataract formation is a multifactorial disease, induced by a variety of stressors. The endoplasmic reticulum (ER) stress?induced unfolded protein response (UPR) is known to produce reactive oxygen species (ROS) leading to apoptosis. The present study aimed to investigate whether activation of the UPR occurs in human lenses, using human lens epithelial cell (HLEC) lines and lenses obtained from an eye bank, from individuals aged between 50 and 90 years. In vitro analysis was performed using calcimycin (10 µM) as an ER stressor. The level of ER stress was measured by the production of ROS, staining for cell death, detection of binding immunoglobulin proteins (BIP) and levels of other UPR proteins, including inositol?requiring enzyme?1 (IRE), activating transcription factor (ATF) 6 and PKR?like eukaryotic initiation factor 2a kinase (PERK). These parameters were examined in HLECs exposed to calcimycin for 12, 24, 48 and 72 h. Fluorescent activated cell sorting analysis of the levels of ROS and apoptosis revealed an increase following 24 h calcimycin exposure. The reverse transcription quantitative polymerase chain reaction results demonstrated a gradual increase in the mRNA levels of BIP, IRE1, ATF6 and PERK between 12 and 72 h. A similar effect was observed in the protein levels, which also demonstrated a gradual increase in the levels of endoplasmic oxidoreductin?1?like (Ero1?L)?? and protein disulfide isomerase, but a lower level of Ero1?L?. Activation of the UPR involved the apoptotic pathway, revealed by increased levels of C/EBP homologous protein, ATF4 and caspase?4. Additionally, the antioxidant protein levels were also suppressed. The investigation of aged human lenses revealed a similar increase in the protein expression of UPR. These results indicated that activation of the UPR?induced ROS production suppressed the antioxidant status and triggered the apoptotic pathway, ultimately leading to the formation of age?related cataracts. PMID:25739021

  2. Diuretics and the renal adenylate cyclase system

    PubMed Central

    Dawborn, J.K.; Macneil, S.; Martin, T.J.

    1977-01-01

    1 The relationship between the diuretic effectiveness and the effect on the renal adenylate cyclase of three diuretics, acetazolamide, frusemide and ethacrynic acid, was examined. The hypothesis that acetazolamide and parathyroid hormone (PTH), inhibit renal carbonic anhydrase by a cyclic adenosine 3?,5?-monophosphate (cyclic AMP)-dependent mechanism was also tested. 2 In vitro, acetazolamide, frusemide and ethacrynic acid at high concentrations (10-3M) all produced some inhibition of basal and stimulated rat kidney plasma membrane adenylate cyclase. The effect of acetazolamide was much less than that of frusemide and ethacrynic acid. These plasma membrane effects were reproduced in studies of cyclic AMP formation in isolated kidney tubules of rats. 3 Intravenous injections of acetazolamide did not change the total cyclic AMP content of the kidneys of rats killed by microwave irradiation. 4 Acetazolamide produced a diuresis in the rat and a slight inhibition of the antidiuretic effect of Pitressin. Frusemide produced a diuresis and greatly reduced the antidiuretic response to Pitressin. Ethacrynic acid was ineffective as a diuretic in the rat and actually enhanced the antidiuretic response to Pitressin. 5 In investigating the possible influence of diuretics and PTH on the activity and state of phosphorylation of carbonic anhydrase it was found that: there was no correlation between the ability of diuretics to inhibit carbonic anhydrase activity and to inhibit carbonic anhydrase phosphorylation; neither PTH nor cyclic AMP (in the presence of adenosine triphosphate, Mg2+, K+ and incubation at 37°C) inhibited rat cortex homogenate carbonic anhydrase activity. 6 It seems unlikely that any of the tested diuretics exerts its pharmacological effect by means of changes in kidney cyclic AMP metabolism. PMID:202362

  3. Activation of oxidative stress-responsive signaling pathways in early splenotoxic response of aniline

    SciTech Connect

    Wang Jianling; Wang Gangduo; Ansari, G.A.S. [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0438 (United States); Khan, M. Firoze [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0438 (United States)], E-mail: mfkhan@utmb.edu

    2008-07-15

    Aniline exposure causes toxicity to the spleen, which leads to a variety of sarcomas, and fibrosis appears to be an important preneoplastic lesion. However, early molecular mechanisms in aniline-induced toxicity to the spleen are not known. Previously, we have shown that aniline exposure results in iron overload and induction of oxidative stress in the spleen, which can cause transcriptional upregulation of fibrogenic/inflammatory cytokines via activation of oxidative stress (OS)-responsive signaling pathways. To test this mechanism, male SD rats were treated with aniline (1mmol/kg/day via gavage) for 7days, an experimental condition that precedes the appearance of fibrosis. Significant increases in both NF-{kappa}B and AP-1 binding activity was observed in the nuclear extracts of splenocytes from aniline-treated rats as determined by ELISAs, and supported by Western blot data showing increases in p-I{kappa}B{alpha}, p-p65 and p-c-Jun. To understand the upstream signaling events which could account for the activation of NF-{kappa}B and AP-1, phosphorylation patterns of I{kappa}B kinases (IKK{alpha} and IKK{beta}) and mitogen-activated protein kinases (MAPKs) were pursued. Our data showed remarkable increases in both p-IKK{alpha} and p-IKK{beta} in the splenocytes from aniline-treated rats, suggesting their role in the phosphorylation of both I{kappa}B{alpha} and p65 subunits. Furthermore, aniline exposure led to activation of all three classes of MAPKs, as evident from increased phosphorylation of extracellular-signal-regulated kinase (ERK1/2), c-Jun N-terminal kinase (JNK1/2) and p38 MAPKs, which could potentially contribute to the observed activation of both AP-1 and NF-{kappa}B. Activation of upstream signaling molecules was also associated with simultaneous increases in gene transcription of cytokines IL-1, IL-6 and TNF-{alpha}. The observed sequence of events following aniline exposure could initiate a fibrogenic and/or tumorigenic response in the spleen.

  4. Transactivation of the human T-cell lymphotropic virus type 1 Tax1-responsive 21-base-pair repeats requires Holo-TFIID and TFIIA.

