Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

PubMed Central

Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

PubMed

Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

2005-01-01

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

Molecular switching behavior in isosteric DNA base pairs.

PubMed

Jissy, A K; Konar, Sukanya; Datta, Ayan

2013-04-15

The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Layer-Based Approach for Image Pair Fusion.

PubMed

Son, Chang-Hwan; Zhang, Xiao-Ping

2016-04-20

Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

PubMed

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes

PubMed Central

Watkins, Norman E.; SantaLucia, John

2005-01-01

Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087

The pairing center plays a key role in homolog paring: an explanation for adjacent-2 segregation in interchange heterozygotes.

PubMed

Luo, Peigao

2009-05-01

Having reflected on the discrepancy between various views of chromosome behavior during meiosis, we propose an alternative description of Mendel's first law of segregation by referring to the segregation of pairing centers instead of centromeres. We also propose an alternative description of Mendel's second law of independent assortment, which refers to the free combination of different pairing centers. This interpretation is based on the modified concept that true 'homologous chromosomes' should carry the pairing center rather than centromere: the length of homology or the importance of the homologous segment on the chromosome is the crucial factor in homologous chromosome pairing and synapsis.

A Voronoi interior adjacency-based approach for generating a contour tree

NASA Astrophysics Data System (ADS)

Chen, Jun; Qiao, Chaofei; Zhao, Renliang

2004-05-01

A contour tree is a good graphical tool for representing the spatial relations of contour lines and has found many applications in map generalization, map annotation, terrain analysis, etc. A new approach for generating contour trees by introducing a Voronoi-based interior adjacency set concept is proposed in this paper. The immediate interior adjacency set is employed to identify all of the children contours of each contour without contour elevations. It has advantages over existing methods such as the point-in-polygon method and the region growing-based method. This new approach can be used for spatial data mining and knowledge discovering, such as the automatic extraction of terrain features and construction of multi-resolution digital elevation model.

An ensemble of SVM classifiers based on gene pairs.

PubMed

Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

2013-07-01

In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

NASA Astrophysics Data System (ADS)

Yang, Bo; Rodgers, M. T.

2015-08-01

Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

PubMed

Paukku, Y; Hill, G

2011-05-12

Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Database of non-canonical base pairs found in known RNA structures

NASA Technical Reports Server (NTRS)

Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

2000-01-01

Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

Structural landscape of base pairs containing post-transcriptional modifications in RNA

PubMed Central

Seelam, Preethi P.; Sharma, Purshotam

2017-01-01

Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

NASA Technical Reports Server (NTRS)

Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

2013-01-01

This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

Non-target adjacent stimuli classification improves performance of classical ERP-based brain computer interface

NASA Astrophysics Data System (ADS)

Ceballos, G. A.; Hernández, L. F.

2015-04-01

Objective. The classical ERP-based speller, or P300 Speller, is one of the most commonly used paradigms in the field of Brain Computer Interfaces (BCI). Several alterations to the visual stimuli presentation system have been developed to avoid unfavorable effects elicited by adjacent stimuli. However, there has been little, if any, regard to useful information contained in responses to adjacent stimuli about spatial location of target symbols. This paper aims to demonstrate that combining the classification of non-target adjacent stimuli with standard classification (target versus non-target) significantly improves classical ERP-based speller efficiency. Approach. Four SWLDA classifiers were trained and combined with the standard classifier: the lower row, upper row, right column and left column classifiers. This new feature extraction procedure and the classification method were carried out on three open databases: the UAM P300 database (Universidad Autonoma Metropolitana, Mexico), BCI competition II (dataset IIb) and BCI competition III (dataset II). Main results. The inclusion of the classification of non-target adjacent stimuli improves target classification in the classical row/column paradigm. A gain in mean single trial classification of 9.6% and an overall improvement of 25% in simulated spelling speed was achieved. Significance. We have provided further evidence that the ERPs produced by adjacent stimuli present discriminable features, which could provide additional information about the spatial location of intended symbols. This work promotes the searching of information on the peripheral stimulation responses to improve the performance of emerging visual ERP-based spellers.

The electrostatic characteristics of G·U wobble base pairs

PubMed Central

Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

2007-01-01

G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

An asymmetric pair of vortices adjacent to a spinning cylinder

NASA Astrophysics Data System (ADS)

Iosilevskii, G.; Seginer, A.

The two-dimensional flow field over a spinning circular cylinder is analyzed using an extension of the Foeppl method. Equilibrium equations for two asymmetric point vortices in the wake of the cylinder are solved for a case when both vortices are equidistant from the cylinder. The two Foeppl solutions for the cylinder are presented. It is observed that the spin does not affect the angle between the two vortices; however, it displaces the vortex pair in the spin direction and the sinus of the displacement angle is proportional to the spin rate.

Envisaging quantum transport phenomenon in a muddled base pair of DNA

NASA Astrophysics Data System (ADS)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

PubMed Central

Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

2013-01-01

We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

PubMed

Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

2015-10-12

A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Binaural unmasking with multiple adjacent masking electrodes in bilateral cochlear implant users

PubMed Central

Lu, Thomas; Litovsky, Ruth; Zeng, Fan-Gang

2011-01-01

Bilateral cochlear implant (BiCI) users gain an advantage in noisy situations from a second implant, but their bilateral performance falls short of normal hearing listeners. Channel interactions due to overlapping electrical fields between electrodes can impair speech perception, but its role in limiting binaural hearing performance has not been well characterized. To address the issue, binaural masking level differences (BMLD) for a 125 Hz tone in narrowband noise were measured using a pair of pitch-matched electrodes while simultaneously presenting the same masking noise to adjacent electrodes, representing a more realistic stimulation condition compared to prior studies that used only a single electrode pair. For five subjects, BMLDs averaged 8.9 ± 1.0 dB (mean ± s.e.) in single electrode pairs but dropped to 2.1 ± 0.4 dB when presenting noise on adjacent masking electrodes, demonstrating a negative impact of the additional maskers. Removing the masking noise from only the pitch-matched electrode pair not only lowered thresholds but also resulted in smaller BMLDs. The degree of channel interaction estimated from auditory nerve evoked potentials in three subjects was significantly and negatively correlated with BMLD. The data suggest that if the amount of channel interactions can be reduced, BiCI users may experience some performance improvements related to binaural hearing. PMID:21682415

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

NASA Technical Reports Server (NTRS)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Understanding the kinetic mechanism of RNA single base pair formation

PubMed Central

Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

2016-01-01

RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

PubMed

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Constructing an optimal facility layout to maximize adjacency as a function of common boundary length

NASA Astrophysics Data System (ADS)

Ghassemi Tari, Farhad; Neghabi, Hossein

2018-03-01

An effective facility layout implies that departments with high flow are laid adjacent. However, in the case of a very narrow boundary length between the neighbouring departments, the adjacency would actually be useless. In traditional layout design methods, a score is generally assigned independent of the department's boundary length. This may result in a layout design with a restricted material flow. This article proposes a new concept of adjacency in which the department pairs are laid adjacent with a wider path. To apply this concept, a shop with unequal rectangular departments is contemplated and a mathematical programming model with the objective of maximizing the sum of the adjacency degrees is proposed. A computational experiment is conducted to demonstrate the efficiency of the layout design. It is demonstrated that the new concept provides a more efficient and a more realistic layout design.

Orbital selective pairing and gap structures of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

Orbital selective pairing and gap structures of iron-based superconductors

DOE PAGES

Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

2017-05-08

We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

Successive Two-sided Loop Jets Caused by Magnetic Reconnection between Two Adjacent Filamentary Threads

NASA Astrophysics Data System (ADS)

Tian, Zhanjun; Liu, Yu; Shen, Yuandeng; Elmhamdi, Abouazza; Su, Jiangtao; Liu, Ying D.; Kordi, Ayman. S.

2017-08-01

We present observational analysis of two successive two-sided loop jets observed by the ground-based New Vacuum Solar Telescope and the space-borne Solar Dynamics Observatory. The two successive two-sided loop jets manifested similar evolution processes and both were associated with the interaction of two small-scale adjacent filamentary threads, magnetic emerging, and cancellation processes at the jet’s source region. High temporal and high spatial resolution observations reveal that the two adjacent ends of the two filamentary threads are rooted in opposite magnetic polarities within the source region. The two threads approached each other, and then an obvious brightening patch is observed at the interaction position. Subsequently, a pair of hot plasma ejections are observed heading in opposite directions along the paths of the two filamentary threads at a typical speed for two-sided loop jets of the order 150 km s-1. Close to the end of the second jet, we report the formation of a bright hot loop structure at the source region, which suggests the formation of new loops during the interaction. Based on the observational results, we propose that the observed two-sided loop jets are caused by magnetic reconnection between the two adjacent filamentary threads, largely different from the previous scenario that a two-sided loop jet is generated by magnetic reconnection between an emerging bipole and the overlying horizontal magnetic fields.

Variable length adjacent partitioning for PTS based PAPR reduction of OFDM signal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ibraheem, Zeyid T.; Rahman, Md. Mijanur; Yaakob, S. N.

2015-05-15

Peak-to-Average power ratio (PAPR) is a major drawback in OFDM communication. It leads the power amplifier into nonlinear region operation resulting into loss of data integrity. As such, there is a strong motivation to find techniques to reduce PAPR. Partial Transmit Sequence (PTS) is an attractive scheme for this purpose. Judicious partitioning the OFDM data frame into disjoint subsets is a pivotal component of any PTS scheme. Out of the existing partitioning techniques, adjacent partitioning is characterized by an attractive trade-off between cost and performance. With an aim of determining effects of length variability of adjacent partitions, we performed anmore » investigation into the performances of a variable length adjacent partitioning (VL-AP) and fixed length adjacent partitioning in comparison with other partitioning schemes such as pseudorandom partitioning. Simulation results with different modulation and partitioning scenarios showed that fixed length adjacent partition had better performance compared to variable length adjacent partitioning. As expected, simulation results showed a slightly better performance of pseudorandom partitioning technique compared to fixed and variable adjacent partitioning schemes. However, as the pseudorandom technique incurs high computational complexities, adjacent partitioning schemes were still seen as favorable candidates for PAPR reduction.« less

Adjacency Matrix-Based Transmit Power Allocation Strategies in Wireless Sensor Networks

PubMed Central

Consolini, Luca; Medagliani, Paolo; Ferrari, Gianluigi

2009-01-01

In this paper, we present an innovative transmit power control scheme, based on optimization theory, for wireless sensor networks (WSNs) which use carrier sense multiple access (CSMA) with collision avoidance (CA) as medium access control (MAC) protocol. In particular, we focus on schemes where several remote nodes send data directly to a common access point (AP). Under the assumption of finite overall network transmit power and low traffic load, we derive the optimal transmit power allocation strategy that minimizes the packet error rate (PER) at the AP. This approach is based on modeling the CSMA/CA MAC protocol through a finite state machine and takes into account the network adjacency matrix, depending on the transmit power distribution and determining the network connectivity. It will be then shown that the transmit power allocation problem reduces to a convex constrained minimization problem. Our results show that, under the assumption of low traffic load, the power allocation strategy, which guarantees minimal delay, requires the maximization of network connectivity, which can be equivalently interpreted as the maximization of the number of non-zero entries of the adjacency matrix. The obtained theoretical results are confirmed by simulations for unslotted Zigbee WSNs. PMID:22346705

Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

PubMed

Nonin, S; Leroy, J L; Guéron, M

1995-08-22

We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

PubMed Central

Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

2010-01-01

It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

Physics of base-pairing dynamics in DNA

NASA Astrophysics Data System (ADS)

Manghi, Manoel; Destainville, Nicolas

2016-05-01

As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

Successive Two-sided Loop Jets Caused by Magnetic Reconnection between Two Adjacent Filamentary Threads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Zhanjun; Liu, Yu; Shen, Yuandeng

We present observational analysis of two successive two-sided loop jets observed by the ground-based New Vacuum Solar Telescope and the space-borne Solar Dynamics Observatory . The two successive two-sided loop jets manifested similar evolution processes and both were associated with the interaction of two small-scale adjacent filamentary threads, magnetic emerging, and cancellation processes at the jet’s source region. High temporal and high spatial resolution observations reveal that the two adjacent ends of the two filamentary threads are rooted in opposite magnetic polarities within the source region. The two threads approached each other, and then an obvious brightening patch is observedmore » at the interaction position. Subsequently, a pair of hot plasma ejections are observed heading in opposite directions along the paths of the two filamentary threads at a typical speed for two-sided loop jets of the order 150 km s{sup −1}. Close to the end of the second jet, we report the formation of a bright hot loop structure at the source region, which suggests the formation of new loops during the interaction. Based on the observational results, we propose that the observed two-sided loop jets are caused by magnetic reconnection between the two adjacent filamentary threads, largely different from the previous scenario that a two-sided loop jet is generated by magnetic reconnection between an emerging bipole and the overlying horizontal magnetic fields.« less

A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

PubMed Central

Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

2013-01-01

The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

Error simulation of paired-comparison-based scaling methods

NASA Astrophysics Data System (ADS)

Cui, Chengwu

2000-12-01

Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

Multi-hop teleportation based on W state and EPR pairs

NASA Astrophysics Data System (ADS)

Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

2016-05-01

Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

Method for sequencing DNA base pairs

DOEpatents

Sessler, Andrew M.; Dawson, John

1993-01-01

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

Method for sequencing DNA base pairs

DOEpatents

Sessler, A.M.; Dawson, J.

1993-12-14

The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

Signature scheme based on bilinear pairs

NASA Astrophysics Data System (ADS)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

33 CFR 334.1060 - Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area.

Code of Federal Regulations, 2013 CFR

2013-07-01

... the Oakland Army Base; restricted area. 334.1060 Section 334.1060 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.1060 Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area. (a) The area...

33 CFR 334.1060 - Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area.

Code of Federal Regulations, 2012 CFR

2012-07-01

... the Oakland Army Base; restricted area. 334.1060 Section 334.1060 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.1060 Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area. (a) The area...

33 CFR 334.1060 - Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area.

Code of Federal Regulations, 2010 CFR

2010-07-01

... the Oakland Army Base; restricted area. 334.1060 Section 334.1060 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.1060 Oakland Outer Harbor adjacent to the Oakland Army Base; restricted area. (a) The area...

Aerodynamic Interactions between Pairs of Vertical-Axis Wind Turbines

NASA Astrophysics Data System (ADS)

Brownstein, Ian; Dabiri, John

2017-11-01

Increased power production has been observed in downstream vertical-axis wind turbines (VAWTs) when positioned offset from the wake of upstream turbines. This effect was found to exist in both laboratory and field environments with pairs of co- and counter-rotating turbines. It is hypothesized that the observed power production enhancement is due to flow acceleration adjacent to the upstream turbine caused by bluff body blockage, which increases the incident freestream velocity on appropriately positioned downstream turbines. This type of flow acceleration has been observed in computational and laboratory studies of VAWTs and will be further investigated here using 3D-PTV measurements around pairs of laboratory-scale VAWTs. These measurements will be used to understand the mechanisms behind the performance enhancement effect and seek to determine optimal separation distances and angles between turbines based on turbine design parameters. These results will lead to recommendations for optimizing the power production of VAWT wind farms which utilize this effect.

Triple helical DNA in a duplex context and base pair opening

PubMed Central

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Determining resistivity of a formation adjacent to a borehole having casing using multiple electrodes and with resistances being defined between the electrodes

DOEpatents

Vail, III, William B.

1996-01-01

Methods of operation of different types of multiple electrode apparatus vertically disposed in a cased well to measure information related to the resistivity of adjacent geological formations from inside the cased well. The multiple electrode apparatus have a minimum of three spaced apart voltage measurement electrodes that electrically engage the interior of the cased well. Measurement information is obtained related to current which is caused to flow from the cased well into the adjacent geological formation. First compensation information is obtained related to a first casing resistance between a first pair of the spaced apart voltage measurement electrodes. Second compensation information is obtained related to a second casing resistance between a second pair of the spaced apart voltage measurement electrodes. The measurement information, and first and second compensation information are used to determine a magnitude related to the adjacent formation resistivity.

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

Determining resistivity of a formation adjacent to a borehole having casing using multiple electrodes and with resistances being defined between the electrodes

DOEpatents

Vail, W.B. III

1996-10-29

Methods of operation are disclosed for different types of multiple electrode apparatus vertically disposed in a cased well to measure information related to the resistivity of adjacent geological formations from inside the cased well. The multiple electrode apparatus have a minimum of three spaced-apart voltage measurement electrodes that electrically engage the interior of the cased well. Measurement information is obtained related to current which is caused to flow from the cased well into the adjacent geological formation. First compensation information is obtained related to a first casing resistance between a first pair of the spaced-apart voltage measurement electrodes. Second compensation information is obtained related to a second casing resistance between a second pair of the spaced-apart voltage measurement electrodes. The measurement information, and first and second compensation information are used to determine a magnitude related to the adjacent formation resistivity. 13 figs.

PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

NASA Technical Reports Server (NTRS)

Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

2003-01-01

Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

DTIC Science & Technology

2016-04-01

DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

PubMed

Nonin, S; Jiang, F; Patel, D J

1997-05-02

We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

Learning Non-Adjacent Regularities at Age 0 ; 7

ERIC Educational Resources Information Center

Gervain, Judit; Werker, Janet F.

2013-01-01

One important mechanism suggested to underlie the acquisition of grammar is rule learning. Indeed, infants aged 0 ; 7 are able to learn rules based on simple identity relations (adjacent repetitions, ABB: "wo fe fe" and non-adjacent repetitions, ABA: "wo fe wo", respectively; Marcus et al., 1999). One unexplored issue is…

Stem and leaf hydraulics of congeneric tree species from adjacent tropical savanna and forest ecosystems

Treesearch

Guang You Hao; William A. Hoffmann; Fabian G. Scholz; Sandra J. Bucci; Frederick C. Meinzer; Augusto C. Franco; Kun Fang Cao; Guillermo Goldstein

2008-01-01

Leaf and stem functional traits related to plant water relations were studied for six congeneric species pairs, each composed of one tree species typical of savanna habitats and another typical of adjacent forest habitats, to determine whether there were intrinsic differences in plant hydraulics between these two functional types. Only individuals growing in savanna...

Configurations of base-pair complexes in solutions. [nucleotide chemistry

NASA Technical Reports Server (NTRS)

Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

1978-01-01

A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

Variability of adjacency effects in sky reflectance measurements.

PubMed

Groetsch, Philipp M M; Gege, Peter; Simis, Stefan G H; Eleveld, Marieke A; Peters, Steef W M

2017-09-01

Sky reflectance R sky (λ) is used to correct in situ reflectance measurements in the remote detection of water color. We analyzed the directional and spectral variability in R sky (λ) due to adjacency effects against an atmospheric radiance model. The analysis is based on one year of semi-continuous R sky (λ) observations that were recorded in two azimuth directions. Adjacency effects contributed to R sky (λ) dependence on season and viewing angle and predominantly in the near-infrared (NIR). For our test area, adjacency effects spectrally resembled a generic vegetation spectrum. The adjacency effect was weakly dependent on the magnitude of Rayleigh- and aerosol-scattered radiance. The reflectance differed between viewing directions 5.4±6.3% for adjacency effects and 21.0±19.8% for Rayleigh- and aerosol-scattered R sky (λ) in the NIR. Under which conditions in situ water reflectance observations require dedicated correction for adjacency effects is discussed. We provide an open source implementation of our method to aid identification of such conditions.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

PubMed

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

Design and Applications of Noncanonical DNA Base Pairs.

