These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

A Drosophila CREB/CREM homolog encodes multiple isoforms, including a cyclic AMP-dependent protein kinase-responsive transcriptional activator and antagonist.  

PubMed Central

We have characterized a Drosophila gene that is a highly conserved homolog of the mammalian cyclic AMP (cAMP)-responsive transcription factors CREB and CREM. Uniquely among Drosophila genes characterized to date, it codes for a cAMP-responsive transcriptional activator. An alternatively spliced product of the same gene is a specific antagonist of cAMP-inducible transcription. Analysis of the splicing pattern of the gene suggests that the gene may be the predecessor of the mammalian CREB and CREM genes. PMID:7651429

Yin, J C; Wallach, J S; Wilder, E L; Klingensmith, J; Dang, D; Perrimon, N; Zhou, H; Tully, T; Quinn, W G

1995-01-01

2

Induction of cyclooxygenase-2 by ginsenoside Rd via activation of CCAAT-enhancer binding proteins and cyclic AMP response binding protein  

SciTech Connect

Panax ginseng is a widely used herbal medicine in East Asia and is reported to have a variety of pharmacological effects against cardiovascular diseases and cancers. Here we show a unique effect of ginsenoside Rd (Rd) on cyclooxygenase-2 (COX-2) expression in RAW264.7 macrophages. Rd (100 {mu}g/ml), but not other ginsenosides induced COX-2 and increased prostaglandin E{sub 2} production. Gel shift and Western blot analyses using nuclear fractions revealed that Rd increased both the DNA binding of and the nuclear levels of CCAAT/enhancer binding protein (C/EBP){alpha}/{beta} and cyclic AMP response element binding protein (CREB), but not of p65, in RAW264.7 cells. Moreover, Rd increased the luciferase reporter gene activity in cells transfected with a 574-bp mouse COX-2 promoter construct. Site-specific mutation analyses confirmed that Rd-mediated transcriptional activation of COX-2 gene was regulated by C/EBP and CREB. These results provide evidence that Rd activated C/EBP and CREB, and that the activation of C/EBP and CREB appears to be essential for induction of COX-2 in RAW264.7 cells.

Jeong, Hye Gwang [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Pokharel, Yuba Raj [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Han, Eun Hee [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of); Kang, Keon Wook [BK21 Project Team, College of Pharmacy, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759, South Korea (Korea, Republic of)]. E-mail: kwkang@chosun.ac.kr

2007-07-20

3

Neuronal NF1/RAS regulation of cyclic AMP requires atypical PKC activation.  

PubMed

Neurofibromatosis type 1 (NF1) is a common neurodevelopmental disorder in which affected individuals are prone to learning, attention and behavioral problems. Previous studies in mice and flies have yielded conflicting results regarding the specific effector pathways responsible for NF1 protein (neurofibromin) regulation of neuronal function, with both cyclic AMP (cAMP)- and RAS-dependent mechanisms described. Herein, we leverage a combination of induced pluripotent stem cell-derived NF1 patient neural progenitor cells and Nf1 genetically engineered mice to establish, for the first time, that neurofibromin regulation of cAMP requires RAS activation in human and mouse neurons. However, instead of involving RAS-mediated MEK/AKT signaling, RAS regulation of cAMP homeostasis operates through the activation of atypical protein kinase C zeta, leading to GRK2-driven G?s inactivation. These findings reveal a novel mechanism by which RAS can regulate cAMP levels in the mammalian brain. PMID:25070947

Anastasaki, Corina; Gutmann, David H

2014-12-20

4

The Cyclic AMP-Cyclic AMP Receptor Protein Complex Regulates Activity of the traJ Promoter of the Escherichia coli Conjugative Plasmid pRK100  

Microsoft Academic Search

The TraJ protein is a central activator of F-like plasmid conjugal transfer. In a search for regulators of traJ expression, we studied the possible regulatory role of the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex in traJ transcription using a traJ-lacZ reporter system. A comparison of the enzyme activities in the wild-type Escherichia coli strain MC4100 with those in cya

M. Starcic; D. Zgur-Bertok; B. J. A. M. Jordi; M. M. S. M. Wosten; W. Gaastra; J. P. M. van Putten

2003-01-01

5

Increased cyclic AMP response to forskolin in Epstein-Barr virus-transformed human B-lymphocytes derived from schizophrenics  

Microsoft Academic Search

Phorbol 12-myristate-13-acetate (PMA), a protein kinase C (PKC) activator, elevated basal cyclic AMP levels and enhanced\\u000a isoproterenol-, prostaglandin E1- (PGE1), forskolin- and cholera toxin-stimulated cyclic AMP accumulation in Epstein-Barr virus (EBV)-transformed human B-lymphocytes.\\u000a Staurosporine, a PKC inhibitor, significantly antagonized the increase in cyclic AMP accumulation produced by PMA, whereas\\u000a the inactive phorbol ester, 4?-phorbol 12,13-didecanoate (4?PDD), had no effect. Basal

Naoki Natsukari; Henrietta Kulaga; Ivory Baker; Richard Jed Wyatt; Joseph M. Masserano

1997-01-01

6

Modulation of calcium-activated non-specific cation currents by cyclic AMP-dependent phosphorylation in neurones of Helix.  

PubMed Central

1. Currents through calcium-activated non-specific cation (CAN) channels were studied in the fast burster neurone of Helix aspersa and Helix pomatia. CAN currents were activated by reproducible intracellular injections of small quantities of Ca2+ utilizing a fast, quantitative pressure injection technique. 2. External application of forskolin (10-25 microM), an activator of adenylate cyclase, caused the endogenous bursting activity of the cells to be replaced by beating activity. These same concentrations of forskolin reduced CAN currents reversibly to about 50%. 3. External application of IBMX (3-isobutyl-1-methylxanthine, 100 microM), an inhibitor of phosphodiesterase, the enzyme which breaks down cyclic AMP, reduced CAN currents reversibly to about 40%. 4. External application of the membrane-permeable cyclic AMP analogues 8-bromo-cyclic AMP and dibutyryl-cyclic AMP (100 microM) caused almost complete block of the CAN current. A marked reduction in the CAN current was also observed following quantitative injections of cyclic AMP (internal concentrations up to 50 microM) directly into the cells from a second pressure injection pipette. 5. Similar results were obtained with quantitative injections of the catalytic subunit (C-subunit) of the cyclic AMP-dependent protein kinase (internal concentrations 10(-4) units of enzyme) directly into the cells from a second pressure injection pipette. 6. Injection of the non-hydrolysable GTP analogue, GTP-gamma-S (internal concentrations 100 microM), which stimulates G-proteins, produced a prolonged increase in CAN current amplitude by as much as 300%. 7. External application of serotonin (100-200 microM) caused a transition from bursting to beating activity of the neurones and mimicked cyclic AMP's effects on CAN currents. Two other neurotransmitters, dopamine and acetylcholine, were not significantly effective in reducing CAN currents. 8. Injection of a peptide inhibitor of cyclic AMP-dependent protein kinase suppressed serotonin's action on bursting and on CAN current. 9. Our results indicate that CAN currents in Helix burster neurones are modulated by cyclic AMP-dependent membrane phosphorylation. They suggest that the physiological transmitter that induces this second messenger action is serotonin. The dual control of CAN channels by two second messengers, namely Ca2+ and cyclic AMP, has important functional implications. While Ca2+ activates these channels which generate the pacemaker current in these neurones, cyclic AMP-dependent phosphorylation down-regulates them, thereby resulting in modulation of neuronal bursting activity. PMID:1703569

Partridge, L D; Swandulla, D; Muller, T H

1990-01-01

7

Spatial Memory in the Morris Water Maze and Activation of Cyclic AMP Response Element-Binding (CREB) Protein within the Mouse Hippocampus  

ERIC Educational Resources Information Center

We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…

Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.

2008-01-01

8

Cyclic AMP-receptor protein activates aerobactin receptor IutA expression in Vibrio vulnificus.  

PubMed

The ferrophilic bacterium Vibrio vulnificus can utilize the siderophore aerobactin of Escherichia coli for iron acquisition via its specific receptor IutA. This siderophore piracy by V. vulnificus may contribute to its survival and proliferation, especially in mixed bacterial environments. In this study, we examined the effects of glucose, cyclic AMP (cAMP), and cAMP-receptor protein (Crp) on iutA expression in V. vulnificus. Glucose dose-dependently repressed iutA expression. A mutation in cya encoding adenylate cyclase required for cAMP synthesis severely repressed iutA expression, and this change was recovered by in trans complementing cya or the addition of exogenous cAMP. Furthermore, a mutation in crp encoding Crp severely repressed iutA expression, and this change was recovered by complementing crp. Accordingly, glucose deprivation under iron-limited conditions is an environmental signal for iutA expression, and Crp functions as an activator that regulates iutA expression in response to glucose availability. PMID:22538662

Kim, Choon-Mee; Kim, Seong-Jung; Shin, Sung-Heui

2012-04-01

9

The serum response factor nuclear localization signal: general implications for cyclic AMP-dependent protein kinase activity in control of nuclear translocation.  

PubMed Central

We have identified a basic sequence in the N-terminal region of the 67-kDa serum response factor (p67SRF or SRF) responsible for its nuclear localization. A peptide containing this nuclear localization signal (NLS) translocates rabbit immunoglobulin G (IgG) into the nucleus as efficiently as a peptide encoding the simian virus 40 NLS. This effect is abolished by substituting any two of the four basic residues in this NLS. Overexpression of a modified form of SRF in which these basic residues have been mutated confirms the absolute requirement for this sequence, and not the other basic amino acid sequences adjacent to it, in the nuclear localization of SRF. Since this NLS is in close proximity to potential phosphorylation sites for the cAMP-dependent protein kinase (A-kinase), we further investigated if A-kinase plays a role in the nuclear location of SRF. The nuclear transport of SRF proteins requires basal A-kinase activity, since inhibition of A-kinase by using either the specific inhibitory peptide PKIm or type II regulatory subunits (RII) completely prevents the nuclear localization of plasmid-expressed tagged SRF or an SRF-NLS-IgG conjugate. Direct phosphorylation of SRF by A-kinase can be discounted in this effect, since mutation of the putative phosphorylation sites in either the NLS peptide or the encoded full-length SRF protein had no effect on nuclear transport of the mutants. Finally, in support of an implication of A-kinase-dependent phosphorylation in a more general mechanism affecting nuclear import, we show that the nuclear transport of a simian virus 40-NLS-conjugated IgG or purified cyclin A protein is also blocked by inhibition of A-kinase, even though neither contains any potential sites for phosphorylation by A-kinase or can be phosphorylated by A-kinase in vitro. PMID:7799952

Gauthier-Rouviere, C; Vandromme, M; Lautredou, N; Cai, Q Q; Girard, F; Fernandez, A; Lamb, N

1995-01-01

10

Role of cyclic AMP in promoting the thromboresistance of human endothelial cells by enhancing thrombomodulin and decreasing tissue factor activities.  

PubMed Central

1. The effects of forskolin, prostaglandin E1 (PGE1), dibutyryl cyclic AMP (db cyclic AMP), dibutyryl cyclic GMP (db cyclic GMP) and 3-isobutyl-l-methyl-xanthine (IBMX) were investigated on the expression of tissue factor and thrombomodulin activities on the surface of human saphenous vein endothelial cells (HSVEC) in culture. 2. Forskolin (10(-6) to 10(-4) M), PGE1 (10(-7) to 10(-5) M) and db cyclic AMP (10(-4) to 10(-3) M) caused a concentration-dependent decrease of cytokine-induced tissue factor activity. 3. Similar concentrations of forskolin, PGE1 and db cyclic AMP enhanced significantly constitutive thrombomodulin activity and reversed the decrease of this activity caused by interleukin-1 (IL-1). 4. IBMX (10(-4) M) decreased tissue factor activity and enhanced the effect of forskolin on tissue factor and thrombomodulin activities. 5. Forskolin (10(-4) M) decreased the IL-1-induced tissue factor mRNA and increased the thrombomodulin mRNA level. IL-1 did not change the thrombomodulin mRNA level after 2 h of incubation with HSVEC in culture. 6. Dibutyryl cyclic GMP (10(-4) M to 10(-3) M) did not influence tissue factor or thrombomodulin activity. 7. Our data suggest that elevation of intracellular cyclic AMP levels may participate in the regulation of tissue factor and thrombomodulin expression, thus contributing to promote or restore antithrombotic properties of the endothelium. Images Figure 5 Figure 6 PMID:7684300

Archipoff, G.; Beretz, A.; Bartha, K.; Brisson, C.; de la Salle, C.; Froget-LA(C)on, C.; Klein-Soyer, C.; Cazenave, J. P.

1993-01-01

11

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.  

PubMed

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator. PMID:24936051

Aung, Htin Lin; Berney, Michael; Cook, Gregory M

2014-09-01

12

Phloretin differentially inhibits volume-sensitive and cyclic AMP-activated, but not Ca-activated, Cl? channels  

PubMed Central

Some phenol derivatives are known to block volume-sensitive Cl? channels. However, effects on the channel of the bisphenol phloretin, which is a known blocker of glucose uniport and anion antiport, have not been examined. In the present study, we investigated the effects of phloretin on volume-sensitive Cl? channels in comparison with cyclic AMP-activated CFTR Cl? channels and Ca2+-activated Cl? channels using the whole-cell patch-clamp technique.Extracellular application of phloretin (over 10??M) voltage-independently, and in a concentration-dependent manner (IC50 ?30??M), inhibited the Cl? current activated by a hypotonic challenge in human epithelial T84, Intestine 407 cells and mouse mammary C127/CFTR cells.In contrast, at 30??M phloretin failed to inhibit cyclic AMP-activated Cl? currents in T84 and C127/CFTR cells. Higher concentrations (over 100??M) of phloretin, however, partially inhibited the CFTR Cl? currents in a voltage-dependent manner.At 30 and 300??M, phloretin showed no inhibitory effect on Ca2+-dependent Cl? currents induced by ionomycin in T84 cells.It is concluded that phloretin preferentially blocks volume-sensitive Cl? channels at low concentrations (below 100??M) and also inhibits cyclic AMP-activated Cl? channels at higher concentrations, whereas phloretin does not inhibit Ca2+-activated Cl? channels in epithelial cells. PMID:11487521

Fan, Hai-Tian; Morishima, Shigeru; Kida, Hajime; Okada, Yasunobu

2001-01-01

13

Heat shock response of Saccharomyces cerevisiae mutants altered in cyclic AMP-dependent protein phosphorylation.  

PubMed Central

When Saccharomyces cerevisiae cells grown at 23 degrees C were transferred to 36 degrees C, they initiated synthesis of heat shock proteins, acquired thermotolerance to a lethal heat treatment given after the temperature shift, and arrested their growth transiently at the G1 phase of the cell division cycle. The bcy1 mutant which resulted in production of cyclic AMP (cAMP)-independent protein kinase did not synthesize the three heat shock proteins hsp72A, hsp72B, and hsp41 after the temperature shift. The bcy1 cells failed to acquire thermotolerance to the lethal heat treatment and were not arrested at the G1 phase after the temperature shift. In contrast, the cyr1-2 mutant, which produced a low level of cAMP, constitutively produced three heat shock proteins and four other proteins without the temperature shift and was resistant to the lethal heat treatment. The results suggest that a decrease in the level of cAMP-dependent protein phosphorylation results in the heat shock response, including elevated synthesis of three heat shock proteins, acquisition of thermotolerance, and transient arrest of the cell cycle. Images PMID:3031463

Shin, D Y; Matsumoto, K; Iida, H; Uno, I; Ishikawa, T

1987-01-01

14

Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure  

SciTech Connect

Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

Gao Yanan [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China); Gao Ge [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China); Long Caixia [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China); Han Song [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China); Zu Pengyu [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China); Fang Li [Division of Neurosurgery, Department of Surgery, Neuroscience and Cell Biology, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-0517 (United States)]. E-mail: lfang@utmb.edu; Li Junfa [Institute for Biomedical Science of Pain, Beijing Key Laboratory for Neural Regeneration and Repairing, Department of Neurobiology, Capital University of Medical Sciences, No. 10 You AnMen Wai Xi Tou Tiao, Beijing 100054 (China)]. E-mail: junfali@cpums.edu.cn

2006-02-10

15

Transcription Activation Mediated by a Cyclic AMP Receptor Protein from Thermus thermophilus HB8  

Microsoft Academic Search

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus- Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms

Akeo Shinkai; Satoshi Kira; Noriko Nakagawa; Aiko Kashihara; Seiki Kuramitsu; Shigeyuki Yokoyama

2007-01-01

16

A physiological response (plasma cyclic amp) and a psychological response (STAI-A-state) to noise exposure and/or calculation task  

NASA Astrophysics Data System (ADS)

The effects of 90 dB(A) noise exposure and/or a calculation task on plasma cyclic AMP concentrations (physiological index) and STAI-A-State scores (psychological index) in normal subjects are compared. Neither the plasma cyclic AMP concentration nor the STAI-A-State scores showed any significant change in response to the calculation task. STAI-A-State scores increased significantly only in response to 90 dB(A) noise exposure, while both the indices showed significant increases under the effects of both noise exposure and the calculation task. The sensitivity of the rate of increase in plasma cyclic AMP caused by noise exposure plus the calculation task was higher than that of the rate of increase in scores on the A-State scale caused by this noise exposure/task combination. The physiological effect in human subjects of noise exposure became larger when a psychological stress (calculation task) was added.

Iwamoto, M.; Ishii, F.; Yoneda, J.; Morie, T.; Harada, N.

1995-10-01

17

Activation of the adenylyl cyclase/cyclic AMP/protein kinase A pathway in endothelial cells exposed to cyclic strain  

NASA Technical Reports Server (NTRS)

The aim of this study was to assess the involvement of the adenylyl cyclase/cyclic AMP/protein kinase A pathway (AC) in endothelial cells (EC) exposed to different levels of mechanical strain. Bovine aortic EC were seeded to confluence on flexible membrane-bottom wells. The membranes were deformed with either 150 mm Hg (average 10% strain) or 37.5 mm Hg (average 6% strain) vacuum at 60 cycles per minute (0.5 s strain; 0.5 s relaxation) for 0-60 min. The results demonstrate that at 10% average strain (but not 6% average strain) there was a 1.5- to 2.2-fold increase in AC, cAMP, and PKA activity by 15 min when compared to unstretched controls. Further studies revealed an increase in cAMP response element binding protein in EC subjected to the 10% average strain (but not 6% average strain). These data support the hypothesis that cyclic strain activates the AC/cAMP/PKA signal transduction pathway in EC which may occur by exceeding a strain threshold and suggest that cyclic strain may stimulate the expression of genes containing cAMP-responsive promoter elements.

Cohen, C. R.; Mills, I.; Du, W.; Kamal, K.; Sumpio, B. E.

1997-01-01

18

Transcription from a murine T-cell receptor V beta promoter depends on a conserved decamer motif similar to the cyclic AMP response element.  

PubMed Central

We identified a regulatory region of the murine V beta promoter by both in vivo and in vitro analyses. The results of transient transfection assays indicated that the dominant transcription-activating element within the V beta 8.3 promoter is the palindromic motif identified previously as the conserved V beta decamer. Elimination of this element, by linear deletion or specific mutation, reduced transcriptional activity from this promoter by 10-fold. DNase I footprinting, gel mobility shift, and methylation interference assays confirmed that the palindrome acts as the binding site of a specific nuclear factor. In particular, the V beta promoter motif functioned in vitro as a high-affinity site for a previously characterized transcription activator, ATF. A consensus cyclic AMP response element (CRE) but not a consensus AP-1 site, can substitute for the decamer in vivo. These data suggest that cyclic AMP response element-binding protein (ATF/CREB) or related proteins activate V beta transcription. Images PMID:2557542

Anderson, S J; Miyake, S; Loh, D Y

1989-01-01

19

Mect1-Maml2 Fusion Oncogene Linked to the Aberrant Activation of Cyclic AMP\\/CREB Regulated Genes  

Microsoft Academic Search

Malignant salivary gland tumors can arise from a t(11;19) translocation that fuses 42 residues from Mect1\\/Torc1, a cyclic AMP (cAMP)\\/cAMP-responsive element binding protein (CREB)-dependent transcriptional coactivator, with 982 residues from Maml2, a NOTCH receptor coactivator. To determine if the Mect1-Maml2 fusion oncogene mediates tumorigenicity by disrupting cAMP\\/CREB signaling, we have generated in-frame deletions within the CREB-binding domain of Mect1\\/Torc1 for

Amy Coxon; Ester Rozenblum; Yoon-Soo Park; Nina Joshi; Junji Tsurutani; Phillip A. Dennis; Ilan R. Kirsch; Frederic J. Kaye

20

Use of a synthetic dodecapeptide (malantide) to measure the cyclic AMP-dependent protein kinase activity ratio in a variety of tissues.  

PubMed Central

1. The cyclic AMP-dependent protein kinase activity-ratio assay was investigated by comparing histone and a synthetic peptide, malantide [Malencik & Anderson (1983) Anal. Biochem. 132, 32-40], as substrates. 2. In several tissues the activity ratio was higher when assayed with histone as the substrate; this result was obtained in control tissues and also in those incubated with agents known to increase cyclic AMP. The effect of these agents to increase the activity ratio was more clearly demonstrated with malantide. 3. The higher activity ratios observed with histone are due to: (a) measurement of phosphorylation not catalysed by cyclic AMP-dependent protein kinase; (b) activation of cyclic AMP-dependent protein kinase by histone during the assay. 4. When tissues were homogenized in buffers without NACl, lower activity ratios were found, owing to the catalytic subunit being artifactually removed from the supernatant. 5. We conclude that the measured activity ratio more faithfully reflects that in the tissue when NaCl is included in the homogenization buffer and malantide is used in the assay. This was confirmed in experiments where cyclic AMP-dependent protein kinase was added to the tissue before homogenization, and no dissociation of the exogenous enzyme was observed. PMID:2160235

Murray, K J; England, P J; Lynham, J A; Mills, D; Schmitz-Peiffer, C; Reeves, M L

1990-01-01

21

Molecular Components of Striatal Plasticity: The Various Routes of Cyclic AMP Pathways  

PubMed Central

Neuroplasticity serves an important role for normal striatal function and in disease states. One route to neuroplasticity involves activation of the transcription factor cyclic 3?,5?-adenosine monophosphate (cyclic AMP) response element binding protein (CREB) by phosphorylation of the amino acid 133Ser. Dopamine and glutamate, the two predominant neurotransmitters in the striatum, induce CREB phosphorylation in primary cultures of rat striatum through cyclic AMP and Ca2+ pathways. Here we present the role of N-methyl-D-aspartate receptors and Ca2+ in cyclic AMP-mediated CREB phosphorylation. PMID:9691194

Rajadhyaksha, Anjali; Leveque, Jean-Christophe; Macias, Wendy; Barczak, Amy; Konradi, Christine

2014-01-01

22

A selective increase in phosphorylation of cyclic AMP response element-binding protein in hippocampal CA1 region of male, but not female, rats following contextual fear and passive avoidance conditioning  

Microsoft Academic Search

Cyclic AMP response element-binding protein (CREB), a transcription factor on which multiple signal transduction pathways converge, has been implicated in long-term memory. We examined whether the sex difference in the performance of contextual fear or passive avoidance conditioning is associated with a change in the activation of CREB in the hippocampus, a neural structure important for long-term memory. The activation

Koutarou Kudo; Chun-Xiang Qiao; Shigenobu Kanba; Jun Arita

2004-01-01

23

Involvement of the cyclic AMP-responsive element binding protein in bovine leukemia virus expression in vivo.  

PubMed Central

The TAR element (Tax-responsive element; also called TxRE) is a major determinant of the regulation of bovine leukemia virus (BLV) expression. In order to gain insight into the mechanisms of viral expression, complexes formed between proteins and the TAR enhancer DNA were analyzed by gel retardation assays. We report here that nuclear lysates from ex vivo-isolated B lymphocytes contain proteins that specifically bind to TAR. An antibody directed toward the cyclic AMP-responsive element binding (CREB) protein supershifted a complex (C1) present only in BLV-infected B lymphocytes. The CREB protein thus appears to be a major transcription factor involved in BLV expression in vivo. Images PMID:8057465

Adam, E; Kerkhofs, P; Mammerickx, M; Kettmann, R; Burny, A; Droogmans, L; Willems, L

1994-01-01

24

Cyclic AMP in prokaryotes.  

PubMed Central

Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

Botsford, J L; Harman, J G

1992-01-01

25

Transcription activation by the Escherichia coli cyclic AMP receptor protein: determinants within activating region 3 1 1 Edited by R. Ebright  

Microsoft Academic Search

At Class II CRP-dependent promoters, the Escherichia coli cyclic AMP receptor protein (CRP) activates transcription by making multiple interactions with RNA polymerase (RNAP). Two discrete surfaces of CRP, known as Activating Region 1 (AR1) and Activating Region 2 (AR2), interact with the C-terminal and N-terminal domains, respectively, of the ? subunit of RNAP. Activating Region 3 (AR3) is a third

Virgil A Rhodius; Stephen J. W Busby

2000-01-01

26

Outer Dynein Arm Light Chain 1 Is Essential for Controlling the Ciliary Response to Cyclic AMP in Paramecium tetraurelia  

PubMed Central

The individual role of the outer dynein arm light chains in the molecular mechanisms of ciliary movements in response to second messengers, such as Ca2+ and cyclic nucleotides, is unclear. We examined the role of the gene termed the outer dynein arm light chain 1 (LC1) gene of Paramecium tetraurelia (ODAL1), a homologue of the outer dynein arm LC1 gene of Chlamydomonas reinhardtii, in ciliary movements by RNA interference (RNAi) using a feeding method. The ODAL1-silenced (ODAL1-RNAi) cells swam slowly, and their swimming velocity did not increase in response to membrane-hyperpolarizing stimuli. Ciliary movements on the cortical sheets of ODAL1-RNAi cells revealed that the ciliary beat frequency was significantly lower than that of control cells in the presence of ?1 mM Mg2+-ATP. In addition, the ciliary orientation of ODAL1-RNAi cells did not change in response to cyclic AMP (cAMP). A 29-kDa protein phosphorylated in a cAMP-dependent manner in the control cells disappeared in the axoneme of ODAL1-RNAi cells. These results indicate that ODAL1 is essential for controlling the ciliary response by cAMP-dependent phosphorylation. PMID:22427431

Kutomi, Osamu; Hori, Manabu; Ishida, Masaki; Tominaga, Takashi; Kamachi, Hiroyuki; Koll, France; Cohen, Jean; Yamada, Norico

2012-01-01

27

The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi.  

PubMed Central

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi. PMID:9171393

Reverchon, S; Expert, D; Robert-Baudouy, J; Nasser, W

1997-01-01

28

The cyclic AMP receptor protein is the main activator of pectinolysis genes in Erwinia chrysanthemi.  

PubMed

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi. PMID:9171393

Reverchon, S; Expert, D; Robert-Baudouy, J; Nasser, W

1997-06-01

29

Cyclic AMP-dependent functional forms of cyclic AMP receptor protein from Vibrio cholerae  

Microsoft Academic Search

The cyclic AMP receptor protein (CRP) from Escherichia coli, involved in the transcriptional regulation of a number of genes and operons, works by binding to specific sites upstream of promoters. CRP also binds cyclic AMP (cAMP), and this binding, which causes conformational changes in CRP, is mandatory for its activity. A cAMP-dependent variation in the conformation as well as biological

Rima Chattopadhyay; Pradeep Parrack

2006-01-01

30

Interplay of the E box, the cyclic AMP response element, and HTF4/HEB in transcriptional regulation of the neurospecific, neurotrophin-inducible vgf gene.  

PubMed Central

vgf is a neurotrophin response-specific, developmentally regulated gene that codes for a neurosecretory polypeptide. Its transcription in neuronal cells is selectively activated by the neurotrophins nerve growth factor (NGF), brain-derived neurotrophic factor, and neurotrophin 3, which induce survival and differentiation, and not by epidermal growth factor. We studied a short region of the rat vgf promoter which is essential for its regulated expression. A cyclic AMP response element (CRE) within this region is necessary for NGF induction of vgf transcription. Two sites upstream of CRE, an E box and a CCAAT sequence, bind nuclear protein complexes and are involved in transcriptional control. The E box has a dual role. It acts as an inhibitor in NIH 3T3 fibroblasts, together with a second E box located downstream, and as a stimulator in the NGF-responsive cell line PC12. By expression screening, we have isolated the cDNA for a basic helix-loop-helix transcription factor, a homolog of the HTF4/HEB E protein, that specifically binds the vgf promoter E box. The E protein was present in various cell lines, including PC12 cells, and was a component of a multiprotein nuclear complex that binds the promoter in vitro. The E box and CRE cooperate in binding to this complex, which may be an important determinant for neural cell-specific expression. PMID:9032251

Di Rocco, G; Pennuto, M; Illi, B; Canu, N; Filocamo, G; Trani, E; Rinaldi, A M; Possenti, R; Mandolesi, G; Sirinian, M I; Jucker, R; Levi, A; Nasi, S

1997-01-01

31

Cyclic AMP Receptor Protein-Dependent Activation of the Escherichia coli acsP2 Promoter by a Synergistic Class III Mechanism  

Microsoft Academic Search

Received 12 February 2003\\/Accepted 16 June 2003 The cyclic AMP receptor protein (CRP) activates transcription of the Escherichia coli acs gene, which encodes an acetate-scavenging enzyme required for fitness during periods of carbon starvation. Two promoters direct transcription of acs, the distal acsP1 and the proximal acsP2. In this study, we demonstrated that acsP2 can function as the major promoter

Christine M. Beatty; Douglas F. Browning; Stephen J. W. Busby; Alan J. Wolfe

2003-01-01

32

The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice.  

PubMed

Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at -45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the AP1/dyad (AD) element at -205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at -91 or -95. However, in its native context at -205, the AD could not support expression. In contrast, a CRE, moved from its normal position at -45 to -206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context-and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines. PMID:7665571

Lazaroff, M; Patankar, S; Yoon, S O; Chikaraishi, D M

1995-09-15

33

Extracellular Signal-Regulated Kinase 5 and Cyclic AMP Response Element Binding Protein Are Novel Pathways Inhibited by Vandetanib (ZD6474) and Doxorubicin in Mesotheliomas.  

PubMed

Malignant mesothelioma (MM), lung cancers, and asbestosis are hyperproliferative diseases associated with exposures to asbestos. All have a poor prognosis; thus, the need to develop novel and effective therapies is urgent. Vandetanib (Van) (ZD6474, ZACTIMA) is a tyrosine kinase inhibitor that has shown equivocal results in clinical trials for advanced non-small cell lung cancer. However, tyrosine kinase inhibitors alone have shown no significant clinical activity in phase II trials of patients with unresectable MM. Using epithelioid (HMESO) and sarcomatoid (H2373) human MM lines, the efficacy of tumor cell killing and signaling pathways modulated by Van with and without doxorubicin (Dox) was examined. Van alone reduced total cell numbers in HMESO MM and synergistically increased the toxicity of Dox in HMESO and H2373 cells. Most importantly, we identified two novel cell survival/resistance pathways, ERK5 and cyclic AMP response element binding protein (CREB), that were inhibited by Van and Dox. After silencing of either ERK5 or CREB, significant decreases in cell numbers in the Dox-resistant sarcomatoid H2373 line were observed. Results suggest that a plethora of cell signaling pathways associated with cell survival are induced by Dox but inhibited by the addition of Van in MM. Data from our study support the combined efficacy of Van and Dox as a novel approach in the treatment of MM that is further enhanced by blocking ERK5 or CREB signaling cascades. PMID:24940987

Sayan, Mutlay; Shukla, Arti; MacPherson, Maximilian B; Macura, Sherrill L; Hillegass, Jedd M; Perkins, Timothy N; Thompson, Joyce K; Beuschel, Stacie L; Miller, Jill M; Mossman, Brooke T

2014-11-01

34

Activation of cyclic AMP-dependent kinase is required but may not be sufficient to mimic cyclic AMP-dependent DNA synthesis and thyroglobulin expression in dog thyroid cells.  

PubMed

Thyrotropin (TSH), via a cyclic AMP (cAMP)-dependent pathway, induces cytoplasmic retractions, proliferation, and differentiation expression in dog thyroid cells. The role of cAMP-dependent protein kinase (PKA) in the induction of these events was assessed by microinjection into living cells. Microinjection of the heat-stable inhibitor of PKA (PKI) inhibited the effects of TSH, demonstrating that activation of PKA was required in this process. Overexpression of the catalytic (C) subunit of PKA brought about by microinjection of the expression plasmid pC alpha ev or of purified C subunit itself was sufficient to mimic the cAMP-dependent cytoplasmic changes and thyroperoxidase mRNA expression but not to induce DNA synthesis and thyroglobulin (Tg) expression. The cAMP-dependent morphological effect was not observed when C subunit was coinjected with the regulatory subunit (RI or RII subunit) of PKA. To mimic the cAMP-induced PKA dissociation into free C and R subunits, the C subunit was coinjected with the regulation-deficient truncated RI subunit (RIdelta1-95) or with wild-type RI or native RII subunits, followed by incubation with TSH at a concentration too low to stimulate the cAMP-dependent events by itself. Although the cAMP-dependent morphology changes were still observed, neither DNA synthesis nor Tg expression was stimulated in these cells. Taken together, these data suggest that in addition to PKA activation, another cAMP-dependent mechanism could exist and play an important role in the transduction of the cAMP signal in thyroid cells. PMID:9343436

Dremier, S; Pohl, V; Poteet-Smith, C; Roger, P P; Corbin, J; Doskeland, S O; Dumont, J E; Maenhaut, C

1997-11-01

35

Activation of cyclic AMP-dependent kinase is required but may not be sufficient to mimic cyclic AMP-dependent DNA synthesis and thyroglobulin expression in dog thyroid cells.  

PubMed Central

Thyrotropin (TSH), via a cyclic AMP (cAMP)-dependent pathway, induces cytoplasmic retractions, proliferation, and differentiation expression in dog thyroid cells. The role of cAMP-dependent protein kinase (PKA) in the induction of these events was assessed by microinjection into living cells. Microinjection of the heat-stable inhibitor of PKA (PKI) inhibited the effects of TSH, demonstrating that activation of PKA was required in this process. Overexpression of the catalytic (C) subunit of PKA brought about by microinjection of the expression plasmid pC alpha ev or of purified C subunit itself was sufficient to mimic the cAMP-dependent cytoplasmic changes and thyroperoxidase mRNA expression but not to induce DNA synthesis and thyroglobulin (Tg) expression. The cAMP-dependent morphological effect was not observed when C subunit was coinjected with the regulatory subunit (RI or RII subunit) of PKA. To mimic the cAMP-induced PKA dissociation into free C and R subunits, the C subunit was coinjected with the regulation-deficient truncated RI subunit (RIdelta1-95) or with wild-type RI or native RII subunits, followed by incubation with TSH at a concentration too low to stimulate the cAMP-dependent events by itself. Although the cAMP-dependent morphology changes were still observed, neither DNA synthesis nor Tg expression was stimulated in these cells. Taken together, these data suggest that in addition to PKA activation, another cAMP-dependent mechanism could exist and play an important role in the transduction of the cAMP signal in thyroid cells. PMID:9343436

Dremier, S; Pohl, V; Poteet-Smith, C; Roger, P P; Corbin, J; Doskeland, S O; Dumont, J E; Maenhaut, C

1997-01-01

36

Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.  

PubMed

Presenilins, the catalytic components of the ?-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using ?-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature ?-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known ?-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

2013-12-01

37

Cyclic AMP Levels, Adenylyl Cyclase Activity, and Their Stimulation by Serotonin Quantif ied in Intact Neurons  

PubMed Central

In molluscan central neurons that express cAMP-gated Na+ current (INa,cAMP), estimates of the cAMP binding affinity of the channels have suggested that effective native intracellular cAMP concentrations should be much higher than characteristic of most cells. Using neurons of the marine opisthobranch snail Pleurobranchaea californica, we applied theory and conventional voltage clamp techniques to use INa,cAMP to report basal levels of endogenous cAMP and adenylyl cyclase, and their stimulation by serotonin. Measurements were calibrated to iontophoretic cAMP injection currents to enable expression of the data in molar terms. In 30 neurons, serotonin stimulated on average a 23-fold increase in submembrane [cAMP], effected largely by an 18-fold increase in adenylyl cyclase activity. Serotonin stimulation of adenylyl cyclase and [cAMP] was inversely proportional to cells' resting adenylyl cyclase activity. Average cAMP concentration at the membrane rose from 3.6 to 27.6 ?M, levels consistent with the expected cAMP dissociation constants of the INa,cAMP channels. These measures confirm the functional character of INa,cAMP in the context of high levels of native cAMP. Methods similar to those employed here might be used to establish critical characters of cyclic nucleotide metabolism in the many cells of invertebrates and vertebrates that are being found to express ion currents gated by direct binding of cyclic nucleotides. PMID:9276752

Sudlow, Leland C.; Gillette, Rhanor

1997-01-01

38

Cyclic AMP response element-binding protein in post-mortem brain of teenage suicide victims: specific decrease in the prefrontal cortex but not the hippocampus.  

PubMed

Abnormalities in both adenylyl cyclase (AC) and phosphoinositide (PI) signalling systems have been observed in the post-mortem brain of suicide victims. Cyclic AMP response element-binding protein (CREB) is a transcription factor that is activated by phosphorylating enzymes such as protein kinase A (PKA) and protein kinase C (PKC), which suggests that both AC and PI signalling systems converge at the level of CREB. CREB is involved in the transcription of many neuronally expressed genes that have been implicated in the pathophysiology of depression and suicide. Since we observed abnormalities of both PKA and PKC in the post-mortem brain of teenage suicide victims, we examined if these abnormalities are also associated with abnormalities of CREB, which is activated by these phosphorylating enzymes. We determined CRE-DNA binding using the gel shift assay, as well as protein expression of CREB using the Western blot technique, and the mRNA expression of CREB using a quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) technique in the prefrontal cortex (PFC), and hippocampus obtained from 17 teenage suicide victims and 17 matched normal control subjects. We observed that the CRE-DNA binding and the protein expression of CREB were significantly decreased in the PFC of teenage suicide victims compared with controls. There was also a significant decrease in mRNA expression of CREB in the PFC of teenage suicide victims compared with control subjects. However, there were no significant differences in CRE-DNA binding or the protein and mRNA expression of CREB in the hippocampus of teenage suicide victims compared with control subjects. These results suggest that the abnormalities of PKA, and of PKC, observed in teenage suicide victims are also associated with abnormalities of the transcription factor CREB, and that this may also cause alterations of important neuronally expressed genes, and provide further support of the signal transduction of abnormalities in suicide. PMID:16978443

Pandey, Ghanshyam N; Dwivedi, Yogesh; Ren, Xinguo; Rizavi, Hooriyah S; Roberts, Rosalinda C; Conley, Robert R

2007-10-01

39

Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP  

PubMed Central

Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

2011-01-01

40

Mlc Is a Transcriptional Activator with a Key Role in Integrating Cyclic AMP Receptor Protein and Integration Host Factor Regulation of Leukotoxin RNA Synthesis in Aggregatibacter actinomycetemcomitans  

PubMed Central

Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cyclic AMP (cAMP) receptor protein (CRP) indirectly increases ltxA expression, but the intermediary regulator is unknown. Integration host factor (IHF) binds to and represses the leukotoxin promoter, but neither CRP nor IHF is responsible for the anaerobic induction of ltxA RNA synthesis. Thus, we have undertaken studies to identify other regulators of leukotoxin transcription and to demonstrate how these proteins work together to modulate leukotoxin synthesis. First, analyses of ltxA RNA expression from defined leukotoxin promoter mutations in the chromosome identify positions ?69 to ?35 as the key control region and indicate that an activator protein modulates leukotoxin transcription. We show that Mlc, which is a repressor in Escherichia coli, functions as a direct transcriptional activator in A. actinomycetemcomitans; an mlc deletion mutant reduces leukotoxin RNA synthesis, and recombinant Mlc protein binds specifically at the ?68 to ?40 region of the leukotoxin promoter. Furthermore, we show that CRP activates ltxA expression indirectly by increasing the levels of Mlc. Analyses of ?mlc, ?ihf, and ?ihf ?mlc strains demonstrate that Mlc can increase RNA polymerase (RNAP) activity directly and that IHF represses ltxA RNA synthesis mainly by blocking Mlc binding. Finally, a ?ihf ?mlc mutant still induces ltxA during anaerobic growth, indicating that there are additional factors involved in leukotoxin transcriptional regulation. A model for the coordinated regulation of leukotoxin transcription is presented. PMID:23475968

Childress, Catherine; Feuerbacher, Leigh A.; Phillips, Linda; Burgum, Alex

2013-01-01

41

A Ric8/Synembryn Homolog Promotes Gpa1 and Gpa2 Activation To Respectively Regulate Cyclic AMP and Pheromone Signaling in Cryptococcus neoformans.  

PubMed

The G protein ? subunits Gpa1, Gpa2, and Gpa3 mediate signal transduction and are important in the growth and virulence of Cryptococcus neoformans. To understand how Gpa1 functions without a conventional G? subunit, we characterized a resistance to inhibitors of cholinesterase 8 (Ric8) homolog from C. neoformans, which shares amino acid sequence homology with other Ric8 proteins that exhibit guanine nucleotide exchange factor (GEF) activity toward G?. We found that the ric8 mutant was reduced in capsule size and melanin formation, which could be suppressed by cyclic AMP (cAMP) supplementation or by introducing the activated GPA1(Q284L) allele. Consistent with the fact that Ric8 participates in cAMP signaling to regulate virulence, the ric8 mutant was attenuated in virulence toward mice. Interestingly, disruption of RIC8 also resulted in opposing effects on pheromone signaling, as the ric8 mutant showed reduced mating but an enhanced ability to induce the pheromone response in the mating partner. To identify Ric8 functional mechanisms, we examined the interactions between Ric8 and the three G? proteins. Ric8 interacted with Gpa1 and Gpa2, but not Gpa3. The presence of Gpa1(Q284L) negatively affected its interaction with Ric8, whereas the activated Gpa2(Q203L) allele abolished the interaction. Collectively, these findings suggest that Ric8 functions as a GEF to facilitate the activation of Gpa1-cAMP signaling and to promote Gpa2, affecting mating efficiency. Our study highlights the distinct and conserved characteristics associated with G protein signaling and contributes to our overall understanding of how G protein ? subunits function with or without a canonical G? partner in C. neoformans. PMID:25084863

Gong, Jinjun; Grodsky, Jacob D; Zhang, Zhengguang; Wang, Ping

2014-10-01

42

Augmentation of bursting pacemaker activity by serotonin in an identified Achatina fulica neurone: an increase in sodium- and calcium-activated negative slope resistance via cyclic-AMP-dependent protein phosphorylation.  

PubMed

The mechanism of serotonin (5-HT) action on bursting activity was examined in a bursting pacemaker neurone of the snail Achatina fulica. 5-HT augmented both the depolarizing and post-burst-hyperpolarizing phases of the bursting cycle in a dose-dependent manner. This biogenic amine also enhanced the negative slope resistance (NSR), which was normally detectable at membrane potentials between -40 and -20 mV, and produced another NSR at voltages between -20 and 0 mV. The former NSR disappeared in Na(+)-free saline and the latter was abolished by replacement with Co(2+)-substituted Ca(2+)-free saline. Both isobutylmethylxanthine, extracellular applied, and intracellularly applied cyclic AMP simulated a 5-HT effect on the current-voltage relationships. In contrast, the 5-HT effect was suppressed in a dose-dependent manner by prior treatment with a cyclic-AMP-dependent protein kinase inhibitor, isoquinoline sulphonamide. Similar suppression was observed after intracellular injection of a cyclic-AMP-dependent protein kinase inhibitor isolated from bovine muscle. These results suggest that 5-HT may augment the bursting pacemaker activity by its stimulatory effect on both the slow Na+ channels and the Ca2+ channels through cyclic-AMP-dependent protein phosphorylation. PMID:8382731

Funase, K; Watanabe, K; Onozuka, M

1993-02-01

43

The response of the immature rat ovary to gonadotrophins: acute changes in cyclic AMP, progesteron, testosteron, androstenedione and oestradiol after treatment with PMS or FSH + LH.  

PubMed

Radioimmunoassays were used to measure changes in progesterone, testosterone, androstenedione, oestradiol, gonadotrophin and ovarian cyclic AMP in immature female rats during the first 24 h after exposure to slowly (PMS) or rapidly (FSH + LH) disappearing gonadotrophins. Cyclic AMP was increased 30 min after injection of either kind of gonadotrophin but it had returned to control level within 4 h. Serum and ovarian testosterone and androstenedione also increased to a peak at 30 min but decreased to base line by the 4th h. Multiple injections of FSH + LH maintained an elevated serum testosterone level but they had little effect upon the secretion of androstenedione. Serum and ovarian progesterone increased quickly after treatment with gonadotrophin. With PMS the peak in the serum was reached at 8 h, it remained high for 4 h and then fell precipitously between the 12th and 16th h. FSH + LH produced a prompt increase in serum progesterone but the level could be maintained only by repeated doses given every 4 h. Oestradiol was not increased in the serum or the ovot produce an increase in oestrogen but a transient increase was found with 3 doses; 4 doses kept an elevated level of oestradiol for 12 h. These results indicate that the aromatizing system of the immature rat ovary is relatively inactive and that continual stimulation by gonadotrophin for about 10-12 h is necessary to bring about increased function. In contrast, the mechanisms for the synthesis and secretion of progesterone and androgens are vary active and can be immediately stimulated by exposure to gonadotrophins. PMID:179259

Sashida, T; Johnson, D C

1976-06-01

44

Interactions between activating region 3 of the Escherichia coli cyclic AMP receptor protein and region 4 of the RNA polymerase ? 70 subunit: application of suppression genetics 1 1 Edited by R. Ebright  

Microsoft Academic Search

The Escherichia coli cyclic AMP receptor protein, CRP, induces transcription at Class II CRP-dependent promoters by making three different activatory contacts with different surfaces of holo RNA polymerase. One contact surface of CRP, known as Activating Region 3 (AR3), is functional in the downstream subunit of the CRP dimer and is predicted to interact with region 4 of the RNAP

Virgil A Rhodius; Stephen J. W Busby

2000-01-01

45

TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.  

PubMed

The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

Fayet, G; Aouani, A; Hovsépian, S

1986-01-01

46

Association of cyclic-AMP-dependent protein kinase with neurofilaments.  

PubMed Central

Neurofilament preparations isolated from bovine spinal cord contain cyclic-AMP-dependent protein kinase (PKA) activity. Treatment of this preparation with cyclic AMP, to dissociate the regulatory subunit of the kinase from the catalytic subunit, resulted in retention of the kinase activity but loss of cyclic AMP regulation. This suggests that PKA is associated via its catalytic subunit with the neurofilament preparation. The association of exogenous PKA from bovine heart with the neurofilament preparation and with neurofilaments reconstituted from purified neurofilament proteins was also investigated. Either the free catalytic subunit or combinations of the catalytic and regulatory subunits of PKA were incubated with the preparations, and the degree of association was determined as the level of kinase activity that co-sediments with neurofilaments. The results indicate that the free catalytic subunit of PKA co-sediments with neurofilaments reconstituted from purified proteins. The regulatory subunit of PKA from bovine heart, when pre-mixed with the catalytic subunit, decreased the level of kinase that co-sediments with the neurofilament fraction in a dose-dependent manner. This effect of the regulatory subunit was reversed by inclusion of cyclic AMP in the incubation medium before centrifugation. The above findings suggest that the regulatory subunit, when attached to the catalytic subunit, has an inhibitory effect on its association with neurofilaments, with the implication that the association may be a cyclic-AMP-regulated event. Images Fig. 1. PMID:1312331

Dosemeci, A; Pant, H C

1992-01-01

47

Comparative transcriptome analysis reveals novel roles of the Ras and cyclic AMP signaling pathways in environmental stress response and antifungal drug sensitivity in Cryptococcus neoformans.  

PubMed

The cyclic AMP (cAMP) pathway plays a central role in the growth, differentiation, and virulence of pathogenic fungi, including Cryptococcus neoformans. Three upstream signaling regulators of adenylyl cyclase (Cac1), Ras, Aca1, and Gpa1, have been demonstrated to control the cAMP pathway in C. neoformans, but their functional relationship remains elusive. We performed a genome-wide transcriptome analysis with a DNA microarray using the ras1Delta, gpa1Delta, cac1Delta, aca1Delta, and pka1Delta pka2Delta mutants. The aca1Delta, gpa1Delta, cac1Delta, and pka1Delta pka2Delta mutants displayed similar transcriptome patterns, whereas the ras1Delta mutant exhibited transcriptome patterns distinct from those of the wild type and the cAMP mutants. Interestingly, a number of environmental stress response genes are modulated differentially in the ras1Delta and cAMP mutants. In fact, the Ras signaling pathway was found to be involved in osmotic and genotoxic stress responses and the maintenance of cell wall integrity via the Cdc24-dependent signaling pathway. Notably, the Ras and cAMP mutants exhibited hypersensitivity to a polyene drug, amphotericin B, without showing effects on ergosterol biosynthesis, which suggested a novel method of antifungal combination therapy. Among the cAMP-dependent gene products that we characterized, two small heat shock proteins, Hsp12 and Hsp122, were found to be involved in the polyene antifungal drug susceptibility of C. neoformans. PMID:20097740

Maeng, Shinae; Ko, Young-Joon; Kim, Gyu-Bum; Jung, Kwang-Woo; Floyd, Anna; Heitman, Joseph; Bahn, Yong-Sun

2010-03-01

48

Ephedrine induced thioredoxin-1 expression through ?-adrenergic receptor/cyclic AMP/protein kinase A/dopamine- and cyclic AMP-regulated phosphoprotein signaling pathway.  

PubMed

Ephedrine (Eph) is one of alkaloids that has been isolated from the ancient herb ephedra (ma huang) and is used as the treatment of asthma, hypotension and fatigue. However, its molecular mechanism remains unknown. Thioredoxin-1 (Trx-1) is a redox regulating protein, which has various biological activities, including regulating transcription factor DNA binding activity and neuroprotection. In this study, we found that Eph induced Trx-1 expression, which was inhibited by propranolol (?-adrenergic receptor inhibitor), but not by phenoxybenzamine (?-adrenergic receptor inhibitor) in rat pheochromocytoma PC12 cells. Moreover, the increase of Trx-1 expression was inhibited by SQ22536 (adenylyl cyclase inhibitor) and H-89 (protein kinase A inhibitor). Interestingly, the effect of Eph on dopamine- and cyclic AMP-regulated phosphoprotein (DARPP-32) was similar to Trx-1. Thus, the relationship between Trx-1 and DARPP-32 was further studied. The DARPP-32 siRNA significantly reduced Trx-1 expression, but Trx-1 siRNA did not exchange DARPP-32. These results suggested that Eph induced the Trx-1 expression through ?-adrenergic receptor/cyclic AMP/PKA/DARPP-32 signaling pathway. Furthermore, Eph induced PKA-mediated cyclic AMP response element-binding protein (CREB) phosphorylation. Down-regulation of DARPP-32 expression decreased phosphorylated CREB. In addition, Eph had a significant effect on the viability of the rat pheochromocytoma PC12 cells through ?-adrenergic receptors. Trx-1 may play an important role in the actions of Eph. PMID:23416460

Jia, Jin-Jing; Zeng, Xian-Si; Li, Ye; Ma, Sha; Bai, Jie

2013-05-01

49

Dopaminergic Stimulation of Cyclic AMP Accumulation and Parathyroid Hormone Release from Dispersed Bovine Parathyroid Cells  

Microsoft Academic Search

The effects of dopaminergic agonists and antagonists have been studied in dispersed bovine parathyroid cells. Dopaminergic agonists caused a transient 20- to 40-fold increase in cellular cyclic AMP and a 2- to 3-fold increase in parathyroid hormone release. Dose-response relationships were similar for cyclic AMP accumulation and hormone release, whether studied by increasing agonist concentration or by increasing concentration of

E. M. Brown; R. J. Carroll; G. D. Aurbach

1977-01-01

50

The role of cyclic AMP and its effect on protein kinase A in the mitogenic action of thyrotropin on the thyroid cell.  

PubMed

Cyclic AMP has been shown to inhibit cell proliferation in many cell types and to activate it in some. The latter has been recognized only lately, thanks in large part to studies on the regulation of thyroid cell proliferation in dog thyroid cells. The steps that led to this conclusion are outlined. Thyrotropin activates cyclic accumulation in thyroid cells of all the studied species and also phospholipase C in human cells. It activates directly cell proliferation in rat cell lines, dog, and human thyroid cells but not in bovine or pig cells. The action of cyclic AMP is responsible for the proliferative effect of TSH. It accounts for several human diseases: congenital hyperthyroidism, autonomous adenomas, and Graves' disease; and, by default, for hypothyroidism by TSH receptor defect. Cyclic AMP proliferative action requires the activation of protein kinase A, but this effect is not sufficient to explain it. Cyclic AMP action also requires the permissive effect of IGF-1 or insulin through their receptors, mostly as a consequence of PI3 kinase activation. The mechanism of these effects at the level of cyclin and cyclin-dependent protein kinases involves an induction of cyclin D3 by IGF-1 and the cyclic AMP-elicited generation and activation of the cyclin D3-CDK4 complex. PMID:12119271

Dremier, S; Coulonval, K; Perpete, S; Vandeput, F; Fortemaison, N; Van Keymeulen, A; Deleu, S; Ledent, C; Clément, S; Schurmans, S; Dumont, J E; Lamy, F; Roger, P P; Maenhaut, C

2002-06-01

51

Regulation of intracellular cyclic AMP in skeletal muscle cells involves the efflux of cyclic nucleotide to the extracellular compartment  

PubMed Central

This report analyses the intracellular and extracellular accumulation of cyclic AMP in primary rat skeletal muscle cultures, after direct and receptor-dependent stimulation of adenylyl cyclase (AC). Isoprenaline, calcitonin gene-related peptide (CGRP) and forskolin induced a transient increase in the intracellular cyclic AMP that peaked 5 min after onset stimulation. Under stimulation with isoprenaline or CGRP, the intracellular cyclic AMP initial rise was followed by an exponential decline, reaching 46 and 52% of peak levels in 10 min, respectively. Conversely, the forskolin-dependent accumulation of intracellular cyclic AMP decreased slowly and linearly, reaching 49% of the peak level in 30 min. The loss of intracellular cyclic AMP from peak levels, induced by direct or receptor-induced activation of AC, was followed by an increase in the extracellular cyclic AMP. This effect was independent on PDEs, since it was obtained in the presence of 3-isobutyl-1-methylxanthine (IBMX). Besides, in isoprenaline treated cells, the beta-adrenoceptor antagonist propranolol reduced both intra- and extracellular accumulation of cyclic AMP, whereas the organic anion transporter inhibitor probenecid reduced exclusively the extracellular accumulation. Together our data show that direct or receptor-dependent activation of skeletal muscle AC results in a transient increase in the intracellular cyclic AMP, despite the continuous presence of the stimulus. The temporal declining of intracellular cyclic AMP was not dependent on the cyclic AMP breakdown but associated to the efflux of cyclic nucleotide to the extracellular compartment, by an active transport since it was prevented by probenecid. PMID:12642402

Godinho, Rosely Oliveira; Costa-Jr, Valter Luiz

2003-01-01

52

Electrostatic control of half-site spacing preferences by the cyclic AMP response element-binding protein CREB  

PubMed Central

Basic region leucine zipper (bZIP) proteins represent a class of transcription factors that bind DNA using a simple, dimeric, ?-helical recognition motif. The cAMP response element-binding protein (CREB) is a member of the CREB/ATF subfamily of bZIP proteins. CREB discriminates effectively in vivo and in vitro between the 10 bp cAMP response element (ATGACGTCAT, CRE) and the 9 bp activating protein 1 site (ATGACTCAT, AP-1). Here we describe an alanine scanning mutagenesis study designed to identify those residues within the CREB bZIP element that control CRE/AP-1 specificity. We find that the preference of CREB for the CRE site is controlled in a positive and negative way by acidic and basic residues in the basic, spacer and zipper segments. The CRE/AP-1 specificity of CREB is increased significantly by four glutamic acid residues located at positions 24, 28, 35 and 41; glutamic acid residues at positions 10 and 48 contribute in a more modest way. Specificity is decreased significantly by two basic residues located at positions 21 and 23; basic residues at positions 14, 18, 33 and 34 and V17 contribute in a more modest way. All of the residues that influence specificity significantly are located on the solvent-exposed face of the protein–DNA complex and likely participate in interactions between and among proteins, not between protein and DNA. The finding that the CRE/AP-1 specificity of CREB is dictated by the presence or absence of charged residues has interesting implications for how transcription factors seek and selectively bind sequences within genomic DNA. PMID:11504868

Montclare, Jin Kim; Sloan, Leslie S.; Schepartz, Alanna

2001-01-01

53

Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus  

ERIC Educational Resources Information Center

cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

2008-01-01

54

Activation of exchange protein activated by cyclic-AMP enhances long-lasting synaptic potentiation in the hippocampus.  