    PubMed Central

    Duvall, J F; Kashanchi, F; Cvekl, A; Radonovich, M F; Piras, G; Brady, J N

    1995-01-01

    The human T-cell lymphotropic virus type 1 (HTLV-1) is the etiological agent for adult T-cell leukemia and tropical spastic paraparesis/HTLV-1-associated myelopathy. The HTLV-1 Tax1 gene product has been shown to transactivate transcription of viral and cellular promoters. To examine the biochemical mechanism of Tax1 transactivation, we have developed an in vitro transactivation assay in which wild-type Tax1 is able to specifically transactivate a polymerase II promoter through upstream Tax1-responsive elements. The in vitro system utilizes the HTLV-1 21-bp repeats cloned upstream of the ovalbumin promoter and G-free cassette. Purified Tax1 specifically transactivates this template 5- to 10-fold in a concentration-dependent manner. No transactivation of the ovalbumin promoter (pLovTATA) template control was observed. Tax1 transactivation was inhibited by low concentrations of alpha-amanitin and was effectively neutralized by anti-Tax1 but not control sera. Consistent with in vivo transactivating activity, Tax1 NF-kappa B mutant M22, but not cyclic AMP-responsive element-binding protein mutant M47, transactivated the template containing the tandem 21-bp repeat. In a reconstituted in vitro transcription assay, Tax1 transactivation was dependent upon basal transcription factors TFIIB, TFIIF, Pol II, TFIID, and TFIIA. TATA-binding protein did not functionally substitute for TFIID in the transactivation assay by Tax1 but was sufficient for basal transcription. Finally, we have used anti-TFIIA antibody (p55) to ask if Tax1 transactivation required TFIIA activity. Addition of TFIIA antibody to in vitro transcription reactions, as well as depletion of TFIIA by preclearing with antibody, showed that TFIIA was required for Tax1 transactivation. Only a slight (twofold) drop of basal transcription was observed. Tax1 transactivation was restored when purified HeLa TFIIA was added back into the reconstituted system. We propose that Tax1 utilizes a transactivation pathway involving the activator regulated basal transcription factors TFIID and TFIIA. PMID:7609077

  5. Response of selenium changes in blood using cyclic activation analysis

    SciTech Connect

    Spyrou, N.M.; Akanle, O.B.; Damyanova, A.A.

    1986-01-01

    A study was undertaken to investigate the response of selenium uptake and washout in whole blood and its components in healthy subjects, aged 20 to 30 yr, who were given selenium as a supplement to their usual diet, in the form of a yeast tablet (200 mg) containing 100 ..mu..g of the element together with vitamins A, C, and E (natural). Selenium has gained worldwide interest not only as an essential trace element but as a potent modifier of environmental hazards and as a naturally occurring toxicant. It is important therefore to investigate the character and the degree of the changes in healthy people on selenium supplementation. Cyclic activation analysis was used for the determination of selenium concentration through the detection of /sup 77m/Se (17.5 s), because of the increased sensitivity of the method and the large number of samples involved.

  6. Active Disaster Response System for a Smart Building

    PubMed Central

    Lin, Chun-Yen; Chu, Edward T.-H; Ku, Lun-Wei; Liu, Jane W. S.

    2014-01-01

    Disaster warning and surveillance systems have been widely applied to help the public be aware of an emergency. However, existing warning systems are unable to cooperate with household appliances or embedded controllers; that is, they cannot provide enough time for preparedness and evacuation, especially for disasters like earthquakes. In addition, the existing warning and surveillance systems are not responsible for collecting sufficient information inside a building for relief workers to conduct a proper rescue action after a disaster happens. In this paper, we describe the design and implementation of a proof of concept prototype, named the active disaster response system (ADRS), which automatically performs emergency tasks when an earthquake happens. ADRS can interpret Common Alerting Protocol (CAP) messages, published by an official agency, and actuate embedded controllers to perform emergency tasks to respond to the alerts. Examples of emergency tasks include opening doors and windows and cutting off power lines and gas valves. In addition, ADRS can maintain a temporary network by utilizing the embedded controllers; hence, victims trapped inside a building are still able to post emergency messages if the original network is disconnected. We conducted a field trial to evaluate the effectiveness of ADRS after an earthquake happened. Our results show that compared to manually operating emergency tasks, ADRS can reduce the operation time by up to 15 s, which is long enough for people to get under sturdy furniture, or to evacuate from the third floor to the first floor, or to run more than 100 m. PMID:25237897

  7. Biological responses to activated carbon amendments in sediment remediation.

    PubMed

    Janssen, Elisabeth M-L; Beckingham, Barbara A

    2013-07-16

    Sorbent amendment with activated carbon (AC) is a novel in situ management strategy for addressing human and ecological health risks posed by hydrophobic organic chemicals (HOCs) in sediments and soils. A large body of literature shows that AC amendments can reduce bioavailability of sediment-associated HOCs by more than 60-90%. Empirically derived biodynamic models can predict bioaccumulation in benthic invertebrates within a factor of 2, allowing for future scenarios under AC amendment to be estimated. Higher AC dose and smaller AC particle size further reduce bioaccumulation of HOCs but may induce stress in some organisms. Adverse ecotoxicity response to AC exposure was observed in one-fifth of 82 tests, including changes in growth, lipid content, behavior, and survival. Negative effects on individual species and benthic communities appear to depend on the characteristics of the sedimentary environment and the AC amendment strategy (e.g., dose and particle size). More research is needed to evaluate reproductive end points, bacterial communities, and plants, and to link species- and community-level responses to amendment. In general, the ability of AC to effectively limit the mobility of HOCs in aquatic environments may outshine potential negative secondary effects, and these outcomes must be held in comparison to traditional remediation approaches. PMID:23745511

  8. Active disaster response system for a smart building.

    PubMed

    Lin, Chun-Yen; Chu, Edward T-H; Ku, Lun-Wei; Liu, Jane W S

    2014-01-01

    Disaster warning and surveillance systems have been widely applied to help the public be aware of an emergency. However, existing warning systems are unable to cooperate with household appliances or embedded controllers; that is, they cannot provide enough time for preparedness and evacuation, especially for disasters like earthquakes. In addition, the existing warning and surveillance systems are not responsible for collecting sufficient information inside a building for relief workers to conduct a proper rescue action after a disaster happens. In this paper, we describe the design and implementation of a proof of concept prototype, named the active disaster response system (ADRS), which automatically performs emergency tasks when an earthquake happens. ADRS can interpret Common Alerting Protocol (CAP) messages, published by an official agency, and actuate embedded controllers to perform emergency tasks to respond to the alerts. Examples of emergency tasks include opening doors and windows and cutting off power lines and gas valves. In addition, ADRS can maintain a temporary network by utilizing the embedded controllers; hence, victims trapped inside a building are still able to post emergency messages if the original network is disconnected. We conducted a field trial to evaluate the effectiveness of ADRS after an earthquake happened. Our results show that compared to manually operating emergency tasks, ADRS can reduce the operation time by up to 15 s, which is long enough for people to get under sturdy furniture, or to evacuate from the third floor to the first floor, or to run more than 100 m. PMID:25237897

  9. Dermatophytes Activate Skin Keratinocytes via Mitogen-Activated Protein Kinase Signaling and Induce Immune Responses.

    PubMed

    Achterman, Rebecca R; Moyes, David L; Thavaraj, Selvam; Smith, Adam R; Blair, Kris M; White, Theodore C; Naglik, Julian R

