Genome Sequence of the Fleming Strain of Micrococcus luteus, a Simple Free-Living Actinobacterium▿ †‡

PubMed Central

Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Victor; Mavromatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.

2010-01-01

Micrococcus luteus (NCTC2665, “Fleming strain”) has one of the smallest genomes of free-living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content, 73%) predicted to encode 2,403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 insertion sequence (IS) elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and 14 response regulators, a finding indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to β-lactam antibiotics may result from the presence of a reduced set of penicillin-binding proteins and the absence of a wblC gene, which plays an important role in the antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to most other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy, and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three-gene cluster essential for this

Isolation and characterization of a novel nitrobenzene-degrading bacterium with high salinity tolerance: Micrococcus luteus.

PubMed

Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong

2009-06-15

Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Micrococcus luteus mediated dual mode synthesis of gold nanoparticles: involvement of extracellular α-amylase and cell wall teichuronic acid.

PubMed

Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati

2013-03-01

In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.

Physicochemical parameters influencing coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13.

PubMed

Min, K R; Zimmer, M N; Rickard, A H

2010-11-01

The aim of this study was to explore the physicochemical parameters that influence coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13. Using visual coaggregation assays, the effect of different buffers, solutions of differing ionic strength, pH, temperature, and viscosity on the degree of coaggregation was assessed. Coaggregation occurred maximally in distilled water but was inhibited when coaggregates were suspended in a commonly-used oral bacterial coaggregation buffer, saline solutions, and Tris-Cl buffers. Coaggregation was weakly expressed in standard laboratory buffers. The ionic strength of inorganic salt solutions required to inhibit coaggregation depended upon the inorganic salt being tested. Coaggregation occurred at a pH of 3-10, between 5 and 80°C and was inhibited in solutions with a viscosity of 22.5 centipoises at 20°C. Inhibition of coaggregation with NaCl impaired biofilm development. When developing buffers to test for coaggregation, the natural liquid environment should be considered. Coaggregation between S. natatoria 2.1 and M. luteus 2.13 is only affected by physicochemical conditions beyond those typically found in natural freshwater ecosystems. Such a robust ability to coaggregate may enhance the ability of S. natatoria 2.1 and M. luteus 2.13 to develop a niche in freshwater biofilms.

Taxonomic dissection of the genus Micrococcus: Kocuria gen. nov., Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen. nov., and Micrococcus Cohn 1872 gen. emend.

PubMed

Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P

1995-10-01

The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].

Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

PubMed

Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

2010-02-01

Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

Survival of Microorganisms in Nature.

DTIC Science & Technology

1982-04-07

number) Survival of bacteria; Death of bacteria; Cysts; Dormancy; Pseudomonas aeruginosa; Azotobacter; Chemotaxis; Micrococcus luteus; Predation...attracted to and rapidly destroys (lyses) added Micrococcus luteus cells. There is also attack of predator on predator in this system. DO 1 DIT1 473 Oor I OV...and on laboratory media. 4 1 SUMMARY OF IMPORTANT RESULTS Micrococcus luteus was shown to survive only poorly in soil (Casida, 1980a). This was

Detection of Micrococcus luteus biofilm formation in microfluidic environments by pH measurement using an ion-sensitive field-effect transistor.

PubMed

Matsuura, Koji; Asano, Yuka; Yamada, Akira; Naruse, Keiji

2013-02-18

Biofilm formation in microfluidic channels is difficult to detect because sampling volumes are too small for conventional turbidity measurements. To detect biofilm formation, we used an ion-sensitive field-effect transistor (ISFET) measurement system to measure pH changes in small volumes of bacterial suspension. Cells of Micrococcus luteus (M. luteus) were cultured in polystyrene (PS) microtubes and polymethylmethacrylate (PMMA)-based microfluidic channels laminated with polyvinylidene chloride. In microtubes, concentrations of bacteria and pH in the suspension were analyzed by measuring turbidity and using an ISFET sensor, respectively. In microfluidic channels containing 20 μL of bacterial suspension, we measured pH changes using the ISFET sensor and monitored biofilm formation using a microscope. We detected acidification and alkalinization phases of M. luteus from the ISFET sensor signals in both microtubes and microfluidic channels. In the alkalinization phase, after 2 day culture, dense biofilm formation was observed at the bottom of the microfluidic channels. In this study, we used an ISFET sensor to detect biofilm formation in clinical and industrial microfluidic environments by detecting alkalinization of the culture medium. 

Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates.

PubMed

Mauclaire, Laurie; Egli, Marcel

2010-08-01

Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.

Structure of FabH and factors affecting the distribution of branched fatty acids in Micrococcus luteus.

PubMed

Pereira, Jose H; Goh, Ee-Been; Keasling, Jay D; Beller, Harry R; Adams, Paul D

2012-10-01

Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition.

Proteomic and metabolomic responses in hepatopancreas of Mytilus galloprovincialis challenged by Micrococcus luteus and Vibrio anguillarum.

PubMed

Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian

2013-12-06

The outbreak of pathogens can induce diseases and lead to massive mortalities of aquaculture animals including fish, mollusk and shrimp. In this work, the responses induced by Micrococcus luteus and Vibrio anguillarum were investigated in hepatopancreas of mussel Mytilus galloprovincialis using proteomics and metabolomics. Metabolic biomarkers demonstrated that M. luteus and V. anguillarum injections could induce osmotic stress and disturbance in energy metabolism. And the uniquely and more markedly altered metabolic biomarkers (glutamine, succinate, aspartate, glucose, ATP, homarine and tyrosine) indicated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. The differentially altered proteins meant that M. luteus and V. anguillarum induced different effects in mussels. However, the common proteomic biomarkers, arginine kinase and small heat shock protein, demonstrated that these two bacteria induced similar effects including oxidative stress and disturbance in energy metabolism in M. galloprovincialis. In addition, some metabolic biomarkers, ATP and glutamine, were confirmed by related proteins including arginine kinase, ATP synthase, nucleoside diphosphate kinase and glutamine synthetase in bacteria-challenged mussels. This study demonstrated that proteomics and metabolomics could provide an insightful view into the effects of environmental pathogens to the marine mussel M. galloprovincialis. The outbreak of pathogens can lead to diseases and massive mortalities of aquaculture animals including fish, mollusk and shrimp. The mussel M. galloprovincialis distributes widely along the Bohai coast and is popularly consumed as delicious seafood by local residents. This bivalve has become one of the important species in marine aquaculture industry in China. Therefore a study on pathogen-induced effects is necessary. In the present study, an integrated metabolomic and proteomic approach was used to elucidate the

Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.

PubMed

Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L

2011-06-01

The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.

Dynamic miRNA-mRNA regulations are essential for maintaining Drosophila immune homeostasis during Micrococcus luteus infection.

PubMed

Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei

2018-04-01

Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Extrachromosomal genetic elements in Micrococcus.

PubMed

Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm

2013-01-01

Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.

Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

PubMed

Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

2016-06-01

To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

Physicochemical properties and membrane biofouling of extra-cellular polysaccharide produced by a Micrococcus luteus strain.

PubMed

Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

2014-07-01

The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

PubMed Central

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

Endonuclease from Micrococcus luteus Which Has Activity Toward Ultraviolet-Irradiated Deoxyribonucleic Acid: Its Action on Transforming Deoxyribonucleic Acid

PubMed Central

Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.

1970-01-01

An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478

Impact of Branched-Chain Amino Acid Catabolism on Fatty Acid and Alkene Biosynthesis in Micrococcus luteus.

PubMed

Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang

2018-01-01

Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how

Evaluation of enhanced thermostability and operational stability of carbonic anhydrase from Micrococcus species.

PubMed

Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana

2013-06-01

Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.

Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

PubMed

Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

2015-05-01

Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Description of Micrococcus aloeverae sp. nov., an endophytic actinobacterium isolated from Aloe vera.

PubMed

Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S

2014-10-01

A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.

Biosynthetic elongation of isolated teichuronic acid polymers via glucosyl- and N-acetylmannosaminuronosyltransferases from solubilized cytoplasmic membrane fragments of Micrococcus luteus.

PubMed Central

Hildebrandt, K M; Anderson, J S

1990-01-01

Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507

Viability and biomass of Micrococcus luteus DE2008 at different salinity concentrations determined by specific fluorochromes and CLSM-image analysis.

PubMed

Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Esteve, Isabel; Solé, Antonio

2012-01-01

In previous studies, our group developed a method based on Confocal Laser Scanning Microscopy and Image Analysis (CLSM-IA) to analyze the diversity and biomass of cyanobacteria in microbial mats. However, this method cannot be applied to heterotrophic microorganisms, as these do not have autofluorescence. In this article, we present a method that combines CLSM-IA and Hoechst 33342 and SYTOX Green fluorochromes (FLU-CLSM-IA) to determine the viability and biomass of Micrococcus luteus DE2008, isolated from a saline microbial mat (Ebro Delta, Tarragona, Spain). The method has been applied to assess the effect of salinity on this microorganism. A reduction in viability and biomass (live cells) was observed as the salt concentration increases. The largest effect was at 100‰ NaCl with a cell death of 27.25% and a decrease in total and individual biomass of 39.75 and 0.009 mgC/cm(3), respectively, both with respect to optimal growth (10 ‰ NaCl). On the other hand, another important contribution of this article was that combining the FLU-CLSM-IA results with those achieved by plate counts enabled us to determine, for first time, the viability and the total biomass of the "dormant cells" (66.75% of viability and 40.59 mgC/cm(3) of total biomass at 100‰ NaCl). FLU-CLSM-IA is an efficient, fast, and reliable method for making a total count of cells at pixel level, including the dormant cells, to evaluate the viability and the biomass of a hetetrophic microorganism, M. luteus DE2008.

First report of linear megaplasmids in the genus Micrococcus.

PubMed

Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm

2010-01-01

High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.

Biosynthetic pathway for γ-cyclic sarcinaxanthin in Micrococcus luteus: heterologous expression and evidence for diverse and multiple catalytic functions of C(50) carotenoid cyclases.

PubMed

Netzer, Roman; Stafsnes, Marit H; Andreassen, Trygve; Goksøyr, Audun; Bruheim, Per; Brautaset, Trygve

2010-11-01

We report the cloning and characterization of the biosynthetic gene cluster (crtE, crtB, crtI, crtE2, crtYg, crtYh, and crtX) of the γ-cyclic C(50) carotenoid sarcinaxanthin in Micrococcus luteus NCTC2665. Expression of the complete and partial gene cluster in Escherichia coli hosts revealed that sarcinaxanthin biosynthesis from the precursor molecule farnesyl pyrophosphate (FPP) proceeds via C(40) lycopene, C(45) nonaflavuxanthin, C(50) flavuxanthin, and C(50) sarcinaxanthin. Glucosylation of sarcinaxanthin was accomplished by the crtX gene product. This is the first report describing the biosynthetic pathway of a γ-cyclic C(50) carotenoid. Expression of the corresponding genes from the marine M. luteus isolate Otnes7 in a lycopene-producing E. coli host resulted in the production of up to 2.5 mg/g cell dry weight sarcinaxanthin in shake flasks. In an attempt to experimentally understand the specific difference between the biosynthetic pathways of sarcinaxanthin and the structurally related ε-cyclic decaprenoxanthin, we constructed a hybrid gene cluster with the γ-cyclic C(50) carotenoid cyclase genes crtYg and crtYh from M. luteus replaced with the analogous ε-cyclic C(50) carotenoid cyclase genes crtYe and crtYf from the natural decaprenoxanthin producer Corynebacterium glutamicum. Surprisingly, expression of this hybrid gene cluster in an E. coli host resulted in accumulation of not only decaprenoxanthin, but also sarcinaxanthin and the asymmetric ε- and γ-cyclic C(50) carotenoid sarprenoxanthin, described for the first time in this work. Together, these data contributed to new insight into the diverse and multiple functions of bacterial C(50) carotenoid cyclases as key catalysts for the synthesis of structurally different carotenoids.

Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

PubMed

Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

2015-05-01

We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

PubMed

Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

2016-03-01

A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

[Occurrence of bacteria in the mouth from genera of Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus].

PubMed

Szczerba, Izabela; Krzemiński, Zbigniew

2002-01-01

The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.

Characterization of Micrococcus strains isolated from indoor air.

PubMed

Kooken, Jennifer M; Fox, Karen F; Fox, Alvin

2012-02-01

The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.

Characterization of Micrococcus strains isolated from indoor air

PubMed Central

Kooken, Jennifer M.; Fox, Karen F.; Fox, Alvin

2014-01-01

The characterization of microbes, such as of opportunists and pathogens (e.g. methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. PMID:21963944

Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris.

PubMed

Yoshimune, Kazuaki; Shirakihara, Yasuo; Wakayama, Mamoru; Yumoto, Isao

2010-02-01

Glutaminase from Micrococcus luteus K-3 [Micrococcus glutaminase (Mglu); 456 amino acid residues (aa); 48 kDa] is a salt-tolerant enzyme. Our previous study determined the structure of its major 42-kDa fragment. Here, using new crystallization conditions, we determined the structures of the intact enzyme in the presence and absence of its product L-glutamate and its activator Tris, which activates the enzyme by sixfold. With the exception of a 'lid' part (26-29 aa) and a few other short stretches, the structures were all very similar over the entire polypeptide chain. However, the presence of the ligands significantly reduced the length of the disordered regions: 41 aa in the unliganded structure (N), 21 aa for L-glutamate (G), 8 aa for Tris (T) and 6 aa for both L-glutamate and Tris (TG). L-glutamate was identified in both the G and TG structures, whereas Tris was only identified in the TG structure. Comparison of the glutamate-binding site between Mglu and salt-labile glutaminase (YbgJ) from Bacillus subtilis showed significantly smaller structural changes of the protein part in Mglu. A comparison of the substrate-binding pocket of Mglu, which is highly specific for L-glutamine, with that of Erwinia carotovora asparaginase, which has substrates other than L-glutamine, shows that Mglu has a larger substrate-binding pocket that prevents the binding of L-asparagine with proper interactions.

Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.

PubMed

Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang

2007-01-01

Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).

Nisin Migration in Shelf Stable, Tuna-Filled Tortillas During Storage

DTIC Science & Technology

2014-09-22

RATIONS SHELF LIFE ACCEPTABILITY MICROCOCCUS LUTEUS STORAGE INHIBITION MILITARY RATIONS...7 Figure 3. The assay of nisin against Micrococcus luteus ATCC 10240 in tuna enrobed in a tortilla wrap...METHODS 2.1 BACTERIAL STRAINS, MEDIA, AND BUFFER The nisin-sensitive test organism, Micrococcus luteus ATCC® 10240, was obtained from the American

Devices for monitoring content of microparticles and bacterium in injection solutions in pharmaceutical production

NASA Astrophysics Data System (ADS)

Bilyi, Olexander I.; Getman, Vasyl B.; Konyev, Fedir A.; Sapunkov, Olexander; Sapunkov, Pavlo G.

2001-06-01

The devices for monitoring of parameters of efficiency of water solutions filtration, which are based on the analysis of scattered light by microparticles are considered in this article. The efficiency of using of devices in pharmaceutics in technological processes of manufacturing medical injection solutions is shown. The examples of monitoring of contents of bacterial cultures Pseudomonas aeruginosa, Escherichia coli, and Micrococcus luteus in water solutions of glucose are indicated.

Evaluation of antibacterial properties of some medicinal plants used in Iran.

PubMed

Bonjar, Shahidi

2004-10-01

Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.

Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

DTIC Science & Technology

1987-11-23

III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

Standardized Procedures for Use of Nucleic Acid-Based Tools

DTIC Science & Technology

2008-08-01

Dhc size or cell wall characteristics including Brevundimonas diminuta (small), Micrococcus sp. (small coccoid) and Halobacterium sp. (Dhc-like cell...Halobacterium species as a Dhc surrogate. Another potential surrogate based on size and shape is Micrococcus species including Micrococcus luteus... Micrococcus luteus (ATCC-4442) are relatively small (1,000 nm) spherical bacteria (Madigan et al., 2006). Due to the fact that introduction and

Regioselective synthesis of novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole and 2,2‧-(1,3-phenylene)bis(3-substituted-2-imino-4-phenyl-3H-thiazole) derivatives as antibacterial agents

NASA Astrophysics Data System (ADS)

Abbasi Shiran, Jafar; Yahyazadeh, Asieh; Mamaghani, Manouchehr; Rassa, Mehdi

2013-05-01

Several novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole derivatives were synthesized by the reaction of allyl-thioureas and 2-bromoacetophenone. We also report the synthesis of bis-allyl-3H thiazoles using the reaction of various isothiocyanates and 1,3-phenylenediamine. The structures of all compounds were characterized by spectral and elemental analysis. Most of the synthesized compounds exhibited efficient antibacterial activities against Salmonella enterica, Micrococcus luteus, Bacillus subtilis and Pseudomonas aeruginosa.

Antibacterial properties of the skin mucus of the freshwater fishes, Rita rita and Channa punctatus.

PubMed

Kumari, U; Nigam, A K; Mitial, S; Mitial, A K

2011-07-01

The skin mucus of Rita rita and Channa punctatus was investigated to explore the possibilities of its antibacterial properties. Skin mucus was extracted in acidic solvents (0.1% trifluoroacetic acid and 3% acetic acid) and in triple distilled water (aqueous medium). The antibacterial activity of the mucus extracts was analyzed, using disc diffusion method, against five strains of bacteria--the Gram-positive Staphylococcus aureus and Micrococcus luteus; and the Gram negative Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi. In both Rita rita and Channa punctatus, the skin mucus extracted in acidic solvents as well as in aqueous medium show antibacterial activity against Staphylococcus aureus and Micrococcus luteus. Nevertheless, the activity is higher in acidic solvents than that in aqueous medium. The acidic mucus extracts of Rita rita, show antibacterial activity against Salmonella typhi as well. The results suggest that fish skin mucus have bactericidal properties and thus play important role in the protection of fish against the invasion of pathogens. Fish skin mucus could thus be regarded as a potential source of novel antibacterial components.

In vitro antibacterial activity of selected medicinal plants from lower Himalayas.

PubMed

Zulqarnain; Rahim, Abdur; Ahmad, Khalid; Ullah, Faizan; Ullah, Hamid; Nishan, Umar

2015-03-01

The present studies cover antibacterial activity of the crude methanolic extracts of 11 medicinal plants viz. Adhatoda vasica, Bauhenia variegate, Bombax ceiba, Carrisa opaca, Caryopteris grata, Debregeasia salicifolia, Lantana camara, Melia azedarach, Phyllanthus emblica, Pinus roxburghii and Olea ferruginea collected from lower Himalayas against two Gram positive (Staphylococcus aureus, Micrococcus luteus) and two Gram negative (Escherichia coli, Pseudomonas aureginosa) bacterial strains. The extracts were applied at four different concentrations (120 mg/mL, 90mg/mL, 60mg/mL and 30mg/mL) in dimethyl sulfoxide (DMSO) by using agar well diffusion method. Antibacterial activities against Staphylococcus aureus and Micrococcus luteus were observed formethanolic extracts of all the above mentioned plants. Greater antibacterial activity against Pseudomonas aeruginosa was only exhibited by Phyllanthus emblica, Pinus roxburghii, Debregeasia salicifolia and Lantana camara. Escherichia coli was highly resistant to all the plant extracts at all concentrations. It is inferred that methanolic crude extracts of the above mentioned plantsexhibitantibacterial activities against pathogenic bacteria, which proved the ethnobotanical importance of the selected plants that indigenous people use for cure against various diseases.

One-pot and two-step synthesis of novel carbonylthioureas and dicarbonyldithioureas derivatives

NASA Astrophysics Data System (ADS)

Banaei, Alireza; Shiran, Jafar Abbasi; Saadat, Afshin; Ardabili, Farnaz Fazlalizadeh; McArdle, Patrick

2015-11-01

One-pot, two-step synthesis of several 1-cyclopropanecarbonyl-3-(substituted phenyl)-thioureas and 1-(phenylene-1,4-dione)-3,3‧-(substituted phenyl)-dithioureas have been successfully prepared. The structures of the synthesized compounds were confirmed by elemental analysis, FT-IR spectroscopy and NMR. Also the crystal structure one of these compounds was determined by X-ray crystallography. All synthesized compounds were evaluated for antibacterial activity using Salmonella enterica (SE), Micrococcus luteus (ML), Bacillus subtilis (BS) and Pseudomonas aeruginosa (PS).

21 CFR 610.12 - Sterility.

Code of Federal Regulations, 2010 CFR

2010-04-01

.... Non-spore-formers 3. Candida albicans (ATCC No. 10231) Do. 4. Micrococcus luteus (ATCC No. 9341) Do. 5.... 6633) 20 to 25 °C. Non-spore-formers 2. Candida albicans (ATCC No. 10231) Do. 3. Micrococcus luteus...

Distribution and Persistence of Staphylococcus and Micrococcus Species and Other Aerobic Bacteria on Human Skin1

PubMed Central

Kloos, Wesley E.; Musselwhite, Margaret S.

1975-01-01

The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086

University Research Initiative Program for Combat Readiness

DTIC Science & Technology

1999-05-01

found in sponge-associated bacteria Micrococcus luteus (Bultel-Ponce et al., 1998). Such compounds have antimicrobial activity. Water contact angles...Guyot, M. 1998. Metabolites from the sponge-associated bacterium Micrococcus luteus. J. Mar. Biotechnol. 6:233-236. 3. Incze, B.I., Sea Technol. 1996, 37

Natural History of Multi-Drug Resistant Organisms in a New Military Medical Facility

DTIC Science & Technology

2012-10-01

Enterobacter cloacae  Maternity Ward  05.312  Sink top  Micrococcus  luteus  Maternity Ward  05.312  Telephone  Pantoea agglomerans  Maternity Ward...Acinetobacter baumannii  Surgical Ward  06.316  Call box  Acinetobacter  baumannii/calcoaceticus complex  Surgical Ward  06.316  Sink top  Micrococcus  luteus...Medical Ward  07.216  Sink top  Micrococcus  luteus  Medical Ward  07.216  Room Sink  Staphylococcus sciuri  ICU  02.123  Toilet seat  Staphylococcus

Evaluation of autochthonous micrococcus strains as starter cultures for the production of Kedong sufu.

PubMed

Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X

2016-03-01

The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.

Sterilization effects of atmospheric cold plasma brush

NASA Astrophysics Data System (ADS)

Yu, Q. S.; Huang, C.; Hsieh, F.-H.; Huff, H.; Duan, Yixiang

2006-01-01

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0×104-1.0×105 Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar +O2 plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structures were examined using scanning electron microscopy.

One-pot synthesis of biologically active 1,2,3-trisubstituted pyrrolo[2,3-b]quinoxalines through a palladium-catalyzed reaction with internal alkyne moieties.

PubMed

Keivanloo, Ali; Besharati-Seidani, Tayebeh; Kaboudin, Babak; Yoshida, Akihiro; Yokomatsu, Tsutomu

2018-06-16

Synthesis of 2,3-disubstituted 1-alkylpyrrolo[2,3-b]quinoxalines was accomplished through the reaction of 3-chloroquinoxalin-2-amines with internal alkynes in the presence of Pd(OAc)[Formula: see text], NaOAc, and KOtBu in DMSO. This method afforded desired pyrrolo[2,3-b]quinoxalines in 65-92% reaction yields. The minimum inhibition concentration and minimum bactericidal concentration determinations against Micrococcus luteus and Pseudomonas aeruginosa revealed that some of the synthesized compounds showed the same values compared to tetracycline. These compounds could be used in the future research for the development of new antibiotics.

Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

PubMed

Urban, C; Salton, M R

1983-08-31

The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

Sterilization effects of atmospheric cold plasma brush

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Q.S.; Huang, C.; Hsieh, F.-H.

2006-01-02

This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0x10{sup 4}-1.0x10{sup 5} Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar+O{sub 2} plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structuresmore » were examined using scanning electron microscopy.« less

[Features of interaction bacterial strains Micrococcus luteus LBK1 from plants varieties/hybrids cucumber and sweet pepper and with fungus Fusarium oxysporum Scelecht].

PubMed

Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V

2014-01-01

The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.

Crystal structure of heterodimeric hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 reveals that the small subunit is directly involved in the product chain length regulation.

PubMed

Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio

2011-02-04

Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.

Micrococcus-associated central venous catheter infection in patients with pulmonary arterial hypertension.

PubMed

Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J

2004-07-01

To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require

Antimicrobial and anticancer efficacy of antineoplastic agent capped gold nanoparticles.

PubMed

Selvaraj, V; Grace, A Nirmala; Alagar, M; Hamerton, I

2010-04-01

Synthesis of thioguanine (TG)-capped Au nanoparticles (Au@TG) and their enhanced in vitro antimicrobial and anticancer efficacy against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Aspergillus fumigatus, Aspergillus niger and Hep2 cancer cell (Human epidermiod cell) have been reported. The nature of binding between 6-TG and the gold nanoparticles via complexation is investigated using ultraviolet-visible spectrum, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FT-IR) spectroscopy. The present experimental studies suggests that Au@TG are more potential than TG towards antimicrobial and anticancer activities. Hence, gold nanoparticles have the potential to be used as effective carriers for anticancer drug.

Antimicrobial Activity and Phytochemical Screening of Buchenavia tetraphylla (Aubl.) R. A. Howard (Combretaceae: Combretoideae)

PubMed Central

de Oliveira, Ygor Lucena Cabral; Nascimento da Silva, Luís Cláudio; da Silva, Alexandre Gomes; Macedo, Alexandre José; de Araújo, Janete Magali; Correia, Maria Tereza dos Santos; da Silva, Márcia Vanusa

2012-01-01

This study evaluated the antimicrobial and hemolytic activities and phytochemical constituents of hydroalcoholic extract and its fractions from Buchenavia tetraphylla leaves. Cyclohexane (BTCF), ethyl acetate (BTEF), and n-butanol-soluble (BTSBF) and non-soluble (BTNBF) fractions were obtained from a liquid-liquid partition of hydroalcoholic extract (BTHE) from B. tetraphylla leaves. The hemolytic activity of active fractions was checked. The BTHE inhibited the growth of Micrococcus luteus (MIC: 0.10 mg/mL), Pseudomonas aeruginosa (MIC: 0.20 mg/mL), Mycobacterium smegmatis (MIC: 0.39 mg/mL), Proteus vulgaris, and Staphylococcus aureus (MIC: 0.78 mg/mL for both). The more active fractions were BTCF and BTBSF. BTCF showed better potential to inhibit M. luteus (0.10 mg/mL), P. aeruginosa (0.20 mg/mL), S. enteritidis (0.39 mg/mL), and S. aureus (1.56 mg/mL). BTBSF showed the best results for M. luteus (0.10 mg/mL), M. smegmatis, B. subtilis (0.39 mg/mL for both), and P. vulgaris (0.10 mg/mL). The HC50 were greater than observed MIC: 20.30, 4.70 and 2.53 mg/mL, respectively, to BTBF, BTHE and BTCF, which. The phytochemical analysis detected the presence of flavanoids, triterpene, carbohydrate, and tannin. Our work showed for the first time the broad-spread antimicrobial activity of B. tetraphylla, which has nonhemolytic action, creating a new perspective on the interesting association of traditional and scientific knowledge. PMID:23365533

A novel antibacterial and antifungal phenolic compound from the endophytic fungus Pestalotiopsis mangiferae.

PubMed

Subban, Kamalraj; Subramani, Ramesh; Johnpaul, Muthumary

2013-01-01

A novel phenolic compound, 4-(2,4,7-trioxa-bicyclo[4.1.0]heptan-3-yl) phenol (1), was isolated from Pestalotiopsis mangiferae, an endophytic fungus associated with Mangifera indica Linn. The structure of the compound was elucidated on the basis of comprehensive spectral analysis (UV, IR, ¹H-, ¹³C- and 2D-NMR, as well as HRESI-MS). Compound (1) shows potent antibacterial and antifungal activity against Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa and Candida albicans. The transmission electron microscope study for the mode of inhibition of compound (1) on bacterial pathogens revealed the destruction of bacterial cells by cytoplasm agglutination with the formation of pores in cell wall membranes.

Analytical detection and biological assay of antileukemic drug 5-fluorouracil using gold nanoparticles as probe.

PubMed

Selvaraj, Vaithilingam; Alagar, Muthukaruppan

2007-06-07

Gold nanoparticles are reported and evaluated as probes for the detection of anticancer drug 5-fluorouracil (5FU). The nature of binding between 5FU and gold nanoparticles via complexation is investigated using ultraviolet visible spectrophotometry, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FTIR) spectroscopy. The bound antileukemic drug is fluorescent and the quenching property of gold nanoparticles could be exploited for biological investigations. The 5FU-colloidal gold complex (Au@5FU) is observed to have appreciable antibacterial and antifungal activity against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus fumigatus, and Aspergillus niger. The experimental studies suggest that gold nanoparticles have the potential to be used as effective carriers for anticancer drugs.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

[Occurrence and number of bacteria from the Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus genera on skin and mucous membranes in humans].

PubMed

Szczerba, Izabela

2003-01-01

The aim of work was to evaluate the frequency of occurrence of bacteria from genera of Micrococcus, Kocuria, Nesterenkonia, kytococcus and Dermatococcus on human skin and mucous membranes in healthy population. Among 150 investigated persons these bacteria were found in 122 (81.3%). The frequency of isolation was similar in both sex (82.4% in female and 79.7% in male). Most often the strains were isolated from oral cavity (48.7%), and from skin of palm and forearm (40.7% and 37.3%). Least frequency of occurrence was observed in vestibule of nose (26%). The predominant isolated strains were: M. luteus (26.2%), and N. halobia (21%) followed by K. varians (16.4%), M. lylae (12.2%), D. sedentarius (9.1%), K. kristinae (7.3%), K. nishinomiyaensis (7.3%), K. rosea (0.3%).

Antimicrobial activity of Chinese bayberry extract for the preservation of surimi.

PubMed

Li, Jianrong; Han, Qiang; Chen, Wei; Ye, Libin

2012-08-30

Chemical preservatives such as sodium nitrite and potassium sorbate have been widely used to keep surimi products fresh. However, the potential harmfulness to human health cannot be ignored. This study was conducted to develop natural preservatives for the storage of Collichthys surimi. Among the eight Chinese traditional herbs and fruits, Chinese bayberry extract showed the greatest inhibitory effect against surimi spoilage bacteria Serratia marcescens and Pseudomonas aeruginosa. Moreover, N-butanol phase extract of bayberry (NB) showed the greatest activity among the different phases of bayberry extract. When Chinese bayberry extract was combined with tea polyphenol, an additive inhibitory effect was observed on growth of Hansenula anomala, Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Our results further indicated that the shelf life of surimi products stored at room temperature can be extended when supplemented with Chinese bayberry extract. Our results suggest that Chinese bayberry extract can be used as a natural preservative for the storage of Collichthys surimi. Copyright © 2012 Society of Chemical Industry.

Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.

PubMed

Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen

2014-01-01

Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Catalase derived from Micrococcus lysodeikticus... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture...

The Role of Inducible DNA Repair in W-Reactivation and Related Phenomena.

DTIC Science & Technology

1981-10-14

unexcised dimers in X DNA. This was consistent with the finding of Tomilin and Mosevitskaya (1975) which showed that the UV-endonuclease from Micrococcus ...of DNA in vitro with UV-endonuclease from Micrococcus luteus. Mutat. Res. 27, 147-156 (1975) Tomizawa, J., Ogawa, T.: Effect of ultraviolet irradiation

Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.

PubMed

Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang

2010-08-01

Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is

Pitting failure of copper pipings for emergency fire sprinkler in ground water

NASA Astrophysics Data System (ADS)

Baek, Seung-won; Lee, Jong-kwon; Kim, Jong-jip; Kim, Kyung-ja

2015-05-01

The possibility of microbiologically influenced corrosion was investigated in the early pitted copper pipes. The pipes were installed for less than 6 months as an immergency fire sprinkler. The bacteria were cultured by sampling of corrosion by-product near pits on failed copper pipes for the aerobic as well as anaerobic bacteria. However, only aerobic bacteria was found, which were Micrococcus Luteus and Bacillus sp.. The corrosion rate of copper pipes were studied by weight loss in the groundwater and polarization method. In immersion test as well as the electrochemical polarization test in ground water, only Micrococcus Luteus could activate corrosion of copper by 20% and 15%, respectively. On the other hand, Bacillus sp. showed little effect on corrosion in the above two tests. The shape and characteristics of failed copper pipes as well as simulated copper were investigated using stereoscope, optical microscopy, scanning electron microscope and EDS. The cause of pits were discussed, related with the dissolved copper concentrations, pH, and optical density. It could be concluded that the early failure of copper pipings could be ascribed to the acceration of copper in the presence of bacteria, i.e., Micrococcus Luteus.

Optimization of Nutrients and Culture Conditions for Alkaline Protease Production Using Two Endophytic Micrococci: Micrococcus aloeverae and Micrococcus yunnanensis.

PubMed

Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S

2017-06-01

An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.

Development of a simple and low cost microbioreactor for high-throughput bioprocessing.

PubMed

Rahman, Pattanathu K S M; Pasirayi, Godfrey; Auger, Vincent; Ali, Zulfiqur

2009-02-01

A simple microbioreactor for high-throughput bioprocessing made from low cost polymer polytetrafluoroethylene (PTFE) tubes with a working volume of 1.5 ml is described. We have developed a microfluidic system that handles a small population of cells of a model microorganism, Pseudomonas aeruginosa DS10-129. Under the conditions of the microbioreactor, the organism produced extracellular secondary metabolites by using nutrient broth modified with glycerol. Pyocyanins were isolated from the fermented medium as a metabolite of interest. Antibiotic properties of pyocyanin were effective against a number of microorganisms such as Staphylococcus aureus, S. epidermis, Bacillus subtilis, Micrococcus luteus and Saccharomyces cerevisiae. Batch fermentation of the model organism in the microbioreactor was compared to shake-flask and conventional bench fermenter methods. Results obtained from the microbioreactor compared favourably with the conventional processes.

Micrococcus lactis sp. nov., isolated from dairy industry waste.

PubMed

Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

2011-12-01

A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

Urinary infection caused by Micrococcus subgroup 3

PubMed Central

Kerr, Helen

1973-01-01

The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds.

PubMed

Rauha, J P; Remes, S; Heinonen, M; Hopia, A; Kähkönen, M; Kujala, T; Pihlaja, K; Vuorela, H; Vuorela, P

2000-05-25

Plant phenolics, especially dietary flavonoids, are currently of growing interest owing to their supposed functional properties in promoting human health. Antimicrobial screening of 13 phenolic substances and 29 extracts prepared from Finnish plant materials against selected microbes was conducted in this study. The tests were carried out using diffusion methods with four to nine microbial species (Aspergillus niger, Bacillus subtilis, Candida albicans, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Saccharomyces cerevisiae, Staphylococcus aureus and Staphylococcus epidermidis). Flavone, quercetin and naringenin were effective in inhibiting the growth of the organisms. The most active plant extracts were purple loosestrife (Lythrum salicaria L.) against Candida albicans, meadowsweet (Filipendula ulmaria (L.) Maxim.), willow herb (Epilobium angustifolium L.), cloudberry (Rubus chamaemorus L.) and raspberry (Rubus idaeus L.) against bacteria, and white birch (Betula pubescens Ehrh.), pine (Pinus sylvestris L.) and potato (Solanum tuberosum. L.) against gram-positive Staphylococcus aureus.

Development of a rapid optic bacteria detecting system based on ATP bioluminescence

NASA Astrophysics Data System (ADS)

Liu, Jun Tao; Luo, JinPing; Liu, XiaoHong; Cai, XinXia

2014-12-01

A rapid optic bacteria detecting system based on the principle of Adenosine triphosphate(ATP) bioluminescence was presented in this paper. This system consisted of bioluminescence-based biosensor and the high-sensitivity optic meter. A photon counting photomultiplier tube (PMT) module was used to improve the detection sensitivity, and a NIOS II/f processor based on a Field Programmable Gate Array(FPGA) was used to control the system. In this work, Micrococcus luteus were chosen as the test sample. Several Micrococcus luteus suspension with different concentration was tested by both T2011 and plate counting method. By comparing the two group results, an calibration curve was obtained from the bioluminescence intensity for Micrococcus luteus in the range of 2.3×102 ~ 2.3×106 CFU/mL with a good correlation coefficient of 0.960. An impacting Air microorganism sampler was used to capture Airborne Bacteria, and 8 samples were collected in different place. The TBC results of 8 samples by T2011 were between 10 ~ 2×103 cfu/mL, consistent with that of plate counting method, which indicated that 8 samples were between 10 ~ 3×103 cfu/mL. For total airborne bacteria count was small, correlation coefficient was poor. Also no significant difference was found between T2011 and plate counting method by statistical analyses.

Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.

PubMed

Qabaha, Khaled Ibraheem

2013-01-01

Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.

Halophilic Amylase from a Moderately Halophilic Micrococcus

PubMed Central

Onishi, Hiroshi

1972-01-01

A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445

Antimicrobial activity of honokiol and magnolol isolated from Magnolia officinalis.

PubMed

Ho, K Y; Tsai, C C; Chen, C P; Huang, J S; Lin, C C

2001-03-01

The antimicrobial activity of honokiol and magnolol, the main constituents of Magnolia officinalis was investigated. The antimicrobial activity was assayed by the agar dilution method using brain heart infusion medium and the minimum inhibitory concentration (MIC) were determined for each compound using a twofold serial dilution assay. The results showed that honokiol and magnolol have a marked antimicrobial effect (MIC = 25 microg/mL) against Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Micrococcus luteus and Bacillus subtilis, but did not show antimicrobial activity (MIC > or = 100 microg/mL) for Shigella flexneii, Staphylococcus epidermidis, Enterobacter aerogenes, Proteus vulgaris, Escherichia coli and Pseudomonas aeruginosa. Our results indicate that honokiol and magnolol, although less potent than tetracycline, show a significant antimicrobial activity for periodontal pathogens. Hence we suggest that honokiol and magnolol might have the potential to be an adjunct in the treatment of periodontitis. Copyright 2001 John Wiley & Sons, Ltd.

New Benzophenones and Xanthones from Cratoxylum sumatranum ssp. neriifolium and Their Antibacterial and Antioxidant Activities.

PubMed

Tantapakul, Cholpisut; Maneerat, Wisanu; Sripisut, Tawanun; Ritthiwigrom, Thunwadee; Andersen, Raymond J; Cheng, Ping; Cheenpracha, Sarot; Raksat, Achara; Laphookhieo, Surat

2016-11-23

Two new benzophenones (1 and 2) and four new xanthones (4-6 and 17) together with 24 known compounds (3, 7-16, and 18-30) were isolated from the roots and twigs of Cratoxylum sumatranum ssp. neriifolium. Their structures were elucidated by spectroscopic methods. Compounds 5 and 26 showed antibacterial activity against Micrococcus luteus, Bacillus cereus, and Staphylococcus epidermis with minimum inhibitory concentrations ranging from 4 to 8 μg/mL, whereas compounds 7, 20, and 26 displayed selective antibacterial activities against Staphylococcus aureus (8 μg/mL), Salmonella typhimurium (4 μg/mL), and Pseudomonas aeruginosa (4 μg/mL), respectively. The radical scavenging effects of some isolated compounds were investigated. Compounds 11 and 21 exhibited potent activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 50 values of 7.0 ± 1.0 and 6.0 ± 0.2 μM, respectively.

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies.

PubMed

Parra-González, Lorena B; Aravena-Abarzúa, Gabriela A; Navarro-Navarro, Cristell S; Udall, Joshua; Maughan, Jeff; Peterson, Louis M; Salvo-Garrido, Haroldo E; Maureira-Butler, Iván J

2012-08-24

Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession's origin. L. luteus deep transcriptome sequencing will facilitate the further

Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

PubMed Central

von Eiff, C; Herrmann, M; Peters, G

1995-01-01

The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321

Yellow lupin (Lupinus luteus L.) transcriptome sequencing: molecular marker development and comparative studies

PubMed Central

2012-01-01

Background Yellow lupin (Lupinus luteus L.) is a minor legume crop characterized by its high seed protein content. Although grown in several temperate countries, its orphan condition has limited the generation of genomic tools to aid breeding efforts to improve yield and nutritional quality. In this study, we report the construction of 454-expresed sequence tag (EST) libraries, carried out comparative studies between L. luteus and model legume species, developed a comprehensive set of EST-simple sequence repeat (SSR) markers, and validated their utility on diversity studies and transferability to related species. Results Two runs of 454 pyrosequencing yielded 205 Mb and 530 Mb of sequence data for L1 (young leaves, buds and flowers) and L2 (immature seeds) EST- libraries. A combined assembly (L1L2) yielded 71,655 contigs with an average contig length of 632 nucleotides. L1L2 contigs were clustered into 55,309 isotigs. 38,200 isotigs translated into proteins and 8,741 of them were full length. Around 57% of L. luteus sequences had significant similarity with at least one sequence of Medicago, Lotus, Arabidopsis, or Glycine, and 40.17% showed positive matches with all of these species. L. luteus isotigs were also screened for the presence of SSR sequences. A total of 2,572 isotigs contained at least one EST-SSR, with a frequency of one SSR per 17.75 kbp. Empirical evaluation of the EST-SSR candidate markers resulted in 222 polymorphic EST-SSRs. Two hundred and fifty four (65.7%) and 113 (30%) SSR primer pairs were able to amplify fragments from L. hispanicus and L. mutabilis DNA, respectively. Fifty polymorphic EST-SSRs were used to genotype a sample of 64 L. luteus accessions. Neighbor-joining distance analysis detected the existence of several clusters among L. luteus accessions, strongly suggesting the existence of population subdivisions. However, no clear clustering patterns followed the accession’s origin. Conclusion L. luteus deep transcriptome

Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.

PubMed Central

Geary, C; Stevens, M

1986-01-01

A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667

Factors Affecting Transformation of Micrococcus lysodeikticus

PubMed Central

Kloos, Wesley E.

1969-01-01

Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710

Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.

PubMed

Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo

2009-04-01

In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.

EFFECT OF IMPACT STRESS ON MICROBIAL RECOVERY ON AN AGAR SURFACE

EPA Science Inventory

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. he relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving a...

Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.

PubMed

Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T

2017-08-10

We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.

Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.

PubMed

Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun

2009-05-01

A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).

Antimicrobial and antifungal activities of the extracts and essential oils of Bidens tripartita.

PubMed

Tomczykowa, Monika; Tomczyk, Michał; Jakoniuk, Piotr; Tryniszewska, Elzbieta

2008-01-01

The aim of this study was to determine the antibacterial and antifungal properties of the extracts, subextracts and essential oils of Bidens tripartita flowers and herbs. In the study, twelve extracts and two essential oils were investigated for activity against different Gram-positive Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Gram-negative bacteria Escherichia coli, E. coli (beta-laktamase+), Klebsiella pneumoniae (ESBL+), Pseudomonas aeruginosa and some fungal organisms Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus using a broth microdilution and disc diffusion methods. The results obtained indicate antimicrobial activity of the tested extracts (except butanolic extracts), which however did not inhibit the growth of fungi used in this study. Bacteriostatic effect of both essential oils is insignificant, but they have strong antifungal activity. These results support the use of B. tripartita to treat a microbial infections and it is indicated as an antimicrobial and antifungal agent, which may act as pharmaceuticals and preservatives.

Search for antibacterial and antifungal agents from selected Indian medicinal plants.