PubMed

Jissy, A K; Datta, Ayan

2014-01-02

While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

PubMed

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

PubMed Central

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2014-01-01

The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

New support for an old hypothesis: density affects extra-pair paternity

PubMed Central

Mayer, Christian; Pasinelli, Gilberto

2013-01-01

Density has been suggested to affect variation in extra-pair paternity (EPP) in avian mating systems, because increasing density promotes encounter rates and thus mating opportunities. However, the significance of density affecting EPP variation in intra- and interspecific comparisons has remained controversial, with more support from intraspecific comparisons. Neither experimental nor empirical studies have consistently provided support for the density hypothesis. Testing the density hypothesis is challenging because density measures may not necessarily reflect extra-pair mating opportunities, mate guarding efforts may covary with density, populations studied may differ in migratory behavior and/or climatic conditions, and variation in density may be insufficient. Accounting for these potentially confounding factors, we tested whether EPP rates within and among subpopulations of the reed bunting (Emberiza schoeniclus) were related to density. Our analyses were based on data from 13 subpopulations studied over 4 years. Overall, 56.4% of totally 181 broods contained at least one extra-pair young (EPY) and 37.1% of totally 669 young were of extra-pair origin. Roughly 90% of the extra-pair fathers were from the adjacent territory or from the territory after the next one. Within subpopulations, the proportion of EPY in broods was positively related to local breeding density. Similarly, among subpopulations, proportion of EPY was positively associated with population density. EPP was absent in subpopulations consisting of single breeding pairs, that is, without extra-pair mating opportunities. Our study confirms that density is an important biological factor, which significantly influences the amount of EPP within and among subpopulations, but also suggests that other mechanisms influence EPP beyond the variation explained by density. PMID:23533071

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

PubMed Central

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

NASA Astrophysics Data System (ADS)

Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

2018-01-01

The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

PubMed

Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

2012-08-14

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

PubMed Central

Yusupov, Marat; Yusupova, Gulnara

2014-01-01

The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

PubMed Central

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

PubMed Central

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eliav, E.; Kaldor, U.; Ishikawa, Y.

1994-12-31

Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

PubMed Central

Lee, Alex H. F.; Kool, Eric T.

2008-01-01

A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

Modified Amber Force Field Correctly Models the Conformational Preference for Tandem GA pairs in RNA

PubMed Central

2015-01-01

Molecular mechanics with all-atom models was used to understand the conformational preference of tandem guanine-adenine (GA) noncanonical pairs in RNA. These tandem GA pairs play important roles in determining stability, flexibility, and structural dynamics of RNA tertiary structures. Previous solution structures showed that these tandem GA pairs adopt either imino (cis Watson–Crick/Watson–Crick A-G) or sheared (trans Hoogsteen/sugar edge A-G) conformations depending on the sequence and orientation of the adjacent closing base pairs. The solution structures (GCGGACGC)2 [Biochemistry, 1996, 35, 9677–9689] and (GCGGAUGC)2 [Biochemistry, 2007, 46, 1511–1522] demonstrate imino and sheared conformations for the two central GA pairs, respectively. These systems were studied using molecular dynamics and free energy change calculations for conformational changes, using umbrella sampling. For the structures to maintain their native conformations during molecular dynamics simulations, a modification to the standard Amber ff10 force field was required, which allowed the amino group of guanine to leave the plane of the base [J. Chem. Theory Comput., 2009, 5, 2088–2100] and form out-of-plane hydrogen bonds with a cross-strand cytosine or uracil. The requirement for this modification suggests the importance of out-of-plane hydrogen bonds in stabilizing the native structures. Free energy change calculations for each sequence demonstrated the correct conformational preference when the force field modification was used, but the extent of the preference is underestimated. PMID:24803859

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Canine GM2-Gangliosidosis Sandhoff Disease Associated with a 3-Base Pair Deletion in the HEXB Gene.

PubMed

Wang, P; Henthorn, P S; Galban, E; Lin, G; Takedai, T; Casal, M

2018-01-01

GM2-gangliosidosis is a fatal neurodegenerative lysosomal storage disease (LSD) caused by deficiency of either β-hexosaminidase A (Hex-A) and β-hexosaminidase B (Hex-B) together, or the GM2 activator protein. Clinical signs can be variable and are not pathognomonic for the specific, causal deficiency. To characterize the phenotype and genotype of GM2-gangliosidosis disease in an affected dog. One affected Shiba Inu and a clinically healthy dog. Clinical and neurologic evaluation, brain magnetic resonance imaging (MRI), assays of lysosomal enzyme activities, and sequencing of all coding regions of HEXA, HEXB, and GM2A genes. A 14-month-old, female Shiba Inu presented with clinical signs resembling GM2-gangliosidosis in humans and GM1-gangliosidosis in the Shiba Inu. Magnetic resonance imaging (MRI) of the dog's brain indicated neurodegenerative disease, and evaluation of cerebrospinal fluid (CSF) identified storage granules in leukocytes. Lysosomal enzyme assays of plasma and leukocytes showed deficiencies of Hex-A and Hex-B activities in both tissues. Genetic analysis identified a homozygous, 3-base pair deletion in the HEXB gene (c.618-620delCCT). Clinical, biochemical, and molecular features are characterized in a Shiba Inu with GM2-gangliosidosis. The deletion of 3 adjacent base pairs in HEXB predicts the loss of a leucine residue at amino acid position 207 (p.Leu207del) supporting the hypothesis that GM2-gangliosidosis seen in this dog is the Sandhoff type. Because GM1-gangliosidosis also exists in this breed with almost identical clinical signs, genetic testing for both GM1- and GM2-gangliosidosis should be considered to make a definitive diagnosis. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

PubMed

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

PubMed Central

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

DOE PAGES

Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

2015-02-27

The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

Spatiotemporal configuration dependent pairing of nerve events in dark-adapted human vision

NASA Astrophysics Data System (ADS)

Bouman, Maarten A.

2002-02-01

In the model presented here, in the dark any single quantum absorption in a rod or cone produces a subliminal excitation. Subliminal excitations from both halves of a twin unit pair in the retina for the perception of light from the stimulus. A twin unit contains either two red or two green cones. The twin units are intertwined in triples of two red units and one green unit in a hexagon called a trion. P satellite rods surround each cone, P being approximately proportional to the square of eccentricity. A successful pairing for light perception represents-through the points of time and locations of the creation of its partners in the retina-a direction event with two possible polarities and with the orientation of the elongated shape of the twin unit. The polarity of the event depends on which of the two partners arrives first at the twin's pairing facility. Simultaneous events and successive events with the same polarity in adjacent units that are aligned along one of the three orientations of the hexagonal retinal mosaic pair in the cortex for the perception of edge and of movement. Inter-twin pairing products of the three differently oriented sets of aligned twins are independent of each other and sum vectorially in the cortex. This system of three sub-retinas is called the retrinet. Two one-quantum excitations in any of a twin's receptors make the percept colored. The odd blue cone produces already a blue signal for a single one-quantum excitation. Intra-receptor pairing in a rod, a red cone and a green cone is for white, red, and green respectively. Red and green cone products of a trion cross-pair in the retina and produce a yellow signal. Red and green cone products of a hexagon of adjacent trions cross-pair in the cortex and produce a white signal. This large hexagon with a total of seven trions is called a persepton. After subliminal excitations in a twin have paired successfully, further subliminal receptor excitations in neighboring and aligned twins are

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Synthesis, base pairing and structure studies of geranylated RNA

PubMed Central

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-01-01

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

PubMed

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d -wave pairs in the s ± condensate of iron-based superconductors

DOE PAGES

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-02

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

PubMed

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

PubMed

De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

2018-06-05

Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

PubMed

Li, Hai; Zhao, Yuan Yuan

2017-11-22

In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

PubMed

Nakano, Shu-ichi; Sugimoto, Naoki

2014-08-05

The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

PubMed

Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

2004-05-01

In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

Synthesis, base pairing and structure studies of geranylated RNA.

PubMed

Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

2016-07-27

Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Reproductive pair correlations and the clustering of organisms.

PubMed

Young, W R; Roberts, A J; Stuhne, G

2001-07-19

Clustering of organisms can be a consequence of social behaviour, or of the response of individuals to chemical and physical cues. Environmental variability can also cause clustering: for example, marine turbulence transports plankton and produces chlorophyll concentration patterns in the upper ocean. Even in a homogeneous environment, nonlinear interactions between species can result in spontaneous pattern formation. Here we show that a population of independent, random-walking organisms ('brownian bugs'), reproducing by binary division and dying at constant rates, spontaneously aggregates. Using an individual-based model, we show that clusters form out of spatially homogeneous initial conditions without environmental variability, predator-prey interactions, kinesis or taxis. The clustering mechanism is reproductively driven-birth must always be adjacent to a living organism. This clustering can overwhelm diffusion and create non-poissonian correlations between pairs (parent and offspring) or organisms, leading to the emergence of patterns.

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

DTIC Science & Technology

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Objectifying the Adjacent and Opposite Angles: A Cultural Historical Analysis

ERIC Educational Resources Information Center

Daher, Wajeeh; Musallam, Nadera

2018-01-01

The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles'…

Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

ERIC Educational Resources Information Center

Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

2012-01-01

In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

PubMed

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Size cues and the adjacency principle.

DOT National Transportation Integrated Search

1963-11-01

The purpose of the present study was to apply the adjacency principle to the perception of relative depth from size cues. In agreement with the adjacency principle, it was found that the size cue between adjacent objects was more effective than the s...

Local adjacency metric dimension of sun graph and stacked book graph

NASA Astrophysics Data System (ADS)

Yulisda Badri, Alifiah; Darmaji

2018-03-01

A graph is a mathematical system consisting of a non-empty set of nodes and a set of empty sides. One of the topics to be studied in graph theory is the metric dimension. Application in the metric dimension is the navigation robot system on a path. Robot moves from one vertex to another vertex in the field by minimizing the errors that occur in translating the instructions (code) obtained from the vertices of that location. To move the robot must give different instructions (code). In order for the robot to move efficiently, the robot must be fast to translate the code of the nodes of the location it passes. so that the location vertex has a minimum distance. However, if the robot must move with the vertex location on a very large field, so the robot can not detect because the distance is too far.[6] In this case, the robot can determine its position by utilizing location vertices based on adjacency. The problem is to find the minimum cardinality of the required location vertex, and where to put, so that the robot can determine its location. The solution to this problem is the dimension of adjacency metric and adjacency metric bases. Rodrguez-Velzquez and Fernau combine the adjacency metric dimensions with local metric dimensions, thus becoming the local adjacency metric dimension. In the local adjacency metric dimension each vertex in the graph may have the same adjacency representation as the terms of the vertices. To obtain the local metric dimension of values in the graph of the Sun and the stacked book graph is used the construction method by considering the representation of each adjacent vertex of the graph.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

ERIC Educational Resources Information Center

Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

2010-01-01

This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

PubMed Central

Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

2013-01-01

Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

2003-01-01

The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

46 CFR 148.445 - Adjacent spaces.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 5 2011-10-01 2011-10-01 false Adjacent spaces. 148.445 Section 148.445 Shipping COAST... THAT REQUIRE SPECIAL HANDLING Additional Special Requirements § 148.445 Adjacent spaces. When... following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by natural...

46 CFR 148.445 - Adjacent spaces.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 5 2014-10-01 2014-10-01 false Adjacent spaces. 148.445 Section 148.445 Shipping COAST... THAT REQUIRE SPECIAL HANDLING Additional Special Requirements § 148.445 Adjacent spaces. When... following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by natural...

46 CFR 148.445 - Adjacent spaces.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 5 2013-10-01 2013-10-01 false Adjacent spaces. 148.445 Section 148.445 Shipping COAST... THAT REQUIRE SPECIAL HANDLING Additional Special Requirements § 148.445 Adjacent spaces. When... following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by natural...

46 CFR 148.445 - Adjacent spaces.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 5 2012-10-01 2012-10-01 false Adjacent spaces. 148.445 Section 148.445 Shipping COAST... THAT REQUIRE SPECIAL HANDLING Additional Special Requirements § 148.445 Adjacent spaces. When... following requirements must be met: (a) Each space adjacent to a cargo hold must be ventilated by natural...

The role of spatial organization in preference for color pairs.

PubMed

Schloss, Karen B; Palmer, Stephen E

2011-01-01

We investigated how spatial organization influences color-pair preference asymmetries: differential preference for one color pair over another when the pairs contain the same colors in opposite spatial configurations. Schloss and Palmer (2011, Attention, Perception, & Psychophysics 73 55-571) found weak figure ground preference asymmetries for small squares centered on large squares in aesthetic ratings. Here, we found robust preference asymmetries using a more sensitive forced-choice task: participants strongly prefer pairs with yellower, lighter figures on bluer, darker grounds (experiment 1). We also investigated which spatial factors influence these preference asymmetries. Relative area of the two component regions is clearly important, and perceived 3-D area of the 2-D displays (ie after the ground is amodally completed behind the figure) is more influential than 2-D area (experiment 2). Surroundedness is not required, because yellowness blueness effects were comparable for pairs in which the figure was surrounded by the ground, and for mosaic arrangements in which the regions were adjacent and separated by a gap (experiment 3). Lightness darkness effects, however, were opposite for figure ground versus mosaic organizations: people prefer figure-ground organizations in which smaller regions are lighter, but prefer mosaic organizations in which smaller regions are darker. Physiological, phenomenological, and ecological explanations of the reported results are discussed.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

PubMed

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Objectifying the adjacent and opposite angles: a cultural historical analysis

NASA Astrophysics Data System (ADS)

Daher, Wajeeh; Musallam, Nadera

2018-02-01

The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles' concepts. We videoed the learning of a group of three high-achieving students who used technology, specifically GeoGebra, to explore geometric relations related to the adjacent and opposite angles' concepts. To analyze students' objectification of these concepts, we used the categories of objectification of knowledge (attention and awareness) and the categories of generalization (factual, contextual and symbolic), developed by Radford. The research results indicate that teacher's and students' verbal and visual signs, together with the software dynamic tools, mediated the students' objectification of the adjacent and opposite angles' concepts. Specifically, eye and gestures perceiving were part of the semiosis cycles in which the participating students were engaged and which related to the mathematical signs that signified the adjacent and the opposite angles. Moreover, the teacher's suggestions/requests/questions included/suggested semiotic signs/tools, including verbal signs that helped the students pay attention, be aware of and objectify the adjacent and opposite angles' concepts.

Time series regression-based pairs trading in the Korean equities market

NASA Astrophysics Data System (ADS)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

PubMed

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

PubMed

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

Double binding energy differences: Mean-field or pairing effect?

NASA Astrophysics Data System (ADS)

Qi, Chong

2012-10-01

In this Letter we present a systematic analysis on the average interaction between the last protons and neutrons in atomic nuclei, which can be extracted from the double differences of nuclear binding energies. The empirical average proton-neutron interaction Vpn thus derived from experimental data can be described in a very simple form as the interplay of the nuclear mean field and the pairing interaction. It is found that the smooth behavior as well as the local fluctuations of the Vpn in even-even nuclei with N ≠ Z are dominated by the contribution from the proton-neutron monopole interactions. A strong additional contribution from the isoscalar monopole interaction and isovector proton-neutron pairing interaction is seen in the Vpn for even-even N = Z nuclei and for the adjacent odd-A nuclei with one neutron or proton being subtracted.

A systematic review of definitions and classification systems of adjacent segment pathology.

PubMed

Kraemer, Paul; Fehlings, Michael G; Hashimoto, Robin; Lee, Michael J; Anderson, Paul A; Chapman, Jens R; Raich, Annie; Norvell, Daniel C

2012-10-15

Systematic review. To undertake a systematic review to determine how "adjacent segment degeneration," "adjacent segment disease," or clinical pathological processes that serve as surrogates for adjacent segment pathology are classified and defined in the peer-reviewed literature. Adjacent segment degeneration and adjacent segment disease are terms referring to degenerative changes known to occur after reconstructive spine surgery, most commonly at an immediately adjacent functional spinal unit. These can include disc degeneration, instability, spinal stenosis, facet degeneration, and deformity. The true incidence and clinical impact of degenerative changes at the adjacent segment is unclear because there is lack of a universally accepted classification system that rigorously addresses clinical and radiological issues. A systematic review of the English language literature was undertaken and articles were classified using the Grades of Recommendation Assessment, Development, and Evaluation criteria. RESULTS.: Seven classification systems of spinal degeneration, including degeneration at the adjacent segment, were identified. None have been evaluated for reliability or validity specific to patients with degeneration at the adjacent segment. The ways in which terms related to adjacent segment "degeneration" or "disease" are defined in the peer-reviewed literature are highly variable. On the basis of the systematic review presented in this article, no formal classification system for either cervical or thoracolumbar adjacent segment disorders currently exists. No recommendations regarding the use of current classification of degeneration at any segments can be made based on the available literature. A new comprehensive definition for adjacent segment pathology (ASP, the now preferred terminology) has been proposed in this Focus Issue, which reflects the diverse pathology observed at functional spinal units adjacent to previous spinal reconstruction and balances

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

PubMed Central

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

PubMed

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

NASA Astrophysics Data System (ADS)

Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

2014-02-01

The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

PubMed

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

PubMed

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

Content-based image retrieval by matching hierarchical attributed region adjacency graphs

NASA Astrophysics Data System (ADS)

Fischer, Benedikt; Thies, Christian J.; Guld, Mark O.; Lehmann, Thomas M.

2004-05-01

Content-based image retrieval requires a formal description of visual information. In medical applications, all relevant biological objects have to be represented by this description. Although color as the primary feature has proven successful in publicly available retrieval systems of general purpose, this description is not applicable to most medical images. Additionally, it has been shown that global features characterizing the whole image do not lead to acceptable results in the medical context or that they are only suitable for specific applications. For a general purpose content-based comparison of medical images, local, i.e. regional features that are collected on multiple scales must be used. A hierarchical attributed region adjacency graph (HARAG) provides such a representation and transfers image comparison to graph matching. However, building a HARAG from an image requires a restriction in size to be computationally feasible while at the same time all visually plausible information must be preserved. For this purpose, mechanisms for the reduction of the graph size are presented. Even with a reduced graph, the problem of graph matching remains NP-complete. In this paper, the Similarity Flooding approach and Hopfield-style neural networks are adapted from the graph matching community to the needs of HARAG comparison. Based on synthetic image material build from simple geometric objects, all visually similar regions were matched accordingly showing the framework's general applicability to content-based image retrieval of medical images.

Using Pair Programming to Teach CAD Based Engineering Graphics

ERIC Educational Resources Information Center

Leland, Robert P.

2010-01-01

Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

Medical image classification using spatial adjacent histogram based on adaptive local binary patterns.

PubMed

Liu, Dong; Wang, Shengsheng; Huang, Dezhi; Deng, Gang; Zeng, Fantao; Chen, Huiling

2016-05-01

Medical image recognition is an important task in both computer vision and computational biology. In the field of medical image classification, representing an image based on local binary patterns (LBP) descriptor has become popular. However, most existing LBP-based methods encode the binary patterns in a fixed neighborhood radius and ignore the spatial relationships among local patterns. The ignoring of the spatial relationships in the LBP will cause a poor performance in the process of capturing discriminative features for complex samples, such as medical images obtained by microscope. To address this problem, in this paper we propose a novel method to improve local binary patterns by assigning an adaptive neighborhood radius for each pixel. Based on these adaptive local binary patterns, we further propose a spatial adjacent histogram strategy to encode the micro-structures for image representation. An extensive set of evaluations are performed on four medical datasets which show that the proposed method significantly improves standard LBP and compares favorably with several other prevailing approaches. Copyright © 2016 Elsevier Ltd. All rights reserved.