    2015-04-01

    Dermatophytes cause superficial and cutaneous fungal infections in immunocompetent hosts and invasive disease in immunocompromised hosts. However, the host mechanisms that regulate innate immune responses against these fungi are largely unknown. Here, we utilized commercially available epidermal tissues and primary keratinocytes to assess (i) damage induction by anthropophilic, geophilic, and zoophilic dermatophyte strains and (ii) the keratinocyte signaling pathways, transcription factors, and proinflammatory responses induced by a representative dermatophyte, Trichophyton equinum. Initially, five dermatophyte species were tested for their ability to invade, cause tissue damage, and induce cytokines, with Microsporum gypseum inducing the greatest level of damage and cytokine release. Using T. equinum as a representative dermatophyte, we found that the mitogen-activated protein kinase (MAPK) pathways were predominantly affected, with increased levels of phospho-p38 and phospho-Jun N-terminal protein kinase (JNK) but decreased levels of phospho-extracellular signal-regulated kinases 1 and 2 (ERK1/2). Notably, the NF-?B and PI3K pathways were largely unaffected. T. equinum also significantly increased expression of the AP-1-associated transcription factor, c-Fos, and the MAPK regulatory phosphatase, MKP1. Importantly, the ability of T. equinum to invade, cause tissue damage, activate signaling and transcription factors, and induce proinflammatory responses correlated with germination, indicating that germination may be important for dermatophyte virulence and host immune activation. PMID:25667269

  10. Dermatophytes Activate Skin Keratinocytes via Mitogen-Activated Protein Kinase Signaling and Induce Immune Responses

    PubMed Central

    Achterman, Rebecca R.; Moyes, David L.; Thavaraj, Selvam; Smith, Adam R.; Blair, Kris M.

    2015-01-01

    Dermatophytes cause superficial and cutaneous fungal infections in immunocompetent hosts and invasive disease in immunocompromised hosts. However, the host mechanisms that regulate innate immune responses against these fungi are largely unknown. Here, we utilized commercially available epidermal tissues and primary keratinocytes to assess (i) damage induction by anthropophilic, geophilic, and zoophilic dermatophyte strains and (ii) the keratinocyte signaling pathways, transcription factors, and proinflammatory responses induced by a representative dermatophyte, Trichophyton equinum. Initially, five dermatophyte species were tested for their ability to invade, cause tissue damage, and induce cytokines, with Microsporum gypseum inducing the greatest level of damage and cytokine release. Using T. equinum as a representative dermatophyte, we found that the mitogen-activated protein kinase (MAPK) pathways were predominantly affected, with increased levels of phospho-p38 and phospho-Jun N-terminal protein kinase (JNK) but decreased levels of phospho-extracellular signal-regulated kinases 1 and 2 (ERK1/2). Notably, the NF-?B and PI3K pathways were largely unaffected. T. equinum also significantly increased expression of the AP-1-associated transcription factor, c-Fos, and the MAPK regulatory phosphatase, MKP1. Importantly, the ability of T. equinum to invade, cause tissue damage, activate signaling and transcription factors, and induce proinflammatory responses correlated with germination, indicating that germination may be important for dermatophyte virulence and host immune activation. PMID:25667269

  11. Active Ageing in CIS Countries: Semantics, Challenges, and Responses.

    PubMed

    Sidorenko, Alexandre; Zaidi, Asghar

    2013-01-01

    Although the CIS countries are connected together by the legacy of breaking away from the Soviet Union, they have had a distinctive transition course and are rather diverse in terms of the population ageing challenges and policy responses in place. The commonality is that a comprehensive national strategy on ageing is lacking, and many of necessary reforms were put aside owing to political uncertainties, lack of societal consensus, and financial instability. The notion of active ageing is associated with the term "accelerated ageing," which is understood to be an individual living a life under harsh living conditions or a society experiencing rapid increases in the relative number of older persons, and therefore it carries a negative connotation. Yet, in the same spirit as the European Year for Active Ageing and Solidarity between Generations 2012, the CIS countries have initiated sectoral programmes towards enhancing employment of older workers, social participation of older people in the society in a wider sense and also measures promoting health and independent living of older persons. PMID:23346109

  12. Active Ageing in CIS Countries: Semantics, Challenges, and Responses

    PubMed Central

    Sidorenko, Alexandre; Zaidi, Asghar

    2013-01-01

    Although the CIS countries are connected together by the legacy of breaking away from the Soviet Union, they have had a distinctive transition course and are rather diverse in terms of the population ageing challenges and policy responses in place. The commonality is that a comprehensive national strategy on ageing is lacking, and many of necessary reforms were put aside owing to political uncertainties, lack of societal consensus, and financial instability. The notion of active ageing is associated with the term “accelerated ageing,” which is understood to be an individual living a life under harsh living conditions or a society experiencing rapid increases in the relative number of older persons, and therefore it carries a negative connotation. Yet, in the same spirit as the European Year for Active Ageing and Solidarity between Generations 2012, the CIS countries have initiated sectoral programmes towards enhancing employment of older workers, social participation of older people in the society in a wider sense and also measures promoting health and independent living of older persons. PMID:23346109

  13. Identification of amino acids that are selectively involved in Gi/o activation by rat melanin-concentrating hormone receptor 1.

    PubMed

    Hamamoto, Akie; Kobayashi, Yuki; Saito, Yumiko

    2015-04-01

    Many G-protein-coupled receptors (GPCRs) are known to functionally couple to multiple G-protein subfamily members. Although promiscuous G-protein coupling enables GPCRs to mediate diverse signals, only a few GPCRs have been identified with differential determinants for coupling to distinct G? proteins. Mammalian melanin-concentrating hormone receptor 1 (MCHR1) couples to dual G-protein subfamilies. However, the selectivity mechanisms between MCHR1 and different subtypes of G? proteins are unclear. Our previous studies demonstrated that mammalian MCHR1 couples to both Gi/o and Gq, whereas goldfish MCHR1 exclusively couples to Gq. In this study, we analyzed multiple sequence alignments between rat and goldfish MCHR1s, and designed three multisubstituted mutants of rat MCHR1 by replacing corresponding residues with those in goldfish MCHR1, focusing on regions around the cytosolic intracellular loops. By measurement of intracellular Ca(2+) mobilization, we found that two MCHR1 mutants, i2_6sub and i3_6sub, which contained six simultaneously substituted residues in the second intracellular loop or a combination of substituted residues in the third intracellular loop and fifth transmembrane domain, respectively, significantly reduced Gi/o-sensitive pertussis toxin responsiveness without altering Gq-mediated activity. Analyses of 10 other substitutions revealed that the multiple substitutions in i2_6sub and i3_6sub were necessary for Gi/o-selective responses. As judged by Gi/o-dependent GTP?S binding and cyclic AMP assays, i2_6sub and i3_6sub elicited phenotypes for impaired Gi/o-mediated signaling. We also monitored the dynamic mass redistribution (DMR) in living cells, which reveals receptor activity as an optical trace containing activation of all GPCR coupling classes. Cells transfected with i2_6sub or i3_6sub exhibited reduced Gi/o-mediated DMR responses compared with those transfected with MCHR1. These data suggest that two different regions independently affect the Gi/o-protein preference, and that multiple residues comprise a conformation favoring Gi/o-protein coupling and subsequently result in Gi/o-selective signaling. PMID:25617691