PubMed

Kumar, V Prashanth; Chauhan, Neelam S; Padh, Harish; Rajani, M

2006-09-19

A series of 61 Indian medicinal plants belonging to 33 different families used in various infectious disorders, were screened for their antimicrobial properties. Screening was carried out at 1000 and 500 microg/ml concentrations by agar dilution method against Bacillus cereus var mycoides, Bacillus pumilus, Bacillus subtilis, Bordetella bronchiseptica, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus faecalis, Candida albicans, Aspergillus niger and Saccharomyces cerevisiae. Twenty-eight plant extracts showed activity against at least one of the test organisms used in the screening. On the basis of the results obtained, we conclude that the crude extracts of Dorema ammoniacum, Sphaeranthus indicus, Dracaena cinnabari, Mallotus philippinensis, Jatropha gossypifolia, Aristolochia indica, Lantana camara, Nardostachys jatamansi, Randia dumetorum and Cassia fistula exhibited significant antimicrobial activity and properties that support folkloric use in the treatment of some diseases as broad-spectrum antimicrobial agents. This probably explains the use of these plants by the indigenous people against a number of infections.

Antioxidant, electrochemical, thermal, antimicrobial and alkane oxidation properties of tridentate Schiff base ligands and their metal complexes

NASA Astrophysics Data System (ADS)

Ceyhan, Gökhan; Çelik, Cumali; Uruş, Serhan; Demirtaş, İbrahim; Elmastaş, Mahfuz; Tümer, Mehmet

2011-10-01

In this study, two Schiff base ligands (HL 1 and HL 2) and their Cu(II), Co(II), Ni(II), Pd(II) and Ru(III) metal complexes were synthesized and characterized by the analytical and spectroscopic methods. Alkane oxidation activities of the metal complexes were studied on cyclohexane as substrate. The ligands and their metal complexes were evaluated for their antimicrobial activity against Corynebacterium xerosis, Bacillus brevis, Bacillus megaterium, Bacillus cereus, Mycobacterium smegmatis, Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis (as Gram-positive bacteria) and Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Yersinia enterocolitica, Klebsiella fragilis, Saccharomyces cerevisiae, and Candida albicans (as Gram-negative bacteria). The antioxidant properties of the Schiff base ligands were evaluated in a series of in vitro tests: 1,1-diphenyl-2-picrylhydrazyl (DPPH rad ) free radical scavenging and reducing power activity of superoxide anion radical generated non-enzymatic systems. Electrochemical and thermal properties of the compounds were investigated.

Pure and zinc doped nano-hydroxyapatite: Synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2014-09-01

The structural, antimicrobial, and hemolytic properties and bioactivity have been studied of pure hydroxyapatite (HAP) and zinc doped hydroxyapatite (Zn-HAP) nano-particles for their medical applications. Pure HAP and Zn-HAP nano-particles were synthesized by the surfactant mediated approach. The doping of zinc was estimated by EDAX. The average particle size was determined by applying Scherrer's formula to powdered XRD patterns. The nano-particle morphology was studied by TEM and the presence of various functional groups was identified by FTIR spectroscopy. Good antimicrobial activity of nano-HAP and nano-Zn-HAP was found against five organisms, viz., Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus, Staphylococcous aureus and Bacillus cereus as Gram positive. The ability of new apatite formation on the surface of pure and doped HAP samples was studied by using Simulated Body Fluid (SBF) in vitro. Hemolytic study indicated that all samples were non-hemolytic and suggesting potential application as bone implant material.

Isolation and identification of symbiotic bacteria from the skin, mouth, and rectum of wild and captive tree shrews.

PubMed

Li, Gui; Lai, Ren; Duan, Gang; Lyu, Long-Bao; Zhang, Zhi-Ye; Liu, Huang; Xiang, Xun

2014-11-18

Endosymbionts influence many aspects of their hosts' health conditions, including physiology, development, immunity, metabolism, etc. Tree shrews (Tupaia belangeri chinensis) have attracted increasing attention in modeling human diseases and therapeutic responses due to their close relationship with primates. To clarify the situation of symbiotic bacteria from their body surface, oral cavity, and anus, 12 wild and 12 the third generation of captive tree shrews were examined. Based on morphological and cultural characteristics, physiological and biochemical tests, as well as the 16S rDNA full sequence analysis, 12 bacteria strains were isolated and identified from the wild tree shrews: body surface: Bacillus subtilis (detection rate 42%), Pseudomonas aeruginosa (25%), Staphlococcus aureus (33%), S. Epidermidis (75%), Micrococcus luteus (25%), Kurthia gibsonii (17%); oral cavity: Neisseria mucosa (58%), Streptococcus pneumonia (17%); anus: Enterococcus faecalis (17%), Lactococus lactis (33%), Escherichia coli (92%), Salmonella typhosa (17%); whereas, four were indentified from the third generation captive tree shrews: body surface: S. epidermidis (75%); oral cavity: N.mucosa (67%); anus: L. lactis (33%), E. coli (100%). These results indicate that S. epidermidis, N. mucosa, L. lactis and E. coli were major bacteria in tree shrews, whereas, S. aureus, M. luteus, K. gibsonii, E. faecalis and S. typhosa were species-specific flora. This study facilitates the future use of tree shrews as a standard experimental animal and improves our understanding of the relationship between endosymbionts and their hosts.

Endocarditis due to Micrococcus sedentarius incertae sedis.

PubMed Central

Old, D C; McNeill, G P

1979-01-01

The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056

Regioselective synthesis of 3-benzyl substituted pyrimidino chromen-2-ones and evaluation of anti-microbial and anti-biofilm activities.

PubMed

Emmadi, Narender Reddy; Atmakur, Krishnaiah; Bingi, Chiranjeevi; Godumagadda, Narender Reddy; Chityal, Ganesh Kumar; Nanubolu, Jagadeesh Babu

2014-01-15

Regioselective synthesis of a number of highly functionalized 3-benzylpyrimidino chromen-2-ones (4) were accomplished in a one pot three component reaction in acetic acid and determined their anti-microbial and anti-biofilm activities. Compounds 4o and 4p showed an excellent anti-microbial activity against Micrococcus luteus MTCC 2470 at a par with standard control (Ciprofloxacin) and exhibited best activity against Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Further, compounds 4h, 4i, 4m, 4n and 4q showed promising activity against Micrococcus luteus MTCC 2470, Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Whereas, compounds 4m showed very promising biofilm inhibition activity against Staphylococcus aureus MLS 16 MTCC 2940 and 4o, 4p showed very potent activity against Staphylococcus aureus MTCC 96 at a par with Ciprofloxacin used as standard control. Copyright © 2013 Elsevier Ltd. All rights reserved.

Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

PubMed

Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

2016-01-01

Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

Ultraviolet/ultrasound-activated persulfate for degradation of drug by zinc selenide quantum dots: Catalysis and microbiology study.

PubMed

Fakhri, Ali; Naji, Mahsa; Tahami, Shiva

2017-05-01

In this study, wet chemical method used for ZnSe quantum dots (QDs) and characterized by, UV-vis, photoluminescence spectroscopy, X-ray diffraction and transmission electron microscopy. The crystallites size of ZnSe QDs was 4.0nm. The average diameters of ZnSe QDs were 3.0-5.3nm. Ritalin was degraded using the UV/ZnSe QDs/persulfate process. The several parameters investigated for the influence of Rtialin degradation were the temperature, the persulfate concentration, and the initial Ritalin concentration. The values of optimum parameters ware room temperature, concentration persulfate 5mmol/L and initial Ritalin concentration 0.09mmol/L. Comparative analyses showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. Comparative analysis showed the maximum degradation of Ritalin was found for ZnSe/persulfate under ultra-visible and ultra-sonic irradiation process. The values of first-order rate constants from degradation of Ritalin at 25°C were 0.96×10 -2 , 1.09×10 -2 , 1.59×10 -2 and 2.19×10 -2 for US/PS, UV/PS, ZnSe/US/PS and ZnSe/UV/PS system, respectively. The antibacterial activity evaluation against two bacterials, including Gram-positive bacteria Staphylococcus aureus (ATCC 43300), Bacillus megaterium (ATCC 14581) and Gram-negative bacteria Pseudomonas aeruginosa (ATCC 27853), Micrococcus luteus (ATCC 4698) was considered. It was found that the MIC values for the antibacterial assay in the presence of ZnSe QDs were around 0.30mM with 64.0, 66.0, 79.2, and 83.5% inhibition for the S. aureus, B. megaterium, P. aeruginosa and M. luteus bacterial strains, respectively. Then, results show that the ZnSe QDs have antibacterial activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Micrococcus cohnii sp. nov., isolated from the air in a medical practice.

PubMed

Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike

2013-01-01

Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).

Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots.

PubMed

Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun

2009-10-01

In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).

Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.

PubMed

Joshi, V D; Sreekantiah, K R; Manjrekar, S P

1996-01-01

A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

PubMed Central

Tallur, Preeti N.; Mulla, Sikandar I.; Megadi, Veena B.; Talwar, Manjunatha P.; Ninnekar, Harichandra Z.

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water. PMID:26413046

Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

PubMed

Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

2015-01-01

Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

Antioxidant and antibacterial properties of green, black, and herbal teas of Camellia sinensis.

PubMed

Chan, Eric W C; Soh, Eu Ying; Tie, Pei Pei; Law, Yon Peng

2011-10-01

The role of non-polymeric phenolic (NP) and polymeric tannin (PT) constituents in the antioxidant and antibacterial properties of six brands of green, black, and herbal teas of Camellia sinensis were investigated. Total phenolic content (TPC) and ascorbic acid equivalent antioxidant capacity (AEAC) were assessed using the Folin-Ciocalteu and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays, respectively. Minimum inhibitory dose (MID) against Gram-positive Micrococcus luteus, Staphylococcus aureus, and Bacillus cereus, and Gram-negative. Escherichia coli, Salmonella typhi, and Pseudomonas aeruginosa was assessed using the disc-diffusion method. Teas were extracted with hot water successively three times for one hour each time. The extracts were fractionated using Sephadex LH-20 column chromatography to obtain the NP and PT constituents. Extraction yields ranged from 12 to 23%. Yields of NP fractions (70-81%) were much higher than those of PT fractions (1-11%), suggesting that the former are the major tea components. Ranking of antioxidant properties of extracts was green tea>black tea>herbal tea. For all six teas, antioxidant properties of PT fractions were significantly higher than extracts and NP fractions. Extracts and fractions of all six teas showed no activity against the three Gram-negative bacteria. Green teas inhibited all three Gram-positive bacteria with S. aureus being the least susceptible. Black and herbal teas inhibited the growth of M. luteus and B. cereus, but not S. aureus. The most potent were the PT fractions of Boh Cameron Highlands and Ho Yan Hor with MID of 0.01 and 0.03 mg/disc against M. luteus. Results suggested that NP constituents are major contributors to the antioxidant and antibacterial properties of teas of C. sinensis. Although PT constituents have stronger antioxidant and antibacterial properties, they constitute only a minor component of the teas.

Identification of Staphylococcus and Micrococcus species with the STAPHYtest system.

PubMed

Sedlácek, I; Kocur, M

1991-01-01

A collection of 216 well-characterized strains of Staphylococcus, Micrococcus and Stomatococcus was examined by a commercially available STAPHYtest system (Lachema, Brno, Czechoslovakia). The results of STAPHYtest agreed with those of conventional tests. The STAPHYtest permitted a clear-cut separation of Staphylococcus from Micrococcus and Stomatococcus strains and correctly identified 104 of 145 (72%) Staphylococcus strains after 24 h of incubation. However, it allowed the identification only of 19 of 29 validly published Staphylococcus species. The STAPHYtest proved to be a simple and rapid system for the separation of staphylococci from micrococci and for the identification of most frequent clinically significant staphylococci.

Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

PubMed

Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

2015-05-01

The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. Copyright © 2015 Elsevier GmbH. All rights reserved.

Lipopeptide biosurfactants from Paenibacillus polymyxa inhibit single and mixed species biofilms.

PubMed

Quinn, Gerry A; Maloy, Aaron P; McClean, Stephen; Carney, Brian; Slater, John W

2012-01-01

Although biofilms are recognised as important in microbial colonisation, solutions to their inhibition are predominantly based on planktonic assays. These solutions have limited efficacy against biofilms. Here, a series of biofilm-orientated tests were used to identify anti-biofilm compounds from marine micro-flora. This led to the isolation of a complex of anti-biofilm compounds from an extract of Paenibacillus polymyxa (PPE). A combination of rpHPLC and mass spectrometry identified the principle components of PPE as fusaricidin B (LI-FO4b) and polymyxin D1, with minor contributions from surfactins. This complex (PPE) reduced the biofilm biomass of Bacillus subtilis, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus bovis. In contrast, ampicillin was only effective against S. aureus. PPE also inhibited a self-assembling marine biofilm (SAMB) in co-incubation assays by 99.3% ± 1.9 and disrupted established SAMB by 72.4% ± 4.4, while ampicillin showed no significant reduction. The effectiveness of this complex of lipopeptides against single and multispecies biofilms suggests a future role in biofilm prevention strategies.

Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

PubMed

Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

2010-08-01

Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

Irradiation of Microbes from Spent Nuclear Fuel Storage Pool Environments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breckenridge, C.R.; Watkins, C.S.; Bruhn, D.F.

Microbes have been isolated and identified from spent nuclear fuel storage pools at the Idaho National Engineering and Environmental Laboratory (INEEL). Included among these are Corynebacterium aquaticum, Pseudomonas putida, Comamonas acidovorans, Gluconobacter cerinus, Micrococcus diversus, Rhodococcus rhodochrous, and two strains of sulfate-reducing bacteria (SRB). We examined the sensitivity of these microbes to a variety of total exposures of radiation generated by a 6-MeV linear accelerator (LINAC). The advantage of using a LINAC is that it provides a relatively quick screen of radiation tolerance. In the first set of experiments, we exposed each of the aforementioned microbes along with four additionalmore » microbes, pseudomonas aeruginosa, Micrococcus luteus, Escherchia coli, and Deinococcus radiodurans to exposures of 5 x 10{sup 3} and 6 x 10{sup 4} rad. All microbial specimens withstood the lower exposure with little or no reduction in cell population. Upon exposing the microbes to the larger dose of 6 x 10{sup 4} rad, we observed two distinct groupings: microbes that demonstrate resistance to radiation, and microbes that display intolerance through a dramatic reduction from their initial population. Microbes in the radiation tolerant grouping were exposed to 1.1 x 10{sup 5} rad to examine the extent of their resistance. We observe a correlation between radiation resistance and gram stain. The gram-positive species we examined seem to demonstrate a greater radiation resistance.« less

Antimicrobial activity of Bryum argenteum.

PubMed

Sabovljevic, Aneta; Sokovic, Marina; Sabovljevic, Marko; Grubisic, Dragoljub

2006-02-01

The antimicrobial activity of Bryum argenteum ethanol extracts was evaluated by microdilution method against four bacterial (Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphilococcus aureus) and four fungal species (Aspergillus niger, Penicillium ochrochloron, Candida albicans and Trichophyton mentagrophyes). All the investigated ethanol extracts have been proved to be active against all bacteria and fungi tested.

Micrococcus sedentarius bacteraemia presenting with haemophagocytic syndrome in previously healthy boy.

PubMed

Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz

2006-01-01

Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.

Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects

PubMed Central

Nath, K. R.; Wagner, B. J.

1973-01-01

Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337

Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.

PubMed

Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z

2011-02-01

A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

Rhizostabilization of metals in soils using Lupinus luteus inoculated with the metal resistant rhizobacterium Serratia sp. MSMC541.

PubMed

El Aafi, N; Brhada, F; Dary, M; Maltouf, A Filali; Pajuelo, E

2012-03-01

The aim of this work was to test Lupinus luteus plants, inoculated with metal resistant rhizobacteria, in order to phytostabilise metals in contaminated soils. The resistance to heavy metals of strains isolated from nodules of Lupinus plants was evaluated. The strain MSMC541 showed multi-resistance to several metals (up to 13.3 mM As, 2.2 mM Cd, 2.3 mM Cu, 9 mM Pb and 30 mM Zn), and it was selected for further characterization. Furthermore, this strain was able to biosorb great amounts of metals in cell biomass. 16S rDNA sequencing positioned this strain within the genus Serratia. The presence of arsenic resistance genes was confirmed by southern blot and PCR amplification. A rhizoremediation pot experiment was conducted using Lupinus luteus grown on sand supplemented with heavy metals and inoculated with MSMC541. Plant growth parameters and metal accumulation were determined in inoculated vs. non-inoculated Lupinus luteus plants. The results showed that inoculation with MSMC541 improved the plant tolerance to metals. At the same time, metal translocation to the shoot was significantly reduced upon inoculation. These results suggest that Lupinus luteus plants, inoculated with the metal resistant strain Serratia sp. MSMC541, have a great potential for phytostabilization of metal contaminated soils.

Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.

PubMed

Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R

2016-02-22

The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.

Physiological responses of Microcystis aeruginosa against the algicidal bacterium Pseudomonas aeruginosa.

PubMed

Zhou, Su; Yin, Hua; Tang, Shaoyu; Peng, Hui; Yin, Donggao; Yang, Yixuan; Liu, Zehua; Dang, Zhi

2016-05-01

Proliferation of cyanobacteria in aquatic ecosystems has caused water security problems throughout the world. Our preliminary study has showed that Pseudomonas aeruginosa can inhibit the growth of cyanobacterium, Microcystis aeruginosa. In order to explore the inhibitory mechanism of P. aeruginosa on the cell growth and synthesis of intracellular substances of M. aeruginosa, concentrations of Chlorophyll-a, intracellular protein, carbohydrate, enzyme activities and ion metabolism of M. aeruginosa, were investigated. The results indicated that 83.84% algicidal efficiency of P. aeruginosa was achieved after treatment for 7 days. The strain inhibited the reproduction of M. aeruginosa by impeding the synthesis of intracellular protein and carbohydrate of cyanobacterium, and only a very small part of intracellular protein and carbohydrate was detected after exposure to P. aeruginosa for 5 days. P. aeruginosa caused the alteration of intracellular antioxidant enzyme activity of M. aeruginosa, such as catalase, peroxidase. The accumulation of malondialdehyde aggravated membrane injury after treatment for 3 days. P. aeruginosa also affected the ion metabolism of cyanobacteria. The release of Na(+) and Cl(-) was significantly enhanced while the uptake of K(+), Ca(2+), Mg(2+), NO3(-) and SO4(2)(-) decreased. Surface morphology and intracellular structure of cyanobacteria and bacterial cells changed dramatically over time as evidenced by electron microscope (SEM) and transmission electron microscope (TEM) analysis. These results revealed that the algicidal activity of P. aeruginosa was primarily due to the fermentation liquid of P. aeruginosa that impeded the synthesis of intracellular protein and carbohydrate, and damaged the cell membrane through membrane lipid peroxidation. Copyright © 2016 Elsevier Inc. All rights reserved.

A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

DTIC Science & Technology

2009-03-01

Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is

Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.

PubMed

Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko

2018-03-01

A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.

ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1

PubMed Central

Perry, Jerome J.; Evans, James B.

1961-01-01

Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme...

Antibiotic Sensitivity of Micrococcus radiodurans

PubMed Central

Hawiger, J.; Jeljaszewicz, J.

1967-01-01

A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078

Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

PubMed Central

De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

1977-01-01

Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

PubMed

Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

2005-12-30

A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

Antimicrobial activity, cytotoxicity, and phytochemical screening of Voacanga globosa (Blanco) Merr. leaf extract (Apocynaceae).

PubMed

Vital, Pierangeli G; Rivera, Windell L

2011-10-01

To determine the antibacterial, antifungal, antiprotozoal, cytotoxic, and phytochemical properties of ethanol extracts of leaves of Voacanga globosa (Blanco) Merr. (V. globosa). The extracts were tested against bacteria and fungus through disc diffusion assay; against protozoa through growth curve determination, antiprotozoal and cytotoxicity assays. The extract revealed antibacterial activities, inhibiting the growth of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Micrococcus luteus, and Salmonella typhimurium. Antifungal assay showed that it inhibited Candida albicans. The antiprotozoal assay against Trichomonas vaginalis and Entamoeba histolytica showed that V. globosa can inhibit the parasites, wherein the action can be comparable to metronidazole. With the in situ cell death detection kit, Trichomonas vaginalis and Entamoeba histolytica exposed to V. globosa leaf extract was observed to fluoresce simultaneously in red and yellow signals signifying apoptotic-like changes. Preliminary phytochemical screening revealed the chemical composition of plant extract containing alkaloids, saponins, 2-deoxysugars, and hydrolysable tannins. Thus, this study provides scientific evidence on the traditional use of V. globosa leaf extract in treating microbial diseases. Further, the leaf extract can possibly be used to produce alternative forms of antimicrobials. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Cobalt-doped nanohydroxyapatite: synthesis, characterization, antimicrobial and hemolytic studies

NASA Astrophysics Data System (ADS)

Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

2013-05-01

Hydroxyapatite (Ca10(PO4)6(OH)2; HAP) is a major mineral component of the calcified tissues, and it has various applications in medicine and dentistry. In the present investigation, cobalt-doped hydroxyapatite (Co-HAP) nanoparticles were synthesized by surfactant-mediated approach and characterized by different techniques. The EDAX was carried out to estimate the amount of doping in Co-HAP. The transmission electron microscopy result suggested the transformation of morphology from needle shaped to spherical type on increasing the doping concentration. The powder XRD study indicated the formation of a new phase of brushite for higher concentration of cobalt. The average particle size and strain were calculated using Williamson-Hall analysis. The average particle size was found to be 30-60 nm. The FTIR study confirmed the presence of various functional groups in the samples. The antimicrobial activity was evaluated against four organisms Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus and Staphylococcus aureus as Gram positive. The hemolytic test result suggested that all samples were non-hemolytic. The photoluminescence study was carried out to identify its possible applicability as a fluorescent probe.

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM

PubMed Central

MacCallum, William G.; Hastings, Thomas W.

1899-01-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water

A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM.

PubMed

Maccallum, W G; Hastings, T W

1899-09-01

From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water

Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation.

PubMed

Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

2017-03-01

Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion

Molecular identification and nanoremediation of microbial contaminants in algal systems using untreated wastewater.

PubMed

Limayem, Alya; Gonzalez, Francisco; Micciche, Andrew; Haller, Edward; Nayak, Bina; Mohapatra, Shyam

2016-12-01

Wastewater-algal biomass is a promising option to biofuel production. However, microbial contaminants constitute a substantial barrier to algal biofuel yield. A series of algal strains, Nannochloris oculata and Chlorella vulgaris samples (n = 30), were purchased from the University of Texas, and were used for both stock flask cultures and flat-panel vertical bioreactors. A number of media were used for isolation and differentiation of potential contaminants according to laboratory standards (CLSI). Conventional PCR amplification was performed followed by 16S rDNA sequencing to identify isolates at the species level. Nanotherapeutics involving a nanomicellar combination of natural chitosan and zinc oxide (CZNPs) were tested against the microbial lytic groups through Minimum Inhibitory Concentration (MIC) tests and Transmission Electronic Microscopy (TEM). Results indicated the presence of Pseudomonas spp., Bacillus pumilus/ safensis, Cellulosimicrobium cellulans, Micrococcus luteus and Staphylococcus epidermidis strains at a substantial level in the wastewater-fed algal reactors. TEM confirmed the effectiveness of CZNPs on the lytic group while the average MICs (mg/mL) detected for the strains, Pseudomonas spp, Micrococcus luteus, and Bacillus pumilus were 0.417, 3.33, and 1.458, respectively. Conclusively, CZNP antimicrobials proved to be effective as inhibitory agents against currently identified lytic microbial group, did not impact algae cells, and shows promise for in situ interventions.

Molecular assessment of the membrane menaquinones of irradiated micrococcus on disposable medical devices with high performance liquid chromatography (HPLC)

NASA Astrophysics Data System (ADS)

Ghojaie, M.

1993-10-01

The genus of micrococcus and its main species like; M. Roseus, M. Nishinomiyansis consist of upto 10% of microbial contamination of disposable medical devices. Chemical alteration of Menuquinones Mainly [MK-7-(H2), MK-8(H2),…] from some Irradiated species of the micrococcus at different doses (500 Gy to 25 kGy; the sterilization dose) are quantitatively evaluated by HPLC.

The deoxyribonucleic acid of Micrococcus radiodurans

PubMed Central

Schein, Arnold H.

1966-01-01

The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439

Structures Containing Polyphosphate in Micrococcus lysodeikticus1

PubMed Central

Friedberg, Ilan; Avigad, Gad

1968-01-01

Granular structures containing inorganic polyphosphate were found in Micrococcus lysodeikticus. These structures were isolated by fractionation of the bacterial extract obtained by lysing the organisms with lysozyme. The composition of the fraction which was enriched with these structures was found to be: protein, 24%; lipids, 30%; and polyphosphate, 27%. This fraction also contained small amounts of ribonucleic acids, carbohydrate, and polyvalent cations. The effect of different reagents and enzymes on the integrity of the granules was examined. It was noticed that they accumulate in the bacteria during the logarithmic phase of growth but disappear gradually during the stationary phase. Images PMID:5674060

Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1

PubMed Central

Perry, Jerome J.; Evans, James B.

1966-01-01

Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100

Arsenic alters transcriptional responses to Pseudomonas aeruginosa infection and decreases antimicrobial defense of human airway epithelial cells.

PubMed

Goodale, Britton C; Rayack, Erica J; Stanton, Bruce A

2017-09-15

Arsenic contamination of drinking water and food threatens the health of hundreds of millions of people worldwide by increasing the risk of numerous diseases. Arsenic exposure has been associated with infectious lung disease in epidemiological studies, but it is not yet understood how ingestion of low levels of arsenic increases susceptibility to bacterial infection. Accordingly, the goal of this study was to examine the effect of arsenic on gene expression in primary human bronchial epithelial (HBE) cells and to determine if arsenic altered epithelial cell responses to Pseudomonas aeruginosa, an opportunistic pathogen. Bronchial epithelial cells line the airway surface, providing a physical barrier and serving critical roles in antimicrobial defense and signaling to professional immune cells. We used RNA-seq to define the transcriptional response of HBE cells to Pseudomonas aeruginosa, and investigated how arsenic affected HBE gene networks in the presence and absence of the bacterial challenge. Environmentally relevant levels of arsenic significantly changed the expression of genes involved in cellular redox homeostasis and host defense to bacterial infection, and decreased genes that code for secreted antimicrobial factors such as lysozyme. Using pathway analysis, we identified Sox4 and Nrf2-regulated gene networks that are predicted to mediate the arsenic-induced decrease in lysozyme secretion. In addition, we demonstrated that arsenic decreased lysozyme in the airway surface liquid, resulting in reduced lysis of Microccocus luteus. Thus, arsenic alters the expression of genes and proteins in innate host defense pathways, thereby decreasing the ability of the lung epithelium to fight bacterial infection. Copyright © 2017 Elsevier Inc. All rights reserved.

Systematics of a widely distributed western North American springsnail, Pyrgulopsis micrococcus (Caenogastropoda, Hydrobiidae), with descriptions of three new congeners.

PubMed

Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin

2013-01-01

We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.

Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.

PubMed Central

Eaton, R W; Ribbons, D W

1982-01-01

During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin

PubMed Central

Goh, Hweh Fen; Philip, Koshy

2015-01-01

A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it’s mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain. PMID:26474074

Leptoglycin: a new Glycine/Leucine-rich antimicrobial peptide isolated from the skin secretion of the South American frog Leptodactylus pentadactylus (Leptodactylidae).

PubMed

Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M

2009-07-01

Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.

Antimicrobial, wound healing and antioxidant activity of Plagiochasma appendiculatum Lehm. et Lind.

PubMed

Singh, Meenakshi; Govindarajan, Raghavan; Nath, Virendra; Rawat, Ajay Kumar Singh; Mehrotra, Shanta

2006-08-11

Plagiochasma appendiculatum (Aytoniaceae) of the order Marchantiales is widely used in the form of paste ethnomedicinally by Gaddi tribe in Kangra valley for treating skin diseases. In this context, antimicrobical potential of Plagiochasma appendiculatum against a wide range of microorganisms was studied. To validate the ethnotherapeutic claims of the plant in skin diseases, wound healing activity was studied, besides antioxidant activity to understand the mechanism of wound healing activity. The plant (alchoholic and aqueous extract) showed significant antibacterial and antifungal activity against almost all the organisms: Micrococcus luteus, Bacillus subtilis, Bacillus cereus, Staphylococcus aureus, Streptococcus pneumoniae, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhimurium, and eight fungi Candida albicans and Cryptococcus albidus-dimorphic fungi, Trichophyton rubrum-dermatophyte fungi, Aspergillus niger, Aspergillus flavus, Aspergillus spinulosus, Aspergillus terreus and Aspergillus nidulans-systemic fungi, with especially good activity against the dermatophyte (Trichophyton rubrum) and some infectious bacteria (Escherichia coli, Proteus mirabilis and Salmonella typhimurium) with an MIC of 2.5 microg/disc. The results show that Plagiochasma appendiculatum extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. The results also indicated that Plagiochasma appendiculatum extract possesses potent antioxidant activity by inhibiting lipid peroxidation and increase in the superoxide dismutase (SOD) and Catalase activity.

Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin.

PubMed

Goh, Hweh Fen; Philip, Koshy

2015-01-01

A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it's mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain.

Effect of Hydroxyurea on Staphylococcus epidermidis and Micrococcus lysodeikticus: Thickening of the Cell Wall

PubMed Central

Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.

1973-01-01

Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602

Isolation and Identification of Echinenone from Micrococcus roseus

PubMed Central

Schwartzel, E. H.; Cooney, J. J.

1970-01-01

An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895

Members of Microvirga and Bradyrhizobium genera are native endosymbiotic bacteria nodulating Lupinus luteus in Northern Tunisian soils.

PubMed

Msaddak, Abdelhakim; Rejili, Mokhtar; Durán, David; Rey, Luis; Imperial, Juan; Palacios, Jose Manuel; Ruiz-Argüeso, Tomas; Mars, Mohamed

2017-06-01

The genetic diversity of bacterial populations nodulating Lupinus luteus (yellow lupine) in Northern Tunisia was examined. Phylogenetic analyses of 43 isolates based on recA and gyrB partial sequences grouped them in three clusters, two of which belong to genus Bradyrhizobium (41 isolates) and one, remarkably, to Microvirga (2 isolates), a genus never previously described as microsymbiont of this lupine species. Representatives of the three clusters were analysed in-depth by multilocus sequence analysis of five housekeeping genes (rrs, recA, glnII, gyrB and dnaK). Surprisingly, the Bradyrhizobium cluster with the two isolates LluI4 and LluTb2 may constitute a new species defined by a separate position between Bradyrhizobium manausense and B. denitrificans. A nodC-based phylogeny identified only two groups: one formed by Bradyrhizobium strains included in the symbiovar genistearum and the other by the Microvirga strains. Symbiotic behaviour of representative isolates was tested, and among the seven legumes inoculated only a difference was observed i.e. the Bradyrhizobium strains nodulated Ornithopus compressus unlike the two strains of Microvirga. On the basis of these data, we conclude that L. luteus root nodule symbionts in Northern Tunisia are mostly strains within the B. canariense/B. lupini lineages, and the remaining strains belong to two groups not previously identified as L. luteus endosymbionts: one corresponding to a new clade of Bradyrhizobium and the other to the genus Microvirga. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

[Production and characteristics of bacteria-labeled talc dust for experimental air hygiene studies].

PubMed

Ohgke, H; Oldenburg, B; Gropengiesser, R; Herbst, M

1983-04-01

Freeze-drying of suspensions of Micrococcus luteus together with talc yields bacteria-labelled dust. This material can be used in experimental air hygiene. Loss of viability due to drying in air during experiments can be expected to be negligible. A wide range of particle diameters (1 to greater than 23 micron) is available. Scanning electron microscopy shows the bacteria sticking on talc particles after freeze-drying (Fig. 3a + b). Viable counts of the material decreased very slowly on storage.

Halophilic Nuclease from a Moderately Halophilic Micrococcus varians

PubMed Central

Kamekura, Masahiro; Onishi, Hiroshi

1974-01-01

The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218

REDUCTION OF INORGANIC COMPOUNDS WITH MOLECULAR HYDROGEN BY MICROCOCCUS LACTILYTICUS I.

PubMed Central

Woolfolk, C. A.; Whiteley, H. R.

1962-01-01

Woolfolk, C. A. (University of Washington, Seattle) and H. R. Whiteley. Reduction of inorganic compounds with molecular hydrogen by Micrococcus lactilyticus. I. Stoichiometry with compounds of arsenic, selenium, tellurium, transition and other elements. J. Bacteriol. 84:647–658. 1962.—Extracts of Micrococcus lactilyticus (Veillonella alcalescens) oxidize molecular hydrogen at the expense of certain compounds of arsenic, bismuth, selenium, tellurium, lead, thallium, vanadium, manganese, iron, copper, molybdenum, tungsten, osmium, ruthenium, gold, silver, and uranium, as well as molecular oxygen. Chemical and manometric data indicate that the following reductions are essentially quantitative: arsenate to arsenite, pentavalent and trivalent bismuth to the free element, selenite via elemental selenium to selenide, tellurate and tellurite to tellurium, lead dioxide and manganese dioxide to the divalent state, ferric to ferrous iron, osmium tetroxide to osmate ion, osmium dioxide and trivalent osmium to the metal, uranyl uranium to the tetravalent state, vanadate to the level of vanadyl, and polymolybdate ions to molybdenum blues with an average valence for molybdenum of +5. The results of a study of certain other hydrogenase-containing bacteria with respect to their ability to carry out some of the same reactions are also presented. PMID:14001842

Accumulation and distribution of mercury in fruiting bodies by fungus Suillus luteus foraged in Poland, Belarus and Sweden.

PubMed

Saba, Martyna; Falandysz, Jerzy; Nnorom, Innocent C

2016-02-01

Presented in this paper is result of the study of the bioconcentration potential of mercury (Hg) by Suillus luteus mushroom collected from regions within Central, Eastern, and Northern regions of Europe. As determined by cold-vapor atomic absorption spectroscopy, the Hg content varied from 0.13 ± 0.05 to 0.33 ± 0.13 mg kg(-1) dry matter for caps and from 0.038 ± 0.014 to 0.095 ± 0.038 mg kg(-1) dry matter in stems. The Hg content of the soil substratum (0-10 cm layer) underneath the fruiting bodies showed generally low Hg concentrations that varied widely ranging from 0.0030 to 0.15 mg kg(-1) dry matter with mean values varying from 0.0078 ± 0.0035 to 0.053 ± 0.025 mg kg(-1) dry matter, which is below typical content in the Earth crust. The caps were observed to be on the richer in Hg than the stems at ratio between 1.8 ± 0.4 and 5.3 ± 2.6. The S. luteus mushroom showed moderate ability to accumulate Hg with bioconcentration factor (BCF) values ranging from 3.6 ± 1.3 to 42 ± 18. The consumption of fresh S. luteus mushroom in quantities up to 300 g week(-1) (assuming no Hg ingestion from other foods) from background areas in the Central, Eastern, and Northern part of Europe will not result in the intake of Hg exceeds the provisional weekly tolerance limit (PTWI) of 0.004 mg kg(-1) body mass.

Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics.

PubMed

Ji, Chenglong; Wu, Huifeng; Wei, Lei; Zhao, Jianmin; Wang, Qing; Lu, Hongjian

2013-08-01

Pathogens can cause diseases and lead to massive mortalities of aquaculture animals and substantial economic loss. In this work, we studied the responses induced by Micrococcus luteus and Vibrio anguillarum in gill of mussel Mytilus galloprovincialis at protein and metabolite levels. Metabolic biomarkers (e.g., amino acids, betaine, ATP) suggested that both M. luteus and V. anguillarum induced disturbances in energy metabolism and osmotic regulation. The unique and some more remarkably altered metabolic biomarkers (threonine, alanine, aspartate, taurine, succinate) demonstrated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. Proteomic biomarkers (e.g., goose-type lysozyme 2, matrilin, ependymin-related protein, peptidyl-prolyl cis-trans isomerases) indicated that M. luteus caused immune stress, and disturbances in signaling pathways and protein synthesis. However, V. anguillarum mainly induced oxidative stress and disturbance in energy metabolism in mussel gills indicated by altered procollagen-proline dioxygenase, protein disulfide isomerase, nucleoside diphosphate kinases, electron transfer flavoprotein and glutathione S-transferase. This work confirmed that an integration of proteomics and metabolomics could provide an insightful view into the effects of pathogens to the marine mussel M. galloprovincialis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Amino acids in cell wall of Gram-positive bacterium Micrococcus sp. hsn08 with flocculation activity on Chlorella vulgaris biomass.

PubMed

Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

2018-02-01

The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of physiological age on radiation resistance of some bacteria that are highly radiation resistant. [Micrococcus radiodurans; Micrococcus sp. isolate C-3; Moraxella sp isolate 4; Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, L.C.; Maxcy, R.B.

1984-05-01

Physiological age-dependent variation in radiation resistance was studied for three bacteria that are highly radiation resistant: Micrococcus radiodurans, Micrococcus sp. isolate C-3, and Moraxella sp. isolate 4. Stationary-phase cultures of M. radiodurans and isolate C-3 were much more resistant to gamma radiation than were log-phase cultures. This pattern of relative resistance was reversed for isolate 4. Resistance of isolate 4 to UV light was also greater during log phase, although heat resistance and NaCl tolerance after heat stresses were greater during stationary phase. Radiation-induced injury of isolate 4 compared with injury of Escherichia coli B suggested that the injury process,more » as well as the lethal process, was affected by growth phase. The hypothesis that growth rate affects radiation resistance was tested, and results were interpreted in light of the probable confounding effect of methods used to alter growth rates of bacteria. These results indicate that dose-response experiments should be designed to measure survival during the most resistant growth phase of the organism under study. The timing is particularly important when extrapolations of survival results might be made to potential irradiation processes for foods. 17 references.« less

Immunological properties of Micrococcus lysodeikticus membranes.

PubMed

Fukui, Y; Nachbar, M S; Salton, M R

1971-01-01

Membranes of Micrococcus lysodeikticus possess antigens which are distinct from other cellular components such as cytoplasm, ribosomes, and cell walls. Only a few (two to three) components are found when dissociated membranes are examined by immunodiffusion and immunoelectrophoresis techniques. Membranes treated with 0.3% sodium dodecyl sulfate, 0.3% Triton X-100, trypsin, phospholipase A or C, or by sonic oscillation at pH 9.0, all showed the same pattern (three major bands) when examined against membrane antisera by immunoelectrophoresis. Immunological analysis of fractions isolated by sucrose gradient centrifugation or by polyacrylamide gel electrophoresis suggests that individual components cross-react. Antibodies to adenosine triphosphatase (EC 3.6.1.3) and fast-moving component are not removed by absorption with protoplasts. Removal of antibody to one of the membrane antigens by protoplast absorption indicated a surface location. Glutaraldehyde fixation of protoplasts resulted in the loss of membrane antigens detectable by immunodiffusion.

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-05-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not

Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

NASA Astrophysics Data System (ADS)

Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

2018-03-01

This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not

Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

PubMed

Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

2010-11-01

A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

Antagonistic intestinal microflora produces antimicrobial substance inhibitory to Pseudomonas species and other spoilage organisms.

PubMed

Hatew, Bayissa; Delessa, Tenagne; Zakin, Vered; Gollop, Natan

2011-10-01

Chicken intestine harbors a vast number of bacterial strains. In the present study, antimicrobial substance produced by lactic acid bacteria (LAB) isolated from the gastrointestinal tract of healthy chicken was detected, characterized, and purified. Based on 16S rRNA sequencing, the bacteria were identified as Lactobacillus plantarum vN. The antimicrobial substance produced by this bacterium was designated vN-1 and exhibited a broad-spectrum of activity against many important pathogenic and spoilage microorganisms, including Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Salmonella Typhimurium, and Erwinia amylovova. vN-1 was determined to be thermostable, insensitive to pH values ranging from 2.0 to 8.0, resistant to various organic solvents and to enzymatic inactivation. The inhibition kinetics displayed a bactericidal mode of action. This study revealed an antimicrobial substance with low molecular mass of less than 1 kDa as determined by ultrafiltration and having features not previously reported for LAB isolated from chicken intestines. The detection of this antimicrobial substance addresses an important aspect of biotechnological control agents of spoilage caused by Pseudomonas spp. and promises the possibility for preservation of refrigerated poultry meat. Practical Application:  The newly characterized antimicrobial substance and designated as vN-1 may have the potential to be used in food preservation. © 2011 Institute of Food Technologists®

Studies on interaction of colloidal silver nanoparticles (SNPs) with five different bacterial species.

PubMed

Khan, S Sudheer; Mukherjee, Amitava; Chandrasekaran, N

2011-10-01

Silver nanoparticles (SNPs) are being increasingly used in many consumer products like textile fabrics, cosmetics, washing machines, food and drug products owing to its excellent antimicrobial properties. Here we have studied the adsorption and toxicity of SNPs on bacterial species such as Pseudomonas aeruginosa, Micrococcus luteus, Bacillus subtilis, Bacillus barbaricus and Klebsiella pneumoniae. The influence of zeta potential on the adsorption of SNPs on bacterial cell surface was investigated at acidic, neutral and alkaline pH and with varying salt (NaCl) concentrations (0.05, 0.1, 0.5, 1 and 1.5 M). The survival rate of bacterial species decreased with increase in adsorption of SNPs. Maximum adsorption and toxicity was observed at pH 5, and NaCl concentration of <0.5 M. A very less adsorption was observed at pH 9 and NaCl concentration >0.5 M, there by resulting in less toxicity. The zeta potential study suggests that, the adsorption of SNPs on the cell surface was related to electrostatic force of attraction. The equilibrium and kinetics of the adsorption process were also studied. The adsorption equilibrium isotherms fitted well to the Langmuir model. The kinetics of adsorption fitted best to pseudo-first-order. These findings form a basis for interpreting the interaction of nanoparticles with environmental bacterial species. Copyright © 2011 Elsevier B.V. All rights reserved.

Biochemical Properties and Mechanism of Action of Enterocin LD3 Purified from Enterococcus hirae LD3.

PubMed

Gupta, Aabha; Tiwari, Santosh Kumar; Netrebov, Victoria; Chikindas, Michael L

2016-09-01

Enterocin LD3 was purified using activity-guided multistep chromatography techniques such as cation-exchange and gel-filtration chromatography. The preparation's purity was tested using reverse-phase ultra-performance liquid chromatography. The specific activity was tested to be 187.5 AU µg(-1) with 13-fold purification. Purified enterocin LD3 was heat stable up to 121 °C (at 15 psi pressure) and pH 2-6. The activity was lost in the presence of papain, reduced by proteinase K, pepsin and trypsin, but was unaffected by amylase and lipase, suggesting proteinaceous nature of the compound and no role of carbohydrate and lipid moieties in the activity. MALDI-TOF/MS analysis of purified enterocin LD3 resolved m/z 4114.6, and N-terminal amino acid sequence was found to be H2NQGGQANQ-COOH suggesting a new bacteriocin. Dissipation of membrane potential, loss of internal ATP and bactericidal effect were recorded when indicator strain Micrococcus luteus was treated with enterocin LD3. It inhibited Gram-positive and Gram-negative bacteria including human pathogens such as Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella typhi, Shigella flexneri, Listeria monocytogenes, Escherichia coli O157:H7, E. coli (urogenic, a clinical isolate) and Vibrio sp. These properties of purified enterocin LD3 suggest its applications as a food biopreservative and as an alternative to clinical antibiotics.

Membrane-acting bacteriocin purified from a soil isolate Pediococcus pentosaceus LB44 shows broad host-range.