Experimental extraction of an entangled photon pair from two identically decohered pairs.

PubMed

Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki

2003-01-23

Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.

Aberrant gene expression in mucosa adjacent to tumor reveals a molecular crosstalk in colon cancer

PubMed Central

2014-01-01

Background A colorectal tumor is not an isolated entity growing in a restricted location of the body. The patient’s gut environment constitutes the framework where the tumor evolves and this relationship promotes and includes a complex and tight correlation of the tumor with inflammation, blood vessels formation, nutrition, and gut microbiome composition. The tumor influence in the environment could both promote an anti-tumor or a pro-tumor response. Methods A set of 98 paired adjacent mucosa and tumor tissues from colorectal cancer (CRC) patients and 50 colon mucosa from healthy donors (246 samples in total) were included in this work. RNA extracted from each sample was hybridized in Affymetrix chips Human Genome U219. Functional relationships between genes were inferred by means of systems biology using both transcriptional regulation networks (ARACNe algorithm) and protein-protein interaction networks (BIANA software). Results Here we report a transcriptomic analysis revealing a number of genes activated in adjacent mucosa from CRC patients, not activated in mucosa from healthy donors. A functional analysis of these genes suggested that this active reaction of the adjacent mucosa was related to the presence of the tumor. Transcriptional and protein-interaction networks were used to further elucidate this response of normal gut in front of the tumor, revealing a crosstalk between proteins secreted by the tumor and receptors activated in the adjacent colon tissue; and vice versa. Remarkably, Slit family of proteins activated ROBO receptors in tumor whereas tumor-secreted proteins transduced a cellular signal finally activating AP-1 in adjacent tissue. Conclusions The systems-level approach provides new insights into the micro-ecology of colorectal tumorogenesis. Disrupting this intricate molecular network of cell-cell communication and pro-inflammatory microenvironment could be a therapeutic target in CRC patients. PMID:24597571

Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

NASA Astrophysics Data System (ADS)

Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

Thermal structure of Sikhote Alin and adjacent areas based on spectral analysis of the anomalous magnetic field

NASA Astrophysics Data System (ADS)

Didenko, A. N.; Nosyrev, M. Yu.; Shevchenko, B. F.; Gilmanova, G. Z.

2017-11-01

The depth of the base of the magnetoactive layer and the geothermal gradient in the Sikhote Alin crust are estimated based on a method determining the Curie depth point of magnetoactive masses by using spectral analysis of the anomalous magnetic field. A detailed map of the geothermal gradient is constructed for the first time for the Sikhote Alin and adjacent areas of the Central Asian belt. Analysis of this map shows that the zones with a higher geothermal gradient geographically fit the areas with a higher level of seismicity.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

PubMed

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Explaining large mortality differences between adjacent counties: a cross-sectional study.

PubMed

Schootman, M; Chien, L; Yun, S; Pruitt, S L

2016-08-02

Extensive geographic variation in adverse health outcomes exists, but global measures ignore differences between adjacent geographic areas, which often have very different mortality rates. We describe a novel application of advanced spatial analysis to 1) examine the extent of differences in mortality rates between adjacent counties, 2) describe differences in risk factors between adjacent counties, and 3) determine if differences in risk factors account for the differences in mortality rates between adjacent counties. We conducted a cross-sectional study in Missouri, USA with 2005-2009 age-adjusted all-cause mortality rate as the outcome and county-level explanatory variables from a 2007 population-based survey. We used a multi-level Gaussian model and a full Bayesian approach to analyze the difference in risk factors relative to the difference in mortality rates between adjacent counties. The average mean difference in the age-adjusted mortality rate between any two adjacent counties was -3.27 (standard deviation = 95.5) per 100,000 population (maximum = 258.80). Six variables were associated with mortality differences: inability to obtain medical care because of cost (β = 2.6), hospital discharge rate (β = 1.03), prevalence of fair/poor health (β = 2.93), and hypertension (β = 4.75) and poverty prevalence (β = 6.08). Examining differences in mortality rates and associated risk factors between adjacent counties provides additional insight for future interventions to reduce geographic disparities.

Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

PubMed

Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

2015-11-30

In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

NASA Technical Reports Server (NTRS)

Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

2002-01-01

(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

PubMed Central

Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

2015-01-01

The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

Adjacent level effects of bi level disc replacement, bi level fusion and disc replacement plus fusion in cervical spine--a finite element based study.

PubMed

Faizan, Ahmad; Goel, Vijay K; Biyani, Ashok; Garfin, Steven R; Bono, Christopher M

2012-03-01

Studies delineating the adjacent level effect of single level disc replacement systems have been reported in literature. The aim of this study was to compare the adjacent level biomechanics of bi-level disc replacement, bi-level fusion and a construct having adjoining level disc replacement and fusion system. In total, biomechanics of four models- intact, bi level disc replacement, bi level fusion and fusion plus disc replacement at adjoining levels- was studied to gain insight into the effects of various instrumentation systems on cranial and caudal adjacent levels using finite element analysis (73.6N+varying moment). The bi-level fusion models are more than twice as stiff as compared to the intact model during flexion-extension, lateral bending and axial rotation. Bi-level disc replacement model required moments lower than intact model (1.5Nm). Fusion plus disc replacement model required moment 10-25% more than intact model, except in extension. Adjacent level motions, facet loads and endplate stresses increased substantially in the bi-level fusion model. On the other hand, adjacent level motions, facet loads and endplate stresses were similar to intact for the bi-level disc replacement model. For the fusion plus disc replacement model, adjacent level motions, facet loads and endplate stresses were closer to intact model rather than the bi-level fusion model, except in extension. Based on our finite element analysis, fusion plus disc replacement procedure has less severe biomechanical effects on adjacent levels when compared to bi-level fusion procedure. Bi-level disc replacement procedure did not have any adverse mechanical effects on adjacent levels. Copyright © 2011 Elsevier Ltd. All rights reserved.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

PubMed

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Wide angle sun sensor. [consisting of cylinder, insulation and pair of detectors

NASA Technical Reports Server (NTRS)

Schumacher, L. L. (Inventor)

1975-01-01

A single-axis sun sensor consists of a cylinder of an insulating material on which at least one pair of detectors is deposited on a circumference of the cylinder, was disclosed. At any time only one-half of the cylinder is illuminated so that the total resistance of the two detectors is a constant. Due to the round surface on which the detectors are deposited, the sensor exhibits a linear wide angle of + or - 50 deg to within an accuracy of about 2%. By depositing several pairs of detectors on adjacent circumferences, sufficient redundancy is realized to provide high reliability. A two-axis sensor is provided by depositing detectors on the surface of a sphere along at least two orthogonal great circles.

Exploring the Specifications of Spatial Adjacencies and Weights in Bayesian Spatial Modeling with Intrinsic Conditional Autoregressive Priors in a Small-area Study of Fall Injuries

PubMed Central

Law, Jane

2016-01-01

Intrinsic conditional autoregressive modeling in a Bayeisan hierarchical framework has been increasingly applied in small-area ecological studies. This study explores the specifications of spatial structure in this Bayesian framework in two aspects: adjacency, i.e., the set of neighbor(s) for each area; and (spatial) weight for each pair of neighbors. Our analysis was based on a small-area study of falling injuries among people age 65 and older in Ontario, Canada, that was aimed to estimate risks and identify risk factors of such falls. In the case study, we observed incorrect adjacencies information caused by deficiencies in the digital map itself. Further, when equal weights was replaced by weights based on a variable of expected count, the range of estimated risks increased, the number of areas with probability of estimated risk greater than one at different probability thresholds increased, and model fit improved. More importantly, significance of a risk factor diminished. Further research to thoroughly investigate different methods of variable weights; quantify the influence of specifications of spatial weights; and develop strategies for better defining spatial structure of a map in small-area analysis in Bayesian hierarchical spatial modeling is recommended. PMID:29546147

Accurate segmenting of cervical tumors in PET imaging based on similarity between adjacent slices.

PubMed

Chen, Liyuan; Shen, Chenyang; Zhou, Zhiguo; Maquilan, Genevieve; Thomas, Kimberly; Folkert, Michael R; Albuquerque, Kevin; Wang, Jing

2018-06-01

Because in PET imaging cervical tumors are close to the bladder with high capacity for the secreted 18 FDG tracer, conventional intensity-based segmentation methods often misclassify the bladder as a tumor. Based on the observation that tumor position and area do not change dramatically from slice to slice, we propose a two-stage scheme that facilitates segmentation. In the first stage, we used a graph-cut based algorithm to obtain initial contouring of the tumor based on local similarity information between voxels; this was achieved through manual contouring of the cervical tumor on one slice. In the second stage, initial tumor contours were fine-tuned to more accurate segmentation by incorporating similarity information on tumor shape and position among adjacent slices, according to an intensity-spatial-distance map. Experimental results illustrate that the proposed two-stage algorithm provides a more effective approach to segmenting cervical tumors in 3D 18 FDG PET images than the benchmarks used for comparison. Copyright © 2018 Elsevier Ltd. All rights reserved.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

PubMed

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

NASA Astrophysics Data System (ADS)

Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

2018-03-01

In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

PubMed

Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

2004-12-01

Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

PubMed

Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

2014-08-15

We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

PubMed

Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

2011-12-01

We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

A paired-watershed budget study to quantify interbasin groundwater flow in a lowland rain forest, Costa Rica

NASA Astrophysics Data System (ADS)

Genereux, David P.; Jordan, Michael T.; Carbonell, David

2005-04-01

A paired-watershed budget study was used to quantify the annual water and major ion (sodium, potassium, magnesium, calcium, chloride, and sulfate) budgets of two adjacent lowland rain forest watersheds in Costa Rica. Interbasin groundwater flow (IGF) accounted for about two thirds of the water input and about 97% of the solute input (an average over the six major ions) to one watershed but little or none of the inputs to the adjacent watershed in which IGF was at most marginally distinguishable from zero. Results underscore the significance of IGF as a potential control on the hydrology and water quality of lowland watersheds, the spatial complexity of its occurrence in lowlands (where its influence may range from dominating to negligible on adjacent watersheds), and the importance of accounting for IGF in the design and execution of watershed studies and in water management.

Adjacent-Categories Mokken Models for Rater-Mediated Assessments

PubMed Central

Wind, Stefanie A.

2016-01-01

Molenaar extended Mokken’s original probabilistic-nonparametric scaling models for use with polytomous data. These polytomous extensions of Mokken’s original scaling procedure have facilitated the use of Mokken scale analysis as an approach to exploring fundamental measurement properties across a variety of domains in which polytomous ratings are used, including rater-mediated educational assessments. Because their underlying item step response functions (i.e., category response functions) are defined using cumulative probabilities, polytomous Mokken models can be classified as cumulative models based on the classifications of polytomous item response theory models proposed by several scholars. In order to permit a closer conceptual alignment with educational performance assessments, this study presents an adjacent-categories variation on the polytomous monotone homogeneity and double monotonicity models. Data from a large-scale rater-mediated writing assessment are used to illustrate the adjacent-categories approach, and results are compared with the original formulations. Major findings suggest that the adjacent-categories models provide additional diagnostic information related to individual raters’ use of rating scale categories that is not observed under the original formulation. Implications are discussed in terms of methods for evaluating rating quality. PMID:29795916

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

PubMed

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

PubMed Central

van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

1997-01-01

The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

NASA Astrophysics Data System (ADS)

Andreozzi, F.; Covello, A.; Gargano, A.; Ye, Liu Jian; Porrino, A.

1985-07-01

The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v=0, v=1, and v=2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states.

VIEW OF LAMP FIXTURE (EXTERIOR) ADJACENT TO ENTRANCE AT SOUTHWEST ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

VIEW OF LAMP FIXTURE (EXTERIOR) ADJACENT TO ENTRANCE AT SOUTHWEST CORNER OF BUILDING 23, FACING NORTH - Roosevelt Base, Auditorium-Gymnasium, West Virginia Street between Richardson & Reeves Avenues, Long Beach, Los Angeles County, CA

OBLIQUE OF SOUTHWEST END AND SOUTHEAST SIDE, WITH ADJACENT FACILITY ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

OBLIQUE OF SOUTHWEST END AND SOUTHEAST SIDE, WITH ADJACENT FACILITY 391 IN THE FOREGROUND. - U.S. Naval Base, Pearl Harbor, Joint Intelligence Center, Makalapa Drive in Makalapa Administration Area, Pearl City, Honolulu County, HI

View from water showing south facade and adjacent boat slips ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

View from water showing south facade and adjacent boat slips (Facility Nos. S375 & S376) - U.S. Naval Base, Pearl Harbor, Boat House, Hornet Avenue at Independence Street, Pearl City, Honolulu County, HI

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

PubMed Central

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2013-01-01

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

Efficient Implementation of the Pairing on Mobilephones Using BREW

NASA Astrophysics Data System (ADS)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

PubMed

Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

2018-06-04

Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The solvability of quantum k-pair network in a measurement-based way.

PubMed

Li, Jing; Xu, Gang; Chen, Xiu-Bo; Qu, Zhiguo; Niu, Xin-Xin; Yang, Yi-Xian

2017-12-01

Network coding is an effective means to enhance the communication efficiency. The characterization of network solvability is one of the most important topic in this field. However, for general network, the solvability conditions are still a challenge. In this paper, we consider the solvability of general quantum k-pair network in measurement-based framework. For the first time, a detailed account of measurement-based quantum network coding(MB-QNC) is specified systematically. Differing from existing coding schemes, single qubit measurements on a pre-shared graph state are the only allowed coding operations. Since no control operations are concluded, it makes MB-QNC schemes more feasible. Further, the sufficient conditions formulating by eigenvalue equations and stabilizer matrix are presented, which build an unambiguous relation among the solvability and the general network. And this result can also analyze the feasibility of sharing k EPR pairs task in large-scale networks. Finally, in the presence of noise, we analyze the advantage of MB-QNC in contrast to gate-based way. By an instance network [Formula: see text], we show that MB-QNC allows higher error thresholds. Specially, for X error, the error threshold is about 30% higher than 10% in gate-based way. In addition, the specific expressions of fidelity subject to some constraint conditions are given.

To pair or not to pair: chromosome pairing and evolution.

PubMed

Moore, G

1998-04-01

Chromosome pairing in wild-type wheat closely resembles the process in both yeast and Drosophila. The recent characterisation of a mutant Ph1 wheat and the observation that chromosome pairing in the absence of Ph1 more closely resembles that of mammals and maize has shed light on the evolution of chromosome pairing in the cereals.

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

PubMed Central

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

PubMed Central

Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

2016-01-01

The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

PubMed Central

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Adjacent-level arthroplasty following cervical fusion.

PubMed

Rajakumar, Deshpande V; Hari, Akshay; Krishna, Murali; Konar, Subhas; Sharma, Ankit

2017-02-01

-up period. CONCLUSIONS Artificial cervical disc replacement in patients who have previously undergone cervical fusion surgery appears to be safe, with encouraging early clinical results based on this small case series, but more data from larger numbers of patients with long-term follow-up are needed. Arthroplasty may provide an additional tool for the management of post-fusion adjacent-level cervical disc disease in carefully selected patients.

Unusual paired pattern of radiohaloes on a diamond crystal from Guaniamo (Venezuela)

NASA Astrophysics Data System (ADS)

Schulze, Daniel J.; Nasdala, Lutz

2016-11-01

An octahedral diamond crystal from Guaniamo, Venezuela shows a multitude of round radiocolouration spots that indicate a remarkable formation history. Spots always occur in pairs, with similar spacing and intensity ratio between the two spots of each pair. We interpret this pattern to be the result of long-term irradiation of the stone emanating from a multitude of radioactive point sources. At some point during the irradiation, the stone must have experienced a translational movement which shifted it ca. 50 μm relative to the adjacent material [i.e., the (111) crystal face was a fault plane], after which irradiation continued. The Neoproterozoic age of the Guaniamo kimberlites and the high degree of radiation damage suggest that both of the two irradiation periods lasted over hundreds of millions of years. This interpretation is supported by results of He-irradiation experiments.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

PubMed Central

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

PubMed

Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

2007-02-15

Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

PubMed Central

Triman, K L

1995-01-01

Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

Array-Based Discovery of Aptamer Pairs

DTIC Science & Technology

2014-12-11

affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND

Quantum coordinated multi-point communication based on entanglement swapping

NASA Astrophysics Data System (ADS)

Du, Gang; Shang, Tao; Liu, Jian-wei

2017-05-01

In a quantum network, adjacent nodes can communicate with each other point to point by using pre-shared Einsten-Podolsky-Rosen (EPR) pairs, and furthermore remote nodes can establish entanglement channels by using quantum routing among intermediate nodes. However, with the rapid development of quantum networks, the demand of various message transmission among nodes inevitably emerges. In order to realize this goal and extend quantum networks, we propose a quantum coordinated multi-point communication scheme based on entanglement swapping. The scheme takes full advantage of EPR pairs between adjacent nodes and performs multi-party entanglement swapping to transmit messages. Considering various demands of communication, all nodes work cooperatively to realize different message transmission modes, including one to many, many to one and one to some. Scheme analysis shows that the proposed scheme can flexibly organize a coordinated group and efficiently use EPR resources, while it meets basic security requirement under the condition of coordinated communication.

pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

PubMed

Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

2017-11-15

The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

A terrain-based paired-site sampling design to assess biodiversity losses from eastern hemlock decline

USGS Publications Warehouse

Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.

2002-01-01

Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

NASA Astrophysics Data System (ADS)

Brancolini, Giorgia; Di Felice, Rosa

2011-05-01

Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

PubMed Central

2011-01-01

Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

47 CFR 101.1421 - Coordination of adjacent area MVDDS stations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... SPECIAL RADIO SERVICES FIXED MICROWAVE SERVICES Multichannel Video Distribution and Data Service Rules for... compatible with adjacent and co-channel operations in the adjacent areas on all its frequencies; and (2... adjacent and co-channel operations in adjacent areas. (b) Harmful interference to public safety stations...

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

PubMed

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

PubMed

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

PubMed

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Detection of figure and caption pairs based on disorder measurements

NASA Astrophysics Data System (ADS)

Faure, Claudie; Vincent, Nicole

2010-01-01

Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.

Assessing the recharge process and importance of montane water to adjacent tectonic valley-plain groundwater using a ternary end-member mixing analysis based on isotopic and chemical tracers

NASA Astrophysics Data System (ADS)

Peng, Tsung-Ren; Zhan, Wen-Jun; Tong, Lun-Tao; Chen, Chi-Tsun; Liu, Tsang-Sen; Lu, Wan-Chung

2018-03-01

A study in eastern Taiwan evaluated the importance of montane water contribution (MC) to adjacent valley-plain groundwater (VPG) in a tectonic suture zone. The evaluation used a ternary natural-tracer-based end-member mixing analysis (EMMA). With this purpose, VPG and three end-member water samples of plain precipitation (PP), mountain-front recharge (MFR), and mountain-block recharge (MBR) were collected and analyzed for stable isotopic compositions (δ 2H and δ 18O) and chemical concentrations (electrical conductivity (EC) and Cl-). After evaluation, Cl- is deemed unsuitable for EMMA in this study, and the contribution fractions of respective end members derived by the δ 18O-EC pair are similar to those derived by the δ 2H-EC pair. EMMA results indicate that the MC, including MFR and MBR, contributes at least 70% (679 × 106 m3 water volume) of the VPG, significantly greater than the approximately 30% of PP contribution, and greater than the 20-50% in equivalent humid regions worldwide. The large MC is attributable to highly fractured strata and the steep topography of studied catchments caused by active tectonism. Furthermore, the contribution fractions derived by EMMA reflect the unique hydrogeological conditions in the respective study sub-regions. A region with a large MBR fraction is indicative of active lateral groundwater flow as a result of highly fractured strata in montane catchments. On the other hand, a region characterized by a large MFR fraction may possess high-permeability stream beds or high stream gradients. Those hydrogeological implications are helpful for water resource management and protection authorities of the studied regions.