  14. Manipulation of endogenous kinase activity in living cells using photoswitchable inhibitory peptides.

    PubMed

    Yi, Jason J; Wang, Hui; Vilela, Marco; Danuser, Gaudenz; Hahn, Klaus M

    2014-11-21

    Optogenetic control of endogenous signaling can be an important tool for probing cell behavior. Using the photoresponse of the LOV2 domain of Avena sativa phototropin 1, we developed analogues of kinase inhibitors whose activity is light dependent. Inhibitory peptides were appended to the J? helix, where they potently inhibited kinases in the light but were sterically blocked from kinase interaction in the dark. Photoactivatable inhibitors for cyclic-AMP dependent kinase (PKA) and myosin light chain kinase (MLCK) are described, together with studies that shed light on proper positioning of the peptides in the LOV domain. These inhibitors altered endogenous signaling in living cells and produced light-dependent changes in cell morphodynamics. PMID:24905630

  15. Synergistic Regulation of Schwann Cell Proliferation by Heregulin and Forskolin

    Microsoft Academic Search

    MOHAMMED RAHMATULLAH; ALLEN SCHROERING; KATRINA ROTHBLUM; RICHARD C. STAHL; BOBBI URBAN; DAVID J. CAREY

    1998-01-01

    A peptide corresponding to the epidermal growth factor homology domain of b-heregulin stimulated autophosphorylation of the heregulin receptors erbB2 and erbB3 in Schwann cells and activation of the mitogen-activated protein (MAP) kinases ERK1 and ERK2. Heregulin-dependent activation of PAK65, a component of the stress-activated signaling pathway, ribosomal S6 kinase, and a cyclic AMP (cAMP) response element binding protein (CREB) kinase,

  16. The nitric oxide-cGKII system relays death and survival signals during embryonic retinal development via AKT-induced CREB1 activation.

    PubMed

    Socodato, R; Brito, R; Portugal, C C; de Oliveira, N A; Calaza, K C; Paes-de-Carvalho, R

    2014-06-01

    During early neurogenesis, retinal neuronal cells display a conserved differentiation program in vertebrates. Previous studies established that nitric oxide (NO) and cGMP accumulation regulate essential events in retinal physiology. Here we used pharmacological and genetic loss-of-function to investigate the effects of NO and its downstream signaling pathway in the survival of developing avian retinal neurons in vitro and in vivo. Six-day-old (E6) chick retinal cells displayed increased calcium influx and produced higher amounts of NO when compared with E8 cells. L-arginine (substrate for NO biosynthesis) and S-nitroso-N-acetyl-D,L-penicillamine (SNAP; a nitrosothiol NO donor) promoted extensive cell death in E6 retinas, whereas in E8 both substances decreased apoptosis. The effect of NO at both periods was mediated by soluble guanylyl cyclase (sGC) and cGMP-dependent kinase (cGK) activation. In addition, shRNA-mediated cGKII knockdown prevented NO-induced cell death (E6) and cell survival (E8). This, NO-induced cell death or cell survival was not correlated with an early inhibition of retinal cell proliferation. E6 cells also responded differentially from E8 neurons regarding cyclic AMP-responsive element-binding protein (CREB) activation in the retina in vivo. NO strongly decreased nuclear phospho-CREB staining in E6 but it robustly enhanced CREB phosphorylation in the nuclei of E8 neurons, an effect that was completely abrogated by cGKII shRNAs at both embryonic stages. The ability of NO in regulating CREB differentially during retinal development relied on the capacity of cGKII in decreasing (E6) or increasing (E8) nuclear AKT (V-Akt murine thymoma viral oncogene) activation. Accordingly, inhibiting AKT prevented both cGKII shRNA-mediated CREB upregulation in E6 and SNAP-induced CREB activation in E8. Furthermore, shRNA-mediated in vivo cGKII or in vitro CREB1 knockdown confirmed that NO/cGKII dualistically regulated the downstream CREB1 pathway and caspase activation in the chick retina to modulate neuronal viability. These data demonstrate that NO-mediated cGKII signaling may function to control the viability of neuronal cells during early retinal development via AKT/CREB1 activity. PMID:24531539

  17. Mouse L cells expressing human prourokinase-type plasminogen activator: effects on extracellular matrix degradation and invasion

    PubMed Central

    1989-01-01

    A cosmid (cos pUK0322) harboring the complete human urokinase-type plasminogen activator (u-PA) gene and Geneticin resistance as a selectable marker was isolated from a human genomic library and characterized. After transfection of cos pUK0322 into mouse L cells and selection, several plasminogen activator (PA)-expressing clones were obtained and one (LuPA) was chosen for additional study. The PA expressed was identical to human pro-u-PA in enzymatic, electrophoretic, and antigenic properties. The expression of PA was stable over 50 population doublings. The regulation of the transfected gene was studied by treatment of the cells with various hormones and other effectors. Expression of PA activity was inhibited fivefold by dexamethasone and stimulated two- to threefold by agonists of the adenylate cyclase dependent pathway of signal transduction, such as dibutyryl cyclic AMP and cholera and pertussis toxins. The modulation of PA activity was associated with corresponding changes in mRNA steady- state levels. The phenotypic changes associated with pro-u-PA expression were analyzed in vitro by degradation of 3H-labeled extracellular matrix (ECM), invasion of a matrigel basement membrane analogue, and by light and electron microscopy. LuPA cells and reference HT-1080 fibrosarcoma cells, in contrast to control Lneo cells transfected with the neomycin resistance gene, degraded the ECM and invaded the matrigel basement membrane. Matrix degradation correlated with the modulation of pro-u-PA gene expression as it was inhibited by dexamethasone and promoted by dibutyryl cyclic AMP. Inhibition of PA or plasmin using anti-u-PA IgG or aprotinin prevented ECM degradation and invasion. These results demonstrate that u-PA expression alone is sufficient to confer to a cell an experimental invasive phenotype. PMID:2503527

  18. German Cockroach Frass Proteases Modulate the Innate Immune Response via Activation of Protease-Activated Receptor2

    Microsoft Academic Search

    Scottie B. Day; Ping Zhou; John R. Ledford; Kristen Page

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular

  19. Spermiogenesis deficiency and germ-cell apoptosis in CREM-mutant mice

    Microsoft Academic Search

    François Nantel; Lucia Monaco; Nicholas S. Foulkes; Denis Masquilier; Marianne Lemeur; Kenth Henriksén; Andrée Dierich; Martti Parvinen; Paolo Sassone-Corsi

    1996-01-01

    SPERMIOGENESIS is a complex process by which postmeiotic male germ cells differentiate into mature spermatozoa. This process involves remarkable structural and biochemical changes including nuclear DNA compaction and acrosome formation1,2. Tran-scriptional activator CREM (cyclic AMP-responsive element modulator) is highly expressed in postmeiotic cells3-5, and CREM may be responsible for the activation of several haploid germ cell-specific genes involved in the

  20. Delayed hyperbaric oxygen therapy induces cell proliferation through stabilization of cAMP responsive element binding protein in the rat model of MCAo-induced ischemic brain injury

    PubMed Central

    Mu, Jun; Ostrowski, Robert P.; Soejima, Yoshiteru; Rolland, William B.; Krafft, Paul R.; Tang, Jiping; Zhang, John H.