PubMed

Kaur, Ramanjeet; Tiwari, Santosh Kumar

2018-04-15

Bacteriocin LB44 was purified from cell-free supernatant (CFS) of Pediococcus pentosaceus LB44 using activity-guided chromatography techniques. It was stable up to 121 °C, pH 2.0-6.0, sensitive to proteinase K, papain and trypsin, and retained complete activity in the presence of organic solvents tested. The molecular weight of bacteriocin was ∼6 kDa and initial ten amino acid residues (GECGMCXECG) suggested a new compound. The loss in viable cell count and K + ion efflux of target cells of Micrococcus luteus suggested bactericidal activity. The cell membrane of bacteriocin-treated cells was found to be ruptured which was further confirmed by Fourier Transform Infrared (FTIR) analysis suggesting interaction of bacteriocin with phospholipids in cell membrane. It showed broad host-range and inhibited the growth of Lactobacillus delbrueckii NRRL B-4525, L. plantarum NRRL B-4496, L. acidophilus NRRL B-4495, Enterococcus hirae LD3, Weissella confusa LM85, Staphylococcus aureus, Salmonella typhi ATCC 13311, Serratia marcescens ATCC 27137, Pseudomonas aeruginosa ATCC 27853, Proteus vulgaris ATCC 29905, Haloferax larsenii HA1, HA3, HA8, HA9 and HA10. These properties suggested a new bacteriocin from soil isolate P. pentosaceus LB44 which may offers possible applications in food-safety and therapeutics. Copyright © 2018 Elsevier Inc. All rights reserved.

Synthesis and spectral studies on metal complexes of s-triazine based ligand and non linear optical properties

NASA Astrophysics Data System (ADS)

Shanmugakala, R.; Tharmaraj, P.; Sheela, C. D.

2014-11-01

A series of transition metal complexes of type [ML] and [ML2]Cl2 (where M = Cu(II), Ni(II), Co(II) have synthesized from 2-phenylamino-4,6-dichloro-s-triazine and 3,5-dimethyl pyrazole; their characteristics have been investigated by means of elemental analyses, magnetic susceptibility, molar conductance, IR, UV-Vis, Mass, NMR and ESR spectra. The electrochemical behavior of copper(II) complexes we have studied, by using cyclic voltammetry. The ESR spectra of copper(II) complexes are recorded at 300 K and 77 K and their salient features are appropriately reported. Spectral datas, we found, show that the ligand acts as a neutral tridentate, and coordinates through the triazine ring nitrogen and pyrazolyl ring nitrogen atoms to the metal ion. Evident from our findings, the metal(II) complexes of [ML] type exhibit square pyramidal geometry, and that of [ML2]Cl2 exhibit octahedral geometry. The in vitro antimicrobial activities of the ligand and its complexes are evaluated against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus mutans, Escherichia coli, Enterobacter aerogenes, Klebsiella pneumoniae, Proteus vulgaris, Cryptococcus neoformans, Pseudomonas aeruginosa, Salmonella typhi, Serratia marcescens, Shigella flexneri, Vibrio cholera, Vibris parahaemolyticus, Aspergillus niger, Candida albicans and Penicillium oxalicum by well-diffusion method. The second harmonic generation efficiency of the ligand and its complexes are determined and compared with urea and KDP.

Pseudomonas aeruginosa Trent and zinc homeostasis.

PubMed

Davies, Corey B; Harrison, Mark D; Huygens, Flavia

2017-09-01

Pseudomonas aeruginosa is a Gram-negative pathogen and the major cause of mortality in patients with cystic fibrosis. The mechanisms that P. aeruginosa strains use to regulate intracellular zinc have an effect on infection, antibiotic resistance and the propensity to form biofilms. However, zinc homeostasis in P. aeruginosa strains of variable infectivity has not been compared. In this study, zinc homeostasis in P. aeruginosa Trent, a highly infectious clinical strain, was compared to that of a laboratory P. aeruginosa strain, ATCC27853. Trent was able to tolerate higher concentrations of additional zinc in rich media than ATCC27853. Further, pre-adaptation to additional zinc enhanced the growth of Trent at non-inhibitory concentrations but the impact of pre-adaption on the growth of ATCC27853 under the same conditions was minimal. The results establish clear differences in zinc-induced responses in Trent and ATCC27853, and how zinc homeostasis can be a promising target for the development of novel antimicrobial strategies for P. aeruginosa infection in cystic fibrosis patients. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Endocarditis associated with cardiac catheterization due to a Gram-positive coccus designated Micrococcus mucilaginosus incertae sedis.

PubMed Central

Rubin, S J; Lyons, R W; Murcia, A J

1978-01-01

A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378

Antimicrobial activity of a nisin-activated plastic film for food packaging.

PubMed

Mauriello, G; De Luca, E; La Storia, A; Villani, F; Ercolini, D

2005-01-01

To determine the effectiveness of a packaging film coated with nisin to inhibit Micrococcus luteus ATCC 10240 in tryptone soya broth (TSB) and the microbiota of raw milk during storage. A further aim was to examine the release of nisin from the activated film. An active package, obtained from nisin-treated film, was filled with 1 l of M. luteus ATCC 10240 (ML) suspension in TSB and stored at 4 and 25 degrees C for 2 days. After 24 h at 25 degrees C there was a remarkable reduction of M. luteus ATCC 10240 compared with the control, while at 4 degrees C a slight reduction was observed. Moreover, microbial growth was controlled when 1 l of three different kinds of milk was poured into the active package and stored at 4 degrees C for 7 days. The most significant results were observed in raw milk and pasteurized milk with a reduction of 0.9 log and 1.3 log, respectively. The release experiments showed that nisin release from the film was unpredictable, but it was favoured by low pH and high temperature. It appears that nisin-coated films were effective in inhibiting M. luteus ATCC 10240 in TSB and the bacterial flora in milk, and the release of nisin was pH and temperature dependent. Nisin-activated film may control bacterial growth, maintaining food quality, safety and extending the shelf-life of food products.

Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.

PubMed

Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z

2008-02-01

A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.

Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.

PubMed

Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla

2011-10-01

The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

Facile fabrication and characterization of chitosan-based zinc oxide nanoparticles and evaluation of their antimicrobial and antibiofilm activity

NASA Astrophysics Data System (ADS)

Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur

2014-06-01

The present investigation deals with the facile synthesis and characterization of chitosan (CTS)-based zinc oxide (ZnO) nanoparticles (NPs) and their antimicrobial activities against pathogenic microorganisms. ZnO-CTS NPs were synthesized through two different methods: nano spray drying and precipitation, using various organic compounds (citric acid, glycerol, starch and whey powder) as stabilizers. Both the synthesis methods were simple and were devoid of any chemical usage. The detailed characterization of the NPs was carried out using UV-Vis spectroscopy, dynamic light scattering particle size analysis, zeta potential measurements and scanning electron microscopy, which confirmed the fabrication of NPs with different shapes and sizes. Antimicrobial assay of synthesized ZnO-CTS NPs was carried out against different pathogenic microbial strains ( Candida albicans, Micrococcus luteus and Staphylococcus aureus). The significant ( p < 0.05) inhibition of growth was observed for both M. luteus and S. aureus with ZnO-CTS NPs (with a concentration ranging from 0.625 to 0.156 mg/ml) as compared to control treatment. ZnO-CTS NPs also showed significant biofilm inhibition activity ( p < 0.05) against M. luteus and S. aureus. The study demonstrated the potential of ZnO-CTS NPs as antimicrobial and antibiofilm agents.

Screening of the constituents, antimicrobial and antioxidant activity of endemic Origanum hypericifolium O. Schwartz & P.H. Davis.

PubMed

Celik, Ali; Nur Herken, E; Arslan, Idris; Zafer Ozel, M; Mercan, Nazime

2010-10-01

The chemical compositions, total phenol content, antioxidant and antimicrobial activities with oxidant status of the essential oil from an endemic Turkish species, Origanum hypericifolium, were investigated. Steam distillation (SD) was used to isolate the essential oils, and the chemical analyses were performed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity was tested by agar disc diffusion method against Morganella morganii (clinic isolate), Micrococcus flavus (clinic isolate), Micrococcus luteus NRLL B-4375, Proteus vulgaris RSKK 96026, Escherichia coli ATCC 11230, Escherichia coli ATCC 25922, Yersinia enterecolitica RSKK 1501, Staphylococcus aureus ATCC 25923, S. aureus ATCC 25933, S. aureus ATCC 12598, S. aureus (clinic isolate), MRSA 1 (clinic isolate), MRSA 2 (clinic isolate), MRSA 3 (clinic isolate) and MRSA 4 (clinic isolate). The major compounds found in volatiles of O. hypericifolium were p-cymene, carvacrol and γ-terpinene. Results showed that O. hypericifolium has the potential for being used in food and medicine because of its antioxidant and antibacterial activity.

Presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria.

PubMed

Jacobs, N J; O'Hara, J; Gray, C T

1983-09-01

Several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. This pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or NADH. Previous studies with one denitrifying and nondenitrifying species of the genus Pseudomonas, in Paracoccus denitrificans, in Alcaligenes faecalis, in Azotobacter vinelandii, in Branhamella catarrhalis, and in Neisseria lactamicus. In all these organisms, the peak of the 567-nm pigment is accompanied by a peak of about equal height at approximately 559 nm, which exhibits similar properties to the 567-nm pigment. The 567-nm pigment was not demonstrable by this technique in Gluconobacter oxydans subspecies suboxydans, Bacillus subtilis, Bacillus licheniformis, Aeromonas hydrophilia, Escherichia coli, a Klebsiella species, Moraxella osloensis, Aquaspirillum itersonii, Micrococcus lysodeikticus, Micrococcus luteus, Agrobacterium tumefaciens, or Rhizobium meliloti.

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family

PubMed Central

Martin, Guillaume E.; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-01-01

Background and Aims To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the ‘inverted repeat-lacking clade’, IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. Methods The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. Key Results The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip–flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. Conclusions This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and

Comparison on conjunctival sac bacterial flora of the seniors with dry eye in Ganzi autonomous prefecture

PubMed Central

Zhang, Yue; Liu, Zhi-Rong; Chen, Hui; Fan, Ying-Chuan; Duo, Ji; Zheng, Hong; Wang, Guang-Jin; Li, Yu-Chan; Jiachu, Dan-Ba; Zewang, Ge-Ma

2013-01-01

AIM To compare the bacterial flora in palpebral conjunctiva of xerophthalmia seniors of Tibetan, Yi and Han, and analyze the differences and similarities of the bacteria. METHODS The test subjects were selected from 2 Tibetan, 2 Yi and 3 Han populated places, respectively. Total 222 seniors (444 eyes) with dry eye were examined. Secretion was collected from the palpebral conjunctiva of the subjects and then inoculated onto a blood agar plate. After 48h of incubation, the bacteria were examined for the differences and similarities between different ethnics. RESULTS There was no significant difference (P>0.05) of Gram stain characterization, dominant bacteria and number of the bacterial species present in oxrophthalmia patients among Tibetan, Yi and Han nationalities. The bacteria presented in all groups include staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa. The bacteria detected from the two of three ethnic groups were staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae, and staphylococcus heads. The incidence rate of bacteria-associated dry eye in Tibetan population was significantly lower than that of Han and Yi population. CONCLUSION There is no significant difference in the bacteria flora of palpebral conjunctiva observed among dry eye elder populations of Tibetan, Yi and Han people. All of staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa, staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae and staphylococcus heads are common bacteria flora of the three nationalities inhibiting in this area. PMID:23991377

Isolation and characterization of aerobic culturable arsenic-resistant bacteria from surfacewater and groundwater of Rautahat District, Nepal.

PubMed

Shakya, S; Pradhan, B; Smith, L; Shrestha, J; Tuladhar, S

2012-03-01

Arsenic (As) contamination of groundwater is a serious Environmental Health Management issue of drinking water sources especially in Terai region of Nepal. Many studies have reported that due to natural abundance of arsenic in the environment, various bacteria have developed different resistance mechanisms for arsenic compound. In this study, the culturable arsenic-resistant bacteria indigenous to surfacewater as well as groundwater from Rautahat District of Nepal were randomly isolated by standard plate count method on the basis of viable growth on plate count agar amended with arsenate ranging from 0, 0.5, 10, 40, 80 to 160 milligram per liter (mg/l). With respect to the morphological and biochemical tests, nine morphologically distinct potent arsenate tolerant bacteria showed relatedness with Micrococcus varians, Micrococcus roseus, Micrococcus luteus, Pseudomonas maltophilia, Pseudomonas sp., Vibrio parahaemolyticus, Bacillus cereus, Bacillus smithii 1 and Bacillus smithii 2. The isolates were capable of tolerating more than 1000 mg/l of arsenate and 749 mg/l of arsenite. Likewise, bioaccumulation capability was highest with M. roseus (85.61%) and the least with B. smithii (47.88%) indicating the potential of the organisms in arsenic resistance and most probably in bioremediation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.

PubMed

Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z

2013-02-01

Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.

Pseudomonas aeruginosa in premise plumbing of large buildings.

PubMed

Bédard, Emilie; Prévost, Michèle; Déziel, Eric

2016-12-01

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that is widely occurring in the environment and is recognized for its capacity to form or join biofilms. The present review consolidates current knowledge on P. aeruginosa ecology and its implication in healthcare facilities premise plumbing. The adaptability of P. aeruginosa and its capacity to integrate the biofilm from the faucet and the drain highlight the role premise plumbing devices can play in promoting growth and persistence. A meta-analysis of P. aeruginosa prevalence in faucets (manual and electronic) and drains reveals the large variation in device positivity reported and suggest the high variability in the sampling approach and context as the main reason for this variation. The effects of the operating conditions that prevail within water distribution systems (disinfection, temperature, and hydraulic regime) on the persistence of P. aeruginosa are summarized. As a result from the review, recommendations for proactive control measures of water contamination by P. aeruginosa are presented. A better understanding of the ecology of P. aeruginosa and key influencing factors in premise plumbing are essential to identify culprit areas and implement effective control measures. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Proteomic characterization of seeds from yellow lupin (Lupinus luteus L.).

PubMed

Ogura, Takahiro; Ogihara, Jun; Sunairi, Michio; Takeishi, Hidetaka; Aizawa, Tomoko; Olivos-Trujillo, Marcos R; Maureira-Butler, Iván J; Salvo-Garrido, Haroldo E

2014-06-01

Yellow lupin (Lupinus luteus L.) is a legume crop containing a large amount of protein in its seeds. In this study, we constructed a seed-protein catalog to provide a foundation for further study of the seeds. A total of 736 proteins were identified in 341 2DE spots by nano-LC-MS/MS. Eight storage proteins were found as multiple spots in the 2DE gels. The 736 proteins correspond to 152 unique proteins as shown by UniRef50 clustering. Sixty-seven of the 152 proteins were associated with KEGG-defined pathways. Of the remaining proteins, 57 were classified according to a GO term. The functions of the remaining 28 proteins have yet to be determined. This is the first yellow lupin seed-protein catalog, and it contains considerably more data than previously reported for white lupin (L. albus L.). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Antimicrobial peptides expressed in medicinal maggots of the blow fly Lucilia sericata show combinatorial activity against bacteria.

PubMed

Pöppel, Anne-Kathrin; Vogel, Heiko; Wiesner, Jochen; Vilcinskas, Andreas

2015-05-01

The larvae of the common green bottle fly (Lucilia sericata) produce antibacterial secretions that have a therapeutic effect on chronic and nonhealing wounds. Recent developments in insect biotechnology have made it possible to use these larvae as a source of novel anti-infectives. Here, we report the application of next-generation RNA sequencing (RNA-Seq) to characterize the transcriptomes of the larval glands, crop, and gut, which contribute to the synthesis of antimicrobial peptides (AMPs) and proteins secreted into wounds. Our data confirm that L. sericata larvae have adapted in order to colonize microbially contaminated habitats, such as carrion and necrotic wounds, and are protected against infection by a diverse spectrum of AMPs. L. sericata AMPs include not only lucifensin and lucimycin but also novel attacins, cecropins, diptericins, proline-rich peptides, and sarcotoxins. We identified 47 genes encoding putative AMPs and produced 23 as synthetic analogs, among which some displayed activities against a broad spectrum of microbial pathogens, including Pseudomonas aeruginosa, Proteus vulgaris, and Enterococcus faecalis. Against Escherichia coli (Gram negative) and Micrococcus luteus (Gram positive), we found mostly additive effects but also synergistic activity when selected AMPs were tested in combination. The AMPs that are easy to synthesize are currently being produced in bulk to allow their evaluation as novel anti-infectives that can be formulated in hydrogels to produce therapeutic wound dressings and adhesive bandages. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Green synthesis, biological and spectroscopic study on the interaction of multi-component Mannich bases of imidazo[2,1-b]benzothiazoles with human serum albumin.

PubMed

Maddili, Swetha K; Yandrati, Leela Prasad; Siddam, Shakuntala; Kannekanti, Vijaya Kumar; Gandham, Himabindu

2017-11-01

A series of Mannich bases of imidazo[2, l-b]benzothiazoles were prepared through one-pot multi-component reaction in the presence of water as an eco-friendly solvent. All the synthesized compounds were confirmed from IR, 1 HNMR, 13 CNMR, and Mass spectroscopy. Evaluation of in vitro anti-inflammatory and anti-microbial activities of all the synthesized derivatives was further accomplished. These results clearly displayed that compound 6d exhibited outstanding anti-inflammatory activity with a percentage inhibition of 70.23% by membrane stabilization method whereas 67.54% at 100μgmL -1 by the albumin denaturation method, which is comparable to the standard Diclofenac. Further screening against five fungal species (C. albicans ATCC 76615, C. mycoderma, C. utilis, A. flavus, and B. yeast) along with four gram positive (Methicillin-resistant S. aureus N315 (MRSA), Staphylococcus aureus ATCC 6538, Bacillus subtilis ATCC 21216, and Micrococcus luteus ATCC 4698), and six Gram-negative bacterial strains (Escherichia coli DH52, Escherichia coli JM109, Salmonella dysenteriae, Pseudomonas aeruginosa ATCC 27853, Bacillus proteus ATCC13315 and Bacillus typhi) was carried out. These findings manifested that compound 7c displayed excellent antifungal efficacy while compound 7b revealed significant anti-microbial activity. In addition binding behaviour of compound 7b was investigated by binding study between calf thymus DNA and compound 7b by UV-Vis absorption spectroscopy and further research about HSA interactions was carried out. Copyright © 2017 Elsevier B.V. All rights reserved.

Spectroscopic studies, antimicrobial activities and crystal structures of N-(2-hydroxy-3-methoxybenzalidene)1-aminonaphthalene

NASA Astrophysics Data System (ADS)

Ünver, Hüseyin; Yıldız, Mustafa; Dülger, Başaran; Özgen, Özen; Kendi, Engin; Durlu, Tahsin Nuri

2005-03-01

Schiff base N-(2-hydroxy-3-methoxybenzalidene)1-aminonaphthalene has been synthesized from the reaction of 2-hydroxy-3-methoxybenzaldehyde with 1-aminonaphthalene. The compound were characterized by elemental analysis, FT-IR, 1H NMR, 13C NMR and UV-visible techniques. The UV-visible spectra of the Schiff base were studied in polar and nonpolar solvents in acidic and basic media. The structure of the compound has been examined cyrstallographically. There are two independent molecules in the asymmetric unit. It crystallizes in the monoclinic space group P21/c, with unit cell parameters: a=14, 602(2), b=5,800(1), c=16, 899(1) Å, V=1394.4(2) Å 3, Dx=1.321 g cm -3 and Z=4. The crystal structure was solved by direct methods and refined by full-matrix least squares to a find R=0.041 of for 1179 observed reflections. The title compound's antimicrobial activities also have been studied. The antimicrobial activities of the ligand has been screened in vitro against the organisms Escherichia coli ATCC 11230, Staphylococcus aureus ATCC 6538, Klebsiella pneumoniae UC57, Micrococcus luteus La 2971, Proteus vulgaris ATCC 8427, Pseudomonas aeruginosa ATCC 27853, Mycobacterium smegmatis CCM 2067, Bacillus cereus ATCC 7064 and Listeria monocytogenes ATCC 15313, the yeast cultures Candida albicans ATCC 10231, Kluyveromyces fragilis NRRL 2415, Rhodotorula rubra DSM 70403, Debaryomyces hansenii DSM 70238 and Hanseniaspora guilliermondii DSM 3432.

Ligational behavior of Schiff bases towards transition metal ion and metalation effect on their antibacterial activity

NASA Astrophysics Data System (ADS)

Devi, Jai; Batra, Nisha; Malhotra, Rajesh

2012-11-01

New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL1 and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL2 derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML(1-2)2 have been synthesized, where M = Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate ? coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mn < Zn < Cu < Co < Ni. The ligands and their complexes were tested for in vitro antibacterial activity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu > Mn > Ni > Co > Zn.

Comparison of nutritional and antinutritional traits among different species (Lupinus albus L., Lupinus luteus L., Lupinus angustifolius L.) and varieties of lupin seeds.

PubMed

Musco, N; Cutrignelli, M I; Calabrò, S; Tudisco, R; Infascelli, F; Grazioli, R; Lo Presti, V; Gresta, F; Chiofalo, B

2017-12-01

In order to promote the use of lupin in pig nutrition, in this research the nutritional characteristics (i.e. dietary fibre, alkaloid and fatty acid profile) and the in vitro gas production of 12 lupin varieties grown in the Mediterranean basin and belonging to three lupin species (Lupinus albus, Lupinus angustifolius and Lupinus luteus) were assessed. Four varieties of L. albus (Asfer, Lublanc, Lutteur and Multitalia) were grown in South Campania. Three varieties of L. luteus (Dukat, Mister and Taper), three of L. angustifolius (Jindalee, Sonet and Wonga) and two of L. albus (Rosetta and Luxor) were grown in Eastern Sicily. Lupinus albus varieties showed interesting nutritional and dietetic characteristics (i.e. high protein and low fibre content); the lipid fraction, rather elevated, is well represented by monounsaturated fatty acids (544 g/kg), whereas saturated fatty acids (SFAs) are less represented (167 g/kg) and the n-3/n-6 ratio (0.510) is the most favourable. Lupinus luteus varieties presented the most remarkable dietetic aspects, in terms of polyunsaturated fatty acid (PUFA) content (569 g/kg), n-6 PUFA series (490 g/kg), UFA/SFA (5.24) and PUFA/SFA (3.56) ratios and atherogenic (0.059) and thrombogenic (0.100) indices and very low alkaloid content (1.07 mg per 100 g). Lupinus angustifolius varieties showed the least interesting nutritional and dietetic characteristics: low protein and fat content, high fibre level, high SFA amount (248 g/kg) and the lowest favourable nutritional indices (IA: 0.164 and IT: 0.334). Regarding the fermentation process, in L. albus, the tendency to increase the rate of gas production during the early stages of fermentation suggests that the high presence of alkaloids did not affect the in vitro degradability, production of short-chain fatty acids and fermentation process, probably due to their concentration and/or water solubility. Lupinus angustifolius and L. luteus showed intermediate and slightly worse in

Emergence and Spread of Epidemic Multidrug-Resistant Pseudomonas aeruginosa.

PubMed

Miyoshi-Akiyama, Tohru; Tada, Tatsuya; Ohmagari, Norio; Viet Hung, Nguyen; Tharavichitkul, Prasit; Pokhrel, Bharat Mani; Gniadkowski, Marek; Shimojima, Masahiro; Kirikae, Teruo

2017-12-01

Pseudomonas aeruginosa (P. aeruginosa) is one of the most common nosocomial pathogens worldwide. Although the emergence of multidrug-resistant (MDR) P. aeruginosa is a critical problem in medical practice, the key features involved in the emergence and spread of MDR P. aeruginosa remain unknown. This study utilized whole genome sequence (WGS) analyses to define the population structure of 185 P. aeruginosa clinical isolates from several countries. Of these 185 isolates, 136 were categorized into sequence type (ST) 235, one of the most common types worldwide. Phylogenetic analysis showed that these isolates fell within seven subclades. Each subclade harbors characteristic drug resistance genes and a characteristic genetic background confined to a geographic location, suggesting that clonal expansion following antibiotic exposure is the driving force in generating the population structure of MDR P. aeruginosa. WGS analyses also showed that the substitution rate was markedly higher in ST235 MDR P. aeruginosa than in other strains. Notably, almost all ST235 isolates harbor the specific type IV secretion system and very few or none harbor the CRISPR/CAS system. These findings may help explain the mechanism underlying the emergence and spread of ST235 P. aeruginosa as the predominant MDR lineage. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The first complete chloroplast genome of the Genistoid legume Lupinus luteus: evidence for a novel major lineage-specific rearrangement and new insights regarding plastome evolution in the legume family.

PubMed

Martin, Guillaume E; Rousseau-Gueutin, Mathieu; Cordonnier, Solenn; Lima, Oscar; Michon-Coudouel, Sophie; Naquin, Delphine; de Carvalho, Julie Ferreira; Aïnouche, Malika; Salmon, Armel; Aïnouche, Abdelkader

2014-06-01

To date chloroplast genomes are available only for members of the non-protein amino acid-accumulating clade (NPAAA) Papilionoid lineages in the legume family (i.e. Millettioids, Robinoids and the 'inverted repeat-lacking clade', IRLC). It is thus very important to sequence plastomes from other lineages in order to better understand the unusual evolution observed in this model flowering plant family. To this end, the plastome of a lupine species, Lupinus luteus, was sequenced to represent the Genistoid lineage, a noteworthy but poorly studied legume group. The plastome of L. luteus was reconstructed using Roche-454 and Illumina next-generation sequencing. Its structure, repetitive sequences, gene content and sequence divergence were compared with those of other Fabaceae plastomes. PCR screening and sequencing were performed in other allied legumes in order to determine the origin of a large inversion identified in L. luteus. The first sequenced Genistoid plastome (L. luteus: 155 894 bp) resulted in the discovery of a 36-kb inversion, embedded within the already known 50-kb inversion in the large single-copy (LSC) region of the Papilionoideae. This inversion occurs at the base or soon after the Genistoid emergence, and most probably resulted from a flip-flop recombination between identical 29-bp inverted repeats within two trnS genes. Comparative analyses of the chloroplast gene content of L. luteus vs. Fabaceae and extra-Fabales plastomes revealed the loss of the plastid rpl22 gene, and its functional relocation to the nucleus was verified using lupine transcriptomic data. An investigation into the evolutionary rate of coding and non-coding sequences among legume plastomes resulted in the identification of remarkably variable regions. This study resulted in the discovery of a novel, major 36-kb inversion, specific to the Genistoids. Chloroplast mutational hotspots were also identified, which contain novel and potentially informative regions for molecular

Pseudomonas aeruginosa Promotes Escherichia coli Biofilm Formation in Nutrient-Limited Medium

PubMed Central

Culotti, Alessandro; Packman, Aaron I.

2014-01-01

Biofilms have been implicated as an important reservoir for pathogens and commensal enteric bacteria such as Escherichia coli in natural and engineered water systems. However, the processes that regulate the survival of E. coli in aquatic biofilms have not been thoroughly studied. We examined the effects of hydrodynamic shear and nutrient concentrations on E. coli colonization of pre-established Pseudomonas aeruginosa biofilms, co-inoculation of E. coli and P. aeruginosa biofilms, and P. aeruginosa colonization of pre-established E. coli biofilms. In nutritionally-limited R2A medium, E. coli dominated biofilms when co-inoculated with P. aeruginosa, and successfully colonized and overgrew pre-established P. aeruginosa biofilms. In more enriched media, P. aeruginosa formed larger clusters, but E. coli still extensively overgrew and colonized the interior of P. aeruginosa clusters. In mono-culture, E. coli formed sparse and discontinuous biofilms. After P. aeruginosa was introduced to these biofilms, E. coli growth increased substantially, resulting in patterns of biofilm colonization similar to those observed under other sequences of organism introduction, i.e., E. coli overgrew P. aeruginosa and colonized the interior of P. aeruginosa clusters. These results demonstrate that E. coli not only persists in aquatic biofilms under depleted nutritional conditions, but interactions with P. aeruginosa can greatly increase E. coli growth in biofilms under these experimental conditions. PMID:25198725

Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.

PubMed

Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S

2017-09-01

Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.

Antibacterial potential of Calotropis procera (flower) extract against various pathogens.

PubMed

Ali, Abid; Ansari, Asma; Qader, Shah Ali Ul; Mumtaz, Majid; Saied, Sumayya; Mahboob, Tabassum

2014-09-01

Increased bacterial resistance towards commonly used antibiotics has become a debated issue all over the world in a last few decades. Due to this, consumer demand towards natural anti-microbial agents is increasing day by day. Natural anti-microbial agents have gained enormous attention as an alternative therapeutic agent in pharmaceutical industry. Current study is an effort to explore and identify a bactericidal potential of various solvent extracts of Calotropis procera flower. Flowers of C. procera were extracted with hexane, butanol, ethyl acetate and aqua to evaluate the antibacterial activity by agar well diffusion method against the various human pathogens. The microorganisms used in this study includes Salmonella typhi, Escherichia coli (O157:H7), Micrococcus luteus KIBGE-IB20 (Gen Bank accession: JQ250612) and methicillin resistant Staphylococcus aureus (MRSA) KIBGE-IB23 (Gen Bank accession: KC465400). Zones of inhibition were observed against all four pathogenic strains. Fraction soluble in hexane showed broad spectrum of inhibition against all the studied pathogens. However, fractions soluble in ethyl acetate inhibited the growth of E. coli, MRSA, and M. luteus. In case of butanol and aqueous extracts only growth of M. luteus was inhibited. Results revealed that the flower extracts of C. procera have a potential to be used as an antibacterial agent against these pathogenic organisms.

[Effect of Pseudomonas aeruginosa melanin on antibiotic activity].

PubMed

Rozhavin, M A

1978-08-01

The properties of microbial melanines are very diverse. Melanine of P. aeruginosa is little studied. The pigment was isolated from a strain of P. aeruginosa possessing all characteristic properties of the species. Interaction of P. aeruginosa melanine with various antibiotics was determined by the method of serial dilutions in beaf-peptone broth, using Staph. aureus 209 as a test-microbe, which was added to the medium in an amount of 10(6) cells to each tube. It was found that P. aeruginosa melanine differed from DOPA-melanine in a concentration of 1 mg/ml and did not change the activity of penicillin, tetracycline, oleandomycin, kanamycin and gentamicin with respect to Staph. aureus.

Risk assessment of Pseudomonas aeruginosa in water.

PubMed

Mena, Kristina D; Gerba, Charles P

2009-01-01

P. aeruginosa is part of a large group of free-living bacteria that are ubiquitous in the environment. This organism is often found in natural waters such as lakes and rivers in concentrations of 10/100 mL to >1,000/100 mL. However, it is not often found in drinking water. Usually it is found in 2% of samples, or less, and at concentrations up to 2,300 mL(-1) (Allen and Geldreich 1975) or more often at 3-4 CFU/mL. Its occurrence in drinking water is probably related more to its ability to colonize biofilms in plumbing fixtures (i.e., faucets, showerheads, etc.) than its presence in the distribution system or treated drinking water. P. aeruginosa can survive in deionized or distilled water (van der Jooij et al. 1982; Warburton et al. 1994). Hence, it may be found in low nutrient or oligotrophic environments, as well as in high nutrient environments such as in sewage and in the human body. P. aeruginosa can cause a wide range of infections, and is a leading cause of illness in immunocompromised individuals. In particular, it can be a serious pathogen in hospitals (Dembry et al. 1998). It can cause endocarditis, osteomyelitis, pneumonia, urinary tract infections, gastrointestinal infections, and meningitis, and is a leading cause of septicemia. P. aeruginosa is also a major cause of folliculitis and ear infections acquired by exposure to recreational waters containing the bacterium. In addition, it has been recognized as a serious cause of keratitis, especially in patients wearing contact lenses. P. aeruginosa is also a major pathogen in burn and cystic fibrosis (CF) patients and causes a high mortality rate in both populations (MOlina et al. 1991; Pollack 1995). P. aeruginosa is frequently found in whirlpools and hot tubs, sometimes in 94-100% of those tested at concenrations of <1 to 2,400 CFU/mL. The high concentrations found probably result from the relatively high temperatures of whirlpools, which favor the growth of P. aeruginosa, and the aeration which also

Pseudomonas aeruginosa inhibits the growth of Cryptococcus species.

PubMed

Rella, Antonella; Yang, Mo Wei; Gruber, Jordon; Montagna, Maria Teresa; Luberto, Chiara; Zhang, Yong-Mei; Del Poeta, Maurizio

2012-06-01

Pseudomonas aeruginosa is a ubiquitous and opportunistic bacterium that inhibits the growth of different microorganisms, including Gram-positive bacteria and fungi such as Candida spp. and Aspergillus fumigatus. In this study, we investigated the interaction between P. aeruginosa and Cryptococcus spp. We found that P. aeruginosa PA14 and, to a lesser extent, PAO1 significantly inhibited the growth of Cryptococcus spp. The inhibition of growth was observed on solid medium by the visualization of a zone of inhibition of yeast growth and in liquid culture by viable cell counting. Interestingly, such inhibition was only observed when P. aeruginosa and Cryptococcus were co-cultured. Minimal inhibition was observed when cell-cell contact was prevented using a separation membrane, suggesting that cell contact is required for inhibition. Using mutant strains of Pseudomonas quinoline signaling, we showed that P. aeruginosa inhibited the growth of Cryptococcus spp. by producing antifungal molecules pyocyanin, a redox-active phenazine, and 2-heptyl-3,4-dihydroxyquinoline (PQS), an extracellular quorum-sensing signal. Because both P. aeruginosa and Cryptococcus neoformans are commonly found in lung infections of immunocompromised patients, this study may have important implication for the interaction of these microbes in both an ecological and a clinical point of view.

Introduction of Pseudomonas aeruginosa into a Hospital via Vegetables

PubMed Central

Kominos, Spyros D.; Copeland, Charles E.; Grosiak, Barbara; Postic, Bosko

1972-01-01

Pseudomonas aeruginosa was isolated from tomatoes, radishes, celery, carrots, endive, cabbage, cucumbers, onions, and lettuce obtained from the kitchen of a general hospital, with tomatoes yielding both highest frequencies of isolation and highest counts. Presence of P. aeruginosa on the hands of kitchen personnel and cutting boards and knives which they used suggests acquisition of the organism through contact with these vegetables. It is estimated that a patient consuming an average portion of tomato salad might ingest as many as 5 × 103 colony-forming units of P. aeruginosa. Pyocine types of P. aeruginosa isolated from clinical specimens were frequently identical to those recovered from vegetables, thus implicating tomatoes and other vegetables as an important source and vehicle by which P. aeruginosa colonizes the intestinal tract of patients. PMID:4628795

Pseudomonas aeruginosa essentials: an update on investigation of essential genes.

PubMed

Juhas, Mario

2015-11-01

Pseudomonas aeruginosa is the leading cause of nosocomial infections, particularly in immunocompromised, cancer, burn and cystic fibrosis patients. Development of novel antimicrobials against P. aeruginosa is therefore of the highest importance. Although the first reports on P. aeruginosa essential genes date back to the early 2000s, a number of more sensitive genomic approaches have been used recently to better define essential genes in this organism. These analyses highlight the evolution of the definition of an 'essential' gene from the traditional to the context-dependent. Essential genes, particularly those indispensable under the clinically relevant conditions, are considered to be promising targets of novel antibiotics against P. aeruginosa. This review provides an update on the investigation of P. aeruginosa essential genes. Special focus is on recently identified P. aeruginosa essential genes and their exploitation for the development of antimicrobials.

Pseudomonas aeruginosa facilitates Campylobacter jejuni growth in biofilms under oxic flow conditions.

PubMed

Culotti, Alessandro; Packman, Aaron I

2015-12-01

We investigated the growth of Campylobacter jejuni in biofilms with Pseudomonas aeruginosa under oxic flow conditions. We observed the growth of C. jejuni in mono-culture, deposited on pre-established P. aeruginosa biofilms, and co-inoculated with P. aeruginosa. In mono-culture, C. jejuni was unable to form biofilms. However, deposited C. jejuni continuously grew on pre-established P. aeruginosa biofilms for a period of 3 days. The growth of scattered C. jejuni clusters was strictly limited to the P. aeruginosa biofilm surface, and no intergrowth was observed. Co-culturing of C. jejuni and P. aeruginosa also enabled the growth of both organisms in biofilms, with C. jejuni clusters developing on the surface of the P. aeruginosa biofilm. Dissolved oxygen (DO) measurements in the medium showed that P. aeruginosa biofilms depleted the effluent DO from 9.0 to 0.5 mg L(-1) 24 hours after inoculation. The localized microaerophilic environment generated by P. aeruginosa promoted the persistence and growth of C. jejuni. Our findings show that P. aeruginosa not only prolongs the survival of C. jejuni under oxic conditions, but also enables the growth of C. jejuni on the surface of P. aeruginosa biofilms. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Halovarius luteus gen. nov., sp. nov., an extremely halophilic archaeon from a salt lake.

PubMed

Mehrshad, Maliheh; Amoozegar, Mohammad Ali; Makhdoumi, Ali; Rasooli, Mehrnoosh; Asadi, Basaer; Schumann, Peter; Ventosa, Antonio

2015-08-01

An extremely halophilic archaeon, strain DA50T, was isolated from a brine sample of Urmia lake, a hypersaline environment in north-west Iran. Strain DA50T was orange-pigmented, motile, pleomorphic and required at least 2.5 M NaCl but not MgCl2 for growth. Optimal growth was achieved at 4.0 M NaCl and 0.3 M MgCl2. The optimum pH and temperature for growth were pH 7.0 and 45 °C, while it was able to grow over a pH range of 6.5-8.0 and a temperature range of 25-50 °C. Analysis of 16S rRNA gene sequences revealed that strain DA50T is a member of the family Halobacteriaceae, showing a low level of similarity with other members of this family. Highest similarities, 94.4, 94.0 and 93.9 %, were obtained with the 16S rRNA gene sequences of the type strains of Natrialba aegyptia, Halobiforma lacisalsi and Halovivax asiaticus, respectively. Polar lipid analyses revealed that strain DA50T contains phosphatidylglycerol and phosphatidylglycerol phosphate methyl ester. Four unidentified glycolipids and two minor phospholipids were also observed. The only quinone present was MK-8(II-H2). The G+C content of its DNA was 62.3 mol%. On the basis of the data obtained, the new isolate could not be classified in any recognized genus. Strain DA50T is thus considered to represent a novel species of a new genus within the family Halobacteriaceae, order Halobacteriales, for which the name Halovarius luteus gen. nov., sp. nov. is proposed. The type strain of Halovarius luteus is DA50T ( = IBRC-M 10912T = CECT 8510T).

Pseudomonas aeruginosa infections of intact skin.

PubMed

Agger, W A; Mardan, A

1995-02-01

Pseudomonas aeruginosa infections of healthy skin are uncommon. We report four cases of P. aeruginosa infections of intact skin. These cases illustrate the clinical spectrum of these cutaneous infections: localized, mild epidermal infections (the green nail syndrome and webbed space infections), moderately serious infections (cutaneous folliculitis and otitis externa), and, in immunocompromised patients, extremely serious infections (malignant otitis externa, perirectal infection, and ecthyma gangrenosum).

Contrasting adaptive strategies to terminal drought-stress gradients in Mediterranean legumes: phenology, productivity, and water relations in wild and domesticated Lupinus luteus L.

PubMed Central

Berger, J. D.; Ludwig, C.

2014-01-01

Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime’s C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. PMID:24591050

Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

PubMed

Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

2007-08-01

The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

Gallium-Protoporphyrin IX Inhibits Pseudomonas aeruginosa Growth by Targeting Cytochromes.

PubMed

Hijazi, Sarah; Visca, Paolo; Frangipani, Emanuela

2017-01-01

Pseudomonas aeruginosa is a challenging pathogen due to both innate and acquired resistance to antibiotics. It is capable of causing a variety of infections, including chronic lung infection in cystic fibrosis (CF) patients. Given the importance of iron in bacterial physiology and pathogenicity, iron-uptake and metabolism have become attractive targets for the development of new antibacterial compounds. P. aeruginosa can acquire iron from a variety of sources to fulfill its nutritional requirements both in the environment and in the infected host. The adaptation of P. aeruginosa to heme iron acquisition in the CF lung makes heme utilization pathways a promising target for the development of new anti- Pseudomonas drugs. Gallium [Ga(III)] is an iron mimetic metal which inhibits P. aeruginosa growth by interfering with iron-dependent metabolism. The Ga(III) complex of the heme precursor protoporphyrin IX (GaPPIX) showed enhanced antibacterial activity against several bacterial species, although no inhibitory effect has been reported on P. aeruginosa . Here, we demonstrate that GaPPIX is indeed capable of inhibiting the growth of clinical P. aeruginosa strains under iron-deplete conditions, as those encountered by bacteria during infection, and that GaPPIX inhibition is reversed by iron. Using P. aeruginosa PAO1 as model organism, we show that GaPPIX enters cells through both the heme-uptake systems has and phu , primarily via the PhuR receptor which plays a crucial role in P. aeruginosa adaptation to the CF lung. We also demonstrate that intracellular GaPPIX inhibits the aerobic growth of P. aeruginosa by targeting cytochromes, thus interfering with cellular respiration.

Detection of Metallo-Beta Lactamases Among Carbapenem-Resistant Pseudomonas aeruginosa.

PubMed

Farajzadeh Sheikh, Ahmad; Rostami, Soodabeh; Jolodar, Abbas; Tabatabaiefar, Mohammad Amin; Khorvash, Farzin; Saki, Azadeh; Shoja, Saeed; Sheikhi, Raheleh

2014-11-01

Carbapenems are important drugs used for the treatment of Pseudomonas aeruginosa infections, however metallo-β-lactamases (MBL) are able to efficiently hydrolyze these classes of drugs. Immediate detection of the MBL-producing P. aeruginosa is necessary in order to accurately treat infections caused by this organism. To determine the prevalence of MBL producing P. aeruginosa in burn and non-burn patients by two phenotypic tests and polymerase chain reaction (PCR) and to compare phenotypic tests with PCR. A total of 223 non-duplicate strains of P. aeruginosa were collected from three teaching hospitals of Ahvaz, Iran. Antimicrobial susceptibility and minimum inhibitory concentrations (MICs) of carbapenems (imipenem, meropenem, doripenem and ertapenem) were determined by the Kirby-Bauer and E-test methods. Combined disk (CD) test, MBL E-test and PCR were performed for carbapenem-resistant P. aeruginosa isolates. Amongst all the P. aeruginosa isolates, 58.7% were resistant to imipenem while 31.8%, 13.5% and 74.4% were resistant to meropenem, doripenem and ertapenem, respectively. Amongst all the P. aeruginosa isolates, 44.4% were multidrug resistant and 13.45% were resistant to all of the carbapenems. The CD test with doripenem disk / 750 μg ethylene diamine tetra acetic acid (EDTA) had the highest efficiency compared to the other phenotypic tests. bla IMP and bla VIM genes were detected in 11.7% and 0.4% of isolates, respectively. bla SPM and bla NDM genes were not observed. Epidemiological and regional evaluation of MBL-producing P. aeruginosa through simple and inexpensive methods should be considered for effective treatment of carbapenem-resistant P. aeruginosa infections.

Antimicrobial activity of 9-O-acyl- and 9-O-benzoyl-substituted berberrubines.