PubMed

cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term potentiation (LTP) of synaptic strength. However, cAMP may also initiate signaling via a guanine nucleotide exchange protein directly activated by cAMP (Epac). The role of Epac in hippocampal synaptic plasticity is unknown. We found that in area CA1 of mouse hippocampal slices, activation of Epac enhances maintenance of LTP without affecting basal synaptic transmission. The persistence of this form of LTP requires extracellular signal-regulated protein kinase (ERK) and new protein synthesis, but not transcription. Because ERK is involved in translational control of long-lasting plasticity and memory, our data suggest that Epac is a crucial link between cAMP and ERK during some forms of protein synthesis-dependent LTP. Activation of Epac represents a novel signaling pathway for rapid regulation of the stability of enduring forms of LTP and, perhaps, of hippocampus- dependent long-term memories. PMID:18509114

Gelinas, Jennifer N; Banko, Jessica L; Peters, Melinda M; Klann, Eric; Weeber, Edwin J; Nguyen, Peter V

2008-06-01

55

Activation of exchange protein activated by cyclic-AMP enhances long-lasting synaptic potentiation in the hippocampus  

PubMed Central

cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term potentiation (LTP) of synaptic strength. However, cAMP may also initiate signaling via a guanine nucleotide exchange protein directly activated by cAMP (Epac). The role of Epac in hippocampal synaptic plasticity is unknown. We found that in area CA1 of mouse hippocampal slices, activation of Epac enhances maintenance of LTP without affecting basal synaptic transmission. The persistence of this form of LTP requires extracellular signal-regulated protein kinase (ERK) and new protein synthesis, but not transcription. Because ERK is involved in translational control of long-lasting plasticity and memory, our data suggest that Epac is a crucial link between cAMP and ERK during some forms of protein synthesis-dependent LTP. Activation of Epac represents a novel signaling pathway for rapid regulation of the stability of enduring forms of LTP and, perhaps, of hippocampus- dependent long-term memories. PMID:18509114

Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

2008-01-01

56

Synergistic activation of insect cAMP-dependent protein kinase A (type II) by cyclicAMP and cyclicGMP  

E-print Network

honeybee regulatory subunit RII and phylogenetic comparison of the two cyclic nucleotide-binding sites Societies. Keywords: Insect; Protein kinase A; Regulatory subunit; Cyclic AMP; Cyclic cGMP; Nucleotide amino acids, interacts with the cyclic nucleotide [6,7]. The PBCs of the R subunits are highly conserved

Menzel, Randolf - Institut für Biologie

57

Exchange protein activated by cyclic AMP is involved in the regulation of adipogenic genes during 3T3-L1 fibroblasts differentiation.  

PubMed

Adipogenesis is stimulated in 3T3-L1 fibroblasts by a combination of insulin, dexamethasone and isobutylmethylxanthine, IBMX, (I+D+M). Two transcription factors are important for the acquisition of the adipocyte phenotype, C/EBP beta (CCAT enhancer-binding protein beta) and PPAR gamma (peroxisome proliferator-activated receptor gamma). IBMX increases cAMP content, which can activate protein kinase A (PKA) and/or EPAC (exchange protein activated by cAMP). To investigate the importance of IBMX in the differentiation mixture, we first evaluated the effect of the addition of IBMX on the increase of C/EBP beta and PPAR gamma and found an enhancement of the amount of both proteins. IBMX addition (I+D+M) or its replacement with a cAMP analogue, dibutyryl-cAMP or 8-(4-chlorophenylthio)-2-O'-methyl-cAMP (8CPT-2-Me-cAMP), the latter activates EPAC and not PKA, remarkably increased PPAR gamma mRNA. However, neither I+D nor any of the inducers alone, increased PPAR gamma mRNA to a similar extent, suggesting the importance of the presence of both IBMX and I+D. It was also found that the addition of IBMX or 8CPT-2-Me-cAMP was able to increase the content of C/EBP beta with respect to I+D. In agreement with these findings, a microarray analysis showed that the presence of either 8CPT-2-Me-cAMP or IBMX in the differentiation mixture was able to upregulate PPAR gamma and PPAR gamma-activated genes as well as other genes involved in lipid metabolism. Our results prove the involvement of IBMX-cAMP-EPAC in the regulation of adipogenic genes during differentiation of 3T3-L1 fibroblasts and therfore contributes to elucidate the role of cyclic AMP in this process. PMID:24444094

Gabrielli, Matías; Martini, Claudia N; Brandani, Javier N; Iustman, Laura J R; Romero, Damián G; del C Vila, María

2014-02-01

58

4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models  

PubMed Central

Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3?, 5?-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3?, 5?-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

2014-01-01

59

4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models.  

PubMed

Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3', 5'-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3', 5'-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

Cho, Jin A; Zhang, Xuan; Miller, Gregory M; Lencer, Wayne I; Nery, Flavia C

2014-01-01

60

Sweet Taste Receptor Expressed in Pancreatic ?-Cells Activates the Calcium and Cyclic AMP Signaling Systems and Stimulates Insulin Secretion  

PubMed Central

Background Sweet taste receptor is expressed in the taste buds and enteroendocrine cells acting as a sugar sensor. We investigated the expression and function of the sweet taste receptor in MIN6 cells and mouse islets. Methodology/Principal Findings The expression of the sweet taste receptor was determined by RT–PCR and immunohistochemistry. Changes in cytoplasmic Ca2+ ([Ca2+]c) and cAMP ([cAMP]c) were monitored in MIN6 cells using fura-2 and Epac1-camps. Activation of protein kinase C was monitored by measuring translocation of MARCKS-GFP. Insulin was measured by radioimmunoassay. mRNA for T1R2, T1R3, and gustducin was expressed in MIN6 cells. In these cells, artificial sweeteners such as sucralose, succharin, and acesulfame-K increased insulin secretion and augmented secretion induced by glucose. Sucralose increased biphasic increase in [Ca2+]c. The second sustained phase was blocked by removal of extracellular calcium and addition of nifedipine. An inhibitor of inositol(1, 4, 5)-trisphophate receptor, 2-aminoethoxydiphenyl borate, blocked both phases of [Ca2+]c response. The effect of sucralose on [Ca2+]c was inhibited by gurmarin, an inhibitor of the sweet taste receptor, but not affected by a Gq inhibitor. Sucralose also induced sustained elevation of [cAMP]c, which was only partially inhibited by removal of extracellular calcium and nifedipine. Finally, mouse islets expressed T1R2 and T1R3, and artificial sweeteners stimulated insulin secretion. Conclusions Sweet taste receptor is expressed in ?-cells, and activation of this receptor induces insulin secretion by Ca2+ and cAMP-dependent mechanisms. PMID:19352508

Nakagawa, Yuko; Nagasawa, Masahiro; Yamada, Satoko; Hara, Akemi; Mogami, Hideo; Nikolaev, Viacheslav O.; Lohse, Martin J.; Shigemura, Noriatsu; Ninomiya, Yuzo; Kojima, Itaru

2009-01-01

61

Direct Transcriptional Control of the Plasminogen Activator Gene of Yersinia pestis by the Cyclic AMP Receptor Protein  

Microsoft Academic Search

Horizontal gene transfer events followed by proper regulatory integration of a gene drive rapid evolution of bacterial pathogens. A key event in the evolution of the highly virulent plague bacterium Yersinia pestis was the acquisition of plasmid pPCP1, which carries the plasminogen activator gene, pla. This promoted the bubonic form of the disease by increasing bacterial dissemination from flea bite

Tae-Jong Kim; Sadhana Chauhan; Vladimir L. Motin; Ee-Been Goh; Michele M. Igo; Glenn M. Young

2007-01-01

62

Roles of hinge region, loops 3 and 4 in the activation of Escherichia coli cyclic AMP receptor protein  

Microsoft Academic Search

The cAMP receptor protein (CRP) requires cAMP for an allosteric change and regulates more than 150 genes in Escherichia coli. In this study, the modular half of cAMP receptor protein was used to investigate the allosteric signal transmission pathway induced by cAMP binding. The activation of CRP upon cAMP binding is indicated to be realignment of the two subunits within

Zhengya Gao; Feng Li; Guangrong Wu; Yanrun Zhu; Ting Yu; Shaoning Yu

63

? 2 Adrenergic activation increases glycogen synthesis in L6 skeletal muscle cells through a signalling pathway independent of cyclic AMP  

Microsoft Academic Search

Aims\\/hypothesis  In skeletal muscle, the storage of glycogen by insulin is regulated by glycogen synthase, which is regulated by glycogen synthase\\u000a kinase 3 (GSK3). Here we examined whether adrenergic receptor activation, which can increase glucose uptake, regulates glycogen\\u000a synthesis in L6 skeletal muscle cells.\\u000a \\u000a \\u000a \\u000a Methods  We used L6 cells and measured glycogen synthesis (as incorporation of d-[U-14C]glucose into glycogen) and GSK3 phosphorylation

D. L. Yamamoto; D. S. Hutchinson; T. Bengtsson

2007-01-01

64

Characterization of Lonidamine and AF2785 blockade of the cyclic AMP-activated chloride current in rat epididymal cells.  

PubMed

It has been shown previously that the antifertility agents Lonidamine and its analogue AF2785, [1-(2,4-dichlorobenzyl)-indazole-3-acrylic acid] are potent inhibitors of the cAMP-activated chloride channel (CFTR) in rat epididymal cells. In this study, we further characterized the blocking actions of these two compounds and compared them with the known chloride channel blocker diphenylamine-2-carboxylate (DPC). Results show that the order of potency in blocking the cAMP-activated current is AF2785 > Lonidamine > DPC. All three compounds shared similar blocking characteristics. Firstly, their blockade of the current exhibited voltage dependence; all three agents blocked the current more markedly at negative than at positive membrane potentials. Secondly, they blocked the channels from the outside of the cell. Thirdly, their blocking efficacies were maximal at low extracellular pH. Lastly, the time course of the block by AF2785 and DPC appeared to be more rapid than that of Lonidamine. It is hoped that further studies with other indazole compounds will add knowledge to the physiology and pharmacology of CFTR in the epididymis. Such information will be of great importance to our quest for novel male contraceptives. PMID:11140278

Gong, X D; Wong, P Y

2000-12-01

65

A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence  

Microsoft Academic Search

Cyclic AMP regulates the expression of a number of genes through a conserved promoter element, the CRE1. Moreover, transcrip-tional induction by cAMP requires the activation of cAMP-dependent protein kinase (protein kinase A)1,2. We have previously characterized the cAMP response element binding protein (CREB) in PC 12 cells and brain tissue as a nuclear factor, of relative molecular mass 43,000, whose

Gustavo A. Gonzalez; Karen K. Yamamoto; Wolfgang H. Fischer; David Karr; Patricia Menzel; William Biggs III; Wylie W. Vale; Marc R. Montminy

1989-01-01

66

Apparent presence of Ser133-phosphorylated cyclic AMP response element binding protein (pCREB) in brain mitochondria is due to cross-reactivity of pCREB antibodies with pyruvate dehydrogenase.  

PubMed

Cyclic AMP response element binding protein (CREB) is a constitutive transcription factor that activates transcription following stimulus-dependent phosphorylation at Ser133, implicated in synaptic plasticity and neuronal survival pathways. The prevailing view that CREB is exclusively nuclear has been questioned by several studies, and, for example, mitochondrial localization has been reported. Using subcellular fractionation of rat brain cortex coupled with western immunoblotting with Ser133-phospho-CREB (pCREB) antibodies, we found a robust pCREB immunoreactivity (IR) in mitochondria-enriched fractions. The pCREB antibodies also stained the mitochondria, in addition to nuclei, of glial cells in primary cortical cultures. However, two CREB antibodies against different epitopes and gel shift assay detected the CREB protein mainly in the nuclear fraction. The two-dimensional electrophoretic mobility of mitochondrial pCREB IR differed markedly from the nuclear CREB/pCREB IR, indicating that the pCREB antibody cross-reacts with another mitochondrial protein. Immunoprecipitation of the mitochondrial pCREB IR produced three bands on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which were identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry as E2, E1 alpha-subunit, and E1 beta-subunit of pyruvate dehydrogenase complex. The cross-reacting epitope was identified as phospho-Ser300 of the alpha-subunit. In conclusion, this study confirms the presence of pCREB-like IR in brain mitochondria that, after careful scrutiny, turned out to be pyruvate dehydrogenase rather than authentic CREB. PMID:16219034

Pláteník, Jan; Balcar, Vladimír J; Yoneda, Yukio; Mioduszewska, Barbara; Buchal, Richard; Hynek, Radovan; Kilianek, Lukasz; Kuramoto, Nobuyuki; Wilczynski, Grzegorz; Ogita, Kiyokazu; Nakamura, Yoichi; Kaczmarek, Leszek

2005-12-01

67

Effects of solute concentration on vasopressin stimulated cyclic AMP generation in the rat medullary thick ascending limbs of Henle's loop.  

PubMed

We examined effects of osmolality or sodium concentration on vasopressin induced cyclic AMP generation in the medullary thick ascending limbs isolated from collagenase treated rat kidneys. Vasopressin-stimulated cyclic AMP generation was increased as a function of NaCl concentration of the incubation medium. Addition of sucrose was also effective in enhancing the vasopressin-stimulated cyclic AMP, whereas addition of urea was without effect. When incubation medium was made hypertonic with sodium cyclamate, vasopressin-stimulated cyclic AMP generation was also enhanced. When choline chloride was used instead of sodium cyclamate, only an insignificant increase in the hormone-stimulated cyclic AMP generation was observed. These results suggest that the responsiveness of the rat medullary thick ascending limbs to vasopressin is regulated, at least in part, by transmembrane osmotic gradient. PMID:6328407

Torikai, S; Imai, M

1984-03-01

68

AIB1 = amplified in breast cancer; AF-1 = activation function-1; AF-2 = activation function-2; cAMP = cyclic AMP; CBP = CREB-binding protein; DES = diethylstilbestrol; E2 = 17-estradiol; ER = estrogen receptor; ERE = estrogen response element; EGF = epide  

E-print Network

39 AIB1 = amplified in breast cancer; AF-1 = activation function-1; AF-2 = activation function-2; c; PKA = protein kinase A; SERM = selective estrogen receptor modulator. Available online http://breast-cancer, they have also been associated pathologically with an increased risk for breast and endometrial cancer [2

Brown, Myles

69

Inhibition of Basal and Stimulated Release of Endothelin1 from Guinea Pig Tracheal Epithelial Cells in Culture by Beta 2-adrenoceptor Agonists and Cyclic AMP Enhancers  

Microsoft Academic Search

The effects of cyclic AMP-related compounds and beta adrenoceptor agonists on the basal and lipopolysaccharide (LPS)-stimulated\\u000a release of endothelin-1 (ET-1) from guinea-pig tracheal epithelial cells (GPTEpCs) in culture were studied. Forskolin (a potent\\u000a activator of adenylyl cyclase), 8-bromo-cyclic AMP (a cyclic AMP analogue), salbutamol and salmeterol (two beta 2-adrenoceptor\\u000a agonists), were used to increase cyclic AMP levels. Cultured GPTEpCs released

Quan Yang; Bruno Battistini; Stéphane Pelletier; Pierre Sirois

2007-01-01

70

Salivary gland ultrastructure and cyclic AMP-dependent reactions in Spacelab 3 rats  

SciTech Connect

Environmental stimuli influencing catecholamine levels induce changes in cyclic AMP-dependent reactions and cell morphology in the rat parotid. Responses of salivary glands to spaceflight were determined by measurement of cyclic AMP-mediated reactions in fresh-frozen salivary glands and by microscopic evaluation of ultrastructure in fixed parotid glands. Decreased cell-free protein phosphorylation, determined by autoradiography, occurred in parotid glands in three of five flight animals. Protein kinase activity ratios were decreased in the soluble and increased in the particulate fractions of Spacelab 3 (SL-3) rat sublingual glands, compared with ground controls. Biochemical analyses show that effects of space flight on salivary glands are similar to those induced experimentally by physiological manipulation or alteration of catecholamine levels. Morphological evaluation of three SL-3 rat parotid glands showed increased numbers of lysosomes, autophagic vacuoles containing degenerating secretory product, and accumulation of lipid droplets. Since these animals lost weight, consistent with disruption of food and water consumption, morphological changes may in part be due to decreased masticatory stimulation, as occurs with reduced food intake or a liquid diet. The observed changes may reflect physiological responses of the gastrointestinal and autonomic systems to effects of spaceflight.

Mednieks, M.I.; Hand, A.R.

1987-02-01

71

21 CFR 862.1230 - Cyclic AMP test system.  

...ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems § 862.1230 Cyclic AMP test system. (a)...

2014-04-01

72

Striatal proenkephalin gene induction: coordinated regulation by cyclic AMP and calcium pathways  

PubMed Central

Enkephalin modulates striatal function, thereby affecting motor performance and addictive behaviors. The proenkephalin gene is also used as a model to study cyclic AMP-mediated gene expression in striatal neurons. The second messenger pathway leading to proenkephalin expression demonstrates how cyclic AMP pathways are synchronized with depolarization. We show that cyclic AMP-mediated regulation of the proenkephalin gene is dependent on the activity of L-type Ca2+ channels. Inhibition of L-type Ca2+ channels blocks forskolin-mediated induction of proenkephalin. The Ca2+-activated kinase, Ca2+/calmodulin kinase, as well as the cyclic AMP-activated kinase, protein kinase A (PKA), are both necessary for the induction of the proenkephalin promoter. Similarly, both kinases are needed for the L-type Ca2+ channel-mediated induction of proenkephalin. This synchronization of second messenger pathways provides a coincidence mechanism that gates proenkephalin synthesis in striatal neurons, ensuring that levels are increased only in the presence of activated PKA and depolarization. PMID:12877986

Konradi, Christine; Macias, Wendy; Dudman, Joshua T.; Carlson, Richard R.

2014-01-01

73

Cyclic AMP system in muscle tissue during prolonged hypokinesia  

NASA Technical Reports Server (NTRS)

Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

1980-01-01

74

Bidirectional Regulation of the Cyclic-AMP Response Element Binding Protein Encodes Spatial Map Alignment in Prism-Adapting Barn Owls  

PubMed Central

The barn owl midbrain contains mutually aligned maps of auditory and visual space. Throughout life, map alignment is maintained through the actions of an instructive signal that encodes the magnitude of auditory-visual mismatch. The intracellular signaling pathways activated by this signal are unknown. Here we tested the hypothesis that CREB (cAMP response element binding protein) provides a cell-specific readout of instructive information. Owls were fitted with prismatic or control spectacles and provided rich auditory-visual experience - hunting live mice. CREB activation was analyzed within 30 minutes of hunting using phosphorylation state-specific (pCREB) and CREB antibodies, confocal imaging and immunofluorescence measurements at individual cell nuclei. In control owls or prism-adapted owls, which experience small instructive signals, the frequency distributions of pCREB/CREB values obtained for cell nuclei within the external nucleus of the inferior colliculus (ICX) were unimodal. In contrast, in owls adapting to prisms or re-adapting to normal conditions, the distributions were bimodal: certain cells had received a signal that positively regulated CREB, and by extension, transcription of CREB-dependent genes, while others a signal that negatively regulated it. These changes were restricted to the sub-region of the inferior colliculus that received optically displaced input, the rostral ICX, and not evident in the caudal ICX or central nucleus. Finally, the topographic pattern of CREB regulation was patchy, not continuous, as expected from the actions of a topographically precise signal encoding discrete events. These results support a model in which the magnitude of CREB activation within individual cells provides a readout of the instructive signal that guides plasticity and learning. PMID:18829948

Nichols, Grant S; DeBello, William M

2012-01-01

75

21 CFR 862.1230 - Cyclic AMP test system.  

Code of Federal Regulations, 2013 CFR

...parathyroid gland). Cyclic AMP measurements may also be used in the diagnosis and treatment of Graves' disease (a disorder of the thyroid) and in the differentiation of causes of hypercalcemia (elevated levels of serum calcium.) (b) Classification....

2013-04-01

76

Inhibition of ADP-induced responses in human platelets by agents elevating the cyclic AMP level: comparison of aggregation and shape change.  

PubMed

The inhibitory effect of cAMP-elevating agents on shape change and aggregation in human platelets was studied to improve the understanding of the sequential relationship between these two responses. Human platelet-rich plasma was preincubated for 2 min at 37 degrees C with prostaglandin E1 or adenosine, agents known to elevate the intracellular level of cAMP. Their inhibitory effects on ADP-induced shape change and aggregation were determined both separately and simultaneously. The dose-inhibition patterns for shape change and aggregation were similar for both PGE1 and adenosine. There was no distinct difference between the inhibitory action of these two inhibitors. These observations suggest that elevation of the intracellular concentration of cAMP interferes with an early step in the stimulus-response coupling that is common for aggregation and shape change. PMID:6099615

Steen, V M; Holmsen, H

1984-12-29

77

Association of Interferon Regulatory Factor1, Nucleophosmin, Nuclear FactorB, and Cyclic AMP Response Element Binding with Acquired Resistance to Faslodex (ICI 182,780)1  

Microsoft Academic Search

To identify genes associated with survival from antiestrogens, both serial analysis of gene expression and gene expression microarrays were used to explore the transcriptomes of antiestrogen-responsive (MCF7\\/ LCC1) and -resistant variants (MCF7\\/LCC9) of the MCF-7 human breast cancer cell line. Structure of the gene microarray expression data was visualized at the top level using a novel algorithm that derives the

Zhiping Gu; Richard Y. Lee; Todd C. Skaar; Kerrie B. Bouker; James N. Welch; Jianping Lu; Aiyi Liu; Yuelin Zhu; Natalie Davis; Fabio Leonessa; Nils Brunner; Yue Wang; Robert Clarke

2002-01-01

78

CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone  

NASA Technical Reports Server (NTRS)

Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast nuclear proteins. These results identify C/EBPdelta as a hormonally activated inducer of IGF-I gene transcription in osteoblasts and show that the HS3D element within IGF-I promoter 1 is a high affinity binding site for this protein.

Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

1997-01-01

79

Cyclic AMP is one of the intracellular signals during the mating of Chlamydomonas eugametos  

Microsoft Academic Search

Chlamydomonas eugametos gametes of opposite mating type make cell-cell contact via their flagellar surfaces. This contact triggers an increase in the intracellular level of cyclic AMP (cAMP) and several cellular responses which are necessary for cell fusion. Here, we show that wheat-germ agglutinin, which binds to the flagellar surface and induces all mating responses, also increased the intracellular cAMP level.

Ron Kooijman; Piet de Wildt; Wies van den Briel; Shu-hui Tan; Alan Musgrave; Herman van den Ende

1990-01-01

80

Effect of Hydrogen Sulfide on Cyclic AMP Production in Isolated Bovine and Porcine Neural Retinae  

Microsoft Academic Search

Hydrogen sulfide (H2S) has been reported to exert pharmacological effects on neural and non-neural tissues from several mammalian species. In\\u000a the present study, we examined the role of the intracellular messenger, cyclic AMP in retinal response to H2S donors, sodium hydrosulfide (NaHS) and sodium sulfide (Na2S) in cows and pigs. Isolated bovine and porcine neural retinae were incubated in oxygenated

Ya Fatou Njie-Mbye; Odelia Y. N. Bongmba; Chinwe C. Onyema; Abhishek Chitnis; Madhura Kulkarni; Catherine A. Opere; Angela M. LeDay; Sunny E. Ohia

2010-01-01

81

Long-term effect of cyclic AMP on N-glycosylation is caused by an increase in the activity of the cis-prenyltransferase.  

PubMed

Previously we have shown that long-term pretreatment of JEG-3 choriocarcinoma cells with 8-bromo-cAMP increases the capacity for N-glycosylation that was caused by an 8-10-fold enlargement of the dolichol pyrophosphoryl oligosaccharide (Dol-PP-oligosaccharide) pool [Konrad and Merz (1994) J. Biol. Chem. 269, 8659-8666]. The factors involved in the effect of cAMP on synthesis of Dol-PP-oligosaccharide are investigated here. The GlcNAc transfer to dolichol phosphate (Dol-P) was found to be unaffected by pretreatment with 8-bromo-cAMP. By measuring the uptake of [3H]mevalonate, a 20-fold increase in the incorporation of the label into Dol-P was observed in the cells treated with 8-bromo-cAMP. Under the same conditions, the synthesis of dolichol was enhanced 60-fold. However, the incorporation of the radioactivity into cholesterol was not increased in the JEG-3 cells pretreated with 8-bromo-cAMP, which suggests a specific stimulation of the dolichol/Dol-P pathway by cAMP. The cis-prenyltransferase activity was found to be increased 10-fold in cells pretreated with 8-bromo-cAMP. Dolichol kinase activity was unaffected by stimulation with 8-bromo-cAMP. The present study suggests that the larger glycosylation capacity in JEG-3 cells treated with 8-bromo-cAMP is caused by an increase in the microsomal cis-prenyltransferase activity. PMID:8687403

Konrad, M; Merz, W E

1996-06-01

82

Effect of adrenalin, hydrocortisone, insulin, and dibutyryl-cyclic AMP on glycolysis and glycogenolysis in surviving liver splices from albino rats  

Microsoft Academic Search

Adrenalin, hydrocortisone, and dibutyryl-cyclic AMP inhibited glycolysis and glycogenolysis in surviving liver slices from albino rats. An inhibitory effect also was found when glucose-6-phosphate (G6P), but not fructore-1, 6-diphosphate, was used as the substrate for glycolysis. This indicates that activity of hexokinase and also, probably, of, phosphorylase and phosphofructokinase, in inhibited under the influence, of these hormones and dibutyrul-cyclic AMP.

L. E. Panin; T. A. Tret'yakova

1978-01-01

83

Lot1 is a key element of the pituitary adenylate cyclase-activating polypeptide (PACAP)/cyclic AMP pathway that negatively regulates neuronal precursor proliferation.  

PubMed

The tumor suppressor gene Lot1 is highly expressed during brain development. During cerebellar development, Lot1 is expressed by proliferating granule cells with a time course matching the expression of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor, a neuropeptide receptor that plays an important role in the regulation of granule cell proliferation/survival. Although it has become clear that Lot1 is a negative regulator of cell division in tumor cells, its role in neuronal proliferation is not understood. We previously demonstrated that in cerebellar granule cells Lot1 expression is regulated by the PACAP/cAMP system. The aim of this study was to investigate the role played by Lot1 in neuron proliferation/survival and to identify the molecular mechanisms underlying its actions. Using a Lot1-inducible expression system, we found that in PC12 cells Lot1 negatively regulates proliferation and favors differentiation by up-regulating the expression of the PACAP receptor. In cerebellar granule cells in culture, an increase in Lot1 expression was paralleled by inhibition of proliferation and up-regulation of the PACAP receptor, which in turn positively regulated Lot1 expression. Silencing of Lot1 leads to an increase in granule cell proliferation and a reduction in survival. Confirming the in vitro results, in vivo experiments showed that PACAP induced an increase in Lot1 expression that was paralleled by inhibition of cerebellar granule cell proliferation. These data show that Lot1 is a key element of the PACAP/cAMP pathway that negatively regulates neuronal precursor proliferation. The existence of a PACAP receptor/Lot1-positive feedback loop may powerfully regulate neural proliferation during critical phases of cerebellar development. PMID:19346254

Fila, Tatiana; Trazzi, Stefania; Crochemore, Christophe; Bartesaghi, Renata; Ciani, Elisabetta

2009-05-29

84

Stimulation of cyclic AMP production in human alveolar macrophages induced by inflammatory mediators and beta-sympathicomimetics.  

PubMed

We have investigated the effects of inflammatory mediators and beta-adrenoceptor agonists on the adenylyl cyclase responsiveness in alveolar macrophages from control subjects, patients suffering from chronic obstructive pulmonary disease (COPD) and asthmatics. Basal cyclic AMP (cAMP) levels in alveolar macrophages from COPD patients were significantly elevated (plus 42%) as compared to controls. In addition, the adenylyl cyclase responsiveness to prostaglandin E2, histamine and the beta-adrenoceptor agonist salbutamol was significantly impaired in alveolar macrophages from COPD patients and asthmatics. The lipid mediator platelet activating factor showed no effect on cAMP production in all three alveolar macrophage populations. Furthermore, the cAMP-enhancing effects of isoprenaline, salbutamol and histamine appeared to be mediated via beta 2-adrenoceptors and histamine H2-receptor subtypes respectively. Taken together, these data suggest an intrinsic desensitization phenomenon in alveolar macrophages from COPD patients and asthmatics. PMID:1356815

Beusenberg, F D; Van Amsterdam, J G; Hoogsteden, H C; Hekking, P R; Brouwers, J W; Schermers, H P; Bonta, I L

1992-05-01

85

Cyclic-AMP deficient MDCK cells form tubules.  

PubMed

It has been known for many years that MDCK cells form blister-like structures, termed domes. During an examination of the morphology of a large number of MDCK clones, we found that two stable morphotypes exist in an MDCK cell population-namely, dome-forming and tubule-forming clones. When maintained at high cell density, tubule-forming clones displayed large numbers of anastomosing tubules which contained lumens. The frequency of observation of the tubule-forming clones in an MDCK population was 0.7%. Tubule-forming MDCK clones should be useful in studying tubule morphogenesis. While agents that affect protein kinase A activity increased dome formation, the same agents abolished the formation of tubules in all tubule-forming clones. In contrast, drugs that stimulate protein kinase C activity (phorbol esters and staurosporine) decreased dome formation an increased tubule morphogenesis in all MDCK morphotypes. Tubule-forming clones were found to have lower resting levels of cyclic-AMP and to respond to forskolin stimulation of adenylate cyclase less readily. Hence, signals transmitted by the protein kinase C pathway appear to lead to tubule formation in MDCK cells, while signals transmitted through the protein kinase A pathway lead to dome formation. PMID:8749715

Klebe, R J; Grant, A; Grant, G; Ghosh, P

1995-12-01

86

Prostaglandin A1 metabolism and inhibition of cyclic AMP extrusion by avian erythrocytes  

SciTech Connect

Prostaglandins (PG) inhibit active cyclic AMP export from pigeon red cells, PGA1 and PGA2 most potently. To probe the mechanism of this action of PGA1, the authors have studied the interaction of (TH)PGA1 with suspensions of pigeon red cells. The interaction of PGA1 with pigeon red cells is a multistep process of uptake, metabolism, and secretion. (TH) PGA1 rapidly enters red cells and is promptly metabolized to a compound(s) that remains in the aqueous layer after ethylacetate extraction. The glutathione-depleting agent, diamide, inhibits formation of the PGA1 metabolite. The red cells secrete the polar metabolite of PGA1 by a saturable mechanism that lowered temperatures inhibit. Because uptake and metabolism progress with much greater rates than metabolite secretion, red cells transiently concentrate the polar compound intracellularly. Onset and reversal of inhibition of cyclic AMP export by PGA1 coincide with accumulation and secretion of PGA1 metabolite, suggesting that the polar metabolite acts at an intracellular site to inhibit cyclic AMP efflux.

Heasley, L.E.; Brunton, L.L.

1985-09-25

87

Transcription of the yeast mitochondrial genome requires cyclic AMP  

Microsoft Academic Search

Using various mutant strains and nutritional manipulations, we investigated a potential role for cyclic AMP (cAMP) in the regulation of mitochondrial (mt) gene expression in the yeast Saccharomyces cerevisiae. In RAS mutants known to have either abnormally low or high cellular levels of this nucleotide, we show that both mt transcription rate and overall mt transcript levels vary directly with

Catherine M. McEntee; Robin Cantwell; Mahboob U. Rahman; Alan P. Hudson

1993-01-01

88

Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens  

Microsoft Academic Search

Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with

Eric J. Kalivoda; Nicholas A. Stella; Marissa A. Aston; James E. Fender; Paul P. Thompson; Regis P. Kowalski; Robert M. Q. Shanks

2010-01-01

89

Posttranscriptional Regulation of the Yersinia pestis Cyclic AMP Receptor Protein Crp and Impact on Virulence  

PubMed Central

ABSTRACT The cyclic AMP receptor protein (Crp) is a transcriptional regulator that controls the expression of numerous bacterial genes, usually in response to environmental conditions and particularly by sensing the availability of carbon. In the plague pathogen Yersinia pestis, Crp regulates the expression of multiple virulence factors, including components of the type III secretion system and the plasminogen activator protease Pla. The regulation of Crp itself, however, is distinctly different from that found in the well-studied Escherichia coli system. Here, we show that at physiological temperatures, the synthesis of Crp in Y. pestis is positively regulated at the posttranscriptional level. The loss of the small RNA chaperone Hfq results in decreased Crp protein levels but not in steady-state Crp transcript levels, and this regulatory effect occurs within the 5? untranslated region (UTR) of the Crp mRNA. The posttranscriptional activation of Crp synthesis is required for the expression of pla, and decoupling crp from Hfq through the use of an exogenously controlled promoter and 5? UTR increases Pla protein levels as well as partially rescues the growth defect associated with the loss of Hfq. Finally, we show that both Hfq and the posttranscriptional regulation of Crp contribute to the virulence of Y. pestis during pneumonic plague. The Hfq-dependent, posttranscriptional regulation of Crp may be specific to Yersinia species, and thus our data help explain the dramatic growth and virulence defects associated with the loss of Hfq in Y. pestis. PMID:24520064

Lathem, Wyndham W.; Schroeder, Jay A.; Bellows, Lauren E.; Ritzert, Jeremy T.; Koo, Jovanka T.; Price, Paul A.; Caulfield, Adam J.; Goldman, William E.

2014-01-01

90

The effects of histamine and prostaglandin D2 on rat mast-cell cyclic AMP and mediator release  

SciTech Connect

The possibility that histamine may play a functional role in modulating mast-cell secretion, as has been suggested for basophil degranulation, has both physiologic and pharmacologic implications. Therefore the capacity of histamine to influence rat peritoneal mast-cell (RPMC) cyclic AMP levels and reversed anaphylatic degranulation as reflected in the release of 3H-serotonin (5-HT) was examined. To ascertain that RPMC were functionally responsive to exogenous hormonal stimulation, assessment of prostaglandin (PG) D2 effects on cyclic AMP and 5-HT release were determined in parallel. Although PGD2 (100 microM) increased cyclic AMP and inhibited 5-HT release in the presence of 50 microM aminophylline, histamine (up to 1000 microM) was ineffective was ineffective in both. However, 1000 microM histamine in the presence of 500 microM aminophylline was capable of transiently increasing RPMC cyclic AMP (for 15 to 30 sec) and under these conditions of suppressing 5-HT release. The receptor subtype involved in the suppressive actions of histamine appeared to be of the H-1 type as reflected in the capacity of specific H-1 agonists to reproduce the inhibition of 5-HT release, whereas neither H-2 agonists nor H-2 antagonists had any influence. Thus, under conditions in which phosphodiesterase enzymatic action is impaired, histamine in extremely high concentrations is able to modulate mast-cell secretion. However, it seems very unlikely that this action of histamine has any physiologic significance.

Wescott, S.; Kaliner, M.

1981-11-01

91

Antagonism of VIP-stimulated cyclic AMP formation in chick brain  

Microsoft Academic Search

Of eight peptides tested (0.01–5 µM), only two, that is, pituitary adenylate cyclase-activating polypeptide (PACAP27) and chicken vasoactive intestinal peptide\\u000a (cVIP), potently stimulated cyclic AMP (cAMP) production in cerebral cortical slices of the chick. Mammalian VIP (mVIP) showed\\u000a some activity only at the highest dose tested, whereas truncated forms of PACAP or VIP, that is, PACAP6-27, cVIP6-28, and\\u000a mVIP6-28, or

Jerzy Z. Nowak; Paulina Sedkowska; Jolanta B. Zawilska; Illana Gozes; Douglas E. Brenneman

2003-01-01

92

Mechanical control of cyclic AMP signalling and gene transcription through integrins  

NASA Technical Reports Server (NTRS)

This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

2000-01-01

93

Cyclic AMP-Mediated Cyst Expansion  

PubMed Central

In polycystic kidney disease (PKD), intracellular cAMP promotes cyst enlargement by stimulating mural epithelial cell proliferation and transepithelial fluid secretion. The proliferative effect of cAMP in PKD is unique in that cAMP is anti-mitogenic in normal renal epithelial cells. This phenotypic difference in the proliferative response to cAMP appears to involve cross-talk between cAMP and Ca2+ signaling to B-Raf, a kinase upstream of the MEK/ERK pathway. In normal cells, B-Raf is repressed by Akt (protein kinase B), a Ca2+-dependent kinase, preventing cAMP activation of ERK and cell proliferation. In PKD cells, disruption of intracellular Ca2+ homeostasis due to mutations in the PKD genes relieves Akt inhibition of B-Raf, allowing cAMP stimulation of B-Raf, ERK and cell proliferation. Fluid secretion by cystic cells is driven by cAMP-dependent transepithelial Cl? secretion involving apical cystic fibrosis transmembrane conductance regulator (CFTR) Cl? channels. This review summarizes the current knowledge of cAMP-dependent cyst expansion, focusing on cell proliferation and Cl?-dependent fluid secretion, and discusses potential therapeutic approaches to inhibit renal cAMP production and its downstream effects on cyst enlargement. PMID:21118718

Wallace, Darren P.

2010-01-01

94

Antagonistic analogs of growth hormone releasing hormone (GHRH) inhibit cyclic AMP production of human cancer cell lines in vitro  

Microsoft Academic Search

Antagonistic analogs of growth hormone-releasing hormone (GHRH) inhibit growth of various human cancers both in vivo and in vitro. GHRH, vasoactive intestinal peptide (VIP), and pituitary adenylate cyclase-activating peptide stimulate cyclic AMP (cAMP) release from various human cancer cell lines in vitro. Thus, in the present study, we investigated the effects of antagonistic analogs of GHRH on the GHRH- and

Valér Csernus; Andrew V Schally; Kate Groot

1999-01-01

95

Regulation of the Discoidin I gamma gene in Dictyostelium discoideum: identification of individual promoter elements mediating induction of transcription and repression by cyclic AMP.  

PubMed Central

We dissected the promoter of the developmentally induced and cyclic AMP-repressed discoidin I gamma gene and identified a sequence element essential for developmental induction. Transfer of the element to an inactive heterologous promoter demonstrated that this sequence is sufficient to confer expression in axenically growing cells and to induce gene activity in development after growth on bacteria. A 16-base-pair sequence within this element was shown to be sufficient for induction in the discoidin promoter context and was used to reactivate different truncated promoter constructs. This led to the localization of an element necessary for down regulation of gene expression by extracellular cyclic AMP. Images PMID:2196444

Vauti, F; Morandini, P; Blusch, J; Sachse, A; Nellen, W

1990-01-01

96

Chloride conductance across toad skin: effects of ionic acclimations and cyclic AMP and relationship to mitochondria-rich cell density.  

PubMed

The anionic conductance across toad (Bufo viridis) skin was studied using the voltage-clamp technique following long-term (more than 10 days) acclimation to NaCl and KCl solutions. The non-specific baseline conductance was approximately 0.6 mS cm(-)(2) and was similar in skins from all acclimation conditions. The voltage-activated Cl(-) conductance (G(Cl)) was maximal in skins from distilled-water- and KCl-acclimated toads (>3 mS cm(-)(2)) and was greatly reduced following acclimation to NaCl solutions. Cyclic AMP (EC(50)=13 micromol l(-)(1)) and isobutylmethyl xanthine (IBMX) (EC(50)=69 micromol l(-)(1)) exerted different effects on the activated conductance. IBMX only sensitized the activated conductance, whereas cyclic AMP (CPTcAMP) at high concentrations induced an increase in anionic conductance that was insensitive to electrical potential. Furthermore, external Cl(-) was not required for the stimulatory effect of cyclic AMP, and the conductive pathway had low selectivity. The effects of the two agonists were reversible and depended on the acclimation conditions. Following electrical measurements, the skin of the toads was removed and stained with silver to measure mitochondria-rich cell density (D(mrc)). There was no correlation between D(mrc) and Cl(-) conductance in the present study. PMID:10851120

Rozman, A; Gabbay, S; Katz, U

2000-07-01

97

Cyclic AMP and arachidonic acid: a tale of two pathways.  

PubMed

Increasing evidence in recent years has demonstrated the regulatory effects of arachidonic acid and its metabolites on steroid hormone production in various steroidogenic tissues. In trophic hormone-stimulated steroidogenesis, arachidonic acid is rapidly released from phospholipids. This release is dependent upon hormone-receptor interaction and inhibition of arachidonic acid release results in an inhibition of steroidogenesis. Several of the earlier studies indicated that arachidonic acid acts at the rate-limiting step of steroid biosynthesis, the transfer of substrate cholesterol to the inner mitochondrial membrane, but the manner in which this occurred was not clear. Recently it has been demonstrated that arachidonic acid release can participate in the regulation of gene expression of the steroidogenic acute regulatory (StAR) protein which mediates cholesterol transfer to the inner mitochondrial membrane. These studies suggest that this fatty acid may be instrumental in transducing a signal from trophic hormone/receptor interaction to the nucleus utilizing a pathway different from the reported cyclic AMP pathway. It is possible that these two pathways cooperate and serve to co-regulate transcription factors, resulting in StAR gene expression and subsequent steroid production. This hypothesis may serve to explain and co-ordinate previous observations on the roles of cyclic AMP (cAMP) and arachidonic acid in steroid hormone biosynthesis. PMID:10630400

Wang, X; Stocco, D M

1999-12-20

98

The regulation of cyclic AMP production and the role of cyclic AMP in B16 melanoma cells of differing metastatic potential  

Microsoft Academic Search

The nature of the relationship between agonist-stimulated cyclic AMP production and metastatic potential was examined in detail for four B16 melanoma cell lines of varying metastatic potential. Highly metastatic cells (B16 F10C1) appeared to differ from cells of low metastatic potential (B16 F1C29) in the degree to which cyclic AMP production in intact cells was stimulated by protein kinase C

S. E. Hill; R. C. Rees; S. MacNeil

1990-01-01

99

The Small Molecule Triclabendazole Decreases the Intracellular Level of Cyclic AMP and Increases Resistance to Stress in Saccharomyces cerevisiae  

PubMed Central

The Ras-adenylyl cyclase-protein kinase A nutrient-sensing pathway controls metabolism, proliferation and resistance to stress in Saccharomyces cerevisiae. The genetic disruption of this pathway increases resistance to a variety of stresses. We show here that the pharmacological inhibition of this pathway by the drug triclabendazole increases resistance to oxidants, heat stress and extends the chronological life. Evidence is presented that triclabendazole decreases the intracellular level of cyclic AMP by inhibiting adenylyl cyclase and triggers the parallel rapid translocation of the stress-resistance transcription factor Msn2 from the cytosol into the nucleus, as deduced from experiments employing a strain in which MSN2 is replaced with MSN2-GFP (GFP, green fluorescent protein). Msn2 and Msn4 are responsible for activating the transcription of numerous genes that encode proteins that protect cells from stress. The results are consistent with triclabendazole either inhibiting the association of Ras with adenylyl cyclase or directly inhibiting adenylyl cyclase, which in turn triggers Msn2/4 to enter the nucleus and activate stress-responsible element gene expression. PMID:23667708

Lee, Yong Joo; Shi, Runhua; Witt, Stephan N.

2013-01-01

100

The effects of hypophysectomy upon the endogenous levels of cyclic AMP during forelimb regeneration of adult newts ( Notophthalmus viridescens )  

Microsoft Academic Search

Cyclic AMP is believed to play a role in limb regeneration. Using high pressure liquid chromatography, endogenous levels of cyclic AMP in regenerating tissues of normal and of hypophysectomized adult newts were estimated. In normally regenerating limbs, cyclic AMP levels were depressed 7 days after amputation and were elevated at 14 and 21 days. In contrast, limb tissues of hypophysectomized

Raymond E. Sicard

1975-01-01

101

Effect of electrical stimulation on beta-adrenergic receptor population and cyclic amp production in chicken and rat skeletal muscle cell cultures  

NASA Technical Reports Server (NTRS)

Expression of the beta-adrenergic receptor (betaAR) and its coupling to cyclic AMP (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the betaAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically, chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the betaAR population was not significantly affected by electrical stimulation; however, the ability of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the betaAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

Young, R. B.; Bridge, K. Y.; Strietzel, C. J.

2000-01-01

103

Cyclic AMP- and (Rp)-cAMPS-induced Conformational Changes in a Complex of the Catalytic and Regulatory (RI?) Subunits of Cyclic AMP-dependent Protein Kinase*  

PubMed Central

We took a discovery approach to explore the actions of cAMP and two of its analogs, one a cAMP mimic ((Sp)-adenosine cyclic 3?:5?-monophosphorothioate ((Sp)-cAMPS)) and the other a diastereoisomeric antagonist ((Rp)-cAMPS), on a model system of the type I? cyclic AMP-dependent protein kinase holoenzyme, RI?(91–244)·C-subunit, by using fluorescence spectroscopy and amide H/2H exchange mass spectrometry. Specifically, for the fluorescence experiments, fluorescein maleimide was conjugated to three cysteine single residue substitution mutants, R92C, T104C, and R239C, of RI?(91–244), and the effects of cAMP, (Sp)-cAMPS, and (Rp)-cAMPS on the kinetics of R-C binding and the time-resolved anisotropy of the reporter group at each conjugation site were measured. For the amide exchange experiments, ESI-TOF mass spectrometry with pepsin proteolytic fragmentation was used to assess the effects of (Rp)-cAMPS on amide exchange of the RI?(91–244)·C-subunit complex. We found that cAMP and its mimic perturbed at least parts of the C-subunit interaction Sites 2 and 3 but probably not Site 1 via reduced interactions of the linker region and ?C of RI?(91–244). Surprisingly, (Rp)-cAMPS not only increased the affinity of RI?(91–244) toward the C-subunit by 5-fold but also produced long range effects that propagated through both the C- and R-subunits to produce limited unfolding and/or enhanced conformational flexibility. This combination of effects is consistent with (Rp)-cAMPS acting by enhancing the internal entropy of the R·C complex. Finally, the (Rp)-cAMPS-induced increase in affinity of RI?(91–244) toward the C-subunit indicates that (Rp)-cAMPS is better described as an inverse agonist because it decreases the fractional dissociation of the cyclic AMP-dependent protein kinase holoenzyme and in turn its basal activity. PMID:20167947

Anand, Ganesh S.; Krishnamurthy, Srinath; Bishnoi, Tanushree; Kornev, Alexandr; Taylor, Susan S.; Johnson, David A.

2010-01-01

104

Gating by Cyclic AMP: Expanded Role for an Old Signaling Pathway  

NSDL National Science Digital Library

Access to the article is free, however registration and sign-in are required. The intracellular signal transduction pathway that utilizes cyclic AMP as a key messenger was the first such pathway to be described and has served as a model for many other transducing systems. Now Iyengar illustrates how this classic pathway has yet another function--in a number of different biological systems, the cyclic AMP pathway appears to gate (either negatively or positively) other signal transduction pathways.

Ravi Iyengar (City University of New York;Department of Pharmacology, Mount Sinai School of Medicine)

1996-01-26

105

Adenylate cyclase and the cyclic AMP receptor protein modulate stress resistance and virulence capacity of uropathogenic Escherichia coli.  

PubMed

In many bacteria, the second messenger cyclic AMP (cAMP) interacts with the transcription factor cAMP receptor protein (CRP), forming active cAMP-CRP complexes that can control a multitude of cellular activities, including expanded carbon source utilization, stress response pathways, and virulence. Here, we assessed the role of cAMP-CRP as a regulator of stress resistance and virulence in uropathogenic Escherichia coli (UPEC), the principal cause of urinary tract infections worldwide. Deletion of genes encoding either CRP or CyaA, the enzyme responsible for cAMP synthesis, attenuates the ability of UPEC to colonize the bladder in a mouse infection model, dependent on intact innate host defenses. UPEC mutants lacking cAMP-CRP grow normally in the presence of glucose but are unable to utilize alternate carbon sources like amino acids, the primary nutrients available to UPEC within the urinary tract. Relative to the wild-type UPEC isolate, the cyaA and crp deletion mutants are sensitive to nitrosative stress and the superoxide generator methyl viologen but remarkably resistant to hydrogen peroxide (H(2)O(2)) and acid stress. In the mutant strains, H(2)O(2) resistance correlates with elevated catalase activity attributable in part to enhanced translation of the alternate sigma factor RpoS. Acid resistance was promoted by both RpoS-independent and RpoS-dependent mechanisms, including expression of the RpoS-regulated DNA-binding ferritin-like protein Dps. We conclude that balanced input from many cAMP-CRP-responsive elements, including RpoS, is critical to the ability of UPEC to handle the nutrient limitations and severe environmental stresses present within the mammalian urinary tract. PMID:23115037

Donovan, Grant T; Norton, J Paul; Bower, Jean M; Mulvey, Matthew A

2013-01-01

106

Modulation of 3',5'-cyclic AMP homeostasis in human platelets by coffee and individual coffee constituents.  

PubMed

3',5'-Cyclic AMP (cAMP) is one of the most important second messengers in mammalian cells, mediating a multitude of diverse cellular signalling responses. Its homeostasis is primarily regulated by adenylate cyclases and phosphodiesterases (PDE), the activities of which are partially dependent on the downstream events of adenosine receptor signalling. The present study was conducted to determine whether coffee constituents other than caffeine can influence the homeostasis of intracellular cAMP in vitro and in vivo by evaluating the effects of selected constituents present in coffee, coffee brews and coffee extracts on platelet PDE activity. In addition, to evaluate the potential effects of these constituents on platelet cAMP concentrations and PDE activity in humans, a 7-week pilot intervention study with eight subjects was conducted. The subjects consumed a regular commercial coffee and a low-caffeine coffee at a rate of 750 ml/d for 2 weeks each. The in vivo results revealed a highly significant inhibition of PDE activity (P< 0·001) after coffee intervention that was not directly dependent on the caffeine content of coffee. Although our in vitro and in vivo findings suggest that caffeine plays some role in the modulation of platelet cAMP status, other natural and roasting-associated compounds such as pyrazines and other currently unidentified species also appear to contribute significantly. In conclusion, moderate consumption of coffee can modulate platelet PDE activity and cAMP concentrations in humans, which may contribute to the putative beneficial health effects of coffee. Further detailed mechanistic investigations will be required to substantiate these beneficial effects and to elucidate the underlying mechanisms. PMID:25247601

Montoya, Gina A; Bakuradze, Tamara; Eirich, Marion; Erk, Thomas; Baum, Matthias; Habermeyer, Michael; Eisenbrand, Gerhard; Richling, Elke

2014-11-01

107

Effects of solute concentration on vasopressin stimulated cyclic AMP generation in the rat medullary thick ascending limbs of Henle's loop  

Microsoft Academic Search

We examined effects of osmolality or sodium concentration on vasopressin induced cyclic AMP generation in the medullary thick ascending limbs isolated from collagenase treated rat kidneys. Vasopressin-stimulated cyclic AMP generation was increased as a function of NaCl concentration of the incubation medium. Addition of sucrose was also effective in enhancing the vasopressin-stimulated cyclic AMP, whereas addition of urea was without

Shozo Torikai; Masashi Imai

1984-01-01

108

CAP1, an Adenylate Cyclase-Associated Protein Gene, Regulates Bud-Hypha Transitions, Filamentous Growth, and Cyclic AMP Levels and Is Required for Virulence of Candida albicans  

Microsoft Academic Search

In response to a wide variety of environmental stimuli, the opportunistic fungal pathogen Candida albicans exits the budding cycle, producing germ tubes and hyphae concomitant with expression of virulence genes, such as that encoding hyphal wall protein 1 (HWP1). Biochemical studies implicate cyclic AMP (cAMP) increases in promoting bud-hypha transitions, but genetic evidence relating genes that control cAMP levels to

YONG-SUN BAHN; PAULA SUNDSTROM

2001-01-01

109

Protein kinase C and cyclic AMP regulate reversible exposure of binding sites for fibrinogen on the glycoprotein IIB-IIIA complex of human platelets.  

PubMed Central

Platelet aggregation is mediated via binding of fibrinogen to sites on the membrane glycoprotein IIB-IIIA complex which become exposed when the cells are stimulated. We report here evidence of a dynamic and reversible exposure of binding sites for fibrinogen. In the absence of fibrinogen, exposed sites (B*) gradually lose their capacity to bind fibrinogen and close (Bo). On stimulation with platelet-activating factor (PAF, 500 nM) at 22 degrees C, closing of B* is enhanced by agents that raise cyclic AMP levels (10 ng of prostaglandin I2/ml; 5 mM-theophylline), inhibit protein kinase C (PKC; 25 microM-sphingosine; 1 microM-staurosporine), or disrupt the energy supply (30 mM-2-deoxy-D-glucose + 1 mM-CN-), or by raising the temperature to 37 degrees C. Conversely, activation of PKC 1 microM-1,2-dioctanoyl-sn-glycerol; 55 nM-phorbol 12-myristate 13-acetate) and an increase in intracellular [Ca2+] (100 nM-ionomycin + extracellular Ca2+) oppose the disappearance of B*. Phosphorylation of the 47 kDa protein illustrates the tight coupling between PKC and B* under all conditions tested, except when the cyclic AMP level is raised, and B* is converted to Bo without affecting PKC activity. Although the increase in PKC activity is much smaller with ADP or even absent upon stimulation with adrenaline, the control of B* is equally sensitive to modulation of cyclic AMP and PKC activity. We conclude that PAF, ADP and adrenaline regulate exposure of fibrinogen binding sites through a common mechanism consisting of two independent pathways, one dominated by PKC and the other by an as yet unidentified cyclic AMP-sensitive step. PMID:1846526

van Willigen, G; Akkerman, J W

1991-01-01

110

Catabolite Repression of the Propionate Catabolic Genes in Escherichia coli and Salmonella enterica: Evidence for Involvement of the Cyclic AMP Receptor Protein  

Microsoft Academic Search

Previous studies with Salmonella enterica serovar Typhimurium LT2 demonstrated that transcriptional activation of the prpBCDE operon requires the function of transcription factor PrpR, sigma-54, and IHF. In this study, we found that transcription from the prpBCDE and prpR promoters was down-regulated by the addition of glucose or glycerol, indicating that these genes may be regulated by the cyclic AMP (cAMP)-cAMP

Sung Kuk Lee; Jack D. Newman; Jay D. Keasling

2005-01-01

111

Autoregulation of PhoP/PhoQ and Positive Regulation of the Cyclic AMP Receptor Protein-Cyclic AMP Complex by PhoP in Yersinia pestis  

PubMed Central

Yersinia pestis is one of the most dangerous bacterial pathogens. PhoP and cyclic AMP receptor protein (CRP) are global regulators of Y. pestis, and they control two distinct regulons that contain multiple virulence-related genes. The PhoP regulator and its cognate sensor PhoQ constitute a two-component regulatory system. The regulatory activity of CRP is triggered only by binding to its cofactor cAMP, which is synthesized from ATP by adenylyl cyclase (encoded by cyaA). However, the association between the two regulatory systems PhoP/PhoQ and CRP-cAMP is still not understood for Y. pestis. In the present work, the four consecutive genes YPO1635, phoP, phoQ, and YPO1632 were found to constitute an operon, YPO1635-phoPQ-YPO1632, transcribed as a single primary RNA, whereas the last three genes comprised another operon, phoPQ-YPO1632, transcribed with two adjacent transcriptional starts. Through direct PhoP-target promoter association, the transcription of these two operons was stimulated and repressed by PhoP, respectively; thus, both positive autoregulation and negative autoregulation of PhoP/PhoQ were detected. In addition, PhoP acted as a direct transcriptional activator of crp and cyaA. The translational/transcriptional start sites, promoter ?10 and ?35 elements, PhoP sites, and PhoP box-like sequences were determined for these PhoP-dependent genes, providing a map of the PhoP-target promoter interaction. The CRP and PhoP regulons have evolved to merge into a single regulatory cascade in Y. pestis because of the direct regulatory association between PhoP/PhoQ and CRP-cAMP. PMID:23264579

Zhang, Yiquan; Wang, Li; Han, Yanping; Yan, Yanfeng; Tan, Yafang; Zhou, Lei; Cui, Yujun; Du, Zongmin; Wang, Xiaoyi; Bi, Yujing; Yang, Huiying; Song, Yajun; Zhang, Pingping

2013-01-01

112

Two phosphodiesterase genes, PDEL and PDEH, regulate development and pathogenicity by modulating intracellular cyclic AMP levels in Magnaporthe oryzae.  