    2012-01-01

    Treatments that could extend the therapeutic window of opportunity for stroke patients are urgently needed. Early administration of hyperbaric oxygen therapy (HBOT) has been proven neuroprotective in the middle cerebral artery occlusion (MCAo) in rodents. Our aim was to determine: 1) whether delayed HBOT after permanent MCAo (pMCAo) can still convey neuroprotection and restorative cell proliferation, and 2) whether these beneficial effects rely on HBO-induced activation of protein phosphatase-1? (PP1-?) leading to a decreased phosphorylation and ubiquitination of CREB and hence its stabilization. The experiments were performed in one hundred thirty-two male Sprague-Dawley rats with the body weight ranging from 240 to 270 g. Permanent MCAo was induced with the intraluminal filament occluding the right middle cerebral artery (MCA). In the first experiment, HBOT (2.5 ATA, 1 hr daily for 10 days) was started 48 hrs after pMCAo. Neurobehavioral deficits and infarct size as well as cyclic AMP response element-binding protein (CREB) expression and BrdU-DAB staining in the hippocampus and the peri-infarct region were evaluated on day 14 and day 28 post-MCAo. In the second experiment, HBOT (2.5 ATA, 1 hr) was started 3 hrs after pMCAo. The effects of CREB siRNA or PP1-? siRNA on HBO-induced infarct size alterations and target proteins expression were studied. HBOT started with 48 hr delay reduced infarct size, ameliorated neurobehavioral deficits and increased protein expression of CREB, resulting in increased cell proliferations in the hippocampus and peri-infarct region, on day 14 and day 28 post-MCAo. In the acute experiment pMCAo resulted in cerebral infarction and functional deterioration and reduced brainexpression of PP1-?, which led to increased phosphorylation and ubiquitination of CREB 24 hrs after MCAo. However HBOT administered 3 hrs after ischemia reversed these molecular events and resulted in CREB stabilization, infarct size reduction and neurobehavioral improvement. Gene silencing with CREB siRNA or PP1-? siRNA reduced acute beneficial effects of HBO. In conclusion, delayed daily HBOT presented as potent neuroprotectant in pMCAo rats, increased CREB expression and signaling activity, and bolstered regenerative type cell proliferation in the injured brain. As shown in the acute experiment these effects of HBO were likely to be mediated by reducing ubiquitin-dependent CREB degradation owing to HBO-induced activation of PP1?. PMID:23146993

  1. Delayed hyperbaric oxygen therapy induces cell proliferation through stabilization of cAMP responsive element binding protein in the rat model of MCAo-induced ischemic brain injury.

    PubMed

    Mu, Jun; Ostrowski, Robert P; Soejima, Yoshiteru; Rolland, William B; Krafft, Paul R; Tang, Jiping; Zhang, John H

    2013-03-01

    Treatments that could extend the therapeutic window of opportunity for stroke patients are urgently needed. Early administration of hyperbaric oxygen therapy (HBOT) has been proven neuroprotective in the middle cerebral artery occlusion (MCAo) in rodents. Our aim was to determine: 1) whether delayed HBOT after permanent MCAo (pMCAo) can still convey neuroprotection and restorative cell proliferation, and 2) whether these beneficial effects rely on HBO-induced activation of protein phosphatase-1? (PP1-?) leading to a decreased phosphorylation and ubiquitination of CREB and hence its stabilization. The experiments were performed in one hundred thirty-two male Sprague-Dawley rats with the body weight ranging from 240 to 270 g. Permanent MCAo was induced with the intraluminal filament occluding the right middle cerebral artery (MCA). In the first experiment, HBOT (2.5 ATA, 1h daily for 10 days) was started 48 h after pMCAo. Neurobehavioral deficits and infarct size as well as cyclic AMP response element-binding protein (CREB) expression and BrdU-DAB staining in the hippocampus and the peri-infarct region were evaluated on day 14 and day 28 post-MCAo. In the second experiment, HBOT (2.5 ATA, 1h) was started 3h after pMCAo. The effects of CREB siRNA or PP1-? siRNA on HBO-induced infarct size alterations and target protein expression were studied. HBOT started with 48 h delay reduced infarct size, ameliorated neurobehavioral deficits and increased protein expression of CREB, resulting in increased cell proliferations in the hippocampus and peri-infarct region, on day 14 and day 28 post-MCAo. In the acute experiment pMCAo resulted in cerebral infarction and functional deterioration and reduced brain expression of PP1-?, which led to increased phosphorylation and ubiquitination of CREB 24h after MCAo. However HBOT administered 3h after ischemia reversed these molecular events and resulted in CREB stabilization, infarct size reduction and neurobehavioral improvement. Gene silencing with CREB siRNA or PP1-? siRNA reduced acute beneficial effects of HBO. In conclusion, delayed daily HBOT presented as potent neuroprotectant in pMCAo rats, increased CREB expression and signaling activity, and bolstered regenerative type cell proliferation in the injured brain. As shown in the acute experiment these effects of HBO were likely to be mediated by reducing ubiquitin-dependent CREB degradation owing to HBO-induced activation of PP1?. PMID:23146993

  2. Enterobacter-Activated Mosquito Immune Responses to Plasmodium Involve Activation of SRPN6 in Anopheles stephensi

    PubMed Central

    Jacobs-Lorena, Marcelo

    2013-01-01

    Successful development of Plasmodium in the mosquito is essential for the transmission of malaria. A major bottleneck in parasite numbers occurs during midgut invasion, partly as a consequence of the complex interactions between the endogenous microbiota and the mosquito immune response. We previously identified SRPN6 as an immune component which restricts Plasmodium berghei development in the mosquito. Here we demonstrate that SRPN6 is differentially activated by bacteria in Anopheles stephensi, but only when bacteria exposure occurs on the lumenal surface of the midgut epithelium. Our data indicate that AsSRPN6 is strongly induced following exposure to Enterobacter cloacae, a common component of the mosquito midgut microbiota. We conclude that AsSRPN6 is a vital component of the E. cloacae-mediated immune response that restricts Plasmodium development in the mosquito An. stephensi. PMID:23658788

  3. Enterobacter-activated mosquito immune responses to Plasmodium involve activation of SRPN6 in Anopheles stephensi.

    PubMed

    Eappen, Abraham G; Smith, Ryan C; Jacobs-Lorena, Marcelo

    2013-01-01

    Successful development of Plasmodium in the mosquito is essential for the transmission of malaria. A major bottleneck in parasite numbers occurs during midgut invasion, partly as a consequence of the complex interactions between the endogenous microbiota and the mosquito immune response. We previously identified SRPN6 as an immune component which restricts Plasmodium berghei development in the mosquito. Here we demonstrate that SRPN6 is differentially activated by bacteria in Anopheles stephensi, but only when bacteria exposure occurs on the lumenal surface of the midgut epithelium. Our data indicate that AsSRPN6 is strongly induced following exposure to Enterobacter cloacae, a common component of the mosquito midgut microbiota. We conclude that AsSRPN6 is a vital component of the E. cloacae-mediated immune response that restricts Plasmodium development in the mosquito An. stephensi. PMID:23658788