PubMed

Hong, S W; Kim, S H; Jeun, J A; Lee, S J; Kim, S U; Kim, J H

2000-05-01

In the course of a structure-activity relationship study on berberrubine derivatives, a series of compounds bearing 9-O-acyl-(4-6) and 9-O-benzoyl- (7) substituents was synthesized with the expectation of increasing the antimicrobial activity. One of the berberrubine derivatives, 9-lauroylberberrubine chloride was the most active against Gram-positive bacteria Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Micrococcus luteus, Bacillus subtilis as well as the Gram-negative bacterium Klebsiella pneumoniae in comparison to berberine, the currently used antibiotic in clinic. This result suggested that the presence of lipophilic substituents of certain structures and sizes might be crucial for the optimal antimicrobial activity.

Branimycins B and C, Antibiotics Produced by the Abyssal Actinobacterium Pseudonocardia carboxydivorans M-227.

PubMed

Braña, Alfredo F; Sarmiento-Vizcaíno, Aida; Pérez-Victoria, Ignacio; Otero, Luis; Fernández, Jonathan; Palacios, Juan José; Martín, Jesús; de la Cruz, Mercedes; Díaz, Caridad; Vicente, Francisca; Reyes, Fernando; García, Luis A; Blanco, Gloria

2017-02-24

Two new antibiotics, branimycins B (2) and C (3), were produced by fermentation of the abyssal actinobacterium Pseudonocardia carboxydivorans M-227, isolated from deep seawater of the Avilés submarine Canyon. Their structures were elucidated by HRMS and NMR analyses. These compounds exhibit antibacterial activities against a panel of Gram-positive bacteria, including Corynebacterium urealyticum, Clostridium perfringens, and Micrococcus luteus, and against the Gram-negative bacterium Neisseria meningitidis. Additionally, branimycin B displayed moderate antibacterial activity against other Gram-negative bacteria such as Bacteroides fragilis, Haemophilus influenzae, and Escherichia coli, and branimycin C against the Gram-positive Enterococcus faecalis and methicillin-sensitive and methicillin-resistant Staphylococcus aureus.

Spätzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.

PubMed

Yamamoto-Hino, Miki; Goto, Satoshi

2016-05-07

The Toll pathway regulates innate immunity in insects and vertebrates. The Drosophila Toll receptor is activated by a processed form of a ligand, Spätzle. Spätzle-processing enzyme (SPE) is the only enzyme identified to date that functions in converting Spätzle to an active form during the immune response. In the present study, Toll activation induced by immune challenge was almost suppressed in spätzle mutant larvae and adults, whereas it was present in SPE mutant larvae challenged with Micrococcus luteus and adults challenged with Bacillus subtilis. Our data suggest that an unidentified protease besides SPE processes Spätzle under conditions of microbial challenge.

Structural studies of 4-aminoantipyrine derivatives

NASA Astrophysics Data System (ADS)

Cunha, Silvio; Oliveira, Shana M.; Rodrigues, Manoel T.; Bastos, Rodrigo M.; Ferrari, Jailton; de Oliveira, Cecília M. A.; Kato, Lucília; Napolitano, Hamilton B.; Vencato, Ivo; Lariucci, Carlito

2005-10-01

Reaction of 4-aminoantipyrine with acetylacetone, ethyl acetoacetate, benzoyl isothiocyanate, phenyl isothiocyanate, maleic anhydride and methoxymethylene Meldrum's acid afforded a series of new antipyrine derivatives. The antibacterial activity of the synthesized compounds against Micrococcus luteus ATCC 9341, Staphilococcus aureus ATCC 29737, and Escherichia coli ATCC 8739 was evaluated and the minimal inhibitory concentration determined. Modest activity was found only to the maleamic acid obtained from the reaction of 4-aminoantipyrine and maleic anhydride. 1H NMR investigation of this maleamic acid showed that it is slowly converted to the corresponding toxic maleimide. The structures of three derivatives were determined by X-ray diffraction analysis.

Mechanisms of phagocytosis and host clearance of Pseudomonas aeruginosa

PubMed Central

Lovewell, Rustin R.; Patankar, Yash R.

2014-01-01

Pseudomonas aeruginosa is an opportunistic bacterial pathogen responsible for a high incidence of acute and chronic pulmonary infection. These infections are particularly prevalent in patients with chronic obstructive pulmonary disease and cystic fibrosis: much of the morbidity and pathophysiology associated with these diseases is due to a hypersusceptibility to bacterial infection. Innate immunity, primarily through inflammatory cytokine production, cellular recruitment, and phagocytic clearance by neutrophils and macrophages, is the key to endogenous control of P. aeruginosa infection. In this review, we highlight recent advances toward understanding the innate immune response to P. aeruginosa, with a focus on the role of phagocytes in control of P. aeruginosa infection. Specifically, we summarize the cellular and molecular mechanisms of phagocytic recognition and uptake of P. aeruginosa, and how current animal models of P. aeruginosa infection reflect clinical observations in the context of phagocytic clearance of the bacteria. Several notable phenotypic changes to the bacteria are consistently observed during chronic pulmonary infections, including changes to mucoidy and flagellar motility, that likely enable or reflect their ability to persist. These traits are likewise examined in the context of how the bacteria avoid phagocytic clearance, inflammation, and sterilizing immunity. PMID:24464809

Mechanisms of phagocytosis and host clearance of Pseudomonas aeruginosa.

PubMed

Lovewell, Rustin R; Patankar, Yash R; Berwin, Brent

2014-04-01

Pseudomonas aeruginosa is an opportunistic bacterial pathogen responsible for a high incidence of acute and chronic pulmonary infection. These infections are particularly prevalent in patients with chronic obstructive pulmonary disease and cystic fibrosis: much of the morbidity and pathophysiology associated with these diseases is due to a hypersusceptibility to bacterial infection. Innate immunity, primarily through inflammatory cytokine production, cellular recruitment, and phagocytic clearance by neutrophils and macrophages, is the key to endogenous control of P. aeruginosa infection. In this review, we highlight recent advances toward understanding the innate immune response to P. aeruginosa, with a focus on the role of phagocytes in control of P. aeruginosa infection. Specifically, we summarize the cellular and molecular mechanisms of phagocytic recognition and uptake of P. aeruginosa, and how current animal models of P. aeruginosa infection reflect clinical observations in the context of phagocytic clearance of the bacteria. Several notable phenotypic changes to the bacteria are consistently observed during chronic pulmonary infections, including changes to mucoidy and flagellar motility, that likely enable or reflect their ability to persist. These traits are likewise examined in the context of how the bacteria avoid phagocytic clearance, inflammation, and sterilizing immunity.

Comparison of UVB and UVC irradiation disinfection efficacies on Pseudomonas Aeruginosa (P. aeruginosa) biofilm

NASA Astrophysics Data System (ADS)

Argyraki, A.; Markvart, M.; Nielsen, Anne; Bjarnsholt, T.; Bjørndal, L.; Petersen, P. M.

2016-04-01

Disinfection routines are important in all clinical applications. The uprising problem of antibiotic resistance has driven major research efforts towards alternative disinfection approaches, involving light-based solutions. Pseudomonas aeruginosa (P. aeruginosa) is a common bacterium that can cause skin, soft tissue, lungs, kidney and urinary tract infections. Moreover, it can be found on and in medical equipment causing often cross infections in hospitals. The objective of this study was to test the efficiency, of two different light-based disinfection treatments, namely UVB and UVC irradiation, on P. aeruginosa biofilms at different growth stages. In our experiments a new type of UV light emitting diodes (LEDs) were used to deliver UV irradiation on the biofilms, in the UVB (296nm) and UVC (266nm) region. The killing rate was studied as a function of dose for 24h grown biofilms. The dose was ramped from 72J/m2 to 10000J/m2. It was shown that UVB irradiation was more effective than UVC irradiation in inactivating P. aeruginosa biofilms. No colony forming units (CFU) were observed for the UVB treated biofilms when the dose was 10000 J/m2 (CFU in control sample: 7.5 x 104). UVB irradiation at a dose of 20000J/m2 on mature biofilms (72h grown) resulted in a 3.9 log killing efficacy. The fact that the wavelength of 296nm exists in daylight and has such disinfection ability on biofilms gives new perspectives for applications within disinfection at hospitals.

T lymphocyte-mediated protection against Pseudomonas aeruginosa infection in granulocytopenic mice.

PubMed Central

Powderly, W G; Pier, G B; Markham, R B

1986-01-01

BALB/c mice immunized with Pseudomonas aeruginosa immunotype 1 polysaccharide develop protective T cell immunity to bacterial challenge. In vitro, T cells from immunized mice kill P. aeruginosa by production of a bactericidal lymphokine. The present study demonstrates that adoptive transfer of T cells from immunized BALB/c mice to granulocytopenic mice resulted in 97% survival on challenge with P. aeruginosa, compared with 17% survival with adoptive transfer of T cells from nonimmune BALB/c mice. This protection is specifically elicited by reexposure to the original immunizing antigen; adoptive recipients cannot withstand challenge with immunotype 3 P. aeruginosa. However, the adoptive recipients do survive simultaneous infection with both P. aeruginosa immunotypes 1 and 3. Adoptive transfer of T cells from the congenic CB.20 mice, which are unable to kill P. aeruginosa in vitro, provides only 20% protection to granulocytopenic mice. These studies indicate that transfer of specific immune T lymphocytes can significantly enhance the resistance to P. aeruginosa infection in granulocytopenic mice. PMID:2426306

Current therapies for pseudomonas aeruginosa.

PubMed

Giamarellou, Helen; Kanellakopoulou, Kyriaki

2008-04-01

Based on the worldwide prevalence of multidrug-resistant strains of Pseudomas aeruginosa and the fact that no newer antipseudomonal agents are available, this article aims to investigate therapeutic solutions for combating infections caused by P aeruginosa, including multidrug-resistant strains. The article focuses mainly on colistin, the re-emerging old antibiotic that possesses prominent antipseudomonal activity in vitro and on doripenem, a newer carbapenem that seems to be close to its global marketing. Regarding older antipseudomonal antibiotics that have been reviewed extensively, only newer aspects on their use are considered in this article.

Dissecting the machinery that introduces disulfide bonds in Pseudomonas aeruginosa.

PubMed

Arts, Isabelle S; Ball, Geneviève; Leverrier, Pauline; Garvis, Steven; Nicolaes, Valérie; Vertommen, Didier; Ize, Bérengère; Tamu Dufe, Veronica; Messens, Joris; Voulhoux, Romé; Collet, Jean-François

2013-12-10

Disulfide bond formation is required for the folding of many bacterial virulence factors. However, whereas the Escherichia coli disulfide bond-forming system is well characterized, not much is known on the pathways that oxidatively fold proteins in pathogenic bacteria. Here, we report the detailed unraveling of the pathway that introduces disulfide bonds in the periplasm of the human pathogen Pseudomonas aeruginosa. The genome of P. aeruginosa uniquely encodes two DsbA proteins (P. aeruginosa DsbA1 [PaDsbA1] and PaDsbA2) and two DsbB proteins (PaDsbB1 and PaDsbB2). We found that PaDsbA1, the primary donor of disulfide bonds to secreted proteins, is maintained oxidized in vivo by both PaDsbB1 and PaDsbB2. In vitro reconstitution of the pathway confirms that both PaDsbB1 and PaDsbB2 shuttle electrons from PaDsbA1 to membrane-bound quinones. Accordingly, deletion of both P. aeruginosa dsbB1 (PadsbB1) and PadsbB2 is required to prevent the folding of several P. aeruginosa virulence factors and to lead to a significant decrease in pathogenicity. Using a high-throughput proteomic approach, we also analyzed the impact of PadsbA1 deletion on the global periplasmic proteome of P. aeruginosa, which allowed us to identify more than 20 new potential substrates of this major oxidoreductase. Finally, we report the biochemical and structural characterization of PaDsbA2, a highly oxidizing oxidoreductase, which seems to be expressed under specific conditions. By fully dissecting the machinery that introduces disulfide bonds in P. aeruginosa, our work opens the way to the design of novel antibacterial molecules able to disarm this pathogen by preventing the proper assembly of its arsenal of virulence factors. The human pathogen Pseudomonas aeruginosa causes life-threatening infections in immunodepressed and cystic fibrosis patients. The emergence of P. aeruginosa strains resistant to all of the available antibacterial agents calls for the urgent development of new antibiotics

Gallium-Protoporphyrin IX Inhibits Pseudomonas aeruginosa Growth by Targeting Cytochromes

PubMed Central

Hijazi, Sarah; Visca, Paolo; Frangipani, Emanuela

2017-01-01

Pseudomonas aeruginosa is a challenging pathogen due to both innate and acquired resistance to antibiotics. It is capable of causing a variety of infections, including chronic lung infection in cystic fibrosis (CF) patients. Given the importance of iron in bacterial physiology and pathogenicity, iron-uptake and metabolism have become attractive targets for the development of new antibacterial compounds. P. aeruginosa can acquire iron from a variety of sources to fulfill its nutritional requirements both in the environment and in the infected host. The adaptation of P. aeruginosa to heme iron acquisition in the CF lung makes heme utilization pathways a promising target for the development of new anti-Pseudomonas drugs. Gallium [Ga(III)] is an iron mimetic metal which inhibits P. aeruginosa growth by interfering with iron-dependent metabolism. The Ga(III) complex of the heme precursor protoporphyrin IX (GaPPIX) showed enhanced antibacterial activity against several bacterial species, although no inhibitory effect has been reported on P. aeruginosa. Here, we demonstrate that GaPPIX is indeed capable of inhibiting the growth of clinical P. aeruginosa strains under iron-deplete conditions, as those encountered by bacteria during infection, and that GaPPIX inhibition is reversed by iron. Using P. aeruginosa PAO1 as model organism, we show that GaPPIX enters cells through both the heme-uptake systems has and phu, primarily via the PhuR receptor which plays a crucial role in P. aeruginosa adaptation to the CF lung. We also demonstrate that intracellular GaPPIX inhibits the aerobic growth of P. aeruginosa by targeting cytochromes, thus interfering with cellular respiration. PMID:28184354

Pseudomonas aeruginosa Population Structure Revisited

PubMed Central

Pirnay, Jean-Paul; Bilocq, Florence; Pot, Bruno; Cornelis, Pierre; Zizi, Martin; Van Eldere, Johan; Deschaght, Pieter; Vaneechoutte, Mario; Jennes, Serge; Pitt, Tyrone; De Vos, Daniel

2009-01-01

At present there are strong indications that Pseudomonas aeruginosa exhibits an epidemic population structure; clinical isolates are indistinguishable from environmental isolates, and they do not exhibit a specific (disease) habitat selection. However, some important issues, such as the worldwide emergence of highly transmissible P. aeruginosa clones among cystic fibrosis (CF) patients and the spread and persistence of multidrug resistant (MDR) strains in hospital wards with high antibiotic pressure, remain contentious. To further investigate the population structure of P. aeruginosa, eight parameters were analyzed and combined for 328 unrelated isolates, collected over the last 125 years from 69 localities in 30 countries on five continents, from diverse clinical (human and animal) and environmental habitats. The analysed parameters were: i) O serotype, ii) Fluorescent Amplified-Fragment Length Polymorphism (FALFP) pattern, nucleotide sequences of outer membrane protein genes, iii) oprI, iv) oprL, v) oprD, vi) pyoverdine receptor gene profile (fpvA type and fpvB prevalence), and prevalence of vii) exoenzyme genes exoS and exoU and viii) group I pilin glycosyltransferase gene tfpO. These traits were combined and analysed using biological data analysis software and visualized in the form of a minimum spanning tree (MST). We revealed a network of relationships between all analyzed parameters and non-congruence between experiments. At the same time we observed several conserved clones, characterized by an almost identical data set. These observations confirm the nonclonal epidemic population structure of P. aeruginosa, a superficially clonal structure with frequent recombinations, in which occasionally highly successful epidemic clones arise. One of these clones is the renown and widespread MDR serotype O12 clone. On the other hand, we found no evidence for a widespread CF transmissible clone. All but one of the 43 analysed CF strains belonged to a ubiquitous P

Pseudomonas aeruginosa Dose-Response and Bathing Water Infection

EPA Science Inventory

Pseudomonas aeruginosa is the most commonly identified opportunistic pathogen associated with pool acquired bather disease. To better understand why this microorganism poses this protracted problem we recently appraised P. aeruginosa pool risk management. Much is known about the ...

Influence of Culture Media on the Radiation Resistance of Micrococcus radiodurans

PubMed Central

Krabbenhoft, K. L.; Anderson, A. W.; Elliker, P. R.

1967-01-01

The addition of NZ-case (a tryptic digest of casein) to a growth medium (PC) consisting of tryptone, glucose, and yeast extract caused a significant decrease in γ radiation resistance of Micrococcus radiodurans. The level of radiation resistance was inversely related to the concentration of NZ-case. The ld50 for this organism was approximately 700 krad when grown in tryptone, glucose, yeast extract, and dl-methionine (TGYM) broth, but it was approximately one-half as resistant when grown in a PC medium containing 0.5% NZ-case (PCNZ). The resistance to ultraviolet light was also reduced. Cultures transferred from PCNZ to TGYM media regained the high level of resistance. Images Fig. 2 Fig. 3 PMID:5340165

Contrasting adaptive strategies to terminal drought-stress gradients in Mediterranean legumes: phenology, productivity, and water relations in wild and domesticated Lupinus luteus L.

PubMed

Berger, J D; Ludwig, C

2014-11-01

Our understanding of within-species annual plant adaptation to rainfall gradients is fragmented. Broad-scale ecological applications of Grime's C-S-R triangle are often superficial, while detailed drought physiology tends to be narrow, focusing on elite cultivars. The former lack the detail to explain how plants respond, while the latter provide little context to investigate trade-offs among traits, to explain where/why these might be adaptive. Ecophysiology, combining the breadth of the former with the detail of the latter, can resolve this disconnect and is applied here to describe adaptive strategies in the Mediterranean legume Lupinus luteus. Wild and domesticated material from low- and high-rainfall environments was evaluated under contrasting terminal drought. These opposing environments have selected for contrasting, integrated, adaptive strategies. Long-season, high-rainfall habitats select for competitive (C) traits: delayed phenology, high above- and below-ground biomass, productivity, and fecundity, leading to high water-use and early stress onset. Terminal drought-prone environments select for the opposite: ruderal (R) traits that facilitate drought escape/avoidance but limit reproductive potential. Surprisingly, high-rainfall ecotypes generate lower critical leaf water potentials under water deficit, maintaining higher relative water content than the latter. Given that L. luteus evolved in sandy, low-water-holding capacity soils, this represents a bet-hedging response to intermittent self-imposed water-deficits associated with a strongly C-selected adaptive strategy that is therefore redundant in R-selected low-rainfall ecotypes. Domesticated L. luteus is even more R-selected, reflecting ongoing selection for early maturity. Introgression of appropriate C-selected adaptive traits from wild germplasm may widen the crop production range. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes

New antibacterial xanthone from the marine sponge-derived Micrococcus sp. EG45.

PubMed

Eltamany, Enas E; Abdelmohsen, Usama Ramadan; Ibrahim, Amany K; Hassanean, Hashim A; Hentschel, Ute; Ahmed, Safwat A

2014-11-01

Microluside A [4 (19-para-hydroxy benzoyloxy-O-β-D-cellobiosyl), 5 (30-para-hydroxy benzoyloxy-O-β-D-glucopyranosyl) xanthone (1)] is a unique O-glycosylated disubstituted xanthone isolated from the broth culture of Micrococcus sp. EG45 cultivated from the Red Sea sponge Spheciospongia vagabunda. The structure of microluside A was determined by 1D- and 2D-NMR techniques as well as high resolution tandem mass spectrometry. The antimicrobial activity evaluation showed that 1 exhibited antibacterial potential against Enterococcus faecalis JH212 and Staphylococcus aureus NCTC 8325 with MIC values of 10 and 13 μM, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genetic and Functional Diversity of Pseudomonas aeruginosa Lipopolysaccharide

PubMed Central

Lam, Joseph S.; Taylor, Véronique L.; Islam, Salim T.; Hao, Youai; Kocíncová, Dana

2011-01-01

Lipopolysccharide (LPS) is an integral component of the Pseudomonas aeruginosa cell envelope, occupying the outer leaflet of the outer membrane in this Gram-negative opportunistic pathogen. It is important for bacterium–host interactions and has been shown to be a major virulence factor for this organism. Structurally, P. aeruginosa LPS is composed of three domains, namely, lipid A, core oligosaccharide, and the distal O antigen (O-Ag). Most P. aeruginosa strains produce two distinct forms of O-Ag, one a homopolymer of D-rhamnose that is a common polysaccharide antigen (CPA, formerly termed A band), and the other a heteropolymer of three to five distinct (and often unique dideoxy) sugars in its repeat units, known as O-specific antigen (OSA, formerly termed B band). Compositional differences in the O units among the OSA from different strains form the basis of the International Antigenic Typing Scheme for classification via serotyping of different strains of P. aeruginosa. The focus of this review is to provide state-of-the-art knowledge on the genetic and resultant functional diversity of LPS produced by P. aeruginosa. The underlying factors contributing to this diversity will be thoroughly discussed and presented in the context of its contributions to host–pathogen interactions and the control/prevention of infection. PMID:21687428

Monohexosylceramides from Rhizopus Species Isolated from Brazilian Caatinga: Chemical Characterization and Evaluation of Their Anti-Biofilm and Antibacterial Activities.

PubMed

Vieira, Edson Rodrigues; Xisto, Mariana Ingrid Dutra da Silva; Pele, Milagre Américo; Alviano, Daniela Sales; Alviano, Celuta Sales; Barreto-Bergter, Eliana; de Campos-Takaki, Galba Maria

2018-06-01

Monohexosylceramides (CMHs) are highly conserved fungal glycosphingolipids playing a role in several cellular processes such as growth, differentiation and morphological transition. In this study, we report the isolation, purification and chemical characterization of CMHs from Rhizopus stolonifer and R. microspores . Using positive ion mode ESI-MS, two major ion species were observed at m / z 750 and m / z 766, respectively. Both ion species consisted of a glucose/galactose residue attached to a ceramide moiety containing 9-methyl-4,8-sphingadienine with an amidic linkage to a hydroxylated C16:0 fatty acid. The antimicrobial activity of CMH was evaluated against Gram positive and Gram negative bacteria using the agar diffusion assay. CMH from both Rhizopus species inhibited the growth of Bacillus terrae , Micrococcus luteus ( M. luteus ) and Pseudomonas stutzeri ( P. stutzeri ) with a MIC 50 of 6.25, 6.25 and 3.13 mg/mL, respectively. The bactericidal effect was detected only for M. luteus and P. stutzeri , with MBC values of 25 and 6.25 mg/mL, respectively. Furthermore, the action of CMH on the biofilm produced by methicillin-resistant Staphylococcus aureus (MRSA) was analyzed using 12.5 and 25 mg/mL of CMH from R. microsporus . Total biofilm biomass, biofilm matrix and viability of the cells that form the biofilm structure were evaluated. CMH from R. microsporus was able to inhibit the MRSA biofilm formation in all parameters tested.

Pseudomonas Aeruginosa: Resistance to the Max

PubMed Central

Poole, Keith

2011-01-01

Pseudomonas aeruginosa is intrinsically resistant to a variety of antimicrobials and can develop resistance during anti-pseudomonal chemotherapy both of which compromise treatment of infections caused by this organism. Resistance to multiple classes of antimicrobials (multidrug resistance) in particular is increasingly common in P. aeruginosa, with a number of reports of pan-resistant isolates treatable with a single agent, colistin. Acquired resistance in this organism is multifactorial and attributable to chromosomal mutations and the acquisition of resistance genes via horizontal gene transfer. Mutational changes impacting resistance include upregulation of multidrug efflux systems to promote antimicrobial expulsion, derepression of ampC, AmpC alterations that expand the enzyme's substrate specificity (i.e., extended-spectrum AmpC), alterations to outer membrane permeability to limit antimicrobial entry and alterations to antimicrobial targets. Acquired mechanisms contributing to resistance in P. aeruginosa include β-lactamases, notably the extended-spectrum β-lactamases and the carbapenemases that hydrolyze most β-lactams, aminoglycoside-modifying enzymes, and 16S rRNA methylases that provide high-level pan-aminoglycoside resistance. The organism's propensity to grow in vivo as antimicrobial-tolerant biofilms and the occurrence of hypermutator strains that yield antimicrobial resistant mutants at higher frequency also compromise anti-pseudomonal chemotherapy. With limited therapeutic options and increasing resistance will the untreatable P. aeruginosa infection soon be upon us? PMID:21747788

α-Glucosidase Inhibition and Antibacterial Activity of Secondary Metabolites from the Ecuadorian Species Clinopodium taxifolium (Kunth) Govaerts.

PubMed

Morocho, Vladimir; Valle, Andrea; García, Jessica; Gilardoni, Gianluca; Cartuche, Luis; Suárez, Alírica I

2018-01-11

The phytochemical investigation of both volatile and fixed metabolites of Clinopodium taxifolium (Kunth) Govaerts (Lamiaceae) was performed for the first time. It allowed the isolation and characterization of the essential oil and six known compounds: carvacrol ( 1 ), squalane ( 2 ), uvaol ( 3 ), erythrodiol ( 4 ), ursolic acid ( 5 ), and salvigenin ( 6 ). Their structures were identified and characterized by Nuclear Magnetic Resonance (NMR) and Gas Chromatography coupled to Mass Spectroscopy (GC-MS), and corroborated by literature. The essential oil of the leaves was obtained by hydrodistillation in two different periods and analyzed by GC-MS and GC coupled to Flame Ionization Detector (GC-FID). A total of 54 compounds were detected, of which 42 were identified (including trace constituents). The major constituents were carvacrol methyl ether (18.9-23.2%), carvacrol (13.8-16.3%) and, carvacryl acetate (11.4-4.8%). The antibacterial activities were determined as Minimum Inhibition Concentration (MIC) against Staphylococcus aureus , Enterococcus faecalis , Escherichia coli , Klebsiella pneumoniae , Proteus vulgaris , Pseudomonas aeruginosa and Micrococcus luteus . The hexane and methanol extracts exhibited activity only against Klebsiella pneumoniae (250 and 500 μg/mL respectively), while the ethyl acetate extract was inactive. The hypoglycemic activity was evaluated by the in vitro inhibition of α-glucosidase. The ethyl acetate (EtOAc) extract showed strong inhibitory activity with IC 50 = 24.88 µg/mL, however methanolic and hexanic extracts showed weak activity. As a pure compound, only ursolic acid showed a strong inhibitory activity, with IC 50 = 72.71 μM.

Evaluation of wound healing, anti-microbial and antioxidant potential of Pongamia pinnata in wistar rats.

PubMed

Dwivedi, Deepak; Dwivedi, Mona; Malviya, Sourabh; Singh, Vinod

2017-01-01

To investigate wound healing, antimicrobial and antioxidant activity of leaf extract of Pongamia Pinnata . Methanolic extracts of P. pinnata leaf were studied for wound healing efficiency, and was assessed by the rate of wound contraction, tensile strength, breaking strength, hydroxyproline and hexosamine content, along with its effect on pro-inflammatory and anti-inflammatory cytokines was assessed using excision and incision model of wound repair in Wistar rats. Antimicrobial activity against ten microorganisms was also assessed. In vivo antioxidant activity was performed to understand the mechanism of wound healing potency. The results indicated that P. pinnata extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. Hydroxyproline and hexosamine expression were also well correlated with the healing pattern observed. extract exhibited significant antimicrobial activity, Staphylococcus aureus, Staphylococcus pyogenes, Staphylococcus epidermidis, Escherichia coli, Micrococcus luteus, Enterobacter aerogenes, Salmonella typhi, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger also indicate that P. pinnata posses potent antioxidant activity by inhibition lipid peroxidation, reduce glutathione, superoxide dismutase level and increases catalase activity. During early wound healing phase TNF-α and IL-6 level were found to be up-regulated by P. pinnata treatment. Increased wound contraction and tensile strength, augmented hydroxyproline and hexosamine content, antioxidative activity and moderate antimicrobial activity support the early wound healing exhibited by P. pinnata . Induction in cytokine production may be one of the mechanisms in accelerating the wound healing. Results suggest that P. pinnata may be useful in tropical management of wound healing.

Carbapenem Susceptibility and Multidrug-Resistance in Pseudomonas aeruginosa Isolates in Egypt

PubMed Central

Hashem, Hany; Hanora, Amro; Abdalla, Salah; Shawky, Alaa; Saad, Alaa

2016-01-01

Background Resistant Pseudomonas aeruginosa is a serious concern for antimicrobial therapy, as the common isolates exhibit variable grades of resistance, involving beta-lactamase enzymes, beside native defense mechanisms. Objectives The present study was designed to determine the occurrence of Metallo-β- Lactamases (MBL) and Amp C harboring P. aeruginosa isolates from Suez Canal university hospital in Ismailia, Egypt. Methods A total of 147 P. aeruginosa isolates, recovered from 311 patients during a 10-month period, were collected between May 2013 and February 2014; the isolates were collected from urine, wound and sputum. Minimum inhibitory concentration (MIC) determined by agar dilution methods was ≥2 μg/mL for meropenem and imipenem. Identification of P. aeruginosa was confirmed using API 20NE. Metallo-β- Lactamases and Amp C were detected based on different phenotypic methods. Results Overall, 26.5% of P. aeruginosa isolates (39/147) were carbapenem resistant isolates. Furthermore, 64.1% (25/39) were MBL producers, these isolates were screened by the combined disc and disc diffusion methods to determine the ability of MBL production. Both MBL and Amp C harbored P. aeruginosa isolates were 28% (7/25). Sixty-four percent of P. aeruginosa isolates were multidrug resistant (MDR) (16/25). The sensitivity toward polymyxin, imipenem, norfloxacin, piperacillin-tazobactam and gentamicin was 99%, 91%, 88%, 82% and 78%, respectively. The resistance rate towards cefotaxime, ceftazidime, cefepime, aztreonam and meropenem was 98.6%, 86%, 71.4%, 34% and 30%, respectively. Conclusions Multidrug resistance was significantly associated with MBL production in P. aeruginosa. Early detection of MBL-producing P. aeruginosa and hospital antibiotic policy prescription helps proper antimicrobial therapy and avoidance of dissemination of these multidrug resistance isolates. PMID:28138370

Carbapenem Susceptibility and Multidrug-Resistance in Pseudomonas aeruginosa Isolates in Egypt.

PubMed

Hashem, Hany; Hanora, Amro; Abdalla, Salah; Shawky, Alaa; Saad, Alaa

2016-11-01

Resistant Pseudomonas aeruginosa is a serious concern for antimicrobial therapy, as the common isolates exhibit variable grades of resistance, involving beta-lactamase enzymes, beside native defense mechanisms. The present study was designed to determine the occurrence of Metallo-β- Lactamases (MBL) and Amp C harboring P. aeruginosa isolates from Suez Canal university hospital in Ismailia, Egypt. A total of 147 P. aeruginosa isolates, recovered from 311 patients during a 10-month period, were collected between May 2013 and February 2014; the isolates were collected from urine, wound and sputum. Minimum inhibitory concentration (MIC) determined by agar dilution methods was ≥2 μg/mL for meropenem and imipenem. Identification of P. aeruginosa was confirmed using API 20NE. Metallo-β- Lactamases and Amp C were detected based on different phenotypic methods. Overall, 26.5% of P. aeruginosa isolates (39/147) were carbapenem resistant isolates. Furthermore, 64.1% (25/39) were MBL producers, these isolates were screened by the combined disc and disc diffusion methods to determine the ability of MBL production. Both MBL and Amp C harbored P. aeruginosa isolates were 28% (7/25). Sixty-four percent of P. aeruginosa isolates were multidrug resistant (MDR) (16/25). The sensitivity toward polymyxin, imipenem, norfloxacin, piperacillin-tazobactam and gentamicin was 99%, 91%, 88%, 82% and 78%, respectively. The resistance rate towards cefotaxime, ceftazidime, cefepime, aztreonam and meropenem was 98.6%, 86%, 71.4%, 34% and 30%, respectively. Multidrug resistance was significantly associated with MBL production in P. aeruginosa . Early detection of MBL-producing P. aeruginosa and hospital antibiotic policy prescription helps proper antimicrobial therapy and avoidance of dissemination of these multidrug resistance isolates.

The utilization of aconate and itaconate by Micrococcus sp

PubMed Central

Cooper, R. A.; Itiaba, K.; Kornberg, H. L.

1965-01-01

1. An organism, identified as Micrococcus sp., was isolated by elective culture on aconate; it also grew on itaconate. 2. Washed suspensions of the aconate-grown organism readily oxidized intermediates of the tricarboxylic acid cycle, aconate and succinic semialdehyde, but not itaconate. Itaconate-grown cells oxidized tricarboxylic acid-cycle intermediates, succinic semialdehyde and itaconate, but not aconate. Succinate-grown cells oxidized neither itaconate nor aconate. 3. Extracts of aconate-grown cells catalysed the formation of succinic semialdehyde and carbon dioxide, in equimolar amounts, from aconate. In the presence of NAD or NADP, succinic semialdehyde was oxidized to succinate with concomitant reduction of the coenzyme. 4. Extracts of itaconate-grown cells catalysed the formation of pyruvate and acetyl-CoA from itaconyl-CoA. 5. Key enzymes involved in the formation of succinate from aconate, and of pyruvate and acetyl-CoA from itaconate, were distinct and inducible: their formation preceded growth on the appropriate substrate. PMID:14342240

Proposal for creation of a new genus Neomicrococcus gen. nov. to accommodate Zhihengliuella aestuarii Baik et al. 2011 and Micrococcus lactis Chittpurna et al. 2011 as Neomicrococcus aestuarii comb. nov. and Neomicrococcus lactis comb. nov.

PubMed

Prakash, Om; Sharma, Avinash; Nimonkar, Yogesh; Shouche, Yogesh S

2015-11-01

Micrococcus lactis and Zhihengliuella aestuarii were described independently in 2011. Their type strains showed high levels of 16S rRNA gene sequence similarity (99.3%). Phylogenetic analysis revealed that M. lactis MCC 2278T and Z. aestuarii JCM 16166T formed a monophyletic group and showed distant relationships to other members of closely related genera such as Micrococcus, Zhihengliuella, Arthrobacter and Citricoccus. The presence of large proportions of iso-C14:0 and iso-C16:0 with small amounts of iso-C15:0 distinguished M. lactis MCC 2278T and Z. aestuarii JCM 16166T from other members of the genera Micrococcus and Zhihengliuella. Unlike other members of the genera Zhihengliuella and Micrococcus, M. lactis MCC 2278T and Z. aestuarii JCM 16166T showed growth at low concentrations of NaCl. Thus, based on distinctive phylogenetic, chemotaxonomic and physiological features of these two organisms in comparison with other members of the genera Micrococcus and Zhihengliuella, it is clear that they do not fit within the existing classification and deserve separate status. DNA-DNA hybridization between the two type strains was 63%, indicating that they represent separate species. In this study, we propose the creation of a novel genus, Neomicrococcus gen. nov., to accommodate the two species with Neomicrococcus aestuarii gen. nov., comb. nov. (type strain JCM 16166T = KCTC 19557T) as the type species. Neomicrococcus lactis comb. nov. (type strain MCC 2278T = DSM 23694T) is also proposed.

Why Does the Healthy Cornea Resist Pseudomonas aeruginosa Infection?

PubMed Central

Evans, David J.; Fleiszig, Suzanne M. J.

2013-01-01

Purpose To provide our perspective on why the cornea is resistant to infection based on our research results with Pseudomonas aeruginosa. Perspective We focus on our current understanding of the interplay between bacteria, tear fluid and the corneal epithelium that determine health as the usual outcome, and propose a theoretical model for how contact lens wear might change those interactions to enable susceptibility to P. aeruginosa infection. Methods Use of “null-infection” in vivo models, cultured human corneal epithelial cells, contact lens-wearing animal models, and bacterial genetics help to elucidate mechanisms by which P. aeruginosa survive at the ocular surface, adheres, and traverses multilayered corneal epithelia. These models also help elucidate the molecular mechanisms of corneal epithelial innate defense. Results and Discussion Tear fluid and the corneal epithelium combine to make a formidable defense against P. aeruginosa infection of the cornea. Part of that defense involves the expression of antimicrobials such as β-defensins, the cathelicidin LL-37, cytokeratin-derived antimicrobial peptides, and RNase7. Immunomodulators such as SP-D and ST2 also contribute. Innate defenses of the cornea depend in part on MyD88, a key adaptor protein of TLR and IL-1R signaling, but the basal lamina represents the final barrier to bacterial penetration. Overcoming these defenses involves P. aeruginosa adaptation, expression of the type three secretion system, proteases, and P. aeruginosa biofilm formation on contact lenses. Conclusion After more than two decades of research focused on understanding how contact lens wear predisposes to P. aeruginosa infection, our working hypothesis places blame for microbial keratitis on bacterial adaptation to ocular surface defenses, combined with changes to the biochemistry of the corneal surface caused by trapping bacteria and tear fluid against the cornea under the lens. PMID:23601656

Chromosomally Encoded mcr-5 in Colistin non-susceptible Pseudomonas aeruginosa.

PubMed

Snesrud, Erik; Maybank, Rosslyn; Kwak, Yoon I; Jones, Anthony R; Hinkle, Mary K; Mc Gann, Patrick

2018-05-29

Whole genome sequencing (WGS) of historical Pseudomonas aeruginosa clinical isolates identified a chromosomal copy of mcr-5 within a Tn 3 -like transposon in P. aeruginosa MRSN 12280. The isolate was non-susceptible to colistin by broth microdilution and genome analysis revealed no mutations known to confer colistin resistance. To the best of our knowledge, this is the first report of mcr in colistin non-susceptible P. aeruginosa .

The Genomic Basis of Evolutionary Innovation in Pseudomonas aeruginosa

PubMed Central

Wagner, Andreas; MacLean, R. Craig

2016-01-01

Novel traits play a key role in evolution, but their origins remain poorly understood. Here we address this problem by using experimental evolution to study bacterial innovation in real time. We allowed 380 populations of Pseudomonas aeruginosa to adapt to 95 different carbon sources that challenged bacteria with either evolving novel metabolic traits or optimizing existing traits. Whole genome sequencing of more than 80 clones revealed profound differences in the genetic basis of innovation and optimization. Innovation was associated with the rapid acquisition of mutations in genes involved in transcription and metabolism. Mutations in pre-existing duplicate genes in the P. aeruginosa genome were common during innovation, but not optimization. These duplicate genes may have been acquired by P. aeruginosa due to either spontaneous gene amplification or horizontal gene transfer. High throughput phenotype assays revealed that novelty was associated with increased pleiotropic costs that are likely to constrain innovation. However, mutations in duplicate genes with close homologs in the P. aeruginosa genome were associated with low pleiotropic costs compared to mutations in duplicate genes with distant homologs in the P. aeruginosa genome, suggesting that functional redundancy between duplicates facilitates innovation by buffering pleiotropic costs. PMID:27149698

[Inhibition effects of Houttuynia cordata Thunb. on Microcystis aeruginosa].

PubMed

Liu, Lu; Li, Cheng; Xia, Wentong; Yang, Xiaohui; Zhang, Tingting

2014-05-01

To research the inhibitory effect of Houttuynia cordata Thunb. on Microcystis aeruginosa. M. aeruginosat were treated respectively by H. cordata leaching solution or H. cordata extracts. H. cordata leaching solution extracted by water and the H. cordata extracts extracted by organic solvent (acetone, ethyl acetate, petroleum ether and ethanol, respectively). The inhibition ratios were calculated according to the M. aeruginosa densities, and the allelochemicals of the extract that had the best inhibitiory effect on M. aeruginosa were identified by GC-MS analysis. It was proved that leaching solution of H. cordata and four crude extracts had good inhibitory effect on M. aeruginosa. The inhibitory effects of the four crude extracts were the fraction extracted by ethyl acetate, the fraction extracted by ethanol, the fraction extracted by acetone and the fraction extracted by petroleum ether form strong to weak in turn. Then, the allelochemicals of the fraction extracted by ethyl acetate were indentified, mainly including acetonyldimethylcarbinol, 2,2-dimethyl-3-hexanone, 6-chlorohexanoic and 4-cyanophenyl ester. H. cordata has strong inhibitory effect on water-blooming cyanobacteria and the potential to develop into an ecological M. aeruginosa inhibiting agent.

Chronic Pseudomonas aeruginosa infection and respiratory muscle impairment in cystic fibrosis.

PubMed

Dassios, Theodore G; Katelari, Anna; Doudounakis, Stavros; Dimitriou, Gabriel

2014-03-01

Chronic infection with Pseudomonas aeruginosa in patients with cystic fibrosis (CF) is associated with increased morbidity. Chronic infection can cause limb and respiratory muscle compromise. Respiratory muscle function can be assessed via maximal inspiratory pressure (PImax), maximal expiratory pressure (PEmax), and the pressure-time index of the respiratory muscles (PTImus). We studied the effect of chronic P. aeruginosa infection on respiratory muscle function in patients with CF. This cross-sectional study assessed PImax, PEmax, PTImus, FEV1, FVC, maximum expiratory flow during the middle half of the FVC maneuver, body mass index, and upper arm muscle area in 122 subjects with CF, in 4 subgroups matched for age and sex at different stages of P. aeruginosa infection, according to the Leeds criteria. We compared respiratory muscle function in the subgroups according to P. aeruginosa infection state. Median PImax was significantly lower in CF subjects with chronic P. aeruginosa infection (PImax = 62 cm H2O), compared to subjects who were never infected (PImax = 86 cm H2O, P = .02), free of infection (PImax = 74 cm H2O, P = .01), or intermittently infected (PImax = 72 cm H2O, P = .02). Median PTImus was significantly increased in CF subjects with chronic P. aeruginosa infection (PTImus = .142), compared to subjects who were free of infection (PTImus = .102, P = .006). Median upper-arm muscle area was significantly lower in CF subjects with chronic P. aeruginosa infection (upper-arm muscle area = 2,219 mm(2)), compared to subjects who were never infected (2,754 mm(2), P = .03), free of infection (2,678 mm(2), P = .01), or intermittently infected (2,603 mm(2), P = .04). Multivariate logistic regression revealed P. aeruginosa state of infection as a significant determinant of PTImus (P = .03) independently of sex, upper-arm muscle area, and FEV1. CF subjects with chronic P. aeruginosa infection exhibited impaired respiratory muscle function and decreased inspiratory

Network-assisted investigation of virulence and antibiotic-resistance systems in Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Hwang, Sohyun; Kim, Chan Yeong; Ji, Sun-Gou; Go, Junhyeok; Kim, Hanhae; Yang, Sunmo; Kim, Hye Jin; Cho, Ara; Yoon, Sang Sun; Lee, Insuk

2016-05-01

Pseudomonas aeruginosa is a Gram-negative bacterium of clinical significance. Although the genome of PAO1, a prototype strain of P. aeruginosa, has been extensively studied, approximately one-third of the functional genome remains unknown. With the emergence of antibiotic-resistant strains of P. aeruginosa, there is an urgent need to develop novel antibiotic and anti-virulence strategies, which may be facilitated by an approach that explores P. aeruginosa gene function in systems-level models. Here, we present a genome-wide functional network of P. aeruginosa genes, PseudomonasNet, which covers 98% of the coding genome, and a companion web server to generate functional hypotheses using various network-search algorithms. We demonstrate that PseudomonasNet-assisted predictions can effectively identify novel genes involved in virulence and antibiotic resistance. Moreover, an antibiotic-resistance network based on PseudomonasNet reveals that P. aeruginosa has common modular genetic organisations that confer increased or decreased resistance to diverse antibiotics, which accounts for the pervasiveness of cross-resistance across multiple drugs. The same network also suggests that P. aeruginosa has developed mechanism of trade-off in resistance across drugs by altering genetic interactions. Taken together, these results clearly demonstrate the usefulness of a genome-scale functional network to investigate pathogenic systems in P. aeruginosa.