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

NASA Astrophysics Data System (ADS)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

33 CFR 80.1395 - Puget Sound and adjacent waters.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

33 CFR 80.1395 - Puget Sound and adjacent waters.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

33 CFR 80.1395 - Puget Sound and adjacent waters.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

33 CFR 80.1395 - Puget Sound and adjacent waters.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

33 CFR 80.1395 - Puget Sound and adjacent waters.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Puget Sound and adjacent waters... INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Thirteenth District § 80.1395 Puget Sound and adjacent waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

NASA Astrophysics Data System (ADS)

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-01

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

Cryopreserved embryo transfer: adjacent or non-adjacent to failed fresh long GnRH-agonist protocol IVF cycle.

PubMed

Volodarsky-Perel, Alexander; Eldar-Geva, Talia; Holzer, Hananel E G; Schonberger, Oshrat; Reichman, Orna; Gal, Michael

2017-03-01

The optimal time to perform cryopreserved embryo transfer (CET) after a failed oocyte retrieval-embryo transfer (OR-ET) cycle is unknown. Similar clinical pregnancy rates were recently reported in immediate and delayed CET, performed after failed fresh OR-ET, in cycles with the gonadotrophin-releasing hormone (GnRH) antagonist protocol. This study compared outcomes of CET performed adjacently (<50 days, n = 67) and non-adjacently (≥50 to 120 days, n = 62) to the last OR-day of cycles with the GnRH agonist down-regulation protocol. Additional inclusion criteria were patients' age 20-38 years, the transfer of only 1-2 cryopreserved embryos, one treatment cycle per patient and artificial preparation for CET. Significantly higher implantation, clinical pregnancy and live birth rates were found in the non-adjacent group than in the adjacent group: 30.5% versus 11.3% (P = 0.001), 41.9% versus 17.9% (P = 0.003) and 32.3% versus 13.4% (P = 0.01), respectively. These results support the postponement of CET after a failed OR-ET for at least one menstrual cycle, when a preceding long GnRH-agonist protocol is used. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Lessons learned for applying a paired-catchment approach in drought analysis

NASA Astrophysics Data System (ADS)

Van Loon, Anne; Rangecroft, Sally; Coxon, Gemma; Agustín Breña Naranjo, José; Van Ogtrop, Floris; Croghan, Danny; Van Lanen, Henny

2017-04-01

by human activities. This issue can generally be overcome by selecting adjacent or nearby catchments. Finally, we found that geology is much more important for paired-catchment analysis of drought than we anticipated based upon the experiences in flood research. For example, in two of the UK pairs, we could not use the results due to differences in geology overruling the human influence. We learned that in the selection of catchments for drought analysis, (hydro)geology should be considered in even more detail. Taking these aspects into account, we concluded that the paired-catchment approach works for evaluating the effects of reservoirs and groundwater abstraction on streamflow drought, but is more challenging for urbanisation. The reasons are more problems in catchment selection, lack of results, and complexity of processes making attribution more difficult. Urbanisation is not a simple land cover change influencing only infiltration and runoff, but it involves all kinds of indirect effects, such as artificial inputs (drainage, sewage return flows) that are very important during low flow periods. For this we would suggest starting in small, well-measured urban catchments, of which all artificial inputs are known. We believe that with the careful selection criteria and accounting for variations in climate and landscape, there is scope for using a paired-catchment approach in hydrological drought research.

Uplink scheduling and adjacent-channel coupling loss analysis for TD-LTE deployment.

PubMed

Yeo, Woon-Young; Moon, Sung Ho; Kim, Jae-Hoon

2014-01-01

TD-LTE, one of the two duplexing modes in LTE, operates in unpaired spectrum and has the advantages of TDD-based technologies. It is expected that TD-LTE will be more rapidly deployed in near future and most of WiMax operators will upgrade their networks to TD-LTE gradually. Before completely upgrading to TD-LTE, WiMax may coexist with TD-LTE in an adjacent frequency band. In addition, multiple TD-LTE operators may deploy their networks in adjacent bands. When more than one TDD network operates in adjacent frequency bands, severe interference may happen due to adjacent channel interference (ACI) and unsynchronized operations. In this paper, coexistence issues between TD-LTE and other systems are analyzed and coexistence requirements are provided. This paper has three research objectives. First, frame synchronization between TD-LTE and WiMax is discussed by investigating possible combinations of TD-LTE and WiMax configurations. Second, an uplink scheduling algorithm is proposed to utilize a leakage pattern of ACI in synchronized operations. Third, minimum requirements for coexistence in unsynchronized operations are analyzed by introducing a concept of adjacent-channel coupling loss. From the analysis and simulation results, we can see that coexistence of TD-LTE with other TDD systems is feasible if the two networks are synchronized. For the unsynchronized case, some special cell-site engineering techniques may be required to reduce the ACI.

Field-enhanced route to generating anti-Frenkel pairs in HfO2

NASA Astrophysics Data System (ADS)

Schie, Marcel; Menzel, Stephan; Robertson, John; Waser, Rainer; De Souza, Roger A.

2018-03-01

The generation of anti-Frenkel pairs (oxygen vacancies and oxygen interstitials) in monoclinic and cubic HfO2 under an applied electric field is examined. A thermodynamic model is used to derive an expression for the critical field strength required to generate an anti-Frenkel pair. The critical field strength of EaFcr˜101GVm-1 obtained for HfO2 exceeds substantially the field strengths routinely employed in the forming and switching operations of resistive switching HfO2 devices, suggesting that field-enhanced defect generation is negligible. Atomistic simulations with molecular static (MS) and molecular dynamic (MD) approaches support this finding. The MS calculations indicated a high formation energy of Δ EaF≈8 eV for the infinitely separated anti-Frenkel pair, and only a decrease to Δ EaF≈6 eV for the adjacent anti-Frenkel pair. The MD simulations showed no defect generation in either phase for E <3 GVm-1 , and only sporadic defect generation in the monoclinic phase (at E =3 GVm-1 ) with fast (trec<4 ps ) recombination. At even higher E but below EaFcr both monoclinic and cubic structures became unstable as a result of field-induced deformation of the ionic potential wells. Further MD investigations starting with preexisting anti-Frenkel pairs revealed recombination of all pairs within trec<1 ps , even for the case of neutral vacancies and charged interstitials, for which formally there is no electrostatic attraction between the defects. In conclusion, we find no physically reasonable route to generating point-defects in HfO2 by an applied field.

Electron pairing without superconductivity

NASA Astrophysics Data System (ADS)

Levy, Jeremy

Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

Prospective very young asteroid pairs

NASA Astrophysics Data System (ADS)

Galád, A.; Vokrouhlický, D.; Zizka, J.

2014-07-01

Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

PubMed

Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

2018-04-27

Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

A novel hazard assessment method for biomass gasification stations based on extended set pair analysis

PubMed Central

Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

2017-01-01

Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011

Biomechanical effects of hybrid stabilization on the risk of proximal adjacent-segment degeneration following lumbar spinal fusion using an interspinous device or a pedicle screw-based dynamic fixator.

PubMed

Lee, Chang-Hyun; Kim, Young Eun; Lee, Hak Joong; Kim, Dong Gyu; Kim, Chi Heon

2017-12-01

OBJECTIVE Pedicle screw-rod-based hybrid stabilization (PH) and interspinous device-based hybrid stabilization (IH) have been proposed to prevent adjacent-segment degeneration (ASD) and their effectiveness has been reported. However, a comparative study based on sound biomechanical proof has not yet been reported. The aim of this study was to compare the biomechanical effects of IH and PH on the transition and adjacent segments. METHODS A validated finite element model of the normal lumbosacral spine was used. Based on the normal model, a rigid fusion model was immobilized at the L4-5 level by a rigid fixator. The DIAM or NFlex model was added on the L3-4 segment of the fusion model to construct the IH and PH models, respectively. The developed models simulated 4 different loading directions using the hybrid loading protocol. RESULTS Compared with the intact case, fusion on L4-5 produced 18.8%, 9.3%, 11.7%, and 13.7% increments in motion at L3-4 under flexion, extension, lateral bending, and axial rotation, respectively. Additional instrumentation at L3-4 (transition segment) in hybrid models reduced motion changes at this level. The IH model showed 8.4%, -33.9%, 6.9%, and 2.0% change in motion at the segment, whereas the PH model showed -30.4%, -26.7%, -23.0%, and 12.9%. At L2-3 (adjacent segment), the PH model showed 14.3%, 3.4%, 15.0%, and 0.8% of motion increment compared with the motion in the IH model. Both hybrid models showed decreased intradiscal pressure (IDP) at the transition segment compared with the fusion model, but the pressure at L2-3 (adjacent segment) increased in all loading directions except under extension. CONCLUSIONS Both IH and PH models limited excessive motion and IDP at the transition segment compared with the fusion model. At the segment adjacent to the transition level, PH induced higher stress than IH model. Such differences may eventually influence the likelihood of ASD.

Influence of ion pairing in ionic liquids on electrical double layer structures and surface force using classical density functional approach.

PubMed

Ma, Ke; Forsman, Jan; Woodward, Clifford E

2015-05-07

We explore the influence of ion pairing in room temperature ionic liquids confined by planar electrode surfaces. Using a coarse-grained model for the aromatic ionic liquid [C4MIM(+)][BF4 (-)], we account for an ion pairing component as an equilibrium associating species within a classical density functional theory. We investigated the resulting structure of the electrical double layer as well as the ensuing surface forces and differential capacitance, as a function of the degree of ion association. We found that the short-range structure adjacent to surfaces was remarkably unaffected by the degree of ion pairing, up to several molecular diameters. This was even the case for 100% of ions being paired. The physical implications of ion pairing only become apparent in equilibrium properties that depend upon the long-range screening of charges, such as the asymptotic behaviour of surface forces and the differential capacitance, especially at low surface potential. The effect of ion pairing on capacitance is consistent with their invocation as a source of the anomalous temperature dependence of the latter. This work shows that ion pairing effects on equilibrium properties are subtle and may be difficult to extract directly from simulations.

Development of improved connection details for adjacent prestressed member bridges.

DOT National Transportation Integrated Search

2017-06-01

Adjacent prestressed member girder bridges are economical systems for short spans and generally come in two types: adjacent box beam bridges and adjacent voided slab bridges. Each type provides the advantages of having low clearances because of their...

The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

PubMed Central

Przybilski, Rita; Hammann, Christian

2007-01-01

Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

Improved connection details for adjacent prestressed bridge beams.

DOT National Transportation Integrated Search

2015-03-01

Bridges with adjacent box beams and voided slabs are simply and rapidly constructed, and are well suited to : short to medium spans. The traditional connection between the adjacent members is a shear key lled with a : conventional non-shrink grout...

High quality image-pair-based deblurring method using edge mask and improved residual deconvolution

NASA Astrophysics Data System (ADS)

Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting

2017-04-01

Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

PubMed

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

PubMed

Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

2018-07-05

The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

PubMed

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

PubMed

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

PubMed

Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

2017-09-01

Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

Uplink Scheduling and Adjacent-Channel Coupling Loss Analysis for TD-LTE Deployment

PubMed Central

Yeo, Woon-Young; Moon, Sung Ho

2014-01-01

TD-LTE, one of the two duplexing modes in LTE, operates in unpaired spectrum and has the advantages of TDD-based technologies. It is expected that TD-LTE will be more rapidly deployed in near future and most of WiMax operators will upgrade their networks to TD-LTE gradually. Before completely upgrading to TD-LTE, WiMax may coexist with TD-LTE in an adjacent frequency band. In addition, multiple TD-LTE operators may deploy their networks in adjacent bands. When more than one TDD network operates in adjacent frequency bands, severe interference may happen due to adjacent channel interference (ACI) and unsynchronized operations. In this paper, coexistence issues between TD-LTE and other systems are analyzed and coexistence requirements are provided. This paper has three research objectives. First, frame synchronization between TD-LTE and WiMax is discussed by investigating possible combinations of TD-LTE and WiMax configurations. Second, an uplink scheduling algorithm is proposed to utilize a leakage pattern of ACI in synchronized operations. Third, minimum requirements for coexistence in unsynchronized operations are analyzed by introducing a concept of adjacent-channel coupling loss. From the analysis and simulation results, we can see that coexistence of TD-LTE with other TDD systems is feasible if the two networks are synchronized. For the unsynchronized case, some special cell-site engineering techniques may be required to reduce the ACI. PMID:24707214

RASSF1A promoter methylation in high-grade serous ovarian cancer: A direct comparison study in primary tumors, adjacent morphologically tumor cell-free tissues and paired circulating tumor DNA.

PubMed

Giannopoulou, Lydia; Chebouti, Issam; Pavlakis, Kitty; Kasimir-Bauer, Sabine; Lianidou, Evi S

2017-03-28

The RASSF1A promoter is frequently methylated in high-grade serous ovarian cancer (HGSC). We examined RASSF1A promoter methylation in primary tumors, adjacent morphologically tumor cell-free tissues and corresponding circulating tumor DNA (ctDNA) samples of patients with HGSC, using a real-time methylation specific PCR (real-time MSP) and a methylation-sensitive high-resolution melting analysis (MS-HRMA) assay for the detection and semi-quantitative estimation of methylation, respectively. Two groups of primary HGSC tumor FFPE samples were recruited (Group A n=67 and Group B n=61), along with matched adjacent morphologically tumor cell-free tissues (n=58) and corresponding plasma samples (n=59) for group B. Using both assays, RASSF1A promoter was found highly methylated in primary tumors of both groups, and at lower percentages in the adjacent morphologically tumor cell-free tissues. Interestingly, RASSF1A promoter methylation was also observed in ctDNA by real-time MSP. Overall survival (OS) was significantly associated with RASSF1A promoter methylation in primary tumor samples using MS-HRMA (P=0.023). Our results clearly indicate that RASSF1A promoter is methylated in adjacent tissue surrounding the tumor in HGSC patients. We report for the first time that RASSF1A promoter methylation provides significant prognostic information in HGSC patients.

RASSF1A promoter methylation in high-grade serous ovarian cancer: A direct comparison study in primary tumors, adjacent morphologically tumor cell-free tissues and paired circulating tumor DNA

PubMed Central

Giannopoulou, Lydia; Chebouti, Issam; Pavlakis, Kitty; Kasimir-Bauer, Sabine; Lianidou, Evi S.

2017-01-01

The RASSF1A promoter is frequently methylated in high-grade serous ovarian cancer (HGSC). We examined RASSF1A promoter methylation in primary tumors, adjacent morphologically tumor cell-free tissues and corresponding circulating tumor DNA (ctDNA) samples of patients with HGSC, using a real-time methylation specific PCR (real-time MSP) and a methylation-sensitive high-resolution melting analysis (MS-HRMA) assay for the detection and semi-quantitative estimation of methylation, respectively. Two groups of primary HGSC tumor FFPE samples were recruited (Group A n=67 and Group B n=61), along with matched adjacent morphologically tumor cell-free tissues (n=58) and corresponding plasma samples (n=59) for group B. Using both assays, RASSF1A promoter was found highly methylated in primary tumors of both groups, and at lower percentages in the adjacent morphologically tumor cell-free tissues. Interestingly, RASSF1A promoter methylation was also observed in ctDNA by real-time MSP. Overall survival (OS) was significantly associated with RASSF1A promoter methylation in primary tumor samples using MS-HRMA (P=0.023). Our results clearly indicate that RASSF1A promoter is methylated in adjacent tissue surrounding the tumor in HGSC patients. We report for the first time that RASSF1A promoter methylation provides significant prognostic information in HGSC patients. PMID:28206954

Exploiting Bounded Signal Flow for Graph Orientation Based on Cause-Effect Pairs

NASA Astrophysics Data System (ADS)

Dorn, Britta; Hüffner, Falk; Krüger, Dominikus; Niedermeier, Rolf; Uhlmann, Johannes

We consider the following problem: Given an undirected network and a set of sender-receiver pairs, direct all edges such that the maximum number of "signal flows" defined by the pairs can be routed respecting edge directions. This problem has applications in communication networks and in understanding protein interaction based cell regulation mechanisms. Since this problem is NP-hard, research so far concentrated on polynomial-time approximation algorithms and tractable special cases. We take the viewpoint of parameterized algorithmics and examine several parameters related to the maximum signal flow over vertices or edges. We provide several fixed-parameter tractability results, and in one case a sharp complexity dichotomy between a linear-time solvable case and a slightly more general NP-hard case. We examine the value of these parameters for several real-world network instances. For many relevant cases, the NP-hard problem can be solved to optimality. In this way, parameterized analysis yields both deeper insight into the computational complexity and practical solving strategies.

Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

PubMed

Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

2018-06-15

Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

PubMed

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

An efficient and near linear scaling pair natural orbital based local coupled cluster method.

PubMed

Riplinger, Christoph; Neese, Frank

2013-01-21

In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on

Pick a Pair. Pancake Pairs

ERIC Educational Resources Information Center

Miller, Pat

2005-01-01

Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

PubMed

Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

2018-04-18

Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

Evaluation of spatial variability of soil arsenic adjacent to a disused cattle-dip site, using model-based geostatistics.

PubMed

Niazi, Nabeel K; Bishop, Thomas F A; Singh, Balwant

2011-12-15

This study investigated the spatial variability of total and phosphate-extractable arsenic (As) concentrations in soil adjacent to a cattle-dip site, employing a linear mixed model-based geostatistical approach. The soil samples in the study area (n = 102 in 8.1 m(2)) were taken at the nodes of a 0.30 × 0.35 m grid. The results showed that total As concentration (0-0.2 m depth) and phosphate-extractable As concentration (at depths of 0-0.2, 0.2-0.4, and 0.4-0.6 m) in soil adjacent to the dip varied greatly. Both total and phosphate-extractable soil As concentrations significantly (p = 0.004-0.048) increased toward the cattle-dip. Using the linear mixed model, we suggest that 5 samples are sufficient to assess a dip site for soil (As) contamination (95% confidence interval of ±475.9 mg kg(-1)), but 15 samples (95% confidence interval of ±212.3 mg kg(-1)) is desirable baseline when the ultimate goal is to evaluate the effects of phytoremediation. Such guidelines on sampling requirements are crucial for the assessment of As contamination levels at other cattle-dip sites, and to determine the effect of phytoremediation on soil As.

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

PubMed Central

Cotton, R G; Rodrigues, N R; Campbell, R D

1988-01-01

The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

Centromere pairing precedes meiotic chromosome pairing in plants.