PubMed

Cyclic AMP (cAMP) signaling plays an important role in regulating multiple cellular responses, such as growth, morphogenesis, and/or pathogenicity of eukaryotic organisms such as fungi. As a second messenger, cAMP is important in the activation of downstream effector molecules. The balance of intracellular cAMP levels depends on biosynthesis by adenylyl cyclases (ACs) and hydrolysis by cAMP phosphodiesterases (PDEases). The rice blast fungus Magnaporthe oryzae contains a high-affinity (PdeH/Pde2) and a low-affinity (PdeL/Pde1) PDEases, and a previous study showed that PdeH has a major role in asexual differentiation and pathogenicity. Here, we show that PdeL is required for asexual development and conidial morphology, and it also plays a minor role in regulating cAMP signaling. This is in contrast to PdeH whose mutation resulted in major defects in conidial morphology, cell wall integrity, and surface hydrophobicity, as well as a significant reduction in pathogenicity. Consistent with both PdeH and PdeL functioning in cAMP signaling, disruption of PDEH only partially rescued the mutant phenotype of ?magB and ?pka1. Further studies suggest that PdeH might function through a feedback mechanism to regulate the expression of pathogenicity factor Mpg1 during surface hydrophobicity and pathogenic development. Moreover, microarray data revealed new insights into the underlying cAMP regulatory mechanisms that may help to identify potential pathogenicity factors for the development of new disease management strategies. PMID:21386978

Zhang, Haifeng; Liu, Kaiyue; Zhang, Xing; Tang, Wei; Wang, Jiansheng; Guo, Min; Zhao, Qian; Zheng, Xiaobo; Wang, Ping; Zhang, Zhengguang

2011-01-01

113

Two Phosphodiesterase Genes, PDEL and PDEH, Regulate Development and Pathogenicity by Modulating Intracellular Cyclic AMP Levels in Magnaporthe oryzae  

PubMed Central

Cyclic AMP (cAMP) signaling plays an important role in regulating multiple cellular responses, such as growth, morphogenesis, and/or pathogenicity of eukaryotic organisms such as fungi. As a second messenger, cAMP is important in the activation of downstream effector molecules. The balance of intracellular cAMP levels depends on biosynthesis by adenylyl cyclases (ACs) and hydrolysis by cAMP phosphodiesterases (PDEases). The rice blast fungus Magnaporthe oryzae contains a high-affinity (PdeH/Pde2) and a low-affinity (PdeL/Pde1) PDEases, and a previous study showed that PdeH has a major role in asexual differentiation and pathogenicity. Here, we show that PdeL is required for asexual development and conidial morphology, and it also plays a minor role in regulating cAMP signaling. This is in contrast to PdeH whose mutation resulted in major defects in conidial morphology, cell wall integrity, and surface hydrophobicity, as well as a significant reduction in pathogenicity. Consistent with both PdeH and PdeL functioning in cAMP signaling, disruption of PDEH only partially rescued the mutant phenotype of ?magB and ?pka1. Further studies suggest that PdeH might function through a feedback mechanism to regulate the expression of pathogenicity factor Mpg1 during surface hydrophobicity and pathogenic development. Moreover, microarray data revealed new insights into the underlying cAMP regulatory mechanisms that may help to identify potential pathogenicity factors for the development of new disease management strategies. PMID:21386978

Zhang, Haifeng; Liu, Kaiyue; Zhang, Xing; Tang, Wei; Wang, Jiansheng; Guo, Min; Zhao, Qian; Zheng, Xiaobo; Wang, Ping; Zhang, Zhengguang

2011-01-01

114

Cyclic AMP compartmentation due to increased cAMP-phosphodiesterase activity in transgenic mice with a cardiac-directed expression of the human adenylyl cyclase type 8 (AC8)  

Microsoft Academic Search

Hearts from AC8TG mice develop a higher contractility (LVSP) and larger Ca2 transients than NTG mice, with (surprisingly) no modification in L-type Ca2 channel current (ICa,L) (1). In this study, we examined the cardiac response of AC8TG mice to -ad- renergic and muscarinic agonists and IBMX, a cyclic nucleotide phosphodiesterase (PDE) inhibitor. Stimula- tion of LVSP and ICa,L by isoprenaline

MARIE GEORGET; PHILIPPE MATEO; GREGOIRE VANDECASTEELE; LARISSA LIPSKAIA; NICOLE DEFER; JACQUES HANOUNE; JACQUELINE HOERTER; CLAIRE LUGNIER; RODOLPHE FISCHMEISTER

2003-01-01

115

Effect of Electrical Stimulation on Beta-Adrenergic Receptor Population and Cyclic AMP Production in Chicken and Rat Skeletal Muscle Cell Cultures  

NASA Technical Reports Server (NTRS)

Expression of the beta-adrenergic receptor (PAR) and its coupling to Adenosine 3'5' Cyclic Monophosphate (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the PAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture, were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the PAR population was not significantly affected by electrical stimulation; however, the ability, of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the PAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

Young, Ronald B.; Bridge, Kristin Y.; Strietzel, Catherine J.

2000-01-01

116

Opposing actions of dibutyryl cyclic AMP and GMP on temperature in conscious guinea-pigs  

NASA Technical Reports Server (NTRS)

It is shown that the intracerebroventricular administration of dibutyryl cyclic AMP (Db-cAMP) induced hyperthermia in guinea pigs which was not mediated through prostaglandins or norepinephrine since a prostaglandin synthesis inhibitor and an alpha-adrenergic receptor blocking agent did not antagonize the hyperthermia. However, the hyperthermic response to Db-cAMP was attenuated by the central administration of a beta-adrenergic receptor antagonist, which indicates that cAMP may be involved, through beta-adrenergic receptors, in the central regulation of heat production and conservation. The central administration of Db-cGMP produced hypothermia which was not mediated via histamine H1 or H2 receptors and serotonin. The antagonism of hypothermia induced by Db-cGMP and acetylcholine + physostigmine by central administration of a cholinergic muscarine receptor antagonist and not by a cholinergic nicotinic receptor antagonist suggests that cholinoceptive neurons and endogenous cGMP may regulate heat loss through cholinergic muscarine receptors. It is concluded that these results indicate a regulatory role in thermoregulation provided by a balance between opposing actions of cAMP and cGMP in guinea pigs.

Kandasamy, S. B.; Williaes, B. A.

1983-01-01

117

Potent constitutive cyclic AMP-generating activity of XL?s implicates this imprinted GNAS product in the pathogenesis of McCune-Albright Syndrome and fibrous dysplasia of bone  

PubMed Central

Patients with McCune-Albright syndrome (MAS), characterized primarily by hyperpigmented skin lesions, precocious puberty, and fibrous dyslasia of bone, carry postzygotic heterozygous mutations of GNAS causing constitutive cAMP signaling. GNAS encodes the ?-subunit of the stimulatory G protein (Gs?), as well as a large variant (XL?s) derived from the paternal allele. The mutations causing MAS affect both GNAS products, but whether XL?s, like Gs?, can be involved in the pathogenesis remains unknown. Here, we investigated biopsy samples from four previously reported and eight new patients with MAS. Activating mutations of GNAS (Arg201 with respect to the amino acid sequence of Gs?) were present in all the previously reported and five of the new cases. The mutation was detected within the paternally expressed XL?s transcript in five and the maternally expressed NESP55 transcript in four cases. Tissues carrying paternal mutations appeared to have higher XL?s mRNA levels than maternal mutations. The human XL?s mutant analogous to Gs?-R201H (XL?s-R543H) showed markedly higher basal cAMP accumulation than wild-type XL?s in transfected cells. Wild-type XL?s demonstrated higher basal and isoproterenol-induced cAMP signaling than Gs? and co-purified with G?1?2 in transduced cells. XL?s mRNA was measurable in mouse calvarial cells, with its level being significantly higher in undifferentiated cells than those expressing preosteoblastic markers osterix and alkaline phosphatase. XL?s mRNA was also expressed in murine bone marrow stromal cells and preosteoblastic MC3T3-E1 cells. Our findings are consistent with the possibility that constitutive XL?s activity adds to the molecular pathogenesis of MAS and fibrous dysplasia of bone. PMID:20887824

Mariot, Virginie; Wu, Joy Y.; Aydin, Cumhur; Mantovani, Giovanna; Mahon, Matthew J.; Linglart, Agnes; Bastepe, Murat

2010-01-01

118

The role of cyclic AMP in normalizing the function of engineered human blood microvessels in microfluidic collagen gels  

E-print Network

in microfluidic collagen gels Keith H.K. Wong, James G. Truslow, Joe Tien* Department of Biomedical Engineering tissue engineering Collagen gels Permeability Microfluidic channels Cyclic AMP a b s t r a c t Nearly all the phenotype of engineered human microvessels in microfluidic type I collagen gels. Cyclic AMP-elevating agents

Tien, Joe

119

The cyclic AMP receptor protein modulates colonial morphology in Vibrio cholerae.  

PubMed

Inactivation of the quorum-sensing regulator HapR causes Vibrio cholerae El Tor biotype strain C7258 to adopt a rugose colonial morphology that correlates with enhanced biofilm formation. V. cholerae mutants lacking the cyclic AMP (cAMP) receptor protein (CRP) produce very little HapR, which results in elevated expression of Vibrio exopolysaccharide (vps) genes and biofilm compared to the wild type. However, Deltacrp mutants still exhibited smooth colonial morphology and expressed reduced levels of vps genes compared to isogenic hapR mutants. In this study we demonstrate that deletion of crp and cya (adenylate cyclase) converts a rugose DeltahapR mutant to a smooth one. The smooth DeltahapR Deltacrp and DeltahapR Deltacya double mutants could be converted back to rugose by complementation with crp and cya, respectively. CRP was found to enhance the expression of VpsR, a strong activator of vps expression, but to diminish transcription of VpsT. Ectopic expression of VpsR in smooth DeltahapR Deltacrp and DeltahapR Deltacya double mutants restored rugose colonial morphology. Lowering intracellular cAMP levels in a DeltahapR mutant by the addition of glucose diminished VpsR expression and colonial rugosity. On the basis of our results, we propose a model for the regulatory input of CRP on exopolysaccharide biosynthesis. PMID:17921282

Liang, Weili; Silva, Anisia J; Benitez, Jorge A

2007-11-01

120

The myriad roles of cyclic AMP in microbial pathogens: from signal to sword  

Microsoft Academic Search

All organisms must sense and respond to their external environments, and this signal transduction often involves second messengers such as cyclic nucleotides. One such nucleotide is cyclic AMP, a universal second messenger that is used by diverse forms of life, including mammals, fungi, protozoa and bacteria. In this review, we discuss the many roles of cAMP in bacterial, fungal and

Ana Rodriguez; Kathleen A. McDonough

2011-01-01

121

Essential Role for Cyclic AMP and Its Receptor Protein in Yersinia enterocolitica Virulence  

Microsoft Academic Search

Insertion mutations were isolated in cya and crp of Yersinia enterocolitica, which encode adenylate cyclase and the cyclic AMP (cAMP) receptor protein (CRP). The cya and crp mutants were affected for the production of proteins exported by the Ysc, Ysa, and flagellar type III secretion systems (TTSS). Protein production by each TTSS was restored when the respective mutation was complemented

Shane Petersen; Glenn M. Young

2002-01-01

122

Phosphodiesterase 3 inhibitor cilostazol induces migraine-like attacks via cyclic AMP increase.  

PubMed

The initiating mechanisms of migraine attacks are very complex but may involve the cyclic AMP signalling pathway. It is unknown whether intracellular cyclic AMP accumulation induces migraine attacks. We investigated whether administration of cilostazol, which causes cyclic AMP accumulation, may induce migraine attacks. We included 14 migraine patients without aura in a double-blind, placebo-controlled crossover study. All participants received oral cilostazol or placebo on two separate days. We recorded migraine headache characteristics, associated symptoms and time of rescue medication intake using a questionnaire. Cilostazol induced delayed migraine-like attacks in 12 patients (86%) compared with two (14%) patients after placebo (P = 0.002). The median time to onset for migraine-like attacks was 6 h (range 3-11 h). Patients reported that the attacks mimicked their usual migraine attacks and that cilostazol-induced attacks responded to their usual migraine treatment. Median time of medication intake was 6 h (range 4-11 h). The present study suggests that intracellular cyclic AMP accumulation plays a crucial role in migraine induction. This knowledge is a further step in our understanding of the intracellular pathway of migraine initiation. PMID:25161294

Guo, Song; Olesen, Jes; Ashina, Messoud

2014-11-01

123

Dynamics of the changes in the tissular levels of cyclic AMP after cobalt-60 gamma-irradiation.  

PubMed

The total amounts of cyclic AMP in liver, brain and intestinal mucosa have been measured in rats, at constant intervals, up to 18 days after whole body exposure to either a unique moderate dose (500 rd) or a unique lethal dose (750 rd) of cobalt-60 gamma-radiation. This radiation, even in a lethal dose, was found to induce no significant changes in the hepatic levels of cAMP. In contrast, an abrupt short-lasting increase in the levels of cAMP was observed in brain and intestinal mucosa after a 500-rd-irradiation, and a progressive long-lasting increase in its levels in the intestinal mucosa and, especially, in the brain was found after a 750-rd-irradiation. It is concluded that these organs contain different cAMP systems, which would explain, at least in part, their dissimilar responses to the ionizing rays. PMID:3869

P?usescu, E; Popescu, M; P?un, C; Teodosiu, T

1976-02-01

124

Imaging Cyclic AMP Changes in Pancreatic Islets of Transgenic Reporter Mice  

PubMed Central

Cyclic AMP (cAMP) and Ca2+ are two ubiquitous second messengers in transduction pathways downstream of receptors for hormones, neurotransmitters and local signals. The availability of fluorescent Ca2+ reporter dyes that are easily introduced into cells and tissues has facilitated analysis of the dynamics and spatial patterns for Ca2+ signaling pathways. A similar dissection of the role of cAMP has lagged because indicator dyes do not exist. Genetically encoded reporters for cAMP are available but they must be introduced by transient transfection in cell culture, which limits their utility. We report here that we have produced a strain of transgenic mice in which an enhanced cAMP reporter is integrated in the genome and can be expressed in any targeted tissue and with tetracycline induction. We have expressed the cAMP reporter in ?-cells of pancreatic islets and conducted an analysis of intracellular cAMP levels in relation to glucose stimulation, Ca2+ levels, and membrane depolarization. Pancreatic function in transgenic mice was normal. In induced transgenic islets, glucose evoked an increase in cAMP in ?-cells in a dose-dependent manner. The cAMP response is independent of (in fact, precedes) the Ca2+ influx that results from glucose stimulation of islets. Glucose-evoked cAMP responses are synchronous in cells throughout the islet and occur in 2 phases suggestive of the time course of insulin secretion. Insofar as cAMP in islets is known to potentiate insulin secretion, the novel transgenic mouse model will for the first time permit detailed analyses of cAMP signals in ?-cells within islets, i.e. in their native physiological context. Reporter expression in other tissues (such as the heart) where cAMP plays a critical regulatory role, will permit novel biomedical approaches. PMID:18461145

Berg, Stephanie A.; Caicedo, Alejandro; Roper, Stephen D.; Chaudhari, Nirupa

2008-01-01

125

Rab11, but not Rab4, facilitates cyclic AMP- and tauroursodeoxycholate-induced MRP2 translocation to the plasma membrane.  

PubMed

Rab proteins (Ras homologous for brain) play an important role in vesicle trafficking. Rab4 and Rab11 are involved in vesicular trafficking to the plasma membrane from early endosomes and recycling endosomes, respectively. Tauroursodeoxycholate (TUDC) and cAMP increase bile formation, in part, by increasing plasma membrane localization of multidrug resistance-associated protein 2 (MRP2). The goal of the present study was to determine the role of these Rab proteins in the trafficking of MRP2 by testing the hypothesis that Rab11 and/or Rab4 facilitate cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. Studies were conducted in HuH-NTCP cells (HuH7 cells stably transfected with human NTCP), which constitutively express MRP2. HuH-NTCP cells were transfected with Rab11-WT and GDP-locked dominant inactive Rab11-GDP or with Rab4-GDP to study the role of Rab11 and Rab4. A biotinylation method and a GTP overlay assay were used to determine plasma membrane MRP2 and activation of Rab proteins (Rab11 and Rab4), respectively. Cyclic AMP and TUDC increased plasma membrane MRP2 and stimulated Rab11 activity. Plasma membrane translocation of MRP2 by cAMP and TUDC was increased and inhibited in cells transfected with Rab11-WT and Rab11-GDP, respectively. Cyclic AMP (previous study) and TUDC increased Rab4 activity. However, cAMP- and TUDC-induced increases in MRP2 were not inhibited by Rab4-GDP. Taken together, these results suggest that Rab11 is involved in cAMP- and TUDC-induced MRP2 translocation to the plasma membrane. PMID:25190474

Park, Se Won; Schonhoff, Christopher M; Webster, Cynthia R L; Anwer, M Sawkat

2014-10-15

126

Artificial control maturation of porcine oocyte by dibutyryl cyclicAMP  

PubMed Central

In this study, we investigated the effects of various durations of dibutyryl cyclic AMP (dbcAMP) treatment on the in vitro maturation (IVM) and subsequent development of parthenogenetically activated embryos. Immature porcine oocytes were cultured with or without 1 mM dbcAMP during the first 20, 28, or 36 h of culture, and then incubated for an additional 24 h without dbcAMP. The expression of Wee1B, Myt, and Cdc25B and the level of maturation promoting factor (MPF) in metaphase II oocytes were analyzed by real-time PCR (qRT-PCR) and enzyme linked immunosorbent assay (ELISA), respectively. The distribution of actin microfilaments in oocytes was also assessed. Subsequently, apoptotic cells in blastocysts from each group were visualized by transferase-mediated dUTP nick-end labeling staining. Results showed that oocytes extruded the first polar body between 12 and 18 h after being released from dbcAMP. MPF activity in oocytes at 28 + 24 h and 36 + 24 h after dbcAMP treatment was higher than that in the control group. Significantly more blastocysts were present among embryos in 28 + 24 h (54.28% vs. 39.11%, P < 0.05) and 36 + 24 h (47.24% vs. 32.94%, P < 0.05) groups than among embryos cultured in the absence of dbcAMP. However, the number of total and apoptotic cells was not significantly different between groups. The distribution of actin microfilaments was abnormal in oocytes cultured for 60 h without dbcAMP. In addition, the expression of Wee1B, Myt, and Cdc25B was higher in the control group at 44 h than in the dbcAMP group, but there were no differences in expression at the other time points. In conclusion, dbcAMP treatment delays oocyte maturation and maintains oocyte quality. PMID:24683444

Zhao, Ming-Hui; Jin, Yong-Xun; Lee, Seul-Ki; Kim, Nam-Hyung; Cui, Xiang-Shun

2014-01-01

127

Acute morphine alters GABAergic transmission in the central amygdala during naloxone-precipitated morphine withdrawal: role of cyclic AMP.  

PubMed

The central amygdala (CeA) plays an important role in opioid addiction. Therefore, we examined the effects of naloxone-precipitated morphine withdrawal (WD) on GABAergic transmission in rat CeA neurons using whole-cell recordings with naloxone in the bath. The basal frequency of miniature inhibitory postsynaptic currents (mIPSCs) increased in CeA neurons from WD compared to placebo rats. Acute morphine (10 ? M) had mixed effects (?20% change from baseline) on mIPSCs in placebo and WD rats. In most CeA neurons (64%) from placebo rats, morphine significantly decreased mIPSC frequency and amplitude. In 32% of placebo neurons, morphine significantly increased mIPSC amplitudes but had no effect on mIPSC frequency. In WD rats, acute morphine significantly increased mIPSC frequency but had no effect on mIPSC amplitude in 41% of CeA neurons. In 45% of cells, acute morphine significantly decreased mIPSC frequency and amplitude. Pre-treatment with the cyclic AMP inhibitor (R)-adenosine, cyclic 3',5'-(hydrogenphosphorothioate) triethylammonium (RP), prevented acute morphine-induced potentiation of mIPSCs. Pre-treatment of slices with the Gi/o G-protein subunit inhibitor pertussis toxin (PTX) did not prevent the acute morphine-induced enhancement or inhibition of mIPSCs. PTX and RP decreased basal mIPSC frequencies and amplitudes only in WD rats. The results suggest that inhibition of GABAergic transmission in the CeA by acute morphine is mediated by PTX-insensitive mechanisms, although PTX-sensitive mechanisms cannot be ruled out for non-morphine responsive cells; by contrast, potentiation of GABAergic transmission is mediated by activated cAMP signaling that also mediates the increased basal GABAergic transmission in WD rats. Our data indicate that during the acute phase of WD, the CeA opioid and GABAergic systems undergo neuroadaptative changes conditioned by a previous chronic morphine exposure and dependence. PMID:24926240

Bajo, Michal; Madamba, Samuel G; Roberto, Marisa; Siggins, George R

2014-01-01

128

Impaired cyclic AMP-dependent phosphorylation renders CREB a repressor of C/EBP-induced transcription of the somatostatin gene in an insulinoma cell line.  

PubMed

Transcription factor CREB regulates cyclic AMP (cAMP)-dependent gene expression by binding to and activating transcription from cAMP response elements (CREs) in the promoters of target genes. The transcriptional transactivation functions of CREB are activated by its phosphorylation by cAMP-dependent protein kinase A (PKA). In studies of many different phenotypically distinct cells, the CRE of the somatostatin gene promoter is a prototype of a highly cAMP-responsive element regulated by CREB. We now report on a somatostatin-producing rat insulinoma cell line, RIN-1027-B2, in which transcription from the somatostatin gene promoter is paradoxically repressed by CREB. We find that CREB fails to transactivate a CRE-containing somatostatin-chloramphenicol acetyltransferase reporter even when coexpressed with the catalytic subunit of PKA. CAAT box/enhancer-binding protein beta (C/EBP beta) and C/EBP-related activating transcription factor bind to the CRE in the promoter of the somatostatin gene and transactivate transcription. CREB binds competitively with C/EBP beta to the somatostatin CRE in vitro and represses C/EBP beta-induced transcription of the CRE-containing somatostatin-chloramphenicol acetyltransferase reporter. The lack of CREB-mediated transcriptional stimulation is due to the presence of a heat-stable inhibitor of PKA that prevents activation of PKA and subsequent CREB phosphorylation in the nucleus. These findings indicate that dephosphorylated CREB is a negative regulator of C/EBP-activated transcription of the somatostatin gene promoter in RIN-1027-B2 cells. PMID:7799950

Vallejo, M; Gosse, M E; Beckman, W; Habener, J F

1995-01-01

129

Inhibition of Cyclic AMP Phosphodiesterase (PDE4) Reverses Memory Deficits Associated with NMDA Receptor Antagonism  

Microsoft Academic Search

Rolipram, a selective inhibitor of type 4 cyclic AMP phosphodiesterase (PDE4), completely reversed the amnesic effects of MK-801 on working and reference memory (F[4,64] = 11.10; p < .0001 and F[4,64] = 2.53; p < .05, respectively) at doses of 0.01–0.1 mg\\/kg in the radial-arm maze task. Similar antagonism by rolipram of the effects of MK-801 was observed on inhibitory

Han-Ting Zhang; Alicia M Crissman; Nandakumar R Dorairaj; L Judson Chandler; James M O'Donnell

2000-01-01

130

The Cyclic AMP Receptor Protein Modulates Colonial Morphology in Vibrio cholerae  

Microsoft Academic Search

Inactivation of the quorum-sensing regulator HapR causes Vibrio cholerae El Tor biotype strain C7258 to adopt a rugose colonial morphology that correlates with enhanced biofilm formation. V. cholerae mutants lacking the cyclic AMP (cAMP) receptor protein (CRP) produce very little HapR, which results in elevated expression of Vibrio exopolysaccharide (vps) genes and biofilm compared to the wild type. However, crp

Weili Liang; Anisia J. Silva; Jorge A. Benitez

2007-01-01

131

Regulation of cyclic AMP phosphodiesterase from human lung tissue by nucleosides and nucleotides  

E-print Network

REGULATION OF CYCLIC AMP PHOSPHODIESTERASE FROM HUMAN LUNG TISSUE BY NUCLEOSIDES AND NUCLEOTIDES A Thesis by WILLIAM FREDRICK GLASS, II Submitted to the Graduate College oi Texas AlkM University in partial fulfillment of the requirement... of +he snake venom 5'-nucleotidase to convert t'!e AMP to adenosine. Many nucleosides inhibit at milli- molar on en. rations, Adenosine inhibits with an sppsrern K of at!out 1. 0!!!M. For reasons discussed, this inhibitory ability may be of regulatory...

Glass, William Fredrick

2012-06-07

132

Regulation of cyclic AMP-dependent protein kinase levels during skeletal myogenesis.  

PubMed

We showed previously that the levels of type I regulatory subunit of cyclic AMP-dependent protein kinase increase during differentiation of L6 skeletal myoblasts as a result of a specific decrease in its rate of degradation. Studies on the rates of degradation of the catalytic subunit show that unlike the type I regulatory subunit, catalytic subunit is degraded very slowly in myoblasts (t1/2 = 29 h) and more rapidly in myotubes (t1/2 = 14 h). As with the regulatory subunit, the degradation of catalytic subunit is increased by treatment of myoblasts with cyclic AMP analogues. These results suggest that the overall increase in the amount of type I cyclic AMP-dependent protein kinase holoenzyme during myogenesis is due to the increase in levels of mRNA for the catalytic subunit. This probably leads to an increase in the amount of catalytic subunit, which then stabilizes the regulatory subunit, thereby causing an increase in the levels of this protein also. PMID:2604715

Lorimer, I A; Sanwal, B D

1989-11-15

133

Cyclic AMP-receptor proteins in heart muscle of rats flown on Cosmos 1887  

NASA Technical Reports Server (NTRS)

The cellular compartmentalization of the cyclic AMP-receptor proteins in heart ventricular tissue obtained from rats flown on the Cosmos 1887 is determined. Photoaffinity labeling of soluble and particular cell fractions with a (32P)-8-azido analog of cyclic AMP is followed by electrophoretic separation of the proteins and by autoradiographic identification of the labeled isoforms of cAPK R subunits. It is shown that RII in the particulate subcellular fraction was significantly decreased in heart cells from rats in the flight group when compared to controls. Protein banding patterns in both the cytoplasmic fraction and in a fraction enriched in chromatin-bound proteins exhibited some variability in tissues of individual animals, but showed no changes that could be directly attributed to flight conditions. No significant change was apparent in the distribution of RI or RII cyclic AMP binding in the soluble fractions. It is inferred that the cardiac cell integrity or its protein content is not compromised under flight conditions.

Mednieks, Maija I.; Popova, Irina A.; Grindeland, Richard E.

1991-01-01

134

The effects of alcohol on cyclic AMP in mouse brain  

Microsoft Academic Search

Detailed analysis of the dose-response and time-course relationship of ethanol to changes in adenosine 3',5'-cyclic monophosphate (cAMP) content of mouse brain revealed several patterns of response, including both decreases and increases depending on brain area. Whole-brain cAMP content was decreased with ethanol injection at all doses (0.4–3.2 g\\/kg), and reflected the decreased levels in the cortex. The subcortical and cerebellar

E. K. Orenberg; J. Renson; J. D. Barchas

1976-01-01

135

GABAB receptors modulate catecholamine secretion in chromaffin cells by a mechanism involving cyclic AMP formation.  

PubMed Central

1. The function of gamma-aminobutyric acidB (GABAB) receptors in modulation of catecholamine secretion by chromaffin cells and the possible mechanism involved in this action have been examined. 2. The GABAB agonists (-)-baclofen and 3-aminopropylphosphinic acid (3-APPA) were found to induce a dose-dependent increase of basal catecholamine secretion. The EC50s were 151 +/- 35 microM and 225 +/- 58 microM for baclofen and 3-APPA, respectively. This stimulatory effect was specific since it could be blocked by 0.5 mM of the specific GABAB antagonist CGP-35348. 3. In contrast, preincubation of chromaffin cells with the GABAB agonists was found to inhibit, in a dose-dependent manner, the catecholamine secretion evoked by 10 microM nicotine and 200 microM muscimol. 4. The effects of GABAB agonists on both basal and evoked catecholamine secretion were found to be accompanied by parallel changes in intracellular calcium concentration ([Ca2+]i). GABAB agonists produced a dose-dependent increase in [Ca2+]i which was partially blocked by CGP 35348, but they produced a strong inhibition of the [Ca2+]i increase induced by nicotine and muscimol. 5. The GABAB agonists also produced a dose-dependent increase in intracellular cyclic AMP levels, there being a direct correlation between both increase in catecholamine secretion and in intracellular cyclic AMP levels. 6. The pretreatment of chromaffin cells with pertussis toxin doubled the catecholamine secretion and increased by four times the intracellular cyclic AMP levels evoked by GABAB agonists. 7. The possible involvement of adenylate cyclase in the mechanism of GABAA receptor modulation of catecholamine secretion is discussed. PMID:8306105

Oset-Gasque, M. J.; Parramón, M.; González, M. P.

1993-01-01

136

Signal transduction for Schistocerca gregaria ion transport peptide is mediated via both cyclic AMP and cyclic GMP.  

PubMed

The second messengers involved in the signal transduction for Schistocerca gregaria, ion transport peptide (Schgr-ITP) that regulates ion and fluid transport across the ileum of the desert locust S. gregaria, were measured using competitive enzyme-linked immunosorbent assays (ELISAs). Synthetic Schgr-ITP elevates intracellular levels of both cyclic AMP and cyclic GMP, measured over a 15 min period in the presence of 3-isobutyl-1-methylxanthine, in a dose-dependent manner. Furthermore, crude corpora cardiaca (CC) extracts elevate intracellular cyclic AMP levels 2-fold greater than Schgr-ITP, suggesting that factors present in the CC, other than Schgr-ITP, also act via this second messenger. These results suggest that the interaction of Schgr-ITP with two separate receptors, most likely a G-protein coupled receptor and a membrane bound guanylate cyclase, elevates intracellular levels of cyclic AMP and cyclic GMP to regulate ion and fluid transport across the locust ileum. Cyclic AMP stimulates Cl(-), K(+) and Na(+) reabsorption, whereas secretion of H(+) into the lumen of the ileum is most likely mediated via cyclic GMP. Cyclic GMP also stimulates Cl(-) uptake in a similar manner to cyclic AMP. The measurement of tissue (central nervous system) levels of Schgr-ITP using an indirect ELISA confirms that the peptide is only present in the locust brain and the CC. The amounts present are greatest in the CC, where the peptide is presumably stored for release into the hemolymph when locusts feed. PMID:23147644

Audsley, Neil; Jensen, Derek; Schooley, David A

2013-03-01

137

Search for new cyclic AMP-binding proteins.  

PubMed

Today, there is evidence that the cAMP-dependent kinases (PKA) are not the only intracellular receptors involved in intracellular cAMP signalling in eukaryotes. Other cAMP-binding proteins have been recently identified, including some cyclic nucleotide-gated channels and Epac (exchange protein directly activated by cAMP) proteins. All these proteins bind cAMP through conserved cyclic nucleotide monophosphate-binding domains. However, all putative cAMP-binding proteins having such domains, as revealed by computer analysis, do not necessarily bind cAMP, indicating that their presence is not a sufficient criteria to predict cAMP-binding property for a protein. PMID:12829244

Dremier, S; Kopperud, R; Doskeland, S O; Dumont, J E; Maenhaut, C

2003-07-01

138

A Cyclic AMP Receptor Protein-Regulated Cell-Cell Communication System Mediates Expression of a FecA Homologue in Stenotrophomonas maltophilia?  

PubMed Central

Stenotrophomonas maltophilia WR-C possesses an rpf/diffusible signal factor (DSF) cell-cell communication system. It produces cis-?2-11-methyl-dodecenoic acid, a DSF, and seven structural derivatives, which require rpfF and rpfB for synthesis. Acquisition of iron from the environment is important for bacterial growth as well as the expression of virulence genes. We identified a gene homologous to fecA, which encodes a ferric citrate receptor that transports exogenous siderophore ferric citrate from the environment into the bacterial periplasm. Western blot analysis with anti-FecA-His6 antibody showed that the FecA homologue was induced in the iron-depleted medium supplemented with a low concentration of ferric citrate. Deletion of rpfF or rpfB resulted in reduced FecA expression compared to the wild type. Synthetic DSF restored FecA expression by the ?rpfF mutant to the wild-type level. Reverse transcription-PCR showed that the fecA transcript was decreased in the ?rpfF mutant compared to the wild type. These data suggest that DSF affected the level of fecA mRNA. Transposon inactivation of crp, which encodes cyclic AMP (cAMP) receptor protein (CRP) resulted in reduced FecA expression and rpfF transcript level. Putative CRP binding sites were located upstream of the rpfF promoter, indicating that the effect of CRP on FecA is through the rpf/DSF pathway and by directly controlling rpfF. We propose that CRP may serve as a checkpoint for iron uptake, protease activity, and hemolysis in response to environmental changes such as changes in concentrations of glucose, cAMP, iron, or DSF. PMID:17574998

Huang, Tzu-Pi; Wong, Amy C. Lee

2007-01-01

139

The TonB3 System in the Human Pathogen Vibrio vulnificus Is under the Control of the Global Regulators Lrp and Cyclic AMP Receptor Protein  

PubMed Central

TonB systems transduce the proton motive force of the cytoplasmic membrane to energize substrate transport through a specific TonB-dependent transporter across the outer membrane. Vibrio vulnificus, an opportunistic marine pathogen that can cause a fatal septicemic disease in humans and eels, possesses three TonB systems. While the TonB1 and TonB2 systems are iron regulated, the TonB3 system is induced when the bacterium grows in human serum. In this work we have determined the essential roles of the leucine-responsive protein (Lrp) and cyclic AMP (cAMP) receptor protein (CRP) in the transcriptional activation of this system. Whereas Lrp shows at least four very distinctive DNA binding regions spread out from position ?59 to ?509, cAMP-CRP binds exclusively in a region centered at position ?122.5 from the start point of the transcription. Our results suggest that both proteins bind simultaneously to the region closer to the RNA polymerase binding site. Importantly, we report that the TonB3 system is induced not only by serum but also during growth in minimal medium with glycerol as the sole carbon source and low concentrations of Casamino Acids. In addition to catabolite repression by glucose, l-leucine acts by inhibiting the binding of Lrp to the promoter region, hence preventing transcription of the TonB3 operon. Thus, this TonB system is under the direct control of two global regulators that can integrate different environmental signals (i.e., glucose starvation and the transition between “feast” and “famine”). These results shed light on new mechanisms of regulation for a TonB system that could be widespread in other organisms. PMID:22307757

Crosa, Jorge H.

2012-01-01

140

The myriad roles of cyclic AMP in microbial pathogens, from signal to sword  

PubMed Central

All organisms must sense and respond to their external environments, and this signal transduction is often done with second messengers such as cyclic nucleotides. Adenosine 3'5'-cyclic AMP is a universal second messenger that is used by diverse forms of life, including mammals, fungi, protozoa and bacteria. In this review, we discuss the many roles of cAMP in bacterial, fungal and protozoan pathogens and its contributions to microbial pathogenesis. These include coordination of intracellular processes such as virulence gene expression with extracellular signals from the host environment, and manipulation of host immunity by increasing cAMP levels in host cells during infection. PMID:22080930

McDonough, Kathleen A.; Rodriguez, Ana

2013-01-01

141

Fencamfamine modulates sodium, potassium-ATPase through cyclic AMP and cyclic AMP-dependent protein kinase in rat striatum  

Microsoft Academic Search

Summary.   Dopamine (DA) and fencamfamine (FCF) modulatory action on Na,K-ATPase and Mg-ATPase activity were evaluated in rat striatum.\\u000a DA and FCF induced a decrease in Na,K-ATPase, without affecting Mg-ATPase activity. The effect of FCF was dose-dependent from\\u000a 10 to 100 ?M, with an IC50 of 4.7 × 10?5 M. Furthermore, the effect of FCF (100 ?M) increasing AMPc levels, but

M. Pinto Ferreira; R. DeLucia; M. Luiz Aizenstein; I. Glezer; C. Scavone

1998-01-01

142

SOK2 may regulate cyclic AMP-dependent protein kinase-stimulated growth and pseudohyphal development by repressing transcription.  

PubMed Central

Yeast cyclic AMP (cAMP)-dependent protein kinase (PKA) activity is essential for growth and cell cycle progression. Dependence on PKA function can be partially relieved by overexpression of a gene, SOK2, whose product has significant homology with several fungal transcription factors (StuA from Aspergillus nidulans and Phd1 from Saccharomyces cerevisiae) that are associated with cellular differentiation and development. Deletion of SOK2 is not lethal but exacerbates the growth defect of strains compromised for PKA activity. Alterations in Sok2 protein production also affect the expression of genes involved in several other PKA-regulated processes, including glycogen accumulation (GAC1) and heat shock resistance (SSA3). These results suggest SOK2 plays a general regulatory role in the PKA signal transduction pathway. Expression of the PKA catalytic subunit genes is unaltered by deletion or overexpression of SOK2. Because homozygous sok2/sok2 diploid strains form pseudohyphae at an accelerated rate, the Sok2 protein may inhibit the switch from unicellular to filamentous growth, a process that is dependent on cAMP. Thus, the product of SOK2 may act downstream of PKA to regulate the expression of genes important in growth and development. PMID:8524252

Ward, M P; Gimeno, C J; Fink, G R; Garrett, S

1995-01-01

143

Cyclic AMP Signaling Functions as a Bimodal Switch in Sympathoadrenal Cell Development in Cultured Primary Neural Crest Cells  

PubMed Central

Cells of the vertebrate neural crest (crest cells) are an invaluable model system to address cell fate specification. Crest cells are amenable to tissue culture, and they differentiate to a variety of neuronal and nonneuronal cell types. Earlier studies have determined that bone morphogenetic proteins (BMP-2, -4, and -7) and agents that elevate intracellular cyclic AMP (cAMP) stimulate the development of the sympathoadrenal (SA, adrenergic) lineage in neural crest cultures. To investigate whether interactive mechanisms between signaling pathways influence crest cell differentiation, we characterized the combinatorial effects of BMP-2 and cAMP-elevating agents on the development of quail trunk neural crest cells in primary culture. We report that the cAMP signaling pathway modulates both positive and negative signals influencing the development of SA cells. Specifically, we show that moderate activation of cAMP signaling promotes, in synergy with BMP-2, SA cell development and the expression of the SA lineage-determining gene Phox2a. By contrast, robust activation of cAMP signaling opposes, even in the presence of BMP-2, SA cell development and the expression of the SA lineage-determining ASH-1 and Phox2 genes. We conclude that cAMP signaling acts as a bimodal regulator of SA cell development in neural crest cultures. PMID:10757785

Bilodeau, Matthew L.; Boulineau, Theresa; Hullinger, Ronald L.; Andrisani, Ourania M.

2000-01-01

144

REVIEW: Role of cyclic AMP signaling in the production and function of the incretin hormone glucagon-like peptide-1  

NASA Astrophysics Data System (ADS)

Pancreatic cells express the proglucagon gene (gcg) and thereby produce the peptide hormone glucagon, which stimulates hepatic glucose production and thereby increases blood glucose levels. The same gcg gene is also expressed in the intestinal endocrine L cells and certain neural cells in the brain. In the gut, gcg expression leads to the production of glucagon-like peptide-1 (GLP-1). This incretin hormone stimulates insulin secretion when blood glucose level is high. In addition, GLP-1 stimulates pancreatic cell proliferation, inhibits cell apoptosis, and has been utilized in the trans-differentiation of insulin producing cells. Today, a long-term effective GLP-1 receptor agonist has been developed as a drug in treating diabetes and potentially other metabolic disorders. Extensive investigations have shown that the expression of gcg and the production of GLP-1 can be activated by the elevation of the second messenger cyclic AMP (cAMP). Recent studies suggest that in addition to protein kinase A (PKA), exchange protein activated by cAMP (Epac), another effector of cAMP signaling, and the crosstalk between PKA and Wnt signaling pathway, are also involved in cAMP-stimulated gcg expression and GLP-1 production. Furthermore, functions of GLP-1 in pancreatic cells are mainly mediated by cAMP-PKA, cAMP-Epac and Wnt signaling pathways as well.

Yu, Zhiwen; Jin, Tianru

2008-01-01

145

Characterization of Mycobacterium tuberculosis Rv3676 (CRPMt), a Cyclic AMP Receptor Protein-Like DNA Binding Protein  

PubMed Central

Little is known about cyclic AMP (cAMP) function in Mycobacterium tuberculosis, despite its ability to encode 15 adenylate cyclases and 10 cNMP-binding proteins. M. tuberculosis Rv3676, which we have designated CRPMt, is predicted to be a cAMP-dependent transcription factor. In this study, we characterized CRPMt's interactions with DNA and cAMP, using experimental and computational approaches. We used Gibbs sampling to define a CRPMt DNA motif that resembles the cAMP receptor protein (CRP) binding motif model for Escherichia coli. CRPMt binding sites were identified in a total of 73 promoter regions regulating 114 genes in the M. tuberculosis genome, which are being explored as a regulon. Specific CRPMt binding caused DNA bending, and the substitution of highly conserved nucleotides in the binding site resulted in a complete loss of binding to CRPMt. cAMP enhanced CRPMt's ability to bind DNA and caused allosteric alterations in CRPMt conformation. These results provide the first direct evidence for cAMP binding to a transcription factor in M. tuberculosis, suggesting a role for cAMP signal transduction in M. tuberculosis and implicating CRPMt as a cAMP-responsive global regulator. PMID:16267303

Bai, Guangchun; McCue, Lee Ann; McDonough, Kathleen A.

2005-01-01

146

Cyclic-AMP inhibition of fimbriae and prodigiosin production by Serratia marcescens is strain-dependent.  

PubMed

The cyclic-nucleotide 3',5'-cyclic AMP (cAMP) is an ancient and widespread regulatory molecule. Previous studies have shown that fimbria production and secondary metabolite production are inhibited by cAMP in the prokaryote Serratia marcescens. This study used genetic manipulations to test the strain specificity of cAMP-cyclic-AMP receptor protein regulation of fimbria production and of the red pigment, prodigiosin. A surprising amount of variation was observed, as multicopy expression of the cAMP-phosphodiesterase gene, cpdS, conferred either an increase or decrease in fimbriae-dependent yeast agglutination and prodigiosin production depending upon the strain background. Mutation of crp, the gene coding for the cAMP-receptor protein, similarly conferred strain-dependent phenotypes. This study shows that three distinct biological properties, modulated by a conserved genetic regulatory molecule, can vary significantly among strains. Such variation can complicate the functional analysis of bacterial phenotypic properties which are dependent upon global genetic regulators such as cAMP. PMID:24619531

Stella, Nicholas A; Shanks, Robert M Q

2014-05-01

147

The Effect of Portacaval Shunt upon Hepatic Cholesterol Synthesis and Cyclic AMP in Dogs and Baboons1,2  

PubMed Central

Hepatic cholesterol synthesis, hepatic cyclic AMP, and portal and peripheral insulin and glucagon levels were investigated in nine dogs and three baboons after complete portacaval shunt. Cholesterol synthesis as measured with acetate incorporation was reduced in both species. Hepatic cyclic AMP increased in dogs. Changes in portal and systemic insulin were inconsistent, but hyper-glucagonemia occurred regularly. Diminished hepatic cholesterol synthesis is apparently one factor, although probably not the only one, in the antilipidemic effect of portacaval shunt. This altered cholesterol metabolism may be due to a change in the hormonal environment of the liver caused by portal diversion. PMID:6244463

Francavilla, Antonio; Jones, Arthur F.; Benichou, Joseph; Starzl, Thomas E.

2010-01-01

148

Seventeen Sxy-Dependent Cyclic AMP Receptor Protein Site-Regulated Genes Are Needed for Natural Transformation in Haemophilus influenzae  

PubMed Central

Natural competence is the ability of bacteria to actively take up extracellular DNA. This DNA can recombine with the host chromosome, transforming the host cell and altering its genotype. In Haemophilus influenzae, natural competence is induced by energy starvation and the depletion of nucleotide pools. This induces a 26-gene competence regulon (Sxy-dependent cyclic AMP receptor protein [CRP-S] regulon) whose expression is controlled by two regulators, CRP and Sxy. The role of most of the CRP-S genes in DNA uptake and transformation is not known. We have therefore created in-frame deletions of each CRP-S gene and studied their competence phenotypes. All but one gene (ssb) could be deleted. Although none of the remaining CRP-S genes were required for growth in rich medium or survival under starvation conditions, DNA uptake and transformation were abolished or reduced in most of the mutants. Seventeen genes were absolutely required for transformation, with 14 of these genes being specifically required for the assembly and function of the type IV pilus DNA uptake machinery. Only five genes were dispensable for both competence and transformation. This is the first competence regulon for which all genes have been mutationally characterized. PMID:22821979

Mell, Joshua C.; Redfield, Rosemary J.

2012-01-01

149

Role of cyclic AMP-induced Cl conductance in aqueous humour formation by the dog ciliary epithelium.  

PubMed Central

1. The effects of isoprenaline, a forskolin derivative NKH-477, and dibutyryl cyclic AMP (db cyclic AMP) on the membrane potential, conductance and cell volume of the dog non-pigmented ciliary epithelium (NPE) were investigated by intracellular potential recording, nystatin-perforated patch clamp technique and videomicroscopic cytometry. 2. The resting membrane potential of NPE was about -70 mV in physiological saline and was depolarized by isoprenaline in a dose-dependent manner with an ED50 of about 3 nM. This depolarization was competitively antagonized by the beta-adrenoceptor antagonist, timolol (pA2 = ca. 9) and almost completely blocked by the Cl transport blocker, DIDS. 3. In single dissociated NPE cells, 10 microM isoprenaline induced an inward current and caused a concomitant decrease in cell volume. The reversal potential measurement indicated that this inward current was carried mainly by Cl ion. DIDS (10 microM) abolished both the current and cell volume decrease. 4. NKH-477 (10 microM) or db cyclic AMP (1 mM) also induced an inward current together with a cell volume decrease, the properties of which were similar to those caused by isoprenaline. 5. These results suggest that beta-adrenoceptor stimulation in NPE leads to an increased rate of aqueous humour production by increasing Cl- efflux via an elevation of cyclic AMP and this effect is efficiently blocked by timolol. PMID:7952875

Chen, S.; Inoue, R.; Inomata, H.; Ito, Y.

1994-01-01

150

The cyclic AMP receptor protein is dependent on GcvA for regulation of the gcv operon.  

PubMed

The Escherichia coli gcv operon is transcriptionally regulated by the GcvA, GcvR, Lrp, and PurR proteins. In this study, the cyclic AMP (cAMP) receptor protein (CRP) is shown to be involved in positive regulation of the gcv operon. A crp deletion reduced expression of a gcvT-lacZ fusion almost fourfold in glucose minimal (GM) medium. The phenotype was complemented by both the wild-type crp gene and four crp alleles that encode proteins with amino acid substitutions in known activating regions of CRP. A cyaA deletion also resulted in a fourfold decrease in gcvT-lacZ expression, and wild-type expression was restored by the addition of cAMP to the growth medium. A cyaA crp double deletion resulted in levels of gcvT-lacZ expression identical to those observed with either single mutation, showing that CRP and cAMP regulate through the same mechanism. Growth in GM medium plus cAMP or glycerol minimal medium did not result in a significant increase in gcvT-lacZ expression. Thus, the level of cAMP present in GM medium appears to be sufficient for regulation by CRP. DNase I footprint analysis showed that CRP binds and protects two sites centered at bp -313 (site 1) and bp -140 (site 2) relative to the transcription initiation site, but a mutational analysis demonstrated that only site 1 is required for CRP-mediated regulation of gcvT-lacZ expression. Expression of the gcvT-lacZ fusion in a crp gcvA double mutant suggested that CRP's role is dependent on the GcvA protein. PMID:10074087

Wonderling, L D; Stauffer, G V

1999-03-01

151

Cholera toxin partially inhibits the T-cell response to phytohaemagglutinin through the ADP-ribosylation of a 45 kDa membrane protein.  

PubMed Central

This study examines the influence of cholera toxin (CT) on T lymphocyte activation by the mitogenic lectin phytohaemagglutinin (PHA). CT suppressed lectin-induced [3H]thymidine uptake in a dose-dependent fashion and acted synergistically with PHA in the generation of intracellular cyclic AMP. The toxin was assumed to act on Gs, because it also stimulated ADP-ribosylation of a 45 kDa membrane protein in vitro; no additional substrates were seen. The inhibitory effect of the adenylate cyclase/cyclic AMP pathway was shown to be directed at a concomitant stimulatory pathway, namely inositol phospholipid turnover. Lectin-stimulated 32P incorporation into both phosphatidylinositol as well as its 4,5-biphosphate derivative was depressed in the presence of CT or exogenous dibutyryl cyclic AMP. This, in turn, was associated with reduced activation of C-kinase as determined by decreased lectin-induced translocation from the cytosol to the surface membrane. These results indicate that Gs probably acts as a transducer between the PHA receptor and adenylate cyclase and may give rise to an exaggerated adenylate cyclase response in the presence of CT. It would seem as if reduction in inositol phospholipid turnover is related to the elevation of cyclic AMP rather than a CT effect on a putative transducer which acts directly on phospholipase C. Our study does not exclude the existence of non-CT-sensitive transducers in this capacity. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. PMID:2851989

Nel, A E; Vandenplas, M; Wooten, M M; Cooper, R; Vandenplas, S; Rheeder, A; Daniels, J

1988-01-01

152

The Paired-Domain Transcription Factor Pax8 Binds to the Upstream Enhancer of the Rat Sodium/Iodide Symporter Gene and Participates in Both Thyroid-Specific and Cyclic-AMP-Dependent Transcription  

PubMed Central

The gene encoding the Na/I symporter (NIS) is expressed at high levels only in thyroid follicular cells, where its expression is regulated by the thyroid-stimulating hormone via the second messenger, cyclic AMP (cAMP). In this study, we demonstrate the presence of an enhancer that is located between nucleotides ?2264 and ?2495 in the 5?-flanking region of the NIS gene and that recapitulates the most relevant aspects of NIS regulation. When fused to either its own or a heterologous promoter, the NIS upstream enhancer, which we call NUE, stimulates transcription in a thyroid-specific and cAMP-dependent manner. The activity of NUE depends on the four most relevant sites, identified by mutational analysis. The thyroid-specific transcription factor Pax8 binds at two of these sites. Mutations that interfere with Pax8 binding also decrease transcriptional activity of the NUE. Furthermore, expression of Pax8 in nonthyroid cells results in transcriptional activation of NUE, strongly suggesting that the paired-domain protein Pax8 plays an important role in NUE activity. The NUE responds to cAMP in both protein kinase A-dependent and -independent manners, indicating that this enhancer could represent a novel type of cAMP responsive element. Such a cAMP response requires Pax8 but also depends on the integrity of a cAMP responsive element (CRE)-like sequence, thus suggesting a functional interaction between Pax8 and factors binding at the CRE-like site. PMID:10022892

Ohno, Makoto; Zannini, Mariastella; Levy, Orlie; Carrasco, Nancy; di Lauro, Roberto

1999-01-01

153

Negative Regulation of IS2 Transposition by the Cyclic AMP (cAMP)cAMP Receptor Protein Complex  

Microsoft Academic Search

Three sequences similar to that of the consensus binding sequence of the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex were found in the major IS2 promoter region. Experiments were performed to determine whether the cAMP-CRP complex plays a role in the regulation of IS2 transposition. In the gel retardation assay, the cAMP-CRP complex was found to be able to bind

SHIAU-TING HU; HSUAN-CHEN WANG; GUANG-SHENG LEI; SHAO-HUNG WANG

1998-01-01

154

The Cyclic AMP Receptor Protein Is Dependent on GcvA for Regulation of the gcv Operon  

Microsoft Academic Search

The Escherichia coli gcv operon is transcriptionally regulated by the GcvA, GcvR, Lrp, and PurR proteins. In this study, the cyclic AMP (cAMP) receptor protein (CRP) is shown to be involved in positive regulation of the gcv operon. A crp deletion reduced expression of a gcvT-lacZ fusion almost fourfold in glucose minimal (GM) medium. The phenotype was complemented by both

LAURA D. WONDERLING; GEORGE V. STAUFFER

1999-01-01

155

An EAL domain protein and cyclic AMP contribute to the interaction between the two quorum sensing systems in Escherichia coli  

Microsoft Academic Search

Quorum sensing (QS) is a bacterial cell-cell communication process by which bacteria communicate using extracellular signals called autoinducers. Two QS systems have been identified in Escherichia coli K-12, including an intact QS system 2 that is stimulated by the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex and a partial QS system 1 that consists of SdiA (suppressor of cell division

Xianxuan Zhou; Xiaoming Meng; Baolin Sun

2008-01-01

156

Cyclic AMP and prostaglandin E in perfusates of rat hind paws during the development of adjuvant arthritis  

Microsoft Academic Search

The contralateral uninjected hind paws of rats which had been injected with Freund's complete (FCA) or incomplete (FIA) adjuvant 10,14, 18, or 22 days previously were perfused under urethane anaesthesia using a stainless steel coaxial catheter. In one series of experiments cyclic AMP (cAMP) levels were determined after a 2-hour perfusion. cAMP levels were also determined in rats treated on

M. J. Parnham; I. L. Bonta; M. J. P. Adolfs

1978-01-01

157

Effects of cobalt-60 gamma-irradiation in association with prostaglandin E1 treatment on the cyclic AMP levels of some radiosensitive tissues.  

PubMed

The amounts of cyclic AMP in brain, liver and intestinal mucosa have been measured in rats, at constant intervals, up to 18 days after whole-body exposure to either a unique moderate dose (500 rd) or a unique lethal dose (750 rd) of cobalt-60 gamma-radiation in association with a preliminary intraperitoneally treatment with prostaglandin E1 (5 microgram/100 g body weight/day) during five days. The amounts of tissular cyclic AMP in these two experimental groups were compared with those obtained from control groups identically irradiated or treated with prostaglandin E1. The effects of gamma-irradiation and prostaglandin E1 treatment on the cyclic AMP levels were found to be quite specific in these organs, suggesting that they contain different adenyl cyclase-cyclic AMP-phosphodiesterase systems: a cerebral system which is influenced by both gamma-radiation and prostaglandin E1, a hepatic system which is "radioresistant" and an intestinal system which is not influenced by prostaglandin E1. When associated with gamma-radiation, this prostaglandin is capable, on the one hand, to annul the "radioresistance" of the hepatic cyclic AMP system and, on the other hand, to annul the "radiosensitivity" of the intestinal cyclic AMP system. PMID:201052

P?u?escu, E; Popescu, M V; Teodosiu, T; P?un, C; Chirvasie, R; Simionescu, A

1977-11-01

158

Control of biodegradative threonine dehydratase inducibility by cyclic AMP in energy-restricted Escherichia coli.  

PubMed Central

To explain the requirement for anaerobic conditions in the induction of biodegradative L-threonine dehydratase in Escherichia coli, Crookes strain, measurements of cyclic AMP (cAMP) were made during aerobic and anaerobic growth and upon an aerobic-to-anaerobic transition. Internal cAMP levels were similar (5 to 10 muM) throughout exponential growth, whether aerobic or anaerobic, but only during anaerobiosis was threonine dehydratase synthesized. When an exponentially growing aerobic culture was made anaerobic, a sharp increase in internal cAMP was noted, reaching 300 muM within 10 min and declining thereafter to normal anaerobic levels. Threonine dehydratase synthesis was detected immediately after the attainment of peak cAMP levels and continued for several generations. A similar pattern but with less accumulation of cAMP and less threonine dehydratase production was also noted upon treatment of an aerobically growing culture with KCN. Pyruvate addition at the time of anaerobic shock severely affected both cAMP accumulation and threonine dehydratase synthesis; however, externally added cAMP could partially counter the pyruvate effect on enzyme synthesis. The conclusion was reached that conditions which resulted in a temporary energy deficit brought about the major accumulation of cAMP, and this elevated level served as a signal for initiation of threonine dehydratase synthesis to supply energy by the nonoxidative degradation of threonine. PMID:211115

Phillips, A T; Egan, R M; Lewis, B

1978-01-01

159

Multiple treatments with L-3,4-dihydroxyphenylalanine modulate dopamine biosynthesis and neurotoxicity through the protein kinase A-transient extracellular signal-regulated kinase and exchange protein activation by cyclic AMP-sustained extracellular signal-regulated kinase signaling pathways.  

PubMed

Multiple treatments with L-3,4-dihydroxyphenylalanine (L-DOPA; 20 µM) induce neurite-like outgrowth and reduce dopamine biosynthesis in rat adrenal pheochromocytoma (PC) 12 cells. We therefore investigated the effects of multiple treatments with L-DOPA (MT-LD) on cell survival and death over a duration of 6 days by using PC12 cells and embryonic rat midbrain primary cell cultures. MT-LD (10 and 20 µM) decreased cell viability, and both types of cells advanced to the differentiation process at 4-6 days. MT-LD induced cyclic adenosine monophosphate (cAMP)-dependent protein kinase A (PKA) phosphorylation and exchange protein activation by cAMP (Epac) expression at 1-3 days, which led to transient extracellular signal-regulated kinase (ERK1/2) phosphorylation in both cells. In these states, MT-LD activated cAMP-response element binding protein (CREB; Ser133) and tyrosine hydroxylase (Ser40) phosphorylation in PC12 cells, which led to an increase in intracellular dopamine levels. In contrast, MT-LD induced prolonged Epac expression at 4-5 days in both cells, which led to sustained ERK1/2 phosphorylation. In these states, the dopamine levels were decreased in PC12 cells. In addition, MT-LD induced c-Jun N-terminal kinase1/2 phosphorylation and cleaved caspase-3 expression at 4-6 days in both cells. These results suggest that MT-LD maintains cell survival via PKA-transient ERK1/2 activation, which stimulates dopamine biosynthesis. In contrast, at the later time period, MT-LD induces differentiation via both prolonged Epac and sustained ERK1/2 activation, which subsequently leads to the cell death process. Our data demonstrate that L-DOPA can cause neurotoxicity by modulating the Epac-ERK pathways in neuronal and PC12 cells. © 2014 Wiley Periodicals, Inc. PMID:25044243

Park, Keun Hong; Park, Hyun Jin; Shin, Keon Sung; Lee, Myung Koo

2014-12-01

160

Estrogen and cyclic amp action, and the involvement of the cytoskeleton on gap junction formation in rat myometrium  

E-print Network

ESTROGEN AND CYCLIC AMP ACTION, ANO THE INVOLVEMENT OF THE CYTOSKELETON ON GAP JUNCTION FORMATION IN RAT MYOMETRIUM A Thesis by OANA GADOY Submitted to the Graduate College of Texas A8M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE August 1985 Major Subject: Zoology ESTROGEN AND CYCLIC ANP ACTION, AND THE INVOLVEHEi4T OF THE CYTOSKELETON ON GAP JUNCTION FORMATION IN RAT HYOMETRIUH A Thesis by DANA GAODY Approved as to style and content by: Ro...

Gaddy, Dana

2012-06-07

161

Regulated expression of cyclic AMP-dependent protein kinase A reveals an influence on cell size and the secretion of virulence factors in Cryptococcus neoformans.  