Expansion of Antibacterial Spectrum of Muraymycins toward Pseudomonas aeruginosa.

PubMed

Takeoka, Yusuke; Tanino, Tetsuya; Sekiguchi, Mitsuaki; Yonezawa, Shuji; Sakagami, Masahiro; Takahashi, Fumiyo; Togame, Hiroko; Tanaka, Yoshikazu; Takemoto, Hiroshi; Ichikawa, Satoshi; Matsuda, Akira

2014-05-08

It is urgent to develop novel anti-Pseudomonas agents that should also be active against multidrug resistant P. aeruginosa. Expanding the antibacterial spectrum of muraymycins toward P. aeruginosa was investigated by the systematic structure-activity relationship study. It was revealed that two functional groups, a lipophilic side chain and a guanidino group, at the accessory moiety of muraymycins were important for the anti-Pseudomonas activity, and analogue 29 exhibited antibacterial activity against a range of P. aeruginosa strains with the minimum inhibitory concentration values of 4-8 μg/mL.

Expansion of Antibacterial Spectrum of Muraymycins toward Pseudomonas aeruginosa

PubMed Central

2014-01-01

It is urgent to develop novel anti-Pseudomonas agents that should also be active against multidrug resistant P. aeruginosa. Expanding the antibacterial spectrum of muraymycins toward P. aeruginosa was investigated by the systematic structure–activity relationship study. It was revealed that two functional groups, a lipophilic side chain and a guanidino group, at the accessory moiety of muraymycins were important for the anti-Pseudomonas activity, and analogue 29 exhibited antibacterial activity against a range of P. aeruginosa strains with the minimum inhibitory concentration values of 4–8 μg/mL. PMID:24900879

Application of halophilic nuclease H of Micrococcus varians subsp. halophilus to commercial production of flavoring agent 5'-GMP.

PubMed Central

Kamekura, M; Hamakawa, T; Onishi, H

1982-01-01

RNA was degraded at 60 degrees C for 24 h by halophilic nuclease H in supernatants from broth cultures of Micrococcus varians subsp. halophilus containing 12% NaCl. Since contaminating 5'-nucleotidase exhibited almost no activity under these conditions, the 5'-GMP formed could be recovered from the reaction mixture, and the yield was 805 mg from 5 g of RNA. PMID:6184020

Geographical differences in first acquisition of Pseudomonas aeruginosa in cystic fibrosis.

PubMed

Ranganathan, Sarath C; Skoric, Billy; Ramsay, Kay A; Carzino, Rosemary; Gibson, Anne-Marie; Hart, Emily; Harrison, Jo; Bell, Scott C; Kidd, Timothy J

2013-04-01

Risk of infection with Pseudomonas aeruginosa in cystic fibrosis (CF) may be associated with environmental factors. To determine whether residential location is associated with risk of first acquisition of P. aeruginosa. We performed bronchoalveolar lavage and upper airway cultures in children newly diagnosed with CF to identify infection with P. aeruginosa during infancy and early childhood. Children were assessed according to their residence in a regional or metropolitan area. Multilocus sequence typing was used to determine P. aeruginosa genotype. An environmental questionnaire was also administered. A total of 105 of 120 (87.5%) infants diagnosed with CF were included in this study. Diagnosis in 65 infants (61.9%) followed newborn screening at mean age of 4.6 weeks. Sixty subjects (57.1%) were homozygous ΔF508, and 47 (44.8%) were female. Fifty-five (52.3%) infants were regional, of whom 26 (47.3%), compared with 9 of 50 (18.0%) metropolitan children, acquired infection with P. aeruginosa (odds ratio, 4.084; 95% confidence interval, 1.55-11.30). Age at acquisition was similar (regional: median, 2.31 yr; range, 0.27-5.96 yr; metropolitan: median, 3.10 yr, range, 0.89-3.70 yr). Strain typing identified P. aeruginosa genotypes often encountered in different ecological settings and little evidence of cross-infection. Ninety questionnaires (85.7%) were completed. Those who acquired P. aeruginosa were more likely to be living in a household that used water sprinkler systems (P = 0.032), but no differences were identified to explain increased risk of acquisition of P. aeruginosa in regional children. Geographical difference in residence of children with CF was associated with increased risk of first acquisition of P. aeruginosa, usually with strains associated with the environment rather than with cross-infection.

Relevance of multidrug-resistant Pseudomonas aeruginosa infections in cystic fibrosis.

PubMed

Stefani, S; Campana, S; Cariani, L; Carnovale, V; Colombo, C; Lleo, M M; Iula, V D; Minicucci, L; Morelli, P; Pizzamiglio, G; Taccetti, G

2017-09-01

Multidrug-resistant (MDR) Pseudomonas aeruginosa is an important issue for physicians who take care of patients with cystic fibrosis (CF). Here, we review the latest research on how P. aeruginosa infection causes lung function to decline and how several factors contribute to the emergence of antibiotic resistance in P. aeruginosa strains and influence the course of the infection course. However, many aspects of the practical management of patients with CF infected with MDR P. aeruginosa are still to be established. Less is known about the exact role of susceptibility testing in clinical strategies for dealing with resistant infections, and there is an urgent need to find a tool to assist in choosing the best therapeutic strategy for MDR P. aeruginosa infection. One current perception is that the selection of antibiotic therapy according to antibiogram results is an important component of the decision-making process, but other patient factors, such as previous infection history and antibiotic courses, also need to be evaluated. On the basis of the known issues and the best current data on respiratory infections caused by MDR P. aeruginosa, this review provides practical suggestions to optimize the diagnostic and therapeutic management of patients with CF who are infected with these pathogens. Copyright © 2017 Elsevier GmbH. All rights reserved.

Chemical composition and antimicrobial activity of the essential oil of the leaves of Feronia elephantum (Rutaceae) from north west Karnataka.

PubMed

Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem

2011-01-01

The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.

Isolation of DNA methyltransferase from plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehrlich, K.; Malbroue, C.

1987-05-01

DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less

Engineering waterborne Pseudomonas aeruginosa out of a critical care unit.

PubMed

Garvey, Mark I; Bradley, Craig W; Wilkinson, Martyn A C; Bradley, Christina; Holden, Elisabeth

2017-08-01

To describe engineering and holistic interventions on water outlets contaminated with Pseudomonas aeruginosa and the observed impact on clinical P. aeruginosa patient isolates in a large Intensive Care Unit (ICU). Descriptive study. Queen Elizabeth Hospital Birmingham (QEHB), part of University Hospitals Birmingham (UHB) NHS Foundation Trust is a tertiary referral teaching hospital in Birmingham, UK and provides clinical services to nearly 1 million patients every year. Breakpoint models were used to detect any significant changes in the cumulative yearly rates of clinical P. aeruginosa patient isolates from August 2013-December 2016 across QEHB. Water sampling undertaken on the ICU indicated 30% of the outlets were positive for P. aeruginosa at any one time. Molecular typing of patient and water isolates via Pulsed Field Gel Electrophoresis suggested there was a 30% transmission rate of P. aeruginosa from the water to patients on the ICU. From, February 2014, QEHB implemented engineering interventions, consisting of new tap outlets and PALL point-of-use filters; as well as holistic measures, from February 2016 including a revised tap cleaning method and appropriate disposal of patient waste water. Breakpoint models indicated the engineering and holistic interventions resulted in a significant (p<0.001) 50% reduction in the number of P. aeruginosa clinical patient isolates over a year. Here we demonstrate that the role of waterborne transmission of P. aeruginosa in an ICU cannot be overlooked. We suggest both holistic and environmental factors are important in reducing transmission. Copyright © 2017 Elsevier GmbH. All rights reserved.

Transferable Drug Resistance in Pseudomonas aeruginosa1

PubMed Central

Bryan, L. E.; Elzen, H. M. Van Den; Tseng, Jui Teng

1972-01-01

Three strains of Pseudomonas aeruginosa were demonstrated to transfer double-drug resistance by conjugation to a P. aeruginosa recipient at frequencies of 10−4 to 10−2 per recipient cell. Two of the three strains also transferred to Escherichia coli at frequencies which were 103- to 105-fold lower, but the third strain could not be demonstrated to do so. The latter strain, however, conferred maleness on the Pseudomonas recipient. The transfer of streptomycin resistance was associated with the acquisition of streptomycin phosphorylase by both P. aeruginosa and E. coli recipients. Maximal broth mating frequencies were obtained with nonagitated cultures less than 1 mm in depth. A pyocine selection system based on donor sensitivity and recipient resistance is described and appears to have future value as a generalized selective device for use after matings. PMID:4207756

Immunolocalization of dually phosphorylated MAPKs in dividing root meristem cells of Vicia faba, Pisum sativum, Lupinus luteus and Lycopersicon esculentum.

PubMed

Winnicki, Konrad; Żabka, Aneta; Bernasińska, Joanna; Matczak, Karolina; Maszewski, Janusz

2015-06-01

In plants, phosphorylated MAPKs display constitutive nuclear localization; however, not all studied plant species show co-localization of activated MAPKs to mitotic microtubules. The mitogen-activated protein kinase (MAPK) signaling pathway is involved not only in the cellular response to biotic and abiotic stress but also in the regulation of cell cycle and plant development. The role of MAPKs in the formation of a mitotic spindle has been widely studied and the MAPK signaling pathway was found to be indispensable for the unperturbed course of cell division. Here we show cellular localization of activated MAPKs (dually phosphorylated at their TXY motifs) in both interphase and mitotic root meristem cells of Lupinus luteus, Pisum sativum, Vicia faba (Fabaceae) and Lycopersicon esculentum (Solanaceae). Nuclear localization of activated MAPKs has been found in all species. Co-localization of these kinases to mitotic microtubules was most evident in L. esculentum, while only about 50% of mitotic cells in the root meristems of P. sativum and V. faba displayed activated MAPKs localized to microtubules during mitosis. Unexpectedly, no evident immunofluorescence signals at spindle microtubules and phragmoplast were noted in L. luteus. Considering immunocytochemical analyses and studies on the impact of FR180204 (an inhibitor of animal ERK1/2) on mitotic cells, we hypothesize that MAPKs may not play prominent role in the regulation of microtubule dynamics in all plant species.

Pseudomonas aeruginosa Genotype Prevalence in Dutch Cystic Fibrosis Patients and Age Dependency of Colonization by Various P. aeruginosa Sequence Types ▿

PubMed Central

van Mansfeld, Rosa; Willems, Rob; Brimicombe, Roland; Heijerman, Harry; van Berkhout, Ferdinand Teding; Wolfs, Tom; van der Ent, Cornelis; Bonten, Marc

2009-01-01

The patient-to-patient transmission of highly prevalent Pseudomonas aeruginosa clones which are associated with enhanced disease progression has led to strict segregation policies for cystic fibrosis (CF) patients in many countries. However, little is known about the population structure of P. aeruginosa among CF patients. The aim of the present cross-sectional study was to determine the prevalence and genetic relatedness of P. aeruginosa isolates from CF patients who visited two major CF centers in The Netherlands in 2007 and 2008. These patients represented 45% of the Dutch CF population. P. aeruginosa carriage in the respiratory tract was determined by standard microbiological culture techniques, and all phenotypically different isolates in the first specimens recovered in 2007 and 2008 were genotyped by multilocus sequence typing. A total of 313 (57%) of 551 patients whose samples were cultured carried P. aeruginosa. Two sequence types (STs), ST406 and ST497, were found in 15% and 5% of the patients, respectively, and 60% of the patients harbored a strain that was also found in at least two other patients. The risk ratios for carrying ST406 and ST497 were 17.8 (95% confidence interval [CI], 7.2 to 43.6) for those aged between 15 and 24 years and 6 (95% CI, 1.4 to 26.1) for those aged >25 years. ST406 and ST497 were not genetically linked to previously described epidemic clones, which were also not found in this CF population. The population structure of P. aeruginosa in Dutch CF patients is characterized by the presence of two prevalent STs that are associated with certain age groups and that are not genetically linked to previously described epidemic clones. PMID:19828746

Functional gene-based discovery of phenazines from the actinobacteria associated with marine sponges in the South China Sea.

PubMed

Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong

2015-07-01

Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.

[Risk factors for Pseudomonas aeruginosa infections, resistant to carbapenem].

PubMed

Ghibu, Laura; Miftode, Egidia; Teodor, Andra; Bejan, Codrina; Dorobăţ, Carmen Mihaela

2010-01-01

Since their introduction in clinical practice,carbapenems have been among the most powerful antibiotics for treating serious infections cased by Gram-negative nosocomial pathogens, including Pseudomonas aeruginosa. The emergence of betalactamases with carbapenem-hydrolyzing activity is of major clinical concern. Pseudomonas aeruginosa is a leading cause of nosocomial infection. Risk factors for colonization with carbapenems-resistant Pseudomonas in hospital are: history of P. aeruginosa infection or colonization within the previous year, (length of hospital stay, being bedridden or in the ICU, mechanical ventilation, malignant disease, and history of chronic obstructive pulmonary disease have all been identified as independent risk factors for MDR P. aeruginosa infection. Long-term-care facilities are also reservoirs of resistant bacteria. Risk factors for colonization of LTCF residents with resistant bacteria included age > 86 years, antibiotic treatment in the previous 3 months, indwelling devices, chronic obstructive pulmonary disease, physical disability, and the particular LTCF unit.

Pseudomonas aeruginosa uses T3SS to inhibit diabetic wound healing.

PubMed

Goldufsky, Josef; Wood, Stephen J; Jayaraman, Vijayakumar; Majdobeh, Omar; Chen, Lin; Qin, Shanshan; Zhang, Chunxiang; DiPietro, Luisa A; Shafikhani, Sasha H

2015-01-01

Diabetic foot ulcers are responsible for more hospitalizations than any other complication of diabetes. Bacterial infection is recognized as an important factor associated with impaired healing in diabetic ulcers. Pseudomonas aeruginosa is the most frequently detected Gram-negative pathogen in diabetic ulcers. P. aeruginosa infection has been shown to impair healing in diabetic wounds in a manner that correlates with its ability to form biofilm. While the majority of infections in diabetic ulcers are biofilm associated, 33% of infections are nonbiofilm in nature. P. aeruginosa is the most prevalent Gram-negative pathogen in all diabetic wound types, which suggests that the deleterious impact of P. aeruginosa on healing in diabetic wounds goes beyond its ability to form biofilm and likely involves other factors. The Type III Secretion System (T3SS) virulence structure is required for the pathogenesis of all P. aeruginosa clinical isolates, suggesting that it may also play a role in the inhibition of wound repair in diabetic skin ulcers. We evaluated the role of T3SS in mediating P. aeruginosa-induced tissue damage in the wounds of diabetic mice. Our data demonstrate that P. aeruginosa establishes a robust and persistent infection in diabetic wounds independent of its ability to form biofilm and causes severe wound damage in a manner that primarily depends on its T3SS. © 2015 by the Wound Healing Society.

Bacteriophage Infectivity Against Pseudomonas aeruginosa in Saline Conditions

PubMed Central

Scarascia, Giantommaso; Yap, Scott A.; Kaksonen, Anna H.; Hong, Pei-Ying

2018-01-01

Pseudomonas aeruginosa is a ubiquitous member of marine biofilm, and reduces thiosulfate to produce toxic hydrogen sulfide gas. In this study, lytic bacteriophages were isolated and applied to inhibit the growth of P. aeruginosa in planktonic mode at different temperature, pH, and salinity. Bacteriophages showed optimal infectivity at a multiplicity of infection of 10 in saline conditions, and demonstrated lytic abilities over all tested temperature (25, 30, 37, and 45°C) and pH 6–9. Planktonic P. aeruginosa exhibited significantly longer lag phase and lower specific growth rates upon exposure to bacteriophages. Bacteriophages were subsequently applied to P. aeruginosa-enriched biofilm and were determined to lower the relative abundance of Pseudomonas-related taxa from 0.17 to 5.58% in controls to 0.01–0.61% in treated microbial communities. The relative abundance of Alphaproteobacteria, Pseudoalteromonas, and Planococcaceae decreased, possibly due to the phage-induced disruption of the biofilm matrix. Lastly, when applied to mitigate biofouling of ultrafiltration membranes, bacteriophages were determined to reduce the transmembrane pressure increase by 18% when utilized alone, and by 49% when used in combination with citric acid. The combined treatment was more effective compared with the citric acid treatment alone, which reported ca. 30% transmembrane pressure reduction. Collectively, the findings demonstrated that bacteriophages can be used as a biocidal agent to mitigate undesirable P. aeruginosa-associated problems in seawater applications. PMID:29770130

[Susceptibility and resistence of Pseudomonas aeruginosa to antimicrobial agents].

PubMed

Gamero Delgado, M C; García-Mayorgas, A D; Rodríguez, F; Ibarra, A; Casal, M

2007-06-01

Pseudomonas aeruginosa is an opportunistic microorganism that is frequently the cause of nosocomial infections. Multiple mechanisms are involved in its natural and acquired resistance to many of the antimicrobial agents commonly used in clinical practice. The objective of this study was to assess the susceptibility and resistance patterns of P. aeruginosa strains isolated in Hospital Reina Sofia between 2000 and 2005, as well as to analyze the differences between intrahospital and extrahospital isolates in 2005 and to compare the results with those obtained in other studies. A total of 3,019 strains of P. aeruginosa from different hospitals and nonhospital settings were evaluated, taking into consideration their degree of sensitivity to different antibiotics. The MICs were determined by means of the Wider I automated system (Soria Melguizo), taking into consideration the criteria of susceptibility and resistance recommended by MENSURA. Results of the analysis showed that P. aeruginosa maintained similar levels of antimicrobial susceptibility during the period 2000-2005, with increased susceptibility to amikacin, gentamicin and tobramycin. There were also important differences in the degree of susceptibility between intrahospital and extrahospital strains, except for imipenem and fosfomycin. The intrahospital difference in susceptibility was also evaluated, emphasizing the importance of periodically studying susceptibility and resistance patterns of P. aeruginosa in each setting in order to evaluate different therapeutic guidelines, as it is not always advisable to extrapolate data from different regions. These differences can be explained by the different use of antibiotics in each center and the geographic variations of the resistance mechanisms of P. aeruginosa.

Molecular epidemiology of Pseudomonas aeruginosa.

PubMed

Speert, David P

2002-10-01

Pseudomonas aeruginosa is a serious opportunistic pathogen in certain compromised hosts, such as those with cystic fibrosis, thermal burns and cancer. It also causes less severe noninvasive disease, such as otitis externa and hot tub folliculitis, in normal hosts. P. aeruginosa is phenotypically very unstable, particularly in patients with chronic infection. Phenotypic typing techniques are useful for understanding the epidemiology of acute infections, but they are limited by their discriminatory power and by their inability to group isolates that are phenotypically unrelated but genetically homologous. Molecular typing techniques, developed over the past decade, are highly discriminatory and are useful for typing strains from patients with chronic infection where the bacterial phenotype is unstable; this is particularly true in cystic fibrosis, where patients often are infected with the same strain for several decades, but the bacteria undergo phenotypic alteration. Molecular typing techniques, which have proven useful in typing P. aeruginosa for epidemiological purposes, include pulsed field gel electrophoresis, restriction fragment length polymorphic DNA analysis, random amplified polymorphic DNA analysis, repetitive extrapalindromic PCR analysis, and multilocus sequence typing. These methods are generally only available in specialized laboratories, but they should be used when data from phenotypic typing analysis are ambiguous or when phenotypic methods are unreliable, such as in cystic fibrosis.

[In vitro indirect pathogenesis of Pseudomonas aeruginosa against anti MRSA chemotherapy].

PubMed

Satoh, Naotake; Kondo, Shigemi; Yamada, Toshihiko; Saionji, Katsu; Oguri, Toyoko; Igari, Jun

2004-09-01

In the patient with a chronic respiratory disease, both Pseudomonas aeruginosa and methicillin-resistant Staphylococcus aureus (MRSA) are frequently detected from expectoration. Vancomycin (VCM) and arbekacin (ABK) are both recommended for the chemotherapy of MRSA infection in Japan. Minocycline (MINO) is also selected for the treatment of MRSA infection. While rifampicin (RFP) and a trimetoprim-sulfamethoxazole combination (ST) are also recommended in Europe and USA but not recommended in Japan for the chemotherapy of MRSA infection. It is pointed out that coexistence bacteria affect chemotherapy as an indirect pathogen. Not only an antibacterial action but the immunological action or the metabolic effect against chronic P. aeruginosa infection such as DPB is known by the administration of 14-membered ring macrolides including erythromycin (EM). We considered the influence of P. aeruginosa isolated with MRSA on the activity against anti-MRSA agents by the disk diffusion method with bilayer flat agar in vitro. Moreover, we also examined the influence of EM against the activity of the anti-MRSA agents when P. aeruginosa was coexistence. One strain of MRSA as an indicator strain and 100 strains of P. aeruginosa as test strains, which were obtained from clinical materials, were used for the following experiment. P. aeruginosa was streaked on to the Mueller-Hinton agar culture medium (MHA), and they incubated at 35 degrees C for 24 hours. Then, the blood agar plate was piled up, MRSA was streaked on the blood agar surface, the susceptibility test disks (VCM, ABK, MINO, RFP, ST) were put on it, and incubated at 35 degrees C for a further 24 hours. The diameter of the zone of inhibition around the susceptibility disks against MRSA was measured and compared with P. aeruginosa free experiments. The anti-MRSA activity of MINO, ST and ABK was reduced by coexistence of P. aeruginosa. In RFP and VCM, the anti-MRSA activity was reinforced by coexistence of P. aeruginosa

ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

PubMed Central

Finnerty, W. R.; Kallio, R. E.

1964-01-01

Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

Characterization of the membrane-bound succinic dehydrogenase of Micrococcus lysodeikticus.

PubMed

Pollock, J J; Linder, R; Salton, M R

1971-07-01

The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 x g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca(2+) and Mg(2+) exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents.

Acute ileitis facilitates infection with multidrug resistant Pseudomonas aeruginosa in human microbiota-associated mice.

PubMed

von Klitzing, Eliane; Ekmekciu, Ira; Bereswill, Stefan; Heimesaat, Markus M

2017-01-01

The rising incidence of multidrug resistant (MDR) Gram-negative bacteria including Pseudomonas aeruginosa has become a serious issue in prevention of its spread particularly among hospitalized patients. It is, however, unclear whether distinct conditions such as acute intestinal inflammation facilitate P. aeruginosa infection of vertebrate hosts. To address this, we analysed P. aeruginosa infection in human microbiota-associated (hma) mice with acute ileitis induced by peroral Toxoplasma gondii challenge. When perorally infected with P. aeruginosa at day 3 post ileitis induction, hma mice displayed higher intestinal P. aeruginosa loads as compared to hma mice without ileitis. However, the overall intestinal microbiota composition was not disturbed by P. aeruginosa (except for lowered bifidobacterial populations), and the infection did not further enhance ileal immune cell responses. Pro-inflammatory cytokines including IFN-γ and IL-12p70 were similarly increased in ileum and mesenteric lymph nodes of P. aeruginosa infected and uninfected hma mice with ileitis. The anti-inflammatory cytokine IL-10 increased multifold upon ileitis induction, but interestingly more distinctly in P. aeruginosa infected as compared to uninfected controls. Immune responses were not restricted to the intestines as indicated by elevated pro-inflammatory cytokine levels in liver and kidney upon ileitis induction. However, except for hepatic TNF-α levels, P. aeruginosa infection did not result in more distinct pro-inflammatory cytokine secretion in liver and kidney of hma mice with ileitis. Whereas viable intestinal bacteria were more frequently detected in systemic compartments such as spleen and cardiac blood of P. aeruginosa infected than uninfected mice at day 7 following ileitis induction, P. aeruginosa infection did not exacerbate systemic pro-inflammatory sequelae, but resulted in lower IL-10 serum levels. Acute intestinal inflammation facilitates infection of the vertebrate host

Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy.

PubMed Central

Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.

1981-01-01

The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382

[Nosocomial infection caused by Pseudomonas aeruginosa in intensive care unit].

PubMed

Wu, Yu-Qi; Shan, Hong-Wei; Zhao, Xian-Yu; Yang, Xing-Yi

2011-02-01

To investigate the risk factors of nosocomial infection caused by Pseudomonas aeruginosa in intensive care unit (ICU), in order to provide reference for an effective measure of infection control. A retrospective study of cases of Pseudomonas aeruginosa infection occurring in ICU was made with multivariable Logistic regression analysis. The clinical data of 1 950 cases admitted from January 2002 to December 2006 were found to have nosocomial infection caused by Pseudomonas aeruginosa were analyzed in order to identify its independent risk factors. Sixty-four out of 1 950 patients were found to suffer from nosocomial infection caused by Pseudomonas aeruginosa, the morbidity rate was 3.3%. At the same time, and in the same department, 37 patients suffering from infection caused by Escherichia coli, served as control group. Univariate analysis showed that the risk factors for nosocomial infection caused by Pseudomonas aeruginosa were the use of corticosteroid, unconsciousness or craniocerebral trauma, abdominal surgery, thorax/abdomen drainage tube, mechanical ventilation, and tracheostomy [the use of corticosteroid: odds ratio (OR)=3.364, 95% confidence interval (95%CI) 1.445-7.830; unconsciousness or craniocerebral trauma: OR=4.026, 95%CI 1.545-10.490; abdominal surgery: OR=0.166, 95%CI 0.068-0.403; thorax/abdomen drainage tube: OR=0.350, 95%CI 0.150-0.818; tracheostomy: OR=4.095, 95%CI 1.638-10.740]. Multivariate analysis showed that the independent risk factors of nosocomial infection caused by Pseudomonas aeruginosa in ICU were: the use of corticosteroid and mechanical ventilation [the use of corticosteroid: OR=3.143, 95%CI 1.115-8.856; mechanical ventilation: OR=3.195, 95%CI 1.607-6.353, P<0.05 and P<0.01]. The independent risk factors of nosocomial infection caused by Pseudomonas aeruginosa in ICU are the use of corticosteroid and mechanical ventilation. Measures should be taken to take care of the risk factors in order to prevent nosocomial infection caused by

[Bacterial flora of the conjunctival sac of the horse].

PubMed

Cattabiani, F; Cabassi, E; Allodi, C; Gianelli, F

1976-01-01

The AA. report the results of taxonomic research conducted on the conjunctival sac of 59 horses for identification of the present bacterial flora. In the controlled animals, it was observed, at the level of the considered niche, a community constituted of normal bacterial populations, but not autochtonous in the significance they attributed from DUBOS et al., relative to the characterization of the indigenous microbiota of the intestine. The isolated normal bacterial flora seems to be constituted of: Micrococcus (subgroup 6 of Baird-Parker, M. luteus, Micrococcus spp.) isolated in 49,15% of the samples; Staphylococcus aureus and St. epidermidis (18,64%); Moraxella osloensis, M. phenylpiruvica, M. equi and Moraxella spp. (11,86%); Bacillus cereus (11,86%); Neisseria catarrhalis (8,47%); Streptococcus equi and Str. zooepidemicus (6,77%); Corynebacterium spp. (6,77%) and Acinetobacter lwoffi (5,08%). The AA. have found, besides, a particular group of bacteria of uncertain classification, attributed to the coryneforms and found in 30,50% of the examined horses. So-called transient bacteria taxa have been considered are Streptomyces spp., isolated in the 10,16% of the controlled subjects, Aerococcus viridans and Bacillus spp. found in only one equine.

Nurses’ uniforms: How many bacteria do they carry after one shift?

PubMed Central

Sanon, Marie-Anne; Watkins, Sally

2013-01-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment. PMID:25285235

Nurses' uniforms: How many bacteria do they carry after one shift?

PubMed

Sanon, Marie-Anne; Watkins, Sally

2012-12-01

This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment.

PAMDB: a comprehensive Pseudomonas aeruginosa metabolome database.

PubMed

Huang, Weiliang; Brewer, Luke K; Jones, Jace W; Nguyen, Angela T; Marcu, Ana; Wishart, David S; Oglesby-Sherrouse, Amanda G; Kane, Maureen A; Wilks, Angela

2018-01-04

The Pseudomonas aeruginosaMetabolome Database (PAMDB, http://pseudomonas.umaryland.edu) is a searchable, richly annotated metabolite database specific to P. aeruginosa. P. aeruginosa is a soil organism and significant opportunistic pathogen that adapts to its environment through a versatile energy metabolism network. Furthermore, P. aeruginosa is a model organism for the study of biofilm formation, quorum sensing, and bioremediation processes, each of which are dependent on unique pathways and metabolites. The PAMDB is modelled on the Escherichia coli (ECMDB), yeast (YMDB) and human (HMDB) metabolome databases and contains >4370 metabolites and 938 pathways with links to over 1260 genes and proteins. The database information was compiled from electronic databases, journal articles and mass spectrometry (MS) metabolomic data obtained in our laboratories. For each metabolite entered, we provide detailed compound descriptions, names and synonyms, structural and physiochemical information, nuclear magnetic resonance (NMR) and MS spectra, enzymes and pathway information, as well as gene and protein sequences. The database allows extensive searching via chemical names, structure and molecular weight, together with gene, protein and pathway relationships. The PAMBD and its future iterations will provide a valuable resource to biologists, natural product chemists and clinicians in identifying active compounds, potential biomarkers and clinical diagnostics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Managing Pseudomonas aeruginosa respiratory infections in cystic fibrosis.

PubMed

Langan, Katherine M; Kotsimbos, Tom; Peleg, Anton Y

2015-12-01

The current guidelines and recent clinical research in the management of Pseudomonas aeruginosa respiratory infections in cystic fibrosis (CF) are reviewed. Areas where further research is required will also be highlighted. P. aeruginosa is a key respiratory pathogen in CF. Inhaled tobramycin or colistin is recommended for early eradication to prevent establishment of chronic infection. Other antibiotic options are currently being investigated. The long-term success of eradication strategies is also now being assessed. The use of inhaled antibiotics in the management of chronic P. aeruginosa infection is an area of active investigation. Acute pulmonary exacerbations are still a major cause of morbidity and mortality. Guidelines continue to recommend combination intravenous therapy but further research is required to clarify the advantage of this approach. Multidrug resistance is common and potentially more effective antipseudomonal antibiotics may soon become available. The management of P. aeruginosa respiratory infection in CF remains a challenging area, especially in the setting of multidrug resistance. The role of inhaled antibiotics continues to be expanded. Further research is required in the key areas of eradication and management of chronic infection and acute pulmonary exacerbations to identify those treatments that optimize long-term, clinical benefits.

Draft Genome Sequence of Micrococcus sp. Strain MS-AsIII-49, an Arsenate-Reducing Isolate from Tropical Metal-Rich Sediment

PubMed Central

Costa, Patrícia S.; Tschoeke, Diogo A.; Silva, Bruno S. O.; Thompson, Fabiano; Reis, Mariana P.; Chartone-Souza, Edmar

2015-01-01

Micrococcus sp. strain MS-AsIII-49, which was isolated from a tropical metal-polluted stream sediment in Brazil, has the ability to reduce AsV to AsIII. Analysis of its draft genome revealed 186 contigs with a total size of 2,440,924 bp encoding several metal resistance genes. PMID:25883272

Quorum-sensing inhibition abrogates the deleterious impact of Pseudomonas aeruginosa on airway epithelial repair.

PubMed

Ruffin, Manon; Bilodeau, Claudia; Maillé, Émilie; LaFayette, Shantelle L; McKay, Geoffrey A; Trinh, Nguyen Thu Ngan; Beaudoin, Trevor; Desrosiers, Martin-Yvon; Rousseau, Simon; Nguyen, Dao; Brochiero, Emmanuelle

2016-09-01

Chronic Pseudomonas aeruginosa lung infections are associated with progressive epithelial damage and lung function decline. In addition to its role in tissue injury, the persistent presence of P. aeruginosa-secreted products may also affect epithelial repair ability, raising the need for new antivirulence therapies. The purpose of our study was to better understand the outcomes of P. aeruginosa exoproducts exposure on airway epithelial repair processes to identify a strategy to counteract their deleterious effect. We found that P. aeruginosa exoproducts significantly decreased wound healing, migration, and proliferation rates, and impaired the ability of directional migration of primary non-cystic fibrosis (CF) human airway epithelial cells. Impact of exoproducts was inhibited after mutations in P. aeruginosa genes that encoded for the quorum-sensing (QS) transcriptional regulator, LasR, and the elastase, LasB, whereas impact was restored by LasB induction in ΔlasR mutants. P. aeruginosa purified elastase also induced a significant decrease in non-CF epithelial repair, whereas protease inhibition with phosphoramidon prevented the effect of P. aeruginosa exoproducts. Furthermore, treatment of P. aeruginosa cultures with 4-hydroxy-2,5-dimethyl-3(2H)-furanone, a QS inhibitor, abrogated the negative impact of P. aeruginosa exoproducts on airway epithelial repair. Finally, we confirmed our findings in human airway epithelial cells from patients with CF, a disease featuring P. aeruginosa chronic respiratory infection. These data demonstrate that secreted proteases under the control of the LasR QS system impair airway epithelial repair and that QS inhibitors could be of benefit to counteract the deleterious effect of P. aeruginosa in infected patients.-Ruffin, M., Bilodeau, C., Maillé, É., LaFayette, S. L., McKay, G. A., Trinh, N. T. N., Beaudoin, T., Desrosiers, M.-Y., Rousseau, S., Nguyen, D., Brochiero, E. Quorum-sensing inhibition abrogates the deleterious impact

A Carbon-Neutral Photosynthetic Microbial Fuel Cell Powered by Microcystis aeruginosa.

PubMed

Ma, Meirong; Cao, Limin; Chen, Li; Ying, Xiaofang; Deng, Zongwu

2015-07-01

A photosynthetic microbial fuel cell (m-PMFC) is developed for generating electricity by harnessing solar energy using Microcystis aeruginosa. In this m-PMFC, commensal bacteria can consume the nutrients that Microcystis aeruginosa produces to generate electricity so that no net CO₂production occurs. A b-MFC is constructed to confirm the role of commensal bacteria in electric generation. An s-PMFC is constructed to confirm the contribution of Microcystis aeruginosa as substrates. The power outputs of m-PMFCs exhibit no significant difference in terms of different inoculation amount of Microcystis aeruginosa or light/dark cycles. The power density of m-PMFC exhibits similar response to bubbling of N₂and O₂as that of b-MFC, as confirmed by cyclic voltammetry analysis of m-PMFC and b-MFC. Scanning electron microscope images demonstrate that the biofilm of m-PMFC consists mainly of commensal bacteria. These results suggest that commensal bacteria act as the main biocatalysts and Microcystis aeruginosa as the anode substrates in the m-PMFC.

Draft Genome Sequences of Pseudomonas aeruginosa Isolates from Wounded Military Personnel.

PubMed

Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A

2016-08-11

Pseudomonas aeruginosa, a Gram-negative bacterium that causes severe hospital-acquired infections, is grouped as an ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) pathogen because of its extensive drug resistance phenotypes and effects on human health worldwide. Five multidrug resistant P. aeruginosa strains isolated from wounded military personnel were sequenced and annotated in this work. Copyright © 2016 Arivett et al.

Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence

PubMed Central

Moradali, M. Fata; Ghods, Shirin; Rehm, Bernd H. A.

2017-01-01

Pseudomonas aeruginosa is an opportunistic pathogen affecting immunocompromised patients. It is known as the leading cause of morbidity and mortality in cystic fibrosis (CF) patients and as one of the leading causes of nosocomial infections. Due to a range of mechanisms for adaptation, survival and resistance to multiple classes of antibiotics, infections by P. aeruginosa strains can be life-threatening and it is emerging worldwide as public health threat. This review highlights the diversity of mechanisms by which P. aeruginosa promotes its survival and persistence in various environments and particularly at different stages of pathogenesis. We will review the importance and complexity of regulatory networks and genotypic-phenotypic variations known as adaptive radiation by which P. aeruginosa adjusts physiological processes for adaptation and survival in response to environmental cues and stresses. Accordingly, we will review the central regulatory role of quorum sensing and signaling systems by nucleotide-based second messengers resulting in different lifestyles of P. aeruginosa. Furthermore, various regulatory proteins will be discussed which form a plethora of controlling systems acting at transcriptional level for timely expression of genes enabling rapid responses to external stimuli and unfavorable conditions. Antibiotic resistance is a natural trait for P. aeruginosa and multiple mechanisms underlying different forms of antibiotic resistance will be discussed here. The importance of each mechanism in conferring resistance to various antipseudomonal antibiotics and their prevalence in clinical strains will be described. The underlying principles for acquiring resistance leading pan-drug resistant strains will be summarized. A future outlook emphasizes the need for collaborative international multidisciplinary efforts to translate current knowledge into strategies to prevent and treat P. aeruginosa infections while reducing the rate of antibiotic resistance

Effect of novel antibacterial gallium-carboxymethyl cellulose on Pseudomonas aeruginosa.

PubMed

Valappil, Sabeel P; Yiu, Humphrey H P; Bouffier, Laurent; Hope, Christopher K; Evans, Gary; Claridge, John B; Higham, Susan M; Rosseinsky, Matthew J

2013-02-07

Gallium has emerged as a new therapeutic agent due partly to the scarcity in development of new antibiotics. In this study, a novel antibacterial gallium exchanged carboxymethyl cellulose (Ga-CMC) has been developed and tested for the susceptibility on a common bacteria, Pseudomonas aeruginosa. The results show that an increase in average molecular weight (MW) from 90 k, 250 k to 700 k of Ga-CMC caused a decrease in antimicrobial activity against planktonic P. aeruginosa. Gallium loading of the Ga-CMC (250 k) samples was altered by varying the amount of functionality (0.7, 0.9 and 1.2 acid groups per mole of carbohydrate) which affected also its antimicrobial activity against planktonic P. aeruginosa. Further, the ability to prevent the growth of biofilms of P. aeruginosa was tested on MW = 250 k samples with 0.9 acid groups per mole of carbohydrate as this sample showed the most promising activity against planktonic P. aeruginosa. Gallium was found to reduce biofilm growth of P. aeruginosa with a maximum effect (0.85 log(10) CFU reduction compared to sodium-carboxymethyl cellulose, Na-CMC) after 24 h. Results of the solubility and ion exchange studies show that this compound is suitable for the controlled release of Ga(3+) upon their breakdown in the presence of bacteria. SEM EDX analysis confirmed that Ga(3+) ions are evenly exchanged on the cellulose surface and systematic controls were carried out to ensure that antibacterial activity is solely due to the presence of gallium as samples intrinsic acidity or nature of counterion did not affect the activity. The results presented here highlight that Ga-CMC may be useful in controlled drug delivery applications, to deliver gallium ions in order to prevent infections due to P. aeruginosa biofilms.

The influence of abscisic acid on the ethylene biosynthesis pathway in the functioning of the flower abscission zone in Lupinus luteus.

PubMed

Wilmowicz, Emilia; Frankowski, Kamil; Kućko, Agata; Świdziński, Michał; de Dios Alché, Juan; Nowakowska, Anna; Kopcewicz, Jan

2016-11-01

Flower abscission is a highly regulated developmental process activated in response to exogenous (e.g. changing environmental conditions) and endogenous stimuli (e.g. phytohormones). Ethylene (ET) and abscisic acid (ABA) are very effective stimulators of flower abortion in Lupinus luteus, which is a widely cultivated species in Poland, Australia and Mediterranean countries. In this paper, we show that artificial activation of abscission by flower removal caused an accumulation of ABA in the abscission zone (AZ). Moreover, the blocking of that phytohormone's biosynthesis by NDGA (nordihydroguaiaretic acid) decreased the number of abscised flowers. However, the application of NBD - an inhibitor of ET action - reversed the stimulatory effect of ABA on flower abscission, indicating that ABA itself is not sufficient to turn on the organ separation. Our analysis revealed that exogenous ABA significantly accelerated the transcriptional activity of the ET biosynthesis genes ACC synthase (LlACS) and oxidase (LlACO), and moreover, strongly increased the level of 1-aminocyclopropane-1-carboxylic acid (ACC) - ET precursor, which was specifically localized within AZ cells. We cannot exclude the possibility that ABA mediates flower abscission processes by enhancing the ET biosynthesis rate. The findings of our study will contribute to the overall basic knowledge on the phytohormone-regulated generative organs abscission in L. luteus. Copyright © 2016 Elsevier GmbH. All rights reserved.

Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2'-bipyridyl, lipoic, kojic and picolinic acids.

PubMed

Çevik, Kübra; Ulusoy, Seyhan

2015-08-01

The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. The inhibitory activity of 2,2'-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation.

Characterization of the Membrane-Bound Succinic Dehydrogenase of Micrococcus lysodeikticus

PubMed Central

Pollock, Jerry J.; Linder, Regina; Salton, Milton R. J.

1971-01-01

The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 × g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca2+ and Mg2+ exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents. Images PMID:4327510

Composition of Asarum heterotropoides var. mandshuricum radix oil from different extraction methods and activities against human body odor-producing bacteria.

PubMed

Haque, A S M Tanbirul; Moon, Jin Nam; Saravana, P S; Tilahun, Adane; Chun, Byung-Soo

2016-10-01

In this study, oils from Asarum heterotropoides were extracted by traditional solvent extraction and supercritical CO 2 (SC-CO 2 ) extraction methods and their antioxidant activities along with antimicrobial and inhibitory activities against five human body odor-producing bacteria (Staphylococcus epidermidis, Propionibacterium freudenreichii, Micrococcus luteus, Corynebacterium jeikeium, and Corynebacterium xerosis) were evaluated. The oil was found to contain 15 components, among which the most abundant component was methyl eugenol (37.6%), which was identified at every condition studied in different extraction methods. The oil extracted with n-hexane and ethanol mixture exhibited a strong antioxidant activity (92% ± 2%) and the highest ABTS and 2,2-diphenyl-1-picrylhydrazyl scavenging activities (89% ± 0.2%). The highest amounts of total phenolic content and total flavonoid content were 23.1±0.4 mg/g and 4.9±0.1 mg/g, respectively, in the traditional method. In the SC-CO 2 method performed at 200 bar/50°C using ethanol as an entrainer, the highest inhibition zone was recorded against all the aforementioned bacteria. In particular, strong antibacterial activity (38±2 mm) was found against M. luteus. The minimum inhibitory concentration (MIC) for the oil against bacteria ranged from 10.1±0.1 μg/mL to 46±2 μg/mL. The lowest MIC was found against M. luteus. Methyl eugenol was found to be one of the major compounds working against human body odor-producing bacteria. Copyright © 2016. Published by Elsevier B.V.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

PubMed

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Relative Roles of the Cellular and Humoral Responses in the Drosophila Host Defense against Three Gram-Positive Bacterial Infections

PubMed Central

Cho, Ju Hyun; Lee, Janice; Lafarge, Marie-Céline; Kocks, Christine; Ferrandon, Dominique

2011-01-01

Background Two NF-kappaB signaling pathways, Toll and immune deficiency (imd), are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense. Methodology/Principal Findings In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different Gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus), we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival – independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response. Conclusions/Significance Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen. PMID:21390224

Bacterial Coaggregation and Cohesion Among Isolates From Contact Lens Cases.