PubMed

Zhang, Jing; Han, Fangpu

2017-11-01

Meiosis is a specialized eukaryotic cell division, in which diploid cells undergo a single round of DNA replication and two rounds of nuclear division to produce haploid gametes. In most eukaryotes, the core events of meiotic prophase I are chromosomal pairing, synapsis and recombination. To ensure accurate chromosomal segregation, homologs have to identify and align along each other at the onset of meiosis. Although much progress has been made in elucidating meiotic processes, information on the mechanisms underlying chromosome pairing is limited in contrast to the meiotic recombination and synapsis events. Recent research in many organisms indicated that centromere interactions during early meiotic prophase facilitate homologous chromosome pairing, and functional centromere is a prerequisite for centromere pairing such as in maize. Here, we summarize the recent achievements of chromosome pairing research on plants and other organisms, and outline centromere interactions, nuclear chromosome orientation, and meiotic cohesin, as main determinants of chromosome pairing in early meiotic prophase.

Solid frustrated-Lewis-pair catalysts constructed by regulations on surface defects of porous nanorods of CeO2

PubMed Central

Zhang, Sai; Huang, Zheng-Qing; Ma, Yuanyuan; Gao, Wei; Li, Jing; Cao, Fangxian; Li, Lin; Chang, Chun-Ran; Qu, Yongquan

2017-01-01

Identification on catalytic sites of heterogeneous catalysts at atomic level is important to understand catalytic mechanism. Surface engineering on defects of metal oxides can construct new active sites and regulate catalytic activity and selectivity. Here we outline the strategy by controlling surface defects of nanoceria to create the solid frustrated Lewis pair (FLP) metal oxide for efficient hydrogenation of alkenes and alkynes. Porous nanorods of ceria (PN-CeO2) with a high concentration of surface defects construct new Lewis acidic sites by two adjacent surface Ce3+. The neighbouring surface lattice oxygen as Lewis base and constructed Lewis acid create solid FLP site due to the rigid lattice of ceria, which can easily dissociate H–H bond with low activation energy of 0.17 eV. PMID:28516952

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

PubMed

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

PubMed Central

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

NASA Astrophysics Data System (ADS)

Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

2017-07-01

Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

Determination of lateral effects of borrow pits on hydrology of adjacent wetlands.

DOT National Transportation Integrated Search

2007-09-28

A three year research project was conducted to develop and test a method to predict the distance borrow pits should : be set back from adjacent wetlands to avoid detrimental impacts on wetland hydrology. The method is based on the : Boussinesq equati...

33 CFR 334.730 - Waters of Santa Rosa Sound and Gulf of Mexico adjacent to Santa Rosa Island, Armament Center...

Code of Federal Regulations, 2014 CFR

2014-07-01

... Gulf of Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. 334.730... Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. (a) The areas—(1) The... CFR part 329, including the waters of Santa Rosa Sound and Gulf of Mexico within a circle one nautical...

33 CFR 334.730 - Waters of Santa Rosa Sound and Gulf of Mexico adjacent to Santa Rosa Island, Armament Center...

Code of Federal Regulations, 2013 CFR

2013-07-01

... Gulf of Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. 334.730... Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. (a) The areas—(1) The... CFR part 329, including the waters of Santa Rosa Sound and Gulf of Mexico within a circle one nautical...

33 CFR 334.730 - Waters of Santa Rosa Sound and Gulf of Mexico adjacent to Santa Rosa Island, Armament Center...

Code of Federal Regulations, 2012 CFR

2012-07-01

... Gulf of Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. 334.730... Mexico adjacent to Santa Rosa Island, Armament Center, Eglin Air Force Base, Fla. (a) The areas—(1) The... CFR part 329, including the waters of Santa Rosa Sound and Gulf of Mexico within a circle one nautical...

Delayed Acquisition of Non-Adjacent Vocalic Distributional Regularities

ERIC Educational Resources Information Center

Gonzalez-Gomez, Nayeli; Nazzi, Thierry

2016-01-01

The ability to compute non-adjacent regularities is key in the acquisition of a new language. In the domain of phonology/phonotactics, sensitivity to non-adjacent regularities between consonants has been found to appear between 7 and 10 months. The present study focuses on the emergence of a posterior-anterior (PA) bias, a regularity involving two…

A New Scheme for the Design of Hilbert Transform Pairs of Biorthogonal Wavelet Bases

NASA Astrophysics Data System (ADS)

Shi, Hongli; Luo, Shuqian

2010-12-01

In designing the Hilbert transform pairs of biorthogonal wavelet bases, it has been shown that the requirements of the equal-magnitude responses and the half-sample phase offset on the lowpass filters are the necessary and sufficient condition. In this paper, the relationship between the phase offset and the vanishing moment difference of biorthogonal scaling filters is derived, which implies a simple way to choose the vanishing moments so that the phase response requirement can be satisfied structurally. The magnitude response requirement is approximately achieved by a constrained optimization procedure, where the objective function and constraints are all expressed in terms of the auxiliary filters of scaling filters rather than the scaling filters directly. Generally, the calculation burden in the design implementation will be less than that of the current schemes. The integral of magnitude response difference between the primal and dual scaling filters has been chosen as the objective function, which expresses the magnitude response requirements in the whole frequency range. Two design examples illustrate that the biorthogonal wavelet bases designed by the proposed scheme are very close to Hilbert transform pairs.

P300/CBP acts as a coactivator to cartilage homeoprotein-1 (Cart1), paired-like homeoprotein, through acetylation of the conserved lysine residue adjacent to the homeodomain.

PubMed

Iioka, Takashi; Furukawa, Keizo; Yamaguchi, Akira; Shindo, Hiroyuki; Yamashita, Shunichi; Tsukazaki, Tomoo

2003-08-01

The paired-like homeoprotein, Cart1, is involved in skeletal development. We describe here that the general coactivator p300/CBP controls the transcription activity of Cart1 through acetylation of a lysine residue that is highly conserved in other homeoproteins. Acetylation of this residue increases the interaction between p300/CBP and Cart1 and enhances its transcriptional activation. Cart1 encodes a paired-like homeoprotein expressed selectively in chondrocyte lineage during embryonic development. Although its target gene remains unknown, gene disruption studies have revealed that Cart1 plays an important role for craniofacial bone formation as well as limb development by cooperating with another homeoprotein, Alx4. In this report, we study the functional involvement of p300/CBP, coactivators with intrinsic histone acetyltransferase (HAT) activity, in the transcriptional control of Cart1. To study the transcription activity of Cart1, a reporter construct containing a putative Cart1 binding site was transiently transfected with the expression vectors of each protein. The interaction between p300/CBP and Cart1 was investigated by glutathione S-transferase (GST) pull-down, yeast two-hybrid, and immunoprecipitation assays. In vitro acetylation assay was performed with the recombinant p300-HAT domain and Cart1 in the presence of acetyl-CoA. p300 and CBP stimulate Cart1-dependent transcription activity, and this transactivation is inhibited by E1A and Tax, oncoproteins that suppress the activity of p300/CBP. Cart1 binds to p300 in vivo and in vitro, and this requires the homeodomain of Cart 1 and N-terminal 139 amino acids of p300. Confocal microscopy analysis shows that Cart1 recruits overexpressed and endogenous p300 to a Cart1-specific subnuclear compartment. Cart1 is acetylated in vivo and sodium butyrate and trichostatin A, histone deacetylase inhibitors, markedly enhance the transcription activity of Cart1. Deletion and mutagenesis analysis identifies the 131st

Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

PubMed Central

Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

1987-01-01

We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

A qualitative signature for early diagnosis of hepatocellular carcinoma based on relative expression orderings.

PubMed

Ao, Lu; Zhang, Zimei; Guan, Qingzhou; Guo, Yating; Guo, You; Zhang, Jiahui; Lv, Xingwei; Huang, Haiyan; Zhang, Huarong; Wang, Xianlong; Guo, Zheng

2018-04-23

Currently, using biopsy specimens to confirm suspicious liver lesions of early hepatocellular carcinoma are not entirely reliable because of insufficient sampling amount and inaccurate sampling location. It is necessary to develop a signature to aid early hepatocellular carcinoma diagnosis using biopsy specimens even when the sampling location is inaccurate. Based on the within-sample relative expression orderings of gene pairs, we identified a simple qualitative signature to distinguish both hepatocellular carcinoma and adjacent non-tumour tissues from cirrhosis tissues of non-hepatocellular carcinoma patients. A signature consisting of 19 gene pairs was identified in the training data sets and validated in 2 large collections of samples from biopsy and surgical resection specimens. For biopsy specimens, 95.7% of 141 hepatocellular carcinoma tissues and all (100%) of 108 cirrhosis tissues of non-hepatocellular carcinoma patients were correctly classified. Especially, all (100%) of 60 hepatocellular carcinoma adjacent normal tissues and 77.5% of 80 hepatocellular carcinoma adjacent cirrhosis tissues were classified to hepatocellular carcinoma. For surgical resection specimens, 99.7% of 733 hepatocellular carcinoma specimens were correctly classified to hepatocellular carcinoma, while 96.1% of 254 hepatocellular carcinoma adjacent cirrhosis tissues and 95.9% of 538 hepatocellular carcinoma adjacent normal tissues were classified to hepatocellular carcinoma. In contrast, 17.0% of 47 cirrhosis from non-hepatocellular carcinoma patients waiting for liver transplantation were classified to hepatocellular carcinoma, indicating that some patients with long-lasting cirrhosis could have already gained hepatocellular carcinoma characteristics. The signature can distinguish both hepatocellular carcinoma tissues and tumour-adjacent tissues from cirrhosis tissues of non-hepatocellular carcinoma patients even using inaccurately sampled biopsy specimens, which can aid early

2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

PubMed Central

Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

2015-01-01

2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

PubMed

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

An Intelligent Model for Pairs Trading Using Genetic Algorithms

PubMed Central

Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236

An Intelligent Model for Pairs Trading Using Genetic Algorithms.

PubMed

Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

33 CFR 334.730 - Waters of Santa Rosa Sound and Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving...

Code of Federal Regulations, 2011 CFR

2011-07-01

... Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving Ground Command, Eglin Air Force Base... Sound and Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving Ground Command, Eglin Air..., Headquarters Air Proving Ground Command, Eglin Air Force Base, Florida, and such agencies as he may designate...

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

PubMed

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

The detachment of particles from coalescing bubble pairs.

PubMed

Ata, Seher

2009-10-15

This paper is concerned with the detachment of particles from coalescing bubble pairs. Two bubbles were generated at adjacent capillaries and coated with hydrophobic glass particles of mean diameter 66 microm. The bubbles were then positioned next to each other until the thin liquid film between them ruptured. The particles that dropped from the bubble surface during the coalescence process were collected and measured. The coalescence process was very vigorous and observations showed that particles detached from the bubble surfaces as a result of the oscillations caused by coalescence. The attached particles themselves and, to some extent the presence of the surfactant had a damping affect on the bubble oscillation, which played a decisive role on the particle detachment phenomena. The behaviour of particles on the surfaces of the bubbles during coalescence was described, and implications of results for the flotation process were discussed.

Magnetic field homogeneity of a conical coaxial coil pair.

PubMed

Salazar, F J; Nieves, F J; Bayón, A; Gascón, F

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Magnetic field homogeneity of a conical coaxial coil pair

NASA Astrophysics Data System (ADS)

Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.

2017-09-01

An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.

Image contrast enhancement using adjacent-blocks-based modification for local histogram equalization

NASA Astrophysics Data System (ADS)

Wang, Yang; Pan, Zhibin

2017-11-01

Infrared images usually have some non-ideal characteristics such as weak target-to-background contrast and strong noise. Because of these characteristics, it is necessary to apply the contrast enhancement algorithm to improve the visual quality of infrared images. Histogram equalization (HE) algorithm is a widely used contrast enhancement algorithm due to its effectiveness and simple implementation. But a drawback of HE algorithm is that the local contrast of an image cannot be equally enhanced. Local histogram equalization algorithms are proved to be the effective techniques for local image contrast enhancement. However, over-enhancement of noise and artifacts can be easily found in the local histogram equalization enhanced images. In this paper, a new contrast enhancement technique based on local histogram equalization algorithm is proposed to overcome the drawbacks mentioned above. The input images are segmented into three kinds of overlapped sub-blocks using the gradients of them. To overcome the over-enhancement effect, the histograms of these sub-blocks are then modified by adjacent sub-blocks. We pay more attention to improve the contrast of detail information while the brightness of the flat region in these sub-blocks is well preserved. It will be shown that the proposed algorithm outperforms other related algorithms by enhancing the local contrast without introducing over-enhancement effects and additional noise.

Orbital-selective pairing and superconductivity in iron selenides

NASA Astrophysics Data System (ADS)

Nica, Emilian M.; Yu, Rong; Si, Qimiao

2017-12-01

An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.

Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

NASA Astrophysics Data System (ADS)

Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

2006-12-01

Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

PubMed

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

PubMed

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

33 CFR 334.730 - Waters of Santa Rosa Sound and Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving...

Code of Federal Regulations, 2010 CFR

2010-07-01

... Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving Ground Command, Eglin Air Force Base... Sound and Gulf of Mexico adjacent to Santa Rosa Island, Air Force Proving Ground Command, Eglin Air Force Base, Fla. (a) The danger zones—(1) Prohibited area. Waters of Santa Rosa Sound and Gulf of Mexico...

A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

PubMed

Sawada, Tomohisa; Fujita, Makoto

2010-05-26

Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

Quantitative Evaluation of Heavy Metals and Trace Elements in the Urinary Bladder: Comparison Between Cancerous, Adjacent Non-cancerous and Normal Cadaveric Tissue.

PubMed

Abdel-Gawad, Mahmoud; Elsobky, Emad; Shalaby, Mahmoud M; Abd-Elhameed, Mohamed; Abdel-Rahim, Mona; Ali-El-Dein, Bedeir

2016-12-01

The role of heavy metals and trace elements (HMTE) in the development of some cancers has been previously reported. Bladder carcinoma is a frequent malignancy of the urinary tract. The most common risk factors for bladder cancer are exposure to industrial carcinogens, cigarette smoking, gender, and possibly diet. The aim of this study was to evaluate HTME concentrations in the cancerous and adjacent non-cancerous tissues and compare them with those of normal cadaveric bladder. This prospective study included 102 paired samples of full-thickness cancer and adjacent non-cancerous bladder tissues of radical cystectomy (RC) specimens that were histologically proven as invasive bladder cancer (MIBC). We used 17 matched controls of non-malignant bladder tissue samples from cadavers. All samples were processed and evaluated for the concentration of 22 HMTE by using Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES). Outcome analysis was made by the Mann-Whitney U, chi-square, Kruskal-Wallis, and Wilcoxon signed ranks tests. When compared with cadaveric control or cancerous, the adjacent non-cancerous tissue had higher levels of six elements (arsenic, lead, selenium, strontium, zinc, and aluminum), and when compared with the control alone, it had a higher concentration of calcium, cadmium, chromium, potassium, magnesium, and nickel. The cancerous tissue had a higher concentration of cadmium, lead, chromium, calcium, potassium, phosphorous, magnesium, nickel, selenium, strontium, and zinc than cadaveric control. Boron level was higher in cadaveric control than cancerous and adjacent non-cancerous tissue. Cadmium level was higher in cancerous tissue with node-positive than node-negative cases. The high concentrations of cadmium, lead, chromium, nickel, and zinc, in the cancerous together with arsenic in the adjacent non-cancerous tissues of RC specimens suggest a pathogenic role of these elements in BC. However, further work-up is needed to support this

Non-classical logic inverter coupling a ZnO nanowire-based Schottky barrier transistor and adjacent Schottky diode.

PubMed

Hosseini Shokouh, Seyed Hossein; Raza, Syed Raza Ali; Lee, Hee Sung; Im, Seongil

2014-08-21

On a single ZnO nanowire (NW), we fabricated an inverter-type device comprising a Schottky diode (SD) and field-effect transistor (FET), aiming at 1-dimensional (1D) electronic circuits with low power consumption. The SD and adjacent FET worked respectively as the load and driver, so that voltage signals could be easily extracted as the output. In addition, NW FET with a transparent conducting oxide as top gate turned out to be very photosensitive, although ZnO NW SD was blind to visible light. Based on this, we could achieve an array of photo-inverter cells on one NW. Our non-classical inverter is regarded as quite practical for both logic and photo-sensing due to its performance as well as simple device configuration.

Tuning the Pairing Interaction in a d -Wave Superconductor by Paramagnons Injected through Interfaces

DOE PAGES

Naritsuka, M.; Rosa, P. F. S.; Luo, Yongkang; ...

2018-05-04

Unconventional superconductivity and magnetism are intertwined on a microscopic level in a wide class of materials. A new approach to this most fundamental and hotly debated issue focuses on the role of interactions between superconducting electrons and bosonic fluctuations at the interface between adjacent layers in heterostructures. In this paper, we fabricate hybrid superlattices consisting of alternating atomic layers of the heavy-fermion superconductormore » $${\\mathrm{CeCoIn}}_{5}$$ and antiferromagnetic (AFM) metal $${\\mathrm{CeRhIn}}_{5}$$, in which the AFM order can be suppressed by applying pressure. We find that the superconducting and AFM states coexist in spatially separated layers, but their mutual coupling via the interface significantly modifies the superconducting properties. An analysis of upper critical fields reveals that, upon suppressing the AFM order by applied pressure, the force binding superconducting electron pairs acquires an extreme strong-coupling nature. Finally, this demonstrates that superconducting pairing can be tuned nontrivially by magnetic fluctuations (paramagnons) injected through the interface.« less

Tuning the Pairing Interaction in a d -Wave Superconductor by Paramagnons Injected through Interfaces

NASA Astrophysics Data System (ADS)

Naritsuka, M.; Rosa, P. F. S.; Luo, Yongkang; Kasahara, Y.; Tokiwa, Y.; Ishii, T.; Miyake, S.; Terashima, T.; Shibauchi, T.; Ronning, F.; Thompson, J. D.; Matsuda, Y.

2018-05-01

Unconventional superconductivity and magnetism are intertwined on a microscopic level in a wide class of materials. A new approach to this most fundamental and hotly debated issue focuses on the role of interactions between superconducting electrons and bosonic fluctuations at the interface between adjacent layers in heterostructures. Here we fabricate hybrid superlattices consisting of alternating atomic layers of the heavy-fermion superconductor CeCoIn5 and antiferromagnetic (AFM) metal CeRhIn5 , in which the AFM order can be suppressed by applying pressure. We find that the superconducting and AFM states coexist in spatially separated layers, but their mutual coupling via the interface significantly modifies the superconducting properties. An analysis of upper critical fields reveals that, upon suppressing the AFM order by applied pressure, the force binding superconducting electron pairs acquires an extreme strong-coupling nature. This demonstrates that superconducting pairing can be tuned nontrivially by magnetic fluctuations (paramagnons) injected through the interface.

Generalized nonimaging compound elliptical and compound hyperbolic luminaire designs for pair-overlap illumination applications.

PubMed

Georlette, O; Gordon, J M

1994-07-01

Generalized nonimaging compound elliptical luminaires (CEL's) and compound hyperbolic luminaires (CHL's) are developed for pair-overlap illumination applications. A comprehensive analysis of CEL's and CHL's is presented. This includes the possibility of reflector truncation, as well as the extreme direction that spans the full range from positive to negative. Negative extreme direction devices have been overlooked in earlier studies and are shown to be well suited to illumination problems for which large cutoff angles are required. Flux maps can be calculated analytically without the need for computer ray tracing. It is demonstrated that, for a broad range of cutoff angles, adjacent pairs of CEL's and CHL's can generate highly uniform far-field illuminance while maintaining maximal lighting efficiency and excellent glare control. The trade-off between luminaire compactness and flux homogeneity is also illustrated. For V troughs, being a special case of CHL's and being well suited to simple, inexpensive fabri ation, we identify geometries that closely approach the performance characteristics of the optimized CEL's and CHL's.