PubMed

Cyclic AMP-dependent protein kinase A (PKA) regulates elaboration of the virulence factors melanin and polysaccharide capsule in Cryptococcus neoformans. A mutation in PKA1 encoding the catalytic subunit is known to reduce virulence in mice while a defect in PKR1 encoding the regulatory subunit enhances disease. Here, we constructed strains with galactose-inducible and glucose-repressible versions of PKA1 and PKR1 by inserting the GAL7 promoter upstream of the genes. As expected, no capsule was found in dextrose-containing media for the P(GAL7):PKA1 strain, whereas a large capsule was formed on cells grown in galactose. Along with capsule thickness, high PKA activity also influenced cell size, ploidy and vacuole enlargement, as observed in previous reports of giant/titan cell formation. We employed the regulated strains to test the hypothesis that PKA influences secretion and found that elevated PKA expression positively regulates extracellular protease activity and negatively regulates urease secretion. Furthermore, proper PKA regulation and activity were required for wild-type levels of melanization and laccase activity, as well as correct localization of the enzyme. The latter phenotype is consistent with the discovery that PKA regulates the organization of intracellular membrane compartments. Overall, these results indicate that PKA influences secretion pathways directly related to virulence factor elaboration. PMID:22717009

Choi, Jaehyuk; Vogl, A Wayne; Kronstad, James W

2012-08-01

162

Agonist trafficking of Gi/o-mediated ?2A-adrenoceptor responses in HEL 92.1.7 cells  

PubMed Central

The ability of 19 agonists to elevate Ca2+ and inhibit forskolin-induced cyclic AMP elevation through ?2A-adrenoceptors in HEL 92.1.7 cells was investigated. Ligands of catecholamine-like- (five), imidazoline- (nine) and non-catecholamine-non-imidazoline-type (five) were included. The relative maximum responses were similar in both assays. Five ligands were full or nearly full agonists, six produced 20?–?70% of the response to a full agonist and the remaining eight gave lower responses (<20%) so that their potencies were difficult to evaluate. Marked differences in the potencies of the agonists with respect to the two measured responses were seen. The catecholamines were several times less potent in decreasing cyclic AMP than in increasing Ca2+, whereas the other, both imidazoline and ox-/thiazoloazepine ligands, were several times more potent with respect to the former than the latter response. For instance, UK14,304 was more potent than adrenaline with respect to the cyclic AMP response but less potent than adrenaline with respect to the Ca2+ response. All the responses were sensitive to pertussis toxin-pretreatment. Also the possible role of PLA2, ?-adrenoceptors or ligand transport or metabolism as a source of error could be excluded. The results suggest that the active receptor states produced by catecholamines and the other agonists are markedly different and therefore have different abilities to activate different signalling pathways. PMID:11264241

Kukkonen, Jyrki P; Jansson, Christian C; Akerman, Karl E O

2001-01-01

163

Chromatin-Dependent Cooperativity between Constitutive and Inducible Activation Domains in CREB  

Microsoft Academic Search

The cyclic AMP (cAMP)-responsive factor CREB induces target gene expression via constitutive (Q2) and inducible (KID, for kinase-inducible domain) activation domains that function synergistically in response to cellular signals. KID stimulates transcription via a phospho (Ser133)-dependent interaction with the coacti- vator paralogs CREB binding protein and p300, whereas Q2 recruits the TFIID complex via a direct associ- ation with hTAFII130.

HIROSHI ASAHARA; BUYUNG SANTOSO; ERNESTO GUZMAN; KEYONG DU; PHILIP A. COLE; IRWIN DAVIDSON; MARC MONTMINY

2001-01-01

164

Circadian responses of teleostean oocytes to gonadotropins and prostaglandins determined by cyclic AMP concentration  

E-print Network

rhythm of pituitary gonadotropin synthesis and release has been demons- trated in the teleosts Salvelinus fontinalis, Salmo gairdneri and Notemigonus crysoleucas (O'Connor, 1972 ; De Vlaming and Vodicnik, 1977

Paris-Sud XI, Université de

165

Stressor-Specific Regulation of Distinct Brain-Derived Neurotrophic Factor Transcripts and Cyclic AMP Response  

E-print Network

that stress-induced hippocampal damage may play a vital role in the etiology of depressive disorders (Mc to stress but also to stress-related psychopathology (Heim and Nemeroff, 2002). Although it is evident

Vaidya, Vidita

166

Cyclic AMP-Mediated Suppression of Neutrophil Extracellular Trap Formation and Apoptosis by the Bordetella pertussis Adenylate Cyclase Toxin.  

PubMed

The adenylate cyclase toxin (ACT) of Bordetella pertussis intoxicates target cells by generating supraphysiologic levels of intracellular cyclic AMP (cAMP). Since ACT kills macrophages rapidly and potently, we asked whether ACT would also kill neutrophils. In fact, ACT prolongs the neutrophil life span by inhibiting constitutive apoptosis and preventing apoptosis induced by exposure to live B. pertussis. Imaging of B. pertussis-exposed neutrophils revealed that B. pertussis lacking ACT induces formation of neutrophil extracellular traps (NETs), whereas wild-type B. pertussis does not, suggesting that ACT suppresses NET formation. Indeed, ACT inhibits formation of NETs by generating cAMP and consequently inhibiting the oxidative burst. Convalescent-phase serum from humans following clinical pertussis blocks the ACT-mediated suppression of NET formation. These studies provide novel insight into the phagocyte impotence caused by ACT, which not only impairs neutrophil function but also inhibits death of neutrophils by apoptosis and NETosis. PMID:25287922

Eby, Joshua C; Gray, Mary C; Hewlett, Erik L

2014-12-01

167

Cyclic AMP Receptor Protein-Dependent Repression of Heat-Labile Enterotoxin  

Microsoft Academic Search

Enterotoxigenic Escherichia coli is a major cause of acute diarrheal illness worldwide and is responsible for high infant and child mortality rates in developing nations. Two types of enterotoxins, one heat labile and the other heat stable, are known to cause diarrhea. The expression of soluble heat-labile toxin is subject to catabolite (glucose) activation, and three binding sites for cAMP

Maria D. Bodero; George P. Munson

2009-01-01

168

Cyclic AMP and afferent activity govern bidirectional synaptic plasticity in striatopallidal neurons.  

PubMed

Recent experimental evidence suggests that the low dopamine conditions in Parkinson's disease (PD) cause motor impairment through aberrant motor learning. Those data, along with computational models, suggest that this aberrant learning results from maladaptive corticostriatal plasticity and learned motor inhibition. Dopaminergic modulation of both corticostriatal long-term depression (LTD) and long-term potentiation (LTP) is proposed to be critical for these processes; however, the regulatory mechanisms underlying bidirectional corticostriatal plasticity are not fully understood. Previously, we demonstrated a key role for cAMP signaling in corticostriatal LTD. In this study, mouse brain slices were used to perform a parametric experiment that tested the impact of varying both intracellular cAMP levels and the strength of excitatory inputs on corticostriatal plasticity. Using slice electrophysiology in the dorsolateral striatum, we demonstrate that both LTP and LTD can be sequentially induced in the same D2-expressing neuron and that LTP was strongest with high intracellular cAMP and LFS, whereas LTD required low intracellular cAMP and high-frequency stimulation. Our results provide a molecular and cellular basis for regulating bidirectional corticostriatal synaptic plasticity and may help to identify novel therapeutic targets for blocking or reversing the aberrant synaptic plasticity that likely contributes to motor deficits in PD. PMID:24806695

Augustin, Shana M; Beeler, Jeff A; McGehee, Daniel S; Zhuang, Xiaoxi

2014-05-01

169

Production and release of cyclic AMP by Daphnia pulex: implications of grazing activity  

SciTech Connect

Daphnia pulex, a common cladoceran zooplankton species, contains tissue cAMP concentrations similar to those found in algae, bacteria, and aquatic macrophytes. Daphnia release significant quantities of cAMP into the extracellular medium. Release of algal cellular cAMP as a result of digestive degradation of algal cells may also be an important source of dissolved cAMP in lakewater.

Francko, D.A.; Wetzel, R.G.

1982-04-01

170

Phosphorylation of the protein kinase A catalytic subunit is induced by cyclic AMP deficiency and physiological stresses in the fission yeast, Schizosaccharomyces pombe  

SciTech Connect

Research highlights: {yields} cAMP deficiency induces phosphorylation of PKA catalytic subunit (Pka1) in S. pombe. {yields} Pka1 phosphorylation is further induced by physiological stresses. {yields} Pka1 phosphorylation is not induced in cells lacking the PKA regulatory subunit. {yields} Results suggest that cAMP-independent Pka1 phosphorylation is stimulatory in nature. -- Abstract: In the fission yeast, Schizosaccharomyces pombe, cyclic AMP (cAMP)-dependent protein kinase (PKA) is not essential for viability under normal culturing conditions, making this organism attractive for investigating mechanisms of PKA regulation. Here we show that S. pombe cells carrying a deletion in the adenylate cyclase gene, cyr1, express markedly higher levels of the PKA catalytic subunit, Pka1, than wild type cells. Significantly, in cyr1{Delta} cells, but not wild type cells, a substantial proportion of Pka1 protein is hyperphosphorylated. Pka1 hyperphosphorylation is strongly induced in cyr1{Delta} cells, and to varying degrees in wild type cells, by both glucose starvation and stationary phase stresses, which are associated with reduced cAMP-dependent PKA activity, and by KCl stress, the cellular adaptation to which is dependent on PKA activity. Interestingly, hyperphosphorylation of Pka1 was not detected in either cyr1{sup +} or cyr1{Delta} S. pombe strains carrying a deletion in the PKA regulatory subunit gene, cgs1, under any of the tested conditions. Our results demonstrate the existence of a cAMP-independent mechanism of PKA catalytic subunit phosphorylation, which we propose could serve as a mechanism for inducing or maintaining specific PKA functions under conditions in which its cAMP-dependent activity is downregulated.

McInnis, Brittney; Mitchell, Jessica [Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487 (United States)] [Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487 (United States); Marcus, Stevan, E-mail: smarcus@bama.ua.edu [Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487 (United States)] [Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487 (United States)

2010-09-03

171

IGF-1 or insulin, and the TSH cyclic AMP cascade separately control dog and human thyroid cell growth and DNA synthesis, and complement each other in inducing mitogenesis.  

PubMed

The regular doubling of cell mass, and therefore of cell protein content, is required for repetitive cell divisions. Preliminary observations have shown that in dog thyrocytes insulin induces protein accumulation but not DNA synthesis, while TSH does not increase protein accumulation but triggers DNA synthesis in the presence of insulin. We show here that EGF and phorbol myristate ester complement insulin action in the same way. HGF is the only factor activating both protein accumulation and DNA synthesis. The effects of insulin on protein accumulation and in permitting the TSH effect are reproduced by IGF-1 and are mediated, at least in part by the IGF-1 receptor. The concentration effect curves are similar for both effects. Similar results are obtained in human thyrocytes. They reflect true cell growth, as shown by increases in RNA content and cell size. Carbachol and fetal calf serum also stimulate protein synthesis and accumulation without triggering DNA synthesis, but they are not permissive for the mitogenic effects of TSH or of the general adenylate cyclase activator, forskolin. Moreover the mitogenic effect of TSH greatly decreased in cells deprived of insulin for 2 days although these cells remain hypertrophic. Hypertrophy may therefore be necessary for cell division, but it is not sufficient to permit it. Three different mechanisms can therefore be distinguished in the mitogenic action of TSH: (1) the increase of cell mass (hypertrophy) induced by insulin or IGF-1; (2) the permissive effect of insulin or IGF-1 on the mitogenic effect of TSH which may involve both the increase of cell mass and the induction of specific proteins such as cyclin D3 and (3) the mitogenic effect of the TSH cyclic AMP cascade proper. PMID:10375016

Deleu, S; Pirson, I; Coulonval, K; Drouin, A; Taton, M; Clermont, F; Roger, P P; Nakamura, T; Dumont, J E; Maenhaut, C

1999-03-25

172

Putting on the Brakes: Cyclic AMP as a Multipronged Controller of Macrophage Function  

NSDL National Science Digital Library

Macrophages orchestrate innate immune responses in tissues by activating various proinflammatory signaling programs. A key mechanism for preventing inflammatory disease states that result from excessive activation of such programs is the generation of the second messenger cyclic adenosine monophosphate (cAMP) by ligation of certain guanine nucleotide–binding protein (G protein)–coupled receptors (GPCRs). The pleiotropic actions of this cyclic nucleotide on various inflammatory functions of macrophages are mediated by diverse molecular mechanisms, including the assembly of distinct multiprotein complexes. A better understanding of crosstalk between cAMP signaling and proinflammatory pathways in macrophages may provide a basis for improved immunomodulatory strategies.

Marc Peters-Golden (Ann Arbor;University of Michigan Medical School REV)

2009-06-16

173

Effects of Dibutyryl Cyclic-AMP on Survival and Neuronal Differentiation of Neural Stem/Progenitor Cells Transplanted into Spinal Cord Injured Rats  

PubMed Central

Neural stem/progenitor cells (NSPCs) have great potential as a cell replacement therapy for spinal cord injury. However, poor control over transplant cell differentiation and survival remain major obstacles. In this study, we asked whether dibutyryl cyclic-AMP (dbcAMP), which was shown to induce up to 85% in vitro differentiation of NSPCs into neurons would enhance survival of transplanted NSPCs through prolonged exposure either in vitro or in vivo through the controlled release of dbcAMP encapsulated within poly(lactic-co-glycolic acid) (PLGA) microspheres and embedded within chitosan guidance channels. NSPCs, seeded in fibrin scaffolds within the channels, differentiated in vitro to betaIII-tubulin positive neurons by immunostaining and mRNA expression, in response to dbcAMP released from PLGA microspheres. After transplantation in spinal cord injured rats, the survival and differentiation of NSPCs was evaluated. Untreated NSPCs, NSPCs transplanted with dbcAMP-releasing microspheres, and NSPCs pre-differentiated with dbcAMP for 4 days in vitro were transplanted after rat spinal cord transection and assessed 2 and 6 weeks later. Interestingly, NSPC survival was highest in the dbcAMP pre-treated group, having approximately 80% survival at both time points, which is remarkable given that stem cell transplantation often results in less than 1% survival at similar times. Importantly, dbcAMP pre-treatment also resulted in the greatest number of in vivo NSPCs differentiated into neurons (37±4%), followed by dbcAMP-microsphere treated NSPCs (27±14%) and untreated NSPCs (15±7%). The reverse trend was observed for NSPC-derived oligodendrocytes and astrocytes, with these populations being highest in untreated NSPCs. This combination strategy of stem cell-loaded chitosan channels implanted in a fully transected spinal cord resulted in extensive axonal regeneration into the injury site, with improved functional recovery after 6 weeks in animals implanted with pre-differentiated stem cells in chitosan channels. PMID:21738784

Kim, Howard; Zahir, Tasneem; Tator, Charles H.; Shoichet, Molly S.

2011-01-01

174

Functional roles of arcA, etrA, cyclic AMP (cAMP)-cAMP receptor protein, and cya in the arsenate respiration pathway in Shewanella sp. strain ANA-3.  

PubMed

Microbial arsenate respiration can enhance arsenic release from arsenic-bearing minerals--a process that can cause arsenic contamination of water. In Shewanella sp. strain ANA-3, the arsenate respiration genes (arrAB) are induced under anaerobic conditions with arsenate and arsenite. Here we report how genes that encode anaerobic regulator (arcA and etrA [fnr homolog]) and carbon catabolite repression (crp and cya) proteins affect arsenate respiration in ANA-3. Transcription of arcA, etrA, and crp in ANA-3 was similar in cells grown on arsenate and cells grown under aerobic conditions. ANA-3 strains lacking arcA and etrA showed minor to moderate growth defects, respectively, with arsenate. However, crp was essential for growth on arsenate. In contrast to the wild-type strain, arrA was not induced in the crp mutant in cultures shifted from aerobic to anaerobic conditions containing arsenate. This indicated that cyclic AMP (cAMP)-cyclic AMP receptor (CRP) activates arr operon transcription. Computation analysis for genome-wide CRP binding motifs identified a putative binding motif within the arr promoter region. This was verified by electrophoretic mobility shift assays with cAMP-CRP and several DNA probes. Lastly, four putative adenylate cyclase (cya) genes were identified in the genome. One particular cya-like gene was differentially expressed under aerobic versus arsenate respiration conditions. Moreover, a double mutant lacking two of the cya-like genes could not grow with arsenate as a terminal electron acceptor; exogenous cAMP could complement growth of the double cya mutant. It is concluded that the components of the carbon catabolite repression system are essential to regulating arsenate respiratory reduction in Shewanella sp. strain ANA-3. PMID:19060154

Murphy, Julie N; Durbin, K James; Saltikov, Chad W

2009-02-01

175

Does histamine stimulate cyclic amp formation in the avian pineal gland via a novel (non-H 1, non-H 2, non-H 3) histamine receptor subtype  

Microsoft Academic Search

The effects of histamine (HA), and selective HA, H1-, H2 and H3-receptor agonists on cyclic AMP formation were investigated in intact thick and duck pineal glands. HA potently stimulated the pineal cyclic AMP formation. The effect of HA was mimicked fully by N?-methylated histamines, and partially by several histaminergic drugs: 2-thiazolylethylamine (H1), amthamine (H2) and R?-methylhistamine (H3). Dimaprit, another selective

Jerzy Z. Nowak; Barbara Sek; Theresa D'Souza; Stuart E. Dryer

1995-01-01

176

Early Stimulation of Human Chorionic Gonadotropin Secretion by Dibutyryl Cyclic AMP and Theophylline in Human Malignant Trophoblast Cells in vitro: Inhibition by Actinomycin D, ?-Amanitin, and Cordycepin  

Microsoft Academic Search

Human malignant trophoblast cells (BeWo line) in culture were employed to investigate the early stimulation of human chorionic gonadotropin (hCG) secretion by 1 mM dibutyryl cyclic AMP and 1 mM theophylline (dbT). The earliest increase in secreted immunoreactive hCG occurred at least 3½ h following addition of dbT, and was preceded by an increase in intracellular hCG. These results suggested

Roland A Pattillo; Robert O. Hussa

1975-01-01

177

Cyclic AMP-mediated immune regulation--overview of mechanisms of action in T cells.  

PubMed

The canonical second messenger cAMP is well established as a potent negative regulator of T cell immune function. Through protein kinase A (PKA) it regulates T cell function at the level of transcription factors, members of the mitogen-activated protein kinase pathway, phospholipases (PLs), Ras homolog (Rho)A and proteins involved in the control of cell cycle progression. Type I PKA is the predominant PKA isoform in T cells. Furthermore, whereas type II PKA is located at the centrosome, type I PKA is anchored close to the T cell receptor (TCR) in lipid rafts by the Ezrin-ERM-binding phosphoprotein of 50 kDa (EBP50)-phosphoprotein associated with glycosphingolipid-enriched microdomains (PAG) scaffold complex. The most TCR-proximal target for type I PKA is C-terminal Src kinase (Csk), which upon activation by raft recruitment and phosphorylation inhibits the Src family tyrosine kinases Lck and Fyn and thus functions to maintain T cell homeostasis. Recently, induction of cAMP levels in responder T cells has emerged as one of the mechanisms by which regulatory T (T(R)) cells execute their suppressive action. Thus, the cAMP-type I PKA-Csk pathway emerges as a putative target for therapeutic intervention in autoimmune disorders as well as in cancer, where T(R) cell-mediated suppression contributes to suboptimal local immune responses. PMID:21130867

Mosenden, Randi; Taskén, Kjetil

2011-06-01

178

Calcium and Cyclic AMP Promote Axonal Regeneration in Caenorhabditis elegans and Require DLK-1 Kinase  

PubMed Central

Axons of adult Caenorhabditis elegans neurons undergo robust regenerative growth after laser axotomy. Here we show that axotomy of PLM sensory neurons triggers axonal calcium waves whose amplitude correlates with the extent of regeneration. Genetic elevation of Ca2+ or cAMP accelerates formation of a growth cone from the injured axon. Elevated Ca2+ or cAMP also facilitates apparent fusion of axonal fragments and promotes branching to postsynaptic targets. Conversely, inhibition of voltage-gated calcium channels or calcium release from internal stores reduces regenerative growth. We identify the fusogen EFF-1 as critical for axon fragment fusion and the basic leucine zipper domain (bZip) protein CREB (cAMP response element-binding protein) as a key effector for branching. The effects of elevated Ca2+ or cAMP on regrowth require the MAPKKK(mitogen-activated protein kinase kinase kinase) DLK-1. Increased cAMP signaling can partly bypass the requirement for the bZip protein CEBP-1, a downstream factor of the DLK-1 kinase cascade. These findings reveal the relationship between Ca2+/cAMP signaling and the DLK-1 MAPK (mitogen-activated protein kinase) cascade in regeneration. PMID:20203177

Ghosh-Roy, Anindya; Wu, Zilu; Goncharov, Alexandr; Jin, Yishi; Chisholm, Andrew D.

2010-01-01

179

Cyclic AMP-mediated regulation of transcription factor Lot1 expression in cerebellar granule cells.  

PubMed

Lot1, a zinc finger transcription factor acting as a tumor suppressor gene on tumoral cells, is highly expressed during brain development. In developing rat cerebellum, Lot1 expression is high in cerebellar granule cells (CGC), a neuronal population undergoing postnatal neurogenesis. The time course of Lot1 cerebellar expression closely matches the expression of pituitary adenylate cyclase-activating polypeptide (PACAP) receptors coupled to adenylyl cyclase. The aim of this study was to ascertain whether Lot1 expression is regulated by cAMP-dependent pathways and to identify mechanisms of Lot1 activation in CGC cultures. Our results show that Lot1 expression in CGC is cAMP-dependent, as treatments with either forskolin or PACAP-38 induced an increase in its expression at both the mRNA and protein levels. This effect on Lot1 expression was mimicked by dibutyryl cAMP and suppressed by protein kinase A and MEK inhibitors. In parallel, we found that treatments with forskolin and PACAP-38 in precursor CGC inhibited bromodeoxyuridine incorporation by 25 and 35%, respectively, indicating a negative effect on neuronal precursor proliferation. Luciferase reporter analysis and mutagenesis of the Lot1 promoter region indicated a crucial role of the AP1-binding site (located at -268 bp) in cAMP-induced Lot1 transcription. In addition, cotransfection experiments indicated that the c-Fos/c-Jun heterodimer is responsible for cAMP-dependent Lot1 transcriptional activation. In conclusion, our data demonstrate that, in CGC, Lot1 is under the transcriptional control of cAMP through an AP1 site regulated by the c-Fos/c-Jun heterodimer and suggest that this gene may be an important element of the cAMP-mediated pathway that regulates neuronal proliferation through the protein kinase A-MEK signaling cascade. PMID:16061485

Contestabile, Andrea; Fila, Tatiana; Bartesaghi, Renata; Ciani, Elisabetta

2005-09-30

180

Effect of interleukin-1. alpha. on striatal prostaglandin E2, cyclic AMP, and dopamine release in irradiated and nonirradiated rats  

SciTech Connect

The purpose of this study was to determine the effect of pretreatment with IL-1{alpha} on irradiated and nonirradiated rats striatal prostaglandin E2 (PGE2) and cyclic AMP (cAMP) levels and in vitro release of dopamine (DA) stimulated by KCl. Rats were irradiated using a LINAC. Striatal PGE2 and cAMP were estimated by radioimmunoassay, and DA was measured by HPLC coupled to electrochemical detection. A 20-hr pretreatment with 10-50 {mu}/kg IP of IL-1{alpha} increased striatal PGE2, had no significant effect on cAMP, but enhanced 30 mM KCl-stimulated DA release in irradiated and nonirradiated animals, although there was no significant difference between them. However, 1-hr pretreatment with IL-1{alpha} had no significant effect on PGE2 and cAMP levels and DA release. IL-1{alpha} enhanced PGE2, and DA releases were attenuated by 1-3 mg/kg IP of indomethacin, a cyclooxygenase inhibitor. Exogenous administration of 500 mM to 5 {mu}M of PGE2 increased 30 mM KCl-stimulated DA release in irradiated and nonirradiated animals. These results suggest that IL-1{alpha} increased KCl-stimulated DA release in striatum is mediated by PGE2 because IL-1{alpha} increased PGE2 levels in vivo and exogenous administration of PGE2 enhanced DA release.

Kandasamy, S.B.; Chen, H.T.; Blakley, S.; Dalton, T.K.; Harris, A.H. (Armed Forces Radiobiology Research Inst., Bethesda, MD (United States))

1991-03-11

181

Action of 50 Hz magnetic fields on cyclic AMP and intercellular communication in monolayers and spheroids of mammalian cells  

SciTech Connect

To investigate the influence of physiological parameters such as cell density and three-dimensional cell contact on the biological action of a 2mT/50 Hz magnetic field, mouse fibroblasts were exposed as monolayers and as multicellular spheroids. Changes in cyclic AMP content of cells and alterations in gap junction-mediated intercellular communication were measured immediately after 5 min of exposure to the field. In monolayers of intermediate cell density (1 {times} 10{sup 5} cells/cm{sup 2}), the field treatment caused an increase in cAMP to 121% of the control level, whereas, at 3 {times} 10{sup 5} cells/cm{sup 2} (near confluence), a decrease to 88% of the unexposed cells was observed. Furthermore, field exposure stimulated gap-junction communication to 160% of the control level as determined by Lucifer yellow dye exchange. In spheroids, alterations in the radial profile of cellular cAMP were observed that were due both to field-induced local cAMP changes and to increased gap-junction permeability for this second messenger, the latter causing radial cAMP gradients to be flattened. The results indicate a strong dependence of field action on physiological parameters of the system exposed.

Schimmelpfeng, J.; Stein, J.C.; Dertinger, H. [Research Center Karlsruhe (Germany). Inst. of Toxicology

1995-12-31

182

Cyclic AMP mediates the elevation of proline by AKH peptides in the cetoniid beetle, Pachnoda sinuata.  

PubMed

The role of cyclic nucleotides in the transduction of the hyperprolinaemic and hypertrehalosaemic signal of the endogenous neuropeptide Mem-CC was investigated in the cetoniid beetle Pachnoda sinuata. Flight and injection of Mem-CC into the haemocoel of the beetle induce an increase of cAMP levels in the fat body of the beetle. This increase is tissue-specific and does not occur in brain and flight muscles. An elevation of cAMP levels was also found when in vitro preparations of fat body tissue were subjected to Mem-CC. Elevation of the cAMP concentration after injection of Mem-CC is time- and dose-dependent: the maximum response is measured after 1 min, and a dose of 25 pmol Mem-CC is needed. Injection of cpt-cAMP, a cAMP analogue which penetrates the cell membrane, causes a stimulation of proline synthesis but no mobilisation of carbohydrate reserves. The same is measured when IBMX, an inhibitor of phosphodiesterase, is injected. cGMP seems not to be involved in synthesis of proline nor carbohydrate release, because injection of cpt-cGMP has no influence on the levels of proline, alanine and carbohydrates in the haemolymph. Although glycogen phosphorylase of the fat body is activated by Mem-CC in a time- and dose-dependent manner, it cannot be stimulated by cpt-cAMP. The combined data suggest that cAMP is involved in regulation of proline levels by Mem-CC but not in regulation of carbohydrates. Octopamine has no effect on metabolites in the haemolymph and is not capable of activating glycogen phosphorylase, indicating that it is not involved in the regulation of substrates in this beetle. Furthermore, the requirements of the receptor of Mem-CC are different for eliciting a hypertrehalosaemic and a hyperprolinaemic effect, respectively, suggesting that differentiation in signal transduction begins at the receptor level. PMID:10634934

Auerswald, L; Gäde, G

2000-01-10

183

Niguldipine discriminates between alpha 1-adrenoceptor-mediated second messenger responses in rat cerebral cortex slices.  

PubMed Central

The effect of both isomers of niguldipine, a highly selective alpha 1-adrenoceptor antagonist and dihydropyridine calcium channel blocker, on noradrenaline-stimulated inositol phosphate (IP) accumulation and adenosine 3':5'-cyclic monophosphate (cyclic AMP) potentiation was examined. Both isomers inhibited noradrenaline-stimulated IP accumulation. (+)-Niguldipine was 100 fold more potent than (-)-niguldipine. Potentiation of beta-adrenoceptor-stimulated cyclic AMP by noradrenaline was only partially inhibited by both isomers. The dihydropyridine, israpidine, did not inhibit either second messenger response. This study provides further evidence that the alpha 1-adrenoceptors mediating IP accumulation and cyclic AMP potentiation are different. PMID:2164859

Robinson, J. P.; Kendall, D. A.

1990-01-01

184

Intracellular lithium and cyclic AMP levels are mutually regulated in neuronal cells.  

PubMed

In this work, we studied the effect of intracellular 3',5'-cyclic adenosine monophosphate (cAMP) on Li+ transport in SH-SY5Y cells. The cells were stimulated with forskolin, an adenylate cyclase activator, or with the cAMP analogue, dibutyryl-cAMP. It was observed that under forskolin stimulation both the Li+ influx rate constant and the Li+ accumulation in these cells were increased. Dibutyryl-cAMP also increased Li+ uptake and identical results were obtained with cortical and hippocampal neurons. The inhibitor of the Na+/Ca2+ exchanger, KB-R7943, reduced the influx of Li+ under resting conditions, and completely inhibited the effect of forskolin on the accumulation of the cation. Intracellular Ca2+ chelation, or inhibition of N-type voltage-sensitive Ca2+ channels, or inhibition of cAMP-dependent protein kinase (PKA) also abolished the effect of forskolin on Li+ uptake. The involvement of Ca2+ on forskolin-induced Li+ uptake was confirmed by intracellular free Ca2+ measurements using fluorescence spectroscopy. Exposure of SH-SY5Y cells to 1 mm Li+ for 24 h increased basal cAMP levels, but preincubation with Li+, at the same concentration, decreased cAMP production in response to forskolin. To summarize, these results demonstrate that intracellular cAMP levels regulate the uptake of Li+ in a Ca(2+)-dependent manner, and indicate that Li+ plays an important role in the homeostasis of this second messenger in neuronal cells. PMID:15287898

Montezinho, L P; B Duarte, C; Fonseca, C P; Glinka, Y; Layden, B; Mota de Freitas, D; Geraldes, C F G C; Castro, M M C A

2004-08-01

185

Cyclic AMP mimics, but does not mediate, interleukin-1- and tumour-necrosis-factor-stimulated phospholipase A2 secretion from rat renal mesangial cells.  

PubMed Central

We have previously shown that recombinant interleukin 1 (IL-1) and recombinant tumour necrosis factor (TNF) synergistically stimulate phospholipase A2 release from mesangial cells. We now report that treatment of mesangial cells with the beta-agonist salbutamol, prostaglandin E2 (PGE2), cholera toxin or forskolin, which all activate adenylate cyclase, increased release of phospholipase A2 activity. Likewise, addition of a membrane-permeant cyclic AMP (cAMP) analogue or the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine enhanced release of phospholipase A2 activity from mesangial cells. There was a lag period of about 8 h before a significantly enhanced secretion could be detected. Furthermore, actinomycin D or cycloheximide completely suppressed cAMP-stimulated secretion of phospholipase A2. Angiotensin II, the phorbol ester phorbol 12-myristate 13-acetate, the Ca2+ ionophore A23187 and a membrane-permeant cGMP analogue did not stimulate phospholipase A2 release from the cells. Treatment with indomethacin completely inhibited IL-1 beta- and TNF-stimulated PGE2 synthesis, without having any effect on phospholipase A2 secretion, thus excluding cytokine-induced PGE2 synthesis as the mediator of phospholipase A2 release. Neither IL-1 beta nor TNF induced any increase in intracellular cAMP in mesangial cells. Furthermore, incubation of the cells with 2',5'-dideoxyadenosine, an inhibitor of adenylate cyclase, did not block cytokine-stimulated phospholipase A2 secretion. In addition, IL-1 beta and TNF synergistically interacted with forskolin to stimulate phospholipase A2 release from the cells. The protein kinase inhibitors H-8, staurosporine, K252a and amiloride inhibited IL-1 beta- and TNF-stimulated phospholipase A2 secretion. However, high concentrations that inhibit other protein kinases were needed. These observations suggest that IL-1 beta and TNF cause secretion of phospholipase A2 by a mechanism independent of cAMP. The signalling pathways used by IL-1 beta and TNF may involve a protein kinase that is probably different from protein kinase A or protein kinase C. PMID:1846528

Pfeilschifter, J; Leighton, J; Pignat, W; Märki, F; Vosbeck, K

1991-01-01

186

DISPARATE DEVELOPMENTAL NEUROTOXICANTS CONVERGE ON THE CYCLIC AMP SIGNALING CASCADE, REVEALED BY TRANSCRIPTIONAL PROFILES IN VITRO AND IN VIVO  

PubMed Central

Cell-signaling cascades are convergent targets for developmental neurotoxicity of otherwise unrelated agents. We compared organophosphates (chlorpyrifos, diazinon), an organochlorine (dieldrin) and a metal (Ni2+) for their effects on neuronotypic PC12 cells, assessing gene transcription involved in the cyclic AMP pathway. Each agent was introduced during neurodifferentiation at a concentration of 30 ?M for 24 or 72 hr and we assessed 69 genes encoding adenylyl cyclase isoforms and regulators, G-protein ?- and ?,?-subunits, protein kinase A subtypes and the phosphodiesterase family. We found strong concordance among the four agents across all the gene families, with the strongest relationships for the G-proteins, followed by adenylyl cyclase, and lesser concordance for protein kinase A and phosphodiesterase. Superimposed on this pattern, chlorpyrifos and diazinon were surprisingly the least alike, whereas there was strong concordance of dieldrin and Ni2+ with each other and with each individual organophosphate. Further, the effects of chlorpyrifos differed substantially depending on whether cells were undifferentiated or differentiating. To resolve the disparities between chlorpyrifos and diazinon, we performed analyses in rat brain regions after in vivo neonatal exposures; unlike the in vitro results, there was strong concordance. Our results show that unrelated developmental neurotoxicants can nevertheless produce similar outcomes by targeting cell signaling pathways involved in neurodifferentiation during a critical developmental period of vulnerability. Nevertheless, a full evaluation of concordance between different toxicants requires evaluations of in vitro systems that detect direct effects, as well as in vivo systems that allow for more complex interactions that converge on the same pathway. PMID:20026089

Adigun, Abayomi A.; Seidler, Frederic J.; Slotkin, Theodore A.

2009-01-01

187

Parathyroid hormone promotes the disassembly of cytoskeletal actin and myosin in cultured osteoblastic cells: Mediation by cyclic AMP  

SciTech Connect

Parathyroid hormone (PTH) alters the shape of osteoblastic cells both in vivo and in vitro. In this study, we examined the effect of PTH on cytoskeletal actin and myosin, estimated by polyacrylamide gel electrophoresis of Triton X-100 (1%) nonextractable proteins. After 2-5 minutes, PTH caused a rapid and transient decrease of 50-60% in polymerized actin and myosin associated with the Triton X-100 nonextractable cytoskeleton. Polymerized actin returned to control levels by 30 min. The PTH effect was dose-dependent with an IC50 of about 1 nM, and was partially inhibited by the (3-34) PTH antagonist. PTH caused a rapid transient rise in cyclic AMP (cAMP) in these cells that peaked at 4 min, while the nadir in cytoskeletal actin and myosin was recorded around 5 min. The intracellular calcium chelator Quin-2/AM (10 microM) also decreased cytoskeletal actin and myosin, to the same extent as did PTH (100 nM). To distinguish between cAMP elevation and Ca++ reduction as mediators of PTH action, we measured the phosphorylation of the 20 kD (PI 4.9) myosin light chain in cells preincubated with (32P)-orthophosphate. The phosphorylation of this protein decreased within 2-3 min after PTH addition and returned to control levels after 5 min. The calcium ionophore A-23187 did not antagonize this PTH effect. Visualization of microfilaments with rhodamine-conjugated phalloidin showed that PTH altered the cytoskeleton by decreasing the number of stress fibers. These changes in the cytoskeleton paralleled changes in the shape of the cells from a spread configuration to a stellate form with retracting processes. The above findings indicate that the alteration in osteoblast shape produced by PTH involve relatively rapid and transient changes in cytoskeletal organization that appear to be mediated by cAMP.

Egan, J.J.; Gronowicz, G.; Rodan, G.A. (National Institutes of Diabetes, Digestive, and Kidney Diseases, Bethesda, MD (USA))

1991-01-01

188

Disparate developmental neurotoxicants converge on the cyclic AMP signaling cascade, revealed by transcriptional profiles in vitro and in vivo.  

PubMed

Cell-signaling cascades are convergent targets for developmental neurotoxicity of otherwise unrelated agents. We compared organophosphates (chlorpyrifos, diazinon), an organochlorine (dieldrin) and a metal (Ni(2+)) for their effects on neuronotypic PC12 cells, assessing gene transcription involved in the cyclic AMP pathway. Each agent was introduced during neurodifferentiation at a concentration of 30 microM for 24 or 72 h and we assessed 69 genes encoding adenylyl cyclase isoforms and regulators, G-protein alpha-and beta,gamma-subunits, protein kinase A subtypes and the phosphodiesterase family. We found strong concordance among the four agents across all the gene families, with the strongest relationships for the G-proteins, followed by adenylyl cyclase, and lesser concordance for protein kinase A and phosphodiesterase. Superimposed on this pattern, chlorpyrifos and diazinon were surprisingly the least alike, whereas there was strong concordance of dieldrin and Ni(2+) with each other and with each individual organophosphate. Further, the effects of chlorpyrifos differed substantially depending on whether cells were undifferentiated or differentiating. To resolve the disparities between chlorpyrifos and diazinon, we performed analyses in rat brain regions after in vivo neonatal exposures; unlike the in vitro results, there was strong concordance. Our results show that unrelated developmental neurotoxicants can nevertheless produce similar outcomes by targeting cell signaling pathways involved in neurodifferentiation during a critical developmental period of vulnerability. Nevertheless, a full evaluation of concordance between different toxicants requires evaluations of in vitro systems that detect direct effects, as well as in vivo systems that allow for more complex interactions that converge on the same pathway. PMID:20026089

Adigun, Abayomi A; Seidler, Frederic J; Slotkin, Theodore A

2010-02-26

189

Cross Talk between a Fungal Blue-Light Perception System and the Cyclic AMP Signaling Pathway  

Microsoft Academic Search

The influence of light on living organisms is critical, not only because of its importance as the main source of energy for the biosphere but also due to its capacity to induce changes in the behavior and morphology of nearly all forms of life. In particular, physiological responses to blue light have been studied in a wide variety of organisms

Sergio Casas-Flores; Mauricio Rios-Momberg; Teresa Rosales-Saavedra; P. Martinez-Hernandez; Vianey Olmedo-Monfil; Alfredo Herrera-Estrella

2006-01-01

190

Cyclic nucleotide responses and radiation-induced mitotic delay in Physarum polycephalum  

SciTech Connect

The response of the plasmodial levels of cyclic AMP and cyclic GMP in Physarum polycephalum to several putative phosphodiesterase inhibitors and to ionizing radiation has been measured. Isobutylmethylxanthine (2 mM) induces a rapid transient threefold elevation of cyclic AMP alone, with maximum response in about 10 min and return to the base line in about 30 min. Theophylline (2 mM) induces a rapid, sustained twofold elevation of cyclic GMP only. Caffeine (2mM) and Ro-20-1724 (18 ..mu..M) both elicit a rapid transient rise in cyclic AMP, resembling the isobutylmethylxanthine response, and a slow transient elevation of the cyclic GMP level. Of particular interest is the rapid threefold transient elevation of the cyclic AMP, but not of the cyclic GMP, level by ..gamma.. radiation.

Daniel, J.W.; Oleinick, N.L.

1984-02-01

191

Glucocorticoids and cyclic AMP selectively increase hepatic lipin-1 expression, and insulin acts antagonistically*  

PubMed Central

Glucocorticoids (GCs) increase hepatic phosphatidate phosphatase (PAP1) activity. This is important in enhancing the liver's capacity for storing fatty acids as triacylglycerols (TAGs) that can be used subsequently for ?-oxidation or VLDL secretion. PAP1 catalyzes the conversion of phosphatidate to diacylglycerol, a key substrate for TAG and phospholipid biosynthesis. PAP1 enzymes in liver include lipin-1A and -1B (alternatively spliced isoforms) and two distinct gene products, lipin-2 and lipin-3. We determined the mechanisms by which the composite PAP1 activity is regulated using rat and mouse hepatocytes. Levels of lipin-1A and -1B mRNA were increased by dexamethasone (dex; a synthetic GC), and this resulted in increased lipin-1 synthesis, protein levels, and PAP1 activity. The stimulatory effect of dex on lipin-1 expression was enhanced by glucagon or cAMP and antagonized by insulin. Lipin-2 and lipin-3 mRNA were not increased by dex/cAMP, indicating that increased PAP1 activity is attributable specifically to enhanced lipin-1 expression. This work provides the first evidence for the differential regulation of lipin activities. Selective lipin-1 expression explains the GC and cAMP effects on increased hepatic PAP1 activity, which occurs in hepatic steatosis during starvation, diabetes, stress, and ethanol consumption. PMID:18245816

Manmontri, Boripont; Sariahmetoglu, Meltem; Donkor, Jimmy; Khalil, Maroun Bou; Sundaram, Meenakshi; Yao, Zemin; Reue, Karen; Lehner, Richard; Brindley, David N.

2008-01-01

192

Serotonin-Mediated Cyclic AMP Inhibitory Pathway in Platelets of Patients Affected by Panic Disorder  

Microsoft Academic Search

Cyclic adenosine monophosphate (cAMP) pathway abnormalities have been suggested to be involved in anxiety disorders including panic (PD). The present study sought at investigating the downstream inhibitory adenylyl cyclase (AC) pathway activated by 5-HT in platelets obtained from 22 patients with a diagnosis of PD versus 22 healthy volunteers. In PD patients, a significant impairment of 5-HT potency to inhibit

Liliana Dell’Osso; Claudia Carmassi; Lionella Palego; Maria Letizia Trincavelli; Daniela Tuscano; Marina Montali; Simone Sbrana; Antonio Ciapparelli; Antonio Lucacchini; Giovanni Battista Cassano; Claudia Martini

2004-01-01

193

Effects of cyclic AMP and theophylline on chloride conductance across toad skin.  

PubMed

1. The effects of the phosphodiesterase inhibitors theophylline and isobutylmethylxanthine (IBMX) on baseline and voltage-activated Cl- conductance (gCl) of toad skin were compared with those of the potent 2-chlorophenylthio analogue of cAMP (CPT-cAMP). 2. Using intact and split skins of Bufo viridis we confirmed that theophylline and IBMX raised the voltage-activated gCl with a pattern identical to that seen under control conditions. This effect was small or missing if gCl was already high in the control. 3. CPT-cAMP, in contrast, increased the Cl(-)-specific conductance by up to 6 mS cm-2 at short circuit. The characteristic time-dependent, slow activation of gCl by serosa-positive clamp potentials was completely lost under these conditions. 4. Coinciding with the loss of voltage activation of gCl the plateau value of the Lorentzian component of fluctuation in current at serosa-positive clamp potentials decreased by almost 50%. The corner frequencies were not notably different. 5. After CPT-cAMP, the sigmoidal voltage-conductance relation that is characteristic of control conditions or after theophylline disappeared; the patterns were variable and incompatible with voltage activation. 6. The voltage-activated gCl under control conditions and with theophylline was blocked by mucosal NO3-, I- or SCN-, the last two being almost equally effective. In the presence of CPT-cAMP, mucosal NO3- had minimal influence on tissue conductance, whereas the effects of I- and SCN- were essentially unchanged. Br- on the mucosal side could substitute for Cl- under all conditions. 7. The results suggest that protein phosphorylation by supramaximal concentrations of cAMP induces maximal conductance through anion-specific routes, while the voltage sensitivity of this pathway is lost. The effects of theophylline and IBMX on the voltage-activated Cl-conductance of toad skin cannot be explained solely by inhibition of the phosphodiesterase. PMID:8583395

Katz, U; Nagel, W

1995-11-15

194

Effects of cyclic AMP and theophylline on chloride conductance across toad skin.  

PubMed Central

1. The effects of the phosphodiesterase inhibitors theophylline and isobutylmethylxanthine (IBMX) on baseline and voltage-activated Cl- conductance (gCl) of toad skin were compared with those of the potent 2-chlorophenylthio analogue of cAMP (CPT-cAMP). 2. Using intact and split skins of Bufo viridis we confirmed that theophylline and IBMX raised the voltage-activated gCl with a pattern identical to that seen under control conditions. This effect was small or missing if gCl was already high in the control. 3. CPT-cAMP, in contrast, increased the Cl(-)-specific conductance by up to 6 mS cm-2 at short circuit. The characteristic time-dependent, slow activation of gCl by serosa-positive clamp potentials was completely lost under these conditions. 4. Coinciding with the loss of voltage activation of gCl the plateau value of the Lorentzian component of fluctuation in current at serosa-positive clamp potentials decreased by almost 50%. The corner frequencies were not notably different. 5. After CPT-cAMP, the sigmoidal voltage-conductance relation that is characteristic of control conditions or after theophylline disappeared; the patterns were variable and incompatible with voltage activation. 6. The voltage-activated gCl under control conditions and with theophylline was blocked by mucosal NO3-, I- or SCN-, the last two being almost equally effective. In the presence of CPT-cAMP, mucosal NO3- had minimal influence on tissue conductance, whereas the effects of I- and SCN- were essentially unchanged. Br- on the mucosal side could substitute for Cl- under all conditions. 7. The results suggest that protein phosphorylation by supramaximal concentrations of cAMP induces maximal conductance through anion-specific routes, while the voltage sensitivity of this pathway is lost. The effects of theophylline and IBMX on the voltage-activated Cl-conductance of toad skin cannot be explained solely by inhibition of the phosphodiesterase. PMID:8583395

Katz, U; Nagel, W

1995-01-01

195

Cyclic AMP stimulates neurite outgrowth of lamprey reticulospinal neurons without substantially altering their biophysical properties.  

PubMed

Reticulospinal (RS) neurons are critical for initiation of locomotor behavior, and following spinal cord injury (SCI) in the lamprey, the axons of these neurons regenerate and restore locomotor behavior within a few weeks. For lamprey RS neurons in culture, experimental induction of calcium influx, either in the growth cone or cell body, is inhibitory for neurite outgrowth. Following SCI, these neurons partially downregulate calcium channel expression, which would be expected to reduce calcium influx and possibly provide supportive conditions for axonal regeneration. In the present study, it was tested whether activation of second messenger signaling pathways stimulates neurite outgrowth of lamprey RS neurons without altering their electrical properties (e.g. spike broadening) so as to possibly increase calcium influx and compromise axonal growth. First, activation of cAMP pathways with forskolin or dbcAMP stimulated neurite outgrowth of RS neurons in culture in a PKA-dependent manner, while activation of cGMP signaling pathways with dbcGMP inhibited outgrowth. Second, neurophysiological recordings from uninjured RS neurons in isolated lamprey brain-spinal cord preparations indicated that dbcAMP or dbcGMP did not significantly affect any of the measured electrical properties. In contrast, for uninjured RS neurons, forskolin increased action potential duration, which might have increased calcium influx, but did not significantly affect most other electrical properties. Importantly, for injured RS neurons during the period of axonal regeneration, forskolin did not significantly alter their electrical properties. Taken together, these results suggest that activation of cAMP signaling by dbcAMP stimulates neurite outgrowth, but does not alter the electrical properties of lamprey RS neurons in such a way that would be expected to induce calcium influx. In conclusion, our results suggest that activation of cAMP pathways alone, without compensation for possible deleterious effects on electrical properties, is an effective approach for stimulating axonal regeneration of RS neuron following SCI. PMID:23603516

Pale, T; Frisch, E B; McClellan, A D

2013-08-15

196

Cyclic AMP-dependent PKA phosphorylates starfish sperm proteins during acrosome reaction  

Microsoft Academic Search

The induction of acrosome reaction (AR) happens when starfish spermatozoa encounter the egg jelly (EJ). This complex process\\u000a involves different signal transduction pathways, such as elevation of cAMP and the activation of protein kinase A (PKA). The\\u000a specific inhibitors of PKA (H89 and KT5720) have been shown to inhibit the EJ-induced Ca2+ elevation and AR. By using a Phospho-Ser\\/Thr PKA

M. Sadiqul Islam; Motonori Hoshi; Midori Matsumoto

2007-01-01

197

Cyclic AMP Mediates a Presynaptic Form of LTP at Cerebellar Parallel Fiber Synapses  

Microsoft Academic Search

The N-methyl-D-aspartate receptor–independent form of long-term potentiation (LTP) at hippocampal mossy fiber synapses requires presynaptic Ca2+–dependent activation of adenylyl cyclase. To determine whether this form of LTP might occur at other synapses, we examined cerebellar parallel fibers that, like hippocampal mossy fiber synapses, express high levels of the Ca2+\\/calmodulin-sensitive adenylyl cyclase I. Repetitive stimulation of parallel fibers caused a long-lasting

Paul A Salin; Robert C Malenka; Roger A Nicoll

1996-01-01

198

Binding of Regulatory Subunits of Cyclic AMP-Dependent Protein Kinase to Cyclic CMP Agarose  

PubMed Central

The bacterial adenylyl cyclase toxins CyaA from Bordetella pertussis and edema factor from Bacillus anthracis as well as soluble guanylyl cyclase ?1?1 synthesize the cyclic pyrimidine nucleotide cCMP. These data raise the question to which effector proteins cCMP binds. Recently, we reported that cCMP activates the regulatory subunits RI? and RII? of cAMP-dependent protein kinase. In this study, we used two cCMP agarose matrices as novel tools in combination with immunoblotting and mass spectrometry to identify cCMP-binding proteins. In agreement with our functional data, RI? and RII? were identified as cCMP-binding proteins. These data corroborate the notion that cAMP-dependent protein kinase may serve as a cCMP target. PMID:22808067

Zeiser, Johannes; Schroder, Anke; Genieser, Hans-Gottfried; Pich, Andreas; Kaever, Volkhard; Schwede, Frank; Wolter, Sabine; Seifert, Roland

2012-01-01

199

Cyclic AMP-dependent phosphorylation of neuronal nitric oxide synthase mediates penile erection  

PubMed Central

Nitric oxide (NO) generated by neuronal NO synthase (nNOS) initiates penile erection, but has not been thought to participate in the sustained erection required for normal sexual performance. We now show that cAMP-dependent phosphorylation of nNOS mediates erectile physiology, including sustained erection. nNOS is phosphorylated by cAMP-dependent protein kinase (PKA) at serine(S)1412. Electrical stimulation of the penile innervation increases S1412 phosphorylation that is blocked by PKA inhibitors but not by PI3-kinase/Akt inhibitors. Stimulation of cAMP formation by forskolin also activates nNOS phosphorylation. Sustained penile erection elicited by either intracavernous forskolin injection, or augmented by forskolin during cavernous nerve electrical stimulation, is prevented by the NOS inhibitor l-NAME or in nNOS-deleted mice. Thus, nNOS mediates both initiation and maintenance of penile erection, implying unique approaches for treating erectile dysfunction. PMID:23012472

Hurt, K. Joseph; Sezen, Sena F.; Lagoda, Gwen F.; Musicki, Biljana; Rameau, Gerald A.; Snyder, Solomon H.; Burnett, Arthur L.

2012-01-01

200

Regulation of cyclic AMP metabolism by prostaglandins in rabbit cortical collecting tubule cells  

SciTech Connect

In the rabbit cortical collecting tubule (RCCT), prostaglandin E/sub 1/ (PGE/sub 1/) and prostaglandin E/sub 2/ (PGE/sub 2/) at 1 nM inhibit arginine-vasopressin (AVP)-induced water reabsorption, while 100 nM PGE/sub 1/ and PGE/sub 2/ alone stimulate water reabsorption. Reported here are studies designed to investigate the molecular basis for the biphasic physiological action of PGE/sub 1/ and PGE/sub 2/ in the collecting duct. In freshly isolated RCCT cells, PGE/sub 1/, PGE/sub 2/, and 16,16-dimethyl-PGE/sub 2/ (DM-PGE/sub 2/) stimulated cAMP synthesis at concentrations ranging from 0.1 to 10 M. Other prostaglandins including the synthetic PGE/sub 2/ analogue, sulprostone, failed to stimulate cAMP synthesis. Moreover, sulprostone did not antagonize PGE/sub 2/-stimulated cAMP formation. In contrast, PGE/sub 2/ and sulprostone at concentrations ranging from 1 to 100 nM, inhibited AVP-induced cAMP accumulation in freshly isolated RCCT cells. PGE/sub 2/, PGE/sub 1/, DM-PGE/sub 2/ and sulprostone at 100 nM were equally effective in inhibiting AVP-induced cAMP formation. Moreover sulprostone inhibited AVP-stimulated adenylate cyclase activity. These results suggest that PGE derivatives mediate either inhibition or activation of adenylate cyclase by stimulating different PGE receptors. To further test this concept, PGE/sub 2/ binding to freshly isolated RCCT cell membranes was characterized. Two different classes of PGE/sub 2/ binding were detected. //sup 3/H/PGE/sub 2/ binding to the high affinity class of sites was increased by the GTP-analogue, GTP S, while pertussis toxin pretreatment blocked the stimulatory action. In contrast, //sup 3/H/ PGE/sub 2/ binding to the low affinity class of sites was decreased by GTP S; this inhibitory effect was not blocked by pertussis toxin pretreatment.

Sonnenburg, W.K.

1987-01-01

201

Cyclic AMP-dependent Protein Lysine Acylation in Mycobacteria Regulates Fatty Acid and Propionate Metabolism*  

PubMed Central

Acetylation of lysine residues is a posttranslational modification that is used by both eukaryotes and prokaryotes to regulate a variety of biological processes. Here we identify multiple substrates for the cAMP-dependent protein lysine acetyltransferase from Mycobacterium tuberculosis (KATmt). We demonstrate that a catalytically important lysine residue in a number of FadD (fatty acyl CoA synthetase) enzymes is acetylated by KATmt in a cAMP-dependent manner and that acetylation inhibits the activity of FadD enzymes. A sirtuin-like enzyme can deacetylate multiple FadDs, thus completing the regulatory cycle. Using a strain deleted for the KATmt ortholog in Mycobacterium bovis Bacillus Calmette-Guérin (BCG), we show for the first time that acetylation is dependent on intracellular cAMP levels. KATmt can utilize propionyl CoA as a substrate and, therefore, plays a critical role in alleviating propionyl CoA toxicity in mycobacteria by inactivating acyl CoA synthetase (ACS). The precision by which mycobacteria can regulate the metabolism of fatty acids in a cAMP-dependent manner appears to be unparalleled in other biological organisms and is ideally suited to adapt to the complex environment that pathogenic mycobacteria experience in the host. PMID:23553634

Nambi, Subhalaxmi; Gupta, Kallol; Bhattacharyya, Moitrayee; Ramakrishnan, Parvathy; Ravikumar, Vaishnavi; Siddiqui, Nida; Thomas, Ann Terene; Visweswariah, Sandhya S.

2013-01-01

202

The cyclic AMP-dependent protein kinase catalytic subunit selectively enhances calcium currents in rat nodose neurones.  

PubMed Central

1. The whole-cell variation of the patch clamp technique was used to study the effect of the purified catalytic subunit of the cyclic AMP-dependent protein kinase (A kinase catalytic subunit: AK-C) on the calcium current components of acutely dissociated rat nodose ganglion neurones. 2. The transient low-threshold calcium current component (T) was stable during whole-cell recording. In contrast, currents containing the transient high-threshold (N) and slowly inactivating high-threshold (L) current components declined steadily after stabilization of the currents during the first 5-7 min of recording. When AK-C was included in the recording pipette at physiological concentrations (50 micrograms/ml, approximately 1 microM), currents containing the N- and L-components increased in magnitude beginning 7-9 min after patch rupture, but there was no effect on the isolated T-current. The current-voltage relation of the T-current component was similar to controls, but the current-voltage relation for the N- and L-current components was shifted slightly to more depolarized clamp potentials (Vc), approximately 10 mV. 3. The effect of AK-C on currents containing the N- and L-currents was concentration dependent. There was no effect of 0.1 microgram/ml AK-C, the lowest concentration tested. Currents evoked from holding potentials (Vh) = -80 mV increased 5-10% during a 20 min recording in the presence of 1 microgram/ml AK-C and 30-35% in the presence of 50 micrograms/ml AK-C. In contrast, currents evoked from Vh = -40 mV increased 5-10% in the presence of either 1 or 50 micrograms/ml AK-C. The increase in current magnitude was associated with an increased rate of current inactivation and was evident particularly in currents evoked from Vh = -80 mV. 4. These effects were blocked by prior incubation of AK-C (1 microgram/ml) with a specific peptide inhibitor (protein kinase inhibitor peptide, PKIP; 0.2 mg/ml). 5. We evoked calcium currents using very long (1 s) voltage commands and modelled the traces using a multiexponential function in order to determine the effects of AK-C on the N- and L-current components. The (curve-fitted) N- and L-current components each declined approximately 50% during a 20 min recording in control neurones.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2177506

Gross, R A; Uhler, M D; Macdonald, R L

1990-01-01

203

Inhibition of noradrenaline-stimulated lipolysis and cyclic AMP accumulation in isolated rat adipocytes by purified phospholipase C and theta-toxin from Clostridium perfringens.  

PubMed

Purified phospholipae C (phosphatidylcholine cholinephosphohydrolase, EC 3.1.4.3) and theta-toxin from Clostridium perfringens both inhibited noradrenaline-stimulated lipolysis and cyclic AMP accumulation in isolated rat adipocytes in a dose-dependent manner. The action of phospholipase C was gradual in onset, while the effect of theta-toxin was almost immediate. Phospholipase C, but not theta-toxin, hydrolyzed membrane phospholipids and inhibited adenylate cyclase (EC 4.6.1.1) in a crude membrane fraction from fat cells. The inhibitory effects of phospholipase C were associated with morphological alterations detectable by electron microscopy, whereas effects of theta-toxin were observed at a time when no clearcut morphological alterations could be observed. It is concluded that the two purified principles from C. perfringens, which are both present in commercial preparations of phospholipase C, antagonize noradrenaline-stimulated cyclic AMP accumulation and lipolysis. Although their exact mechanisms of action have not been elucidated, phospholipase C and theta-toxin have different modes of attack. PMID:203164

Freholm, B B; Möllby, R; Malmquist, T; Smyth, C J

1978-01-01

204

Ultraviolet radiation augments epidermal beta-adrenergic adenylate cyclase response  

SciTech Connect

Pig skin was irradiated in vivo with fluorescent sunlamp tubes (peak emission at 305 nm). A significant increase in epidermal beta-adrenergic adenylate cyclase response was observed as early as 12 h following 1-2 minimum erythema doses (MEDs) UVB exposure, which lasted at least 48 h. The augmentation of adenylate cyclase response was relatively specific to the beta-adrenergic system and there was no significant difference in either adenosine- or histamine-adenylate cyclase response of epidermis. The increased beta-adrenergic adenylate cyclase response was less marked at higher doses of UVB exposure (5 MEDs); in the latter condition, a significant reduction in adenosine- or histamine-adenylate cyclase response was observed. There was no significant difference in either low- or high-Km cyclic AMP phosphodiesterase activity between control and UVB-treated skin at 1-2 MEDs. These data indicate that the epidermal adenylate cyclase responses are affected in vivo by UVB irradiation, which might be a significant regulatory mechanism of epidermal cyclic AMP systems.