PubMed

Datta, Ananya; Stapleton, Fiona; Willcox, Mark D P

2018-06-01

The aim of this study was to examine cohesion, coaggregation, and coculture between bacteria commonly isolated from contact lens cases. Staphylococcus epidermidis, Staphylococcus haemolyticus, Micrococcus luteus, and Acinetobacter radioresistens (two strains each) isolated from contact lens cases of two asymptomatic wearers were used in this study. In the cohesion assay, bacteria were grown, washed, and examined by incubating lens cases with two different types of bacteria sequentially and assessing the number of adhered cells of each isolate. The ability of isolates to interfere with the growth of other isolates was tested by growing strains in cocultures for 24 hours and determining the numbers of cells of individual strains. For coaggregation, equal proportions of two bacterial suspensions were mixed and allowed to coaggregate for 24 hours. Inhibition of coaggregation was tested by the addition of lactose (0.06 M) or sucrose (0.06 M) or pronase. The initial adhesion of M. luteus or A. radioresistens significantly (P < 0.05) enhanced the subsequent adhesion of the staphylococci. The addition of A. radioresistens in liquid media significantly (P < 0.05) enhanced the growth of staphylococci. S. epidermidis or S. haemolyticus coaggregated with M. luteus or A. radioresistens. The degree of coaggregation varied between 30% and 54%. The highest coaggregation (54% ± 5%) was seen between A. radioresistens 22-1 and S. epidermidis 22-1, isolated from the same lens case. Only lactose or sucrose treatment of staphylococci could partly inhibit coaggregation of some pairs. Coaggregation, cohesion, and growth promotion may facilitate the process of bacterial colonization of contact lens cases.

Establishing the diagnosis of chronic colonization with Pseudomonas aeruginosa of cystic fibrosis patients: Comparison of the European consensus criteria with genotyping of P. aeruginosa isolates.

PubMed

Jonckheere, Leander; Schelstraete, Petra; Van Simaey, Leen; Van Braeckel, Eva; Willekens, Julie; Van Daele, Sabine; De Baets, Frans; Vaneechoutte, Mario

2018-04-11

After antibiotic eradication treatment for a first ever Pseudomonas aeruginosa isolation, the European consensus criteria (ECC) are widely used to assess colonization status with P. aeruginosa in CF-patients. We evaluated to what extent genotyping (GT) of subsequent P. aeruginosa isolates could predict/assess chronic colonization (CC), in comparison with the ECC. Over a 14-year period, sputa were cultured from 80 CF-patients (age range: 2-51 years), from a first ever isolation of P. aeruginosa onwards. Patients with a positive culture for P. aeruginosa received antibiotic eradication treatment. For the 40 patients for whom three or more P. aeruginosa isolates were available, these isolates were genotyped. According to the ECC, 27 out of the 40 patients (67.5%) became CC during the study period (ECC-positive patients). Genotyping confirmed persistence of the same genotype for 25 of these ECC-positive patients. Genotyping indicated persistence of the same genotype for at least two subsequent isolates for 5 out of 13 ECC-negative patients. Culture-positivity characteristics of the 27 ECC-positive patients corresponded well to those of the 30 GT-positive patients, with an overall higher number of positive cultures as well as a shorter interval in between first and second isolate compared to ECC-negative and GT-negative patients. Genotyping indicated persistence of the same genotype on average 9.3 months earlier than CC according to the ECC (P < 0.01). Genotyping of P. aeruginosa isolates confirmed CC for 25 out of 27 ECC-positive patients (92.6% specificity) and predicted CC 9.3 months earlier than the ECC. Copyright © 2018 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

The Effect of Strict Segregation on Pseudomonas aeruginosa in Cystic Fibrosis Patients

PubMed Central

van Mansfeld, Rosa; de Vrankrijker, Angelica; Brimicombe, Roland; Heijerman, Harry; Teding van Berkhout, Ferdinand; Spitoni, Cristian; Grave, Sanne; van der Ent, Cornelis; Wolfs, Tom; Willems, Rob; Bonten, Marc

2016-01-01

Introduction Segregation of patients with cystic fibrosis (CF) was implemented to prevent chronic infection with epidemic Pseudomonas aeruginosa strains with presumed detrimental clinical effects, but its effectiveness has not been carefully evaluated. Methods The effect of strict segregation on the incidence of P. aeruginosa infection in CF patients was investigated through longitudinal protocolized follow-up of respiratory tract infection before and after segregation. In two nested cross-sectional studies in 2007 and 2011 the P. aeruginosa population structure was investigated and clinical parameters were determined in patients with and without infection with the Dutch epidemic P. aeruginosa clone (ST406). Results Of 784 included patients 315 and 382 were at risk for acquiring chronic P. aeruginosa infection before and after segregation. Acquisition rates were, respectively, 0.14 and 0.05 per 1,000 days at risk (HR: 0.66, 95% CI [0.2548–1.541]; p = 0.28). An exploratory subgroup analysis indicated lower acquisition after segregation in children < 15 years of age (HR: 0.43, 95% CI[0.21–0.95]; p = 0.04). P. aeruginosa population structure did not change after segregation and ST406 was not associated with lung function decline, death or lung transplantation. Conclusions Strict segregation was not associated with a statistically significant lower acquisition of chronic P. aeruginosa infection and ST406 was not associated with adverse clinical outcome. After segregation there were no new acquisitions of ST406. In an unplanned exploratory analysis chronic acquisition of P. aeruginosa was lower after implementation of segregation in patients under 15 years of age. PMID:27280467

Pseudomonas aeruginosa isolates in severe chronic obstructive pulmonary disease: characterization and risk factors

PubMed Central

2014-01-01

Background Patients with severe chronic obstructive pulmonary disease (COPD) are at increased risk of infection by P. aeruginosa. The specific role of bronchiectasis in both infection and chronic colonization by this microorganism in COPD, however, remains ill defined. To evaluate the prevalence and risk factors for P. aeruginosa recovery from sputum in outpatients with severe COPD, characterizing P. aeruginosa isolates by pulsed-field gel electrophoresis (PFGE) and focusing on the influence of bronchiectasis on chronic colonization in these patients. Methods A case-cohort study of 118 patients with severe COPD attended at a Respiratory Day Unit for an acute infectious exacerbation and followed up over one year. High-resolution CT scans were performed during stability for bronchiectasis assessment and sputum cultures were obtained during exacerbation and stability in all patients. P. aeruginosa isolates were genotyped by PFGE. Determinants of the recovery of P. aeruginosa in sputum and chronic colonization by this microorganism were assessed by multivariate analysis. Results P. aeruginosa was isolated from 41 of the 118 patients studied (34.7%). Five of these 41 patients (12.2%) with P. aeruginosa recovery fulfilled criteria for chronic colonization. In the multivariate analysis, the extent of bronchiectasis (OR 9.8, 95% CI: 1.7 to 54.8) and the number of antibiotic courses (OR 1.7, 95% CI: 1.1 to 2.5) were independently associated with an increased risk of P. aeruginosa isolation. Chronic colonization was unrelated to the presence of bronchiectasis (p=0.75). In patients with chronic colonization the isolates of P. aeruginosa retrieved corresponded to the same clones during the follow-up, and most of the multidrug resistant isolates (19/21) were harbored by these patients. Conclusions The main risk factors for P. aeruginosa isolation in severe COPD were the extent of bronchiectasis and exposure to antibiotics. Over 10% of these patients fulfilled criteria for

Optimization of culture conditions and medium composition for the production of micrococcin GO5 by Micrococcus sp. GO5.

PubMed

Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

2006-01-02

To enhance the production of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5, cultivation conditions and medium composition were optimized. The optimal initial pH and temperature for bacteriocin production were 7.0-9.0 and 37 degrees C, respectively. Micrococcus sp. GO5 displayed the highest micrococcin GO5 activity when grown in modified MRS medium that contained lactose or sucrose, rather than glucose, as a carbon source. The maximum bacteriocin activity was obtained in modified MRS medium containing 0.5% tryptone and 1.0% yeast extract as nitrogen sources instead of the other nitrogen sources present in MRS medium. Bacteriocin production was greatly affected by the concentration of K(2)HPO(4); strain GO5 produced eight-fold more bacteriocin in medium containing 2.0-2.5% K(2)HPO(4) than in medium containing 0.2% K(2)HPO(4). The optimal concentration of MgSO(4).7H(2)O for bacteriocin production was 0.5%. The production of micrococcin GO5 was increased 32-fold in shake flask culture and 16-fold in a bioreactor using the optimized medium (TY medium), compared with culturing in MRS medium.

Reduction of virulence factor pyocyanin production in multidrug-resistant Pseudomonas aeruginosa.

PubMed

Fuse, Katsuhiro; Fujimura, Shigeru; Kikuchi, Toshiaki; Gomi, Kazunori; Iida, Yasuhiro; Nukiwa, Toshihiro; Watanabe, Akira

2013-02-01

Nosocomial infections caused by metallo-β-lactamase (MBL)-producing multidrug-resistant (MDR) Pseudomonas aeruginosa have become a worldwide problem. Pyocyanin, a representative pigment produced by P. aeruginosa, is the major virulence factor of this organismThe aim of this study was to investigate the pyocyanin-producing ability of MBL-producing MDR P. aeruginosa. A total of 50 clinical isolates of P. aeruginosa, including 20 MDR strains, were collected at 18 general hospitals in Japan. The chromaticity and luminosity produced by pyocyanin in each isolate were measured. The quantity of pyocyanin and the expression of the phzM and phzS genes coding a pyocyanin synthesis enzyme were measured. MDR strains showed a bright yellow-green, while non-MDR strains tended to show a dark blue-green. The quantities of pyocyanin in MBL-producing strains and non-producing strains were 0.015 ± 0.002 and 0.41 ± 0.10 μg, respectively. The expression of the phzM and phzS genes in the MDR strains was 11 and 14 %, respectively, of the expression in the non-MDR strains. When the MBL gene was transduced into P. aeruginosa and it acquired multidrug resistance, it was shown that the pyocyanin-producing ability decreased. The pathogenicity of MBL-producing MDR P. aeruginosa may be lower than that of non-MDR strains. These MBL-producing MDR strains may be less pathogenic than non-MDR strains. This may explain why MDR-P. aeruginosa is unlikely to cause infection but, rather, causes subclinical colonization only.

Candida albicans Inhibits Pseudomonas aeruginosa Virulence through Suppression of Pyochelin and Pyoverdine Biosynthesis

PubMed Central

Lopez-Medina, Eduardo; Fan, Di; Coughlin, Laura A.; Ho, Evi X.; Lamont, Iain L.; Reimmann, Cornelia; Hooper, Lora V.; Koh, Andrew Y.

2015-01-01

Bacterial-fungal interactions have important physiologic and medical ramifications, but the mechanisms of these interactions are poorly understood. The gut is host to trillions of microorganisms, and bacterial-fungal interactions are likely to be important. Using a neutropenic mouse model of microbial gastrointestinal colonization and dissemination, we show that the fungus Candida albicans inhibits the virulence of the bacterium Pseudomonas aeruginosa by inhibiting P. aeruginosa pyochelin and pyoverdine gene expression, which plays a critical role in iron acquisition and virulence. Accordingly, deletion of both P. aeruginosa pyochelin and pyoverdine genes attenuates P. aeruginosa virulence. Heat-killed C. albicans has no effect on P. aeruginosa, whereas C. albicans secreted proteins directly suppress P. aeruginosa pyoverdine and pyochelin expression and inhibit P. aeruginosa virulence in mice. Interestingly, suppression or deletion of pyochelin and pyoverdine genes has no effect on P. aeruginosa’s ability to colonize the GI tract but does decrease P. aeruginosa’s cytotoxic effect on cultured colonocytes. Finally, oral iron supplementation restores P. aeruginosa virulence in P. aeruginosa and C. albicans colonized mice. Together, our findings provide insight into how a bacterial-fungal interaction can modulate bacterial virulence in the intestine. Previously described bacterial-fungal antagonistic interactions have focused on growth inhibition or colonization inhibition/modulation, yet here we describe a novel observation of fungal-inhibition of bacterial effectors critical for virulence but not important for colonization. These findings validate the use of a mammalian model system to explore the complexities of polymicrobial, polykingdom infections in order to identify new therapeutic targets for preventing microbial disease. PMID:26313907

Pseudomonas aeruginosa keratitis: outcomes and response to corticosteroid treatment.

PubMed

Sy, Aileen; Srinivasan, Muthiah; Mascarenhas, Jeena; Lalitha, Prajna; Rajaraman, Revathi; Ravindran, Meenakshi; Oldenburg, Catherine E; Ray, Kathryn J; Glidden, David; Zegans, Michael E; McLeod, Stephen D; Lietman, Thomas M; Acharya, Nisha R

2012-01-25

To compare the clinical course and effect of adjunctive corticosteroid therapy in Pseudomonas aeruginosa with those of all other strains of bacterial keratitis. Subanalyses were performed on data collected in the Steroids for Corneal Ulcers Trial (SCUT), a large randomized controlled trial in which patients were treated with moxifloxacin and were randomly assigned to 1 of 2 adjunctive treatment arms: corticosteroid or placebo (4 times a day with subsequent reduction). Multivariate analysis was used to determine the effect of predictors, organism, and treatment on outcomes, 3-month best-spectacle-corrected visual acuity (BSCVA), and infiltrate/scar size. The incidence of adverse events over a 3-month follow-up period was compared using Fisher's exact test. SCUT enrolled 500 patients. One hundred ten patients had P. aeruginosa ulcers; 99 of 110 (90%) enrolled patients returned for follow-up at 3 months. Patients with P. aeruginosa ulcers had significantly worse visual acuities than patients with other bacterial ulcers (P = 0.001) but showed significantly more improvement in 3-month BSCVA than those with other bacterial ulcers, adjusting for baseline characteristics (-0.14 logMAR; 95% confidence interval, -0.23 to -0.04; P = 0.004). There was no significant difference in adverse events between P. aeruginosa and other bacterial ulcers. There were no significant differences in BSCVA (P = 0.69), infiltrate/scar size (P = 0.17), and incidence of adverse events between patients with P. aeruginosa ulcers treated with adjunctive corticosteroids and patients given placebo. Although P. aeruginosa corneal ulcers have a more severe presentation, they appear to respond better to treatment than other bacterial ulcers. The authors did not find a significant benefit with corticosteroid treatment, but they also did not find any increase in adverse events. (ClinicalTrials.gov number, NCT00324168.).

Pseudomonas aeruginosa Keratitis: Outcomes and Response to Corticosteroid Treatment

PubMed Central

Sy, Aileen; Srinivasan, Muthiah; Mascarenhas, Jeena; Lalitha, Prajna; Rajaraman, Revathi; Ravindran, Meenakshi; Oldenburg, Catherine E.; Ray, Kathryn J.; Glidden, David; Zegans, Michael E.; McLeod, Stephen D.; Lietman, Thomas M.

2012-01-01

Purpose. To compare the clinical course and effect of adjunctive corticosteroid therapy in Pseudomonas aeruginosa with those of all other strains of bacterial keratitis. Methods. Subanalyses were performed on data collected in the Steroids for Corneal Ulcers Trial (SCUT), a large randomized controlled trial in which patients were treated with moxifloxacin and were randomly assigned to 1 of 2 adjunctive treatment arms: corticosteroid or placebo (4 times a day with subsequent reduction). Multivariate analysis was used to determine the effect of predictors, organism, and treatment on outcomes, 3-month best-spectacle-corrected visual acuity (BSCVA), and infiltrate/scar size. The incidence of adverse events over a 3-month follow-up period was compared using Fisher's exact test. Results. SCUT enrolled 500 patients. One hundred ten patients had P. aeruginosa ulcers; 99 of 110 (90%) enrolled patients returned for follow-up at 3 months. Patients with P. aeruginosa ulcers had significantly worse visual acuities than patients with other bacterial ulcers (P = 0.001) but showed significantly more improvement in 3-month BSCVA than those with other bacterial ulcers, adjusting for baseline characteristics (−0.14 logMAR; 95% confidence interval, −0.23 to −0.04; P = 0.004). There was no significant difference in adverse events between P. aeruginosa and other bacterial ulcers. There were no significant differences in BSCVA (P = 0.69), infiltrate/scar size (P = 0.17), and incidence of adverse events between patients with P. aeruginosa ulcers treated with adjunctive corticosteroids and patients given placebo. Conclusions. Although P. aeruginosa corneal ulcers have a more severe presentation, they appear to respond better to treatment than other bacterial ulcers. The authors did not find a significant benefit with corticosteroid treatment, but they also did not find any increase in adverse events. (ClinicalTrials.gov number, NCT00324168.) PMID:22159005

Bispecific antibody targets multiple Pseudomonas aeruginosa evasion mechanisms in the lung vasculature.

PubMed

Thanabalasuriar, Ajitha; Surewaard, Bas Gj; Willson, Michelle E; Neupane, Arpan S; Stover, Charles K; Warrener, Paul; Wilson, George; Keller, Ashley E; Sellman, Bret R; DiGiandomenico, Antonio; Kubes, Paul

2017-06-01

Pseudomonas aeruginosa is a major cause of severe infections that lead to bacteremia and high patient mortality. P. aeruginosa has evolved numerous evasion and subversion mechanisms that work in concert to overcome immune recognition and effector functions in hospitalized and immunosuppressed individuals. Here, we have used multilaser spinning-disk intravital microscopy to monitor the blood-borne stage in a murine bacteremic model of P. aeruginosa infection. P. aeruginosa adhered avidly to lung vasculature, where patrolling neutrophils and other immune cells were virtually blind to the pathogen's presence. This cloaking phenomenon was attributed to expression of Psl exopolysaccharide. Although an anti-Psl mAb activated complement and enhanced neutrophil recognition of P. aeruginosa, neutrophil-mediated clearance of the pathogen was suboptimal owing to a second subversion mechanism, namely the type 3 secretion (T3S) injectisome. Indeed, T3S prevented phagosome acidification and resisted killing inside these compartments. Antibody-mediated inhibition of the T3S protein PcrV did not enhance bacterial phagocytosis but did enhance killing of the few bacteria ingested by neutrophils. A bispecific mAb targeting both Psl and PcrV enhanced neutrophil uptake of P. aeruginosa and also greatly increased inhibition of T3S function, allowing for phagosome acidification and bacterial killing. These data highlight the need to block multiple evasion and subversion mechanisms in tandem to kill P. aeruginosa.

Isolation of an iron-binding compound from Pseudomonas aeruginosa.

PubMed Central

Cox, C D; Graham, R

1979-01-01

An iron-binding compound was isolated from ethyl acetate extracts of culture supernatant fluids of Pseudomonas aeruginosa and was purified by successive paper and thin-layer chromatographic procedures. The purified compound was characterized by UV, visible, infrared, and fluorescence spectroscopy. The compound possesses phenolic characteristics, with little or no similarity to dihydroxybenzoates and no indication of a hydroxamate group. P. aeruginosa synthesized the compound during active growth in culture media containing less than 5 X 10(-6) M added FeCl3. When added to iron-poor cultures of P. aeruginosa, the compound promoted the growth of the bacterium and also reversed growth inhibition by the iron chelator ethylenediamine-di-(o-hydroxyphenylacetic acid). PMID:104968

Activation of the lectin pathway of complement in experimental human keratitis with Pseudomonas aeruginosa.

PubMed

Osthoff, Michael; Brown, Karl D; Kong, David C M; Daniell, Mark; Eisen, Damon P

2014-01-01

Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT-PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed.

Activation of the lectin pathway of complement in experimental human keratitis with Pseudomonas aeruginosa

PubMed Central

Osthoff, Michael; Brown, Karl D.; Kong, David C.M.; Daniell, Mark

2014-01-01

Purpose Pseudomonas aeruginosa (P. aeruginosa) microbial keratitis (MK) is a sight-threatening disease. Previous animal studies have identified an important contribution of the complement system to the clearance of P. aeruginosa infection of the cornea. Mannose-binding lectin (MBL), a pattern recognition receptor of the lectin pathway of complement, has been implicated in the host defense against P. aeruginosa. However, studies addressing the role of the lectin pathway in P. aeruginosa MK are lacking. Hence, we sought to determine the activity of the lectin pathway in human MK caused by P. aeruginosa. Methods Primary human corneal epithelial cells (HCECs) from cadaveric donors were exposed to two different P. aeruginosa strains. Gene expression of interleukin (IL)-6, IL-8, MBL, and other complement proteins was determined by reverse transcription-polymerase chain reaction (RT–PCR) and MBL synthesis by enzyme-linked immunosorbent assay and intracellular flow cytometry. Results MBL gene expression was not detected in unchallenged HCECs. Exposure of HCECs to P. aeruginosa resulted in rapid induction of the transcriptional expression of MBL, IL-6, and IL-8. In addition, expression of several complement proteins of the classical and lectin pathways, but not the alternative pathway, were upregulated after 5 h of challenge, including MBL-associated serine protease 1. However, MBL protein secretion was not detectable 18 h after challenge with P. aeruginosa. Conclusions MK due to P. aeruginosa triggers activation of MBL and the lectin pathway of complement. However, the physiologic relevance of this finding is unclear, as corresponding MBL oligomer production was not observed. PMID:24426774

Physiological effects of the herbicide glyphosate on the cyanobacterium Microcystis aeruginosa.

PubMed

Wu, Liang; Qiu, Zhihao; Zhou, Ya; Du, Yuping; Liu, Chaonan; Ye, Jing; Hu, Xiaojun

2016-09-01

Glyphosate has been used extensively for weed control in agriculture in many countries. However, glyphosate can be transported into the aquatic environment and might cause adverse effects on aquatic life. This study investigated the physiological characteristics of cyanobacteria Microcystis aeruginosa (M. aeruginosa) after exposure to glyphosate, and the results showed that changes in cell density production, chlorophyll a and protein content are consistent. In M. aeruginosa, oxidative stress caused by glyphosate indicated that 48h of exposure increased the concentration of malondialdehyde (MDA) and enhanced the activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD). To further investigate the toxicity of glyphosate on M. aeruginosa, the viability of treated cells was monitored and the toxin release was determined. The results indicated that glyphosate induced apoptosis of and triggered toxin release in M. aeruginosa. These results are helpful for understanding the toxic effects of glyphosate on cyanobacteria, which is important for environmental assessment and protection. These results are also useful for guidance on the application of this type of herbicide in agricultural settings. Copyright © 2016 Elsevier B.V. All rights reserved.

Inhibition of Biofilm Formation by Esomeprazole in Pseudomonas aeruginosa and Staphylococcus aureus

PubMed Central

Singh, Vandana; Arora, Vaneet; Alam, M. Jahangir

2012-01-01

Staphylococcus aureus and Pseudomonas aeruginosa are common nosocomial pathogens responsible for biofilm-associated infections. Proton pump inhibitors (PPI), such as esomeprazole, may have novel antimicrobial properties. The objective of this study was to assess whether esomeprazole prevents sessile bacterial growth and biofilm formation and whether it may have synergistic killing effects with standard antibiotics. The antibiofilm activity of esomeprazole at 0.25 mM was tested against two strains each of S. aureus and P. aeruginosa. Bacterial biofilms were prepared using a commercially available 96-peg-plate Calgary biofilm device. Sessile bacterial CFU counts and biomass were assessed during 72 hours of esomeprazole exposure. The killing activities after an additional 24 hours of vancomycin (against S. aureus) and meropenem (against P. aeruginosa) treatment with or without preexposure to esomeprazole were also assessed by CFU and biomass analyses. P. aeruginosa and S. aureus strains exposed to esomeprazole displayed decreased sessile bacterial growth and biomass (P < 0.001, each parameter). After 72 h of exposure, there was a 1-log10 decrease in the CFU/ml of esomeprazole-exposed P. aeruginosa and S. aureus strains compared to controls (P < 0.001). After 72 h of exposure, measured absorbance was 100% greater in P. aeruginosa control strains than in esomeprazole-exposed strains (P < 0.001). Increased killing and decreased biomass were observed for esomeprazole-treated bacteria compared to untreated controls exposed to conventional antibiotics (P < 0.001, each parameter). Reduced biofilm growth after 24 h was visibly apparent by light micrographs for P. aeruginosa and S. aureus isolates exposed to esomeprazole compared to untreated controls. In conclusion, esomeprazole demonstrated an antibiofilm effect against biofilm-producing S. aureus and P. aeruginosa. PMID:22664967

A network biology approach to denitrification in Pseudomonas aeruginosa

DOE PAGES

Arat, Seda; Bullerjahn, George S.; Laubenbacher, Reinhard

2015-02-23

Pseudomonas aeruginosa is a metabolically flexible member of the Gammaproteobacteria. Under anaerobic conditions and the presence of nitrate, P. aeruginosa can perform (complete) denitrification, a respiratory process of dissimilatory nitrate reduction to nitrogen gas via nitrite (NO₂), nitric oxide (NO) and nitrous oxide (N₂O). This study focuses on understanding the influence of environmental conditions on bacterial denitrification performance, using a mathematical model of a metabolic network in P. aeruginosa. To our knowledge, this is the first mathematical model of denitrification for this bacterium. Analysis of the long-term behavior of the network under changing concentration levels of oxygen (O₂), nitrate (NO₃),more » and phosphate (PO₄) suggests that PO₄ concentration strongly affects denitrification performance. The model provides three predictions on denitrification activity of P. aeruginosa under various environmental conditions, and these predictions are either experimentally validated or supported by pertinent biological literature. One motivation for this study is to capture the effect of PO₄ on a denitrification metabolic network of P. aeruginosa in order to shed light on mechanisms for greenhouse gas N₂O accumulation during seasonal oxygen depletion in aquatic environments such as Lake Erie (Laurentian Great Lakes, USA). Simulating the microbial production of greenhouse gases in anaerobic aquatic systems such as Lake Erie allows a deeper understanding of the contributing environmental effects that will inform studies on, and remediation strategies for, other hypoxic sites worldwide.« less

Arsenate biotransformation by Microcystis aeruginosa under different nitrogen and phosphorus levels.

PubMed

Che, Feifei; Du, Miaomiao; Yan, Changzhou

2018-04-01

The arsenate (As(V)) biotransformation by Microcystis aeruginosa in a medium with different concentrations of nitrogen (N) and phosphorus (P) has been studied under laboratory conditions. When 15μg/L As(V) was added, N and P in the medium showed effective regulation on arsenic (As) metabolism in M. aeruginosa, resulting in significant differences in the algal growth among different N and P treatments. Under 0.2mg/L P treatment, increases in N concentration (4-20mg/L) significantly stimulated the cell growth and therefore indirectly enhanced the production of dimethylarsinic acid (DMA), the main As metabolite, accounting for 71%-79% of the total As in the medium. Meanwhile, 10-20mg/L N treatments accelerated the ability of As metabolization by M. aeruginosa, leading to higher contents of DMA per cell. However, As(V) uptake by M. aeruginosa was significantly impeded by 0.5-1.0mg/L P treatment, resulting in smaller rates of As transformation in M. aeruginosa as well as lower contents of As metabolites in the medium. Our data demonstrated that As(V) transformation by M. aeruginosa was significantly accelerated by increasing N levels, while it was inhibited by increasing P levels. Overall, both P and N play key roles in As(V) biotransformation processes. Copyright © 2017. Published by Elsevier B.V.

Pseudomonas aeruginosa uses T3SS to inhibit diabetic wound healing

PubMed Central

Goldufsky, Josef; Wood, Stephen J.; Jayaraman, Vijayakumar; Majdobeh, Omar; Chen, Lin; Qin, Shanshan; Zhang, Chunxiang; DiPietro, Luisa A.; Shafikhani, Sasha H.

2015-01-01

Diabetic foot ulcers are responsible for more hospitalizations than any other complication of diabetes. Bacterial infection is recognized as an important factor associated with impaired healing in diabetic ulcers. Pseudomonas aeruginosa is the most frequently detected Gram-negative pathogen in diabetic ulcers. P. aeruginosa infection has been shown to impair healing in diabetic wounds in a manner that correlates with its ability to form biofilm. While the majority of infections in diabetic ulcers are biofilm associated, 33% of infections are nonbiofilm in nature. P. aeruginosa is the most prevalent Gram-negative pathogen in all diabetic wound types, which suggests that the deleterious impact of P. aeruginosa on healing in diabetic wounds goes beyond its ability to form biofilm and likely involves other factors. The Type III Secretion System (T3SS) virulence structure is required for the pathogenesis of all P. aeruginosa clinical isolates, suggesting that it may also play a role in the inhibition of wound repair in diabetic skin ulcers. We evaluated the role of T3SS in mediating P. aeruginosa–induced tissue damage in the wounds of diabetic mice. Our data demonstrate that P. aeruginosa establishes a robust and persistent infection in diabetic wounds independent of its ability to form biofilm and causes severe wound damage in a manner that primarily depends on its T3SS. PMID:25912785

Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa in a Healthcare Setting in Alexandria, Egypt.

PubMed

Abaza, Amani F; El Shazly, Soraya A; Selim, Heba S A; Aly, Gehan S A

2017-09-27

Pseudomonas aeruginosa has emerged as a major healthcare associated pathogen that creates a serious public health disaster in both developing and developed countries. In this work we aimed at studying the occurrence of metallo-beta-lactamase (MBL) producing P. aeruginosa in a healthcare setting in Alexandria, Egypt. This cross sectional study included 1583 clinical samples that were collected from patients admitted to Alexandria University Students' Hospital. P. aeruginosa isolates were identified using standard microbiological methods and were tested for their antimicrobial susceptibility patterns using single disc diffusion method according to the Clinical and Laboratory Standards Institute recommendations. Thirty P. aeruginosa isolates were randomly selected and tested for their MBL production by both phenotypic and genotypic methods. Diagnostic Epsilometer test was done to detect metallo-beta-lactamase enzyme producers and polymerase chain reaction test was done to detect imipenemase (IMP), Verona integron-encoded (VIM) and Sao Paulo metallo-beta-lactamase (IMP) encoding genes. Of the 1583 clinical samples, 175 (11.3%) P. aeruginosa isolates were identified. All the 30 (100%) selected P. aeruginosa isolates that were tested for MBL production by Epsilometer test were found to be positive; where 19 (63.3%) revealed blaSPM gene and 11 (36.7%) had blaIMP gene. blaVIM gene was not detected in any of the tested isolates. Isolates of MBL producing P. aeruginosa were highly susceptible to polymyxin B 26 (86.7%) and highly resistant to amikacin 26 (86.7%). MBL producers were detected phenotypically by Epsilometer test in both carbapenem susceptible and resistant P. aeruginosa isolates. blaSPM was the most commonly detected MBL gene in P. aeruginosa isolates.

[Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].

PubMed

Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen

2015-06-01

To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).

Effects of sulfate on microcystin production, photosynthesis, and oxidative stress in Microcystis aeruginosa.

PubMed

Chen, Lei; Gin, Karina Y H; He, Yiliang

2016-02-01

Increasing sulfate in freshwater systems, caused by human activities and climate change, may have negative effects on aquatic organisms. Microcystis aeruginosa (M. aeruginosa) is both a major primary producer and a common toxic cyanobacterium, playing an important role in the aquatic environment. This study first investigated the effects of sulfate on M. aeruginosa. The experiment presented here aims at analyzing the effects of sulfate on physiological indices, molecular levels, and its influencing mechanism. The results of our experiment showed that sulfate (at 40, 80, and 300 mg L(-1)) inhibited M. aeruginosa growth, increased both intracellular and extracellular toxin contents, and enhanced the mcyD transcript level. Sulfate inhibited the photosynthesis of M. aeruginosa, based on the decrease in pigment content and the down-regulation of photosynthesis-related genes after sulfate exposure. Furthermore, sulfate decreased the maximum electron transport rate, causing the cell to accumulate surplus electrons and form reactive oxygen species (ROS). Sulfate also increased the malondialdehyde (MDA) content, which showed that sulfate damaged the cytomembrane. This damage contributed to the release of intracellular toxin to the culture medium. Although sulfate increased superoxide dismutase (SOD) activities, expression of sod, and total antioxidant capacity in M. aeruginosa, it still overwhelmed the antioxidant system since the ROS level simultaneously increased, and finally caused oxidative stress. Our results indicate that sulfate has direct effects on M. aeruginosa, inhibits photosynthesis, causes oxidative stress, increases toxin production, and affects the related genes expression in M. aeruginosa.

Violacein-producing Collimonas sp. from the sea surface microlayer of costal waters in Trøndelag, Norway.

PubMed

Hakvåg, Sigrid; Fjaervik, Espen; Klinkenberg, Geir; Borgos, Sven Even F; Josefsen, Kjell D; Ellingsen, Trond E; Zotchev, Sergey B

2009-11-12

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound.

[In vitro studies on antioxidant and antimicrobial activities of polysaccharide from Lycoris aurea].

PubMed

Ru, Qiao-Mei; Pei, Zhen-Ming; Zheng, Hai-Lei

2008-10-01

To study the preliminary antioxidant and antimicrobial activities of polysaccharide extracted from Lycoris aurea. The scavenging activities of the polysaccharide in vitro on superoxide radical (O2-*), hydroxyl radical (*OH), alkyl radical (R*) and hydrogen peroxide (H2O2) were investigated by modified chemical systems. Meanwhile, the antimicrobial activities were tested using paper-discagar diffusion method. In general, the antioxidant activities of the polysaccharide were lower compared with Vc. However, the scavenging effects to *OH and H2O2 were parallel to Vc. Meanwhile, polysaccharide from Lycoris aurea had strong antimicrobial activities against Micrococcus luteus, Bacillus pumilus and Staphylococcus aureus. The polysaccharide extracted from L. aurea can scavenge *OH and H2O2 effectively and inhibit Gram-positive bacterias.

Toxicogenomic response of Pseudomonas aeruginosa to ortho-phenylphenol

PubMed Central

Nde, Chantal W; Jang, Hyeung-Jin; Toghrol, Freshteh; Bentley, William E

2008-01-01

Background Pseudomonas aeruginosa (P. aeruginosa) is the most common opportunistic pathogen implicated in nosocomial infections and in chronic lung infections in cystic fibrosis patients. Ortho-phenylphenol (OPP) is an antimicrobial agent used as an active ingredient in several EPA registered disinfectants. Despite its widespread use, there is a paucity of information on its target molecular pathways and the cellular responses that it elucidates in bacteria in general and in P. aeruginosa in particular. An understanding of the OPP-driven gene regulation and cellular response it elicits will facilitate more effective utilization of this antimicrobial and possibly lead to the development of more effective disinfectant treatments. Results Herein, we performed a genome-wide transcriptome analysis of the cellular responses of P. aeruginosa exposed to 0.82 mM OPP for 20 and 60 minutes. Our data indicated that OPP upregulated the transcription of genes encoding ribosomal, virulence and membrane transport proteins after both treatment times. After 20 minutes of exposure to 0.82 mM OPP, genes involved in the exhibition of swarming motility and anaerobic respiration were upregulated. After 60 minutes of OPP treatment, the transcription of genes involved in amino acid and lipopolysaccharide biosynthesis were upregulated. Further, the transcription of the ribosome modulation factor (rmf) and an alternative sigma factor (rpoS) of RNA polymerase were downregulated after both treatment times. Conclusion Results from this study indicate that after 20 minutes of exposure to OPP, genes that have been linked to the exhibition of anaerobic respiration and swarming motility were upregulated. This study also suggests that the downregulation of the rmf and rpoS genes may be indicative of the mechanism by which OPP causes decreases in cell viability in P. aeruginosa. Consequently, a protective response involving the upregulation of translation leading to the increased synthesis of

Repair of Ultraviolet Radiation Damage in Sensitive Mutants of Micrococcus radiodurans

PubMed Central

Moseley, B. E. B.

1969-01-01

Various aspects of the repair of ultraviolet (UV) radiation-induced damage were compared in wild-type Micrococcus radiodurans and two UV-sensitive mutants. Unlike the wild type, the mutants are more sensitive to radiation at 265 nm than at 280 nm. The delay in deoxyribonucleic acid (DNA) synthesis following exposure to UV is about seven times as long in the mutants as in the wild type. All three strains excise UV-induced pyrimidine dimers from their DNA, although the rate at which cytosine-thymine dimers are excised is slower in the mutants. The three strains also mend the single-strand breaks that appear in the irradiated DNA as a result of dimer excision, although the process is less efficient in the mutants. It is suggested that the increased sensitivity of the mutants to UV radiation may be caused by a partial defect in the second step of dimer excision. PMID:5773016

[Antiseptic sensitivity of clinical strains of Pseudomonas aeruginosa].

PubMed

Adarchenko, A A; Krasil'nikov, A P; Sobeshchuk, O P

1989-12-01

MICs, the frequency of clinical and statistic resistance and the antiseptic activity index were studied in complex on out-of-hospital and hospital ecovars of P. aeruginosa. The forms resistant to a number of antiseptics, i.e. chloramine B, chlorhexidine, decamethoxine and dioxidine whose frequency eventually increased were shown to be widely distributed. The antiseptic sensitivity spectrum was more narrow and more heterogeneous than that of other bacteria, the heterogeneity level being dependent on the antiseptic type and bacterial ecovar. The activity of pervomur, phenol, resorcin and boric acid was higher against the clinical strains of P. aeruginosa while iodopyrin, sulfacetamide sodium and dioxidine were less active. The P. aeruginosa strains had natural resistance to cetylpyridinium chloride, rokkal, ethonium, sodium laurate and laurylsulfate and rivanol. It was recommended to assay antiseptic sensitivity of agents causing purulent inflammatory infections and to control circulation of antiseptic resistant variants of bacteria in hospitals.

RAPD- and ERIC-Based Typing of Clinical and Environmental Pseudomonas aeruginosa Isolates.

PubMed

Auda, Ibtesam Ghadban; Al-Kadmy, Israa M S; Kareem, Sawsan Mohammed; Lafta, Aliaa Khyuon; A'Affus, Mustafa Hussein Obeid; Khit, Ibrahim Abd Aloahd; Al Kheraif, Abdulaziz Abdullah; Divakar, Darshan Devang; Ramakrishnaiah, Ravikumar

2017-03-01

Pseudomonas aeruginosa is a major cause of nosocomial infection in children and adults, resulting in significant morbidity and mortality due to its ability to acquire drug resistance. The ability of P. aeruginosa in the environment to cause infection in individuals has been reported previously; henceforth, surveillance of the emergence and transmission of P. aeruginosa strains among patients is important for infection control in a clinical setup. Various gene-typing methods have been used for epidemiological typing of P. aeruginosa isolates for the purpose of surveillance. In this work, the suitability and comparability of two typing methods, enterobacterial repetitive intergenic consensus (ERIC)-PCR and random amplification of polymorphic DNA (RAPD)-PCR fingerprinting, were studied to characterize P. aeruginosa strains isolated from clinical and environmental sources. Forty-four clinical and environmental bacterial isolates of P. aeruginosa were collected between October 2015 and January 2016. DNA extraction, ERIC-PCR and RAPD-PCR, agarose gel electrophoresis, and phylogenetic analyses were carried using the unweighted pair-group method with mean. RAPD typing revealed less clonality among clinical isolates, whereas the ERIC method showed greater similarity in comparison with RAPD. Environmental isolates, however, showed greater similarity using RAPD compared with ERIC typing. With only a few exceptions, most clinical isolates were distinct from environmental isolates, irrespective of the typing method. In conclusion, both the RAPD and ERIC typing methods proved to be good tools in understanding clonal diversity. The results also suggest that there is no relationship between clinical and environmental isolates. The absence of clonality among the clinical isolates may indicate that most P. aeruginosa infection cases could be endemic and not epidemic and that endemic infections may be due to nonclonal strains of P. aeruginosa.

Enterobactin-mediated iron transport in Pseudomonas aeruginosa.

PubMed Central

Poole, K; Young, L; Neshat, S

1990-01-01

A pyoverdine-deficient strain of Pseudomonas aeruginosa was unable to grow in an iron-deficient minimal medium in the presence of the nonmetabolizable iron chelator ethylene diamine-di(omega-hydroxyphenol acetic acid) (EDDHA), although addition of enterobactin to EDDHA-containing minimal media did restore growth of the pyoverdine-deficient P. aeruginosa. Consistent with the apparent ability of enterobactin to provide iron to P. aeruginosa, enterobactin-dependent 55Fe3+ uptake was observed in cells of P. aeruginosa previously grown in an iron-deficient medium containing enterobactin (or enterobactin-containing Escherichia coli culture supernatant). This uptake was energy dependent, was observable at low concentrations (60 nM) of FeCl3, and was absent in cells cultured without enterobactin. A novel protein with a molecular weight of approximately 80,000 was identified in the outer membranes of cells grown in iron-deficient minimal medium containing enterobactin, concomitant with the induction of enterobactin-dependent iron uptake. A Tn501 insertion mutant lacking this protein was isolated and shown to be deficient in enterobactin-mediated iron transport at 60 nM FeCl3, although it still exhibited enterobactin-dependent growth in iron-deficient medium containing EDDHA. It was subsequently observed that the mutant was, however, capable of enterobactin-mediated iron transport at much higher concentrations (600 nM) of FeCl3. Indeed, enterobactin-dependent iron uptake at this concentration of iron was observed in both the mutant and parent strains irrespective of whether they had been cultured in the presence of enterobactin.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2174865

Occurrence of Pseudomonas aeruginosa in waters: implications for patients with cystic fibrosis (CF).

PubMed

Caskey, S; Stirling, J; Moore, J E; Rendall, J C

2018-06-01

Chronic Pseudomonas aeruginosa infection is associated with increased morbidity and mortality in patients with cystic fibrosis (CF). Current understanding of risk factors for acquisition is limited and so the aim of this study was to examine a large sample of environmental waters from diverse sources. Environmental water samples (n = 7904) from jacuzzis, hydrants, swimming pools, hot tubs, plunge pools, bottled natural mineral water, taps, springs, ice machines, water coolers, bores and showers were examined for the presence of P. aeruginosa. Pseudomonas aeruginosa was detected in 524/7904 (6·6%) waters examined. Hot tubs (51/243; 20·9%), tap water (3/40; 8%) and jacuzzis (432/5811; 7·4%) were the most likely environments where P. aeruginosa was isolated. Pseudomonas aeruginosa was isolated from bottled water (2/67; 3%). Our study highlights the ubiquitous nature of P. aeruginosa in the environment. Given CF patients are frequently counselled to make lifestyle changes to minimize P. aeruginosa exposure, these results have important implications. In particular, the occurrence of P. aeruginosa in tap water highlights the need to disinfect the CF patients' nebulizer after each use. This study examined a large number of water sources (n = 7904) over a 9-year period for the presence of Pseudomonas aeruginosa. The study highlighted that jacuzzis (n = 5811; 7% positive) and hot tubs had the highest occurrence of this organism (n = 243, 21% positive). Patients with cystic fibrosis (CF) are interested in knowing what water environments are likely to be contaminated with this organism, as this bacterium is an important cause of increased morbidity and mortality in such patients. With such information, CF patients and parents may make informed decisions about lifestyle choice and water environment avoidance. © 2018 The Society for Applied Microbiology.

Dose-response algorithms for water-borne Pseudomonas aeruginosa folliculitis.