Phytoparasitic Nematodes Adjacent to Established Strawberry Plantations

PubMed Central

Crow, R. V.; MacDonald, D. H.

1978-01-01

Plant-nematode populations associated with uncultivated vegetation, adjacent strawberry plants, and alternate crop sites were studied at three locations in Minnesota. At one site (Forest Lake), Paratylenchus projectus, Meloidogyne hapla, and Pratylenchus tenuis were frequently associated with the roots of native vegetation. These nematode species were also present in adjacent strawberry beds. Among alternate crops observed, oats and muskmelon usually supported the fewest nematodes although moderate densities of Xiphinema americanum and P. tenuis were found at one location in plots planted to oats. Pratylenchus tenuis was also found on rye at one location. PMID:19305841

Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

PubMed Central

Been, M D; Perrotta, A T

1995-01-01

A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

New Quantum Key Distribution Scheme Based on Random Hybrid Quantum Channel with EPR Pairs and GHZ States

NASA Astrophysics Data System (ADS)

Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run

2018-05-01

A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.

Coexistence Analysis of Adjacent Long Term Evolution (LTE) Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aulama, Mohannad M.; Olama, Mohammed M

As the licensing and deployment of Long term evolution (LTE) systems are ramping up, the study of coexistence of LTE systems is an essential topic in civil and military applications. In this paper, we present a coexistence study of adjacent LTE systems aiming at evaluating the effect of inter-system interference on system capacity and performance as a function of some of the most common mitigation techniques: frequency guard band, base station (BS) antenna coupling loss, and user equipment (UE) antenna spacing. A system model is constructed for two collocated macro LTE networks. The developed model takes into consideration the RFmore » propagation environment, power control scheme, and adjacent channel interference. Coexistence studies are performed for a different combination of time/frequency division duplex (TDD/FDD) systems under three different guard-bands of 0MHz, 5MHz, and 10MHz. Numerical results are presented to advice the minimum frequency guard band, BS coupling loss, and UE antenna isolation required for a healthy system operation.« less

Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

NASA Technical Reports Server (NTRS)

Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

2010-01-01

The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

PubMed Central

Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

2002-01-01

An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

Acid-induced exchange of the imino proton in G.C pairs.

PubMed Central

Nonin, S; Leroy, J L; Gueron, M

1996-01-01

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

Acid-induced exchange of the imino proton in G.C pairs.

PubMed

Nonin, S; Leroy, J L; Gueron, M

1996-02-15

Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

Distinctive Glycerophospholipid Profiles of Human Seminoma and Adjacent Normal Tissues by Desorption Electrospray Ionization Imaging Mass Spectrometry

NASA Astrophysics Data System (ADS)

Masterson, Timothy A.; Dill, Allison L.; Eberlin, Livia S.; Mattarozzi, Monica; Cheng, Liang; Beck, Stephen D. W.; Bianchi, Federica; Cooks, R. Graham

2011-08-01

Desorption electrospray ionization mass spectrometry (DESI-MS) has been successfully used to discriminate between normal and cancerous human tissue from different anatomical sites. On the basis of this, DESI-MS imaging was used to characterize human seminoma and adjacent normal tissue. Seminoma and adjacent normal paired human tissue sections (40 tissues) from 15 patients undergoing radical orchiectomy were flash frozen in liquid nitrogen and sectioned to 15 μm thickness and thaw mounted to glass slides. The entire sample was two-dimensionally analyzed by the charged solvent spray to form a molecular image of the biological tissue. DESI-MS images were compared with formalin-fixed, hematoxylin and eosin (H&E) stained slides of the same material. Increased signal intensity was detected for two seminolipids [seminolipid (16:0/16:0) and seminolipid (30:0)] in the normal tubule testis tissue; these compounds were undetectable in seminoma tissue, as well as from the surrounding fat, muscle, and blood vessels. A glycerophosphoinositol [PI(18:0/20:4)] was also found at increased intensity in the normal testes tubule tissue when compared with seminoma tissue. Ascorbic acid (i.e., vitamin C) was found at increased amounts in seminoma tissue when compared with normal tissue. DESI-MS analysis was successfully used to visualize the location of several types of molecules across human seminoma and normal tissues. Discrimination between seminoma and adjacent normal testes tubules was achieved on the basis of the spatial distributions and varying intensities of particular lipid species as well as ascorbic acid. The increased presence of ascorbic acid within seminoma compared with normal seminiferous tubules was previously unknown.

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

PubMed Central

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Microphysics of mass-transport in coupled droplet-pairs at low Reynolds number and the role of convective dynamics

NASA Astrophysics Data System (ADS)

Dong, Qingming; Sau, Amalendu

2016-06-01

Interfacial mass-transport and redistribution in the micro-scale liquid droplets are important in diverse fields of research interest. The role of the "inflow" and the "outflow" type convective eddy-pairs in the entrainment of outer solute and internal relocation are examined for different homogeneous and heterogeneous water droplet pairs appearing in a tandem arrangement. Two micro-droplets of pure (rain) water interact with an oncoming outer air stream (Re ≤ 100) contaminated by uniformly distributed SO2. By virtue of separation/attachment induced non-uniform interfacial shear-stress gradient, the well-defined inflow/outflow type pairs of recirculating eddy-based convective motion quickly develops, and the eddies effectively attract/repel the accumulated outer solute and control the physical process of mass-transport in the droplet-pair. The non-uniformly shear-driven flow interaction and bifurcation of the circulatory internal flow lead to growth of important micro-scale "secondary" eddies which suitably regroup with the adjacent "primary" one to create the sustained inflow/outflow type convective dynamics. The presently derived flow characteristics and in-depth analysis help to significantly improve our understanding of the micro-droplet based transport phenomena in a wider context. By tuning "Re" (defined in terms of the droplet diameter and the average oncoming velocity of the outer air) and gap-ratio "α," the internal convective forcing and the solute entrainment efficiency could be considerably enhanced. The quantitative estimates for mass entrainment, convective strength, and saturation characteristics for different coupled micro-droplet pairs are extensively examined here for 0.2 ≤ α ≤ 2.0 and 30 ≤ Re ≤ 100. Interestingly, for the compound droplets, with suitably tuned radius-ratio "B" (of upstream droplet with respect to downstream one) the generated "inflow" type coherent convective dynamics helped to significantly augment the centre

Multi-user distribution of polarization entangled photon pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trapateau, J.; Orieux, A.; Diamanti, E.

We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less

Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

PubMed

Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

2018-06-22

Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

Seismic anisotropy beneath the southeastern margin of the Tibetan Plateau and adjacent regions revealed by shear-wave splitting analyses

NASA Astrophysics Data System (ADS)

Gao, S. S.; Kong, F.; Wu, J.; Liu, L.; Liu, K. H.

2017-12-01

Seismic azimuthal anisotropy is measured at 83 stations situated at the southeastern margin of the Tibetan Plateau and adjacent regions based on shear-wave splitting analyses. A total of 1701 individual pairs of splitting parameters (fast polarization orientations and splitting delay times) are obtained using the PKS, SKKS, and SKS phases. The splitting parameters from 21 stations exhibit systematic back-azimuthal variations with a 90° periodicity, which is consistent with a two-layer anisotropy model. The resulting upper-layer splitting parameters computed based on a grid-search algorithm are comparable with crustal anisotropy measurements obtained independently based on the sinusoidal moveout of P-to-S conversions from the Moho. The fast orientations of the upper layer anisotropy, which is mostly parallel with major shear zones, are associated with crustal fabrics with a vertical foliation plane. The lower layer anisotropy and the station averaged splitting parameters at stations with azimuthally invariant splitting parameters can be adequately explained by the differential movement between the lithosphere and asthenosphere. The NW-SE fast orientations obtained in the northern part of the study area probably reflect the southeastward extruded mantle flow from central Tibet. In contrast, the NE-SW to E-W fast orientations observed in the southern part of the study area are most likely related to the northeastward to eastward mantle flow induced by the subduction of the Burma microplate.

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

PubMed

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Long-term effects of vertebroplasty: adjacent vertebral fractures.

PubMed

Baroud, Gamal; Vant, Christianne; Wilcox, Ruth

2006-01-01

In today's aging population, osteoporosis-related fractures are an ever-growing concern. Vertebroplasty, a promising yet cost-effective treatment for vertebral compression fractures, has an increasing role. The first vertebroplasty procedures were reported by Deramond and Galibert in France in 1987, and international interest grew with continued development of clinical techniques and augmentation materials in Europe and the United States. Initial publications and presentations at peer review meetings demonstrated 60-90% success rates in providing immediate and significant pain relief. The objective of this review is to assemble experimental and computational biomechanical research whose goal is determining and preventing the negative long-term effects ofvertebroplasty, with a specific focus on adjacent vertebral fractures. Biomechanical studies using isolated cancellous bone cylinders have shown that osteoporotic cancellous bone samples augmented by the rigid bone cement were at least 12 times stiffer and 35 times stronger than the untreated osteoporotic cancellous bone samples. The biomechanical efficacy of the procedure to repair the fractured vertebrae and prevent further collapse is determined using single-vertebra models. The strength or load-bearing capacity of a single vertebra is significantly increased following augmentation when compared to the intact strength. However, there is no dear result regarding the overall stiffness of the single vertebra, with studies reporting contradictorily that the stiffness increases, decreases, or does not significantly alter following augmentation. The effects of vertebroplasty on adjacent structures are studied via multisegment models, whose results plainly oppose the findings of the single-vertebra and intravertebral models. Here, augmentation was shown to decrease the overall segment strength by 19% when compared to the matched controls. As well, there is a significant increase in disc pressure compared to the pre

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

PubMed

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

Error-correcting pairs for a public-key cryptosystem

NASA Astrophysics Data System (ADS)

Pellikaan, Ruud; Márquez-Corbella, Irene

2017-06-01

Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

Prediction of missing common genes for disease pairs using network based module separation on incomplete human interactome.

PubMed

Akram, Pakeeza; Liao, Li

2017-12-06

Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

PubMed

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

PubMed

Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

2014-01-10

Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

Conference room 211, adjacent to commander's quarters, with vault door ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Conference room 211, adjacent to commander's quarters, with vault door at right. Projection area at center is equipped with automatic security drapes. Projection room uses a 45 degree mirror to reflect the image onto the frosted glass screen. Door on far left leads to display area senior battle staff viewing bridge, and the commander's quarters - March Air Force Base, Strategic Air Command, Combat Operations Center, 5220 Riverside Drive, Moreno Valley, Riverside County, CA

Occurrence and severity of enamel decalcification adjacent to bracket bases and sub-bracket lesions during orthodontic treatment with two different lingual appliances

PubMed Central

Klang, Elisabeth; Helms, Hans-Joachim; Wiechmann, Dirk

2016-01-01

Summary Background: Using lingual enamel surfaces for bracket placement not only has esthetic advantages, but may also be suitable in terms of reducing frequencies of enamel decalcifications. Objective: To test the null-hypothesis that there is no significant difference in enamel decalcification or cavitation incidence adjacent to and beneath bracket bases between two lingual multi-bracket (MB) appliances that are different in terms of design, material composition, and manufacturing technology (group A: WIN, DW-LingualSystems; group B: Incognito, 3M-Unitek), taking into account patient- and treatment-related variables on white spot lesion (WSL) formation. Methods: Standardized, digital, top-view photographs of 630 consecutive subjects (16214 teeth; n Incognito = 237/6076 teeth; n WIN = 393/10138 teeth; mean age: 17.47±7.8; m/f 43.2/56.8%) with completed lingual MB treatment of the upper and lower permanent teeth 1–7 were screened for decalcification or cavitation adjacent to and beneath the bracket bases before and after treatment, scored from 0 to 7. Non-parametric ANOVA was used for main effects ‘appliance type’, ‘gender’, ‘treatment complexity’, ‘grouped age’ (≤16/>16 years), and ‘treatment duration’ as covariable, at an α-level of 5%. Results: About 2.57% [5.94%] of all teeth in group A [B] developed decalcifications. Subject-related incidence was 9.59% [16.17%] for upper incisors in group A [B], and 12.98% [25.74%] for all teeth 16–46. There were significant effects by gender, age, and treatment duration. Conclusion: The null-hypothesis was rejected: sub-bracket lesions were significantly less frequent in group A, while frequencies of WSL adjacent to brackets were not significantly affected by appliance type. In view of the overall low incidences of lingual post-orthodontic white-spot lesions, the use of lingual appliances is advocated as a valid strategy for a reduction of enamel decalcifications during orthodontic treatment. PMID

Constrained and Unconstrained Partial Adjacent Category Logit Models for Ordinal Response Variables

ERIC Educational Resources Information Center

Fullerton, Andrew S.; Xu, Jun

2018-01-01

Adjacent category logit models are ordered regression models that focus on comparisons of adjacent categories. These models are particularly useful for ordinal response variables with categories that are of substantive interest. In this article, we consider unconstrained and constrained versions of the partial adjacent category logit model, which…

Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

PubMed

Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

2016-02-22

We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

PubMed

McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

2014-04-01

Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base

PubMed Central

McCoy, Allison B.; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J.; Sittig, Dean F.

2014-01-01

Background Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. Objective We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. Approach We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Results Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of

An interatomic pair potential for cadmium selenide

NASA Astrophysics Data System (ADS)

Rabani, Eran

2002-01-01

We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

PubMed

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

PIXE analysis of elements in gastric cancer and adjacent mucosa

NASA Astrophysics Data System (ADS)

Liu, Qixin; Zhong, Ming; Zhang, Xiaofeng; Yan, Lingnuo; Xu, Yongling; Ye, Simao

1990-04-01

The elemental regional distributions in 20 resected human stomach tissues were obtained using PIXE analysis. The samples were pathologically divided into four types: normal, adjacent mucosa A, adjacent mucosa B and cancer. The targets for PIXE analysis were prepared by wet digestion with a pressure bomb system. P, K, Fe, Cu, Zn and Se were measured and statistically analysed. We found significantly higher concentrations of P, K, Cu, Zn and a higher ratio of Cu compared to Zn in cancer tissue as compared with normal tissue, but statistically no significant difference between adjacent mucosa and cancer tissue was found.

Kepler-36: a pair of planets with neighboring orbits and dissimilar densities.

PubMed

Carter, Joshua A; Agol, Eric; Chaplin, William J; Basu, Sarbani; Bedding, Timothy R; Buchhave, Lars A; Christensen-Dalsgaard, Jørgen; Deck, Katherine M; Elsworth, Yvonne; Fabrycky, Daniel C; Ford, Eric B; Fortney, Jonathan J; Hale, Steven J; Handberg, Rasmus; Hekker, Saskia; Holman, Matthew J; Huber, Daniel; Karoff, Christopher; Kawaler, Steven D; Kjeldsen, Hans; Lissauer, Jack J; Lopez, Eric D; Lund, Mikkel N; Lundkvist, Mia; Metcalfe, Travis S; Miglio, Andrea; Rogers, Leslie A; Stello, Dennis; Borucki, William J; Bryson, Steve; Christiansen, Jessie L; Cochran, William D; Geary, John C; Gilliland, Ronald L; Haas, Michael R; Hall, Jennifer; Howard, Andrew W; Jenkins, Jon M; Klaus, Todd; Koch, David G; Latham, David W; MacQueen, Phillip J; Sasselov, Dimitar; Steffen, Jason H; Twicken, Joseph D; Winn, Joshua N

2012-08-03

In the solar system, the planets' compositions vary with orbital distance, with rocky planets in close orbits and lower-density gas giants in wider orbits. The detection of close-in giant planets around other stars was the first clue that this pattern is not universal and that planets' orbits can change substantially after their formation. Here, we report another violation of the orbit-composition pattern: two planets orbiting the same star with orbital distances differing by only 10% and densities differing by a factor of 8. One planet is likely a rocky "super-Earth," whereas the other is more akin to Neptune. These planets are 20 times more closely spaced and have a larger density contrast than any adjacent pair of planets in the solar system.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

PubMed

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

Diffusion-Weighted MRI Assessment of Adjacent Disc Degeneration After Thoracolumbar Vertebral Fractures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noriega, David C., E-mail: dcnoriega1970@gmail.com; Marcia, Stefano, E-mail: stemarcia@gmail.com; Ardura, Francisco, E-mail: fardura@ono.com

ObjectiveThe purpose of this study was to assess, by the mean apparent diffusion coefficient (ADC), if a relationship exists between disc ADC and MR findings of adjacent disc degeneration after thoracolumbar fractures treated by anatomic reduction using vertebral augmentation (VAP).Materials and MethodsTwenty non-consecutive patients (mean age 50.7 years; range 45–56) treated because of vertebral fractures, were included in this study. There were 10 A3.1 and 10 A1.2 fractures (AO classification). Surgical treatment using VAP was applied in 14 cases, and conservative in 6 patients. MRI T2-weighted images and mapping of apparent diffusion coefficient (ADC) of the intervertebral disc adjacent to themore » fractured segment were performed after a mean follow-up of 32 months. A total of 60 discs, 3 per patient, were analysed: infra-adjacent, supra-adjacent and a control disc one level above the supra-adjacent.ResultsNo differences between patients surgically treated and those following a conservative protocol regarding the average ADC values obtained in the 20 control discs analysed were found. Considering all discs, average ADC in the supra-adjacent level was lower than in the infra-adjacent (1.35 ± 0.12 vs. 1.53 ± 0.06; p < 0.001). Average ADC values of the discs used as a control were similar to those of the infra-adjacent level (1.54 ± 0.06). Compared to surgically treated patients, discs at the supra-adjacent fracture level showed statistically significant lower values in cases treated conservatively (p < 0.001). The variation in the delay of surgery had no influence on the average values of ADC at any of the measured levels.ConclusionsADC measurements of the supra-adjacent discs after a mean follow-up of 32 months following thoracolumbar fractures, showed that restoration of the vertebral collapse by minimally invasive VAP prevents posttraumatic disc degeneration.« less

Altered expression of cytokeratin 7 and CD117 in transitional mucosa adjacent to human colorectal cancer.

PubMed

Kigasawa, Hideaki; Fujiwara, Masachika; Ishii, Jun; Chiba, Tomohiro; Terado, Yuichi; Shimoyamada, Hiroaki; Mochizuki, Makoto; Kitamura, Osamu; Kamma, Hiroshi; Ohkura, Yasuo

2017-07-01

The multi-step progression of colorectal cancer through precancerous lesions (adenoma and dysplasia) is associated with cumulative molecular alterations, a number of which have also been demonstrated to be present in morphologically normal transitional mucosa adjacent to colorectal cancer. The cytoskeletal protein cytokeratin 7 (CK7) and the receptor tyrosine kinase, KIT proto-oncogene receptor tyrosine kinase (CD117), encoded by the proto-oncogene c-Kit, are lacking in normal colorectal crypt epithelium and are aberrantly expressed in a subset of colorectal cancer. The aim of the present study was to evaluate the expression of CK7 and CD117 in morphologically normal transitional mucosa adjacent to colorectal cancer. Immunohistochemical staining for CK7 and CD117 was performed in the mucosa adjacent to five groups of surgically resected colorectal tumors [low-grade adenoma, high-grade adenoma, mucosal adenocarcinoma, small-sized invasive adenocarcinoma (≤2 cm) and large-sized invasive adenocarcinoma (>2 cm)]. CK7 was expressed in the mucosa adjacent to a subset of colorectal tumors, and the positivity ratio increased according to tumor grade from low-grade adenoma up to small-sized invasive adenocarcinoma (61.2%). However, the positivity ratio of CK7 in the mucosa adjacent to the large-sized invasive adenocarcinoma (25.0%) was significantly lower compared with that of the next lower grade. CD117 was also expressed in the mucosa adjacent to a subset of colorectal tumors. In contrast to CK7, the positivity ratio of CD117 increased according to tumor grade from low-grade adenoma all the way through to the large-sized invasive adenocarcinoma (45.0%). Based on these results, the mechanism of CK7 and CD117 expression in the transitional mucosa adjacent to colorectal cancer may be different, and analysis of their individual expression may provide novel insights into the development and progression of colorectal cancer.