Iizuka, H.; Kajita, S.; Ohkawara, A.

1985-05-01

205

Single Nucleotide Polymorphisms That Cause Structural Changes in the Cyclic AMP Receptor Protein Transcriptional Regulator of the Tuberculosis Vaccine Strain Mycobacterium bovis BCG Alter Global Gene Expression without Attenuating Growth  

Microsoft Academic Search

Single nucleotide polymorphisms (SNPs) are present in the global transcriptional regulator cyclic AMP (cAMP) receptor protein (CRP) of the attenuated vaccine strain Mycobacterium bovis, bacillus Calmette- Guerin (BCG). We have found that these SNPs resulted in small but significant changes in the expression of a number of genes in M. tuberculosis when a deletion of the Rv3676 CRP was complemented

Debbie M. Hunt; J. W. Saldanha; J. F. Brennan; P. Benjamin; M. Strom; J. A. Cole; C. L. Spreadbury; R. S. Buxton

2008-01-01

206

Cyclic AMP response element binding protein and brain-derived neurotrophic factor: Molecules that modulate our mood?  

Microsoft Academic Search

Depression is the major psychiatric ailment of our times, afflicting ?20% of the population. Despite its prevalence, the pathophysiology\\u000a of this complex disorder is not well understood. In addition, although antidepressants have been in existence for the past\\u000a several decades, the mechanisms that underlie their therapeutic effects remain elusive. Building evidence implicates a role\\u000a for the plasticity of specific neuro-circuitry

A. Nair; V. A. Vaidya

2006-01-01

207

Dynamics of the changes in the cerebral amounts of cyclic AMP and some prostaglandins during cobalt-60 gamma-radiation-induced brain edema.  

PubMed

The total amounts of cyclic AMP (cAMP), prostaglandin E1 (PGE1) and prostaglandin F2alpha (PGF2alpha) in cerebra have been measured in rats, at constant intervals, up to 18 days after whole body exposure to either a unique moderate dose (500 rads) or a unique lethal dose (750 rads) of cobalt-60 gamma-radiation. The experimental findings indicate that this radiation (i) results in an abrupt short-lasting increase in the amount of cerebral cAMP after a 500 rad-irradiation and a progressive long-lasting increase in its amount after a 750 rad-irradiation, and (ii) induces no change in the normally, existing correlation between cerebral PGE1 and cAMP, but affects deeply the normally existing correlation between cerebral PGF2alpha and cAMP. These biochemical alterations generally parallel the evolution of the radiation-induced brain edema. PMID:201954

P?u?escu, E; Chirvasie, R; Popescu, M V; Teodosiu, T

1977-01-01

208

Phosphorylation by protein kinase C and cyclic AMP-dependent protein kinase of synthetic peptides derived from the linker region of human P-glycoprotein.  

PubMed Central

Specific sites in the linker region of human P-glycoprotein phosphorylated by protein kinase C (PKC) were identified by means of a synthetic peptide substrate, PG-2, corresponding to residues 656-689 from this region of the molecule. As PG-2 has several sequences of the type recognized by the cyclic AMP-dependent protein kinase (PKA), PG-2 was also tested as a substrate for PKA. PG-2 was phosphorylated by purified PKC in a Ca2+/phospholipid-dependent manner, with a Km of 1.3 microM, and to a maximum stoichiometry of 2.9 +/- 0.1 mol of phosphate/mol of peptide. Sequence analysis of tryptic fragments of PG-2 phosphorylated by PKC identified Ser-661, Ser-667 and Ser-671 as the three sites of phosphorylation. PG-2 was also found to be phosphorylated by purified PKA in a cyclic AMP-dependent manner, with a Km of 21 microM, and to a maximum stoichiometry of 2.6 +/- 0.2 mol of phosphate/mol of peptide. Ser-667, Ser-671 and Ser-683 were phosphorylated by PKA. Truncated peptides of PG-2 were utilized to confirm that Ser-661 was PKC-specific and Ser-683 was PKA-specific. Further studies showed that PG-2 acted as a competitive substrate for the P-glycoprotein kinase present in membranes from multidrug-resistant human KB cells. The membrane kinase phosphorylated PG-2 mainly on Ser-661, Ser-667 and Ser-671. These results show that human P-glycoprotein can be phosphorylated by at least two protein kinases, stimulated by different second-messenger systems, which exhibit both overlapping and unique specificities for phosphorylation of multiple sites in the linker region of the molecule. Images Figure 3 Figure 5 PMID:7909431

Chambers, T C; Pohl, J; Glass, D B; Kuo, J F

1994-01-01

209

Differential Regulation of Human 3?-Hydroxysteroid Dehydrogenase Type 2 for Steroid Hormone Biosynthesis by Starvation and Cyclic Amp Stimulation: Studies in the Human Adrenal NCI-H295R Cell Model  

PubMed Central

Human steroid biosynthesis depends on a specifically regulated cascade of enzymes including 3?-hydroxysteroid dehydrogenases (HSD3Bs). Type 2 HSD3B catalyzes the conversion of pregnenolone, 17?-hydroxypregnenolone and dehydroepiandrosterone to progesterone, 17?-hydroxyprogesterone and androstenedione in the human adrenal cortex and the gonads but the exact regulation of this enzyme is unknown. Therefore, specific downregulation of HSD3B2 at adrenarche around age 6–8 years and characteristic upregulation of HSD3B2 in the ovaries of women suffering from the polycystic ovary syndrome remain unexplained prompting us to study the regulation of HSD3B2 in adrenal NCI-H295R cells. Our studies confirm that the HSD3B2 promoter is regulated by transcription factors GATA, Nur77 and SF1/LRH1 in concert and that the NBRE/Nur77 site is crucial for hormonal stimulation with cAMP. In fact, these three transcription factors together were able to transactivate the HSD3B2 promoter in placental JEG3 cells which normally do not express HSD3B2. By contrast, epigenetic mechanisms such as methylation and acetylation seem not involved in controlling HSD3B2 expression. Cyclic AMP was found to exert differential effects on HSD3B2 when comparing short (acute) versus long-term (chronic) stimulation. Short cAMP stimulation inhibited HSD3B2 activity directly possibly due to regulation at co-factor or substrate level or posttranslational modification of the protein. Long cAMP stimulation attenuated HSD3B2 inhibition and increased HSD3B2 expression through transcriptional regulation. Although PKA and MAPK pathways are obvious candidates for possibly transmitting the cAMP signal to HSD3B2, our studies using PKA and MEK1/2 inhibitors revealed no such downstream signaling of cAMP. However, both signaling pathways were clearly regulating HSD3B2 expression. PMID:23874725

Hofer, Gaby; Mullis, Primus E.; Flück, Christa E.

2013-01-01

210

Enhancement of neurite outgrowth in PC12 cells stimulated with cyclic AMP and NGF by 6-acylated ascorbic acid 2-O-alpha-glucosides (6-Acyl-AA-2G), novel lipophilic ascorbate derivatives.  

PubMed

It has been shown that ascorbate (AsA) and its stable derivative, ascorbic acid 2-O-alpha-glucoside (AA-2G), do not elicit neurite outgrowth in PC12 cells. However, these ascorbates are synergistically enhanced by both dibutyryl cyclic AMP (Bt(2)cAMP)- and nerve growth factor (NGF)-induced neurite outgrowth in this model. In the present study, the effects of a series of novel lipophilic ascorbate derivatives, 6-acylated ascorbic acid 2-O-alpha-glucosides (6-Acyl-AA-2G), on neurite outgrowth induced by Bt(2)cAMP and NGF were examined in PC12 cells. We found that all the tested acylated ascorbate derivatives enhanced neurite formation induced by both agents in a dose-dependent manner. Of the 6-Acyl-AA-2G derivatives, 6-octanoyl ascorbic acid 2-O-alpha-glucoside (6-Octa-AA-2G) enhanced the Bt(2)cAMP-induced phosphorylated MAPK p44 and p42 expression. A alpha-glucosidase inhibitor, castanospermine, completely abrogated the promotion of neurite outgrowth and MAPK expression by 6-Octa-AA-2G. Addition of 6-Octa-AA-2G (0.5 mM) to PC12 cells caused a rapid and significant increase in intracellular AsA content, which reached a maximum and was maintained from 12 to 24 h after the culture. These findings suggest that 6-Acyl-AA-2G is rapidly hydrolyzed to AsA within the cell and enhances neurite differentiation through the interaction with the inducer-activated MAPK pathway. PMID:12612444

Zhou, Xiaohua; Tai, Akihiro; Yamamoto, Itaru

2003-03-01

211

Inhibition and subsequent enhancement of platelet responsiveness by prostacyclin in the rabbit. Relationship to platelet adenosine 3',5'-cyclic monophosphate.  

PubMed Central

Methods were developed for measuring changes in platelet sensitivity to a release-inducing stimulus and in platelet cyclic AMP in fresh whole blood samples from rabbits. These techniques permitted detection of the effects of exogenous and endogenous prostacyclin on circulating platelets. In these methods, rabbit platelets were labeled in vitro by incubation with [14C]serotonin and [3H]adenine and then transfused into other rabbits. Release of platelet [14C]serotonin by a standard dose of synthetic platelet-activating factor (40 pmol/ml) and the platelet cyclic [3H]AMP levels were then measured in citrated blood from the conscious animals within 2 min of arterial puncture. Bolus intravenous injections of prostacyclin (1-10 nmol/kg) caused concentration-dependent increases in platelet cyclic AMP after 2 min, which decreased approximately 75% by 5 min, and disappeared after 30 min. Significant inhibition of the platelet release reaction was detected 2 min but not 5 min after injection of 10 nmol of prostacyclin per kilogram. With lower doses, significant enhancement of the release of [14C]serotonin was observed after 5 min. Similar changes in platelet responsiveness and cyclic [3H]AMP were observed after release of endogenous prostacyclin by intravenous injection of angiotensin II (5 nmol/kg); inhibition of the release of [14C]serotonin after 2 min was followed by potentiation after 5 min, though platelet cyclic [3H]AMP remained above control values. In these experiments, the time course of the changes in platelet cyclic [3H]AMP correlated closely with values for blood prostacyclin obtained previously (Haslam, R.J., and M.D. McClenaghan, 1981, Nature [Lond.]., 292:364-366). Prostacyclin also had a biphasic effect on the release of [14C]serotonin when added to citrated blood in vitro, though both the increase in sensitivity to platelet-activating factor and the return of platelet cyclic [3H]AMP towards control values took place more slowly. At all times, addition of platelet-activating factor decreased platelet cyclic [3H]AMP towards but not below the control level observed in the absence of prostacyclin. Our results indicate that although transient increases in platelet cyclic AMP cause an immediate decrease in platelet responsiveness in vivo or in vitro, a period of enhanced platelet sensitivity follows as platelet cyclic AMP falls. PMID:2991338

Vanderwel, M; Haslam, R J

1985-01-01

212

Cyclic AMP directs inositol (1,4,5)-trisphosphate-evoked Ca2+ signalling to different intracellular Ca2+ stores  

PubMed Central

Summary Cholesterol depletion reversibly abolishes carbachol-evoked Ca2+ release from inositol (1,4,5)-trisphosphate (IP3)-sensitive stores, without affecting the distribution of IP3 receptors (IP3R) or endoplasmic reticulum, IP3 formation or responses to photolysis of caged IP3. Receptors that stimulate cAMP formation do not alone evoke Ca2+ signals, but they potentiate those evoked by carbachol. We show that these potentiated signals are entirely unaffected by cholesterol depletion and that, within individual cells, different IP3-sensitive Ca2+ stores are released by carbachol alone and by carbachol combined with receptors that stimulate cAMP formation. We suggest that muscarinic acetylcholine receptors in lipid rafts deliver IP3 at high concentration to associated IP3R, stimulating them to release Ca2+. Muscarinic receptors outside rafts are less closely associated with IP3R and provide insufficient local IP3 to activate IP3R directly. These IP3R, probably type 2 IP3R within a discrete Ca2+ store, are activated only when their sensitivity is increased by cAMP. Sensitization of IP3R by cAMP extends the effective range of signalling by phospholipase C, allowing muscarinic receptors that are otherwise ineffective to recruit additional IP3-sensitive Ca2+ stores. PMID:23525004

Tovey, Stephen C.; Taylor, Colin W.

2013-01-01

213

Transport of antibiotics and metabolite analogs by systems under cyclic AMP control: positive selection of Salmonella typhimurium cya and crp mutants.  

PubMed Central

Mutants in the cyclic AMP (cAMP) control system in Salmonella typhimurium (cya = adenyl cyclase, crp = cAMP receptor protein) were partially resistant to growth inhibition by 22 antibiotics (including fosfomycin, nalidixic acid, and streptomycin) and 29 inhibitory analogs of normal bacterial fuel/carbon sources. This resistance was used as the basis for an efficient positive selection of cya and crp mutants. We propose that these antibiotics and analogs enter the bacteria through transport systems normally used for transporting fuel/carbon sources and that this is accomplished because of a structural similarity between the antibiotic and the natural substrate of the particular transport system involved. We propose that these transport systems are all under positive control by cAMP and that cAMP acts as a signal molecule (alarmone) for fuel/carbon deprivation. Evidence is provided for a hierarchy within operons controlled by cAMP. The methodology is shown to be useful for analyzing both antibiotic transport systems and the cAMP super-control system. PMID:201606

Alper, M D; Ames, B N

1978-01-01

214

Effect of Increased Cyclic AMP Concentration on Muscle Protein Synthesis and Beta-Adrenergic Receptor Expression in Chicken Skeletal Muscle Cells in Culture  

NASA Technical Reports Server (NTRS)

Analogies of epinephrine are known to cause hypertrophy of skeletal muscle when fed to animals. These compounds presumably exert their physiological action through interaction with the P-adrenergic receptor. Since the intracellular signal generated by the Beta-adrenergic receptor is cyclic AMP (cAMP), experiments were initiated in cell culture to determine if artificial elevation of cAMP by treatment with forskolin would alter muscle protein metabolism and P-adrenergic receptor expression. Chicken skeletal muscle cells after 7 days in culture were treated with 0.2-30 micrometers forskolin for a total of three days. At the end of the treatment period, both the concentration of cAMP and the quantity of myosin heavy chain (MHC) were measured. Concentration of cAMP in forskolin-treated cells increased up to 10-fold in a dose dependent manner. In contrast, the quantity of MHC was increased approximately 50% above control cells at 0.2 micrometers forskolin, but exhibited a gradual decline at higher levels of forskolin so that the quantity of MHC in cells treated with 30 micrometers forskolin was not significantly different from controls. Curiously, the intracellular concentration of cAMP which elicited the maximum increase in the quantity of MHC was only 40% higher than cAMP concentration in control cells.

Young, R. B.; Vaughn, J. R.; Bridge, K. Y.; Smith, C. K.

1998-01-01

215

Cyclic AMP and AKAP-mediated targeting of protein kinase A regulates lactate dehydrogenase subunit A mRNA stability.  

PubMed

Expression of the lactate dehydrogenase A subunit (ldh-A) gene is controlled through transcriptional as well as post-transcriptional mechanisms. Both mechanisms involve activation of protein kinase A (PKA) into its subunits and subsequent phosphorylation and activation of several key regulatory factors. In rat C6 glioma cells, post-transcriptional gene regulation occurs through PKA-mediated stabilization of LDH-A mRNA and subsequent increase of intracellular LDH-A mRNA levels. Previous studies have demonstrated a cAMP-stabilizing region (CSR) located in the LDH-A 3'-untranslated region which, in combination with several phosphorylated CSR-binding proteins (CSR-BP), regulates the PKA-mediated stabilization of LDH-A mRNA. However, the mechanistic details of interaction of CSR with proteins as they pertain to mRNA stabilization by PKA are so far largely unknown. In this study we tested the hypothesis that ribosomal protein extracts (RSW) from glioma cells contain PKA regulatory (RII) and catalytic (C) subunits that, in combination with a protein kinase A anchoring protein (AKAP 95) and CSR-BPs participate in forming CSR-protein complexes that are responsible for mRNA stability regulation. To demonstrate the importance of CSR-protein complex formation, the PKA subunits and AKAP 95 were removed from the RSW by immunoprecipitation, and the antigen-deleted RSW were subjected to CSR binding analysis using gel mobility shift and UV cross-linking. It was shown that AKAP 95 as well as RII formed a direct linkage with CSR during CSR-protein complex formation. In contrast, the catalytic subunit formed part of the CSR-protein complex but did not bind to CSR directly in a covalent linkage. To determine whether formation of CSR complexes that included C, RII, and AKAP 95 constituted a functional event and was necessary for mRNA stabilization, cell-free decay reactions were carried out with RSW extracts, and the kinetics of decay of LDH-A mRNA was determined. Depletion of PKA subunits and AKAP 95 from RSW extracts by immunoprecipitation resulted in a marked loss of mRNA stabilization activity indicating that the presence of the PKA regulatory and catalytic subunits as well as AKAP 95 in the CSR-protein complexes was absolutely necessary to achieve LDH-A mRNA stabilization. PMID:15878851

Jungmann, Richard A; Kiryukhina, Olga

2005-07-01

216

Effects of defolliculation on membrane current responses of Xenopus oocytes.  

PubMed Central

1. Catecholamines, adenosine, gonadotrophins, vasoactive intestinal peptide (VIP) and E-series prostaglandins all elicit K+ currents in follicle-enclosed Xenopus oocytes. Evidence suggests that cyclic nucleotides act as intracellular messengers in the activation of this K+ conductance. Muscarinic agonists and some divalent cations (e.g. Co2+, Mn2+, Ni2+ and Cd2+) elicit slow oscillatory Cl- currents, which are activated through hydrolysis of inositol phospholipids and mobilization of intracellular calcium by inositol phosphates. 2. We investigated whether these membrane current responses were generated in the oocyte itself or in enveloping follicular cells which are coupled to the oocyte by gap junctions. Oocytes were defolliculated, either enzymatically using collagenase, or by manual dissection combined with rolling over poly-L-lysine-coated slides. Removal of follicular cells was checked using scanning electron microscopy. Membrane current responses of defolliculated oocytes were compared with responses seen in follicle-enclosed oocytes taken from the same ovary. 3. The K+ responses evoked by all the various hormones/neurotransmitters were either drastically reduced (greater than 90%) or abolished by defolliculation. K+ currents generated by the adenylate cyclase activator forskolin and by intraoocyte injection of adenosine 3',5'-cyclic monophosphate (cyclic AMP), or guanosine 3',5'-cyclic monophosphate were similarly reduced in defolliculated oocytes. In contrast, oscillatory Cl- currents to acetylcholine and divalent cations were selectively preserved through defolliculation. 4. Injection of cyclic AMP (1-20 pmol) into defolliculated oocytes had little or no effect on oscillatory Cl- currents elicited by ACh. However, the calcium-dependent transient Cl- current, activated by depolarization of the oocyte membrane, was consistently potentiated (100-900%) by injections of cyclic AMP (1-10 pmol). 5. These experiments suggest that cyclic nucleotide-activated K+ currents arise essentially in follicular cells and are monitored within the oocyte through electrical coupling by gap junctions. Oscillatory Cl- responses evoked by ACh and divalent cations are produced largely or wholly in the oocyte itself. Images Fig. 1 Plate 1 Plate 2 PMID:2558177

Miledi, R; Woodward, R M

1989-01-01

217

A multiparameter live cell imaging approach to monitor cyclic AMP and protein kinase A dynamics in parallel.  

PubMed

Parallel detection of signaling activities allows us to correlate activity dynamics between signaling molecules. In this review, we detail a multiparameter live cell imaging method to monitor 3',5'-cyclic adenosine monophosphate (cAMP) levels and protein kinase A (PKA) activities in parallel. PMID:24052391

Aye-Han, Nwe-Nwe; Zhang, Jin

2014-01-01

218

Dexamethasone and cyclic AMP regulate sodium phosphate cotransporter (NaPi-IIb and Pit-1) mRNA and phosphate uptake in rat alveolar type II epithelial cells.  

PubMed

Alveolar epithelial type II (AT II) cells need phosphate (Pi) for surfactant synthesis. The Na-dependent (Na(d)) Pi transporters NaPi-IIb and Pit-1 are expressed in lung, but their expression, regulation, and function in AT II cells remain unclear. We studied NaPi-IIb and Pit-1 mRNA expression in cultured AT II cells isolated from adult rat lung, their regulation by agents known to enhance surfactant production, dexamethasone (dex) and dibutyryl cyclic AMP (cAMP), and the effects of dex and cAMP on Na(d) Pi uptake by this cell type. By Northern analysis, cultured AT II cells expressed both NaPi-IIb (4.8 and 4.0 kb) and Pit-1 (4.3 kb) mRNA. Treatment with 100 nmol/l dex for 24 h decreased the expression of both mRNAs (to 0.48 +/- 0.06 and 0.77 +/- 0.05, respectively, as compared to control), while 0.1 mmol/l cAMP stimulated NaPi-IIb (1.94 +/- 0.22) but not Pit-1 mRNA (0.90 +/- 0.05, compared to vehicle-treated cells). NaPi-IIb and Pit-1 proteins could not be identified by western analysis of plasma membrane preparations of cultured AT II cells. AT II cells take up Pi in a Na(d) manner. Uptake was slightly (to 0.78-fold of the control) decreased by 100 nmol/l dex but not affected by 0.1 mmol/l cAMP treatment. Although NaPi-IIb mRNA expression was maintained to some extent by AT II cells kept in primary culture, Pi uptake was more closely related to Pit-1 mRNA expression. PMID:19806400

Jin, Chengluo; Zoidis, Evangelos; Ghirlanda, Claudia; Schmid, Christoph

2010-01-01

219

Beta-Adrenergic Receptor Population is Up-Regulated by Increased Cyclic Amp Concentration in Chicken Skeletal Muscle Cells in Culture  

NASA Technical Reports Server (NTRS)

Skeletal muscle hypertrophy is promoted in vivo by administration of beta-drenergic receptor (bAR) agonists. Chicken skeletal muscle cells were treated with 1 (mu)M isoproterenol, a strong bAR agonist, between days 7 and 10 in culture. bAR population increased by approximately 40% during this treatment; however, the ability of the cells to synthesize cyclic AMP (cAMP) was diminished by two-fold. The quantity of myosin heavy chain (MHC) was not affected. To understand further the relationship between intracellular cAMP levels, bAR population, and muscle protein accumulation, intracellular cAMP levels were artificially elevated by treatment with 0-10 uM forskolin for up to three days. The basal concentration of CAMP in forskolin-treated cells increased up to 7-fold in a dose dependent manner. Increasing concentrations of forskolin also led to an increase in bAR population, with a maximum increase of approximately 40-60% at 10 uM forskolin. A maximum increase of 40-50% in the quantity of MHC was observed at 0.2 uM forskolin, but higher concentrations of forskolin reduced the quantity of MHC back to control levels. At 0.2 uM forskolin, intracellular levels of cAMP were higher by approximately 35%, and the (beta)AR population was higher by approximately 30%. Neither the number of muscle nuclei fused into myotubes nor the percentage of nuclei in myotubes were affected by forskolin at any of the concentrations studied.

Young, Ronald B.; Bridge, Kristin Y.; Vaughn, Jeffrey R.

1999-01-01

220

Somatic mutations of the catalytic subunit of cyclic AMP-dependent protein kinase (PRKACA) gene in Japanese patients with several adrenal adenomas secreting cortisol [Rapid Communication].  

PubMed

Somatic mutations of the catalytic subunit of the cyclic AMP-dependent protein kinase (PRKACA) gene have recently been identified in about 35% of cortisol-producing adenomas (CPAs), with the affected patients showing overt Cushing's syndrome. Since we recently reported higher prevalence of mutations of the KCNJ5 gene and associations with autonomous cortisol secretion in Japanese aldosterone-producing adenomas than in Western countries, there might be different features of CPAs between Japan and the West. We therefore investigated mutations of the PRKACA gene in Japanese patients with several adrenal tumors secreting cortisol, including overt Cushing's syndrome, subclinical Cushing's syndrome, and aldosterone-producing adenomas (APAs) co-secreting cortisol operated on at Gunma University Hospital. Of the 13 patients with CPA who showed overt Cushing's syndrome, 3 (23%) had recurrent somatic mutations of the PRKACA gene, p.L206R (c.617 T>G), and there were no mutations in subclinical Cushing's syndrome. Among 33 APAs, 24 had somatic mutations of the KCNJ5 gene, either G151R or L168R, 11 (33%) had autonomous cortisol secretion, but there were no mutations of the PRKACA gene. We established a PCR-restriction fragment length polymorphism assay and revealed that the mutated allele was expressed at a similar level to the wild-type allele. These findings demonstrated that 1) the prevalence of Japanese patients with CPA who showed overt Cushing's syndrome and whose somatic mutations in the PRKACA gene was similar to that in Western countries, 2) the mutation might be specific for CPAs causing overt Cushing's syndrome, and 3) the mutant PRKACA allele was expressed appropriately in CPAs. PMID:25069672

Nakajima, Yasuyo; Okamura, Takashi; Gohko, Tamae; Satoh, Tetsurou; Hashimoto, Koshi; Shibusawa, Nobuyuki; Ozawa, Atsushi; Ishii, Sumiyasu; Tomaru, Takuya; Horiguchi, Kazuhiko; Okada, Shuichi; Takata, Daisuke; Rokutanda, Nana; Horiguchi, Jun; Tsushima, Yoshito; Oyama, Tetsunari; Takeyoshi, Izumi; Yamada, Masanobu

2014-01-01

221

Cloning and molecular characterization of csm mutations allowing expression of catabolite-repressible operons in the absence of exogenous cyclic AMP.  

PubMed Central

The cyclic AMP (cAMP) suppressor mutation (csm) of Escherichia coli has been cloned from strain NCR30 in the HindIII-EcoRI site of pBR322. This mutation has been mapped in or near the crp gene. Wild-type crp DNA hybridized to recombinant plasmids pGM5 and pGM25 containing the cloned csm mutation. These recombinant plasmids encoded a protein product of identical molecular weight and charge as that of the wild-type cAMP receptor protein. Transformants of cya crp deletion strains harboring pBM5 or pGM25 exhibited phenotypic characteristics common to strain NCR30. These included the expression of catabolite-repressible enzymes, such as arabinose isomerase, tryptophanase, beta-galactosidase, and threonine deaminase; the expression of chemotactic and motility genes; cAMP sensitivity; and the accumulation of toxic levels of methylglyoxal. DNA sequence analysis indicated that the Csm suppressor phenotype was attributable to the insertion of a guanosine residue 17 base pairs downstream from the termination codon of the crp structural gene. The guanosine insertion is located in the stem region of the presumed transcriptional termination loop. This stem region contained a unique BssHII restriction site which was used to construct an in vitro deletion in the wild-type crp insert in plasmid pHA7. The resulting plasmid, pGM459, renders transformants having a phenotype common to that conferred by the chromosomal or cloned csm mutation. Our results indicate a novel role for the 3' flanking region of the crp structural gene in the expression of the cAMP receptor protein. Images PMID:3009405

George, S E; Melton, T

1986-01-01

222

Low doses of cyclic AMP-phosphodiesterase inhibitors rapidly evoke opioid receptor-mediated thermal hyperalgesia in naïve mice which is converted to prominent analgesia by cotreatment with ultra-low-dose naltrexone.  

PubMed

Systemic (s.c.) injection in naïve mice of cyclic AMP-phosphodiesterase (cAMP-PDE) inhibitors, e.g. 3-isobutyl-1-methylxanthine [(IBMX) or caffeine, 10 mg/kg] or the more specific cAMP-PDE inhibitor, rolipram (1 mug/kg), rapidly evokes thermal hyperalgesia (lasting >5 h). These effects appear to be mediated by enhanced excitatory opioid receptor signaling, as occurs during withdrawal in opioid-dependent mice. Cotreatment of these mice with ultra-low-dose naltrexone (NTX, 0.1 ng/kg-1 pg/kg, s.c.) results in prominent opioid analgesia (lasting >4 h) even when the dose of rolipram is reduced to 1 pg/kg. Cotreatment of these cAMP-PDE inhibitors in naïve mice with an ultra-low-dose (0.1 ng/kg) of the kappa-opioid receptor antagonist, nor-binaltorphimine (nor-BNI) or the mu-opioid receptor antagonist, beta-funaltrexamine (beta-FNA) also results in opioid analgesia. These excitatory effects of cAMP-PDE inhibitors in naïve mice may be mediated by enhanced release of small amounts of endogenous bimodally-acting (excitatory/inhibitory) opioid agonists by neurons in nociceptive networks. Ultra-low-dose NTX, nor-BNI or beta-FNA selectively antagonizes high-efficacy excitatory (hyperalgesic) Gs-coupled opioid receptor-mediated signaling in naïve mice and results in rapid conversion to inhibitory (analgesic) Gi/Go-coupled opioid receptor-mediated signaling which normally requires activation by much higher doses of opioid agonists. Cotreatment with a low subanalgesic dose of kelatorphan, an inhibitor of multiple endogenous opioid peptide-degrading enzymes, stabilizes endogenous opioid agonists released by cAMP-PDE inhibitors, resulting in conversion of the hyperalgesia to analgesia without requiring selective blockade of excitatory opioid receptor signaling. The present study provides a novel pharmacologic paradigm that may facilitate development of valuable non-narcotic clinical analgesics utilizing cotreatment with ultra-low-dose rolipram plus ultra-low-dose NTX or related agents. PMID:18656459

Crain, Stanley M; Shen, Ke-Fei

2008-09-22

223

Prostaglandin E2 and other cyclic AMP elevating agents inhibit interleukin 2 gene transcription by counteracting calcineurin-dependent pathways  

PubMed Central

We have previously shown that prostaglandin E2 and other cAMP elevating agents inhibit the nuclear transcription of the human IL-2 gene by interfering with a Ca(2+)-sensitive T cell signal transduction pathway. Calcineurin, a Ca2+/calmodulin-dependent 2B protein phosphatase, is an essential component of the T cell receptor signal transduction pathway leading to IL-2 gene expression. We have therefore tested the hypothesis that this phosphatase may be a target for the inhibitory effects of cAMP on IL-2 gene transcription. We report here that PGE2 markedly reduces the IL-2 promoter activity that is induced by a constitutively active form of calcineurin. In contrast to the complete inhibition of promoter activity produced by the immunosuppressants cyclosporin A and FK-506, this partial block suggests that PGE2 modulates downstream events needed for lymphokine gene activation. Overexpression of calcineurin in Jurkat cells decreases their apparent sensitivity to the inhibitory effects of PGE2 consistent with the fact that this enzyme plays a physiological role in dephosphorylating substrates of cAMP-dependent kinases in several tissues. These results provide evidence that cAMP-dependent pathways may antagonize calcineurin-regulated cascades for T cell activation in vivo, and suggest crosstalk between the Ca2+ and the cAMP signaling pathways during T cell activation. PMID:7693857

1993-01-01

224

Isoproterenol inhibits cyclic AMP-mediated but not insulin-mediated translocation of the GLUT4 glucose transporter isoform  

Microsoft Academic Search

Isoproterenol is a beta adrenergic agonist whose effects have been attributed to the generation of cAMP. Previous studies have shown that it inhibits glucose transport in adipocytes without changing the number of insulin-responsive glucose transporters (GLUT4) on the cell surface. However, we have shown previously that cAMP stimulates translocation of GLUT4 to the cell surface in adipocytes (Keladaet al. J

S. Lance Macaulay; Ashraf S. M. Kelada; Joseph Proietto

1994-01-01

225

Cyclic AMP-dependent protein kinase A negatively regulates conidia formation by the tangerine pathotype of Alternaria alternata.  

PubMed

The necrotrophic fungal pathogen Alternaria alternata causes brown spot diseases in many citrus cultivars. The FUS3 and SLT2 mitogen-activated protein kinases (MAPK)-mediated signaling pathways have been shown to be required for conidiation. Exogenous application of cAMP to this fungal pathogen decreased conidia formation considerably. This study determined whether a cAMP-activated protein kinase A (PKA) is required for conidiation. Using loss-of-function mutations in PKA catalytic and regulatory subunit-coding genes, we demonstrated that PKA negatively regulates conidiation. Fungal mutants lacking PKA catalytic subunit gene (PKA ( cat )) reduced growth, lacked detectable PKA activity, and produced higher amounts of conidia compared to wild-type. Introduction of a functional copy of PKA ( cat ) into a null mutant partially restored PKA activity and produced wild-type level of conidia. In contrast, fungi lacking PKA regulatory subunit gene (PKA ( reg )) produced detectable PKA activity, exhibited severe growth reduction, formed swelling hyphal segments, and produced no mature conidia. Introduction of the PKA ( reg ) gene to a regulatory subunit mutant restored all phenotypes to wild type. PKA ( reg )-null mutants induced fewer necrotic lesions on citrus compared to wild-type, whereas PKA ( cat ) mutant displayed wild-type virulence. Overall, our studies indicate that PKA and FUS3-mediated signaling pathways apparently have very different roles in the regulation of conidia production and A. alternata pathogenesis in citrus. PMID:23054702

Tsai, Hsieh-Chin; Yang, Siwy Ling; Chung, Kuang-Ren

2013-02-01

226

A Polysaccharide from Ganoderma atrum Inhibits Tumor Growth by Induction of Apoptosis and Activation of Immune Response in CT26-Bearing Mice.  

PubMed

Ganoderma atrum is one species of edible and pharmaceutical mushroom with various biological activities. Recently, a novel polysaccharide, PSG-1, was purified from G. atrum. The antitumor activity and its mechanism of action were studied. In vitro, PSG-1 has little effect on inhibiting proliferation of CT26 tumor cells. However, the tumor size was significantly decreased in PSG-1-treated mice. The results showed that PSG-1 induced apoptosis in CT26 cells. Moreover, the intracellular cyclic AMP (cAMP) level and protein kinase A (PKA) activity were markedly increased in PSG-1-treated mice. In contrast, the contents of cyclic GMP and DAG and the PKC activity were decreased. Similarly, the expression of PKA protein was upregulated, while PKC protein expression in PSG-1-treated group was lowered. Additionally, PSG-1 increased the immune organ index and serum biochemistry parameter. In general, PSG-1 enhances the antitumor immune response, induces apoptosis in CT26-bearing mice, and could be a safe and effective adjuvant for tumor therapy or functional food. PMID:25179589

Zhang, Shenshen; Nie, Shaoping; Huang, Danfei; Huang, Jianqin; Feng, Yanling; Xie, Mingyong

2014-09-24

227

Boron and silicon: Effects on growth, plasma lipids, urinary cyclic AMP and bone and brain mineral composition of male rats  

SciTech Connect

Because boron resembles silicon in its chemical properties, an experiment was performed to determine if excessive dietary boron would affect the response to silicon deprivation and, conversely, if silicon would influence the effects of an excessive intake of boron. Male weanling Sprague-Dawley rats were assigned to groups of 6 or 12 in a two-by-two factorially arranged experiment. Supplemented to a ground corn/casein diet containing 1.2 [mu]g silicon and 3 [mu]g boron per gram were silicon as sodium metasilicate at 0 or 50 [mu]g/g and boron as orthoboric acid at 0 or 500 [mu]g/g diet. At nine weeks, animals fed high dietary boron had significantly decreased final body weights, liver-weight-to-body-weight ratios, urinary cAMP concentrations, plasma triglyceride, cholesterol, glycine, valine, leucine, and lysine concentrations and skull copper, sodium, and manganese concentrations. High dietary boron also significantly increased brain-weight-to-body-weight ratios, magnesium concentrations of femur, brain, and plasma, zinc concentration of femur, and iron concentration of skull. The bone mineral findings suggest that excess dietary boron exerts subtle effects on bone composition. Dietary silicon affected blood urea nitrogen, hematocrit, hemoglobin, and the concentrations of plasma threonine and aspartic acid in animals fed excess boron. Depression of the testes-weight-to-body-weight ratio of animals fed 500 [mu]g boron per gram diet was most marked in animals not fed silicon. Although excessive dietary boron did not markedly enhanced the response of rats to silicon deprivation, dietary silicon affected their response to high dietary boron. Thus, dietary silicon apparently can influence boron toxicity.

Seaborn, C.D.; Nielsen, F.H. (Dept. of Agriculture, Grand Forks, ND (United States). Grand Forks Human Nutrition Research Center)

1994-06-01

228

A deficiency in cyclic AMP results in pH-sensitive growth of Escherichia coli K-12.  

PubMed Central

Mutants of Escherichia coli K-12 deficient in adenyl cyclase (cya) and catabolite activator protein (crp) have been shown to grow more slowly than their parent strains in glucose-minimal medium. Their growth rate decreased markedly with increasing pH between 6 and 7.8. We have shown that this pH sensitivity is a direct consequence of the cya mutation, because a mutation to pH resistance also restored ability to ferment a variety of sugars. The proton motive force-dependent uptake of proline and glutamate was also reduced and sensitive to pH in the cya mutant. The membrane-bound ATPase activity was normal. The rate of oxygen uptake by cells, although reduced, was pH insensitive. We suggest several explanations for this phenotype, including a possible defect in energy transduction. PMID:2841287

Ahmad, D; Newman, E B

1988-01-01

229

Cyclic AMP Signaling Control of Action Potential Firing Rate and Molecular Circadian Pacemaking in the Suprachiasmatic Nucleus  

Microsoft Academic Search

Circadian pacemaking in suprachiasmatic nucleus (SCN) neurons revolves around transcriptional\\/posttranslational feedback loops, driven by protein products of “clock” genes. These loops are synchronized and sustained by intercellular signaling, involving vasoactive intestinal peptide (VIP) via its VPAC2 receptor, which positively regulates cAMP synthesis. In turn, SCN cells communicate circadian time to the brain via a daily rhythm in electrophysiological activity. To

Susan E. Atkinson; Elizabeth S. Maywood; Johanna E. Chesham; Christian Wozny; Christopher S. Colwell; Michael H. Hastings; Stephen R. Williams

2011-01-01

230

Both cyclic-AMP and cyclic-GMP can act as regulators of the phenylpropanoid pathway in Arabidopsis thaliana seedlings.  

PubMed

Cyclic nucleotides (cAMP and cGMP) are important signaling molecules that control a range of cellular functions and modulate different reactions. It is known that under abiotic or biotic stress plant cells synthesize these nucleotides and that they also enhance the activity of the phenylpropanoid pathway. Wondering what is the relation between these two facts, we investigated how the exogenously applied membrane-permeable derivatives, 8-Br-cAMP or 8-Br-cGMP, which are believed to act as the original cyclic nucleotides, affect the expression of the genes for and the specific activity of three enzymes of the phenylpropanoid pathway in Arabidopsis thaliana seedlings. We found that the expression of the genes of phenylalanine ammonia-lyase (PAL2), 4-coumarate:coenzyme A ligase (4CL1) and chalcone synthase (CHS), and the specific activities of PAL (EC 4.3.1.5), 4CL (EC 6.2.1.12) and CHS (EC 2.3.1.74) were induced in the same way by either of these cyclic nucleotides used at 5 ?M concentration. None of the possible cAMP and cGMP degradation products (AMP, GMP, adenosine or guanosine) evoked such effects. Expression of PAL1, 4CL2 and 4CL3 were practically not affected. Although the investigated nucleotides induced rapid expression of the aforementioned enzymes, they did not affect the level of anthocyanins within the same period. We discuss the effects exerted by the exogenously administered cyclic nucleotides, their relation with stress and the role which the phenylpropanoid pathways the cyclic nucleotides may play in plants. PMID:23774376

Pietrowska-Borek, Ma?gorzata; Nuc, Katarzyna

2013-09-01

231

Netrin-1 Promotes Glioblastoma Cell Invasiveness and Angiogenesis by Multiple Pathways Including Activation of RhoA, Cathepsin B, and cAMP-response Element-binding Protein*  

PubMed Central

Glioblastomas are very difficult tumors to treat because they are highly invasive and disseminate within the normal brain, resulting in newly growing tumors. We have identified netrin-1 as a molecule that promotes glioblastoma invasiveness. As evidence, netrin-1 stimulates glioblastoma cell invasion directly through Matrigel-coated transwells, promotes tumor cell sprouting and enhances metastasis to lymph nodes in vivo. Furthermore, netrin-1 regulates angiogenesis as shown in specific angiogenesis assays such as enhanced capillary endothelial cells (EC) sprouting and by increased EC infiltration into Matrigel plugs in vivo, as does VEGF-A. This netrin-1 signaling pathway in glioblastoma cells includes activation of RhoA and cyclic AMP response element-binding protein (CREB). A novel finding is that netrin-1-induced glioblastoma invasiveness and angiogenesis are mediated by activated cathepsin B (CatB), a cysteine protease that translocates to the cell surface as an active enzyme and co-localizes with cell surface annexin A2 (ANXA2). The specific CatB inhibitor CA-074Me inhibits netrin-1-induced cell invasion, sprouting, and Matrigel plug angiogenesis. Silencing of CREB suppresses netrin-1-induced glioblastoma cell invasion, sprouting, and CatB expression. It is concluded that netrin-1 plays an important dual role in glioblastoma progression by promoting both glioblastoma cell invasiveness and angiogenesis in a RhoA-, CREB-, and CatB-dependent manner. Targeting netrin-1 pathways may be a promising strategy for brain cancer therapy. PMID:23195957

Shimizu, Akio; Nakayama, Hironao; Wang, Priscilla; Konig, Courtney; Akino, Tomoshige; Sandlund, Johanna; Coma, Silvia; Italiano, Joseph E.; Mammoto, Akiko; Bielenberg, Diane R.; Klagsbrun, Michael

2013-01-01

232

Cyclic-AMP mediated drugs: differential or global reduction of eicosanoid synthesis in the isolated rat lung?  

PubMed Central

In this study the question was addressed whether cAMP mediated drugs induce a differential reduction of branches of the arachidonic acid metabolism rather than a global reduction of eicosanoid synthesis. The isolated lungs of actively sensitized rats were employed to study prostaglandin and leukotriene release in the presence and absence of the cAMP mediated drugs theophylline, milrinone, sulmazole, isobutyl-methylxanthine and salbutamol. The release of eicosanoids as measured by RIA was predominantly basal and continuous, with a mild antigen induced stimulation only for TXB2 and the leukotrienes. All drugs reduced eicosanoid release globally. It is concluded that cAMP mediated drugs interfere with arachidonic acid metabolism at a site proximal to the branching into lipoxygenase and cyclo-oxygenase pathways. PMID:18475470

Biesebeek, Jan Dirk te; Wemer, Johan; Rooij, Hans H. van; Zijlstra, Freek J.; Porsius, Arijan J.

1992-01-01

233

Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*  

PubMed Central

Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and highlight biological processes important for pathogenicity. PMID:23665591

Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

2013-01-01

234

Low doses of cyclic AMP-phosphodiesterase inhibitors rapidly evoke opioid receptor-mediated thermal hyperalgesia in naïve mice which is converted to prominent analgesia by cotreatment with ultra-low-dose naltrexone  

Microsoft Academic Search

Systemic (s.c.) injection in naïve mice of cyclic AMP-phosphodiesterase (cAMP-PDE) inhibitors, e.g. 3-isobutyl-1-methylxanthine [(IBMX) or caffeine, 10 mg\\/kg] or the more specific cAMP-PDE inhibitor, rolipram (1 ?g\\/kg), rapidly evokes thermal hyperalgesia (lasting >5 h). These effects appear to be mediated by enhanced excitatory opioid receptor signaling, as occurs during withdrawal in opioid-dependent mice. Cotreatment of these mice with ultra-low-dose naltrexone (NTX, 0.1 ng\\/kg–1 pg\\/kg, s.c.)

Stanley M. Crain; Ke-Fei Shen

2008-01-01

235

Inhibition of human platelet cyclic AMP phosphodiesterase and of platelet aggregation by a hemisynthetic flavonoid, amentoflavone hexaacetate.  

PubMed

Amentoflavone hexaacetate (AmAc) was synthesized from natural amentoflavone (Am), a biflavonoid extracted from Viburnum lantana L. Am does not inhibit aggregation of intact platelets up to a concentration of 100 microM but inhibits human platelet cAMP phosphodiesterase (IC50 = 22.0 microM). AmAc is a potent inhibitor of the aggregation of washed human platelets induced by ADP (IC50 = 2.3 microM) or collagen (IC50 = 4.7 microM). AmAc inhibits crude (IC50 = 8.6 microM) or partially purified (IC50 = 42.2 microM) human platelet cAMP phosphodiesterase. In the presence of prostaglandin E1, AmAc (10 microM) induces a 3.7-fold increase in total platelet cAMP. The characteristics of this action suggest a role for cAMP in the mechanism of action of AmAc. The incubation of AmAc with intact platelets for 5 min is necessary for its activity. PMID:3002388

Beretz, A; Briançon-Scheid, F; Stierlé, A; Corre, G; Anton, R; Cazenave, J P

1986-01-15

236

(S)-?-Chlorohydrin Inhibits Protein Tyrosine Phosphorylation through Blocking Cyclic AMP - Protein Kinase A Pathway in Spermatozoa  

PubMed Central

?-Chlorohydrin is a common contaminant in food. Its (S)-isomer, (S)-?-chlorohydrin (SACH), is known for causing infertility in animals by inhibiting glycolysis of spermatozoa. The aim of present work was to examine the relationship between SACH and protein tyrosine phosphorylation (PTP), which plays a critical role in regulating mammalian sperm capacitation. In vitro exposure of SACH 50 µM to isolated rat epididymal sperm inhibited PTP. Sperm-specific glyceraldehyde 3-phosphate dehydrogenase (GAPDS) activities, the intracellular adenosine 5?-triphosphate (ATP) levels, 3?-5?-cyclic adenosine monophosphate (cAMP) levels and phosphorylation of protein kinase A (PKA) substrates in rat sperm were diminished dramatically, indicating that both glycolysis and the cAMP/PKA signaling pathway were impaired by SACH. The inhibition of both PTP and phosphorylation of PKA substrates by SACH could be restored by addition of cAMP analog dibutyryl-cAMP (dbcAMP) and phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX). Moreover, addition of glycerol protected glycolysis, ATP levels, phosphorylation of PKA substrates and PTP against the influence of SACH. These results suggested SACH inhibited PTP through blocking cAMP/PKA pathway in sperm, and PTP inhibition may play a role in infertility associated with SACH. PMID:22916194

Zheng, Weiwei; Yang, Bei; Pi, Jingbo; He, Gengsheng; Qu, Weidong

2012-01-01

237

Olmesartan ameliorates insulin sensitivity by modulating tumor necrosis factor-alpha and cyclic AMP in skeletal muscle.  

PubMed

We have reported that tumor necrosis factor (TNF)-alpha in skeletal muscle is one of the determinants of insulin resistance and that the renin-angiotensin system may be related to the regulation of TNF-a in skeletal muscle. Recent studies have suggested the involvement of cyclic adenosine monophosphate (cAMP) in the regulation of TNF-a in vascular smooth muscle cells or monocytes. The aim of this study was to determine the relationship between cAMP and TNF-a in skeletal muscle in connection with the renin-angiotensin system. Six-week-old male Sprague-Dawley rats were fed either normal rat chow or fructose-rich chow for 6 weeks. For the last 2 weeks of a 6-week period, the rats were treated with a vehicle or with an angiotensin II type 1 receptor antagonist (olmesartan medoxomil, 0.1 mg/kg/day). TNF-alpha levels in the soleus muscle were significantly higher and cAMP levels in the soleus muscle were significantly lower in fructose-fed rats than in control rats. Olmesartan increased cAMP and reduced TNF-a simultaneously in fructose-fed rats. There was a significant negative correlation between levels of cAMP and TNF-alpha. Moreover, a cAMP analogue reduced TNF-a levels in the soleus muscle. These results indicate that the increase in TNF-alpha via suppression of cAMP may affect the induction of insulin resistance. In addition, the facts that olmesartan increased cAMP and decreased TNF-alpha suggest that a part of the TNF-alpha regulation by angiotensin II might consist of modulation of cAMP through Gi protein activation in skeletal muscle. PMID:16419651

Yamaguchi, Koichi; Ura, Nobuyuki; Murakami, Hideyuki; Togashi, Nobuhiko; Hyakukoku, Masaya; Higashiura, Katsuhiro; Shimamoto, Kazuaki

2005-09-01

238

Activation of b2-adrenergic receptor stimulates g-secretase activity and accelerates amyloid  

E-print Network

signaling pathways7,8 or by activation of the muscarinic acetylcholine receptor or estrogen recep- tor9 couple to heterotrimeric guanine nucleotide­binding proteins (G proteins) and modulate the levels of intracellular second messengers, such as cyclic AMP (cAMP)16,17. The activated receptor also undergoes clathrin

Tian, Weidong

239

Ovariectomy and 17?-estradiol replacement play a role on the expression of Endonuclease-G and phosphorylated cyclic AMP response element-binding (CREB) protein in hippocampus.  

PubMed

The aim of the present study was to investigate the effects of different periods of ovariectomy and 17?-estradiol (E2) replacement on the expression of Cytochrome C, apoptosis inducing factor (AIF) and Endonuclease-G (Endo-G) in mitochondrial and cytosolic fractions obtained from hippocampus of the adult female rats. In addition, the expression of phosphorylated CREB (phospho-CREB) was also analyzed in hippocampus. Ovariectomy or E2 treatment did not change the expression of Cytochrome C and AIF. Ovariectomy (15, 21 and 36 days) decreased the expression of Endo-G in the mitochondrial fractions and increased it in the cytosolic fractions obtained from hippocampus. The treatment with E2 after 15 days of ovariectomy for 7 days or 21 days, and throughout the post-ovariectomy period prevented the effects of ovariectomy on Endo-G expression. Our results suggest that ovariectomy-induced apoptotic cell death in hippocampal tissue could be mediated by Endo-G, but not by AIF, via a caspase-independent apoptotic pathway. Furthermore, ovariectomy decreased the expression of phospho-CREB and the treatment with E2 prevented these effects. In conclusion, E2 may help maintain long-term neuronal viability by regulating the expression of members of the Bcl-2 family. Regulation of Endo-G released from mitochondria, but not of Cytochrome C and AIF, is also involved in the neuroprotective actions of E2. Furthermore, CREB may be involved in the expression of Bcl-2. These data provide new understanding into the mechanisms involved in the neuroprotective role of estrogen. PMID:24121025

Pereira, Renato Tavares dos Santos; Porto, Catarina Segreti; Abdalla, Fernando Maurício Francis

2014-01-25

240

An exploratory trial of cyclooxygenase type 2 inhibitor in HIV-1 infection: downregulated immune activation and improved T cell-dependent vaccine responses.  

PubMed

Chronic HIV infection is characterized by chronic immune activation and dysfunctional T cells with elevated intracellular cyclic AMP (cAMP), which inhibits the T cell activation capability. cAMP may be induced by prostaglandin E(2) following lipopolysaccharide (LPS)-induced upregulation of cyclooxygenase type 2 (COX-2) in monocytes due to the elevated LPS levels in patients with chronic HIV infection. This hypothesis was tested using celecoxib, a COX-2 inhibitor, for 12 weeks in HIV-infected patients without antiretroviral treatment in a prospective, open, randomized exploratory trial. Thirty-one patients were randomized in the trial; 27 completed the study, including 13 patients on celecoxib. Celecoxib reduced chronic immune activation in terms of CD38 density on CD8(+) T cells (-24%; P = 0.04), IgA levels (P = 0.04), and a combined score for inflammatory markers (P < 0.05). Celecoxib further reduced the inhibitory surface receptor programmed death 1 (PD-1) on CD8(+) T cells (P = 0.01), including PD-1 on the HIV Gag-specific subset (P = 0.02), enhanced the number of CD3(+) CD4(+) CD25(+) CD127(lo/-) Treg or activated cells (P = 0.02), and improved humoral memory recall responses to a T cell-dependent vaccine (P = 0.04). HIV RNA (P = 0.06) and D dimers (P = 0.07) tended to increase in the controls, whereas interleukin-6 (IL-6) possibly decreased in the treatment arm (P = 0.10). In conclusion, celecoxib downmodulated the immune activation related to clinical progression of chronic HIV infection and improved T cell-dependent functions in vivo. PMID:21490090

Pettersen, Frank O; Torheim, Eirik A; Dahm, Anders E A; Aaberge, Ingeborg S; Lind, Andreas; Holm, Malin; Aandahl, Einar M; Sandset, Per M; Taskén, Kjetil; Kvale, Dag

2011-07-01

241

An Exploratory Trial of Cyclooxygenase Type 2 Inhibitor in HIV-1 Infection: Downregulated Immune Activation and Improved T Cell-Dependent Vaccine Responses?  

PubMed Central

Chronic HIV infection is characterized by chronic immune activation and dysfunctional T cells with elevated intracellular cyclic AMP (cAMP), which inhibits the T cell activation capability. cAMP may be induced by prostaglandin E2 following lipopolysaccharide (LPS)-induced upregulation of cyclooxygenase type 2 (COX-2) in monocytes due to the elevated LPS levels in patients with chronic HIV infection. This hypothesis was tested using celecoxib, a COX-2 inhibitor, for 12 weeks in HIV-infected patients without antiretroviral treatment in a prospective, open, randomized exploratory trial. Thirty-one patients were randomized in the trial; 27 completed the study, including 13 patients on celecoxib. Celecoxib reduced chronic immune activation in terms of CD38 density on CD8+ T cells (?24%; P = 0.04), IgA levels (P = 0.04), and a combined score for inflammatory markers (P < 0.05). Celecoxib further reduced the inhibitory surface receptor programmed death 1 (PD-1) on CD8+ T cells (P = 0.01), including PD-1 on the HIV Gag-specific subset (P = 0.02), enhanced the number of CD3+ CD4+ CD25+ CD127lo/? Treg or activated cells (P = 0.02), and improved humoral memory recall responses to a T cell-dependent vaccine (P = 0.04). HIV RNA (P = 0.06) and D dimers (P = 0.07) tended to increase in the controls, whereas interleukin-6 (IL-6) possibly decreased in the treatment arm (P = 0.10). In conclusion, celecoxib downmodulated the immune activation related to clinical progression of chronic HIV infection and improved T cell-dependent functions in vivo. PMID:21490090

Pettersen, Frank O.; Torheim, Eirik A.; Dahm, Anders E. A.; Aaberge, Ingeborg S.; Lind, Andreas; Holm, Malin; Aandahl, Einar M.; Sandset, Per M.; Taskén, Kjetil; Kvale, Dag

2011-01-01

242

Cholera toxin and the adenylate cyclase-activating signal.  

PubMed

Studies with chemically modified cholera toxin derivatives showed that all treatments that decreased the ability of toxin to bind to mouse thymus cells or to polystyrene-coupled GM1 ganglioside caused a concomitant reduction in the toxin's ability to increase adenosine 3':5'-cyclic phosphate (cyclic AMP) in thymus cells and skin vascular permeability in rabbits. Dissociation of the H (heavy) and L (light) subunits abolished the biologic activity without inhibiting receptor binding, as did treatment with arginyl-specific reagents (which did not change the aggregation state of the toxin). When thymus cells were incubated with 125I-labelled toxin at 37C,only about 1% of the total cell-bound radioactivity was recovered in the cytosol supernate. Similar values were found for cells incubated with toxin at 0C, and with 125I-labelled choleragenoid at 37C or 0C. Thymus cells rapidly bound less than or equal to equal to 5 X 10(4) cholera toxin molecules per cell at both 0C and 37C. Much less, however, of the radioactive toxin bound at 37C than of that bound at 0C was displaced by addition of unlabelled toxin or choleragenoid. Similar temperature-related irreversible binding was noted with 125I-labelled choleragenoid. The relative amounts of H and L subunits in the irreversibly cell-bound and in the displaced 125I-labelled toxin were indistinguishable. Treatment of thymus cells at 37C, but not at 0C, with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide caused a 10-fold reduction of adenylate cyclase stimulation by cholera toxin without inhibiting activation by epinephrine or prostaglandin E1, or appreciably altering the basal, unstimulated enzyme activity. The carbodiimide inhibited the cyclic AMP response to cholera toxin when added shortly after the toxin had bound to the cells (early in the lag phase). PMID:176282

Holmgren, J; Lönnroth, I

1976-03-01

243

Functionally distinct isoforms of the CRE-BP DNA-binding protein mediate activity of a T-cell-specific enhancer.  

PubMed Central

Expression of the CD3 delta gene of the T-cell receptor (TCR) complex is regulated by a T-cell-specific enhancer. A highly conserved 40-bp motif (element delta A) within the CD3 delta enhancer is responsible for mediating its activity and specificity. Element delta A exhibits sequence similarities to the cyclic AMP response element (CRE) but does not respond to changes in the level of cyclic AMP. Using the delta A element as a probe, we have isolated three cDNA clones encoding three distinct protein isoforms, products of differential splicing and alternate promoter usage of the CRE-BP gene. These isoforms share the DNA binding and dimerization domains at the C terminus of the protein but differ at their N termini. In transfection assays, their activities as transcription regulators differ: CRE-BP2 is a potent activator, CRE-BP3 is a weak activator, and CRE-BP1 is transcriptionally inert. Mutations in the basic region of the CRE-BP1 protein which abrogate its ability to bind DNA render this protein a dominant repressor of the delta A enhancer. Antibodies to the CRE-BP protein interact specifically with the ubiquitous and predominantly T-cell-restricted nuclear complexes that bind to the delta A element and suggest the presence of this protein in homo- and heterodimeric complexes. Since the delta A motif is also present in the enhancer and promoter of the TCR alpha and beta genes, the CRE-BP isoforms may mediate expression of other members of the CD3/TCR complex during T-cell development. Images PMID:1531087

Georgopoulos, K; Morgan, B A; Moore, D D

1992-01-01

244

Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis.  