  4. Proteomic profile of Aspergillus flavus in response to water activity.

    PubMed

    Zhang, Feng; Zhong, Hong; Han, Xiaoyun; Guo, Zhenni; Yang, Weiqiang; Liu, Yongfeng; Yang, Kunlong; Zhuang, Zhenhong; Wang, Shihua

    2015-03-01

    Aspergillus flavus, a common contaminant of crops and stored grains, can produce aflatoxins that are harmful to humans and other animals. Water activity (aw) is one of the key factors influencing both fungal growth and mycotoxin production. In this study, we used the isobaric tagging for relative and absolute quantitation (iTRAQ) technique to investigate the effect of aw on the proteomic profile of A. flavus. A total of 3566 proteins were identified, of which 837 were differentially expressed in response to variations in aw. Among these 837 proteins, 403 were over-expressed at 0.99 aw, whereas 434 proteins were over-expressed at 0.93 aw. According to Gene Ontology (GO) analysis, the secretion of extracellular hydrolases increased as aw was raised, suggesting that extracellular hydrolases may play a critical role in induction of aflatoxin biosynthesis. On the basis of Clusters of Orthologous Groups (COG) and Kyoto Encyclopedia of Genes and Genomes (KEGG) categorizations, we identified an exportin protein, KapK, that may down-regulate aflatoxin biosynthesis by changing the location of NirA. Finally, we considered the role of two osmotic stress-related proteins (Sln1 and Glo1) in the Hog1 pathway and investigated the expression patterns of proteins related to aflatoxin biosynthesis. The data uncovered in this study are critical for understanding the effect of water stress on toxin production and for the development of strategies to control toxin contamination of agricultural products. PMID:25749363

  5. Application of constrained optimization to active control of aeroelastic response

    NASA Technical Reports Server (NTRS)

    Newsom, J. R.; Mukhopadhyay, V.

    1981-01-01

    Active control of aeroelastic response is a complex in which the designer usually tries to satisfy many criteria which are often conflicting. To further complicate the design problem, the state space equations describing this type of control problem are usually of high order, involving a large number of states to represent the flexible structure and unsteady aerodynamics. Control laws based on the standard Linear-Quadratic-Gaussian (LQG) method are of the same high order as the aeroelastic plant. To overcome this disadvantage of the LQG mode, an approach developed for designing low order optimal control laws which uses a nonlinear programming algorithm to search for the values of the control law variables that minimize a composite performance index, was extended to the constrained optimization problem. The method involves searching for the values of the control law variables that minimize a basic performance index while satisfying several inequality constraints that describe the design criteria. The method is applied to gust load alleviation of a drone aircraft.

  6. Title: Training Effects on Emergency Management Activation Response Subject Area: Social

    E-print Network

    Collett Jr., Jeffrey L.

    Title: Training Effects on Emergency Management Activation Response Subject Area: Social Keyword considered whether local and long-term emergency management training could produce different behavioral training on emergency management behavioral response. Individuals with higher levels of training engaged

  7. The in vitro effects of propranolol and atenolol on neutrophil motility and post-phagocytic metabolic activity.

    PubMed Central

    Anderson, R; van Rensburg, A J

    1979-01-01

    Propranolol at concentrations of 1 x 10(-6) to 1 x 10(-4) M consistently increased neutrophil motility as measured in Boyden chambers. The effects were not due solely to stimulation of random migration and chemokinesis but also of directional motility. Propranolol, over a similar concentration range, caused inhibition of post-phagocytic cell metabolic activity (hexose monophosphate shunt, nitro-blue tetrazolium reduction and protein iodination) without any detectable effect on the ingestion rate of Candida albicans. Atenolol had no effect on any of these neutrophil functions. Both drugs were without effect on glycolysis and intracellular cyclic AMP levels. Propranolol however, at concentrations which stimulated cell motility, caused increased intracellular cyclic GMP levels. It is suggested that propranolol may stimulate neutrophil motility by promoting increased intracellular cyclic GMP levels or by decreasing neutrophil superoxide production. PMID:223974

  8. Renal adenylate cyclase and the interrelationship between parathyroid hormone and vitamin D in the regulation of urinary phosphate and adenosine cyclic 3',5'-monophosphate excretion.

    PubMed Central

    Forte, L R; Nickols, G A; Anast, C S

    1976-01-01

    This study examined the role of cyclic AMP in the phosphaturic response to parathyroid hormone in vitamin D-deficient rats. Infusion of purified bovine parathyroid hormone (13.3 mug/h) into control, D-fed, or D-deficient, thyroparathyroidectomized rats produced a sixfold increase in renal phosphate and cyclic AMP excretion in D-fed rats, but only a two- to threefold increase in both parameters in D-deficient animals. Intravenous injection of parathyroid hormone over the dosage range from 1-50 mug/kg resulted in a dose-dependent increase in phosphate and cyclic AMP excretion with both D-fed and D-deficient thyroparathyroidectomized rats. However, the D-deficient rats responded to these injections of parathyroid hormone with a two- to threefold increase in both renal phosphate and cyclic AMP excretion at the highest dose of 50 mug/kg, whereas the D-fed animals' response was 35-fold and 11-fold over control excretion levels of phosphate and cyclic AMP, respectively. To directly examine the role of the renal cortical adenylate cyclase system in the blunted phosphaturic and urinary cyclic AMP responses to parathyroid hormone in D-deficient rats, we prepared a plasma membrane fraction enriched in this enzyme activity from the renal cortex of D-fed and D-deficient thyroparathyroidectomized rats. The renal cortical adenylate cyclase of D-deficient rats showed significantly (P less than 0.001) less activation by parathyroid hormone over the hormone concentration range from 0.3 to 7.0 mug/ml than was observed with the enzyme prepared from D-fed animals. Basal adenylate cyclase activity and the fluoride-stimulated enzyme activity were not altered by the state of D-deficiency. These experiments demonstrate that the blunted phosphaturic response to parathyroid hormone observed in D-deficient rats is associated with the reduced responsiveness of the renal cortical adenylate cyclase to the hormone. Moreover, the defect in the renal membrane adenylate cyclase system appears to be localized at the level of PTH binding to membrane receptors or, alternatively, at the level of transmission of the hormone-receptor binding signal to the catalytic moiety of this membrane enzyme. Images PMID:175088

  9. The activity of cAMP-phosphodiesterase 4D7 (PDE4D7) is regulated by protein kinase A-dependent phosphorylation within its unique N-terminus

    PubMed Central

    Byrne, Ashleigh M.; Elliott, Christina; Hoffmann, Ralf; Baillie, George S.