Altered expression of cytokeratin 7 and CD117 in transitional mucosa adjacent to human colorectal cancer

PubMed Central

Kigasawa, Hideaki; Fujiwara, Masachika; Ishii, Jun; Chiba, Tomohiro; Terado, Yuichi; Shimoyamada, Hiroaki; Mochizuki, Makoto; Kitamura, Osamu; Kamma, Hiroshi; Ohkura, Yasuo

2017-01-01

The multi-step progression of colorectal cancer through precancerous lesions (adenoma and dysplasia) is associated with cumulative molecular alterations, a number of which have also been demonstrated to be present in morphologically normal transitional mucosa adjacent to colorectal cancer. The cytoskeletal protein cytokeratin 7 (CK7) and the receptor tyrosine kinase, KIT proto-oncogene receptor tyrosine kinase (CD117), encoded by the proto-oncogene c-Kit, are lacking in normal colorectal crypt epithelium and are aberrantly expressed in a subset of colorectal cancer. The aim of the present study was to evaluate the expression of CK7 and CD117 in morphologically normal transitional mucosa adjacent to colorectal cancer. Immunohistochemical staining for CK7 and CD117 was performed in the mucosa adjacent to five groups of surgically resected colorectal tumors [low-grade adenoma, high-grade adenoma, mucosal adenocarcinoma, small-sized invasive adenocarcinoma (≤2 cm) and large-sized invasive adenocarcinoma (>2 cm)]. CK7 was expressed in the mucosa adjacent to a subset of colorectal tumors, and the positivity ratio increased according to tumor grade from low-grade adenoma up to small-sized invasive adenocarcinoma (61.2%). However, the positivity ratio of CK7 in the mucosa adjacent to the large-sized invasive adenocarcinoma (25.0%) was significantly lower compared with that of the next lower grade. CD117 was also expressed in the mucosa adjacent to a subset of colorectal tumors. In contrast to CK7, the positivity ratio of CD117 increased according to tumor grade from low-grade adenoma all the way through to the large-sized invasive adenocarcinoma (45.0%). Based on these results, the mechanism of CK7 and CD117 expression in the transitional mucosa adjacent to colorectal cancer may be different, and analysis of their individual expression may provide novel insights into the development and progression of colorectal cancer. PMID:28693143

AUCTSP: an improved biomarker gene pair class predictor.

PubMed

Kagaris, Dimitri; Khamesipour, Alireza; Yiannoutsos, Constantin T

2018-06-26

The Top Scoring Pair (TSP) classifier, based on the concept of relative ranking reversals in the expressions of pairs of genes, has been proposed as a simple, accurate, and easily interpretable decision rule for classification and class prediction of gene expression profiles. The idea that differences in gene expression ranking are associated with presence or absence of disease is compelling and has strong biological plausibility. Nevertheless, the TSP formulation ignores significant available information which can improve classification accuracy and is vulnerable to selecting genes which do not have differential expression in the two conditions ("pivot" genes). We introduce the AUCTSP classifier as an alternative rank-based estimator of the magnitude of the ranking reversals involved in the original TSP. The proposed estimator is based on the Area Under the Receiver Operating Characteristic (ROC) Curve (AUC) and as such, takes into account the separation of the entire distribution of gene expression levels in gene pairs under the conditions considered, as opposed to comparing gene rankings within individual subjects as in the original TSP formulation. Through extensive simulations and case studies involving classification in ovarian, leukemia, colon, breast and prostate cancers and diffuse large b-cell lymphoma, we show the superiority of the proposed approach in terms of improving classification accuracy, avoiding overfitting and being less prone to selecting non-informative (pivot) genes. The proposed AUCTSP is a simple yet reliable and robust rank-based classifier for gene expression classification. While the AUCTSP works by the same principle as TSP, its ability to determine the top scoring gene pair based on the relative rankings of two marker genes across all subjects as opposed to each individual subject results in significant performance gains in classification accuracy. In addition, the proposed method tends to avoid selection of non-informative (pivot

Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

NASA Astrophysics Data System (ADS)

Pinski, Peter; Neese, Frank

2018-01-01

Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

PubMed

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

PubMed Central

2004-01-01

With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

PubMed Central

Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

2009-01-01

Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

Deformation Rates in the Snake River Plain and Adjacent Basin and Range Regions Based on GPS Measurements

NASA Astrophysics Data System (ADS)

Payne, S. J.; McCaffrey, R.; King, R. W.; Kattenhorn, S. A.

2012-12-01

We estimate horizontal velocities for 405 sites using Global Positioning System (GPS) phase data collected from 1994 to 2010 within the Northern Basin and Range Province, U.S.A. The velocities reveal a slowly-deforming region within the Snake River Plain in Idaho and Owyhee-Oregon Plateau in Oregon separated from the actively extending adjacent Basin and Range regions by shear. Our results show a NE-oriented extensional strain rate of 5.6 ± 0.7 nanostrain/yr in the Centennial Tectonic Belt and an ~E-oriented extensional strain rate of 3.5 ± 0.2 nanostrain/yr in the Great Basin. These extensional rates contrast with the very low strain rate within the 125 km x 650 km region of the Snake River Plain and Owyhee-Oregon Plateau which is not distinguishable from zero (-0.1 ± 0.4 x nanostrain/yr). Inversions of Snake River Plain velocities with dike-opening models indicate that rapid extension by dike intrusion in volcanic rift zones, as previously hypothesized, is not currently occurring. GPS data also disclose that rapid extension in the surrounding regions adjacent to the slowly-deforming region of the Snake River Plain drives shear between them. We estimate right-lateral shear with slip rates of 0.3-1.5 mm/yr along the northwestern boundary adjacent to the Centennial Tectonic Belt and left-lateral oblique extension with slip rates of 0.5-1.5 mm/yr along the southeastern boundary adjacent to the Intermountain Seismic Belt. The fastest lateral shearing evident in the GPS occurs near the Yellowstone Plateau where earthquakes with right-lateral strike-slip focal mechanisms are within a NE-trending zone of seismicity. The regional velocity gradients are best fit by nearby poles of rotation for the Centennial Tectonic Belt, Snake River Plain, Owyhee-Oregon Plateau, and eastern Oregon, indicating that clockwise rotation is not locally driven by Yellowstone hotspot volcanism, but instead by extension to the south across the Wasatch fault possibly due to gravitational

The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

PubMed

Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

2013-10-01

The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

49 CFR 214.107 - Working over or adjacent to water.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Working over or adjacent to water. 214.107 Section 214.107 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD WORKPLACE SAFETY Bridge Worker Safety Standards § 214.107 Working over or adjacent to water. (a)...

49 CFR 214.107 - Working over or adjacent to water.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 4 2012-10-01 2012-10-01 false Working over or adjacent to water. 214.107 Section 214.107 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD WORKPLACE SAFETY Bridge Worker Safety Standards § 214.107 Working over or adjacent to water. (a)...

49 CFR 214.107 - Working over or adjacent to water.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 4 2011-10-01 2011-10-01 false Working over or adjacent to water. 214.107 Section 214.107 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD WORKPLACE SAFETY Bridge Worker Safety Standards § 214.107 Working over or adjacent to water. (a)...

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

PubMed Central

2018-01-01

Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

PubMed Central

Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

1982-01-01

Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

PubMed

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Ponderomotive effects in multiphoton pair production

NASA Astrophysics Data System (ADS)

Kohlfürst, Christian; Alkofer, Reinhard

2018-02-01

The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

Effects of stream-adjacent logging in fishless headwaters on downstream coastal cutthroat trout

USGS Publications Warehouse

Bateman, Douglas S.; Sloat, Matthew R.; Gresswell, Robert E.; Berger, Aaron M.; Hockman-Wert, David; Leer, David W.; Skaugset, Arne E.

2016-01-01

To investigate effects of headwater logging on downstream coastal cutthroat trout (Oncorhynchus clarkii clarkii) populations, we monitored stream habitat and biotic indicators including biomass, abundance, growth, movement, and survival over 8 years using a paired-watershed approach. Reference and logged catchments were located on private industrial forestland on ∼60-year harvest rotation. Five clearcuts (14% of the logged catchment area) were adjacent to fishless portions of the headwater streams, and contemporary regulations did not require riparian forest buffers in the treatment catchment. Logging did not have significant negative effects on downstream coastal cutthroat trout populations for the duration of the sample period. Indeed, the only statistically significant response of fish populations following logging in fishless headwaters was an increase in late-summer biomass (g·m−2) of age-1+ coastal cutthroat trout in tributaries. Ultimately, the ability to make broad generalizations concerning effects of timber harvest is difficult because response to disturbance (anthropogenically influenced or not) in aquatic systems is complex and context-dependent, but our findings provide one example of environmentally compatible commercial logging in a regenerated forest setting.

Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

NASA Astrophysics Data System (ADS)

Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

2018-01-01

We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

NASA Astrophysics Data System (ADS)

Gajewski, Andrzej; Kolenderski, Piotr L.

2016-10-01

There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

Experimental many-pairs nonlocality

NASA Astrophysics Data System (ADS)

Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

2017-08-01

Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

Early Verb Constructions in French: Adjacency on the Left Edge

ERIC Educational Resources Information Center

Veneziano, Edy; Clark, Eve V.

2016-01-01

Children acquiring French elaborate their early verb constructions by adding adjacent morphemes incrementally at the left edge of core verbs. This hypothesis was tested with 2657 verb uses from four children between 1;3 and 2;7. Consistent with the Adjacency Hypothesis, children added clitic subjects frst only to present tense forms (as in…

A Macroscopic Analogue of the Nuclear Pairing Potential

ERIC Educational Resources Information Center

Dunlap, Richard A.

2013-01-01

A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…

Introducing Hurst exponent in pair trading

NASA Astrophysics Data System (ADS)

Ramos-Requena, J. P.; Trinidad-Segovia, J. E.; Sánchez-Granero, M. A.

2017-12-01

In this paper we introduce a new methodology for pair trading. This new method is based on the calculation of the Hurst exponent of a pair. Our approach is inspired by the classical concepts of co-integration and mean reversion but joined under a unique strategy. We will show how Hurst approach presents better results than classical Distance Method and Correlation strategies in different scenarios. Results obtained prove that this new methodology is consistent and suitable by reducing the drawdown of trading over the classical ones getting as a result a better performance.

Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

PubMed

Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

2003-02-01

As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

Factors related to the joint probability of flooding on paired streams

USGS Publications Warehouse

Koltun, G.F.; Sherwood, J.M.

1998-01-01

increases with increases in drainage area ratio, mean drainage area, and centroid angle adjusted 30 degrees. Logistic-regression equations were developed, which can be used to estimate the probability that streamflows at two streams jointly equal or exceed the 2-year flood threshold given that the streamflow at one of the two streams equals or exceeds the 2-year flood threshold. The logistic-regression equations are applicable to stream pairs in Ohio (and border areas of adjacent states) that are unregulated, free of significant urban influences, and have characteristics similar to those of the 304 gaged stream pairs used in the logistic-regression analyses. Contingency tables were constructed and analyzed to provide information about the bivariate distribution of floods on paired streams. The contingency tables showed that the percentage of trials in which both streams in the pair concurrently flood at identical recurrence-interval ranges generally increased as centroid distances decreased and was greatest for stream pairs with adjusted centroid angles greater than or equal to 60 degrees and drainage area ratios greater than or equal to 0.01. Also, as centroid distance increased, streamflow at one stream in the pair was more likely to be in a less than 2-year recurrence-interval range when streamflow at the second stream was in a 2-year or greater recurrence-interval range.

Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs

NASA Astrophysics Data System (ADS)

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

PubMed

Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

1998-09-23

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

PubMed Central

Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

2005-01-01

The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

PubMed

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

ERIC Educational Resources Information Center

Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

PubMed

Hughes, J M

1996-06-21

The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

PubMed Central

Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

1980-01-01

The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

The Volpe Center GPS Adjacent Band Compatibility Program Plan : GPS Adjacent Band Compatibility Workshop, Volpe Center, Cambridge MA

DOT National Transportation Integrated Search

2014-09-18

Approach to DOT GPS Adjacent Band Compatibility Assessment. Identify forums and provide public outreach to make sure the progress and work are as open and transparent as possible. Develop an implementation plan that incorporates aspects from the DOT ...

Graph-based surface reconstruction from stereo pairs using image segmentation

NASA Astrophysics Data System (ADS)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

PubMed

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

PubMed

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

GOAT ROCKS WILDERNESS AND ADJACENT ROADLESS AREAS, WASHINGTON.

USGS Publications Warehouse

Church, S.E.; Close, T.J.

1984-01-01

The Goat Rocks Wilderness and adjacent roadless areas are a rugged, highly forested, scenic area located on the crest of the Cascade Range in south-central Washington. Several mineral claims have been staked in the area. Mineral surveys were conducted. Geochemical, geophysical, and geologic investigations indicate that three areas have probable mineral-resource potential for base metals in porphyry-type deposits. Available data are not adequate to permit definition of the potential for oil and gas. There is little likelihood for the occurrence of other kinds of energy resources in the area. Evaluation of resource potential in the three areas identified as having probable mineral-resource potential could be improved by more detailed geochemical studies and geologic mapping.

Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

PubMed

Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

2013-06-01

Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

Comparison of Adjacency and Distance-Based Approaches for Spatial Analysis of Multimodal Traffic Crash Data

NASA Astrophysics Data System (ADS)

Gill, G.; Sakrani, T.; Cheng, W.; Zhou, J.

2017-09-01

Many studies have utilized the spatial correlations among traffic crash data to develop crash prediction models with the aim to investigate the influential factors or predict crash counts at different sites. The spatial correlation have been observed to account for heterogeneity in different forms of weight matrices which improves the estimation performance of models. But very rarely have the weight matrices been compared for the prediction accuracy for estimation of crash counts. This study was targeted at the comparison of two different approaches for modelling the spatial correlations among crash data at macro-level (County). Multivariate Full Bayesian crash prediction models were developed using Decay-50 (distance-based) and Queen-1 (adjacency-based) weight matrices for simultaneous estimation crash counts of four different modes: vehicle, motorcycle, bike, and pedestrian. The goodness-of-fit and different criteria for accuracy at prediction of crash count reveled the superiority of Decay-50 over Queen-1. Decay-50 was essentially different from Queen-1 with the selection of neighbors and more robust spatial weight structure which rendered the flexibility to accommodate the spatially correlated crash data. The consistently better performance of Decay-50 at prediction accuracy further bolstered its superiority. Although the data collection efforts to gather centroid distance among counties for Decay-50 may appear to be a downside, but the model has a significant edge to fit the crash data without losing the simplicity of computation of estimated crash count.

Do Mangroves Subsidize Carbon to Adjacent Mudflat Fish Communities?

NASA Astrophysics Data System (ADS)

Henkel, S.; Kasten, S.; Hartmann, J.; Staubwasser, M.; Hernandez, M. F.; West, L.; Midway, S. R.; Polito, M. J.

2017-12-01

Mangroves are often implicated as energetic sources for fisheries productivity. However, the validity of this connection still remains in contention. Stable isotopes may provide answers by tracking the use of specific basal carbon sources in fish and invertebrates living in mangrove-mudflat habitat mosaics. We analyzed 307 consumer samples representing n=44 fish and invertebrate species collected from mangrove forest creeks and adjacent mudflats in coastal Tanzania using bulk carbon and nitrogen stable isotope analysis. Given the proposed high productivity of mangrove habitats, we hypothesize that mudflat communities will have carbon stable isotope values similar to mangrove communities either through the flux of mangrove carbon into adjacent mudflats and/or via the movement of mudflat fish communities into and out of mangrove habitats. Alternatively, mangrove carbon is often refractory, which may result in mudflat communities with isotopic values that differ from those found in adjacent mangrove communities. This scenario would suggest limited carbon flow between mudflat and mangrove food webs and that the movement of fish into and out of mangrove habitats is related to shelter from predation more than feeding. Data analysis is ongoing to test these competing hypotheses. By understanding the contribution of mangrove carbon to adjacent habitats, managers in Tanzania can make better informed decisions regarding the protection of mangroves and the local fisheries, which are a crucial source of income and food.

Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

PubMed Central

Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

2015-01-01

An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

Investigating the optimal passive and active vibration controls of adjacent buildings based on performance indices using genetic algorithms

NASA Astrophysics Data System (ADS)

Hadi, Muhammad N. S.; Uz, Mehmet E.

2015-02-01

This study proposes the optimal passive and active damper parameters for achieving the best results in seismic response mitigation of coupled buildings connected to each other by dampers. The optimization to minimize the H2 and H∞ norms in the performance indices is carried out by genetic algorithms (GAs). The final passive and active damper parameters are checked for adjacent buildings connected to each other under El Centro NS 1940 and Kobe NS 1995 excitations. Using real coded GA in H∞ norm, the optimal controller gain is obtained by different combinations of the measurement as the feedback for designing the control force between the buildings. The proposed method is more effective than other metaheuristic methods and more feasible, although the control force increased. The results in the active control system show that the response of adjacent buildings is reduced in an efficient manner.

Stress Wave Interaction Between Two Adjacent Blast Holes

NASA Astrophysics Data System (ADS)

Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

2016-05-01

Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

Pair-correlations in swimmer suspensions

NASA Astrophysics Data System (ADS)

Nambiar, Sankalp; Subramanian, Ganesh

2017-11-01

Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r << L to a far-field decay of O(1/r2) for r >> L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

PubMed

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

Life detection using glucose and tetrasaccharide enantiomer pairs.

PubMed

Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E

2009-04-01

A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.

A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

PubMed

Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

2012-11-01

Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

PubMed Central

2016-01-01

Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

ReLiance: a machine learning and literature-based prioritization of receptor—ligand pairings

PubMed Central

Iacucci, Ernesto; Tranchevent, Léon-Charles; Popovic, Dusan; Pavlopoulos, Georgios A.; De Moor, Bart; Schneider, Reinhard; Moreau, Yves

2012-01-01

Motivation: The prediction of receptor—ligand pairings is an important area of research as intercellular communications are mediated by the successful interaction of these key proteins. As the exhaustive assaying of receptor—ligand pairs is impractical, a computational approach to predict pairings is necessary. We propose a workflow to carry out this interaction prediction task, using a text mining approach in conjunction with a state of the art prediction method, as well as a widely accessible and comprehensive dataset. Among several modern classifiers, random forests have been found to be the best at this prediction task. The training of this classifier was carried out using an experimentally validated dataset of Database of Ligand-Receptor Partners (DLRP) receptor—ligand pairs. New examples, co-cited with the training receptors and ligands, are then classified using the trained classifier. After applying our method, we find that we are able to successfully predict receptor—ligand pairs within the GPCR family with a balanced accuracy of 0.96. Upon further inspection, we find several supported interactions that were not present in the Database of Interacting Proteins (DIPdatabase). We have measured the balanced accuracy of our method resulting in high quality predictions stored in the available database ReLiance. Availability: http://homes.esat.kuleuven.be/~bioiuser/ReLianceDB/index.php Contact: yves.moreau@esat.kuleuven.be; ernesto.iacucci@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22962483

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

PubMed

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Water resources of the Waccasassa River Basin and adjacent areas, Florida

USGS Publications Warehouse

Taylor, G.F.; Snell, L.J.