PubMed

Acrodysostosis without hormone resistance is a rare skeletal disorder characterized by brachydactyly, nasal hypoplasia, mental retardation and occasionally developmental delay. Recently, loss-of-function mutations in the gene encoding cAMP-hydrolyzing phosphodiesterase-4D (PDE4D) have been reported to cause this rare condition but the pathomechanism has not been fully elucidated. To understand the pathogenetic mechanism of PDE4D mutations, we conducted 3D modeling studies to predict changes in the binding efficacy of cAMP to the catalytic pocket in PDE4D mutants. Our results indicated diminished enzyme activity in the two mutants we analyzed (Gly673Asp and Ile678Thr; based on PDE4D4 residue numbering). Ectopic expression of PDE4D mutants in HEK293 cells demonstrated this reduction in activity, which was identified by increased cAMP levels. However, the cells from an acrodysostosis patient showed low cAMP accumulation, which resulted in a decrease in the phosphorylated cAMP Response Element-Binding Protein (pCREB)/CREB ratio. The reason for this discrepancy was due to a compensatory increase in expression levels of PDE4A and PDE4B isoforms, which accounted for the paradoxical decrease in cAMP levels in the patient cells expressing mutant isoforms with a lowered PDE4D activity. Skeletal radiographs of 10-week-old knockout (KO) rats showed that the distal part of the forelimb was shorter than in wild-type (WT) rats and that all the metacarpals and phalanges were also shorter in KO, as the name acrodysostosis implies. Like the G-protein ?-stimulatory subunit and PRKAR1A, PDE4D critically regulates the cAMP signal transduction pathway and influences bone formation in a way that activity-compromising PDE4D mutations can result in skeletal dysplasia. We propose that specific inhibitory PDE4D mutations can lead to the molecular pathology of acrodysostosis without hormone resistance but that the pathological phenotype may well be dependent on an over-compensatory induction of other PDE4 isoforms that can be expected to be targeted to different signaling complexes and exert distinct effects on compartmentalized cAMP signaling. PMID:25064455

Kaname, Tadashi; Ki, Chang-Seok; Niikawa, Norio; Baillie, George S; Day, Jonathan P; Yamamura, Ken-Ichi; Ohta, Tohru; Nishimura, Gen; Mastuura, Nobuo; Kim, Ok-Hwa; Sohn, Young Bae; Kim, Hyun Woo; Cho, Sung Yoon; Ko, Ah-Ra; Lee, Jin Young; Kim, Hyun Wook; Ryu, Sung Ho; Rhee, Hwanseok; Yang, Kap-Seok; Joo, Keehyoung; Lee, Jooyoung; Kim, Chi Hwa; Cho, Kwang-Hyun; Kim, Dongsan; Yanagi, Kumiko; Naritomi, Kenji; Yoshiura, Ko-Ichiro; Kondoh, Tatsuro; Nii, Eiji; Tonoki, Hidefumi; Houslay, Miles D; Jin, Dong-Kyu

2014-11-01

245

Appetitive Cue-Evoked ERK Signaling in the Nucleus Accumbens Requires NMDA and D1 Dopamine Receptor Activation and Regulates CREB Phosphorylation  

ERIC Educational Resources Information Center

Conditioned stimuli (CS) can modulate reward-seeking behavior. This modulatory effect can be maladaptive and has been implicated in excessive reward seeking and relapse to drug addiction. We previously demonstrated that exposure to an appetitive CS causes an increase in the activation of extracellular signal-regulated kinase (ERK) and cyclic-AMP

Kirschmann, Erin K. Z.; Mauna, Jocelyn C.; Willis, Cory M.; Foster, Rebecca L.; Chipman, Amanda M.; Thiels, Edda

2014-01-01

246

Vasopressin induces dopamine release and cyclic AMP efflux from the brain of water-deprived rats: inhibitory effect of vasopressin V2 receptor-mediated phosphorylation.  

PubMed

The neurohypophyseal hormone vasopressin (AVP) is widely distributed throughout the central nervous system. It acts as an excitatory transmitter in the CNS and plays an important physiological role in water and electrolyte homeostasis. However, water deprivation has been shown to induce changes in the levels of monoamines, but there is little knowledge about the influence of AVP on monoamine levels after water deprivation. In this study, we investigated the effect of AVP and its receptor antagonists on alterations in dopamine (DA) release and cyclic adenosine 3',5' monophosphate (cAMP) efflux from rat brain slices following water deprivation. Striatal brain slices (500 microm thick) were incubated in a medium with or without AVP (0. 1-1.0 microM) for 30 min. After 2 h of washout in normal medium, high KCl (40 mM)-evoked DA release and cAMP efflux from the rat brain slices were examined. In the brain slices of euhydrated animals, treatment with AVP slightly altered DA release and cAMP efflux from the brain. This increase in DA release and cAMP efflux was not significantly affected by the addition of a calcium/calmodulin-dependent protein phosphatase, calcineurin (20 microM), to the incubation medium or either by a V1 or V2 AVP receptor antagonist. In contrast, AVP significantly increased the DA release and enhanced the cAMP efflux from the brain slices of water-deprived animals. The AVP-induced increase of brain response in the water-deprived animals was significantly attenuated by a V2 receptor antagonist, partially by calcineurin, but not by a V1 receptor antagonist. The present results suggest that AVP may play a role in water-deprivation-induced DA release and cAMP efflux, which is possibly mediated through the activation of the V2 receptor. The V2 receptor action is attenuated by calcium/calmodulin-dependent dephosphorlyation of some cellular proteins critical for signal transduction. PMID:9873154

Tyagi, M G; Handa, R K; Stephen, P M; Bapna, J S

1998-01-01

247

Activating transcription factor 4.  

PubMed

Activating transcription factor 4 (ATF4) belongs to the ATF/CREB (activating transcription factor/cyclic AMP response element binding protein) family of basic region-leucine zipper (bZip) transcription factors, which have the consensus binding site cAMP responsive element (CRE). ATF4 has numerous dimerization partners. ATF4 is induced by stress signals including anoxia/hypoxia, endoplasmic reticulum stress, amino acid deprivation, and oxidative stress. ATF4 expression is regulated transcriptionally, translationally via the PERK pathway of eIF2alpha phosphorylation, and posttranslationally by phosphorylation, which targets ATF4 to proteasomal degradation. ATF4 regulates the expression of genes involved in oxidative stress, amino acid synthesis, differentiation, metastasis and angiogenesis. Transgenic studies have demonstrated ATF4 to be involved in hematopoiesis, lens and skeletal development, fertility, proliferation, differentiation, and long-term memory. ATF4 expression is upregulated in cancer. Since ATF4 is induced by tumour microenvironmental factors, and regulates processes relevant to cancer progression, it might serve as a potential therapeutic target in cancer. PMID:17466566

Ameri, Kurosh; Harris, Adrian L

2008-01-01

248

CYCLIC AMP-DEPENDENT PROTEIN KINASE INDUCTION BY POLYCHLORINATED BIPHENYLS (PCBS) STIMULATES CREB PHOSPHORYLATION VIA A CALCIUM-DEPENDENT, PKC-INDEPENDENT PATHWAY IN CORTICAL NEURONS.  

EPA Science Inventory

We have previously demonstrated that the PCB mixture, Aroclor 1254 (A1254), increases the phosphorylated form of CREB (pCREB), the cAMP-responsive element binding protein. This transcription factor is important in nervous system development and plasticity. Phosphorylation of C...

249

Cyclic AMP inhibits translation of cyclin D3 in T lymphocytes at the level of elongation by inducing eEF2-phosphorylation  

Microsoft Academic Search

The purpose of the present study was to understand the mechanism by which activated protein kinase A (PKA) leads to down-regulation of cyclin D3 in lymphocytes. By using Jurkat cells as a model system, we have been able to demonstrate that cyclin D3 is reduced at the level of translation by inhibition of elongation. One of the important factors involved

Kristine B. Gutzkow; Hege U. Låhne; Soheil Naderi; Knut Martin Torgersen; Bjørn Skålhegg; Mamoru Koketsu; Yoshimasa Uehara; Heidi Kiil Blomhoff

2003-01-01

250

Cyclic AMP-dependent phosphorylation modifies the gating properties of L-type Ca 2+ channels in bovine adrenal chromaffin cells  

Microsoft Academic Search

We investigated the effects of cAMP-dependent phosphorylation on the voltage- and time-dependent gating properties of Ca2+ channel currents recorded from bovine adrenal chromaffin cells under whole-cell voltage clamp. Extracellular perfusion with the membrane-permeant activator of cAMP-dependent protein kinase, 8-bromo(8-Br)-cAMP (1 mM), caused a 49%, 29%, and 21% increase in Ca2+ current (ICa) amplitudes evoked by voltage steps to 0, +10,

Craig A. Doupnik; Raymund Y. K. Pun

1992-01-01

251

Effects of cold exposure on cyclic AMP concentration in plasma, liver, and brown and white adipose tissues in cold-acclimated rats  

NASA Astrophysics Data System (ADS)

Effects of acute cold exposure on plasma energy substrates and tissue 3',5'-adenosine monophosphate (cAMP) were analyzed in intact rats, to define an involvement of the nucleotide in nonshivering thermogenesis (NST) and resultant cold acclimation. After an acute cold exposure to -5°C, the plasma glucose level increased gradually in warm-kept control rats (C) while it decreased significantly in cold-acclimated rats (CA). However, it was increased considerably by an extreme cold exposure to -15°C in both C and CA. By contrast, plasma levels of free fatty acids (FFA) increased immediately after cold exposure and the release lasted during the period of exposure especially in C. The cold exposure also increased plasma cAMP concentration but no concomitant increase was found in the liver. In both brown (IBAT) and white (WAT) adipose tissues the nucleotide concentration showed a stepwise decrease. The observed correlation between lipolysis and plasma cAMP response after cold exposure suggests an involvement of the adenylate cyclase-cAMP system in NST via lipid metabolism, at least, in the early stages of cold acclimation.

Habara, Yoshiaki

1989-06-01

252

The Cyclic AMP-binding protein CbpB in Brucella melitensis and its role in cell envelope integrity, resistance to detergent and virulence.  

PubMed

Brucella melitensis possesses an operon with two components: the response regulator OtpR and a putative cAMP-dependent protein kinase regulatory subunit encoded by the BMEI0067 gene. In the previous study, the function of OtpR has been studied, while little is known about the function of the BMEI0067 gene. Using a bioinformatics approach, we showed that the BMEI0067 gene encodes an additional putative cAMP-binding protein, which we refer to as CbpB. Structural modeling predicted that CbpB has a cAMP-binding protein (CAP) domain and is structurally similar to eukaryotic protein kinase A regulatory subunits. Here, we report the characterization of CbpB, a cAMP-binding protein in Brucella melitensis, showed to be involved in mouse persistent infections. ?cbpB::km possessed cell elongation, bubble-like protrusions on cell surface and its resistance to environmental stresses (temperature, osmotic stress and detergent). Interestingly, comparative real-time qPCR assays, the cbpB mutation resulted in significantly different expression of aqpX and several penicillin-binding proteins and cell division proteins in Brucella. Combined, these results demonstrated characterization of CbpB in B. melitensis and its key role for intracellular multiplication. PMID:24850100

Liu, Wen-Juan; Dong, Hao; Peng, Xiao-Wei; Wu, Qing-Min

2014-07-01

253

Two for one: cyclic AMP mediates the anti-inflammatory and anti-spasmodic properties of the non-anesthetic lidocaine analog JMF2-1.  

PubMed

Inhalation of JMF2-1, an analog of lidocaine with reduced anesthetic activity, prevents airway contraction and lung inflammation in experimental asthma models. We sought to test if the JMF2-1 effects are a consequence of increased intracellular cAMP levels in asthma cell targets, such as smooth muscle cells and T cells. Functional effect of JMF2-1 on carbachol-induced contraction of intact or epithelial-denuded rat trachea was assessed in conventional organ baths. cAMP was quantified by radioimmunoassay in cultured guinea pig tracheal smooth muscle cells, as well as lymph node cells from BALB/c mice, exposed to JMF2-1. We found that JMF2-1 (0.1-1mM) concentration-dependently inhibited epithelium-intact tracheal ring contraction induced by carbachol challenge. The antispasmodic effect remained unaltered following epithelium removal or pretreatment with NG-nitro-L-arginine methyl ester (100?M), but it was clearly sensitive to 9-(tetrahydro-2-furyl) adenine (SQ22,536, 100?M), an adenylate cyclase inhibitor. JMF2-1 (300 and 600?M) also dose-dependently increased cAMP intracellular levels of both cultured airway smooth muscle cells and T lymphocytes. This effect was consistently abrogated by SQ22,536 and reproduced by forskolin in both systems. JMF2-1 induced apoptosis of anti-CD3 activated T cells in a mechanism sensitive to zIETD, indicating that JMF2-1 mediates caspase-8-dependent apoptosis. Furthermore, forskolin also inhibited anti-CD3 induced T cell proliferation and survival. Our results suggest that JMF2-1 inhibits respiratory smooth muscle contraction as well as T cell proliferation and survival through enhancement of intracellular cAMP levels. These findings may help to explain the anti-inflammatory and antispasmodic effects of JMF2-1 observed in previous studies. PMID:22329902

Olsen, Priscilla C; Coelho, Luciana P; da Costa, Jorge C S; Cordeiro, Renato S B; Silva, Patricia M R; Martins, Marco A

2012-04-01

254

Involvement of VILIP-1 (visinin-like protein) and opposite roles of cyclic AMP and GMP signaling in in vitro cell migration of murine skin squamous cell carcinoma  

PubMed Central

VILIP-1 (visinin-like protein 1) is downregulated in various human squamous cell carcinoma. In a mouse skin SCC model VILIP-1 expression is reduced in aggressive tumor cells, accompanied by reduced cAMP levels. Overexpression of VILIP-1 in aggressive SCC cells led to enhanced cAMP production, in turn causing a reduction in invasive properties. Moreover, in primary neurons and neuronal tumor lines VILIP-1 enhanced cGMP-signaling. Here, we set out to determine whether and how cAMP and cGMP-signaling contribute to the VILIP-1 effect on enhanced SCC model cell migration, and thus most likely invasiveness in vivo. We found stronger increase in cGMP levels in aggressive, VILIP-1-negative SCC cells following stimulation of guanylyl cyclases NPR-A and -B with the natriuretic peptides ANP and CNP, respectively. Incubation with ANP or 8Br-cGMP to increase cGMP levels further enhanced the migration capacity of aggressive cells, whereas cell adhesion was unaffected. Increased cGMP was caused by elevated expression levels of NPR-A and NPR-B. However, the expression level of VILIP-1 did not affect cGMP signaling and guanylyl cyclase expression in SCC. In contrast, VILIP-1 led to reduced migration of aggressive SCC cells depending on cAMP levels as shown by use of adenylyl cyclase inhibitor 2?,3?-dideoxyadenosine. Involvement of cAMP-effectors PKA and EPAC play a role downstream of adenylyl cyclase activation. VILIP-1-positive and -negative cells did not differ in mRNA expression of adenylyl cyclases, but an effect on enhanced protein expression and membrane localization of ACs was shown to underlie enhancement of cAMP production and, thus, reduction in cell migration by VILIP-1. PMID:21480386

Schonrath, Katharina; Pan, Wensheng; Klein-Szanto, Andres J.; Braunewell, Karl-Heinz

2011-01-01

255

Platelet adenylate cyclase responses in depression: Implications for a receptor defect  

Microsoft Academic Search

The dose-dependent stimulatory response of prostaglandin E1 (PGE1) on the net synthesis of 3H-adenosine 3',5'-monophosphate (cyclic AMP) in platelets whose adenine nucleotide pools had been labelled by prior incubation with 3H-adenine was measured. Also, the dose-dependent inhibition produced by norepinephrine (NE) on this stimulatory process was evaluated. Platelets were obtained from eleven moderately depressed male patients and from eight non-depressed

Yao-Chun Wang; Ghanshyam N. Pandey; Joe Mendels; Alan Frazer

1974-01-01

256

Cyclic AMP and the reverse transformation reaction.  

PubMed

Traditional methods for cancer treatment have been aimed at killing the cancer cells. Unfortunately this approach all too often is accompanied by harmful killing of normal cells. The present paper describes an experimental program in our laboratory in which cancer cells are treated so as to revert to normal cell behavior. This process, which we have named reverse transformation, appears to offer considerable hope in the treatment of a large number of malignancies. PMID:12119272

Puck, Theodore T; Webb, Patricia; Johnson, Robert

2002-06-01

257

Post Graduate Activities Response Rates  

E-print Network

Post Graduate Activities Response Rates Most Frequently Selected Fields, with average salaries www% Military 2% The program offers thorough coverage of the topics important to the field of electrical, 42% were found through career services Salary Statistics Geographic Location of Employed Graduates

Lipson, Michal

258

Post Graduate Activities Response Rates  

E-print Network

Post Graduate Activities Response Rates Most Frequently Selected Fields, with average salaries www% Military 2% The program offers thorough coverage of the topics important to the field of electrical 5% $75,000Communication/Media Government Computer Engineering Devices and Electronics #12;Salary

Lipson, Michal

259

Post Graduate Activities Response Rates  

E-print Network

Post Graduate Activities Response Rates Most Frequently Selected Fields, with average salaries www% Employed 65% Pursue Ph.D. 14% Military 5% Other 4% Still Seeking 17% 65% $64,604 28% $43,349 Government 20/Industry: Other - #12;Salary Statistics Geographic Location of Employed Graduates How Employment was Found Co

Lipson, Michal

260

Modulation of Glycogen Phosphorylase Activity Affects 5?Phosphoribosyl?1?Pyrophosphate Availability in Rat Hepatocyte Cultures  

Microsoft Academic Search

The effect of modulation of the rate of glycogenolysis on the availability of 5?phosphoribosyl?1? pyrophosphate (PRPP) was investigated in rat hepatocyte cultures. Dibutyryl cyclic AMP (dbcAMP), forskolin and glucagon, activating glycogen phosphorylase through activation of protein kinase A (PKA), were found to raise PRPP availability by 44%–56%. Arg?vasopressin and phenylephrine, activating glycogen phosphorylase through the phosphoinositide cascade, did not affect

Pnina Boer; Oded Sperling

2004-01-01

261

Activating Transcription Factor 3 and the Nervous System  

PubMed Central

Activating transcription factor 3 (ATF3) belongs to the ATF/cyclic AMP responsive element binding family of transcription factors and is often described as an adaptive response gene whose activity is usually regulated by stressful stimuli. Although expressed in a number of splice variants and generally recognized as a transcriptional repressor, ATF3 has the ability to interact with a number of other transcription factors including c-Jun to form complexes which not only repress, but can also activate various genes. ATF3 expression is modulated mainly at the transcriptional level and has markedly different effects in different types of cell. The levels of ATF3 mRNA and protein are normally very low in neurons and glia but their expression is rapidly upregulated in response to injury. ATF3 expression in neurons is closely linked to their survival and the regeneration of their axons following axotomy, and that in peripheral nerves correlates with the generation of a Schwann cell phenotype that is conducive to axonal regeneration. ATF3 is also induced by Toll-like receptor (TLR) ligands but acts as a negative regulator of TLR signaling, suppressing the innate immune response which is involved in immuno-surveillance and can enhance or reduce the survival of injured neurons and promote the regeneration of their axons. PMID:22347845

Hunt, David; Raivich, Gennadij; Anderson, Patrick Norval

2012-01-01

262

Allergic manifestations and cutaneous histamine responses in patients with McCune Albright syndrome  

PubMed Central

Background McCune Albright syndrome (MAS) is a rare disorder characterized by precocious puberty, café-au-lait spots, and fibrous dysplasia. Its cause is an activating mutation in the GNAS gene, encoding a subunit of the stimulatory G protein, Gsalpha (Gs?). The action of any mediator that signals via Gs? and cyclic AMP can be up regulated in MAS. We had observed gastritis, gastroesophageal reflux, and anaphylaxis in McCune Albright patients. Objective As histamine is known to signal via histamine 1 (H1) and histamine 2 (H2) receptors, which couple with stimulatory G proteins, we attempted to mechanistically link histamine responsiveness to the activating GNAS mutation. We hypothesized that responsiveness to histamine skin testing would differ between MAS patients and healthy controls. Patients and methods After obtaining informed consent, we performed a systematic review of histamine responsiveness and allergic manifestations in 11 MAS patients and 11 sex-matched, Tanner-stage matched controls. We performed skin prick testing, quantifying the orthogonal diameters of wheals and erythema. We also quantitated G protein mRNA expression. Results The peak wheal and flare responses to histamine were significantly higher in MAS patients compared to controls. Conclusions This study suggests that MAS patients may be at risk for exaggerated histamine responsiveness compared to unaffected controls. PMID:23663565

2013-01-01

263

Resveratrol Inhibits LPS-Induced MAPKs Activation via Activation of the Phosphatidylinositol 3-Kinase Pathway in Murine RAW 264.7 Macrophage Cells  

PubMed Central

Background Resveratrol is a natural polyphenolic compound that has cardioprotective, anticancer and anti-inflammatory properties. We investigated the capacity of resveratrol to protect RAW 264.7 cells from inflammatory insults and explored mechanisms underlying inhibitory effects of resveratrol on RAW 264.7 cells. Methodology/Principal Findings Murine RAW 264.7 cells were treated with resveratrol (1, 5, and 10 µM) and/or LPS (5 µg/ml). Nitric oxide (NO) and prostaglandin E2 (PGE2) were measured by Griess reagent and ELISA. The mRNA and protein levels of proinflammatory proteins and cytokines were analysed by ELISA, RT-PCR and double immunofluorescence labeling, respectively. Phosphorylation levels of Akt, cyclic AMP-responsive element-binding protein (CREB), mitogen-activated protein kinases (MAPKs) cascades, AMP-activated protein kinase (AMPK) and expression of SIRT1(Silent information regulator T1) were measured by western blot. Wortmannin (1 µM), a specific phosphatidylinositol 3-kinase (PI3-K) inhibitor, was used to determine if PI3-K/Akt signaling pathway might be involved in resveratrol’s action on RAW 264.7 cells. Resveratrol significantly attenuated the LPS-induced expression of nitric oxide (NO), prostaglandin E2 (PGE2), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor-? (TNF-?) and interleukin-1? (IL-1?) in RAW 264.7 cells. Resveratrol increased Akt phosphorylation in a time-dependent manner. Wortmannin, a specific phosphatidylinositol 3-kinase (PI3-K) inhibitor, blocked the effects of resveratrol on LPS-induced RAW 264.7 cells activation. In addition, PI3-K inhibition partially abolished the inhibitory effect of resveratrol on the phosphorylation of cyclic AMP-responsive element-binding protein (CREB) and mitogen-activated protein kinases (MAPKs) cascades. Meanwhile, PI3-K is essential for resveratrol-mediated phosphorylation of AMPK and expression of SIRT1. Conclusion and Implications This investigation demonstrates that PI3-K/Akt activation is an important signaling in resveratrol-mediated activation of AMPK phosphorylation and SIRT1 expression, and inhibition of phosphorylation of CREB and MAPKs activation, proinflammatory mediators and cytokines production in response to LPS in RAW 264.7 cells. PMID:22952890

Liu, Bin; Deng, Yi-Shu; Zhan, Dong; Chen, Yuan-Li; He, Ying; Liu, Jing; Zhang, Zong-Ji; Sun, Jun; Lu, Di

2012-01-01

264

Regulation of ?1- and ?3-adrenergic agonist-stimulated lipolytic response in hyperthyroid and hypothyroid rat white adipocytes  

PubMed Central

This study examined the effects of thyroid status on the lipolytic responses of rat white adipocytes to ?-adrenoceptor (?-AR) stimulation. The ?1- and ?3-AR mRNAs and proteins were measured by Northern and saturation analyses, respectively. Glycerol production and adenyl cyclase (AC) activity induced by various non-selective and selective ?1/?3-AR agonists and drugs which act distal to the receptor in the signalling cascade were measured in cells from untreated, tri-iodothyronine (T3)-treated and thyroidectomized rats. The ?3-AR density was enhanced (72%) by T3-treatment and reduced (50%) by introduction of a hypothyroid state while ?1-AR number remained unaffected. The ?1- and ?3-AR density was correlated with the specific mRNA level in all thyroid status. The lipolytic responses to isoprenaline, noradrenaline (?1/?3/?3-AR agonists) and BRL?37344 (?3-AR agonist) were potentiated by 48, 58 and 48%, respectively in hyperthyroidism and reduced by about 80% in hypothyroidism. T3-treatment increased the maximal lipolytic response to the partial ?3-AR (CGP?12177) and ?1-AR (xamoterol) agonists by 234 and 260%, respectively, increasing their efficacy (intrinsic activity: 0.95 versus 0.43 and 1.02 versus 0.42). The maximal AC response to these agonists was increased by 84 and 58%, respectively, without changing their efficacy. In the hypothyroid state, the maximal lipolytic and AC responses were decreased with CGP (0.17±0.03 versus 0.41±0.08??mol glycerol/106 adipocytes; 0.048±0.005 versus 0.114±0.006?pmol cyclic AMP?min?1?mg?1) but not changed with xamoterol. The changes in lipolytic responses to postreceptor-acting agents (forskolin, enprofylline and dibutenyl cyclic AMP, (Bu)2cAMP) suggest the modifications on receptor coupling and phosphodiesterase levels in both thyroid states. Thyroid status affects lipolysis by modifying ?3-AR density and postreceptor events without changes in the ?1-AR functionality. PMID:10711342

Germack, Renee; Starzec, Anna; Perret, Gerard Y

2000-01-01

265

Induction of the rat prodynorphin gene through Gs-coupled receptors may involve phosphorylation-dependent derepression and activation.  

PubMed Central

Prodynorphin transcription is activated via Gs-coupled receptors through a cyclic AMP (cAMP)-dependent pathway. Four cAMP response elements (CREs) are present within the rat prodynorphin (RD) control region, and all four CREs appear to function in RD regulation. Three CREs located upstream between -1860 and -1504 are critical for receptor-responsive activity, but their function is distance dependent unless they act together with a fourth CRE found in exon 1. Regulation of RD also appears to involve multiple CRE-binding proteins. Both CRE-binding protein (CREB) and activator protein 1 (AP-1) can regulate RD, but their effects are in opposite directions; CREB represses and AP-1 activates RD. CREB-induced repression and AP-1 activation require distinct elements within the control region, but their binding and functions overlap at CRE-3. While CREB repression is dependent on CRE-3, AP-1 activation (and cAMP induction) of RD requires additional CREs (CRE-1, -2, and -4). CREB repression blocks AP-1 activation in unstimulated cells. However, phosphorylation relieves CREB-induced repression and enhances AP-1 activation. Gs-coupled receptor activation of RD may require phosphorylation-dependent derepression and activation steps. Images PMID:8164647

Collins-Hicok, J; Lin, L; Spiro, C; Laybourn, P J; Tschumper, R; Rapacz, B; McMurray, C T

1994-01-01

266

DIHYDROTESTOSTERONE ACTIVATES CREB SIGNALING IN CUTURED HIPPOCAMPAL NEURONS  

PubMed Central

Although androgens induce numerous actions in brain, relatively little is known about which cell signaling pathways androgens activate in neurons. Recent work in our laboratory showed that the androgens testosterone and dihydrotestosterone (DHT) activate androgen receptor (AR)-dependent mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) signaling. Since the transcription factor cyclic AMP response element binding protein (CREB) is a downstream effector of MAPK/ERK and androgens activate and CREB in non-neuronal cells, we investigated whether androgens activate CREB signaling in neurons. First, we observed that DHT rapidly activates CREB in cultured hippocampal neurons, as evidenced by CREB phosphorylation. Further, we observed that DHT-induced CREB phosphorylation is AR-dependent, as it occurs in PC12 cells stably transfected with AR but in neither wild-type nor empty vector-transfected cells. Next, we sought to identify the signal transduction pathways upstream of CREB phosphorylation using pharmacological inhibitors. DHT-induced CREB phosphorylation in neurons was found to be dependent upon protein kinase C (PKC) signaling but independent of MAPK/ERK, phosphatidylinositol 3-kinase, protein kinase A, and Ca2+/calmodulin-dependent protein kinase IV. These results demonstrate that DHT induces PKC-dependent CREB signaling, which may contribute to androgen-mediated neural functions. PMID:19729001

Nguyen, Thuy-Vi V.; Yao, Mingzhong; Pike, Christian J.

2009-01-01

267

Regulation of vascular endothelial barrier function by Epac, a cAMP-activated exchange factor for Rap GTPase  

Microsoft Academic Search

Endothelial cell-cell junctional proteins and cortical actin are of central impor- tance for regulating vascular permeabil- ity. Rap1, a member of the Ras family of GTPases, is enriched at endothelial cell- cell contacts and activated by cyclic AMP (cAMP) through a PKA-independent path- way. Activation of a cAMP-inducible gua- nine-exchange factor for Rap, Epac, re- sults in markedly enhanced basal

Xavier Cullere; Sunil K. Shaw; Lorna Andersson; Junichi Hirahashi; Francis W. Luscinskas; Tanya N. Mayadas

2005-01-01

268

Combined effects of adrenaline and insulin on active electrogenic Na+-K+ transport in rat soleus muscle  

Microsoft Academic Search

Both beta2-adrenoreceptor stimulants (such as adrenaline and salbutamol) and insulin can increase active Na+-K+ transport1-6 and hyperpolarise skeletal muscle cells1,2,7-9. Thus, adrenaline and insulin, which are otherwise antagonistic regulators of several metabolic processes, have one action in common, namely, stimulation of active ion translocation. This is especially interesting as cyclic AMP stimulates Na+-K+ transport2, whereas a lowering of the cytoplasmic

J. A. Flatman; T. Clausen

1979-01-01

269

The regulation of Enzyme IIAGlc expression controls adenylate cyclase activity in Escherichia coli  

Microsoft Academic Search

During the last few years, several genes, such as pap, bgl and flhDC, have been shown to be coregulated by the histone-like nucleoid-structuring (H-NS) protein and the cyclic AMP-catabolite activator protein (cAMP\\/CAP) complex, suggesting an interaction between both systems in the control of some cellular functions. In this study, the possible effect of H-NS on the cAMP level was investigated.

Evelyne Krin; Odile Sismeiro; Antoine Danchin; Philippe N. Bertinå

2002-01-01

270

?-Adrenergic stimulation does not activate p38 MAP kinase or induce PGC-1? in skeletal muscle.  

PubMed

There are reports that the ?-adrenergic agonist clenbuterol induces a large increase in peroxisome proliferator-activated receptor-? coactivator-1? (PGC-1?) in skeletal muscle. This has led to the hypothesis that the increases in PGC-1? and mitochondrial biogenesis induced in muscle by endurance exercise are mediated by catecholamines. In the present study, we evaluated this possibility and found that injecting rats with clenbuterol or norepinephrine induced large increases in PGC-1? and mitochondrial proteins in brown adipose tissue but had no effect on PGC-1? expression or mitochondrial biogenesis in skeletal muscle. In brown adipocytes, the increase in PGC-1? expression induced by ?-adrenergic stimulation is mediated by activation of p38 mitogen-activated protein kinase (p38 MAPK), which phosphorylates and activates the cAMP response element binding protein (CREB) family member activating transcription factor 2 (ATF2), which binds to a cyclic AMP response element (CRE) in the PGC-1? promoter and mediates the increase in PGC-1? transcription. Phospho-CREB does not have this effect. Our results show that the reason for the lack of effect of ?-adrenergic stimulation on PGC-1? expression in muscle is that catecholamines do not activate p38 or increase ATF2 phosphorylation in muscle. PMID:23443926

Kim, Sang Hyun; Asaka, Meiko; Higashida, Kazuhiko; Takahashi, Yumiko; Holloszy, John O; Han, Dong-Ho

2013-04-15

271

?-Adrenergic stimulation does not activate p38 MAP kinase or induce PGC-1? in skeletal muscle  

PubMed Central

There are reports that the ?-adrenergic agonist clenbuterol induces a large increase in peroxisome proliferator-activated receptor-? coactivator-1? (PGC-1?) in skeletal muscle. This has led to the hypothesis that the increases in PGC-1? and mitochondrial biogenesis induced in muscle by endurance exercise are mediated by catecholamines. In the present study, we evaluated this possibility and found that injecting rats with clenbuterol or norepinephrine induced large increases in PGC-1? and mitochondrial proteins in brown adipose tissue but had no effect on PGC-1? expression or mitochondrial biogenesis in skeletal muscle. In brown adipocytes, the increase in PGC-1? expression induced by ?-adrenergic stimulation is mediated by activation of p38 mitogen-activated protein kinase (p38 MAPK), which phosphorylates and activates the cAMP response element binding protein (CREB) family member activating transcription factor 2 (ATF2), which binds to a cyclic AMP response element (CRE) in the PGC-1? promoter and mediates the increase in PGC-1? transcription. Phospho-CREB does not have this effect. Our results show that the reason for the lack of effect of ?-adrenergic stimulation on PGC-1? expression in muscle is that catecholamines do not activate p38 or increase ATF2 phosphorylation in muscle. PMID:23443926

Kim, Sang Hyun; Asaka, Meiko; Higashida, Kazuhiko; Takahashi, Yumiko; Han, Dong-Ho

2013-01-01

272

Inhibitory effect of calcium-binding protein regucalcin on Ca 2+ \\/calmodulin-dependent cyclic nucleotide phosphodiesterase activity in rat liver cytosol  

Microsoft Academic Search

The effect of regucalcin, a calcium-binding protein isolated from rat liver cytosol, on Ca2+\\/calmodulin-dependent cyclic nucleotide (AMP) phosphodiesterase activity in rat liver cytosol was investigated. The addition of Ca2+ (50 µM) and calmodulin 160 U\\/ml in the enzyme reaction mixture caused a significant increase in cyclic AMP phosphodiesterase activity. This increase was inhibited by the presence of regucalcin (0.5-3.0 µM);

Masayoshi Yamaguchi; Hitoshi Tai

1991-01-01

273

Policy Name: Commercial Activities Originating/Responsible  

E-print Network

Policy Name: Commercial Activities Originating/Responsible Department: University Services Approval commercial activity at Carleton University requires the explicit approval of the Vice- President (Finance commercial activities on campus. Purpose: To protect the commercial enterprises owned and operated

Carleton University

274

Differential Biological and Adjuvant Activities of Cholera Toxin and Escherichia coli Heat-Labile Enterotoxin Hybrids  

PubMed Central

Two bacterial products that have been demonstrated to function as mucosal adjuvants are cholera toxin (CT), produced by various strains of Vibrio cholerae, and the heat-labile enterotoxin (LT) produced by some enterotoxigenic strains of Escherichia coli. Although LT and CT have many features in common, they are clearly distinct molecules with biochemical and immunologic differences which make them unique. The goal of this study was to determine the basis for these biological differences by constructing and characterizing chimeric CT-LT molecules. Toxin gene fragments were subcloned to create two constructs, each expressing the enzymatically active A subunit of one toxin and the receptor binding B subunit of the other toxin. These hybrid toxins were purified, and the composition and assembly of CT A subunit (CT-A)-LT B subunit (LT-B) and LT A subunit (LT-A)-CT B subunit (CT-B) were confirmed. Hybrids were evaluated for enzymatic activity, as measured by the accumulation of cyclic AMP in Caco-2 cells, and the enterotoxicity of each toxin was assessed in a patent-mouse assay. The results demonstrated that LT-A–CT-B induces the accumulation of lower levels of cyclic AMP and has less enterotoxicity than either wild-type toxin or the other hybrid. Nonetheless, this hybrid retains adjuvant activity equivalent to or greater than that of either wild-type toxin or the other hybrid when used in conjunction with tetanus toxoid for intranasal immunization of BALB/c mice. Importantly, the ability of LT to induce a type 1 cytokine response was found to be a function of LT-A. Specifically, LT-A–CT-B was able to augment the levels of antigen-specific gamma interferon (IFN-?) and interleukin 5 to levels comparable to those achieved with native LT, while CT-A–LT-B and native CT both produced lower levels of antigen-specific IFN-?. Thus, these toxin hybrids possess unique biological characteristics and provide information about the basis for differences in the biological activities observed for CT and LT. PMID:11179323

Bowman, Christal C.; Clements, John D.

2001-01-01

275

Characterization of a 5-HT1B receptor on CHO cells: functional responses in the absence of radioligand binding.  

PubMed Central

1. Chinese hamster ovary (CHO) cells have been reported to be devoid of 5-HT receptors and have frequently been used as hosts for the expression of cloned 5-HT receptors. Unexpectedly, 5-HT was found to induce profound inhibition of forskolin-stimulated cyclic AMP production in these cells and the aim of this study was to classify the 5-HT receptor involved. 2. In CHO(dhfr-) cells 5-HT was a potent agonist and caused 80-100% inhibition of forskolin stimulated cyclic AMP production. A study using several 5-HT1 receptor agonists revealed the following potencies (p[A50]): RU24969 (9.09 +/- 0.17) > 5-carboxamidotryptamine (8.86 +/- 0.20) > 5-HT (8.07 +/- 0.05) > CP-93,129 (7.74 +/- 0.10) > sumatriptan (5.93 +/- 0.04). All five agonists achieved a similar maximum effect. Irreversible receptor alkylation studies yielded a pKA estimate of 7.04 +/- 0.34 for 5-HT. 3. The 5-HT1A/1B antagonist, (+/-)-cyanopindolol (4-100 nM), caused parallel rightward shifts of the 5-HT concentration-effect curve with no change in asymptote. Schild analysis yielded a pKB estimate of 8.69 +/- 0.09 (Schild slope 1.13 +/- 0.10). (+/-)-Cyanopindolol actually behaved as a partial agonist with an intrinsic activity of 0.2-0.5 and a p[A50] of 8.55. 4. 5-HT (0.01-10 microM) also elicited a concentration-dependent increase in intracellular [Ca2+] in CHO(dhfr-) cells thus demonstrating that dual coupling is not a phenomenon restricted to systems in which there is overexpression of transfected receptors. 5. This agonist and antagonist profile is consistent with the presence of a 5-HT1B receptor. 8-OH-DPAT (1 microM) and renzapride (3 microM) were without effect on forskolin-stimulated cyclic AMP production and ketanserin (0.3 microM) did not antagonize the inhibition produced by 5-HT, thus excluding the involvement of 5-HT1A, 5-HT4, and 5-HT2 receptors. 6. The possibility that expression of a 5-HT1B receptor was associated with the dhfr- mutation was excluded since RU24969, 5-HT and CP-93,129 were also potent agonists in unmutated, CHO-K1 cells: p[A50] 9.03 +/- 0.03, 8.34 +/- 0.05, 7.69 +/- 0.07 respectively, and (+/-)-cyanopindolol (0.1 microM) shifted the 5-HT curve to the right and yielded a pA2 estimate of 8.70 +/- 0.06. 7. Little or no specific binding of [3H]-5-HT (0.1-200 nM) or of the high affinity ligand [125I]-iodocyanopindolol (0.01-3 nM) to CHO(dhfr-) cell membranes could be detected. 5-HT also failed to elicit any increase in the binding of [35S]-GTP gamma S to CHO membranes. 8. In conclusion, cultured CHO cells express 5-HT1B receptors which are negatively coupled to adenylyl cyclase and positively coupled to increases in intracellular calcium. The absence of radioligand binding was unexpected in view of the high potency of 5-HT and the partial agonist activity of the normally 'silent' competitive antagonist, (+/-)-cyanopindolol. This implies very efficient receptor-effector coupling of a low density of 5-HT1B receptors. Clearly, the absence of detectable radioligand binding cannot be assumed to mean the absence of receptors capable of eliciting a significant functional response. PMID:8882605

Giles, H.; Lansdell, S. J.; Bolofo, M. L.; Wilson, H. L.; Martin, G. R.

1996-01-01

276

cAMP Receptor Protein from Escherichia coli as a Model of Signal Transduction in Proteins – A Review  

Microsoft Academic Search

In Escherichia coli, cyclic AMP receptor protein (CRP) is known to regulate the transcription of about 100 genes. The signal to activate CRP is the binding of cyclic AMP. It has been suggested that binding of cAMP to CRP leads to a long-distance signal transduction from the N-terminal cAMP-binding domain to the C-terminal domain of the protein, which is responsible

E. Fic; P. Bonarek; A. Gorecki; S. Kedracka-Krok; J. Mikolajczak; A. Polit; M. Tworzydlo; M. Dziedzicka-Wasylewska; Z. Wasylewski

2009-01-01

277

Balance between synaptic versus extrasynaptic NMDA receptor activity influences inclusions and neurotoxicity of mutant huntingtin.  

PubMed

Huntington's disease is caused by an expanded CAG repeat in the gene encoding huntingtin (HTT), resulting in loss of striatal and cortical neurons. Given that the gene product is widely expressed, it remains unclear why neurons are selectively targeted. Here we show the relationship between synaptic and extrasynaptic activity, inclusion formation of mutant huntingtin protein (mtHtt) and neuronal survival. Synaptic N-methyl-D-aspartate-type glutamate receptor (NMDAR) activity induces mtHtt inclusions via a T complex-1 (TCP-1) ring complex (TRiC)-dependent mechanism, rendering neurons more resistant to mtHtt-mediated cell death. In contrast, stimulation of extrasynaptic NMDARs increases the vulnerability of mtHtt-containing neurons to cell death by impairing the neuroprotective cyclic AMP response element-binding protein (CREB)-peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha) cascade and increasing the level of the small guanine nucleotide-binding protein Rhes, which is known to sumoylate and disaggregate mtHtt. Treatment of transgenic mice expressing a yeast artificial chromosome containing 128 CAG repeats (YAC128) with low-dose memantine blocks extrasynaptic (but not synaptic) NMDARs and ameliorates neuropathological and behavioral manifestations. By contrast, high-dose memantine, which blocks both extrasynaptic and synaptic NMDAR activity, decreases neuronal inclusions and worsens these outcomes. Our findings offer a rational therapeutic approach for protecting susceptible neurons in Huntington's disease. PMID:19915593

Okamoto, Shu-ichi; Pouladi, Mahmoud A; Talantova, Maria; Yao, Dongdong; Xia, Peng; Ehrnhoefer, Dagmar E; Zaidi, Rameez; Clemente, Arjay; Kaul, Marcus; Graham, Rona K; Zhang, Dongxian; Vincent Chen, H-S; Tong, Gary; Hayden, Michael R; Lipton, Stuart A

2009-12-01

278

The Freeze-Thaw Stress Response of the Yeast Saccharomyces cerevisiae Is Growth Phase Specific and Is Controlled by Nutritional State via the RAS-Cyclic AMP Signal Transduction Pathway  

Microsoft Academic Search

was frozen at 220°C for 2 h (cooling rate, less than 4°C min21) and thawed on ice for 40 min. Supercooling occurred without reducing cell survival and was followed by freezing. Loss of viability was proportional to the freezing duration, indicating that freezing is the main determinant of freeze-thaw damage. Regardless of the carbon source used, the wild-type strain and

JONG-IN PARK; CHRIS M. GRANT; PAUL V. ATTFIELD; IAN W. DAWES

279

Parallel activation of Ca(2+)-induced survival and death pathways in cardiomyocytes by sorbitol-induced hyperosmotic stress.  

PubMed

Hyperosmotic stress promotes rapid and pronounced apoptosis in cultured cardiomyocytes. Here, we investigated if Ca(2+) signals contribute to this response. Exposure of cardiomyocytes to sorbitol [600 mosmol (kg water)(-1)] elicited large and oscillatory intracellular Ca(2+) concentration increases. These Ca(2+) signals were inhibited by nifedipine, Cd(2+), U73122, xestospongin C and ryanodine, suggesting contributions from both Ca(2+) influx through voltage dependent L-type Ca(2+) channels plus Ca(2+) release from intracellular stores mediated by IP(3) receptors and ryanodine receptors. Hyperosmotic stress also increased mitochondrial Ca(2+) levels, promoted mitochondrial depolarization, reduced intracellular ATP content, and activated the transcriptional factor cyclic AMP responsive element binding protein (CREB), determined by increased CREB phosphorylation and electrophoretic mobility shift assays. Incubation with 1 mM EGTA to decrease extracellular [Ca(2+)] prevented cardiomyocyte apoptosis induced by hyperosmotic stress, while overexpression of an adenoviral dominant negative form of CREB abolished the cardioprotection provided by 1 mM EGTA. These results suggest that hyperosmotic stress induced by sorbitol, by increasing Ca(2+) influx and raising intracellular Ca(2+) concentration, activates Ca(2+) release from stores and causes cell death through mitochondrial function collapse. In addition, the present results suggest that the Ca(2+) increase induced by hyperosmotic stress promotes cell survival by recruiting CREB-mediated signaling. Thus, the fate of cardiomyocytes under hyperosmotic stress will depend on the balance between Ca(2+)-induced survival and death pathways. PMID:20454859

Chiong, M; Parra, V; Eisner, V; Ibarra, C; Maldonado, C; Criollo, A; Bravo, R; Quiroga, C; Contreras, A; Vicencio, J M; Cea, P; Bucarey, J L; Molgó, J; Jaimovich, E; Hidalgo, C; Kroemer, G; Lavandero, S

2010-08-01

280

Hypoxia-activated metabolic pathway stimulates phosphorylation of p300 and CBP in oxygen-sensitive cells  

PubMed Central

Transcription co-activators and histone acetyltransferases, p300 and cyclic AMP responsive element-binding protein-binding protein (CBP), participate in hypoxic activation of hypoxia-inducible genes. Here, we show that exposure of PC12 and cells to 1–10% oxygen results in hyperphosphorylation of p300/CBP. This response is fast, long lasting and specific for hypoxia, but not for hypoxia-mimicking agents such as desferioxamine or Co2+ ions. It is also cell-type specific and occurs in pheochromocytoma PC12 cells and the carotid body of rats but not in hepatoblastoma cells. The p300 hyperphosphorylation specifically depends on the release of intracellular calcium from inositol 1,4,5-triphosphate (IP3)-sensitive stores. However, it is not inhibited by pharmacological inhibitors of any of the kinases traditionally known to be directly or indirectly calcium regulated. On the other hand, p300 hyperphosphorylation is inhibited by several different inhibitors of the glucose metabolic pathway from generation of NADH by glyceraldehyde 3-phosphate dehydrogenase, through the transfer of NADH through the glycerol phosphate shuttle to ubiquinone and complex III of the mitochondrial respiratory chain. Inhibition of IP3-sensitive calcium stores decreases generation of ATP, and this inhibition is significantly stronger in hypoxia than in normoxia. We propose that the NADH glycerol phosphate shuttle participates in generating a pool of ATP that serves either as a co-factor or a modulator of the kinases involved in the phosphorylation of p300/CBP during hypoxia. PMID:16000154

Zakrzewska, Adriana; Schnell, Phillip O.; Striet, Justin B.; Hui, Anna; Robbins, Jennifer R.; Petrovic, Milan; Conforti, Laura; Gozal, David; Wathelet, Marc G.; Czyzyk-Krzeska, Maria F.

2006-01-01

281

Hypoxia-activated metabolic pathway stimulates phosphorylation of p300 and CBP in oxygen-sensitive cells.  

PubMed

Transcription co-activators and histone acetyltransferases, p300 and cyclic AMP responsive element-binding protein-binding protein (CBP), participate in hypoxic activation of hypoxia-inducible genes. Here, we show that exposure of PC12 and cells to 1-10% oxygen results in hyperphosphorylation of p300/CBP. This response is fast, long lasting and specific for hypoxia, but not for hypoxia-mimicking agents such as desferioxamine or Co2+ ions. It is also cell-type specific and occurs in pheochromocytoma PC12 cells and the carotid body of rats but not in hepatoblastoma cells. The p300 hyperphosphorylation specifically depends on the release of intracellular calcium from inositol 1,4,5-triphosphate (IP3)-sensitive stores. However, it is not inhibited by pharmacological inhibitors of any of the kinases traditionally known to be directly or indirectly calcium regulated. On the other hand, p300 hyperphosphorylation is inhibited by several different inhibitors of the glucose metabolic pathway from generation of NADH by glyceraldehyde 3-phosphate dehydrogenase, through the transfer of NADH through the glycerol phosphate shuttle to ubiquinone and complex III of the mitochondrial respiratory chain. Inhibition of IP3-sensitive calcium stores decreases generation of ATP, and this inhibition is significantly stronger in hypoxia than in normoxia. We propose that the NADH glycerol phosphate shuttle participates in generating a pool of ATP that serves either as a co-factor or a modulator of the kinases involved in the phosphorylation of p300/CBP during hypoxia. PMID:16000154

Zakrzewska, Adriana; Schnell, Phillip O; Striet, Justin B; Hui, Anna; Robbins, Jennifer R; Petrovic, Milan; Conforti, Laura; Gozal, David; Wathelet, Marc G; Czyzyk-Krzeska, Maria F

2005-09-01

282

The hyperthermic effect of intracerebroventricular cholera enterotoxin in the unanaesthetized cat  

PubMed Central

1. Cholera enterotoxin was used to evaluate a possible role of endogenous cyclic AMP in production of hyperthermia. Injection of purified toxin (0·10-1·0 ?g in 0·10 ml.) into the lateral cerebral ventricle of unanaesthetized cats caused dose-related hyperthermic responses. Heating the toxin for 40 min at 90° C abolished its hyperthermic activity. 2. Intraventricular administration of dibutyryl cyclic AMP (250-1000 ?g) also caused hyperthermia which, however, was preceded by transient periods of hypothermia and/or excitation in about half of the tests. 3. Paracetamol, indomethacin and sodium salicylate inhibited hyperthermic responses to cholera enterotoxin. Paracetamol and indomethacin also inhibited hyperthermia induced by dibutyryl cyclic AMP (sodium salicylate was not tested). 4. It is likely that the hyperthermic effect of cholera enterotoxin in the cat is mediated via endogenous cyclic AMP and that the antipyretics inhibit this effect by an action subsequent to the increase in cyclic AMP. 5. It is unlikely that prostaglandin-induced hyperthermia in the cat is mediated via cyclic AMP since these antipyretics do not inhibit this response to prostaglandin E1. PMID:4371060

Clark, Wesley G.; Cumby, H. Rick; Davis, Henry E.

1974-01-01

283

L-type Ca2+ channel blockers promote Ca2+ accumulation when dopamine receptors are activated in striatal neurons  

PubMed Central

Dopamine (DA) receptor-mediated signal transduction and gene expression play a central role in many brain disorders from schizophrenia to Parkinson’s disease to addiction. While trying to evaluate the role of L-type Ca2+ channels in dopamine D1 receptor-mediated phosphorylation of the transcription factor cyclic AMP response element-binding protein (CREB), we found that activation of dopamine D1 receptors alters the properties of L-type Ca2+ channel inhibitors and turns them into facilitators of Ca2+ influx. In D1 receptor-stimulated neurons, L-type Ca2+ channel blockers promote cytosolic Ca2+ accumulation. This leads to the activation of a molecular signal transduction pathway and CREB phosphorylation. In the absence of dopamine receptor stimulation, L-type Ca2+ channel blockers inhibit CREB phosphorylation. The effect of dopamine on L-type Ca2+ channel blockers is dependent on protein kinase A (PKA), suggesting that protein phosphorylation plays a role in this phenomenon. Because of the adverse effect of activated dopamine receptors on L-type Ca2+ channel blocker action, the role of L-type Ca2+ channels in the dopamine D1 receptor signal transduction pathway cannot be assessed with pharmacological tools. However, with antisense technology, we demonstrate that L-type Ca2+ channels contribute to D1 receptor-mediated CREB phosphorylation. We conclude that the D1 receptor signal transduction pathway depends on L-type Ca2+ channels to mediate CREB phosphorylation. PMID:15530653

Eaton, Molly E.; Macias, Wendy; Youngs, Rachael M.; Rajadhyaksha, Anjali; Dudman, Joshua T.; Konradi, Christine

2014-01-01

284

Spreading depression activates unfolded protein response.  

PubMed

Preconditioning is a process where a preceding non-lethal form of stress activates a stress response that protects cells against an otherwise lethal form of stress. Preconditioning can be induced in various ways including short-term ischemia or spreading depression. Here we investigated the effect of 1 h repetitive spreading depression on the unfolded protein response (UPR), a stress response activated under conditions associated with endoplasmic reticulum (ER) dysfunction. Spreading depression induced processing of xbp1 mRNA, indicative of an activation of UPR. Processing of xbp1 was paralleled by a rise in grp78 mRNA levels resulting from an activation of a signal transduction pathway that depends on protein synthesis. Preconditioning-induced activation of UPR may preserve ER functioning under pathological conditions interfering with ER functions. PMID:15342130

Schneeloch, Edda; Wenkel, Simone; Mies, Günter; Paschen, Wulf

2004-09-16

285

Physiological Response to Physical Activity in Children.  

ERIC Educational Resources Information Center

This is a report on research in the field of physical responses of children to strenuous activity. The paper is divided into three subtopics: (1) peak performance measure in children; (2) training effects on children; and (3) importance of physical activity for children. Measurements used are oxygen consumption, ventilation, heart rate, cardiac…

Gilliam, Thomas B.

286

Structural basis for cyclic-nucleotide selectivity and cGMP-selective activation of PKG I.  

PubMed

Cyclic guanosine monophosphate (cGMP) and cyclic AMP (cAMP)-dependent protein kinases (PKG and PKA) are closely related homologs, and the cyclic nucleotide specificity of each kinase is crucial for keeping the two signaling pathways segregated, but the molecular mechanism of cyclic nucleotide selectivity is unknown. Here, we report that the PKG I? C-terminal cyclic nucleotide binding domain (CNB-B) is highly selective for cGMP binding, and we have solved crystal structures of CNB-B with and without bound cGMP. These structures, combined with a comprehensive mutagenic analysis, allowed us to identify Leu296 and Arg297 as key residues that mediate cGMP selectivity. In addition, by comparing the cGMP bound and unbound structures, we observed large conformational changes in the C-terminal helices in response to cGMP binding, which were stabilized by recruitment of Tyr351 as a "capping residue" for cGMP. The observed rearrangements of the C-terminal helices provide a mechanical insight into release of the catalytic domain and kinase activation. PMID:24239458

Huang, Gilbert Y; Kim, Jeong Joo; Reger, Albert S; Lorenz, Robin; Moon, Eui-Whan; Zhao, Chi; Casteel, Darren E; Bertinetti, Daniela; Vanschouwen, Bryan; Selvaratnam, Rajeevan; Pflugrath, James W; Sankaran, Banumathi; Melacini, Giuseppe; Herberg, Friedrich W; Kim, Choel

2014-01-01

287

Stress reorganisation and response in active solids  

E-print Network

We present a microscopic model of a disordered viscoelastic active solid, i.e. an active material whose long time behaviour is elastic as opposed to viscous. It is composed of filaments, passive crosslinks and molecular motors powered by stored chemical energy, e.g. actomyosin powered by ATP. Our model allows us to study the collective behaviour of contractile active elements and how their interaction with each other and the passive elastic elements determines the macroscopic mechanical properties of the active material. As a result of the (un)binding dynamics of the active elements, we find that this system provides a highly responsive material with a dynamic mechanical response strongly dependent on the amount of deformation.

Hawkins, Rhoda J

2014-01-01

288

Stress Reorganization and Response in Active Solids  

NASA Astrophysics Data System (ADS)

We present a microscopic model of a disordered viscoelastic active solid, i.e., an active material whose long time behavior is elastic as opposed to viscous. It is composed of filaments, passive cross-links, and molecular motors powered by stored chemical energy, e.g., actomyosin powered by adenosine triphosphate. Our model allows us to study the collective behavior of contractile active elements and how their interaction with each other and the passive elastic elements determines the macroscopic mechanical properties of the active material. As a result of the (un)binding dynamics of the active elements, we find that this system provides a highly responsive material with a dynamic mechanical response strongly dependent on the amount of deformation.

Hawkins, Rhoda J.; Liverpool, Tanniemola B.

2014-07-01

289

Active thermal isolation for temperature responsive sensors  

NASA Technical Reports Server (NTRS)

A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specified surface of the body. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes: (1) operating the isolator at the same temperature as the constant temperature of the sensor and (2) establishing a fixed boundary temperature which is either less than or equal to or slightly greater than the sensor constant temperature.

Martinson, Scott D. (inventor); Gray, David L. (inventor); Carraway, Debra L. (inventor); Reda, Daniel C. (inventor)

1994-01-01

290

The role of calcitonin gene-related peptide on the increase in transient receptor potential vanilloid-1 levels in trigeminal ganglion and trigeminal nucleus caudalis activation of rat.  