PubMed

Roser, D J; Van Den Akker, B; Boase, S; Haas, C N; Ashbolt, N J; Rice, S A

2015-05-01

We developed two dose-response algorithms for P. aeruginosa pool folliculitis using bacterial and lesion density estimates, associated with undetectable, significant, and almost certain folliculitis. Literature data were fitted to Furumoto & Mickey's equations, developed for plant epidermis-invading pathogens: N l = A ln(1 + BC) (log-linear model); P inf = 1-e(-r c C) (exponential model), where A and B are 2.51644 × 107 lesions/m2 and 2.28011 × 10-11 c.f.u./ml P. aeruginosa, respectively; C = pathogen density (c.f.u./ml), N l = folliculitis lesions/m2, P inf = probability of infection, and r C = 4·3 × 10-7 c.f.u./ml P. aeruginosa. Outbreak data indicates these algorithms apply to exposure durations of 41 ± 25 min. Typical water quality benchmarks (≈10-2 c.f.u./ml) appear conservative but still useful as the literature indicated repeated detection likely implies unstable control barriers and bacterial bloom potential. In future, culture-based outbreak testing should be supplemented with quantitative polymerase chain reaction and organic carbon assays, and quantification of folliculitis aetiology to better understand P. aeruginosa risks.

Molecular Characterization of OXA-198 Carbapenemase-Producing Pseudomonas aeruginosa Clinical Isolates.

PubMed

Bonnin, Rémy A; Bogaerts, Pierre; Girlich, Delphine; Huang, Te-Din; Dortet, Laurent; Glupczynski, Youri; Naas, Thierry

2018-06-01

Carbapenemase-producing Pseudomonadaceae have increasingly been reported worldwide, with an ever-increasing heterogeneity of carbapenem resistance mechanisms, depending on the bacterial species and the geographical location. OXA-198 is a plasmid-encoded class D β-lactamase involved in carbapenem resistance in one Pseudomonas aeruginosa isolate from Belgium. In the setting of a multicenter survey of carbapenem resistance in P. aeruginosa strains in Belgian hospitals in 2013, three additional OXA-198-producing P. aeruginosa isolates originating from patients hospitalized in one hospital were detected. To reveal the molecular mechanism underlying the reduced susceptibility to carbapenems, MIC determinations, whole-genome sequencing, and PCR analyses to confirm the genetic organization were performed. The plasmid harboring the bla OXA-198 gene was characterized, along with the genetic relatedness of the four P. aeruginosa isolates. The bla OXA-198 gene was harbored on a class 1 integron carried by an ∼49-kb IncP-type plasmid proposed as IncP-11. The same plasmid was present in all four P. aeruginosa isolates. Multilocus sequence typing revealed that the isolates all belonged to sequence type 446, and single-nucleotide polymorphism analysis revealed only a few differences between the isolates. This report describes the structure of a 49-kb plasmid harboring the bla OXA-198 gene and presents the first description of OXA-198-producing P. aeruginosa isolates associated with a hospital-associated cluster episode. Copyright © 2018 American Society for Microbiology.

Investigation of a pseudo-outbreak of orthopedic infections caused by Pseudomonas aeruginosa.

PubMed

Forman, W; Axelrod, P; St John, K; Kostman, J; Khater, C; Woodwell, J; Vitagliano, R; Truant, A; Satishchandran, V; Fekete, T

1994-10-01

To report a pseudoepidemic of Pseudomonas aeruginosa infections discovered during an investigation of postoperative joint infections. A retrospective review of case patients' hospital charts, operative reports, and laboratory data, as well as environmental culturing, polymerase chain reaction (PCR) ribotyping of outbreak isolates, and in vitro analysis of P aeruginosa growth characteristics. A 510-bed, university-affiliated adult tertiary care hospital. Between October 1 and December 1, 1992, seven postsurgical joint infections were diagnosed, including four caused by P aeruginosa. A bottle of "sterile" saline used to process tissue specimens was found to be contaminated with P aeruginosa. Further investigation revealed that P aeruginosa had grown from seven additional tissue cultures, all of which had been processed with the contaminated saline. PCR ribotypes of the contaminant matched those of the clinical isolates. In vitro, P aeruginosa strains were viable in commercial nonbacteriostatic saline, but never caused visible turbidity. Six patients received antibiotics for their presumed infections; four patients had peripherally inserted central catheters placed, and one experienced severe anaphylactic reactions to several antibiotics. Pseudoepidemics due to common organisms are often difficult to detect, and delayed recognition can result in substantial morbidity. This outbreak investigation illustrates the potential for contamination of diluents in the microbiology laboratory and emphasizes the need for meticulous quality control.

Anaerobic Corrosion of 304 Stainless Steel Caused by the Pseudomonas aeruginosa Biofilm

PubMed Central

Jia, Ru; Yang, Dongqing; Xu, Dake; Gu, Tingyue

2017-01-01

Pseudomonas aeruginosa is a ubiquitous bacterium capable of forming problematic biofilms in many environments. They cause biocorrosion of medical implants and industrial equipment and infrastructure. Aerobic corrosion of P. aeruginosa against stainless steels has been reported by some researchers while there is a lack of reports on anaerobic P. aeruginosa corrosion in the literature. In this work, the corrosion by a wild-type P. aeruginosa (strain PAO1) biofilm against 304 stainless steel (304 SS) was investigated under strictly anaerobic condition for up to 14 days. The anaerobic corrosion of 304 SS by P. aeruginosa was reported for the first time. Results showed that the average sessile cell counts on 304 SS coupons after 7- and 14-day incubations were 4.8 × 107 and 6.2 × 107 cells/cm2, respectively. Scanning electron microscopy and confocal laser scanning microscopy corroborated the sessile cell counts. The X-ray diffraction analysis identified the corrosion product as iron nitride, confirming that the corrosion was caused by the nitrate reducing biofilm. The largest pit depths on 304 SS surfaces after the 7- and 14-day incubations with P. aeruginosa were 3.9 and 7.4 μm, respectively. Electrochemical tests corroborated the pitting data. PMID:29230206

The Pseudomonas aeruginosa AlgZR two-component system coordinates multiple phenotypes

PubMed Central

Okkotsu, Yuta; Little, Alexander S.; Schurr, Michael J.

2014-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that causes a multitude of infections. These infections can occur at almost any site in the body and are usually associated with a breach of the innate immune system. One of the prominent sites where P. aeruginosa causes chronic infections is within the lungs of cystic fibrosis patients. P. aeruginosa uses two-component systems that sense environmental changes to differentially express virulence factors that cause both acute and chronic infections. The P. aeruginosa AlgZR two component system is one of its global regulatory systems that affects the organism's fitness in a broad manner. This two-component system is absolutely required for two P. aeruginosa phenotypes: twitching motility and alginate production, indicating its importance in both chronic and acute infections. Additionally, global transcriptome analyses indicate that it regulates the expression of many different genes, including those associated with quorum sensing, type IV pili, type III secretion system, anaerobic metabolism, cyanide and rhamnolipid production. This review examines the complex AlgZR regulatory network, what is known about the structure and function of each protein, and how it relates to the organism's ability to cause infections. PMID:24999454

Accelerated corrosion of 2205 duplex stainless steel caused by marine aerobic Pseudomonas aeruginosa biofilm.

PubMed

Xu, Dake; Xia, Jin; Zhou, Enze; Zhang, Dawei; Li, Huabing; Yang, Chunguang; Li, Qi; Lin, Hai; Li, Xiaogang; Yang, Ke

2017-02-01

Microbiologically influenced corrosion (MIC) of 2205 duplex stainless steel (DSS) in the presence of Pseudomonas aeruginosa was investigated through electrochemical and surface analyses. The electrochemical results showed that P. aeruginosa significantly reduced the corrosion resistance of 2205 DSS. Confocal laser scanning microscopy (CLSM) images showed that the depths of the largest pits on 2205 DSS with and without P. aeruginosa were 14.0 and 4.9μm, respectively, indicating that the pitting corrosion was accelerated by P. aeruginosa. X-ray photoelectron spectroscopy (XPS) results revealed that CrO 3 and CrN formed on the 2205 DSS surface in the presence of P. aeruginosa. Copyright © 2016 Elsevier B.V. All rights reserved.

[The description of an esculin-positive biovar of Pseudomonas aeruginosa].

PubMed

Sivolodskiĭ, E P

2000-01-01

In the study of 280 P. aeruginosa strains isolated in different hospitals of St. Petersburg for the first time 48 strains capable of hydrolyzing esculin have been detected. The hydrolysis of esculin is determined in plates with the use of the microvolume techniques the results were evaluated after 3-hour incubation at 37 degrees C. The data confirming the existence of the exculin-positive biovar of P. aeruginosa have been obtained; these data show the wide spread of esculin-positive strains in hospitals of different specialization (17.1 +/- 5.1% of P. aeruginosa strains), the characteristic combination of the sign of esculin hydrolysis with such signs as the absence of the smell of trimethylamine and the phenomenon of "iridescent lysis" of the colonies, the stability of the sign of esculin hydrolysis in strains, repeatedly isolated from patients, after the storage of the cultures and their treatment with plasmid-eliminating preparation. The name "esculinolytica" has been proposed for this biovar. The typing strain of biovar esculinolytica has been deposited in the culture collection of the Russian Research Institute of Agricultural Microbiology as P. aeruginosa ARRIAM 64-A. This biovar been found to be most widely spread in urological hospitals, where esculin-positive strains are isolated 3 times more frequently (32.2 +/- 5.1% of P. aeruginosa strains) than in surgical hospitals (10.7 +/- 2.2%).

Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.

PubMed

Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua

2011-08-01

Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.

Bioremediation of contaminated surface water by immobilized Micrococcus roseus.

PubMed

Li, H; Li, P; Hua, T; Zhang, Y; Xiong, X; Gong, Z

2005-08-01

The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.

Cloning and characterization of EF-Tu and EF-Ts from Pseudomonas aeruginosa.

PubMed

Palmer, Stephanie O; Rangel, Edna Y; Montalvo, Alberto E; Tran, Alexis T; Ferguson, Kate C; Bullard, James M

2013-01-01

We have cloned genes encoding elongation factors EF-Tu and EF-Ts from Pseudomonas aeruginosa and expressed and purified the proteins to greater than 95% homogeneity. Sequence analysis indicated that P. aeruginosa EF-Tu and EF-Ts are 84% and 55% identical to E. coli counterparts, respectively. P. aeruginosa EF-Tu was active when assayed in GDP exchange assays. Kinetic parameters for the interaction of EF-Tu with GDP in the absence of EF-Ts were observed to be K M = 33 μM, k cat (obs) = 0.003 s(-1), and the specificity constant k cat (obs)/K M was 0.1 × 10(-3) s(-1) μM(-1). In the presence of EF-Ts, these values were shifted to K M = 2 μM, k cat (obs) = 0.005 s(-1), and the specificity constant k(cat)(obs)/K M was 2.5 × 10(-3) s(-1) μM(-1). The equilibrium dissociation constants governing the binding of EF-Tu to GDP (K GDP) were 30-75 nM and to GTP (K GTP) were 125-200 nM. EF-Ts stimulated the exchange of GDP by EF-Tu 10-fold. P. aeruginosa EF-Tu was active in forming a ternary complex with GTP and aminoacylated tRNA and was functional in poly(U)-dependent binding of Phe-tRNA(Phe) at the A-site of P. aeruginosa ribosomes. P. aeruginosa EF-Tu was active in poly(U)-programmed polyphenylalanine protein synthesis system composed of all P. aeruginosa components.

Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

PubMed Central

Çevik, Kübra; Ulusoy, Seyhan

2015-01-01

Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida

PubMed Central

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y.I.; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds. PMID:27672405

Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida.

PubMed

Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul

2016-01-01

We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.

Microencapsulation, Chemical Characterization, and Antimicrobial Activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) Oregano Essential Oils

PubMed Central

Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E.

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum.

PubMed

Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken

2012-01-01

Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan.

Mode of action and safety of lactosporin, a novel antimicrobial protein produced by Bacillus coagulans ATCC 7050

PubMed Central

Riazi, Shadi; Dover, Sara E.; Chikindas, Michael L.

2012-01-01

Aims To determine the mechanism of action of antimicrobial protein, lactosporin, against Gardnerella vaginalis and to evaluate its safety in-vitro. Methods and Results Bacillus coagulans ATCC 7050 was grown at 37 °C for 18 hours. The cell free supernatant was concentrated 10-fold and screened for antimicrobial activity against indicator strain Micrococcus luteus. The mode of action of lactosporin was determined by measuring the potassium release and monitoring the changes in transmembrane potential (Δψ) and transmembrane pH (ΔpH) of the sensitive cells. Lactosporin caused efflux of potassium ions from M. luteus cells and dissipation of ΔpH in G. vaginalis while it had no effect on the Δψ. The safety of lactosporin was evaluated by using EpiVaginal™ ectocervical (VEC-100) tissue model. Over 80% of the cells in the vaginal tissue remained viable after exposure to lactosporin for 24 hours. Conclusions Lactosporin potentially exerts its antimicrobial activity by selective dissipation of ΔpH and/or by causing leakage of ions from the sensitive cells. Safety studies suggest that lactosporin is a non-cytotoxix antimicrobial for vaginal application. Significance and Impact of the Study This study revealed that lactosporin is an effective and safe antimicrobial preparation with potential application for control of bacterial vaginosis. PMID:22737982

Antimicrobial activity in the common seawhip, Leptogorgia virgulata (Cnidaria: Gorgonaceae).

PubMed

Shapo, Jacqueline L; Moeller, Peter D; Galloway, Sylvia B

2007-09-01

Antimicrobial activity was examined in the gorgonian Leptogorgia virgulata (common seawhip) from South Carolina waters. Extraction and assay protocols were developed to identify antimicrobial activity in crude extracts of L. virgulata. Detection was determined by liquid growth inhibition assays using Escherichia coli BL21, Vibrio harveyii, Micrococcus luteus, and a Bacillus sp. isolate. This represents the first report of antimicrobial activity in L. virgulata, a temperate/sub-tropical coral of the western Atlantic Ocean. Results from growth inhibition assays guided a fractionation scheme to identify active compounds. Reverse-phase HPLC, HPLC-mass spectrometry, and 1H and 13C NMR spectroscopy were used to isolate, purify, and characterize metabolites in antimicrobial fractions of L. virgulata. Corroborative HPLC-MS/NMR evidence validated the presence of homarine and a homarine analog, well-known emetic metabolites previously isolated from L. virgulata, in coral extracts. In subsequent assays, partially-purified L. virgulata fractions collected from HPLC-MS fractionation were shown to contain antimicrobial activity using M. luteus and V. harveyii. This study provides evidence that homarine is an active constituent of the innate immune system in L. virgulata. We speculate it may act synergistically with cofactors and/or congeners in this octocoral to mount a response to microbial invasion and disease.

Microencapsulation, chemical characterization, and antimicrobial activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) oregano essential oils.

PubMed

Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E

2014-01-01

The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano.

Anti-Pseudomonas aeruginosa IgY antibodies augment bacterial clearance in a murine pneumonia model.

PubMed

Thomsen, K; Christophersen, L; Bjarnsholt, T; Jensen, P Ø; Moser, C; Høiby, N

2016-03-01

Oral prophylactic therapy by gargling with pathogen-specific egg yolk immunoglobulins (IgY) may reduce the initial airway colonization with Pseudomonas aeruginosa in cystic fibrosis (CF) patients. IgY antibodies impart passive immunization and we investigated the effects of anti-P. aeruginosa IgY antibodies on bacterial eradication in a murine pneumonia model. P. aeruginosa pneumonia was established in Balb/c mice and the effects of prophylactic IgY administration on lung bacteriology, clinical parameters and subsequent inflammation were compared to controls. Prophylactic administration of IgY antibodies targeting P. aeruginosa significantly reduced the bacterial burden by 2-log 24h post-infection compared to controls and was accompanied by significantly reduced clinical symptom scores and successive inflammatory cytokine profile indicative of diminished lung inflammation. Passive immunization by anti-P. aeruginosa IgY therapy facilitates promptly bacterial clearance and moderates inflammation in P. aeruginosa lung infection and may serve as an adjunct to antibiotics in reducing early colonization. Copyright © 2015. Published by Elsevier B.V.

Glycolipid-Dependent, Protease Sensitive Internalization of Pseudomonas aeruginosa Into Cultured Human Respiratory Epithelial Cells

PubMed Central

Emam, Aufaugh; Carter, William G; Lingwood, Clifford

2010-01-01

Internalization of PAK strain Pseudomonas aeruginosa into human respiratory epithelial cell lines and HeLa cervical cancer cells in vitro was readily demonstrable via a gentamycin protection assay. Depletion of target cell glycosphingolipids (GSLs) using a glucosyl ceramide synthase inhibitor, P4, completely prevented P. aeruginosa internalization. In contrast, P4 treatment had no effect on the internalization of Salmonella typhimurium into HeLa cells. Internalized P. aeruginosa were within membrane vacuoles, often containing microvesicles, between the bacterium and the limiting membrane. P. aeruginosa internalization was markedly enhanced by target cell pretreatment with the exogenous GSL, deacetyl gangliotetraosyl ceramide (Gg4). Gg4 binds the lipid raft marker, GM1 ganglioside. Target cell pretreatment with TLCK, but not other (serine) protease inhibitors, prevented both P. aeruginosa host cell binding and internalization. NFkB inhibition also prevented internalization. A GSL-containing lipid-raft model of P. aeruginosa host cell binding/internalization is proposed PMID:21270937

Effects of hyperbaric oxygen on Pseudomonas aeruginosa susceptibility to imipenem and macrophages.

PubMed

Lima, Flavia Luna; Joazeiro, Paulo Pinto; Lancellotti, Marcelo; de Hollanda, Luciana Maria; de Araújo Lima, Bruna; Linares, Edlaine; Augusto, Ohara; Brocchi, Marcelo; Giorgio, Selma

2015-01-01

The seriousness to treat burn wounds infected with Pseudomonas aeruginosa led us to examine whether the effect of the carbapenem antibiotic imipenem is enhanced by hyperbaric oxygen (HBO). The effects of HBO (100% O2, 3 ATA, 5 h) in combination with imipenen on bacterial counts of six isolates of P. aeruginosa and bacterial ultrastructure were investigated. Infected macrophages were exposed to HBO (100% O2, 3 ATA, 90 min) and the production of reactive oxygen species monitored. HBO enhanced the effects of imipenen. HBO increased superoxide anion production by macrophages and likely kills bacteria by oxidative mechanisms. HBO in combination with imipenem can be used to kill P. aeruginosa in vitro and such treatment may be beneficial for the patients with injuries containing the P. aeruginosa.

Phylogenetic Distribution of CRISPR-Cas Systems in Antibiotic-Resistant Pseudomonas aeruginosa.

PubMed

van Belkum, Alex; Soriaga, Leah B; LaFave, Matthew C; Akella, Srividya; Veyrieras, Jean-Baptiste; Barbu, E Magda; Shortridge, Dee; Blanc, Bernadette; Hannum, Gregory; Zambardi, Gilles; Miller, Kristofer; Enright, Mark C; Mugnier, Nathalie; Brami, Daniel; Schicklin, Stéphane; Felderman, Martina; Schwartz, Ariel S; Richardson, Toby H; Peterson, Todd C; Hubby, Bolyn; Cady, Kyle C

2015-11-24

Pseudomonas aeruginosa is an antibiotic-refractory pathogen with a large genome and extensive genotypic diversity. Historically, P. aeruginosa has been a major model system for understanding the molecular mechanisms underlying type I clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated protein (CRISPR-Cas)-based bacterial immune system function. However, little information on the phylogenetic distribution and potential role of these CRISPR-Cas systems in molding the P. aeruginosa accessory genome and antibiotic resistance elements is known. Computational approaches were used to identify and characterize CRISPR-Cas systems within 672 genomes, and in the process, we identified a previously unreported and putatively mobile type I-C P. aeruginosa CRISPR-Cas system. Furthermore, genomes harboring noninhibited type I-F and I-E CRISPR-Cas systems were on average ~300 kb smaller than those without a CRISPR-Cas system. In silico analysis demonstrated that the accessory genome (n = 22,036 genes) harbored the majority of identified CRISPR-Cas targets. We also assembled a global spacer library that aided the identification of difficult-to-characterize mobile genetic elements within next-generation sequencing (NGS) data and allowed CRISPR typing of a majority of P. aeruginosa strains. In summary, our analysis demonstrated that CRISPR-Cas systems play an important role in shaping the accessory genomes of globally distributed P. aeruginosa isolates. P. aeruginosa is both an antibiotic-refractory pathogen and an important model system for type I CRISPR-Cas bacterial immune systems. By combining the genome sequences of 672 newly and previously sequenced genomes, we were able to provide a global view of the phylogenetic distribution, conservation, and potential targets of these systems. This analysis identified a new and putatively mobile P. aeruginosa CRISPR-Cas subtype, characterized the diverse distribution of known CRISPR-inhibiting genes, and

Aspergillus fumigatus enhances elastase production in Pseudomonas aeruginosa co-cultures.

PubMed

Smith, Karen; Rajendran, Ranjith; Kerr, Stephen; Lappin, David F; Mackay, William G; Williams, Craig; Ramage, Gordon

2015-09-01

In the cystic fibrosis (CF) lung the presence of bacteria and fungi in the airways promotes an inflammatory response causing progressive lung damage, ultimately leading to high rates of morbidity and mortality. We hypothesized that polymicrobial interactions play an important role in promoting airway pathogenesis. We therefore examined the interplay between the most commonly isolated bacterial CF pathogen, Pseudomonas aeruginosa, and the most prevalent filamentous fungi, Aspergillus fumigatus, to test this. Co-culture experiments showed that in the presence of A. fumigatus the production of P. aeruginosa elastase was enhanced. This was confirmed by the presence of zones of clearance on Elastin-Congo Red (ECR) agar, which was identified as elastase by mass spectrometry. When P. aeruginosa were grown in a co-culture model with mature A. fumigatus biofilms, 60% of isolates produced significantly more elastase in the presence of the filamentous fungi than in its absence (P < .05). The expression of lasB also increased when P. aeruginosa isolates PA01 and PA14 were grown in co-culture with A. fumigatus. Supernatants from co-culture experiments were also significantly toxic to a human lung epithelial cell line (19-38% cell cytotoxicity) in comparison to supernatants from P. aeruginosa only cultures (P < .0001). Here we report that P. aeruginosa cytotoxic elastase is enhanced in the presence of the filamentous fungi A. fumigatus, suggesting that this may have a role to play in the damaging pathology associated with the lung tissue in this disease. This indicates that patients who have a co-colonisation with these two organisms may have a poorer prognosis. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Pseudomonas aeruginosa infection in cystic fibrosis: pathophysiological mechanisms and therapeutic approaches.

PubMed

Lund-Palau, Helena; Turnbull, Andrew R; Bush, Andrew; Bardin, Emmanuelle; Cameron, Loren; Soren, Odel; Wierre-Gore, Natasha; Alton, Eric W F W; Bundy, Jacob G; Connett, Gary; Faust, Saul N; Filloux, Alain; Freemont, Paul; Jones, Andy; Khoo, Valerie; Morales, Sandra; Murphy, Ronan; Pabary, Rishi; Simbo, Ameze; Schelenz, Silke; Takats, Zoltan; Webb, Jeremy; Williams, Huw D; Davies, Jane C

2016-06-01

Pseudomonas aeruginosa is a remarkably versatile environmental bacterium with an extraordinary capacity to infect the cystic fibrosis (CF) lung. Infection with P. aeruginosa occurs early, and although eradication can be achieved following early detection, chronic infection occurs in over 60% of adults with CF. Chronic infection is associated with accelerated disease progression and increased mortality. Extensive research has revealed complex mechanisms by which P. aeruginosa adapts to and persists within the CF airway. Yet knowledge gaps remain, and prevention and treatment strategies are limited by the lack of sensitive detection methods and by a narrow armoury of antibiotics. Further developments in this field are urgently needed in order to improve morbidity and mortality in people with CF. Here, we summarize current knowledge of pathophysiological mechanisms underlying P. aeruginosa infection in CF. Established treatments are discussed, and an overview is offered of novel detection methods and therapeutic strategies in development.

Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.

PubMed Central

Hansen, M T

1978-01-01

The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572

Trehalose 6-phosphate phosphatases of Pseudomonas aeruginosa.

PubMed

Cross, Megan; Biberacher, Sonja; Park, Suk-Youl; Rajan, Siji; Korhonen, Pasi; Gasser, Robin B; Kim, Jeong-Sun; Coster, Mark J; Hofmann, Andreas

2018-04-24

The opportunistic bacterium Pseudomonas aeruginosa has been recognized as an important pathogen of clinical relevance and is a leading cause of hospital-acquired infections. The presence of a glycolytic enzyme in Pseudomonas, which is known to be inhibited by trehalose 6-phosphate (T6P) in other organisms, suggests that these bacteria may be vulnerable to the detrimental effects of intracellular T6P accumulation. In the present study, we explored the structural and functional properties of trehalose 6-phosphate phosphatase (TPP) in P. aeruginosa in support of future target-based drug discovery. A survey of genomes revealed the existence of 2 TPP genes with either chromosomal or extrachromosomal location. Both TPPs were produced as recombinant proteins, and characterization of their enzymatic properties confirmed specific, magnesium-dependent catalytic hydrolysis of T6P. The 3-dimensional crystal structure of the chromosomal TPP revealed a protein dimer arising through β-sheet expansion of the individual monomers, which possess the overall fold of halo-acid dehydrogenases.-Cross, M., Biberacher, S., Park, S.-Y., Rajan, S., Korhonen, P., Gasser, R. B., Kim, J.-S., Coster, M. J., Hofmann, A. Trehalose 6-phosphate phosphatases of Pseudomonas aeruginosa.

Pseudomonas aeruginosa quorum sensing molecules correlate with clinical status in cystic fibrosis.

PubMed

Barr, Helen L; Halliday, Nigel; Cámara, Miguel; Barrett, David A; Williams, Paul; Forrester, Douglas L; Simms, Rebecca; Smyth, Alan R; Honeybourne, David; Whitehouse, Joanna L; Nash, Edward F; Dewar, Jane; Clayton, Andrew; Knox, Alan J; Fogarty, Andrew W

2015-10-01

Pseudomonas aeruginosa produces quorum sensing signal molecules that are potential biomarkers for infection.A prospective study of 60 cystic fibrosis patients with chronic P. aeruginosa, who required intravenous antibiotics for pulmonary exacerbations, was undertaken. Clinical measurements and biological samples were obtained at the start and end of the treatment period. Additional data were available for 29 of these patients when they were clinically stable.Cross-sectionally, quorum sensing signal molecules were detectable in the sputum, plasma and urine of 86%, 75% and 83% patients, respectively. They were positively correlated between the three biofluids. Positive correlations were observed for most quorum sensing signal molecules in sputum, plasma and urine, with quantitative measures of pulmonary P. aeruginosa load at the start of a pulmonary exacerbation. Plasma concentrations of 2-nonyl-4-hydroxy-quinoline (NHQ) were significantly higher at the start of a pulmonary exacerbation compared to clinical stability (p<0.01). Following the administration of systemic antibiotics, plasma 2-heptyl-4-hydroxyquinoline (p=0.02) and NHQ concentrations (p<0.01) decreased significantly.In conclusion, quorum sensing signal molecules are detectable in cystic fibrosis patients with pulmonary P. aeruginosa infection and are positively correlated with quantitative measures of P. aeruginosa. NHQ correlates with clinical status and has potential as a novel biomarker for P. aeruginosa infection. Copyright ©ERS 2015.

Interactions between Microcystis aeruginosa and coexisting amoxicillin contaminant at different phosphorus levels.

PubMed

Liu, Ying; Chen, Shi; Chen, Xiao; Zhang, Jian; Gao, Baoyu

2015-10-30

Microcystis aeruginosa was cultured with 0.05-5 mg L(-1) of phosphorus and exposed to 200-500 ng L(-1) of amoxicillin for seven days. Amoxicillin presented no significant effect (p>0.05) on the growth of M. aeruginosa at phosphorus levels of 0.05 and 0.2 mg L(-1), but stimulated algal growth as a hormesis effect at phosphorus levels of 1 and 5 mg L(-1). Phosphorus and amoxicillin affected the contents of chlorophyll-a, adenosine triphosphate (ATP) and malondialdehyde, the expression of psbA and rbcL, as well as the activities of adenosinetriphosphatase and glutathione S-transferase in similar manners, but regulated the production and release of microcystins and the activities of superoxide dismutase and peroxidase in different ways. Increased photosynthesis activity was related with the ATP consumption for the stress response to amoxicillin, and the stress response was enhanced as the phosphorus concentration increased. The biodegradation of amoxicillin by M. aeruginosa increased from 11.5% to 28.2% as the phosphorus concentration increased. Coexisting amoxicillin aggravated M. aeruginosa pollution by increasing cell density and concentration of microcystins, while M. aeruginosa alleviated amoxicillin pollution via biodegradation. The interactions between M. aeruginosa and amoxicillin were significantly regulated by phosphorus (p<0.05) and led to a complicated situation of combined pollution. Copyright © 2015 Elsevier B.V. All rights reserved.

Pseudomonas aeruginosa quorum sensing molecules correlate with clinical status in cystic fibrosis

PubMed Central

Halliday, Nigel; Cámara, Miguel; Barrett, David A.; Williams, Paul; Forrester, Douglas L.; Simms, Rebecca; Smyth, Alan R.; Honeybourne, David; Whitehouse, Joanna L.; Nash, Edward F.; Dewar, Jane; Clayton, Andrew; Knox, Alan J.; Fogarty, Andrew W.

2015-01-01

Pseudomonas aeruginosa produces quorum sensing signal molecules that are potential biomarkers for infection. A prospective study of 60 cystic fibrosis patients with chronic P. aeruginosa, who required intravenous antibiotics for pulmonary exacerbations, was undertaken. Clinical measurements and biological samples were obtained at the start and end of the treatment period. Additional data were available for 29 of these patients when they were clinically stable. Cross-sectionally, quorum sensing signal molecules were detectable in the sputum, plasma and urine of 86%, 75% and 83% patients, respectively. They were positively correlated between the three biofluids. Positive correlations were observed for most quorum sensing signal molecules in sputum, plasma and urine, with quantitative measures of pulmonary P. aeruginosa load at the start of a pulmonary exacerbation. Plasma concentrations of 2-nonyl-4-hydroxy-quinoline (NHQ) were significantly higher at the start of a pulmonary exacerbation compared to clinical stability (p<0.01). Following the administration of systemic antibiotics, plasma 2-heptyl-4-hydroxyquinoline (p=0.02) and NHQ concentrations (p<0.01) decreased significantly. In conclusion, quorum sensing signal molecules are detectable in cystic fibrosis patients with pulmonary P. aeruginosa infection and are positively correlated with quantitative measures of P. aeruginosa. NHQ correlates with clinical status and has potential as a novel biomarker for P. aeruginosa infection. PMID:26022946

Phylogenetic Distribution of CRISPR-Cas Systems in Antibiotic-Resistant Pseudomonas aeruginosa

PubMed Central

van Belkum, Alex; Soriaga, Leah B.; LaFave, Matthew C.; Akella, Srividya; Veyrieras, Jean-Baptiste; Barbu, E. Magda; Shortridge, Dee; Blanc, Bernadette; Hannum, Gregory; Zambardi, Gilles; Miller, Kristofer; Enright, Mark C.; Mugnier, Nathalie; Brami, Daniel; Schicklin, Stéphane; Felderman, Martina; Schwartz, Ariel S.; Richardson, Toby H.; Peterson, Todd C.; Hubby, Bolyn

2015-01-01

ABSTRACT Pseudomonas aeruginosa is an antibiotic-refractory pathogen with a large genome and extensive genotypic diversity. Historically, P. aeruginosa has been a major model system for understanding the molecular mechanisms underlying type I clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated protein (CRISPR-Cas)-based bacterial immune system function. However, little information on the phylogenetic distribution and potential role of these CRISPR-Cas systems in molding the P. aeruginosa accessory genome and antibiotic resistance elements is known. Computational approaches were used to identify and characterize CRISPR-Cas systems within 672 genomes, and in the process, we identified a previously unreported and putatively mobile type I-C P. aeruginosa CRISPR-Cas system. Furthermore, genomes harboring noninhibited type I-F and I-E CRISPR-Cas systems were on average ~300 kb smaller than those without a CRISPR-Cas system. In silico analysis demonstrated that the accessory genome (n = 22,036 genes) harbored the majority of identified CRISPR-Cas targets. We also assembled a global spacer library that aided the identification of difficult-to-characterize mobile genetic elements within next-generation sequencing (NGS) data and allowed CRISPR typing of a majority of P. aeruginosa strains. In summary, our analysis demonstrated that CRISPR-Cas systems play an important role in shaping the accessory genomes of globally distributed P. aeruginosa isolates. PMID:26604259

Photodynamic antimicrobial therapy to inhibit pseudomonas aeruginosa of corneal isolates (Conference Presentation)

NASA Astrophysics Data System (ADS)

Durkee, Heather A.; Relhan, Nidhi; Arboleda, Alejandro; Halili, Francisco; De Freitas, Carolina; Alawa, Karam; Aguilar, Mariela C.; Amescua, Guillermo; Miller, Darlene; Parel, Jean-Marie

2016-03-01

Keratitis associated with Pseudomonas aeruginosa is difficult to manage. Treatment includes antibiotic eye drops, however, some strains of Pseudomonas aeruginosa are resistant. Current research efforts are focused on finding alternative and adjunct therapies to treat multi-drug resistant bacteria. One promising alternate technique is photodynamic therapy (PDT). The purpose of this study was to evaluate the effect of riboflavin- and rose bengal-mediated PDT on Pseudomonas aeruginosa keratitis isolates in vitro. Two isolates (S+U- and S-U+) of Pseudomonas aeruginosa were derived from keratitis patients and exposed to five experimental groups: (1) Control (dark, UV-A irradiation, 525nm irradiation); (2) 0.1% riboflavin (dark, UV-A irradiation); and (3) 0.1% rose bengal, (4) 0.05% rose bengal and (5) 0.01% rose bengal (dark, 525nm irradiation). Three days after treatment, in dark conditions of all concentration of riboflavin and rose bengal showed no inhibition in both S+U- and S-U+ strains of Pseudomonas aeruginosa. In 0.1% and 0.05% rose bengal irradiated groups, for both S+U- and S-U+ strains, there was complete inhibition of bacterial growth in the central 50mm zone corresponding to the diameter of the green light source. These in vitro results suggest that rose bengal photodynamic therapy may be an effective adjunct treatment for Pseudomonas aeruginosa keratitis.

Coexistence of metallo-beta-lactamase-encoding genes in Pseudomonas aeruginosa.

PubMed

Mohanam, Lavanya; Menon, Thangam

2017-07-01

The emergence and rapid spread of carbapenem resistance mediated by metallo-beta-lactamase (MBL) in Pseudomonas aeruginosa is of major concern due to limited therapeutic options. This study was aimed at detecting the presence of MBL and its association with integrons in imipenem-resistant P. aeruginosa isolates and to determine their genetic relatedness. A total of 213 P. aeruginosa isolates were collected from two tertiary care centres and tested against anti-pseudomonal antibiotics by antimicrobial susceptibility testing, followed by the detection of MBL production by combined disk method. Minimum inhibitory concentration (MIC) of meropenem was determined by E-test. Multiplex polymerase chain reaction (PCR) was performed for the detection of blaSPM, blaIMP, blaVIM, blaNDM, blaGIM and blaSIM. PCR was carried out to characterize the variable region of class 1 integron. Transcongujation assay was carried out for the confirmation of plasmid-mediated resistance. Enterobacterial repetitive intergenic consensus sequence (ERIC)-PCR was performed for determining the genetic relatedness among P. aeruginosa isolates. Of the 213 P. aeruginosa isolates, 22 (10%) were found to be carbapenem resistant and these were from pus 18 (82%), urine 2 (9%), sputum 1 (5%) and tracheal wash 1 (5%). Among 22 isolates, 18 (81.8%) were found to be MBL producers by phenotypic method and MIC range of meropenem was 8 to >32 μg/ml. PCR amplification showed that 20 (91%) isolates carried any one of the MBL genes tested: blaVIM and blaNDM in seven (32%) and six (27%) isolates, respectively; blaVIM and blaNDMin three (14%); blaIMP and blaNDM in two (9%); blaVIM and blaIMP in one (5%) isolate. The blaVIM, blaIMP and blaNDM were found to co-exist in one isolate. None of the isolates were positive for blaSPM, blaSIM and blaGIM. All 22 isolates carried class I integron. Of the 20 MBL-positive isolates, transconjugants were obtained for 15 isolates. ERIC-PCR analysis showed all isolates to be clonally

[The effect of biyuanshu oral liquid on the formation of Pseudomonas aeruginosa biofilms in vitro].

PubMed

Liu, Xiang; Chen, Haihong; Wang, Shengqing

2012-07-01

To observe the effect of biyuanshu oral liquid on the formation of pseudomonas aeruginosa biofilms in vitro. Pseudomonas aeruginosa biofilm was established by plate culture and detected by Scanning electron microscopy and AgNO3 staining. After treated with different dosages of biyuanshu oral liquid and erythromycin, the pseudomonas aeruginosa biofilms were observed by AgNO3 staining and the number of viable bacteria were measured by serial dilution. The pseudomonas aeruginosa biofilms could be detected by SEM at the seventh culture day and it was consistent with the detection of AgNO3 staining. The biyuanshu oral liquid and erythromycin have the effect on inhibiting the formation of pseudomonas aeruginosa biofilms. But with the already formed pseudomonas aeruginosa biofilms the inhibition was not significant. The serial dilution method showed that the viable counts of bacteria of biyuanshu oral liquid and erythromycin treated groups were significantly lower than those untreated groups (P < 0.05). The biyuanshu oral liquid and erythromycin can inhibit the formation of pseudomonas aeruginosa biofilms in vitro.

Application of bacteriophages to selectively remove Pseudomonas aeruginosa in water and wastewater filtration systems.

PubMed

Zhang, Yanyan; Hunt, Heather K; Hu, Zhiqiang

2013-09-01

Water and wastewater filtration systems often house pathogenic bacteria, which must be removed to ensure clean, safe water. Here, we determine the persistence of the model bacterium Pseudomonas aeruginosa in two types of filtration systems, and use P. aeruginosa bacteriophages to determine their ability to selectively remove P. aeruginosa. These systems used beds of either anthracite or granular activated carbon (GAC), which were operated at an empty bed contact time (EBCT) of 45 min. The clean bed filtration systems were loaded with an instantaneous dose of P. aeruginosa at a total cell number of 2.3 (± 0.1 [standard deviation]) × 10(7) cells. An immediate dose of P. aeruginosa phages (1 mL of phage stock at the concentration of 2.7 × 10(7) PFU (Plaque Forming Units)/mL) resulted in a reduction of 50% (± 9%) and >99.9% in the effluent P. aeruginosa concentrations in the clean anthracite and GAC filters, respectively. To further evaluate the effects of P. aeruginosa phages, synthetic stormwater was run through anthracite and GAC biofilters where mixed-culture biofilms were present. Eighty five days after an instantaneous dose of P. aeruginosa (2.3 × 10(7) cells per filter) on day 1, 7.5 (± 2.8) × 10(7) and 1.1 (± 0.5) × 10(7) P. aeruginosa cells/g filter media were detected in the top layer (close to the influent port) of the anthracite and GAC biofilters, respectively, demonstrating the growth and persistence of pathogenic bacteria in the biofilters. A subsequent 1-h dose of phages, at the concentration of 5.1 × 10(6) PFU/mL and flow rate of 1.6 mL/min, removed the P. aeruginosa inside the GAC biofilters and the anthracite biofilters by 70% (± 5%) and 56% (± 1%), respectively, with no P. aeruginosa detected in the effluent, while not affecting ammonia oxidation or the ammonia-oxidizing bacterial community inside the biofilters. These results suggest that phage treatment can selectively remove pathogenic bacteria with minimal impact on beneficial

Pseudomonas aeruginosa isolation in patients with non-cystic fibrosis bronchiectasis: a retrospective study.

PubMed

Wang, Hong; Ji, Xiao-Bin; Mao, Bei; Li, Cheng-Wei; Lu, Hai-Wen; Xu, Jin-Fu

2018-03-14

Pseudomonas aeruginosa (P. aeruginosa) occupies an important niche in the pathogenic microbiome of bronchiectasis. The objective of this study is to evaluate the clinical characteristics and prognostic value of P. aeruginosa in Chinese adult patients with bronchiectasis. This retrospective and follow-up study enrolled 1188 patients diagnosed with bronchiectasis at Shanghai Pulmonary Hospital between January 2011 and December 2012. The patients' clinical data including anthropometry, clinical symptoms, serum biomarkers, radiographic manifestations and lung function indices were reviewed. The median follow-up duration (IQR) was 44 (40-54) months, during which 289 patients were lost to follow-up. Data from 899 patients were collected and analysed for the outcomes of mortality, annual exacerbation frequency and health-related quality of life. P. aeruginosa was isolated from 232 patients, alongside other pathogens such as Aspergillus (n=75) and Candida albicans (n=72). There were 74 deaths (12% of patients with P. aeruginosa , 7.3% of those without) over the course of the follow-up. The isolation of P. aeruginosa was a risk factor for all-cause mortality (HR, 3.07; 95% CI 1.32 to 7.15) and was associated with high rates of exacerbations (ie, ≥3 exacerbations per year of follow-up) (HR, 2.40; 95% CI 1.20 to 4.79). Patients with P. aeruginosa also had worse scores on the Hospital Anxiety and Depression Scale (anxiety, p=0.005; depression, p<0.001), the Leicester Cough Questionnaire (p=0.033) and the modified Medical Research Council scale (p=0.001) compared with those without P. aeruginosa . Isolation of P. aeruginosa in patients with bronchiectasis is a significant prognostic indicator and should be a major factor in the clinical management of the disease. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Strain- and Substrate-Dependent Redox Mediator and Electricity Production by Pseudomonas aeruginosa

PubMed Central

Bosire, Erick M.; Blank, Lars M.

2016-01-01

ABSTRACT Pseudomonas aeruginosa is an important, thriving member of microbial communities of microbial bioelectrochemical systems (BES) through the production of versatile phenazine redox mediators. Pure culture experiments with a model strain revealed synergistic interactions of P. aeruginosa with fermenting microorganisms whereby the synergism was mediated through the shared fermentation product 2,3-butanediol. Our work here shows that the behavior and efficiency of P. aeruginosa in mediated current production is strongly dependent on the strain of P. aeruginosa. We compared levels of phenazine production by the previously investigated model strain P. aeruginosa PA14, the alternative model strain P. aeruginosa PAO1, and the BES isolate Pseudomonas sp. strain KRP1 with glucose and the fermentation products 2,3-butanediol and ethanol as carbon substrates. We found significant differences in substrate-dependent phenazine production and resulting anodic current generation for the three strains, with the BES isolate KRP1 being overall the best current producer and showing the highest electrochemical activity with glucose as a substrate (19 μA cm−2 with ∼150 μg ml−1 phenazine carboxylic acid as a redox mediator). Surprisingly, P. aeruginosa PAO1 showed very low phenazine production and electrochemical activity under all tested conditions. IMPORTANCE Microbial fuel cells and other microbial bioelectrochemical systems hold great promise for environmental technologies such as wastewater treatment and bioremediation. While there is much emphasis on the development of materials and devices to realize such systems, the investigation and a deeper understanding of the underlying microbiology and ecology are lagging behind. Physiological investigations focus on microorganisms exhibiting direct electron transfer in pure culture systems. Meanwhile, mediated electron transfer with natural redox compounds produced by, for example, Pseudomonas aeruginosa might enable an

Strong incidence of Pseudomonas aeruginosa on bacterial rrs and ITS genetic structures of cystic fibrosis sputa

PubMed Central

Pages-Monteiro, Laurence; Marti, Romain; Commun, Carine; Alliot, Nolwenn; Bardel, Claire; Meugnier, Helene; Perouse-de-Montclos, Michele; Reix, Philippe; Durieu, Isabelle; Durupt, Stephane; Vandenesch, Francois; Freney, Jean; Cournoyer, Benoit; Doleans-Jordheim, Anne

2017-01-01

Cystic fibrosis (CF) lungs harbor a complex community of interacting microbes, including pathogens like Pseudomonas aeruginosa. Meta-taxogenomic analysis based on V5-V6 rrs PCR products of 52 P. aeruginosa-positive (Pp) and 52 P. aeruginosa-negative (Pn) pooled DNA extracts from CF sputa suggested positive associations between P. aeruginosa and Stenotrophomonas and Prevotella, but negative ones with Haemophilus, Neisseria and Burkholderia. Internal Transcribed Spacer analyses (RISA) from individual DNA extracts identified three significant genetic structures within the CF cohorts, and indicated an impact of P. aeruginosa. RISA clusters Ip and IIIp contained CF sputa with a P. aeruginosa prevalence above 93%, and of 24.2% in cluster IIp. Clusters Ip and IIIp showed lower RISA genetic diversity and richness than IIp. Highly similar cluster IIp RISA profiles were obtained from two patients harboring isolates of a same P. aeruginosa clone, suggesting convergent evolution in the structure of their microbiota. CF patients of cluster IIp had received significantly less antibiotics than patients of clusters Ip and IIIp but harbored the most resistant P. aeruginosa strains. Patients of cluster IIIp were older than those of Ip. The effects of P. aeruginosa on the RISA structures could not be fully dissociated from the above two confounding factors but several trends in these datasets support the conclusion of a strong incidence of P. aeruginosa on the genetic structure of CF lung microbiota. PMID:28282386

Interconversion of large packets and small groups of cells of Micrococcus rubens: dependence upon magnesium and phosphate.