1978-01-01

This map report was prepared in cooperation with the Southwest Florida Water Management District which, with the Waccasassa River Basin Board, had jurisdiction over waters within the Waccasassa River basin, the coastal areas adjacent to the basin, and other adjacent areas outside the basin. New water management district boundaries, effective January 1977, place most of the Waccasassa River basin in the Suwannee River Water Management District. The purpose of the report is to provide water information for consideration in land-use and water development which is accelerating, especially in the northeastern part of the study area. It is based largely on existing data in the relatively undeveloped area. Of the total area included in the topographic drainage basin for the Waccasassa River about 72 percent is in Levy County, 18 percent in Alachua County, 9 percent in Gilchrist County, and 1 percent in Marion County. The elongated north-south drainage basin is approximately 50 mi in length, averages 13 mi in width, and lies between the Suwannee River, the St. Johns River, and the Withlacoochee River basins. (Woodard-USGS)

Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

PubMed

Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

2016-04-19

What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

Grandmothering life histories and human pair bonding.

PubMed

Coxworth, James E; Kim, Peter S; McQueen, John S; Hawkes, Kristen

2015-09-22

The evolution of distinctively human life history and social organization is generally attributed to paternal provisioning based on pair bonds. Here we develop an alternative argument that connects the evolution of human pair bonds to the male-biased mating sex ratios that accompanied the evolution of human life history. We simulate an agent-based model of the grandmother hypothesis, compare simulated sex ratios to data on great apes and human hunter-gatherers, and note associations between a preponderance of males and mate guarding across taxa. Then we explore a recent model that highlights the importance of mating sex ratios for differences between birds and mammals and conclude that lessons for human evolution cannot ignore mammalian reproductive constraints. In contradiction to our claim that male-biased sex ratios are characteristically human, female-biased ratios are reported in some populations. We consider the likelihood that fertile men are undercounted and conclude that the mate-guarding hypothesis for human pair bonds gains strength from explicit links with our grandmothering life history.

Paired Comparisons.

DTIC Science & Technology

1982-05-01

including multidimensional scaling. Applications have arisen in many areas, but most notably in food technolog, marketing research, and sports ... competition .- An extensive bibliography on paired comparisons by Davidson and Farquhar (1976) contains some 400 references. - Paired comparisons have been...consideration of chess competition . Ford (1957) pro- posed the model independently. Both Zermelo and Ford concentrated on solution of normal equations for

Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

NASA Astrophysics Data System (ADS)

Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

2013-04-01

We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

PubMed Central

Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

2013-01-01

The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements. PMID:23467056

Mechanical model for a collagen fibril pair in extracellular matrix.

PubMed

Chan, Yue; Cox, Grant M; Haverkamp, Richard G; Hill, James M

2009-04-01

In this paper, we model the mechanics of a collagen pair in the connective tissue extracellular matrix that exists in abundance throughout animals, including the human body. This connective tissue comprises repeated units of two main structures, namely collagens as well as axial, parallel and regular anionic glycosaminoglycan between collagens. The collagen fibril can be modeled by Hooke's law whereas anionic glycosaminoglycan behaves more like a rubber-band rod and as such can be better modeled by the worm-like chain model. While both computer simulations and continuum mechanics models have been investigated for the behavior of this connective tissue typically, authors either assume a simple form of the molecular potential energy or entirely ignore the microscopic structure of the connective tissue. Here, we apply basic physical methodologies and simple applied mathematical modeling techniques to describe the collagen pair quantitatively. We found that the growth of fibrils was intimately related to the maximum length of the anionic glycosaminoglycan and the relative displacement of two adjacent fibrils, which in return was closely related to the effectiveness of anionic glycosaminoglycan in transmitting forces between fibrils. These reveal the importance of the anionic glycosaminoglycan in maintaining the structural shape of the connective tissue extracellular matrix and eventually the shape modulus of human tissues. We also found that some macroscopic properties, like the maximum molecular energy and the breaking fraction of the collagen, were also related to the microscopic characteristics of the anionic glycosaminoglycan.

Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

NASA Astrophysics Data System (ADS)

Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

2011-10-01

Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.

PubMed Central

Nonin-Lecomte, S; Lin, C H; Patel, D J

2001-01-01

The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

PubMed Central

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

PubMed

Bénard, L; Mathy, N; Grunberg-Manago, M; Ehresmann, B; Ehresmann, C; Portier, C

1998-03-03

The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

Identification in a pseudoknot of a U⋅G motif essential for the regulation of the expression of ribosomal protein S15

PubMed Central

Bénard, Lionel; Mathy, Nathalie; Grunberg-Manago, Marianne; Ehresmann, Bernard; Ehresmann, Chantal; Portier, Claude

1998-01-01

The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U⋅G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U⋅G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U⋅G wobble pair cannot be substituted by A⋅G, C⋅A, A⋅C, G⋅U, or C⋅G without loss of the autocontrol. In addition, the base pair C⋅G, adjacent to the 5′ side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U⋅G/C⋅G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein. PMID:9482926

Terminal Area Procedures for Paired Runways

NASA Technical Reports Server (NTRS)

Lozito, Sandy

2011-01-01

Parallel Runway operations have been found to increase capacity within the National Airspace (NAS) however, poor visibility conditions reduce this capacity [1]. Much research has been conducted to examine the concepts and procedures related to parallel runways however, there has been no investigation of the procedures associated with the strategic and tactical pairing of aircraft for these operations. This study developed and examined the pilot and controller procedures and information requirements for creating aircraft pairs for parallel runway operations. The goal was to achieve aircraft pairing with a temporal separation of 15s(+/- 10s error) at a coupling point that is about 12 nmi from the runway threshold. Two variables were explored for the pilot participants: Two levels of flight deck automation (current-day flight deck automation, and a prototype future automation) as well as two flight deck displays that assisted in pilot conformance monitoring. The controllers were also provided with automation to help create and maintain aircraft pairs. Data showed that the operations in this study were found to be acceptable and safe. Workload when using the pairing procedures and tools was generally low for both controllers and pilots, and situation awareness (SA) was typically moderate to high. There were some differences based upon the display and automation conditions for the pilots. Future research should consider the refinement of the concepts and tools for pilot and controller displays and automation for parallel runway concepts.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Practical sliced configuration spaces for curved planar pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sacks, E.

1999-01-01

In this article, the author presents a practical configuration-space computation algorithm for pairs of curved planar parts, based on the general algorithm developed by Bajaj and the author. The general algorithm advances the theoretical understanding of configuration-space computation, but is too slow and fragile for some applications. The new algorithm solves these problems by restricting the analysis to parts bounded by line segments and circular arcs, whereas the general algorithm handles rational parametric curves. The trade-off is worthwhile, because the restricted class handles most robotics and mechanical engineering applications. The algorithm reduces run time by a factor of 60 onmore » nine representative engineering pairs, and by a factor of 9 on two human-knee pairs. It also handles common special pairs by specialized methods. A survey of 2,500 mechanisms shows that these methods cover 90% of pairs and yield an additional factor of 10 reduction in average run time. The theme of this article is that application requirements, as well as intrinsic theoretical interest, should drive configuration-space research.« less

Two-photon production of dilepton pairs in peripheral heavy ion collisions

NASA Astrophysics Data System (ADS)

Klein, Spencer R.

2018-05-01

The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.

The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

PubMed Central

Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

2015-01-01

During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

Simplified Aircraft-Based Paired Approach: Concept Definition and Initial Analysis

NASA Technical Reports Server (NTRS)

Johnson, Sally C.; Lohr, Gary W.; McKissick, Burnell T.; Abbott, Terence S.; Geurreiro, Nelson M.; Volk, Paul

2013-01-01

Simplified Aircraft-based Parallel Approach (SAPA) is an advanced concept proposed by the Federal Aviation Administration (FAA) to support dependent parallel approach operations to runways with lateral spacing closer than 2500 ft. At the request of the FAA, NASA performed an initial assessment of the potential performance and feasibility of the SAPA concept, including developing and assessing an operational implementation of the concept and conducting a Monte Carlo wake simulation study to examine the longitudinal spacing requirements. The SAPA concept was shown to have significant operational advantages in supporting the pairing of aircraft with dissimilar final approach speeds. The wake simulation study showed that support for dissimilar final approach speeds could be significantly enhanced through the use of a two-phased altitudebased longitudinal positioning requirement, with larger longitudinal positioning allowed for higher altitudes out of ground effect and tighter longitudinal positioning defined for altitudes near and in ground effect. While this assessment is preliminary and there are a number of operational issues still to be examined, it has shown the basic SAPA concept to be technically and operationally feasible.

Cytogenetic analysis in three Bryconamericus species (Characiformes, Characidae): first description of the 5S rDNA-bearing chromosome pairs in the genus

PubMed Central

2013-01-01

Background Nowadays, the genus Bryconamericus is placed in subfamily Stevardiinae within of Characidae, but not shows consistent evidence of monophyletism. The purpose of this work was to study the chromosomes of three species of Bryconamericus, aiming to add cytogenetic knowledge and contribute to the understanding of the chromosomal evolution of this genus. Results The chromosomes of three species of Bryconamericus were analyzed using cytogenetic techniques. The karyotype of Bryconamericus stramineus contained 6 metacentric (m) + 10 submetacentric (sm) + 16 subtelocentric (st) + 20 acrocentric (a), the fundamental number (FN) of 84, one silver impregnated (Ag-NOR) pair, one pair bearing the 18S ribosomal DNA sites, another pair bearing the 5S rDNA sites, and a few positive C-bands. Bryconamericus turiuba had a karyotype containing 8 m + 10sm + 14st + 20a (FN = 84), one chromosome pair Ag-NOR, two pairs bearing the 18S rDNA sites, two pairs bearing the 5S rDNA sites, and a few C-band regions. Bryconamericus cf. iheringii had a karyotype containing 10 m + 14sm + 18st + 10a (FN = 94), including one pair with a secondary constriction Ag-NOR positive. In this karyotype the fluorescent in situ hybridization (FISH) showed the 18S and 5S rDNA probe in adjacent position. Conclusions The results obtained in this work showed different characteristics in the organization of two multigene families, indicating that distinct evolutionary forces acting on the diversity of rDNA sequences in the genome of three Bryconamericus species. PMID:23547656

Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

PubMed

Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

2018-05-01

The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

Nonuniformity correction for an infrared focal plane array based on diamond search block matching.

PubMed

Sheng-Hui, Rong; Hui-Xin, Zhou; Han-Lin, Qin; Rui, Lai; Kun, Qian

2016-05-01

In scene-based nonuniformity correction algorithms, artificial ghosting and image blurring degrade the correction quality severely. In this paper, an improved algorithm based on the diamond search block matching algorithm and the adaptive learning rate is proposed. First, accurate transform pairs between two adjacent frames are estimated by the diamond search block matching algorithm. Then, based on the error between the corresponding transform pairs, the gradient descent algorithm is applied to update correction parameters. During the process of gradient descent, the local standard deviation and a threshold are utilized to control the learning rate to avoid the accumulation of matching error. Finally, the nonuniformity correction would be realized by a linear model with updated correction parameters. The performance of the proposed algorithm is thoroughly studied with four real infrared image sequences. Experimental results indicate that the proposed algorithm can reduce the nonuniformity with less ghosting artifacts in moving areas and can also overcome the problem of image blurring in static areas.

Ionic force field optimization based on single-ion and ion-pair solvation properties: Going beyond standard mixing rules

NASA Astrophysics Data System (ADS)

Fyta, Maria; Netz, Roland R.

2012-03-01

Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

NASA Astrophysics Data System (ADS)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Ultrashort fluorescence lifetimes of hydrogen-bonded base pairs of guanosine and cytidine in solution.

PubMed

Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich

2009-12-24

The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.

Pair-instability supernovae of fast rotating stars

NASA Astrophysics Data System (ADS)

Chen, Ke-Jung

2015-01-01

We present 2D simulations of pair-instability supernovae considering rapid rotation during their explosion phases. Recent studies of the Population III (Pop III) star formation suggested that these stars could be born with a mass scale about 100 M⊙ and with a strong rotation. Based on stellar evolution models, these massive Pop III stars might have died as highly energetic pair-instability supernovae. We perform 2D calculations to investigate the impact of rotation on pair-instability supernovae. Our results suggest that rotation leads to an aspherical explosion due to an anisotropic collapse. If the first stars have a 50% of keplerian rotational rate of the oxygen core before their pair-instability explosions, the overall 56Ni production can be significantly reduced by about two orders of magnitude. An extreme case of 100% keplerian rotational rate shows an interesting feature of fluid instabilities along the equatorial plane caused by non-synchronized and non-isotropic ignitions of explosions, so that the shocks run into the in-falling gas and generate the Richtmyer-Meshkov instability.

Adjacent segment infection after surgical treatment of spondylodiscitis.

PubMed

Siam, Ahmed Ezzat; El Saghir, Hesham; Boehm, Heinrich

2016-03-01

This is the first case series to describe adjacent segment infection (ASI) after surgical treatment of spondylodiscitis (SD). Patients with SD, spondylitis who were surgically treated between 1994 and 2012 were included. Out of 1187 cases, 23 (1.94 %) returned to our institution (Zentralklinik Bad Berka) with ASI: 10 males, 13 females, with a mean age of 65.1 years and a mean follow-up of 69 months. ASI most commonly involved L3-4 (seven patients), T12-L1 (five) and L2-3 (four). The mean interval between operations of primary infection and ASI was 36.9 months. All cases needed surgical intervention, debridement, reconstruction and fusion with longer instrumentation, with culture and sensitivity-based postoperative antimicrobial therapy. At last follow-up, six patients (26.1 %) were mobilized in a wheelchair with a varying degree of paraplegia (three had pre-existing paralysis). Three patients died within 2 months after the ASI operation (13 %). Excellent outcomes were achieved in five patients, and good in eight. Adjacent segment infection after surgical treatment of spondylodiscitis is a rare complication (1.94 %). It is associated with multimorbidity and shows a high mortality rate and a high neurological affection rate. Possible explanations are: haematomas of repeated micro-fractures around screw loosening, haematogenous spread, direct inoculation or a combination of these factors. ASI may also lead to proximal junctional kyphosis, as found in this series. We suggest early surgical intervention with anterior debridement, reconstruction and fusion with posterior instrumentation, followed by antimicrobial therapy for 12 weeks. Level IV retrospective uncontrolled case series.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

PubMed Central

Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095

biobambam: tools for read pair collation based algorithms on BAM files

PubMed Central

2014-01-01

Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.

Cooper Pairs in Insulators?!

ScienceCinema

James Valles

2017-12-09

Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

A chaotic micromixer using obstruction-pairs

NASA Astrophysics Data System (ADS)

Park, Jang Min; Duck Seo, Kyoung; Kwon, Tai Hun

2010-01-01

A micromixer is one of the most important components for a chemical and/or diagnostic analysis in microfluidic devices such as a micro-total-analysis-system and a lab-on-a-chip. In this paper, a novel chaotic micromixer is developed in a simple design by introducing obstruction-pairs on the bottom of a microchannel. An obstruction-pair, which is composed of two hexahedron blocks arranged in an asymmetric manner, can induce a rotational flow along the down-channel direction due to the anisotropy of flow resistance. By utilizing this characteristic of the obstruction-pair, four mixing units are designed in such a way that three obstruction-pairs induce three rotational flows which result in a down-welling and a hyperbolic point in the channel cross-section. There can be a variety of micromixer geometries by arranging the mixing units in various sequences along the microchannel, and their mixing performances will differ from each other due to different flow characteristics. In this regard, numerical investigations are carried out to predict and characterize the mixing performances of various micromixers. Also experimental verifications are carried out by a flow visualization technique using phenolphthalein and sodium hydroxide solutions in a polydimethylsiloxane-based micromixer.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

PubMed

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

PubMed

Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

2014-05-01

The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

Environmental characteristics of the Grand Fir Mosaic and adjacent habitat types

Treesearch

Dennis E. Ferguson; John C. Byrne

2000-01-01

Grand Fir Mosaic habitats differ from adjacent forest habitats in their slow rate of secondary succession to woody vegetation. Remote monitoring stations were used to sample the environment at a Grand Fir Mosaic site and three adjacent habitat types. The Grand Fir Mosaic site has shorter growing seasons, cooler temperatures, and more soil moisture than the other sites...

A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness

ERIC Educational Resources Information Center

Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert

2014-01-01

Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…

A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng; Li, Feng; Ganguly, Manjori

2008-11-14

Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less

Processing multiple non-adjacent dependencies: evidence from sequence learning

PubMed Central

de Vries, Meinou H.; Petersson, Karl Magnus; Geukes, Sebastian; Zwitserlood, Pienie; Christiansen, Morten H.

2012-01-01

Processing non-adjacent dependencies is considered to be one of the hallmarks of human language. Assuming that sequence-learning tasks provide a useful way to tap natural-language-processing mechanisms, we cross-modally combined serial reaction time and artificial-grammar learning paradigms to investigate the processing of multiple nested (A1A2A3B3B2B1) and crossed dependencies (A1A2A3B1B2B3), containing either three or two dependencies. Both reaction times and prediction errors highlighted problems with processing the middle dependency in nested structures (A1A2A3B3_B1), reminiscent of the ‘missing-verb effect’ observed in English and French, but not with crossed structures (A1A2A3B1_B3). Prior linguistic experience did not play a major role: native speakers of German and Dutch—which permit nested and crossed dependencies, respectively—showed a similar pattern of results for sequences with three dependencies. As for sequences with two dependencies, reaction times and prediction errors were similar for both nested and crossed dependencies. The results suggest that constraints on the processing of multiple non-adjacent dependencies are determined by the specific ordering of the non-adjacent dependencies (i.e. nested or crossed), as well as the number of non-adjacent dependencies to be resolved (i.e. two or three). Furthermore, these constraints may not be specific to language but instead derive from limitations on structured sequence learning. PMID:22688641

MINARETS WILDERNESS AND ADJACENT AREAS, CALIFORNIA.

USGS Publications Warehouse

Huber, N. King; Thurber, Horace K.

1984-01-01

A mineral survey of the Minarets Wilderness and adjacent areas in the central Sierra Nevada, California was conducted. The results of the survey indicate that the study area has a substantiated resource potential for small deposits of copper, silver, zinc, lead, and iron, and a probable mineral-resource potential for molybdenum. No energy-resource potential was identified in the study.

Homologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.

PubMed

Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W

1998-04-06

The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

Updates on Pairing Issues with the US Antarctic Meteorite Collection

NASA Technical Reports Server (NTRS)

Righter, K.; Satterwhite, C.; Schutt, J.

2015-01-01

The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.

Understanding Fomalhaut as a Cooper pair

NASA Astrophysics Data System (ADS)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

ERIC Educational Resources Information Center

Ilhan, Mustafa

2016-01-01

The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

Vortex pairs on surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)