PubMed

Calcitonin gene-related peptide (CGRP) and transient receptor potential vanilloid-1 (TRPV1) play an important role in the development of pain and migraine pathogenesis. Increase in plasma CGRP levels is associated with delayed migraine-like attacks in migraine patients. Although several lines of evidence have indicated a key role of CGRP in migraine pain, its mechanisms remain unclear. In this study, we aimed to investigate the functional role of CGRP on trigeminal nociceptive pathway by determining the alteration in TRPV1 levels in trigeminal ganglion (TG) and the activation of trigeminal nucleus caudalis (TNC) of rat. Post intravenous injection of CGRP (600ng/kg) at 60min significantly increased the levels of TRPV1, CGRP, phosphorylated protein kinase C and phosphorylated cyclic AMP responsive element-binding protein in TG of rats. The number of small and medium TRPV1 and CGRP positive immunostaining neurons accompanying with co-localization of TRPV1 with CGRP neurons were significantly increased in TG of CGRP-injected rats. The sustained increase in c-Fos expression in TNC neurons was also observed in CGRP-injected rats. These results indicate that CGRP may participate in trigeminal nociceptive system sensitization by induced increase in TRPV1 and CGRP levels in TG neurons and activation of the central neurons in TNC. PMID:23123284

Chatchaisak, Duangthip; Srikiatkhachorn, Anan; Maneesri-le Grand, Supang; Govitrapong, Piyarat; Chetsawang, Banthit

2013-01-01

291

Multiple signaling pathways are responsible for prostaglandin E2-induced murine keratinocyte proliferation  

PubMed Central

Although prostaglandin E2 (PGE2) has been shown by pharmacological and genetic studies to be important in skin cancer, the molecular mechanism(s) by which it contributes to tumor growth is not well understood. In this study we investigated the mechanisms by which PGE2 stimulates murine keratinocyte proliferation using in vitro and in vivo models. In primary mouse keratinocyte (PMK) cultures, PGE2 activated the epidermal growth factor receptor (EGFR) and its downstream signaling pathways as well as increased cyclic AMP (cAMP) production and activated the cAMP response element binding protein (CREB). EGFR activation was not significantly inhibited by pretreatment with a c-src inhibitor (PP2), nor by a protein kinase A inhibitor (H-89). However, PGE2-stimulated extracellularly-regulated kinase1/2 (ERK1/2) activation was completely blocked by EGFR, ERK1/2 and phosphatidylinositol 3-kinase (PI3-K) pathway inhibitors. In addition, these inhibitors attenuated the PGE2-induced proliferation, nuclear factor-?B (NF-?B), activator protein-1 (AP-1) and CREB binding to the promoter regions of the cyclin D1 and vascular endothelial growth factor (VEGF) genes and expression of cyclin D1 and VEGF in PMKs. Similarly, in vivo, we found that wild type (WT) mice treated with PGE2 and untreated COX-2 overexpressing transgenic mice had higher levels of cell proliferation and expression of cyclin D1 and VEGF, as well as higher levels of activated EGFR, NF-?B, AP-1 and CREB, than vehicle-treated WT mice. Our findings provide evidence for a link between COX-2 overexpression and EGFR-, ERK-, PI3-K-, cAMP-mediated cell proliferation, and the tumor promoting activity of PGE2 in mouse skin. PMID:18567804

Ansari, Kausar M.; Rundhaug, Joyce E.; Fischer, Susan M.

2008-01-01

292

© 1998 International Society for Neurochemistry Apolipoprotein E Attenuates f3-Amyloid-Induced Astrocyte Activation  

E-print Network

Abstract: A common feature of Alzheimer’s disease pathology is an abundance of activated glia, indicative of an inflammatory reaction in the brain. The relationship between glial activation and neurodegeneration is not known, although several cytokines and inflammatory mediators produced by activated glia have the potential to initiate or exacerbate the progression of neuropathology. As f3-amyloid (A/3) is one of several stimuli that can activate glia, it is important to determine how A,3-induced glial activation is influenced by other proteins present in the plaque, such as apolipoprotein E (apoE). We examined the effect of native preparations of apoE on activation of rat cortical astrocyte cultures by A~31—42. The apoE source was conditioned medium from human embryonic kidney 293 cells stably transfected with human apoE3 or apoE4 cDNA. By morphological criteria, apoE inhibited A,3-induced astrocyte activation in three experimental paradigms: apoE pretreatment blocked subsequent A/3-induced activation, A/3 aged in the presence of apoE did not activate astrocytes, and apoE addition to activated astrocytes transiently reversed the activated phenotype. No apoE isoform selectivity was observed. The effect of apoE appears to be specific to A~3,as apoE did not attenuate cyclic AMP-induced astrocyte activation. These data suggest that apoE may modulate the ability of A~3to induce inflammatory responses in the brain. Key Words: Glia—Astrocyte—Apolipoprotein— Alzheimer’s disease — ~3-Amyloid—Apolipoprotein E.

Jingna Hu; Mary Jo Ladu; Lindaj Van Eldik

293

Cyclic adenosine 3', 5'-monophosphate in cerebrospinal fluid during thermoregulation and fever.  

PubMed Central

1. Samples of cerebrospinal fluid (c.s.f.) have been taken from the cisterna magna of unanaesthetized cats, whilst rectal temperature was recorded, during exposure of the animals to various ambient temperatures and during fever induced by pyrogen. The concentration of adenosine 3', 5'-monophosphate (cyclic AMP) in samples of c.s.f. has been assayed. 2. Cats exposed to low ambient temperatures (-2 to +2 degrees C) for 3 h maintained body temperature by both behavioural and autonomic heat gain activity. Exposure of cats to high ambient temperatures (44 - 45 degrees C) for 3.5 h caused a rise in body temperatures of about 2.5 degrees C, despite behavioural and autonomic heat loss activity. Neither cold nor heat stress had a significant effect on c.s.f. cyclic AMP. 3. Fever induced by intravenous Shigella dysenteriae (2 and 20 mug/kg) was associated with a dose-related increase in the concentration of cyclic AMP in c.s.f. Paracetamol (75 mg/kg) injected I.P. before the onset of fever, suppressed the increase in both temperature and c.s.f. cyclic AMP in response to pyrogen. Paracetamol (50 and 100 mg/kg), injected after the onset of fever, caused a fall in temperature, which was not associated with a decrease in the concentration of cyclic AMP in c.s.f. 4. Fever induced in cats by intravenous Shigella dysenteriae (20 mug/kg) was associated with an increase in the concentration of cyclic AMP in plasma as well as in c.s.f. 5. The sodium salt of cyclic AMP (0.1-10 mg/kg) injected I.V. into unanaesthetized cats caused a dose-related hypothermia, which was associated with autonomic heat loss activity and a dose-related increase in the concentration of cyclic AMP in cisternal c.s.f., which was not mimicked by adenosine. 6. It is concluded that the raised concentrations of cyclic AMP in c.s.f., in response to pyrogen I.V., do not mediate fever in the cat and that the concentration of cyclic AMP in cisternal c.s.f. may be affected by changes in the plasma concentration of the nucleotide. PMID:190383

Dascombe, M J; Milton, A S

1976-01-01

294

Thrombin-Induced Increase in Intracellular Cyclic 3?,5?-Adenosine Monophosphate in Human Platelets  

PubMed Central

The present data disagree with earlier suggestions that thrombin's effect on platelets is to cause a decrease in intracellular cyclic 3?,5?-adenosine monophosphate. Washed human platelets or platelet-rich plasma were incubated at 37°C with human thrombin. After centrifugation, the supernates were assayed for nucleotides and calcium released. The platelet pellets, and in some experiments the supernates as well, were assayed by radioimmunoassay for intracellular cyclic AMP. In the washed platelet system, increasing doses of thrombin to 0.5 U/cc induced increasing release of nucleotides and calcium. This was accompanied by an average twofold increase in intracellular cyclic AMP levels. Prostaglandin E1, which inhibited 30-50% of release, induced a four- to fivefold increase in cyclic AMP levels that was additive to the cyclic AMP-stimulatory effect of thrombin. Theophylline, which inhibited only 20-40% of nucleotide release, was synergistic with thrombin in the intracellular accumulation of cyclic AMP. The time-course of cyclic AMP accumulation in response to thrombin was slower than thrombin-induced nucleotide release. Similar findings were made in the platelet-rich plasma system where thrombin stimulation of nucleotide release also resulted in a marked accumulation of intracellular cyclic AMP. Thrombin did not appear to stimulate the release of intracellular cyclic AMP. The mechanism underlying these observations was not apparent. The thrombin had no measurable inhibitory effect on platelet phosphodiesterase activity in either intact washed cells or the platelet homogenate supernates. Furthermore, thrombin inhibited, rather than stimulated, platelet adenyl cyclase activity in both intact washed cells and washed platelet particulate fractions. Of note, however, was the finding that thrombin did not completely inhibit the adenyl cyclase activity of prostaglandin-stimulated cells. Further work is needed to clarify the significance of this observation. Nonetheless, the accumulation of intracellular cyclic AMP in response to thrombin observed in the present study suggests that the antagonistic actions of various agents on the platelet release reaction, thought to underlie platelet function, may depend upon a mechanism more intricate than a straightforward mediation through directly opposite effects on platelet cyclic AMP. PMID:4344994

Droller, Michael J.; Wolfe, Sidney M.

1972-01-01

295

Low dielectric response in enzyme active site  

PubMed Central

The kinetics of charge transfer depend crucially on the dielectric reorganization of the medium. In enzymatic reactions that involve charge transfer, atomic dielectric response of the active site and of its surroundings determines the efficiency of the protein as a catalyst. We report direct spectroscopic measurements of the reorganization energy associated with the dielectric response in the active site of ?-chymotrypsin. A chromophoric inhibitor of the enzyme is used as a spectroscopic probe. We find that water strongly affects the dielectric reorganization in the active site of the enzyme in solution. The reorganization energy of the protein matrix in the vicinity of the active site is similar to that of low-polarity solvents. Surprisingly, water exhibits an anomalously high dielectric response that cannot be described in terms of the dielectric continuum theory. As a result, sequestering the active site from the aqueous environment inside low-dielectric enzyme body dramatically reduces the dielectric reorganization. This reduction is particularly important for controlling the rate of enzymatic reactions. PMID:10681440

Mertz, Edward L.; Krishtalik, Lev I.

2000-01-01

296

Protein kinase A regulates caspase-1 via Ets-1 in bone stromal cell-derived lesions: a link between cyclic AMP and pro-inflammatory pathways in osteoblast progenitors  

PubMed Central

Patients with genetic defects of the cyclic (c) adenosine-monophosphate (AMP)-signaling pathway and those with neonatal-onset multisystem inflammatory disease (NOMID) develop tumor-like lesions of the long bones. The molecular basis of this similarity is unknown. NOMID is caused by inappropriate caspase-1 activity, which in turn activates the inflammasome. The present study demonstrates that NOMID bone lesions are derived from the same osteoblast progenitor cells that form fibroblastoid tumors in mice and humans with defects that lead to increased cAMP-dependent protein kinase A (PKA) signaling. NOMID tumor cells showed high PKA activity, and an increase in their cAMP signaling led to PKA-specific activation of caspase-1. Increased PKA led to inflammation-independent activation of caspase-1 via over-expression of the proto-oncogene (and early osteoblast factor) Ets-1. In NOMID tumor cells, as in cells with defective PKA regulation, increased prostaglandin E2 (PGE2) led to increased cAMP levels and activation of Wnt signaling, like in other states of inappropriate PKA activity. Caspase-1 and PGE2 inhibition led to a decrease in cell proliferation of both NOMID and cells with abnormal PKA. These data reveal a previously unsuspected link between abnormal cAMP signaling and defective regulation of the inflammasome and suggest that caspase-1 and PGE2 inhibition may be therapeutic targets in bone lesions associated with defects of these two pathways. PMID:20940146

Almeida, Madson Q.; Tsang, Kit Man; Cheadle, Chris; Watkins, Tonya; Grivel, Jean-Charles; Nesterova, Maria; Goldbach-Mansky, Raphaela; Stratakis, Constantine A.

2011-01-01

297

Lipolytic Products Activate Peroxisome Proliferator-activated Receptor (PPAR) ? and ? in Brown Adipocytes to Match Fatty Acid Oxidation with Supply*  

PubMed Central

?-adrenergic receptors (?-ARs) promote brown adipose tissue (BAT) thermogenesis by mobilizing fatty acids and inducing the expression of oxidative genes. ?-AR activation increases the expression of oxidative genes by elevating cAMP, but whether lipolytic products can modulate gene expression is not known. This study examined the role that adipose triglyceride lipase (ATGL) and hormone-sensitive lipase (HSL) plays in the induction of gene expression. Activation of brown adipocytes by ?-AR agonism or 8-bromo-cyclic AMP increased the expression of PGC1?, PDK4, PPAR?, uncoupling protein 1 (UCP1), and neuron-derived orphan receptor-1 (NOR-1), and concurrent inhibition of HSL reduced the induction of PGC1?, PDK4, PPAR?, and UCP1 but not NOR-1. Similar results were observed in the BAT of mice following pharmacological or genetic inhibition of HSL and in brown adipocytes with stable knockdown of ATGL. Conversely, treatments that increase endogenous fatty acids elevated the expression of oxidative genes. Pharmacological antagonism and siRNA knockdown indicate that PPAR? and PPAR? modulate the induction of oxidative genes by ?-AR agonism. Using a live cell fluorescent reporter assay of PPAR activation, we demonstrated that ligands for PPAR? and -?, but not PPAR?, were rapidly generated at the lipid droplet surface and could transcriptionally activate PPAR? and -?. Knockdown of ATGL reduced cAMP-mediated induction of genes involved in fatty acid oxidation and oxidative phosphorylation. Consequently, ATGL knockdown reduced maximal oxidation of fatty acids, but not pyruvate, in response to cAMP stimulation. Overall, the results indicate that lipolytic products can activate PPAR? and PPAR? in brown adipocytes, thereby expanding the oxidative capacity to match enhanced fatty acid supply. PMID:22685301

Mottillo, Emilio P.; Bloch, Ainsley E.; Leff, Todd; Granneman, James G.

2012-01-01

298

Protein kinase activators alter glial cholesterol esterification  

SciTech Connect

Similar to nonneural tissues, the activity of glial acyl-CoA cholesterol acyltransferase is controlled by a phosphorylation and dephosphorylation mechanism. Manipulation of cyclic AMP content did not alter the cellular cholesterol esterification, suggesting that cyclic AMP is not a bioregulator in this case. Therefore, the authors tested the effect of phorbol-12-myristate 13-acetate (PMA) on cellular cholesterol esterification to determine the involvement of protein kinase C. PMA has a potent effect on cellular cholesterol esterification. PMA depresses cholesterol esterification initially, but cells recover from inhibition and the result was higher cholesterol esterification, suggesting dual effects of protein kinase C. Studies of other phorbol analogues and other protein kinase C activators such as merezein indicate the involvement of protein kinase C. Oleoyl-acetyl glycerol duplicates the effect of PMA. This observation is consistent with a diacyl-glycerol-protein kinase-dependent reaction. Calcium ionophore A23187 was ineffective in promoting the effect of PMA. They concluded that a calcium-independent and protein C-dependent pathway regulated glial cholesterol esterification.

Jeng, I.; Dills, C.; Klemm, N.; Wu, C.

1986-05-01

299

Absence of an effect of the lithium-induced increase in cyclic GMP on the cyclic GMP-stimulated phosphodiesterase (PDE II). Evidence for cyclic AMP-specific hydrolysis  

Microsoft Academic Search

Chronic treatment of rats with LiCl is known to induce a decrease in cAMP, while this decrease has also been found to occur together with both a simultaneous increase in total cortical phosphodiesterase (PDE; EC 3.1.4.17) activity and a concomitant increase in cGMP. These studies have implicated an involvement of PDE in lithium (Li+) action and it has been suggested

Brian Harvey; Machteld Carstens; Joshua Taljaard

1993-01-01

300

Neuronal Activity Controls the Antagonistic Balance Between Peroxisome Proliferator-Activated Receptor-? Coactivator-1? and Silencing Mediator of Retinoic Acid and Thyroid Hormone Receptors in Regulating Antioxidant Defenses  

PubMed Central

Abstract Transcriptional coactivators and corepressors often have multiple targets and can have opposing actions on transcription and downstream physiological events. The coactivator peroxisome proliferator-activated receptor-? coactivator (PGC)-1? is under-expressed in Huntington's disease and is a regulator of antioxidant defenses and mitochondrial biogenesis. We show that in primary cortical neurons, expression of PGC-1? strongly promotes resistance to excitotoxic and oxidative stress in a cell autonomous manner, whereas knockdown increases sensitivity. In contrast, the transcriptional corepressor silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) specifically antagonizes PGC-1?-mediated antioxidant effects. The antagonistic balance between PGC-1? and SMRT is upset in favor of PGC-1? by synaptic activity. Synaptic activity triggers nuclear export of SMRT reliant on multiple regions of the protein. Concommitantly, synaptic activity post-translationally enhances the transactivating potential of PGC-1? in a p38-dependent manner, as well as upregulating cyclic-AMP response element binding protein-dependent PGC-1? transcription. Activity-dependent targeting of PGC-1? results in enhanced gene expression mediated by the thyroid hormone receptor, a prototypical transcription factor coactivated by PGC-1? and repressed by SMRT. As a consequence of these events, SMRT is unable to antagonize PGC-1?-mediated resistance to oxidative stress in synaptically active neurons. Thus, PGC-1? and SMRT are antagonistic regulators of neuronal vulnerability to oxidative stress. Further, this coactivator–corepressor antagonism is regulated by the activity status of the cell, with implications for neuronal viability. Antioxid. Redox Signal. 14, 1425–1436. PMID:20849372

Soriano, Francesc X.; Leveille, Frederic; Papadia, Sofia; Bell, Karen F.S.; Puddifoot, Clare

2011-01-01

301

Active thermal isolation for temperature responsive sensors  

NASA Astrophysics Data System (ADS)

The detection of flow transition between laminar and turbulent flow and of shear stress or skin friction of airfoils is important in basic research for validation of airfoil theory and design. These values are conventionally measured using hot film nickel sensors deposited on a polyimide substrate. The substrate electrically insulates the sensor and underlying airfoil but is prevented from thermally isolating the sensor by thickness constraints necessary to avoid flow contamination. Proposed heating of the model surface is difficult to control, requires significant energy expenditures, and may alter the basic flow state of the airfoil. A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specific surface of the body. The total thickness of the isolator and sensor avoid any contamination of the flow. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes (1) operating the isolator at the same temperature as the constant temperature of the sensor; and (2) establishing a fixed boundary temperature which is either less than or equal to, or slightly greater than the sensor constant temperature. The present invention accordingly thermally isolates a temperature responsive sensor in an energy efficient, controllable manner while avoiding any contamination of the flow.

Martinson, Scott D.; Gray, David L.; Carraway, Debra L.; Reda, Daniel C.

1994-05-01

302

Active thermal isolation for temperature responsive sensors  

NASA Astrophysics Data System (ADS)

The detection of flow transition between laminar and turbulent flow and of shear stress or skin friction of airfoils is important in basic research for validation of airfoil theory and design. These values are conventionally measured using hot film nickel sensors deposited on a polyimide substrate. The substrate electrically insulates the sensor and underlying airfoil but is prevented from thermally isolating the sensor by thickness constraints necessary to avoid flow contamination. Proposed heating of the model surface is difficult to control, requires significant energy expenditures, and may alter the basic flow state of the airfoil. A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specific surface of the body. The total thickness of the isolator and sensor avoid any contamination of the flow. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes (1) operating the isolator at the same temperature as the constant temperature of the sensor; and (2) establishing a fixed boundary temperature which is either (a) less than or equal to or (b) slightly greater than the sensor constant temperature. The present invention accordingly thermally isolates a temperature responsive sensor in an energy efficient, controllable manner while avoiding any contamination of the flow.

Martinson, Scott D.; Gray, David L.; Carraway, Debra L.; Reda, Daniel C.

1992-01-01

303

TGF-betas upregulate NCAM and L1 expression in cultured Schwann cells, suppress cyclic AMP-induced expression of O4 and galactocerebroside, and are widely expressed in cells of the Schwann cell lineage in vivo.  

PubMed

We have examined both how the molecular phenotype of Schwann cells in vitro is regulated by transforming growth factor beta (TGF-beta), using immunohistochemistry and immunoblotting, and the distribution of TGF-beta 2 and 3 in embryonic and mature nerves and ganglia, using immunohistochemistry and in situ hybridisation. We find that TGF-beta 2 and -3 upregulate expression of the neural cell adhesion molecules NCAM and L1. In TGF-beta-treated cultures, in addition to the 140 and 120 kD isoforms known to be present in Schwann cells, small amounts of the 180 kD isoform can be detected. TGF-beta s also block cAMP-induced expression of the lipid antigens galactocerebroside (GalC) and O4, in addition to blocking expression of protein zero (P0), the major peripheral myelin glycoprotein, as previously shown. Using antibodies specific to TGF-beta 2 and -3, respectively, we confirm the presence of these proteins in myelin-forming Schwann cells and show also that TGF-beta 2 and -3 are clearly expressed by peripheral glia that are not involved in myelination. This includes Schwann cell precursors, embryonic Schwann cells, non-myelin-forming Schwann cells and satellite cells from adult nerves and ganglia, and neonatal Schwann cells in purified cultures without neurones. In situ hybridisation with a digoxygenin-labelled riboprobe reveals a strong TGF-beta 3 mRNA signal in Schwann cells, satellite cells, and some neurones. Schwann cells in culture also secrete TGF-beta in a latent form, whereas purified cultures of dorsal root ganglion neurones from 1-day-old rats secrete active TGF beta during the first 48 h in culture. PMID:8926036

Stewart, H J; Rougon, G; Dong, Z; Dean, C; Jessen, K R; Mirsky, R

1995-12-01

304

Transcription Activation by the DNA-Binding Domain of the AraC Family Protein RhaS in the Absence of Its Effector-Binding Domain?  

PubMed Central

The Escherichia coli l-rhamnose-responsive transcription activators RhaS and RhaR both consist of two domains, a C-terminal DNA-binding domain and an N-terminal dimerization domain. Both function as dimers and only activate transcription in the presence of l-rhamnose. Here, we examined the ability of the DNA-binding domains of RhaS (RhaS-CTD) and RhaR (RhaR-CTD) to bind to DNA and activate transcription. RhaS-CTD and RhaR-CTD were both shown by DNase I footprinting to be capable of binding specifically to the appropriate DNA sites. In vivo as well as in vitro transcription assays showed that RhaS-CTD could activate transcription to high levels, whereas RhaR-CTD was capable of only very low levels of transcription activation. As expected, RhaS-CTD did not require the presence of l-rhamnose to activate transcription. The upstream half-site at rhaBAD and the downstream half-site at rhaT were found to be the strongest of the known RhaS half-sites, and a new putative RhaS half-site with comparable strength to known sites was identified. Given that cyclic AMP receptor protein (CRP), the second activator required for full rhaBAD expression, cannot activate rhaBAD expression in a ?rhaS strain, it was of interest to test whether CRP could activate transcription in combination with RhaS-CTD. We found that RhaS-CTD allowed significant activation by CRP, both in vivo and in vitro, although full-length RhaS allowed somewhat greater CRP activation. We conclude that RhaS-CTD contains all of the determinants necessary for transcription activation by RhaS. PMID:17513476

Wickstrum, Jason R.; Skredenske, Jeff M.; Kolin, Ana; Jin, Ding J.; Fang, Jianwen; Egan, Susan M.

2007-01-01

305

Active maturation-promoting factor is present in mature mouse oocytes  

PubMed Central

Cytoplasmic extracts of meiotically mature mouse oocytes were injected into immature Xenopus laevis oocytes, which underwent germinal vesicle breakdown within 2 h. Germinal vesicle breakdown was not inhibited by incubation of the Xenopus oocytes in cycloheximide (20 micrograms/ml). Identically prepared extracts of meiotically immature mouse oocytes, arrested at the germinal vesicle stage by dibutyryl cyclic AMP (100 micrograms/ml), did not induce germinal vesicle breakdown in Xenopus oocytes. The results show that maturation-promoting factor activity appears during the course of oocyte maturation in the mouse. PMID:3886670

1985-01-01

306

Evidence that M1 muscarinic receptors enhance noradrenaline release in mouse atria by activating protein kinase C.  

PubMed Central

1. The M1 selective muscarinic agonist, McNeil A 343, enhanced the electrically evoked release of noradrenaline from postganglionic sympathetic nerves in mouse atria. This has been found previously to be due to activation of muscarinic receptors of the M1 subtype, probably located on sympathetic nerve terminals. The present study investigated the signal transduction mechanisms involved in the release-enhancing effects of McNeil A 343. The release of noradrenaline from mouse atria was assessed by measuring the electrically-induced (3 Hz, 60 s) outflow of radioactivity from atria which had been pre-incubated with [3H]-noradrenaline. 2. 8-Bromo cyclic AMP in the presence of IBMX was used to enhance maximally S-I noradrenaline release through cyclic AMP-dependent mechanisms. However, the facilitatory effect of McNeil A 343 (10 microM) was not different from the effect in the absence of these drugs, suggesting that McNeil A 343 enhances noradrenaline release independently of the cyclic AMP system. Furthermore, the release-enhancing effect of McNeil A 343 (10 microM) on noradrenaline release was also not altered by the 5-lipoxygenase inhibitor, BW A4C. 3. The facilitatory effect of McNeil A 343 was not altered in the presence of drugs (trifluoperazine, W7, and calmidazolium) which inhibit calmodulin-dependent processes, suggesting that the mechanisms of action of McNeil A 343 does not depend on calmodulin. 4. It was considered likely that the facilitatory effect of McNeil A 343 on noradrenaline release may be due to activation of protein kinase C, since activators of protein kinase C enhance noradrenaline release.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7694761

Costa, M.; Barrington, M.; Majewski, H.

1993-01-01

307

Hypothesis: cyclic AMP turnover in S49 cells  

SciTech Connect

The fractional turnover constant (ke) of cAMP in S49 lymphoma cells stimulated by epinephrine was essentially identical to the decay constant for cAMP in these cells. This was in sharp distinction to the situation in the human diploid lung fibroblast WI-38, in which ke was much lower in hormone stimulated cells. In this study we report a new method for the determination of cAMP turnover. The method was based on the assumption that for tritium label to be incorporated into cAMP on treatment of cells with (/sup 3/H)-adenine, the label must first pass through ATP. An equation relating the rate of change in cAMP specific radioactivity with cAMP and ATP specific radioactivities was thereby determined. The equation was expressed in a form that gave a linear graphical plot with the fractional turnover constant as the slope of the line.

Barber, R.; Goka, T.J.

1981-01-01

308

SHORT COMMUNICATION The identification of novel cyclic AMP-dependent  

E-print Network

proteins using bioinformatic filters and peptide arrays William A.McLaughlin1,7, Tingjun Hou2, Susan S University, Suzhou 215123, People's Republic of China, 3 Department of Chemistry and Biochemistry, 4 Howard, and the top candidates were tested for an interaction using peptide array experiments. Verified interactions

Wang, Wei

309

Chemosensory responses by the heterotrophic marine dinoflagellateCrypthecodinium cohnii.  

PubMed

Chemosensory responses by the colorles inshore marine dinoflagellateCrypthecodinium cohnii were observed in quadrant-divided Petri plates containing an agar layer + liquid overlay. A suspension of organisms in salt solution was poured onto this and allowed to stand 3 hr. A differential tendency of the cells to become firmly attached or embedded in the substratum was observed when various substances were incorporated in the gel. A positive response (tendency to attach) occurred with: ?-L-fucose, dimethyl-?-propiothetin, betaine, sucrose, glycine, L-alanine, hemin, and fructose; negative response: formalin, glutathione, acid hydrolyzed agar, protamine SO4, L-glutamic acid, lactose, glutamine, taurine, L-aspartic acid, putrescine 2 HCl, choline citrate, choline bitartrate, K citrate, and choline HCl. ?-Aminobutyric acid was negative or positive dependeng on concentration. Dead or immotile cells did not become attached. The following compounds elicited no response: ?-D-fucose, dimethyl acetothetin chloride, cyclic AMP, and glucose. PMID:24241032

Hauser, D C; Levandowsky, M; Hutner, S H; Chunosoff, L; Hollwitz, J S

1974-12-01

310

Identification of a cAMP-response Element in the Regulator of G-protein Signaling-2 (RGS2) Promoter as a Key Cis-regulatory Element for RGS2 Transcriptional Regulation by Angiotensin II in Cultured Vascular Smooth Muscles*  

PubMed Central

Mice deficient in regulator of G-protein signaling-2 (RGS2) have severe hypertension, and RGS2 genetic variations occur in hypertensive humans. A potentially important negative feedback loop in blood pressure homeostasis is that angiotensin II (Ang II) increases vascular smooth muscle cell (VSMC) RGS2 expression. We reported that Group VIA phospholipase A2 (iPLA2?) is required for this response (Xie, Z., Gong, M. C., Su, W., Turk, J., and Guo, Z. (2007) J. Biol. Chem. 282, 25278–25289), but the specific molecular causes and consequences of iPLA2? activation are not known. Here we demonstrate that both protein kinases C (PKC) and A (PKA) participate in Ang II-induced VSMC RGS2 mRNA up-regulation, and that actions of PKC and PKA precede and follow iPLA2? activation, respectively. Moreover, we identified a conserved cAMP-response element (CRE) in the murine RGS2 promoter that is critical for cAMP-response element-binding protein (CREB) binding and RGS2 promoter activation. Forskolin-stimulated RGS2 mRNA up-regulation is inhibited by CREB sequestration or specific disruption of the CREB-RGS2 promoter interaction, and Ang II-induced CREB phosphorylation and nuclear localization are blocked by iPLA2? pharmacologic inhibition or genetic ablation. Ang II-induced intracellular cyclic AMP accumulation precedes CREB phosphorylation and is diminished by inhibiting iPLA2, cyclooxygenase, or lipoxygenase. Moreover, three single nucleotide polymorphisms identified in hypertensive patients are located in the human RGS2 promoter CREB binding site. Point mutations corresponding to these single nucleotide polymorphisms interfere with stimulation of human RGS2 promoter activity by forskolin. Our studies thus delineate a negative feedback loop to attenuate Ang II signaling in VSMC with potential importance in blood pressure homeostasis and the pathogenesis of human essential hypertension. PMID:22057271

Xie, Zhongwen; Liu, Dexiang; Liu, Shu; Calderon, Lindsay; Zhao, Guogang; Turk, John; Guo, Zhenheng

2011-01-01

311

Early transcutaneous electrical nerve stimulation reduces hyperalgesia and decreases activation of spinal glial cells in mice with neuropathic pain.  

PubMed

Although transcutaneous electrical nerve stimulation (TENS) is widely used for the treatment of neuropathic pain, its effectiveness and mechanism of action in reducing neuropathic pain remain uncertain. We investigated the effects of early TENS (starting from the day after surgery) in mice with neuropathic pain, on hyperalgesia, glial cell activation, pain transmission neuron sensitization, expression of proinflammatory cytokines, and opioid receptors in the spinal dorsal horn. Following nerve injury, TENS and behavioral tests were performed every day. Immunohistochemical, immunoblot, and flow cytometric analysis of the lumbar spinal cord were performed after 8 days. Early TENS reduced mechanical and thermal hyperalgesia and decreased the activation of microglia and astrocytes (P<0.05). In contrast, the application of TENS at 1 week (TENS-1w) or 2 weeks (TENS-2w) after injury was ineffective in reducing hyperalgesia (mechanical and thermal) or activation of microglia and astrocytes. Early TENS decreased p-p38 within microglia (P<0.05), the expression levels of protein kinase C (PKC-?), and phosphorylated anti-phospho-cyclic AMP response element-binding protein (p-CREB) in the superficial spinal dorsal horn neurons (P<0.05), mitogen-activated protein (MAP) kinases, and proinflammatory cytokines, and increased the expression levels of opioid receptors (P<0.05). The results suggested that the application of early TENS relieved hyperalgesia in our mouse model of neuropathic pain by inhibiting glial activation, MAP kinase activation, PKC-?, and p-CREB expression, and proinflammatory cytokines expression, as well as maintenance of spinal opioid receptors. The findings indicate that TENS treatment is more effective when applied as early after nerve injury as possible. PMID:25010326

Matsuo, Hideaki; Uchida, Kenzo; Nakajima, Hideaki; Guerrero, Alexander Rodriguez; Watanabe, Shuji; Takeura, Naoto; Sugita, Daisuke; Shimada, Seiichiro; Nakatsuka, Terumasa; Baba, Hisatoshi

2014-09-01

312

Desensitization of enucleated cells to hormones and role of cytoskeleton in control of normal hormonal response.  

PubMed Central

Prostaglandin E1 and the beta-adrenergic hormone l-isoproterenol stimulated cyclic AMP formation in both nucleated and enucleated myeloid leukemic cells that could be induced to differentiate normally to mature cells by the macrophage- and granulocyte-inducing protein MGI (MGI+D+ cells). Enucleated as well as nucleated MGI+D+ cells also desensitized to these hormones, indicating that this desensitization is an extranuclear process. Nucleated or enucleated mutant myeloid leukemic cells that are not induced to differentiate (MGI-D- cells) were not desensitized to these hormones. The antitubulin alkaloids colchicine and vinblastine, but not the antimicrofilament compound cytochalasin B, increased the maximal hormone-induced formation of cyclic AMP in nucleated MGI+D+ cells but not in the MGI-D- cells. These alkaloids also inhibited the development of desensitization to l-isoproterenol and prostaglandin E1 in enucleated MGI+D+ cells. The results indicate that in MGI+D+ cells the cytoskeletal system puts constraints on the cells' ability to respond to these hormones and that these constraints are absent in the mutant MGI-D- cells. Because MGI+D+ but not MGI-D- cells can be induced to differentiate by the macrophage- and granulocyte-inducing protein, cytoskeletal constraints, which are also found in normal myeloid cells, may be necessary for cell competence to differentiate. The results support the suggestion that membrane cytoskeletal constraints generate may control the normal response and desensitization to membrane-mediated cell inducers. PMID:6254040

Simantov, R; Shkolnik, T; Sachs, L

1980-01-01

313

Interplay between Cyclic AMP-Cyclic AMP Receptor Protein and Cyclic di-GMP Signaling in Vibrio cholerae Biofilm Formation  

Microsoft Academic Search

Vibrio cholerae is a facultative human pathogen. The ability of V. cholerae to form biofilms is crucial for its survival in aquatic habitats between epidemics and is advantageous for host-to-host transmission during epidemics. Formation of mature biofilms requires the production of extracellular matrix components, includ- ing Vibrio polysaccharide (VPS) and matrix proteins. Biofilm formation is positively controlled by the tran-

Jiunn C. N. Fong; Fitnat H. Yildiz

2008-01-01

314

Increased pancreatic beta-cell proliferation mediated by CREB binding protein gene activation.  

PubMed

The cyclic AMP (cAMP) signaling pathway is central in beta-cell gene expression and function. In the nucleus, protein kinase A (PKA) phosphorylates CREB, resulting in recruitment of the transcriptional coactivators p300 and CREB binding protein (CBP). CBP, but not p300, is phosphorylated at serine 436 in response to insulin action. CBP phosphorylation disrupts CREB-CBP interaction and thus reduces nuclear cAMP action. To elucidate the importance of the cAMP-PKA-CREB-CBP pathway in pancreatic beta cells specifically at the nuclear level, we have examined mutant mice lacking the insulin-dependent phosphorylation site of CBP. In these mice, the CREB-CBP interaction is enhanced in both the absence and presence of cAMP stimulation. We found that islet and beta-cell masses were increased twofold, while pancreas weights were not different from the weights of wild-type littermates. beta-Cell proliferation was increased both in vivo and in vitro in isolated islet cultures. Surprisingly, glucose-stimulated insulin secretion from perfused, isolated mutant islets was reduced. However, beta-cell depolarization with KCl induced similar levels of insulin release from mutant and wild-type islets, indicating normal insulin synthesis and storage. In addition, transcripts of pgc1a, which disrupts glucose-stimulated insulin secretion, were also markedly elevated. In conclusion, sustained activation of CBP-responsive genes results in increased beta-cell proliferation. In these beta cells, however, glucose-stimulated insulin secretion was diminished, resulting from concomitant CREB-CBP-mediated pgc1a gene activation. PMID:16908541

Hussain, Mehboob A; Porras, Delia L; Rowe, Matthew H; West, Jason R; Song, Woo-Jin; Schreiber, Weston E; Wondisford, Fredric E

2006-10-01

315

Transplantation of Human Pericyte Progenitor Cells Improves the Repair of Infarcted Heart Through Activation of an Angiogenic Program Involving Micro-RNA-132  

PubMed Central

Rationale Pericytes are key regulators of vascular maturation, but their value for cardiac repair remains unknown. Objective We investigated the therapeutic activity and mechanistic targets of saphenous vein-derived pericyte progenitor cells (SVPs) in a mouse myocardial infarction (MI) model. Methods and Results SVPs have a low immunogenic profile and are resistant to hypoxia/starvation (H/S). Transplantation of SVPs into the peri-infarct zone of immunodeficient CD1/Foxn-1nu/nu or immunocompetent CD1 mice attenuated left ventricular dilatation and improved ejection fraction compared to vehicle. Moreover, SVPs reduced myocardial scar, cardiomyocyte apoptosis and interstitial fibrosis, improved myocardial blood flow and neovascularization, and attenuated vascular permeability. SVPs secrete vascular endothelial growth factor A, angiopoietin-1, and chemokines and induce an endogenous angiocrine response by the host, through recruitment of vascular endothelial growth factor B expressing monocytes. The association of donor- and recipient-derived stimuli activates the proangiogenic and prosurvival Akt/eNOS/Bcl-2 signaling pathway. Moreover, microRNA-132 (miR-132) was constitutively expressed and secreted by SVPs and remarkably upregulated, together with its transcriptional activator cyclic AMP response element-binding protein, on stimulation by H/S or vascular endothelial growth factor B. We next investigated if SVP-secreted miR-132 acts as a paracrine activator of cardiac healing. In vitro studies showed that SVP conditioned medium stimulates endothelial tube formation and reduces myofibroblast differentiation, through inhibition of Ras-GTPase activating protein and methyl-CpG-binding protein 2, which are validated miR-132 targets. Furthermore, miR-132 inhibition by antimiR-132 decreased SVP capacity to improve contractility, reparative angiogenesis, and interstitial fibrosis in infarcted hearts. Conclusion SVP transplantation produces long-term improvement of cardiac function through a novel paracrine mechanism involving the secretion of miR-132 and inhibition of its target genes. PMID:21868695

Katare, Rajesh; Riu, Federica; Mitchell, Kathryn; Gubernator, Miriam; Campagnolo, Paola; Cui, Yuxin; Fortunato, Orazio; Avolio, Elisa; Cesselli, Daniela; Beltrami, Antonio Paolo; Angelini, Gianni; Emanueli, Costanza; Madeddu, Paolo

2013-01-01

316

Activation of codependent transcription factors is required for transcriptional induction of the vgf gene by nerve growth factor and Ras.  

PubMed Central

Nerve growth factor (NGF) treatment of PC12 cells leads to the elaboration of a neuronal phenotype, including the induction of neuronally expressed genes such as vgf. To study vgf transcription, we have created chimeric vgf/beta-globin genes in which vgf promoter sequences drive the expression of the beta-globin reporter gene or of a chimeric beta-globin gene fused to 3' untranslated vgf gene sequences. We have found that the level of inducibility of the latter construct by NGF resembles that of the endogenous vgf gene. Using transient transfection of the chimeric reporter genes into PC12 cells, into PC12 subclones expressing activated or dominantly interfering mutant Ras proteins, and into PC12 variants expressing specific NGF receptor/Trk mutants, we show that transcriptional regulation of the vgf promoter by NGF is mediated through a Ras-dependent signaling pathway. By mutational analysis of the vgf promoter, we have identified three promoter elements involved in mediating transcriptional induction by NGF and Ras. In addition to the cyclic AMP-responsive element (CRE), which binds to ATF-1, ATF-2, and CRE-binding protein in PC12 nuclear extracts, a novel CCAAT element and its binding proteins were identified, which, like the CRE, is necessary but not sufficient for the Ras-dependent induction of the vgf gene by NGF. We also identify a G(S)G element unusually located between the TATA box and transcriptional start site, which binds the NGF- and Ras-induced transcription factor, NGFI-A, and amplifies the transcriptional response. Integrating data from studies of vgf promoter regulation and NGF signal transduction, we present a model for vgf gene induction in which transcriptional activation is achieved through the persistent, direct activation of multiple interacting transcription factors binding to CRE and CCAAT elements, coordinated with the delayed transcription factor action at a G(S)G element resulting from the induced expression of NGFI-A. PMID:8756618

D'Arcangelo, G; Habas, R; Wang, S; Halegoua, S; Salton, S R

1996-01-01

317

Dehydroepiandrosterone sulfate mediates activation of transcription factors CREB and ATF-1 via a G?11-coupled receptor in the spermatogenic cell line GC-2.  

PubMed

Dehydroepiandrosterone sulfate (DHEAS) is a circulating steroid produced in the adrenal cortex, brain, and gonads. Whereas a series of investigations attest to neuroprotective effects of the steroid in the brain, surprisingly little is known about the physiological effects of DHEAS on cells of the reproductive system. Here we demonstrate that DHEAS acting on the spermatogenic cell line GC-2 induces a time- and concentration-dependent phosphorylation of c-Src and Erk1/2 and activates the transcription factors activating transforming factor-1 (ATF-1) and cyclic AMP-responsive element binding protein (CREB). These actions are consistent with the non-classical signaling pathway of testosterone and suggest that DHEAS is a pro-androgen that is converted into testosterone in order to exert its biological activity. The fact, however, that steroid sulfatase mRNA was not detected in the GC-2 cells and the clear demonstration of DHEAS-induced activation of Erk1/2, ATF-1 and CREB after silencing the androgen receptor by small interfering RNA (siRNA) clearly contradict this assumption and make it appear unlikely that DHEAS has to be converted in the cytosol into a different steroid in order to activate the kinases and transcription factors mentioned. Instead, it is likely that the DHEAS-induced signaling is mediated through the interaction of the steroid with a membrane-bound G-protein-coupled receptor, since silencing of Guanine nucleotide-binding protein subunit alpha-11 (Gn?11) leads to the abolition of the DHEAS-induced stimulation of Erk1/2, ATF-1, and CREB. The investigation presented here shows a hormone-like activity of DHEAS on a spermatogenic cell line. Since DHEAS is produced in male and female reproductive organs, these findings could help to define new roles for DHEAS in the physiology of reproduction. PMID:23988737

Shihan, Mazen; Kirch, Ulrike; Scheiner-Bobis, Georgios

2013-12-01

318

Structure-activity relationship studies of naphthol AS-E and its derivatives as anticancer agents by inhibiting CREB-mediated gene transcription  

PubMed Central

CREB (cyclic AMP-response element binding protein) is a downstream transcription factor of a multitude of signaling pathways emanating from receptor tyrosine kinases or G-protein coupled receptors. CREB is not activated until it is phosphorylated at Ser133 and its subsequent binding to CREB-binding protein (CBP) through kinase-inducible domain (KID) in CREB and KID-interacting (KIX) domain in CBP. Tumor tissues from various organs present higher level of expression and activation of CREB. Thus CREB has been proposed as a promising cancer drug target. We previously described naphthol AS-E (1a) as a small molecule inhibitor of CREB-mediated gene transcription in living cells. Here we report the structure–activity relationship (SAR) studies of 1a by modifying the appendant phenyl ring. All the compounds were evaluated for in vitro inhibition of KIX–KID interaction, cellular inhibition of CREB-mediated gene transcription and inhibition of proliferation of four cancer cell lines (A549, MCF-7, MDA-MB-231 and MDA-MB-468). SAR indicated that a small and electron-withdrawing group was preferred at the para-position for KIX–KID interaction inhibition. Compound 1a was selected for further biological characterization and it was found that 1a down-regulated the expression of endogenous CREB target genes. Expression of a constitutively active CREB mutant, VP16-CREB in MCF-7 cells rendered the cells resistant to 1a, suggesting that CREB was critical in mediating its anticancer activity. Furthermore, 1a was not toxic to normal human cells. Collectively, these data support that 1a represents a structural template for further development into potential cancer therapeutics with a novel mechanism of action. PMID:23102993

Li, Bingbing X.; Yamanaka, Kinrin; Xiao, Xiangshu

2012-01-01

319

Stimulus-response compatibility and automatic response activation: Evidence from psychophysiological studies  

Microsoft Academic Search

Effects of dimensional overlap between stimuli and responses on partial response activation were investigated within a priming paradigm with the help of event-related potentials. The likely position of a target stimulus (requiring a left or a right reaction) was indicated by an arrow precue. To test whether automatic response activation processes are triggered by the cue, the lateralized readiness potential

Martin Eimer

1995-01-01

320

ACTIVATING TEACHING METHODS, STUDYING RESPONSES AND LEARNING  

Microsoft Academic Search

Students' study strategies when exposed to activating teaching methods are meas- ured, analysed and compared to study strategies in more traditional lecture-based teaching. The resulting learning outcome is discussed. Workshop topic Beyond active learning

Hans Peter Christensen; Martin E. Vigild; Erik V. Thomsen; Peter Szabo; Andy Horsewell; DTU Nanotech

321

Changes in Responsiveness of the \\/?Adrenergic and Serotonergic Pathways of the Rabbit Corneal Epithelium  

Microsoft Academic Search

Adrenergic agonists stimulate the synthesis of cyclic AMP by incubated rabbit corneas with the following order of potency: isoproterenol > epinephrine > norepinephrine. These agonists have the same order of potency when displacing the specific, \\/3-adrenergic radioligand, 3 H-dihydroalprenolol, from \\/8-adrenergic receptors on membranes prepared from corneal epithelium. At another locus, serotonin stimulates cyclic AMP synthesis. Inhibition of stimulation in

Arthur H. Neufeld; Sally E. Ledgord; Barbara K. Yoza

1983-01-01

322

Characteristics of a 5-hydroxytryptamine-sensitive adenylate cyclase in intact and intracellularly perfused squid axons.  

PubMed Central

1. Cyclic AMP metabolism was studied in intact and intracellularly perfused axons. 2. Cyclic AMP content of intact axons lay within the range 10-100 nmol kg-1 axoplasm. This was increased by exposure to caffeine (2-fold) and to 5-HT (15-fold). The caffeine-sensitive cyclic AMP increase was 30-fold larger in the presence of 5-HT. 3. A reduction in sodium concentration from the sea water bathing intact axons attenuated the 5-HT-evoked increase in cyclic AMP content, but had little effect on resting cyclic AMP. This effect was partially reversed by exclusion of external calcium, and suggests that free calcium plays a role in cyclic AMP homeostasis. 4. Prolonged exposure of intact axons to 5-HT (up to 3 h) led to apparent desensitization of the cyclic AMP response. 5. Intracellular perfusion can be used as a method to study adenylate cyclase in a single axon, simply by measuring the cyclic AMP content of the emerging perfusate. 6. Intracellular perfusion revealed micromolar requirements for internal GTP (K0.5 approximately 1-10 microM) and external 5-HT (K0.5 approximately 1-10 microM); a detailed investigation of this observation was limited due to the progressive loss of 5-HT-evoked adenylate cyclase activity with time. This slow loss was not seen during Gpp(NH)p (guanylylimidodiphosphate), NaF or forskolin activation of cyclase activity. 7. In perfused axons, an increase in intracellular calcium stimulated cyclase activated by 100 microM-forskolin but inhibited cyclase activated by 500 microM-Gpp(NH)p or 10 mM-NaF. A reduction in intracellular magnesium from 10 to 4-5 mM attenuated the effects of 5-HT-evoked cyclase activity. 8. Study of the perfused axon allows characterization of the intracellular requirements of a plasmalemmal transduction system which activates adenylate cyclase, whilst maintaining ionic asymmetry across the cell membrane. PMID:2561784

Allen, T J

1989-01-01

323

An Unliganded Thyroid Hormone ? Receptor Activates the Cyclin D1/Cyclin-Dependent Kinase/Retinoblastoma/E2F Pathway and Induces Pituitary Tumorigenesis  

PubMed Central

Thyroid-stimulating hormone (TSH)-secreting tumors (TSH-omas) are pituitary tumors that constitutively secrete TSH. The molecular genetics underlying this abnormality are not known. We discovered that a knockin mouse harboring a mutated thyroid hormone receptor (TR) ? (PV; TR?PV/PV mouse) spontaneously developed TSH-omas. TR?PV/PV mice lost the negative feedback regulation with highly elevated TSH levels associated with increased thyroid hormone levels (3,3?,5-triiodo-l-thyronine [T3]). Remarkably, we found that mice deficient in all TRs (TR?1?/? TR??/?) had similarly increased T3 and TSH levels, but no discernible TSH-omas, indicating that the dysregulation of the pituitary-thyroid axis alone is not sufficient to induce TSH-omas. Comparison of gene expression profiles by cDNA microarrays identified overexpression of cyclin D1 mRNA in TR?PV/PV but not in TR?1?/? TR??/? mice. Overexpression of cyclin D1 protein led to activation of the cyclin D1/cyclin-dependent kinase/retinoblastoma protein/E2F pathway only in TR?PV/PV mice. The liganded TR? repressed cyclin D1 expression via tethering to the cyclin D1 promoter through binding to the cyclic AMP response element-binding protein. That repression effect was lost in mutant PV, thereby resulting in constitutive activation of cyclin D1 in TR?PV/PV mice. The present study revealed a novel molecular mechanism by which an unliganded TR? mutant acts to contribute to pituitary tumorigenesis in vivo and provided mechanistic insights into the understanding of pathogenesis of TSH-omas in patients. PMID:15601836

Furumoto, Hiroko; Ying, Hao; Chandramouli, G. V. R.; Zhao, Li; Walker, Robert L.; Meltzer, Paul S.; Willingham, Mark C.; Cheng, Sheue-Yann

2005-01-01

324

Caffeine induces beneficial changes in PKA signaling and JNK and ERK activities in the striatum and cortex of Alzheimer's transgenic mice.  

PubMed

Caffeine intake has been associated with a lower incidence of Alzheimer's disease (AD) in humans. In AD mouse models, caffeine significantly decreases senile plaques and amyloid beta (A?) levels while also protecting against or reversing cognitive impairment. To understand the mechanism(s) underlying the protective effects of caffeine against AD pathology, we investigated the effects of a two-week treatment with caffeine (3mg/day) in transgenic (APPswe) mice and non-transgenic (NT) mice on signaling factors involved in neuronal plasticity and survival. We evaluated cAMP-dependent protein kinase A (PKA), phospho-cyclic AMP response-element binding protein (phospho-CREB), and the pro-apoptotic protein kinases extracellular signal-regulated kinase 1/2 (phospho-ERK) and phospho-c-Jun N-terminal kinase 1 (phospho-JNK) in the striatum and frontal cortex of caffeine-treated mice. In the striatum, APPswe control mice exhibited a significant decrease in phospho-CREB, as well as significant increases in phospho-JNK and phospho-ERK in comparison to NT mice. Caffeine treatment stimulated PKA activity, increased phospho-CREB levels, and decreased phospho-JNK and phospho-ERK expression in the striatum of APPswe mice, all of which are thought to be beneficial changes for brain function. Even caffeine-treated NT mice exhibited some of these changes in striatum. In the frontal cortex, caffeine did not significantly increase phospho-CREB and PKA activity, but significantly reduced phospho-JNK and phospho-ERK expression in both APPswe and NT mice. These results suggest that caffeine shifts the balance between neurodegeneration and neuronal survival toward the stimulation of pro-survival cascades and inhibition of pro-apoptotic pathways in the striatum and/or cortex, which may contribute to its beneficial effects against AD. PMID:21907331

Zeitlin, Ross; Patel, Sagar; Burgess, Sarah; Arendash, Gary W; Echeverria, Valentina

2011-10-12

325

The relationship between the agonist-induced activation and desensitization of the human tachykinin NK2 receptor expressed in Xenopus oocytes  

PubMed Central

Repeated applications of neurokinin?A (NKA) to oocytes injected with 25?ng wild-type hNK2 receptor cRNA caused complete attenuation of second and subsequent NKA-induced responses while analogous experiments using repeated applications of GR64349 and [Nle10]NKA(4–10) resulted in no such desensitization. This behaviour has been previously attributed to the ability of the different ligands to stabilize different active conformations of the receptor that have differing susceptibilities to receptor kinases (Nemeth & Chollet, 1995).However, for Xenopus oocytes injected (into the nucleus) with 10?ng wild-type hNK2 receptor cDNA, a single 100?nM concentration of any of the three ligands resulted in complete desensitization to further concentrations.On the other hand, none of the ligands caused any desensitization in oocytes injected with 0.25?ng wild-type hNK2 receptor cRNA, even at concentrations up to 10??M.The two N-terminally truncated analogues of neurokinin?A have a lower efficacy than NKA and it is likely that it is this property which causes the observed differences in desensitization, rather than the formation of alternative active states of the receptor.The peak calcium-dependent chloride current is not a reliable measure of maximal receptor stimulation and efficacy is better measured in this system by studying agonist-induced desensitization.The specific adenylyl cyclase inhibitor SQ22536 can enhance NKA and GR64349-mediated desensitization which suggests that agonist-induced desensitization involves the inhibition of adenylyl cyclase and the subsequent down-regulation of the cyclic AMP-dependent protein kinase, possibly by cross-talk to a second signalling pathway. PMID:9690859

Maudsley, S; Gent, J P; Findlay, J B C; Donnelly, D

1998-01-01

326

P-glycoprotein activity and biological response  

SciTech Connect

P-glycoprotein (P-gp) is a transmembrane drug efflux pump encoded by the MDR-1 gene in humans. Most likely P-gp protects organs against endogenous and exogenous toxins by extruding toxic compounds such as chemotherapeutics and other drugs. Many drugs are substrates for P-gp. Since P-gp is also expressed in the blood-brain barrier, P-gp substrates reach lower concentrations in the brain than in P-gp-negative tissues. Failure of response to chemotherapy of malignancies can be due to intrinsic or acquired drug resistance. Many tumors are multidrug resistant (MDR); resistant to several structurally unrelated chemotherapeutic agents. Several mechanisms are involved in MDR of which P-gp is studied most extensively. P-gp extrudes drugs out of tumor cells resulting in decreased intracellular drug concentrations, leading to the MDR phenotype. Furthermore, the MDR-1 gene exhibits several single nucleotide polymorphisms, some of which result in different transport capabilities. P-gp functionality and the effect of P-gp modulation on the pharmacokinetics of novel and established drugs can be studied in vivo by positron emission tomography (PET) using carbon-11 and fluorine-18-labeled P-gp substrates and modulators. PET may demonstrate the consequences of genetic differences on tissue pharmacokinetics. Inhibitors such as calcium-channel blockers (verapamil), cyclosporin A, ONT-093, and XR9576 can modulate the P-gp functionality. With PET the effect of P-gp modulation on the bioavailability of drugs can be investigated in humans in vivo. PET also allows the measurement of the efficacy of newly developed P-gp modulators.

Vaalburg, W. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands)]. E-mail: w.vaalburg@pet.umcg.nl; Hendrikse, N.H. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Elsinga, P.H. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Bart, J. [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands); Waarde, A. van [Groningen University Hospital, PO Box 30.001, 9700 RB Groningen (Netherlands)

2005-09-01

327

Analysis of Thyroid Response Element Activity during Retinal Development  

E-print Network

Analysis of Thyroid Response Element Activity during Retinal Development Nathan A. Billings1 , Mark Medical School, Boston, Massachusetts, United States of America Abstract Thyroid hormone (TH) signaling the competence of retinal cells to mount a transcriptional response to TH, reporters that included thyroid

Tabin, Cliff

328

Reindeer and caribou (Rangifer tarandus) response towards human activities  

Microsoft Academic Search

We address the question of how human activities and infrastructure influence reindeer\\/caribou's (Rangifer tarandus) behaviour and habitat use and review studies based on current methodologies. Anthropogenic activities have a direct affect on Rangifer behaviour through the senses hearing, sight and smell, and all of these are important tools for behavioural risk assessment. Short term indirect responses, such as habituation, sensitisation,

329

Broad Activation of the Glomerular Layer Enhances Subsequent Olfactory Responses  

Microsoft Academic Search

Early olfactory experience with a specific odorant enhances the subsequent response of the glomerular layer of the rat olfactory bulb to that same odorant. Because different odorants activate different glomerular layer regions, it seemed plausible that ex- perience with a large number of odorants might result in enhanced glomerular activation during subsequent exposure to both the previously experienced odorants and

Cynthia C. Woo; Edna E. Hingco; Brett A. Johnson; Michael Leon

2007-01-01

330

Amarogentin, a secoiridoid glycoside, abrogates platelet activation through PLC ? 2-PKC and MAPK pathways.  

PubMed

Amarogentin, an active principle of Gentiana lutea, possess antitumorigenic, antidiabetic, and antioxidative properties. Activation of platelets is associated with intravascular thrombosis and cardiovascular diseases. The present study examined the effects of amarogentin on platelet activation. Amarogentin treatment (15~60? ?M) inhibited platelet aggregation induced by collagen, but not thrombin, arachidonic acid, and U46619. Amarogentin inhibited collagen-induced phosphorylation of phospholipase C (PLC) ?2, protein kinase C (PKC), and mitogen-activated protein kinases (MAPKs). It also inhibits in vivo thrombus formation in mice. In addition, neither the guanylate cyclase inhibitor ODQ nor the adenylate cyclase inhibitor SQ22536 affected the amarogentin-mediated inhibition of platelet aggregation, which suggests that amarogentin does not regulate the levels of cyclic AMP and cyclic GMP. In conclusion, amarogentin prevents platelet activation through the inhibition of PLC ?2-PKC cascade and MAPK pathway. Our findings suggest that amarogentin may offer therapeutic potential for preventing or treating thromboembolic disorders. PMID:24868545

Yen, Ting-Lin; Lu, Wan-Jung; Lien, Li-Ming; Thomas, Philip Aloysius; Lee, Tzu-Yin; Chiu, Hou-Chang; Sheu, Joen-Rong; Lin, Kuan-Hung

2014-01-01

331

Amarogentin, a Secoiridoid Glycoside, Abrogates Platelet Activation through PLC?2-PKC and MAPK Pathways  

PubMed Central

Amarogentin, an active principle of Gentiana lutea, possess antitumorigenic, antidiabetic, and antioxidative properties. Activation of platelets is associated with intravascular thrombosis and cardiovascular diseases. The present study examined the effects of amarogentin on platelet activation. Amarogentin treatment (15~60??M) inhibited platelet aggregation induced by collagen, but not thrombin, arachidonic acid, and U46619. Amarogentin inhibited collagen-induced phosphorylation of phospholipase C (PLC)?2, protein kinase C (PKC), and mitogen-activated protein kinases (MAPKs). It also inhibits in vivo thrombus formation in mice. In addition, neither the guanylate cyclase inhibitor ODQ nor the adenylate cyclase inhibitor SQ22536 affected the amarogentin-mediated inhibition of platelet aggregation, which suggests that amarogentin does not regulate the levels of cyclic AMP and cyclic GMP. In conclusion, amarogentin prevents platelet activation through the inhibition of PLC?2-PKC cascade and MAPK pathway. Our findings suggest that amarogentin may offer therapeutic potential for preventing or treating thromboembolic disorders. PMID:24868545

Yen, Ting-Lin; Lu, Wan-Jung; Lien, Li-Ming; Thomas, Philip Aloysius; Lee, Tzu-Yin; Chiu, Hou-Chang; Sheu, Joen-Rong

2014-01-01

332

The effect of age on the renal response to PTH infusion  

Microsoft Academic Search

Summary  The renal responses to PTH infusion were compared in two age groups of healthy subjects. Basal nephrogenous cyclic AMP (NcAMP)\\u000a was higher (1.68±0.74 vs. 0.97±0.50 nmol\\/dl GF;P4\\/GFR was lower (0.93±0.21 vs. 1.16±0.14 mmol\\/liter;P<0.025) in 10 elderly subjects compared with 12 young adults. Creatinine clearance was decreased in the elderly (84.8±25.7\\u000a vs. 144.7±43.2 ml\\/min;P<0.005) and serum iPTH tended to be increased

M. A. B. Naafs; H. R. A. Fischer; G. Koorevaar; W. H. L. Hackeng; W. Schopman; J. Silberbusch

1987-01-01

333

Asymmetric frontal cortical activity and negative affective responses to ostracism.  