    2015-01-01

    The cyclic AMP phosphodiesterases type 4 (PDE4s) are expressed in a cell specific manner, with intracellular targeting directed by unique N-terminal anchor domains. All long form PDE4s are phosphorylated and activated by PKA phosphorylation within their upstream conserved region 1 (UCR1). Here, we identify and characterise a novel PKA site (serine 42) within the N-terminal region of PDE4D7, an isoform whose activity is known to be important in prostate cancer progression and ischemic stroke. In contrast to the UCR1 site, PKA phosphorylation of the PDE4D7 N-terminus appears to occur constitutively and inhibits PDE4 activity to allow cAMP signalling under basal conditions. PMID:25680530

  10. The Effect of Tip Geometry on Active-Twist Rotor Response

    NASA Technical Reports Server (NTRS)

    Wilbur, Matthew L.; Sekula, Martin K.

    2005-01-01

    A parametric examination of the effect of tip geometry on active-twist rotor system response is conducted. Tip geometry parameters considered include sweep, taper, anhedral, nonlinear twist, and the associated radial initiation location for each of these variables. A detailed study of the individual effect of each parameter on active-twist response is presented, and an assessment offered of the effect of combining multiple tip shape parameters. Tip sweep is shown to have the greatest affect on active-twist response, significantly decreasing the response available. Tip taper and anhedral are shown to increase moderately the active-twist response, while nonlinear twist is shown to have a minimal effect. A candidate tip shape that provides active-twist response equivalent to or greater than a rectangular planform blade is presented.

  11. Activation of defense responses to Fusarium infection in Asparagus densiflorus

    Microsoft Academic Search

    Chenyang He; Tom Hsiang; David J. Wolyn

    2001-01-01

    Defense responses to Fusarium oxysporum f. sp. asparagi and F. proliferatum were compared after root inoculation of the asparagus fern, Asparagus densiflorus vars. Myersii and Sprengeri, and cultivated asparagus, A. officinalis cv. Guelph Millennium. Both varieties of A. densiflorus exhibited a hypersensitive response with rapid death of epidermal cells within 8-24 h and restricted the fungal growth. In A. officinalis

  12. Activation of Defense Responses to Fusarium Infection in Asparagus densiflorus

    Microsoft Academic Search

    Chenyang He; Tom Hsiang; David J. Wolyn

    2001-01-01

    Defense responses to Fusarium oxysporum f. sp. asparagi and F. proliferatum were compared after root inoculation of the asparagus fern, Asparagus densiflorus vars. Myersii and Sprengeri, and cultivated asparagus, A. officinalis cv. Guelph Millennium. Both varieties of A. densiflorus exhibited a hypersensitive response with rapid death of epidermal cells within 8–24 h and restricted the fungal growth. In A. officinalis

  13. Analysis of Thyroid Response Element Activity during Retinal Development

    Microsoft Academic Search

    Nathan A. Billings; Mark M. Emerson; Constance L. Cepko

    2010-01-01

    Thyroid hormone (TH) signaling components are expressed during retinal development in dynamic spatial and temporal patterns. To probe the competence of retinal cells to mount a transcriptional response to TH, reporters that included thyroid response elements (TREs) were introduced into developing retinal tissue. The TREs were placed upstream of a minimal TATA-box and two reporter genes, green fluorescent protein (GFP)

  14. Magnetospheric impulse response for many levels of geomagnetic activity

    Microsoft Academic Search

    L. F. Bargatze; D. N. Baker; R. L. McPherron; Hones E. W. Jr

    1985-01-01

    The temporal relationship between the solar wind and magnetospheric activity has been studied using 34 intervals of high time resolution IMP 8 solar wind data and the corresponding AL auroral activity index. The median value of the AL index for each interval were utilized to rank the intervals according to geomagnetic activity level. The linear prediction filtering technique was then

  15. Photosynthetic activity of US biomes: responses to the spatial variability and seasonality of precipitation

    E-print Network

    Xiao, Jingfeng

    Photosynthetic activity of US biomes: responses to the spatial variability and seasonality­2000) for six biomes in the conterminous United States. We focused on within- and across-biome variance in long activity. Forested and nonforested biomes differed sharply in their response to spatial gradients

  16. Involvement of tissue plasminogen activator in stress responsivity during acute cocaine withdrawal in mice

    E-print Network

    Involvement of tissue plasminogen activator in stress responsivity during acute cocaine withdrawal to stress responsivity during cocaine withdrawal (WD). Recent studies suggest that tissue plasminogen activator (tPA) in the CeA is a downstream effector protein for CRF after acute "binge" cocaine

  17. Direct activation of the Mauthner cell by electric field pulses drives ultrarapid escape responses.

    PubMed

    Tabor, Kathryn M; Bergeron, Sadie A; Horstick, Eric J; Jordan, Diana C; Aho, Vilma; Porkka-Heiskanen, Tarja; Haspel, Gal; Burgess, Harold A

    2014-08-15

    Rapid escape swims in fish are initiated by the Mauthner cells, giant reticulospinal neurons with unique specializations for swift responses. The Mauthner cells directly activate motoneurons and facilitate predator detection by integrating acoustic, mechanosensory, and visual stimuli. In addition, larval fish show well-coordinated escape responses when exposed to electric field pulses (EFPs). Sensitization of the Mauthner cell by genetic overexpression of the voltage-gated sodium channel SCN5 increased EFP responsiveness, whereas Mauthner ablation with an engineered variant of nitroreductase with increased activity (epNTR) eliminated the response. The reaction time to EFPs is extremely short, with many responses initiated within 2 ms of the EFP. Large neurons, such as Mauthner cells, show heightened sensitivity to extracellular voltage gradients. We therefore tested whether the rapid response to EFPs was due to direct activation of the Mauthner cells, bypassing delays imposed by stimulus detection and transmission by sensory cells. Consistent with this, calcium imaging indicated that EFPs robustly activated the Mauthner cell but only rarely fired other reticulospinal neurons. Further supporting this idea, pharmacological blockade of synaptic transmission in zebrafish did not affect Mauthner cell activity in response to EFPs. Moreover, Mauthner cells transgenically expressing a tetrodotoxin (TTX)-resistant voltage-gated sodium channel retained responses to EFPs despite TTX suppression of action potentials in the rest of the brain. We propose that EFPs directly activate Mauthner cells because of their large size, thereby driving ultrarapid escape responses in fish. PMID:24848468

  18. Metabolic activity and collagen turnover in human tendon in response to physical activity.

    PubMed

    Kjaer, M; Langberg, H; Miller, B F; Boushel, R; Crameri, R; Koskinen, S; Heinemeier, K; Olesen, J L; Døssing, S; Hansen, M; Pedersen, S G; Rennie, M J; Magnusson, P

    2005-03-01

    Connective tissue of the human tendon plays an important role in force transmission. The extracellular matrix turnover of tendon is influenced by physical activity. Blood flow, oxygen demand, and the level of collagen synthesis and matrix metalloproteinases increase with mechanical loading. Gene transcription and especially post-translational modifications of proteins of the extracellular matrix are enhanced following exercise. Conversely, inactivity markedly decreases collagen turnover. Training leads to a chronically increased collagen turnover, and dependent on the type of collagen also to some degree of net collagen synthesis. These changes modify the biomechanical properties of the tissue (for example, viscoelastic characteristics) as well as the structural properties of the in collagen (for example, cross-sectional area). Mechanical loading of human tendon does result in a marked interstitial increase in growth factors that are known potentially to stimulate synthesis of collagen and other extracellular matrix proteins. Taken together, human tendon tissue mounts a vigorous acute and chronic response to mechanical loading in terms of metabolic-circulatory changes as well as of extracellular matrix formation. These changes may contribute to training-induced adaptation of biomechanical properties consisting of altered resistance to loading and enhanced tolerance to strenuous exercise. Understanding of such changes is a pre-requisite in the development of measures aimed at prevention of overuse tendon injuries occurring during sport, work or leisure-related activities. PMID:15788870

  19. WATER: Water Activities Teaching Environmental Responsibility: Teacher Resource, Environmental Science.

    ERIC Educational Resources Information Center

    Kramer, Ed, Ed.; And Others

    This activity book was developed as part of an effort to protect water quality of the Stillwater River, Ohio, through a Watershed Protection Project. It is designed to raise teachers' and students' awareness and trigger a sense of stewardship towards the preservation of water resources. The activities are generally appropriate for elementary age…

  20. Corporate social responsibility, new activism and public relations

    Microsoft Academic Search

    Kristin Demetrious

    2008-01-01

    Purpose – This paper aims to analyse why some contemporary corporate organisations are reluctant to articulate the effect of their market positioning behaviour on the unwilling communities that oppose their activities. It describes the communicative interactions between several large corporate organisations and the grassroots activist groups opposing their activities, in Victoria, Australia. Design\\/methodology\\/approach – Extensive secondary data were collected, including

  1. Mechanisms Establishing TLR4Responsive Activation States of Inflammatory Response Genes

    Microsoft Academic Search

    Laure Escoubet-Lozach; Christopher Benner; Minna U. Kaikkonen; Jean Lozach; Sven Heinz; Nathan J. Spann; Andrea Crotti; Josh Stender; Serena Ghisletti; Donna Reichart; Christine S. Cheng; Rosa Luna; Colleen Ludka; Roman Sasik; Ivan Garcia-Bassets; Alexander Hoffmann; Shankar Subramaniam; Gary Hardiman; Michael G. Rosenfeld; Christopher K. Glass

    2011-01-01

    Precise control of the innate immune response is required for resistance to microbial infections and maintenance of normal tissue homeostasis. Because this response involves coordinate regulation of hundreds of genes, it provides a powerful biological system to elucidate the molecular strategies that underlie signal- and time-dependent transitions of gene expression. Comprehensive genome-wide analysis of the epigenetic and transcription status of

  2. Prostate response to prolactin in sexually active male rats

    Microsoft Academic Search

    Maria Elena Hernandez; Abraham Soto-Cid; Fausto Rojas; Luz I Pascual; Gonzalo E Aranda-Abreu; Rebeca Toledo; Luis I Garcia; Andres Quintanar-Stephano; Jorge Manzo

    2006-01-01

    BACKGROUND: The prostate is a key gland in the sexual physiology of male mammals. Its sensitivity to steroid hormones is widely known, but its response to prolactin is still poorly known. Previous studies have shown a correlation between sexual behaviour, prolactin release and prostate physiology. Thus, here we used the sexual behaviour of male rats as a model for studying

  3. Metabolic and Cardiovascular Responses of Children during Prolonged Physical Activity.

    ERIC Educational Resources Information Center

    Chausow, Sharon A.; And Others

    1984-01-01

    Metabolic and cardiovascular responses during 45 minutes of continuous moderate intensity exercise were investigated in 11 children, 8-11 years of age. Results indicate that children exhibit metabolic and cardiovascular adjustments similar to those noted in adults during prolonged exercise. (Author/JMK)

  4. responses via induction of activation of TGF-f3

    Microsoft Academic Search

    DAOHONG ZHOU; ANDREW MUNSTER; RICHARD A. WINCHURCH

    Interleukin 6 levels are increased in a var- iety of clinical conditions including bacterial and viral infections, HIV infection, autoimmune diseases, certain neoplasias, and traumatic injury. In general, all these conditions are characterized by suppression of one or more manifestations of the immune response. Concentra- tions of IL 6 comparable to those found in the sera of im- munosuppressed, thermally

  5. Controlling NK Cell Responses: Integration of Signals for Activation and Inhibition

    PubMed Central

    Long, Eric O.; Kim, Hun Sik; Liu, Dongfang; Peterson, Mary E.; Rajagopalan, Sumati

    2013-01-01

    Understanding how signals are integrated to control NK cell responsiveness in the absence of antigen-specific receptors has been a challenge, but recent work has revealed some underlying principles that govern NK cell responses. NK cells use an array of innate receptors to sense their environment and respond to alterations caused by infections, cellular stress and transformation. No single activation receptor dominates; instead, synergistic signals from combinations of receptors are integrated to activate natural cytotoxicity and cytokine production. Inhibitory receptors for MHC class I have a critical role in controlling NK cell responses and paradoxically, in maintaining NK cells in a state of responsiveness to subsequent activation events, a process referred to as licensing. MHC-I specific inhibitory receptors both block activation signals and trigger signals to phosphorylate and inactivate the small adaptor Crk. These different facets of inhibitory signaling are incorporated into a revocable license model for the reversible tuning of NK cell responsiveness. PMID:23516982

  6. Dorsal cochlear nucleus response properties following acoustic trauma: Response maps and spontaneous activity

    PubMed Central

    Ma, Wei-Li Diana; Young, Eric D.

    2006-01-01

    Recordings from single neurons in the dorsal cochlear nucleus (DCN) of unanesthetized (decerebrate) cats were done to characterize the effects of acoustic trauma. Trauma was produced by a 250 Hz band of noise centered at 10 kHz, presented at 105–120 dB SPL for 4 h. After a one-month recovery period, neurons were recorded in the DCN. The threshold shift, determined from compound action-potential audiograms, showed a sharp threshold elevation of about 60 dB at BFs above an edge frequency of 5–10 kHz. The response maps of neurons with best frequencies (BFs) above the edge did not show the typical organization of excitatory and inhibitory areas seen in the DCN of unexposed animals. Instead, neurons showed no response to sound, weak responses that were hard to tune and characterize, or “tail” responses, consisting of broadly-tuned, predominantly excitatory responses, with a roughly low-pass shape similar to the tuning curves of auditory nerve fibers with similar threshold shifts. In some tail responses whose BFs were near the edge of the threshold elevation, a second weak high-frequency response was seen that suggests convergence of auditory nerve inputs with widely separated BFs on these cells. Spontaneous rates among neurons with elevated thresholds were not increased over those in populations of principal neurons in unexposed animals. PMID:16630701