PubMed

Ostracism arouses negative affect. However, little is known about variables that influence the intensity of these negative affective responses. Two studies fill this void by incorporating work on approach- and withdrawal-related emotional states and their associated cortical activations. Study 1 found that following ostracism anger related directly to relative left frontal cortical activation. Study 2 used unilateral hand contractions to manipulate frontal cortical activity prior to an ostracizing event. Right-hand contractions, compared to left-hand contractions, caused greater relative left frontal cortical activation during the hand contractions as well as ostracism. Also, right-hand contractions caused more self-reported anger in response to being ostracized. Within-condition correlations revealed patterns of associations between ostracism-induced frontal asymmetry and emotive responses to ostracism consistent with Study 1. Taken together, these results suggest that asymmetrical frontal cortical activity is related to angry responses to ostracism, with greater relative left frontal cortical activity being associated with increased anger. PMID:20360350

Peterson, Carly K; Gravens, Laura C; Harmon-Jones, Eddie

2011-06-01

334

Patterning of sympathetic nerve activity in response to vestibular stimulation  

NASA Technical Reports Server (NTRS)

Growing evidence suggests a role for the vestibular system in regulation of autonomic outflow during postural adjustments. In the present paper we review evidence for the patterning of sympathetic nerve activity elicited by vestibular stimulation. In response to electrical activation of vestibular afferents, firing of sympathetic nerves located throughout the body is altered. However, activity of the renal nerve is most sensitive to vestibular inputs. In contrast, high-intensity simultaneous activation of cutaneous and muscle inputs elicits equivalent changes in firing of the renal, superior mesenteric and lumbar colonic nerves. Responses of muscle vasoconstrictor (MVC) efferents to vestibular stimulation are either inhibitory (Type I) or are comprised of a combination of excitation and inhibition (Type II). Interestingly, single MVC units located in the hindlimb exhibited predominantly Type I responses while those located in the forelimb and face exhibited Type II responses. Furthermore, brachial and femoral arterial blood flows were dissociated in response to vestibular stimulation, such that brachial vascular resistance increased while femoral resistance decreased. These studies demonstrate that vestibulosympathetic reflexes are patterned according to both the anatomical location and innervation target of a particular sympathetic nerve, and can lead to distinct changes in local blood flow.

Kerman, I. A.; McAllen, R. M.; Yates, B. J.

2000-01-01

335

Ionizing radiation activates the Nrf2 antioxidant response  

PubMed Central

The transcription factor Nrf2 binds the antioxidant DNA response element (ARE) to activate important cellular cytoprotective defense systems. Recently several types of cancers have been shown to overexpress Nrf2, but its role in the cellular response to radiation therapy has yet to be fully determined. In this study, we report that single doses of ionizing radiation from 2-8Gy activate ARE-dependent transcription in breast cancer cells in a dose-dependent manner, but only after a delay of 5 days. Clinically relevant daily dose fractions of radiation also increased ARE-dependent transcription, but again only after 5 days. Downstream activation occurred of Nrf2-ARE-dependent gene and protein markers, such as heme oxygenase-1, whereas Nrf2-deficient fibroblasts were incapable of these responses. Compared to wild-type fibroblasts, Nrf2-deficient fibroblasts had relatively high basal levels of reactive oxygen species that increased greatly five days after radiation exposure. Further, in vitro clonogenic survival assays and in vivo sublethal whole body irradiation tests demonstrated that Nrf2 deletion increased radiation sensitivity, whereas Nrf2-inducing drugs did not increase radioresistance. Our results indicate that the Nrf2-ARE pathway is important to maintain resistance to irradiation, but that it operates as a second-tier antioxidant adaptive response system activated by radiation only under specific circumstances, including those that may be highly relevant to tumor response during standard clinical dose-fractionated radiation therapy. PMID:20940400

McDonald, J. Tyson; Kim, Kwanghee; Norris, Andrew; Vlashi, Erina; Phillips, Tiffany M.; Lagadec, Chann; Donna, Lorenza Della; Ratikan, Josephine; Szelag, Heather; Hlatky, Lynn; McBride, William H.

2010-01-01

336

Methods for activating and characterizing mechanically responsive polymers.  

PubMed

Mechanically responsive polymers harness mechanical energy to facilitate unique chemical transformations and bestow materials with force sensing (e.g., mechanochromism) or self-healing capabilities. A variety of solution- and solid-state techniques, covering a spectrum of forces and strain rates, can be used to activate mechanically responsive polymers. Moreover, many of these methods have been combined with optical spectroscopy or chemical labeling techniques to characterize the products formed via mechanical activation of appropriate precursors in situ. In this tutorial review, we discuss the methods and techniques that have been used to supply mechanical force to macromolecular systems, and highlight the advantages and challenges associated with each. PMID:23389104

Wiggins, Kelly M; Brantley, Johnathan N; Bielawski, Christopher W

2013-09-01

337

Adrenalectomy mediated alterations in adrenergic activation of adenylate cyclase in rat liver  

SciTech Connect

Adrenalectomy caused a large increase in the number of ..beta..-adrenergic binding sites on liver plasma membranes as measured by /sup 125/I-iodocyanopindolol (22 and 102 fmol/mg protein for control and adrenalectomized (ADX) rats). Concomitantly an increase in the number of binding sites for /sup 3/H-yohimbine was also observed (104 and 175 fmol/mg protein for control and adx membranes). Epinephrine-stimulated increase in cyclic AMP accumulation in isolated hepatocytes were greater in cells from ADX rats. This increase in ..beta..-adrenergic mediated action was much less than what may be expected as a result of the increase in the ..beta..-adrenergic binding in ADX membranes. In addition phenoxybenzamine (10 ..mu..M) further augmented this action of epinephrine in both control and ADX cells. To test the hypothesis that the increase in the number of the inhibitory ..cap alpha../sub 2/-adrenergic receptors in adrenalectomy is responsible for the muted ..beta..-adrenergic response, the authors injected rats with pertussis toxin (PT). This treatment may cause the in vivo ribosylation of the inhibitory binding protein (Ni). Adenylate cyclase (AC) activity in liver plasma membranes prepared from treated and untreated animals was measured. In contrast with control rats, treatment of ADX rats with PT resulted in a significant increase in the basal activity of AC (5.5 and 7.7 pmol/mg protein/min for untreated and treated rats respectively). Isoproterenol (10 ..mu..M), caused AC activity to increase to 6.5 and 8.4 pmol/mg protein/min for membranes obtained from ADX untreated and ADX treated rats respectively. The ..cap alpha..-adrenergic antagonists had no significant effect on the ..beta..-adrenergic-mediated activation of AC in liver plasma membranes from PT treated control and ADX rats. The authors conclude that the ..beta..-adrenergic activation of AC is attenuated by Ni protein both directly and as a result of activation of ..cap alpha..-adrenergic receptors.

El-Refai, M.; Chan, T.

1986-05-01

338

Identification of Cyclic GMP-Activated Nonselective Ca2+-Permeable Cation Channels and Associated CNGC5 and CNGC6 Genes in Arabidopsis Guard Cells1[W][OPEN  

PubMed Central

Cytosolic Ca2+ in guard cells plays an important role in stomatal movement responses to environmental stimuli. These cytosolic Ca2+ increases result from Ca2+ influx through Ca2+-permeable channels in the plasma membrane and Ca2+ release from intracellular organelles in guard cells. However, the genes encoding defined plasma membrane Ca2+-permeable channel activity remain unknown in guard cells and, with some exceptions, largely unknown in higher plant cells. Here, we report the identification of two Arabidopsis (Arabidopsis thaliana) cation channel genes, CNGC5 and CNGC6, that are highly expressed in guard cells. Cytosolic application of cyclic GMP (cGMP) and extracellularly applied membrane-permeable 8-Bromoguanosine 3?,5?-cyclic monophosphate-cGMP both activated hyperpolarization-induced inward-conducting currents in wild-type guard cells using Mg2+ as the main charge carrier. The cGMP-activated currents were strongly blocked by lanthanum and gadolinium and also conducted Ba2+, Ca2+, and Na+ ions. cngc5 cngc6 double mutant guard cells exhibited dramatically impaired cGMP-activated currents. In contrast, mutations in CNGC1, CNGC2, and CNGC20 did not disrupt these cGMP-activated currents. The yellow fluorescent protein-CNGC5 and yellow fluorescent protein-CNGC6 proteins localize in the cell periphery. Cyclic AMP activated modest inward currents in both wild-type and cngc5cngc6 mutant guard cells. Moreover, cngc5 cngc6 double mutant guard cells exhibited functional abscisic acid (ABA)-activated hyperpolarization-dependent Ca2+-permeable cation channel currents, intact ABA-induced stomatal closing responses, and whole-plant stomatal conductance responses to darkness and changes in CO2 concentration. Furthermore, cGMP-activated currents remained intact in the growth controlled by abscisic acid2 and abscisic acid insensitive1 mutants. This research demonstrates that the CNGC5 and CNGC6 genes encode unique cGMP-activated nonselective Ca2+-permeable cation channels in the plasma membrane of Arabidopsis guard cells. PMID:24019428

Wang, Yong-Fei; Munemasa, Shintaro; Nishimura, Noriyuki; Ren, Hui-Min; Robert, Nadia; Han, Michelle; Puzorjova, Irina; Kollist, Hannes; Lee, Stephen; Mori, Izumi; Schroeder, Julian I.

2013-01-01

339

Educating for Political Activity: A Younger Generational Response  

ERIC Educational Resources Information Center

This paper is a response to Professor Chitty's "Educational Review" Guest Lecture article, "Educating for political activity". I address the three sections of his paper: a global and national-based politics of war, corporate manipulation and parliamentary scandals. This provides a basis to draw upon empirical material from a recent critical…

Mac an Ghaill, Mairtin

2010-01-01

340

Recognition of microorganisms and activation of the immune response  

Microsoft Academic Search

The mammalian immune system has innate and adaptive components, which cooperate to protect the host against microbial infections. The innate immune system consists of functionally distinct 'modules' that evolved to provide different forms of protection against pathogens. It senses pathogens through pattern-recognition receptors, which trigger the activation of antimicrobial defences and stimulate the adaptive immune response. The adaptive immune system,

Ruslan Medzhitov

2007-01-01

341

Phase response curves in the characterization of epileptiform activity  

NASA Astrophysics Data System (ADS)

Coordinated cellular activity is a major characteristic of nervous system function. Coupled oscillator theory offers unique avenues to address cellular coordination phenomena. In this study, we focus on the characterization of the dynamics of epileptiform activity, based on some seizures that manifest themselves with very periodic rhythmic activity, termed absence seizures. Our approach consists in obtaining experimentally the phase response curves (PRCs) in the neocortex and thalamus, and incorporating these PRCs into a model of coupled oscillators. Phase preferences of the stationary states and their stability are determined, and these results from the model are compared with the experimental recordings, and interpreted in physiological terms.

Perez Velazquez, J. L.; Galán, R. F.; Dominguez, L. Garcia; Leshchenko, Y.; Lo, S.; Belkas, J.; Erra, R. Guevara

2007-12-01

342

Bacterial lifestyle shapes the regulation of stringent response activation  

PubMed Central

Bacteria inhabit enormously diverse niches and have a correspondingly large array of regulatory mechanisms to adapt to often inhospitable and variable environments. The stringent response allows bacteria to quickly reprogram transcription in response to changes in nutrient availability. Although the proteins controlling this response are conserved in almost all bacterial species, recent work has illuminated considerable diversity in the starvation cues and regulatory mechanisms that activate stringent signaling proteins in bacteria from different environments. In this review we describe the signals and genetic circuitries that control the stringent signaling systems of a copiotroph, a bacteriovore, an oligotroph and a mammalian pathogen – Escherichia coli, Myxococcus xanthus, Caulobacter crescentus and Mycobacterium tuberculosis, respectively – and discuss how control of the stringent response in these species is adapted to their particular lifestyles. PMID:23419217

Boutte, Cara C.; Crosson, Sean

2014-01-01

343

Effects of glucagon on adenosine 3?,5?-monophosphate and guanosine 3?,5?-monophosphate in human plasma and urine  

PubMed Central

Glucagon, infused intravenously into fasting, well-hydrated, normal men in doses of 25-200 ng/kg per min, induced up to 30-fold increases in both plasma and urinary cyclic AMP. Cyclic GMP levels were unaffected by glucagon. Simultaneous cyclic AMP and inulin clearance studies demonstrated that the glucagon-induced increase in urinary cyclic AMP was entirely due to glomerular filtration of the elevated plasma levels of the nucleotide. The cyclic AMP response to glucagon was not mediated by parathyroid hormone or epinephrine, and trypsintreated glucagon was completely inactive. The perfused rat liver released cyclic AMP into the perfusate in response to glucagon, indicating that the liver is a possible source of the cyclic AMP entering the extracellular fluids in response to glucagon in vivo. Images PMID:5480850

Broadus, Arthur E.; Kaminsky, Neil I.; Northcutt, Robert C.; Hardman, Joel G.; Sutherland, Earl W.; Liddle, Grant W.

1970-01-01

344

Human cytomegalovirus infection activates and regulates the unfolded protein response.  

PubMed

Viral infection causes stress to the endoplasmic reticulum. The response to endoplasmic reticulum stress, known as the unfolded protein response (UPR), is designed to eliminate misfolded proteins and allow the cell to recover by attenuating translation and upregulating the expression of chaperones, degradation factors, and factors that regulate the cell's metabolic and redox environment. Some consequences of the UPR (e.g., expression of chaperones and regulation of the metabolism and redox environment) may be advantageous to the viral infection; however, translational attenuation would not. Thus, viruses may induce mechanisms which modulate the UPR, maintaining beneficial aspects and suppressing deleterious aspects. We demonstrate that human cytomegalovirus (HCMV) infection induces the UPR but specifically regulates the three branches of UPR signaling, PKR-like ER kinase (PERK), activating transcription factor 6 (ATF6), and inositol-requiring enzyme 1 (IRE-1), to favor viral replication. HCMV infection activated the eIF2alpha kinase PERK; however, the amount of phosphorylated eIF2alpha was limited and translation attenuation did not occur. Interestingly, translation of select mRNAs, which is dependent on eIF2alpha phosphorylation, did occur, including the transcription factor ATF4, which activates genes which may benefit the infection. The endoplasmic reticulum stress-induced activation of the transcription factor ATF6 was suppressed in HCMV-infected cells; however, specific chaperone genes, normally activated by ATF6, were activated by a virus-induced, ATF6-independent mechanism. Lastly, HCMV infection activated the IRE-1 pathway, as indicated by splicing of Xbp-1 mRNA. However, transcriptional activation of the XBP-1 target gene EDEM (ER degradation-enhancing alpha-mannosidase-like protein, a protein degradation factor) was inhibited. These results suggest that, although HCMV infection induces the unfolded protein response, it modifies the outcome to benefit viral replication. PMID:15890928

Isler, Jennifer A; Skalet, Alison H; Alwine, James C

2005-06-01

345

Characterizing wind turbine system response to lightning activity  

SciTech Connect

A lightning protection research program was instituted by National Renewable Energy Laboratory to minimize lightning damage to wind turbines and to further the understanding of effective damage mitigation techniques. To that end, a test program is under way to observe lightning activity, protection system response, and damage at a wind power plant in the Department of Energy (DOE) and Electric Power Research Institute (EPRI) Turbine Verification Program. The authors installed Lightning activated surveillance cameras along with a special storm tracking device to observe the activity in the wind plant area. They instrumented the turbines with lightning and ground current detection devices to log direct and indirect strike activity at each unit. They installed a surge monitor on the utility interface to track incoming activity from the transmission lines. Maintenance logs are used to verify damage and determine downtime and repair costs. Actual strikes to turbines were recorded on video and ancillary devices. The test setup and some results are discussed in this paper.

McNiff, B.; LaWhite, N. [McNiff Light Industry, Harborside, ME (United States); Muljadi, E. [National Renewable Energy Lab., Golden, CO (United States)

1998-07-01

346

Response Activation in Overlapping Tasks and the Response-Selection Bottleneck  

ERIC Educational Resources Information Center

The authors investigated the impact of response activation on dual-task performance by presenting a subliminal prime before the stimulus in Task 2 (S2) of a psychological refractory period (PRP) task. Congruence between prime and S2 modulated the reaction times in Task 2 at short stimulus onset asynchrony despite a PRP effect. This Task 2…

Schubert, Torsten; Fischer, Rico; Stelzel, Christine

2008-01-01

347

Activity-dependent regulation of synaptic clustering in a hippocampal culture system  

PubMed Central

Currently, there is a limited understanding of the factors that influence the localization and density of individual synapses in the central nervous system. Here we have studied the effects of activity on synapse formation between hippocampal dentate granule cells and CA3 pyramidal neurons in culture, taking advantage of FM1–43 as a fluorescent marker of synaptic boutons. We observed an early tendency for synapses to group together, quickly followed by the appearance of synaptic clusters on dendritic processes. These events were strongly influenced by N-methyl-d-aspartic acid receptor- and cyclic AMP-dependent signaling. The microstructure and localization of the synaptic clusters resembled that found in hippocampus, at mossy fiber synapses of stratum lucidum. Activity-dependent clustering of synapses represents a means for synaptic targeting that might contribute to synaptic organization in the brain. PMID:10536019

Kavalali, Ege T.; Klingauf, Jürgen; Tsien, Richard W.

1999-01-01

348

Testosterone activates mitogen-activated protein kinase and the cAMP response element binding  

E-print Network

Testosterone activates mitogen-activated protein kinase and the cAMP response element binding for review January 23, 2004) The androgen testosterone is essential for the Sertoli cell to support- latory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can

Breedlove, Marc

349

Regulation of two phosphatases and a cyclic phosphodiesterase of Salmonella typhimurium.  

PubMed Central

The regulation of three Salmonella typhimurium phosphatases in reponse to different nutritional limitations has been studied. Two enzymes, an acid hexose phosphatase (EC 3.1.3.2) and a cyclic phosphodiesterase (EC 3.1.4.d), appear to be regulated by the cyclic adenosine 3' ,5'-monophosphate (AMP) catabolite repression system. Levels of these enzymes increased in cells grown on poor carbon sources but not in cells grown on poor nitrogen or phosphorus sources. Mutants lacking adenyl cyclase did not produce elevated levels of these enzymes in response to carbon limitation unless cyclic AMP was supplied. Mutants lacking the cyclic AMP receptor protein did not produce elevated levels of these enzymes in response to carbon limitation regardless of the presence of cyclic AMP. Since no specific induction of either enzyme could be demonstrated, these enzymes appear to be controlled solely by the cyclic AMP system. Nonspecific acid phsphatase activity (EC 3.1.3.2) increased in response to carbon, nitrogen, phosphorus, or sulfur limitation. The extent of the increase depended on growth rate, with slower growth rates favoring greater increases, and on the type of limitation. Limitation for either carbon or phosphorus resulted in maximum increases, whereas severe limitation of Mg2+ caused only a slight increase. The increase in nonspecific acid phosphatase during carbon limitation was apparently not mediated by the catabolite repression system since mutants lacking adenyl cyclase or the cyclic AMP receptor protein still produced elevated levels of this enzyme during carbon starvation. Nor did the increase during phosphorus limitation appear to be mediated by the alkaline phosphatase regulatory system. A strain of Salmonella bearing a chromosomal mutation, which caused constitutive production of alkaline phosphatase (introduced by an episome from Escherichia coli), did not have constitutive levels of nonspecific acid phosphatase. PMID:192713

Kier, L D; Weppelman, R; Ames, B N

1977-01-01

350

Activation and regulation of ATM kinase activity in response to DNA double-strand breaks  

Microsoft Academic Search

The ataxia–telangiectasia-mutated (ATM) protein kinase is rapidly and specifically activated in response to DNA double-strand breaks in eukaryotic cells. In this review, we summarize recent insights into the mechanism of ATM activation, focusing on the role of the Mre11\\/Rad50\\/Nbs1 (MRN) complex in this process. We also compare observations of the ATM activation process in different biological systems and highlight potential

J-H Lee; T T Paull

2007-01-01

351

Spontaneous olfactory receptor neuron activity determines follower cell response properties  

PubMed Central

Noisy or spontaneous activity is common in neural systems and poses a challenge to detecting and discriminating signals. Here we use the locust to answer fundamental questions about noise in the olfactory system: Where does spontaneous activity originate? How is this activity propagated or reduced throughout multiple stages of neural processing? What mechanisms favor the detection of signals despite the presence of spontaneous activity? We found that spontaneous activity long observed in the secondary projection neurons (PNs) originates almost entirely from the primary olfactory receptor neurons (ORNs) rather than from spontaneous circuit interactions in the antennal lobe, and that spontaneous activity in ORNs tonically depolarizes the resting membrane potentials of their target PNs and local neurons (LNs), and indirectly tonically depolarizes tertiary Kenyon cells (KCs). However, because these neurons have different response thresholds, in the absence of odor stimulation, ORNs and PNs display a high spontaneous firing rate but KCs are nearly silent. Finally, we used a simulation of the olfactory network to show that discrimination of signal and noise in the KCs is best when threshold levels are set so that baseline activity in PNs persists. Our results show how the olfactory system benefits from making a signal detection decision after a point of maximal information convergence, e.g., after KCs pool inputs from many PNs. PMID:22357872

Joseph, Joby; Dunn, Felice A.; Stopfer, Mark

2012-01-01

352

Resveratrol Inhibits Inflammatory Responses via the Mammalian Target of Rapamycin Signaling Pathway in Cultured LPS-Stimulated Microglial Cells  

PubMed Central

Background Resveratrol have been known to possess many pharmacological properties including antioxidant, cardioprotective and anticancer effects. Although current studies indicate that resveratrol produces neuroprotection against neurological disorders, the precise mechanisms for its beneficial effects are still not fully understood. We investigate the effect of anti-inflammatory and mechamisms of resveratrol by using lipopolysaccharide (LPS)-stimulated murine microglial BV-2 cells. Methodology/Principal Findings BV-2 cells were treated with resveratrol (25, 50, and 100 µM) and/or LPS (1 µg/ml). Nitric oxide (NO) and prostaglandin E2 (PGE2) were measured by Griess reagent and ELISA. The mRNA and protein levels of proinflammatory proteins and cytokines were analysed by RT-PCR and double immunofluorescence labeling, respectively. Phosphorylation levels of PTEN (phosphatase and tensin homolog deleted on chromosome 10), Akt, mammalian target of rapamycin (mTOR), mitogen-activated protein kinases (MAPKs) cascades, inhibitor ?B-? (I?B-?) and cyclic AMP-responsive element-binding protein (CREB) were measured by western blot. Resveratrol significantly attenuated the LPS-induced expression of NO, PGE2, inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor-? (TNF-?), interleukin-1? (IL-1?) and nuclear factor-?B (NF-?B) in BV-2 cells. Resveratrol increased PTEN, Akt and mTOR phosphorylation in a dose-dependent manner or a time-dependent manner. Rapamycin (10 nM), a specific mTOR inhibitor, blocked the effects of resveratrol on LPS-induced microglial activation. In addition, mTOR inhibition partially abolished the inhibitory effect of resveratrol on the phosphorylation of I?B-?, CREB, extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun N-terminal protein kinase (JNK), and p38 mitogen-activated protein kinase (p38 MAPK). Conclusion and Implications This study indicates that resveratrol inhibited LPS-induced proinflammatory enzymes and proinflammatory cytokines via down-regulation phosphorylation of NF-?B, CREB and MAPKs family in a mTOR-dependent manner. These findings reveal, in part, the molecular basis underlying the anti-inflammatory properties of resveratrol. PMID:22363816

Guo, Jia-Zhi; Zhang, Wei; He, Ying; Song, Rui; Wang, Wen-Min; Xiao, Chun-Jie; Lu, Di

2012-01-01

353

A Paradox of Syntactic Priming: Why Response Tendencies Show Priming for Passives, and Response Latencies Show Priming for Actives  

PubMed Central

Speakers tend to repeat syntactic structures across sentences, a phenomenon called syntactic priming. Although it has been suggested that repeating syntactic structures should result in speeded responses, previous research has focused on effects in response tendencies. We investigated syntactic priming effects simultaneously in response tendencies and response latencies for active and passive transitive sentences in a picture description task. In Experiment 1, there were priming effects in response tendencies for passives and in response latencies for actives. However, when participants' pre-existing preference for actives was altered in Experiment 2, syntactic priming occurred for both actives and passives in response tendencies as well as in response latencies. This is the first investigation of the effects of structure frequency on both response tendencies and latencies in syntactic priming. We discuss the implications of these data for current theories of syntactic processing. PMID:22022352

Segaert, Katrien; Menenti, Laura; Weber, Kirsten; Hagoort, Peter

2011-01-01

354

Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis  

PubMed Central

Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calve, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

2013-01-01

355

Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.  

PubMed

Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

2013-01-01

356

Affective Response to Physical Activity: Testing for Measurement Invariance of the Physical Activity Affect Scale Across Active and Non-Active Individuals  

Microsoft Academic Search

Affective responses to physical activity are assumed to play a role in exercise initiation and maintenance. The Physical Activity Affect Scale measures four dimensions of an individual's affective response to exercise. Group differences in the interpretation of scale items can impact the interpretability of mean differences, underscoring the need to examine whether measurement structure holds across groups (e.g., active vs.

Laura C. Carpenter; Sara Anne Tompkins; Sarah J. Schmiege; Renea Nilsson; Angela Bryan

2010-01-01

357

Transactivation of the human T-cell lymphotropic virus type 1 Tax1-responsive 21-base-pair repeats requires Holo-TFIID and TFIIA.  

PubMed Central

The human T-cell lymphotropic virus type 1 (HTLV-1) is the etiological agent for adult T-cell leukemia and tropical spastic paraparesis/HTLV-1-associated myelopathy. The HTLV-1 Tax1 gene product has been shown to transactivate transcription of viral and cellular promoters. To examine the biochemical mechanism of Tax1 transactivation, we have developed an in vitro transactivation assay in which wild-type Tax1 is able to specifically transactivate a polymerase II promoter through upstream Tax1-responsive elements. The in vitro system utilizes the HTLV-1 21-bp repeats cloned upstream of the ovalbumin promoter and G-free cassette. Purified Tax1 specifically transactivates this template 5- to 10-fold in a concentration-dependent manner. No transactivation of the ovalbumin promoter (pLovTATA) template control was observed. Tax1 transactivation was inhibited by low concentrations of alpha-amanitin and was effectively neutralized by anti-Tax1 but not control sera. Consistent with in vivo transactivating activity, Tax1 NF-kappa B mutant M22, but not cyclic AMP-responsive element-binding protein mutant M47, transactivated the template containing the tandem 21-bp repeat. In a reconstituted in vitro transcription assay, Tax1 transactivation was dependent upon basal transcription factors TFIIB, TFIIF, Pol II, TFIID, and TFIIA. TATA-binding protein did not functionally substitute for TFIID in the transactivation assay by Tax1 but was sufficient for basal transcription. Finally, we have used anti-TFIIA antibody (p55) to ask if Tax1 transactivation required TFIIA activity. Addition of TFIIA antibody to in vitro transcription reactions, as well as depletion of TFIIA by preclearing with antibody, showed that TFIIA was required for Tax1 transactivation. Only a slight (twofold) drop of basal transcription was observed. Tax1 transactivation was restored when purified HeLa TFIIA was added back into the reconstituted system. We propose that Tax1 utilizes a transactivation pathway involving the activator regulated basal transcription factors TFIID and TFIIA. PMID:7609077

Duvall, J F; Kashanchi, F; Cvekl, A; Radonovich, M F; Piras, G; Brady, J N

1995-01-01

358

Early signalling events implicated in leukotriene B4-induced activation of the NADPH oxidase in eosinophils: role of Ca2+, protein kinase C and phospholipases C and D.  

PubMed Central

The early signalling events that may ultimately contribute to the assembly and subsequent activation of the NADPH oxidase in guinea-pig peritoneal eosinophils were investigated in response to leukotriene B4 (LTB4). LTB4 promoted a rapid, transient and receptor-mediated increase in the rate of H2O2 generation that was potentiated by R 59 022, a diradylglycerol (DRG) kinase inhibitor, implicating protein kinase C (PKC) in the genesis of this response. This conclusion was supported by the finding that the PKC inhibitor, Ro 31-8220, attenuated (by about 30%) the peak rate of LTB4-induced H2O2 generation under conditions where the same response evoked by 4 beta-phorbol 12,13-dibutyrate (PDBu) was inhibited by more than 90%. Paradoxically, Ro 31-8220 doubled the amount of H2O2 produced by LTB4 which may relate to the ability of PKC to inhibit cell signalling through phospholipase C (PLC). Indeed, Ro 31-8220 significantly enhanced LTB4-induced Ins(1,4,5)P3 accumulation and the duration of the Ca2+ transient in eosinophils. Experiments designed to assess the relative importance of DRG-mobilizing phospholipases in LTB4-induced oxidase activation indicated that phospholipase D (PLD) did not play a major role. Thus, although H2O2 generation was abolished by butan-1-ol, this was apparently unrelated to the inhibition of PLD, as LTB4 failed to stimulate the formation of Ptd[3H]BuOH in [3H]butan-1-ol-treated eosinophils. Rather, the inhibition was probably due to the ability of butan-1-ol to increase the eosinophil cyclic AMP content. In contrast, Ca(2+)- and PLC-driven mechanisms were implicated in H2O2 generation, as LTB4 elevated the Ins(1,4,5)P3 content and intracellular free Ca2+ concentration in intact cells, and cochelation of extracellular and intracellular Ca2+ significantly attenuated LTB4-induced H2O2 generation. Pretreatment of eosinophils with wortmannin did not affect LTB4-induced H2O2 production at concentrations at which it abolished the respiratory burst evoked by formylmethionyl-leucylphenylalanine in human neutrophils. Collectively, these data suggest that LTB4 activates the NADPH oxidase in eosinophils by PLD- and PtdIns 3-kinase-independent mechanisms that involve Ca2+, PLC and PKC. Furthermore, the activation of additional pathways that do not require Ca2+ is also suggested by the finding that LTB4 evoked a significant respiratory burst in Ca(2+)-depleted cells. PMID:7575412

Perkins, R S; Lindsay, M A; Barnes, P J; Giembycz, M A

1995-01-01

359

Optimization of an Active Twist Rotor Blade Planform for Improved Active Response and Forward Flight Performance  

NASA Technical Reports Server (NTRS)

A study was conducted to identify the optimum blade tip planform for a model-scale active twist rotor. The analysis identified blade tip design traits which simultaneously reduce rotor power of an unactuated rotor while leveraging aeromechanical couplings to tailor the active response of the blade. Optimizing the blade tip planform for minimum rotor power in forward flight provided a 5 percent improvement in performance compared to a rectangular blade tip, but reduced the vibration control authority of active twist actuation by 75 percent. Optimizing for maximum blade twist response increased the vibration control authority by 50 percent compared to the rectangular blade tip, with little effect on performance. Combined response and power optimization resulted in a blade tip design which provided similar vibration control authority to the rectangular blade tip, but with a 3.4 percent improvement in rotor performance in forward flight.

Sekula, Martin K; Wilbur, Matthew L.

2014-01-01

360

Physiologic Responses Produced by Active and Passive Personal Cooling Vests  

NASA Technical Reports Server (NTRS)

Personal thermoregulatory systems which provide chest cooling are used in the industrial and aerospace environments to alleviate thermal stress. However, little information is available regarding the physiologic and circulatory changes produced by routine operation of these systems. The objectives of this study were to document and compare the subjects' response to three cooling vests in their recommended configurations. The Life Enhancement Tech (LET) lightweight active cooling vest with cap, the MicroClimate Systems Change of Phase garment (MCS), and the Steele Vest were each used to cool the chest regions of 12 male and 8 female Healthy subjects (21 to 69 yr.) in this study. The subjects, seated in an upright position at normal room temperature (approx. 22 C), were tested for 60 min. with one of the cooling garments. The LET active garment had an initial coolant fluid inlet temperature of 60 F, and was ramped down to 50 F. Oral, right and left ear canal temperatures were logged manually every 5 min. Arm, leg, chest and rectal temperatures; heart rate; and respiration were recorded continuously on a U.F.I., Inc. Biolog ambulatory monitor. For men, all three vests had similar, significant cooling effects. Decreases in the average rectal temperature, oral temperature, and ear canal temperatures were approximately 0.2 C, 0.2 C and 0.1 C, respectively. In contrast to the men, the female subjects wearing the MCS and Steel vests had similar cooling responses in which the core temperature remained elevated and oral and ear canal temperatures did not drop. The LET active garment cooled most of the female subjects in this study; rectal, oral and ear temperature decreased about 0.2 C, 0.3 C and 0.3 C, respectively. These results show that the garment configurations tested do not elicit a similar thermal response in all subjects. A gender difference is evident. The LET active garment configuration was most effective in decreasing temperatures of the female subjects; the MCS vest was least effective. For male subjects, the three vests appear to be more nearly equivalent. The active garment system under study included a cooling cap, which may account for some of the difference in response.

Ku, Yu-Tsuan E.; Lee, Hank C.; Montgomery, Leslie D.; Luna, Bernadette

2000-01-01

361

Manipulation of endogenous kinase activity in living cells using photoswitchable inhibitory peptides.  

PubMed

Optogenetic control of endogenous signaling can be an important tool for probing cell behavior. Using the photoresponse of the LOV2 domain of Avena sativa phototropin 1, we developed analogues of kinase inhibitors whose activity is light dependent. Inhibitory peptides were appended to the J? helix, where they potently inhibited kinases in the light but were sterically blocked from kinase interaction in the dark. Photoactivatable inhibitors for cyclic-AMP dependent kinase (PKA) and myosin light chain kinase (MLCK) are described, together with studies that shed light on proper positioning of the peptides in the LOV domain. These inhibitors altered endogenous signaling in living cells and produced light-dependent changes in cell morphodynamics. PMID:24905630

Yi, Jason J; Wang, Hui; Vilela, Marco; Danuser, Gaudenz; Hahn, Klaus M

2014-11-21

362

Thermosphere-ionosphere coupling in response to recurrent geomagnetic activity  

NASA Astrophysics Data System (ADS)

The paper presents the global thermosphere-ionosphere response to the high-speed solar wind streams and the subsequent recurrent geomagnetic variations with a period of 9 d during the period of time 1 October 2007-31 March 2009. The COSMIC electron density at fixed heights, as well as the ionospheric parameters foF2 and hmF2, and the two coefficients characterizing the top and bottom side vertical gradients of the electron density profile, are used for investigating the ionospheric 9-d (s=0) wave response. The SABER temperature data are utilized for studying the response of the lower thermosphere to the recurrent auroral heating. The COSMIC and SABER measurements are analyzed by one and the same method where the atmospheric tides and planetary waves which are present in the temperature and electron density measurements are simultaneously extracted from the data. The use of such data analysis approach brings to light additional features of the ionospheric response to a recurrent geomagnetic activity which have not been found before.

Mukhtarov, Plamen; Pancheva, Dora

2012-12-01

363

Effects of habitual physical activity on response to endurance training.  

PubMed

We hypothesised that habitual physical activity (PA) together with progressive endurance training contributes to the differences in training response (?[V(·)]O(2max)) in healthy and physically active male participants. Twenty volunteers (age 30±3 years and [V(·)]O(2max) 54±7 ml·kg?¹·min?¹) participated in an eight-week training program which included four to six heart rate-guided exercise sessions weekly. PA data over the whole period were collected by an accelerometer-equipped wristwatch. Individual relative intensities of endurance training and PA were separately determined by adjusting to [V(·)]O(2max) reserve and calculated as mean daily duration (min) of training and PA at light, moderate, high and very high intensity levels. [V(·)]O(2max) increased 6.4±4.1% (p < 0.0001) during the training period. ?[V(·)]O(2max) correlated with the amount of habitual PA that was mainly of light intensity (r = 0.53, p = 0.016), but not with the duration of moderate, high or very high intensity PA (p = ns for all). Age, body mass index, and daily amount of training at any intensity level of exercise were not related to ?[V(·)]O(2max) (p = ns for all). In conclusion, a high amount of habitual PA together with prescribed endurance training was associated with good training response in physically active males. PMID:22315980

Hautala, Arto; Martinmaki, Kaisu; Kiviniemi, Antti; Kinnunen, Hannu; Virtanen, Paula; Jaatinen, Jukka; Tulppo, Mikko

2012-01-01

364

Embedding Responses in Spontaneous Neural Activity Shaped through Sequential Learning  

PubMed Central

Recent experimental measurements have demonstrated that spontaneous neural activity in the absence of explicit external stimuli has remarkable spatiotemporal structure. This spontaneous activity has also been shown to play a key role in the response to external stimuli. To better understand this role, we proposed a viewpoint, “memories-as-bifurcations,” that differs from the traditional “memories-as-attractors” viewpoint. Memory recall from the memories-as-bifurcations viewpoint occurs when the spontaneous neural activity is changed to an appropriate output activity upon application of an input, known as a bifurcation in dynamical systems theory, wherein the input modifies the flow structure of the neural dynamics. Learning, then, is a process that helps create neural dynamical systems such that a target output pattern is generated as an attractor upon a given input. Based on this novel viewpoint, we introduce in this paper an associative memory model with a sequential learning process. Using a simple Hebbian-type learning, the model is able to memorize a large number of input/output mappings. The neural dynamics shaped through the learning exhibit different bifurcations to make the requested targets stable upon an increase in the input, and the neural activity in the absence of input shows chaotic dynamics with occasional approaches to the memorized target patterns. These results suggest that these dynamics facilitate the bifurcations to each target attractor upon application of the corresponding input, which thus increases the capacity for learning. This theoretical finding about the behavior of the spontaneous neural activity is consistent with recent experimental observations in which the neural activity without stimuli wanders among patterns evoked by previously applied signals. In addition, the neural networks shaped by learning properly reflect the correlations of input and target-output patterns in a similar manner to those designed in our previous study. PMID:23505355

Kurikawa, Tomoki; Kaneko, Kunihiko

2013-01-01

365

Candida albicans Czf1 and Efg1 coordinate the response to farnesol during quorum sensing, white-opaque thermal dimorphism, and cell death.  

PubMed

Quorum sensing by farnesol in Candida albicans inhibits filamentation and may be directly related to its ability to cause both mucosal and systemic diseases. The Ras1-cyclic AMP signaling pathway is a target for farnesol inhibition. However, a clear understanding of the downstream effectors of the morphological farnesol response has yet to be unraveled. To address this issue, we screened a library for mutants that fail to respond to farnesol. Six mutants were identified, and the czf1?/czf1? mutant was selected for further characterization. Czf1 is a transcription factor that regulates filamentation in embedded agar and also white-to-opaque switching. We found that Czf1 is required for filament inhibition by farnesol under at least three distinct environmental conditions: on agar surfaces, in liquid medium, and when embedded in a semisolid agar matrix. Since Efg1 is a transcription factor of the Ras1-cyclic AMP signaling pathway that interacts with and regulates Czf1, an efg1?/efg1? czf1?/czf1? mutant was tested for filament inhibition by farnesol. It exhibited an opaque-cell-like temperature-dependent morphology, and it was killed by low farnesol levels that are sublethal to wild-type cells and both efg1?/efg1? and czf1?/czf1? single mutants. These results highlight a new role for Czf1 as a downstream effector of the morphological response to farnesol, and along with Efg1, Czf1 is involved in the control of farnesol-mediated cell death in C. albicans. PMID:23873867

Langford, Melanie L; Hargarten, Jessica C; Patefield, Krista D; Marta, Elizabeth; Blankenship, Jill R; Fanning, Saranna; Nickerson, Kenneth W; Atkin, Audrey L

2013-09-01

366

Active microwave responses - An aid in improved crop classification  

NASA Technical Reports Server (NTRS)

A study determined the feasibility of using visible, infrared, and active microwave data to classify agricultural crops such as corn, sorghum, alfalfa, wheat stubble, millet, shortgrass pasture and bare soil. Visible through microwave data were collected by instruments on board the NASA C-130 aircraft over 40 agricultural fields near Guymon, OK in 1978 and Dalhart, TX in 1980. Results from stepwise and discriminant analysis techniques indicated 4.75 GHz, 1.6 GHz, and 0.4 GHz cross-polarized microwave frequencies were the microwave frequencies most sensitive to crop type differences. Inclusion of microwave data in visible and infrared classification models improved classification accuracy from 73 percent to 92 percent. Despite the results, further studies are needed during different growth stages to validate the visible, infrared, and active microwave responses to vegetation.

Rosenthal, W. D.; Blanchard, B. J.

1984-01-01

367

Facilitation of neuronal responses by intrinsic default mode network activity.  

PubMed

Default mode network (DMN) shows intrinsic, high-level activity at rest. We tested a hypothesis proposed for its role in sensory information processing: Intrinsic DMN activity facilitates neural responses to sensory input. A neural network model, consisting of a sensory network (Nsen) and a DMN, was simulated. The Nsen contained cell assemblies. Each cell assembly comprised principal cells, GABAergic interneurons (Ia, Ib), and glial cells. We let the Nsen carry out a perceptual task: detection of sensory stimuli. During DMN activation, glial cells were hyperpolarized by Ia-to-glia circuitry, by which glial membrane transporters imported GABA molecules from the extracellular space and decreased ambient GABA concentration. Acting on extrasynaptic GABA receptors, the decrease in ambient GABA concentration reduced inhibitory current in a tonic manner. This depolarized principal cells below their firing threshold during the ongoing spontaneous time period and accelerated their reaction speed to a sensory stimulus. During the stimulus presentation period, the Nsen inhibited the DMN and caused DMN deactivation. The DMN deactivation made Nsen Ia cells cease firing, thereby stopping the glial membrane hyperpolarization, quitting the GABA import, returning to the basal ambient GABA level, and thus enhancing global inhibition. Notably, the stimulus-relevant P cell firing could be maintained when GABAergic gliotransmission via Ia-glia signaling worked, decreasing ambient GABA concentration around the stimulus-relevant P cells. This enabled the Nsen to reliably detect the stimulus. We suggest that intrinsic default model network activity may accelerate the reaction speed of the sensory network by modulating its ongoing-spontaneous activity in a subthreshold manner. Ambient GABA contributes to achieve an optimal ongoing spontaneous subthreshold neuronal state, in which GABAergic gliotransmission triggered by the intrinsic default model network activity may play an important role. PMID:25149693

Matsui, Hiroakira; Zheng, Meihong; Hoshino, Osamu

2014-11-01

368

Assessing estrogenic activity of phytochemicals using transcriptional activation and immature mouse uterotrophic responses  

Microsoft Academic Search

The estrogenic responses of several phytoestrogens including genistein, daidzein, coumestrol, ?-zearalanol, zearalenone, naringenin, taxifolin and biochanin A were compared over a wide dose range using an in vitro assay that measures transcriptional activation of the estrogen receptor (ER) and an in vivo immature mouse uterotrophic assay consisting of measuring uterine wet weight increase plus sensitive morphological and biochemical endpoints in

Wendy N Jefferson; Elizabeth Padilla-Banks; George Clark; Retha R Newbold

2002-01-01

369

Structural insights into activation of antiviral NK cell responses  

PubMed Central

Summary Natural killer (NK) cells are key components of innate immune responses, providing surveillance against cells undergoing tumorigenesis or infection, by viruses or internal pathogens. NK cells can directly eliminate compromised cells and regulate downstream responses of the innate and acquired immune systems through the release of immune modulators (cytokines, interferons). The importance of the role NK cells play in immune defense was demonstrated originally in herpes viral infections, usually mild or localized, which become severe and life-threatening in NK-deficient patients (1). NK cell effector functions are governed by balancing opposing signals from a diverse array of activating and inhibitory receptors. Many NK receptors occur in paired activating and inhibitory isoforms and recognize major histocompatibility complex (MHC) class I proteins with varying degrees of peptide specificity. Structural studies have made considerable inroads into understanding the molecular mechanisms employed to broadly recognize multiple MHC ligands or specific pathogen-associated antigens and the strategies employed by viruses to thwart these defenses. While many details of NK development, signaling, and integration remain mysterious, it is clear that NK receptors are key components of a system exquisitely tuned to sense any dysregulation in MHC class I expression, or the expression of certain viral antigens, resulting in the elimination of affected cells. PMID:23046134

Finton, Kathryn A.; Strong, Roland K.

2012-01-01

370

Activation of innate immune responses by Haemophilus influenzae lipooligosaccharide.  

PubMed

A Gram-negative pathogen Haemophilus influenzae has a truncated endotoxin known as lipooligosaccharide (LOS). Recent studies on H. influenzae LOS highlighted its structural and compositional implications for bacterial virulence; however, the role of LOS in the activation of innate and adaptive immunity is poorly understood. THP-1 monocytes were stimulated with either lipopolysaccharide (LPS) from Escherichia coli or LOS compounds derived from H. influenzae Eagan, Rd, and Rd lic1 lpsA strains. Cell surface expression of key antigen-presenting, costimulatory, and adhesion molecules, as well as gene expression of some cytokines and pattern recognition receptors, were studied. Eagan and Rd LOS had a lower capacity to induce the expression of ICAM-1, CD40, CD58, tumor necrosis factor alpha (TNF-?), and interleukin-1? (IL-1?) compared to LPS. In contrast, antigen-presenting (HLA-ABC or HLA-DR) and costimulatory (CD86) molecules and NOD2 were similarly upregulated in response to LOS and LPS. LOS from a mutant Rd strain (Rd lic1 lpsA) consistently induced higher expression of innate immune molecules than the wild-type LOS, suggesting the importance of phosphorylcholine and/or oligosaccharide extension in cellular responses to LOS. An LOS compound with a strong ability to upregulate antigen-presenting and costimulatory molecules combined with a low proinflammatory activity may be considered a vaccine candidate to immunize against H. influenzae. PMID:24671554

Choi, Joshua; Cox, Andrew D; Li, Jianjun; McCready, William; Ulanova, Marina

2014-05-01

371

A supramolecular microgel glutathione peroxidase mimic with temperature responsive activity.  

PubMed

Glutathione peroxidase (GPx) protects cells from oxidative damage by scavenging surplus reactive oxygen species (ROS). Commonly, an appropriate amount of ROS acts as a signal molecule in the metabolism. A smart artificial GPx exhibits adjustable catalytic activity, which can potentially reduce the amount of ROS to an appropriate degree and maintain its important physiological functions in metabolism. To construct an optimum and excellent smart artificial GPx, a novel supramolecular microgel artificial GPx (SM-Te) was prepared based on the supramolecular host-guest interaction employing the tellurium-containing guest molecule (ADA-Te-ADA) and the cyclodextrin-containing host block copolymer (poly(N-isopropylacrylamide)-b-[polyacrylamides-co-poly(6-o-(triethylene glycol monoacrylate ether)-?-cyclodextrin)], PPAM-CD) as building blocks. Subsequently, based on these building blocks, SM-Te was constructed and the formation of its self-assembled structure was confirmed by dynamic light scattering, NMR, SEM, TEM, etc. Typically, benefitting from the temperature responsive properties of the PNIPAM scaffold, SM-Te also exhibited similar temperature responsive behaviour. Importantly, the GPx catalytic rates of SM-Te displayed a noticeable temperature responsive characteristic. Moreover, SM-Te exhibited the typical saturation kinetics behaviour of a real enzyme catalyst. It was proved that the changes of the hydrophobic microenvironment and the pore size in the supramolecular microgel network of SM-Te played significant roles in altering the temperature responsive catalytic behaviour. The successful construction of SM-Te not only overcomes the insurmountable disadvantages existing in previous covalent bond crosslinked microgel artificial GPx but also bodes well for the development of novel intelligent antioxidant drugs. PMID:24652520

Yin, Yanzhen; Jiao, Shufei; Lang, Chao; Liu, Junqiu

2014-05-21

372

Sulforaphane prevents pulmonary damage in response to inhaled arsenic by activating the Nrf2-defense response  

SciTech Connect

Exposure to arsenic is associated with an increased risk of lung disease. Novel strategies are needed to reduce the adverse health effects associated with arsenic exposure in the lung. Nrf2, a transcription factor that mediates an adaptive cellular defense response, is effective in detoxifying environmental insults and prevents a broad spectrum of diseases induced by environmental exposure to harmful substances. In this report, we tested whether Nrf2 activation protects mice from arsenic-induced toxicity. We used an in vivo arsenic inhalation model that is highly relevant to low environmental human exposure to arsenic-containing dusts. Two-week exposure to arsenic-containing dust resulted in pathological alterations, oxidative DNA damage, and mild apoptotic cell death in the lung; all of which were blocked by sulforaphane (SF) in an Nrf2-dependent manner. Mechanistically, SF-mediated activation of Nrf2 alleviated inflammatory responses by modulating cytokine production. This study provides strong evidence that dietary intervention targeting Nrf2 activation is a feasible approach to reduce adverse health effects associated with arsenic exposure. -- Highlights: ? Exposed to arsenic particles and/or SF have elevated Nrf2 and its target genes. ? Sulforaphane prevents pathological alterations, oxidative damage and cell death. ? Sulforaphane alleviates infiltration of inflammatory cells into the lungs. ? Sulforaphane suppresses arsenic-induced proinflammatory cytokine production.

Zheng, Yi [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China) [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China); Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Tao, Shasha [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States)] [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Lian, Fangru [Department of Pathology, University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States)] [Department of Pathology, University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Chau, Binh T. [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States)] [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Chen, Jie; Sun, Guifan [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China)] [Department of Environmental and Occupational Health, School of Public Health, China Medical University, Shenyang, Liaoning 110001 (China); Fang, Deyu [Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States)] [Department of Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States); Lantz, R. Clark [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States) [Department of Cellular and Molecular Medicine, The University of Arizona, 1501 North Campbell Ave, Tucson, AZ 85724 (United States); Arizona Cancer Center, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724 (United States); Zhang, Donna D., E-mail: dzhang@pharmacy.arizona.edu [Department of Pharmacology and Toxicology, College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721 (United States); Arizona Cancer Center, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724 (United States)

2012-12-15

373

Cardiotonic agents. 9. Synthesis and biological evaluation of a series of (E)-4,5-dihydro-6-[2-[4-(1H-imidazol-1-yl)phenyl]ethenyl]-3 (2H)-pyridazinones: a novel class of compounds with positive inotropic, antithrombotic, and vasodilatory activities for the treatment of congestive heart failure.  

PubMed

A novel series of analogues of (E)-4,5-dihydro-6-[2-[4-(1H-imidazol-1-yl) phenyl]ethenyl]-3(2H)-pyridazinone was synthesized as a variation on the imazodan series. The compounds were evaluated for (i) hemodynamic activity, (ii) cyclic AMP-phosphodiesterase inhibitory activity (human platelets and guinea pig heart tissue), and (iii) platelet aggregation inhibitory activity. The insertion of the ethenyl moiety between the phenyl and dihydropyridazinone rings produced novel compounds that retained the potent inotropic/vasodilator activity of the parent imazodan series and enhanced the platelet aggregation inhibitory potency. Compound 3d, the most potent in this series, demonstrated in vivo antithrombotic activity. The synthesis and the biological activity of these new pyridazinone analogues are reported. PMID:2536438

Sircar, I; Steffen, R P; Bobowski, G; Burke, S E; Newton, R S; Weishaar, R E; Bristol, J A; Evans, D B

1989-02-01

374

Affective Response to Physical Activity: Testing for Measurement Invariance of the Physical Activity Affect Scale across Active and Non-Active Individuals  

ERIC Educational Resources Information Center

Affective responses to physical activity are assumed to play a role in exercise initiation and maintenance. The Physical Activity Affect Scale measures four dimensions of an individual's affective response to exercise. Group differences in the interpretation of scale items can impact the interpretability of mean differences, underscoring the need…

Carpenter, Laura C.; Tompkins, Sara Anne; Schmiege, Sarah J.; Nilsson, Renea; Bryan, Angela

2010-01-01

375

Forearm neurovascular responses during mental stress and vestibular activation.  

PubMed

Autonomic responses may underlie associations among anxiety, vestibular dysfunction, and unexplained syncope. Mental stress (MS), an anxiety-inducing stimulus, causes forearm vasodilation, whereas the vestibulosympathetic reflex (VSR) causes forearm vasoconstriction. The purpose of this study was to examine the combined effects of mental and vestibular stimulation on neurovascular control in the forearm. Heart rate, arterial pressure (Finapres), and forearm blood flow (Doppler) were measured in 10 healthy volunteers in the prone position during 1) head-down rotation (HDR), 2) MS (mental arithmetic), and 3) HDR + MS. Forearm vascular resistance (FVR) increased during HDR (from 232 +/- 40 to 319 +/- 53 units) and decreased during MS (from 260 +/- 57 to 154 +/- 22 units). During HDR + MS, FVR did not change [change (Delta) = -31 +/- 50 units] and was not significantly different from the algebraic sum of each trial performed alone (Delta = -20 +/- 42 units). Arm muscle sympathetic nerve activity (MSNA; microneurography) was measured in seven additional subjects. MSNA increased during HDR (from 13 +/- 2 to 17 +/- 2 bursts/min) and HDR + MS (from 11 +/- 2 to 16 +/- 2 bursts/min). Increases in MSNA during HDR + MS (Delta = 5 +/- 2 bursts/min) were not different from the algebraic sum of each trial performed alone (Delta = 6 +/- 2 bursts/min). We conclude that an additive neurovascular interaction exists between MS and the VSR in the forearm. Activation of the VSR prevented forearm vasodilation during MS, suggesting that activation of the VSR may help protect against stress-induced syncope. PMID:15486035

Carter, Jason R; Cooke, William H; Ray, Chester A

2005-02-01

376

75 FR 21648 - MMS Information Collection Activity: 1010-0106, Oil Spill Financial Responsibility for Offshore...  

Federal Register 2010, 2011, 2012, 2013

...Collection Activity: 1010-0106, Oil Spill Financial Responsibility for Offshore...regulations under ``30 CFR Part 253, Oil Spill Financial Responsibility for Offshore...INFORMATION: Title: 30 CFR Part 253, Oil Spill Financial Responsibility for...

2010-04-26

377

77 FR 33479 - Information Collection Activities: Oil-Spill Response Requirements for Facilities Located Seaward...  

Federal Register 2010, 2011, 2012, 2013

...Information Collection Activities: Oil-Spill Response Requirements for Facilities...regulations under Part 254, ``Oil-Spill Response Requirements for Facilities...INFORMATION: Title: 30 CFR 254, Oil-Spill Response Requirements for...

2012-06-06

378

Humans clearly adjust their outdoor activities in response to meteorological conditions. For  

E-print Network

outside," rather than actual temperature and humidity. These are hourly meteorological data from WilliamsHumans clearly adjust their outdoor activities in response to meteorological conditions human responses are obvious, do daily meteorological conditions affect people's outdoor activities

Hall, Sharon J.

379

Activation of oxidative stress-responsive signaling pathways in early splenotoxic response of aniline  

SciTech Connect

Aniline exposure causes toxicity to the spleen, which leads to a variety of sarcomas, and fibrosis appears to be an important preneoplastic lesion. However, early molecular mechanisms in aniline-induced toxicity to the spleen are not known. Previously, we have shown that aniline exposure results in iron overload and induction of oxidative stress in the spleen, which can cause transcriptional upregulation of fibrogenic/inflammatory cytokines via activation of oxidative stress (OS)-responsive signaling pathways. To test this mechanism, male SD rats were treated with aniline (1mmol/kg/day via gavage) for 7days, an experimental condition that precedes the appearance of fibrosis. Significant increases in both NF-{kappa}B and AP-1 binding activity was observed in the nuclear extracts of splenocytes from aniline-treated rats as determined by ELISAs, and supported by Western blot data showing increases in p-I{kappa}B{alpha}, p-p65 and p-c-Jun. To understand the upstream signaling events which could account for the activation of NF-{kappa}B and AP-1, phosphorylation patterns of I{kappa}B kinases (IKK{alpha} and IKK{beta}) and mitogen-activated protein kinases (MAPKs) were pursued. Our data showed remarkable increases in both p-IKK{alpha} and p-IKK{beta} in the splenocytes from aniline-treated rats, suggesting their role in the phosphorylation of both I{kappa}B{alpha} and p65 subunits. Furthermore, aniline exposu