PubMed Central

Yamada, M; Koyama, T; Matsuhashi, M

1977-01-01

Micrococcus rubens, a gram-positive occus, usually forms large, cubic packets of more than 500 cells that are regularly arranged in three-dimensional cell groups. In medium with extremely low concentration of Mg2+ and phosphate, in which the cells can only grow on a agar surface, it formed small groups of 2 to 20 cells. Irregularly arraged cell groups of intermediated size were obtained in culture media containing intermediated concentrations of Mg2+ and phosphate. Mutants that formed irregular cell groups of intermediate size under normal culture conditions were also obtained. Images PMID:845123

Pseudomonas aeruginosa adapts its iron uptake strategies in function of the type of infections

PubMed Central

Cornelis, Pierre; Dingemans, Jozef

2013-01-01

Pseudomonas aeruginosa is a Gram-negative γ-Proteobacterium which is known for its capacity to colonize various niches, including some invertebrate and vertebrate hosts, making it one of the most frequent bacteria causing opportunistic infections. P. aeruginosa is able to cause acute as well as chronic infections and it uses different colonization and virulence factors to do so. Infections range from septicemia, urinary infections, burn wound colonization, and chronic colonization of the lungs of cystic fibrosis patients. Like the vast majority of organisms, P. aeruginosa needs iron to sustain growth. P. aeruginosa utilizes different strategies to take up iron, depending on the type of infection it causes. Two siderophores are produced by this bacterium, pyoverdine and pyochelin, characterized by high and low affinities for iron respectively. P. aeruginosa is also able to utilize different siderophores from other microorganisms (siderophore piracy). It can also take up heme from hemoproteins via two different systems. Under microaerobic or anaerobic conditions, P. aeruginosa is also able to take up ferrous iron via its Feo system using redox-cycling phenazines. Depending on the type of infection, P. aeruginosa can therefore adapt by switching from one iron uptake system to another as we will describe in this short review. PMID:24294593

Swimming Motility Mediates the Formation of Neutrophil Extracellular Traps Induced by Flagellated Pseudomonas aeruginosa

PubMed Central

Sil, Payel; Chassaing, Benoit; Yoo, Dae-goon; Gewirtz, Andrew T.; Goldberg, Joanna B.; McCarter, Linda L.; Rada, Balázs

2016-01-01

Pseudomonas aeruginosa is an opportunistic pathogen causing severe infections often characterized by robust neutrophilic infiltration. Neutrophils provide the first line of defense against P. aeruginosa. Aside from their defense conferred by phagocytic activity, neutrophils also release neutrophil extracellular traps (NETs) to immobilize bacteria. Although NET formation is an important antimicrobial process, the details of its mechanism are largely unknown. The identity of the main components of P. aeruginosa responsible for triggering NET formation is unclear. In this study, our focus was to identify the main bacterial factors mediating NET formation and to gain insight into the underlying mechanism. We found that P. aeruginosa in its exponential growth phase promoted strong NET formation in human neutrophils while its NET-inducing ability dramatically decreased at later stages of bacterial growth. We identified the flagellum as the primary component of P. aeruginosa responsible for inducing NET extrusion as flagellum-deficient bacteria remained seriously impaired in triggering NET formation. Purified P. aeruginosa flagellin, the monomeric component of the flagellum, does not stimulate NET formation in human neutrophils. P. aeruginosa-induced NET formation is independent of the flagellum-sensing receptors TLR5 and NLRC4 in both human and mouse neutrophils. Interestingly, we found that flagellar motility, not flagellum binding to neutrophils per se, mediates NET release induced by flagellated bacteria. Immotile, flagellar motor-deficient bacterial strains producing paralyzed flagella did not induce NET formation. Forced contact between immotile P. aeruginosa and neutrophils restored their NET-inducing ability. Both the motAB and motCD genetic loci encoding flagellar motor genes contribute to maximal NET release; however the motCD genes play a more important role. Phagocytosis of P. aeruginosa and superoxide production by neutrophils were also largely dependent upon

Solar Disinfection of Pseudomonas aeruginosa in Harvested Rainwater: A Step towards Potability of Rainwater

PubMed Central

Amin, Muhammad T.; Nawaz, Mohsin; Amin, Muhammad N.; Han, Mooyoung

2014-01-01

Efficiency of solar based disinfection of Pseudomonas aeruginosa (P. aeruginosa) in rooftop harvested rainwater was evaluated aiming the potability of rainwater. The rainwater samples were exposed to direct sunlight for about 8–9 hours and the effects of water temperature (°C), sunlight irradiance (W/m2), different rear surfaces of polyethylene terephthalate bottles, variable microbial concentrations, pH and turbidity were observed on P. aeruginosa inactivation at different weathers. In simple solar disinfection (SODIS), the complete inactivation of P. aeruginosa was obtained only under sunny weather conditions (>50°C and >700 W/m2) with absorptive rear surface. Solar collector disinfection (SOCODIS) system, used to improve the efficiency of simple SODIS under mild and weak weather, completely inactivated the P. aeruginosa by enhancing the disinfection efficiency of about 20% only at mild weather. Both SODIS and SOCODIS systems, however, were found inefficient at weak weather. Different initial concentrations of P. aeruginosa and/or Escherichia coli had little effects on the disinfection efficiency except for the SODIS with highest initial concentrations. The inactivation of P. aeruginosa increased by about 10–15% by lowering the initial pH values from 10 to 3. A high initial turbidity, adjusted by adding kaolin, adversely affected the efficiency of both systems and a decrease, about 15–25%; in inactivation of P. aeruginosa was observed. The kinetics of this study was investigated by Geeraerd Model for highlighting the best disinfection system based on reaction rate constant. The unique detailed investigation of P. aeruginosa disinfection with sunlight based disinfection systems under different weather conditions and variable parameters will help researchers to understand and further improve the newly invented SOCODIS system. PMID:24595188

Evaluation of antibacterial properties of Barium Zirconate Titanate (BZT) nanoparticle

PubMed Central

Mohseni, Simin; Aghayan, Mahdi; Ghorani-Azam, Adel; Behdani, Mohammad; Asoodeh, Ahmad

2014-01-01

So far, the antibacterial activity of some organic and inorganic compounds has been studied. Barium zirconate titanate [Ba(ZrxTi1-x)O3] (x = 0.05) nanoparticle is an example of inorganic materials. In vitro studies have provided evidence for the antibacterial activity of this nanoparticle. In the current study, the nano-powder was synthesized by sol-gel method. X-ray diffraction showed that the powder was single-phase and had a perovskite structure at the calcination temperature of 1000 °C. Antibacterial activity of the desired nanoparticle was assessed on two gram-positive (Staphylococcus aureus PTCC1431 and Micrococcus luteus PTCC1625) and two gram-negative (Escherichia coli HP101BA 7601c and clinically isolated Klebsiella pneumoniae) bacteria according to Radial Diffusion Assay (RDA). The results showed that the antibacterial activity of BZT nano-powder on both gram-positive and gram-negative bacteria was acceptable. The minimum inhibitory concentration of this nano-powder was determined. The results showed that MIC values for E. coli, K. pneumoniae, M. luteus and S. aureus were about 2.3 μg/mL, 7.3 μg/mL, 3 μg/mL and 12 μg/mL, respectively. Minimum bactericidal concentration (MBC) was also evaluated and showed that the growth of E. coli, K. pneumoniae, M. luteus and S. aureus could be decreased at 2.3, 14, 3 and 18 μg/mL of BZT. Average log reduction in viable bacteria count in time-kill assay ranged between 6 Log10 cfu/mL to zero after 24 h of incubation with BZT nanoparticle. PMID:25763046

Effect of impact stress on microbial recovery on an agar surface.

PubMed Central

Stewart, S L; Grinshpun, S A; Willeke, K; Terzieva, S; Ulevicius, V; Donnelly, J

1995-01-01

Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. The relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving agar slide impactor operating over a flow rate range from 3.8 to 40 liters/min yielding impaction velocities from 24 to 250 m/s. As a reference, the sixth stage of the Andersen Six-Stage Viable Particle Sizing Sampler was used at its operating flow rate of 28.3 liters/min (24 m/s). At a collection efficiency of close to 100% for the agar slide impactor, an increase in sampling flow rate and, therefore, in impaction velocity produced a significant decline in the percentage of microorganisms recovered. Conversely, when the collection efficiency was less than 100%, greater recovery and lower injury rates occurred. The highest relative rate of recovery (approximately 51% for P. fluorescens and approximately 62% for M. luteus) was obtained on the complete (Trypticase soy agar) medium at 40 and 24 m/s (6.4 and 3.8 liters/min), respectively. M. luteus demonstrated less damage than P. fluorescens, suggesting the hardy nature of the gram-positive strain versus that of the gram-negative microorganism. Comparison of results from the agar slide and Andersen impactors at the same sampling velocity showed that recovery and injury due to collection depends not only on the magnitude of the impaction velocity but also on the degree to which the microorganisms may be embedded in the collection medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7747946

Anti-Quorum Sensing Activity of Forsythia suspense on Chromobacterium violaceum and Pseudomonas aeruginosa.

PubMed

Zhang, An; Chu, Wei-Hua

2017-01-01

Quorum sensing (QS) plays an important role in the production of virulence factors and pathogenicity in Pseudomonas aeruginosa , and the interruption of QS will be a hopeful pathway to combat bacterial infection. In this study, we selected Forsythia suspense (Thunb.) Vahl from traditional Chinese herbal medicines for its anti-QS activity. Anti-QS of F. suspense extracts (FSE) was monitored using the Chromobacterium violaceum 12472 bioassay. Standard methods were used to investigate the effects of FSE on QS-controlled virulence factors production, swimming motility, and biofilm establishment in P. aeruginosa PAO1. FSE could obviously inhibit the violacein production in C. violaceum 12472 and also could inhibit quorum sensing-regulated virulence factors production and biofilm formation in P. aeruginosa in a concentration-dependent manner. The elastase activity and pyocyanin production were inhibited at a maximum of 40.97 and 47.58% when P. aeruginosa was grown in the presence of 0.25 g/mL FSE, which can also inhibit swimming motility of P. aeruginosa . The biofilm formation ability was decreased about 72.45% when in PAO1 cultured with the 0.25 g/mL FSE. The results suggested that FSE may be used as an alternative drug to control and handle harmful infections caused by bacterial pathogens based on QS inhibition. Forsythia suspense water extract could obviously inhibit the purple pigment production in C. violaceum 12472 Forsythia suspense water extract could inhibit QS-regulated virulence factors production and biofilm formation in P. aeruginosa . Abbreviations used: QS: Quorum sensing, Pseudomonas aeruginosa P. aeruginosa , Forsythia suspense F. suspense , FSE: F. suspense extracts, Chromobacterium violaceum 12472 C. violaceum 12472, AIs: autoinducers, AHLs: N -acyl-homoserinelactones, LB: Luria-Bertani, MICs: Minimum inhibitory concentrations, CFU: Colony-Forming Units, ATCC: American Type Culture Collection, PBS: phosphate buffered saline.

Anti-Quorum Sensing Activity of Forsythia suspense on Chromobacterium violaceum and Pseudomonas aeruginosa

PubMed Central

Zhang, An; Chu, Wei-Hua

2017-01-01

Background: Quorum sensing (QS) plays an important role in the production of virulence factors and pathogenicity in Pseudomonas aeruginosa, and the interruption of QS will be a hopeful pathway to combat bacterial infection. Objective: In this study, we selected Forsythia suspense (Thunb.) Vahl from traditional Chinese herbal medicines for its anti-QS activity. Materials and Methods: Anti-QS of F. suspense extracts (FSE) was monitored using the Chromobacterium violaceum 12472 bioassay. Standard methods were used to investigate the effects of FSE on QS-controlled virulence factors production, swimming motility, and biofilm establishment in P. aeruginosa PAO1. Results: FSE could obviously inhibit the violacein production in C. violaceum 12472 and also could inhibit quorum sensing–regulated virulence factors production and biofilm formation in P. aeruginosa in a concentration-dependent manner. The elastase activity and pyocyanin production were inhibited at a maximum of 40.97 and 47.58% when P. aeruginosa was grown in the presence of 0.25 g/mL FSE, which can also inhibit swimming motility of P. aeruginosa. The biofilm formation ability was decreased about 72.45% when in PAO1 cultured with the 0.25 g/mL FSE. The results suggested that FSE may be used as an alternative drug to control and handle harmful infections caused by bacterial pathogens based on QS inhibition. SUMMARY Forsythia suspense water extract could obviously inhibit the purple pigment production in C. violaceum 12472Forsythia suspense water extract could inhibit QS-regulated virulence factors production and biofilm formation in P. aeruginosa. Abbreviations used: QS: Quorum sensing, Pseudomonas aeruginosa P. aeruginosa, Forsythia suspense F. suspense, FSE: F. suspense extracts, Chromobacterium violaceum 12472 C. violaceum 12472, AIs: autoinducers, AHLs: N-acyl-homoserinelactones, LB: Luria-Bertani, MICs: Minimum inhibitory concentrations, CFU: Colony-Forming Units, ATCC: American Type Culture Collection

2-Aminoacetophenone as a potential breath biomarker for Pseudomonas aeruginosa in the cystic fibrosis lung

PubMed Central

2010-01-01

Background Pseudomonas aeruginosa infections are associated with progressive life threatening decline of lung function in cystic fibrosis sufferers. Growth of Ps. aeruginosa releases a "grape-like" odour that has been identified as the microbial volatile organic compound 2-aminoacetophenone (2-AA). Methods We investigated 2-AA for its specificity to Ps. aeruginosa and its suitability as a potential breath biomarker of colonisation or infection by Solid Phase Micro Extraction and Gas Chromatography-Mass Spectrometry (GC/MS). Results Cultures of 20 clinical strains of Ps. aeruginosa but not other respiratory pathogens had high concentrations of 2-AA in the head space of in vitro cultures when analysed by GC/MS. 2-AA was stable for 6 hours in deactivated glass sampling bulbs but was not stable in Tedlar® bags. Optimisation of GC/MS allowed detection levels of 2-AA to low pico mol/mol range in breath. The 2-AA was detected in a significantly higher proportion of subjects colonised with Ps. aeruginosa 15/16 (93.7%) than both the healthy controls 5/17 (29%) (p < 0.0002) and CF patients not colonised with Ps. aeruginosa 4/13(30.7%) (p < 0.001). The sensitivity and specificity of the 2-AA breath test compared to isolation of Ps. aeruginosa in sputum and/or BALF was 93.8% (95% CI, 67-99) and 69.2% (95% CI, 38-89) respectively. The peak integration values for 2-AA analysis in the breath samples were significantly higher in Ps. aeruginosa colonised subjects (median 242, range 0-1243) than the healthy controls (median 0, range 0-161; p < 0.001) and CF subjects not colonised with Ps. aeruginosa (median 0, range 0-287; p < 0.003) Conclusions Our results report 2-AA as a promising breath biomarker for the detection of Ps. aeruginosa infections in the cystic fibrosis lung. PMID:21054900

Indoleacetic acid production and plant growth promoting potential of bacterial endophytes isolated from rice (Oryza sativa L.) seeds.

PubMed

Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung

2017-06-01

Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.

Pitfalls in efficacy testing – how important is the validation of neutralization of chlorhexidine digluconate?

PubMed Central

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-01-01

Background Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Methods Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 – 8°C onto tryptic soy agar containing a neutralizing mixture. Results The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Conclusion Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy

Pitfalls in efficacy testing--how important is the validation of neutralization of chlorhexidine digluconate?

PubMed

Reichel, Mirja; Heisig, Peter; Kampf, Günter

2008-12-02

Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 - 8 degrees C onto tryptic soy agar containing a neutralizing mixture. The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid

The algicidal mechanism of prodigiosin from Hahella sp. KA22 against Microcystis aeruginosa.

PubMed

Yang, Ke; Chen, Qiuliang; Zhang, Danyang; Zhang, Huajun; Lei, Xueqian; Chen, Zhangran; Li, Yi; Hong, Yaling; Ma, Xiaohong; Zheng, Wei; Tian, Yun; Zheng, Tianling; Xu, Hong

2017-08-10

In recent years, Microcystis aeruginosa blooms have occurred throughout the world, causing huge economic losses and destroying aquatic ecosystems. It is necessary to develop effective and ecofriendly methods to control M. aeruginosa blooms. Here, we report a high algicidal activity of prodigiosin (PG) against M. aeruginosa as well as the algicidal mechanism. PG showed high algicidal activity against M. aeruginosa, with a 50% lethal dose (LD 50 ) of 5.87 μg/mL in 72 h. A combination of methods, including propidium iodide and Annexin V-fluorescein staining assays and light and electron microscopy indicated the existence of two modes of cell death with features similar to those in eukaryotic programmed cell death: necrotic-like and apoptotic-like. Biochemical and physiological analyses showed that PG generates reactive oxygen species (ROS), which induce lipid peroxidation, damage the membrane system and destroy the function of the photosystem. A proteomics analysis revealed that many proteins were differentially expressed in response to PG stress and that most of these proteins were involved in important metabolic processes, which may trigger necrotic-like or apoptotic-like cell death. The present study sheds light on the multiple toxicity mechanisms of PG on M. aeruginosa and its potential for controlling the occurrence of M. aeruginosa blooms in lakes.

[Effect of Pseudomonas aeruginosa exometabolites on planktonic and biofilm cultures of Escherichia coli].

PubMed

Kuznetsova, M V; Karpunina, T I; Maslennikova, I L; Nesterova, L Iu; Demakov, V A

2012-01-01

Study the effect of P. aeruginosa exometabolites on planktonic and biofilm cultures of bioluminescent E. coli strain. E. coli K12 TG1 (pF1 lux+ Ap(r)) recombinant bioluminescent strain, P. aeruginosa ATCC 27853 reference strain and 2 nosocomial isolates were used. Pyocyanin and pyoverdin content in supernatant of P. aeruginosa over-night cultures was evaluated according to E. Deziel et al. (2001). Planktonic and biofilm cultures of E. coli were obtained in 96-well plates (LB, statically, 37 degrees C), optical density of plankton, film biomass (OD600, OD580) and bioluminescence in plankton and biofilm were evaluated in microplate reader Infiniti M200 (Tecan, Austria). P. aeruginosa exometabolites increased the duration of lag-phase in E. coli, and short term exposition inhibited luminescence of planktonic cells. These effects are determined by bactericidal action ofpyocyanin and pyoverdin. Supernatants ofover-night cultures of P. aeruginosa inhibit formation of biofilm and disrupt the formed biofilm of E. coli. Effect of pyocyanin and pyoverdin on these processes is not established, other factors may have higher significance. Bioluminescence of E. coli K12 TGI that reflects the energetic status of the cell allows to evaluate and prognose the character of coexistence of P. aeruginosa in combined with E. coli planktonic and biofilm culture.

Current and future therapies for Pseudomonas aeruginosa infection in patients with cystic fibrosis.

PubMed

Smith, Wynne D; Bardin, Emmanuelle; Cameron, Loren; Edmondson, Claire L; Farrant, Katie V; Martin, Isaac; Murphy, Ronan A; Soren, Odel; Turnbull, Andrew R; Wierre-Gore, Natasha; Alton, Eric W; Bundy, Jacob G; Bush, Andrew; Connett, Gary J; Faust, Saul N; Filloux, Alain; Freemont, Paul S; Jones, Andrew L; Takats, Zoltan; Webb, Jeremy S; Williams, Huw D; Davies, Jane C

2017-08-01

Pseudomonas aeruginosa opportunistically infects the airways of patients with cystic fibrosis and causes significant morbidity and mortality. Initial infection can often be eradicated though requires prompt detection and adequate treatment. Intermittent and then chronic infection occurs in the majority of patients. Better detection of P. aeruginosa infection using biomarkers may enable more successful eradication before chronic infection is established. In chronic infection P. aeruginosa adapts to avoid immune clearance and resist antibiotics via efflux pumps, β-lactamase expression, reduced porins and switching to a biofilm lifestyle. The optimal treatment strategies for P. aeruginosa infection are still being established, and new antibiotic formulations such as liposomal amikacin, fosfomycin in combination with tobramycin and inhaled levofloxacin are being explored. Novel agents such as the alginate oligosaccharide OligoG, cysteamine, bacteriophage, nitric oxide, garlic oil and gallium may be useful as anti-pseudomonal strategies, and immunotherapy to prevent infection may have a role in the future. New treatments that target the primary defect in cystic fibrosis, recently licensed for use, have been associated with a fall in P. aeruginosa infection prevalence. Understanding the mechanisms for this could add further strategies for treating P. aeruginosa in future. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Role of Iron Uptake Systems in Pseudomonas aeruginosa Virulence and Airway Infection

PubMed Central

Minandri, Fabrizia; Imperi, Francesco; Frangipani, Emanuela; Bonchi, Carlo; Visaggio, Daniela; Facchini, Marcella; Pasquali, Paolo; Bragonzi, Alessandra

2016-01-01

Pseudomonas aeruginosa is a leading cause of hospital-acquired pneumonia and chronic lung infections in cystic fibrosis patients. Iron is essential for bacterial growth, and P. aeruginosa expresses multiple iron uptake systems, whose role in lung infection deserves further investigation. P. aeruginosa Fe3+ uptake systems include the pyoverdine and pyochelin siderophores and two systems for heme uptake, all of which are dependent on the TonB energy transducer. P. aeruginosa also has the FeoB transporter for Fe2+ acquisition. To assess the roles of individual iron uptake systems in P. aeruginosa lung infection, single and double deletion mutants were generated in P. aeruginosa PAO1 and characterized in vitro, using iron-poor media and human serum, and in vivo, using a mouse model of lung infection. The iron uptake-null mutant (tonB1 feoB) and the Fe3+ transport mutant (tonB1) did not grow aerobically under low-iron conditions and were avirulent in the mouse model. Conversely, the wild type and the feoB, hasR phuR (heme uptake), and pchD (pyochelin) mutants grew in vitro and caused 60 to 90% mortality in mice. The pyoverdine mutant (pvdA) and the siderophore-null mutant (pvdA pchD) grew aerobically in iron-poor media but not in human serum, and they caused low mortality in mice (10 to 20%). To differentiate the roles of pyoverdine in iron uptake and virulence regulation, a pvdA fpvR double mutant defective in pyoverdine production but expressing wild-type levels of pyoverdine-regulated virulence factors was generated. Deletion of fpvR in the pvdA background partially restored the lethal phenotype, indicating that pyoverdine contributes to the pathogenesis of P. aeruginosa lung infection by combining iron transport and virulence-inducing capabilities. PMID:27271740

Pseudomonas aeruginosa ExoU augments neutrophil transepithelial migration.

PubMed

Pazos, Michael A; Lanter, Bernard B; Yonker, Lael M; Eaton, Alex D; Pirzai, Waheed; Gronert, Karsten; Bonventre, Joseph V; Hurley, Bryan P

2017-08-01

Excessive neutrophil infiltration of the lungs is a common contributor to immune-related pathology in many pulmonary disease states. In response to pathogenic infection, airway epithelial cells produce hepoxilin A3 (HXA3), initiating neutrophil transepithelial migration. Migrated neutrophils amplify this recruitment by producing a secondary gradient of leukotriene B4 (LTB4). We sought to determine whether this two-step eicosanoid chemoattractant mechanism could be exploited by the pathogen Pseudomonas aeruginosa. ExoU, a P. aeruginosa cytotoxin, exhibits phospholipase A2 (PLA2) activity in eukaryotic hosts, an enzyme critical for generation of certain eicosanoids. Using in vitro and in vivo models of neutrophil transepithelial migration, we evaluated the impact of ExoU expression on eicosanoid generation and function. We conclude that ExoU, by virtue of its PLA2 activity, augments and compensates for endogenous host neutrophil cPLA2α function, leading to enhanced transepithelial migration. This suggests that ExoU expression in P. aeruginosa can circumvent immune regulation at key signaling checkpoints in the neutrophil, resulting in exacerbated neutrophil recruitment.

CHANGES IN THE MORPHOLOGY AND POLYSACCHARIDE CONTENT OF MICROCYSTIS AERUGINOSA (CYANOBACTERIA) DURING FLAGELLATE GRAZING(1).

PubMed

Yang, Zhou; Kong, Fanxiang; Shi, Xiaoli; Zhang, Min; Xing, Peng; Cao, Huansheng

2008-06-01

To investigate the changes in the morphology and polysaccharide content of Microcystis aeruginosa (Kütz.) Kütz. during flagellate grazing, cultures of M. aeruginosa were exposed to grazing Ochromonas sp. for a period of 9 d under controlled laboratory conditions. M. aeruginosa responded actively to flagellate grazing and formed colonies, most of which were made up of several or dozens of cells, suggesting that flagellate grazing may be one of the biotic factors responsible for colony formation in M. aeruginosa. When colonies were formed, the cell surface ultrastructure changed, and the polysaccharide layer on the surface of the cell wall became thicker. This change indicated that synthesis and secretion of extracellular polysaccharide (EPS) of M. aeruginosa cells increased under flagellate grazing pressure. The contents of soluble extracellular polysaccharide (sEPS), bound extracellular polysaccharide (bEPS), and total polysaccharide (TPS) in colonial cells of M. aeruginosa increased significantly compared with those in single cells. This finding suggested that the increased amount of EPS on the cell surface may play a role in keeping M. aeruginosa cells together to form colonies. © 2008 Phycological Society of America.

Direct evaluation of Pseudomonas aeruginosa biofilm mediators in a chronic infection model.

PubMed

Byrd, Matthew S; Pang, Bing; Hong, Wenzhou; Waligora, Elizabeth A; Juneau, Richard A; Armbruster, Chelsie E; Weimer, Kristen E D; Murrah, Kyle; Mann, Ethan E; Lu, Haiping; Sprinkle, April; Parsek, Matthew R; Kock, Nancy D; Wozniak, Daniel J; Swords, W Edward

2011-08-01

Biofilms contribute to Pseudomonas aeruginosa persistence in a variety of diseases, including cystic fibrosis, burn wounds, and chronic suppurative otitis media. However, few studies have directly addressed P. aeruginosa biofilms in vivo. We used a chinchilla model of otitis media, which has previously been used to study persistent Streptococcus pneumoniae and Haemophilus influenzae infections, to show that structures formed in vivo are biofilms of bacterial and host origin within a matrix that includes Psl, a P. aeruginosa biofilm polysaccharide. We evaluated three biofilm and/or virulence mediators of P. aeruginosa known to affect biofilm formation in vitro and pathogenesis in vivo--bis-(3',5')-cyclic dimeric GMP (c-di-GMP), flagella, and quorum sensing--in a chinchilla model. We show that c-di-GMP overproduction has a positive impact on bacterial persistence, while quorum sensing increases virulence. We found no difference in persistence attributed to flagella. We conclude from these studies that a chinchilla otitis media model provides a means to evaluate pathogenic mediators of P. aeruginosa and that in vitro phenotypes should be examined in multiple infection systems to fully understand their role in disease.

Pseudomonas aeruginosa Biofilm, a Programmed Bacterial Life for Fitness.

PubMed

Lee, Keehoon; Yoon, Sang Sun

2017-06-28

A biofilm is a community of microbes that typically inhabit on surfaces and are encased in an extracellular matrix. Biofilms display very dissimilar characteristics to their planktonic counterparts. Biofilms are ubiquitous in the environment and influence our lives tremendously in both positive and negative ways. Pseudomonas aeruginosa is a bacterium known to produce robust biofilms. P. aeruginosa biofilms cause severe problems in immunocompromised patients, including those with cystic fibrosis or wound infection. Moreover, the unique biofilm properties further complicate the eradication of the biofilm infection, leading to the development of chronic infections. In this review, we discuss the history of biofilm research and general characteristics of bacterial biofilms. Then, distinct features pertaining to each stage of P. aeruginosa biofilm development are highlighted. Furthermore, infections caused by biofilms on their own or in association with other bacterial species ( i.e. , multispecies biofilms) are discussed in detail.

Pseudomonas aeruginosa Airway Infection Recruits and Modulates Neutrophilic Myeloid-Derived Suppressor Cells

PubMed Central

Öz, Hasan H.; Zhou, Benyuan; Voss, Pina; Carevic, Melanie; Schroth, Carolin; Frey, Nina; Rieber, Nikolaus; Hector, Andreas; Hartl, Dominik

2016-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that causes infections mainly in patients with cystic fibrosis (CF) lung disease. Despite innate and adaptive immune responses upon infection, P. aeruginosa is capable of efficiently escaping host defenses, but the underlying immune mechanisms remain poorly understood. Myeloid-derived suppressor cells (MDSCs) are innate immune cells that are functionally characterized by their potential to suppress T- and natural killer (NK)-cell responses. Here we demonstrate, using an airway in vivo infection model, that P. aeruginosa recruits and activates neutrophilic MDSCs, which functionally suppress T-cell responses. We further show that the CF gene defect (CF transmembrane conductance regulator, CFTR) modulates the functionality, but not the recruitment or generation of neutrophilic MDSCs. Collectively, we define a mechanism by which P. aeruginosa airway infection undermines host immunity by modulating neutrophilic MDSCs in vivo. PMID:27965936

Sepsis associated with hematological malignancies: prophylaxis of Pseudomonas aeruginosa sepsis.

PubMed

Sakamoto, M; Saruta, K; Nakazawa, Y; Shindo, N; Maezawa, H; Yoshikawa, K; Yoshida, M; Shiba, K; Sakai, O; Saito, A

1996-02-01

Underlying diseases, pathogenic bacteria, clinical background and outcome were studied during 91 febrile episodes complicated by sepsis in 55 patients with hematological malignancies, who had been admitted to our hospital (Jikei University Kashiwa Hospital) between January 1990 and December 1994. Particularly in patients with P. aeruginosa sepsis, we compared the prophylactic effect of ciprofloxacin (CPFX) alone with that of the combination of polymyxin B (PL-B) plus kanamycin (KM). The major underlying diseases were acute myelocytic leukemia and malignant lymphoma, followed by myelodysplastic syndrome, acute lymphocytic leukemia and chronic myelocytic leukemia. Nearly two-thirds of the pathogenic microorganisms isolated were gram-positive bacteria (including coagulase-negative staphylococci and Staphylococcus aureus); approximately one-quarter were gram-negative bacteria (such as Pseudomonas aeruginosa), and the remainder were fungi. These microorganisms usually induced sepsis when granulocyte counts were decreased. Sepsis was a direct cause of death in about 60% of the patients and P. aeruginosa sepsis had the worst outcome. Oral administration of CPFX was more effective than PL-B plus KM in preventing P. aeruginosa sepsis. The difference in effectiveness might depend on the absorption profile of the drugs.

Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa.

PubMed

Wilton, Mike; Charron-Mazenod, Laetitia; Moore, Richard; Lewenza, Shawn

2016-01-01

Biofilms consist of surface-adhered bacterial communities encased in an extracellular matrix composed of DNA, exopolysaccharides, and proteins. Extracellular DNA (eDNA) has a structural role in the formation of biofilms, can bind and shield biofilms from aminoglycosides, and induces antimicrobial peptide resistance mechanisms. Here, we provide evidence that eDNA is responsible for the acidification of Pseudomonas aeruginosa planktonic cultures and biofilms. Further, we show that acidic pH and acidification via eDNA constitute a signal that is perceived by P. aeruginosa to induce the expression of genes regulated by the PhoPQ and PmrAB two-component regulatory systems. Planktonic P. aeruginosa cultured in exogenous 0.2% DNA or under acidic conditions demonstrates a 2- to 8-fold increase in aminoglycoside resistance. This resistance phenotype requires the aminoarabinose modification of lipid A and the production of spermidine on the bacterial outer membrane, which likely reduce the entry of aminoglycosides. Interestingly, the additions of the basic amino acid L-arginine and sodium bicarbonate neutralize the pH and restore P. aeruginosa susceptibility to aminoglycosides, even in the presence of eDNA. These data illustrate that the accumulation of eDNA in biofilms and infection sites can acidify the local environment and that acidic pH promotes the P. aeruginosa antibiotic resistance phenotype. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Bioprospecting highly diverse endophytic Pestalotiopsis spp. with antibacterial properties from Maytenus ilicifolia, a medicinal plant from Brazil.

PubMed

Gomes-Figueiredo, Josiane; Pimentel, Ida C; Vicente, Vânia A; Pie, Marcio R; Kava-Cordeiro, Vanessa; Galli-Terasawa, Lygia; Pereira, José O; de Souza, Antonia Q L; Glienke, Chirlei

2007-10-01

Thirteen endophytic fungal strains of the genus Pestalotiopsis were isolated from the medicinal plant Maytenus ilicifolia Mart. ex. Reiss (commonly known as "espinheira santa") and their antimicrobial properties were investigated. Two isolates were successful in inhibiting the growth of the tested microorganisms (Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Staphylococcus aureus, and methicillin-resistant Staphylococcus aureus (MRSA)) using the technique of bioautographic thin-layer chromatography (TLC) agar overlay assay. An analysis based on a polyphasic approach integrating taxonomic information, morphological traits, RAPD markers, and the sequencing of the ITS1-5.8S-ITS2 of the rDNA led to the assignment of the isolates as belonging to the species Pestalotiopsis microspora, Pestalotiopsis vismiae, and Pestalotiopsis leucothoes. Therefore, the present study presents a new approach to the study of endophytic fungi of the genus Pestalotiopsis.

Degradable Polymer with Protein Resistance in a Marine Environment.

PubMed

Ma, Jielin; Ma, Chunfeng; Zhang, Guangzhao

2015-06-16

Protein resistance is the central issue in marine antibiofouling. We have prepared poly(ε-caprolactone) (PCL)-based polyurethane with 2-(dimethylamino) ethyl methacrylate (DEM) as pendant groups by a combination of the thiol-ene click reaction and the condensation reaction. By the use of quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance (SPR), we have investigated the adsorption of fibrinogen, bovine serum albumin (BSA), and lysozyme on the polymer surface. The polymer exhibits protein resistance in seawater but not in fresh water because DEM pendant groups carry net neutral charges in the former. The evaluation of antibacterial adhesion of the polymer by using Micrococcus luteus demonstrates that the polymer can effectively inhibit the settlement of marine bacteria. Our studies also show that the polymer is degradable in marine environments.

Antibacterial properties of grapefruit seed extract against Paenibacillus larvae subsp. larvae.

PubMed

Semprini, P; Langella, V; Pasini, B; Falda, M T; Calvarese, S

2004-01-01

Twenty-one samples of grapefruit seed extract (GSE) either from marketed products or provided by an apiculturist were analysed to verify their inhibition activity, in particular against Paenibacillus larvae subsp. larvae, responsible for American foulbrood. The bactericide capacity of GSE has been measured in Bacillus subtilis BGA, Bacillus cereus 11778, Bacillus cereus K250 and Micrococcus luteus 9341a; these bacteria are normally used in the laboratory to study inhibitors. The results showed that not all GSE have the same inhibitory activity and two of those analysed do not inhibit the five bacteria used. Considering that 19 samples inhibited American foulbrood bacillus, the authors conclude that the use of a natural product (such as GSE) to control this important disease of bees, can be used as a substitute for chemotherapeutic products, after appropriate expedients.

A novel green one-step synthesis of silver nanoparticles using chitosan: catalytic activity and antimicrobial studies

NASA Astrophysics Data System (ADS)

Venkatesham, Maragoni; Ayodhya, Dasari; Madhusudhan, Alle; Veera Babu, Nagati; Veerabhadram, Guttena

2014-01-01

Stable silver nanoparticles were synthesized using chitosan acting as both reducing and stabilizing agent without using any toxic chemicals. This reaction was carried out in an autoclave at a pressure of 15 psi and 120 °C temperature by varying the time. The influence of different parameters such as time, change of concentration of silver nitrate and concentration of chitosan on the formation of silver nanoparticles were studied. The synthesized silver nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infrared, X-ray diffraction and transmission electron microscopy. The results of catalytic reduction of 4-nitrophenol by sodium borohydride in the presence of green synthesized silver nanoparticles were presented. The antimicrobial activity of silver nanoparticles was tested against Escherichia coli and Micrococcus luteus and was found to be possessing inhibiting property.

Violacein-Producing Collimonas sp. from the Sea Surface Microlayer of Costal Waters in Trøndelag, Norway

PubMed Central

Hakvåg, Sigrid; Fjærvik, Espen; Klinkenberg, Geir; Borgos, Sven Even F.; Josefsen, Kjell D.; Ellingsen, Trond E.; Zotchev, Sergey B.

2009-01-01

A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound. PMID:20098599

Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

PubMed Central

Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

1963-01-01

A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

Pseudomonas aeruginosa ventilator-associated pneumonia management.

PubMed

Ramírez-Estrada, Sergio; Borgatta, Bárbara; Rello, Jordi

2016-01-01

Ventilator-associated pneumonia is the most common infection in intensive care unit patients associated with high morbidity rates and elevated economic costs; Pseudomonas aeruginosa is one of the most frequent bacteria linked with this entity, with a high attributable mortality despite adequate treatment that is increased in the presence of multiresistant strains, a situation that is becoming more common in intensive care units. In this manuscript, we review the current management of ventilator-associated pneumonia due to P. aeruginosa, the most recent antipseudomonal agents, and new adjunctive therapies that are shifting the way we treat these infections. We support early initiation of broad-spectrum antipseudomonal antibiotics in present, followed by culture-guided monotherapy de-escalation when susceptibilities are available. Future management should be directed at blocking virulence; the role of alternative strategies such as new antibiotics, nebulized treatments, and vaccines is promising.

Tolerance of Pseudomonas aeruginosa in in-vitro biofilms to high-level peracetic acid disinfection.

PubMed

Akinbobola, A B; Sherry, L; Mckay, W G; Ramage, G; Williams, C

2017-10-01

Biofilm has been suggested as a cause of disinfection failures in flexible endoscopes where no lapses in the decontamination procedure can be identified. To test this theory, the activity of peracetic acid, one of the widely used disinfectants in the reprocessing of flexible endoscopes, was evaluated against both planktonic and sessile communities of Pseudomonas aeruginosa. To investigate the ability of P. aeruginosa biofilm to survive high-level peracetic acid disinfection. The susceptibility of planktonic cells of P. aeruginosa and biofilms aged 24, 48, 96, and 192 h to peracetic acid was evaluated by estimating their viability using resazurin viability and plate count methods. The biomass of the P. aeruginosa biofilms was also quantified using Crystal Violet assay. Planktonic cells of P. aeruginosa were treated with 5-30 ppm concentration of peracetic acid in the presence of 3.0 g/L of bovine serum albumin (BSA) for 5 min. Biofilms of P. aeruginosa were also treated with various peracetic acid concentrations (100-3000 ppm) for 5 min. Planktonic cells of P. aeruginosa were eradicated by 20 ppm of peracetic acid, whereas biofilms showed an age-dependent tolerance to peracetic acid, and 96 h biofilm was only eradicated at peracetic acid concentration of 2500 ppm. Ninety-six-hour P. aeruginosa biofilm survives 5 min treatment with 2000 ppm of peracetic acid, which is the working concentration used in some endoscope washer-disinfectors. This implies that disinfection failure of flexible endoscopes might occur when biofilms build up in the lumens of endoscopes. Copyright © 2017. Published by Elsevier Ltd.

Emergence of Carbapenem-Resistant Pseudomonas aeruginosa and Acinetobacter baumannii Clinical Isolates Collected from Some Libyan Hospitals.

PubMed

Mathlouthi, Najla; Areig, Zaynab; Al Bayssari, Charbel; Bakour, Sofiane; Ali El Salabi, Allaaeddin; Ben Gwierif, Salha; Zorgani, Abdulaziz A; Ben Slama, Karim; Chouchani, Chedly; Rolain, Jean-Marc

2015-06-01

The aim of the present study was to investigate the molecular mechanism of carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates recovered from Libyan hospitals between April 2013 and April 2014. In total, 49 strains (24 P. aeruginosa and 25 A. baumannii) were isolated, including 21 P. aeruginosa and 22 A. baumannii isolates (87.75%) resistant to imipenem (minimum inhibitory concentrations ≥16 μg/ml). The blaVIM-2 gene was detected in 19 P. aeruginosa isolates. All imipenem-resistant P. aeruginosa isolates showed the presence of OprD mutations. Acquired OXA-carbapenemase-encoding genes were present in all A. baumannii isolates: blaOXA-23 (n=19) and blaOXA-24 (n=3). Finally, a total of 13 and 17 different sequence types were assigned to the 21 P. aeruginosa and the 22 A. baumannii carbapenem-resistant isolates, respectively. This study is the first report describing imipenem-resistant P. aeruginosa and A. baumannii isolated from patients in Libya. We report the first case of co-occurrence of blaVIM-2 with oprD porin loss in identical isolates of P. aeruginosa in Libya and demonstrate that these oprD mutations can be used as a tool to study the clonality in P. aeruginosa isolates. We also report the first identification of multidrug-resistant A. baumannii isolates harboring blaOXA-23-like, blaOXA-24-like, and blaOXA-48-like genes in Libya.

Strain- and Substrate-Dependent Redox Mediator and Electricity Production by Pseudomonas aeruginosa.

PubMed

Bosire, Erick M; Blank, Lars M; Rosenbaum, Miriam A

2016-08-15

Pseudomonas aeruginosa is an important, thriving member of microbial communities of microbial bioelectrochemical systems (BES) through the production of versatile phenazine redox mediators. Pure culture experiments with a model strain revealed synergistic interactions of P. aeruginosa with fermenting microorganisms whereby the synergism was mediated through the shared fermentation product 2,3-butanediol. Our work here shows that the behavior and efficiency of P. aeruginosa in mediated current production is strongly dependent on the strain of P. aeruginosa We compared levels of phenazine production by the previously investigated model strain P. aeruginosa PA14, the alternative model strain P. aeruginosa PAO1, and the BES isolate Pseudomonas sp. strain KRP1 with glucose and the fermentation products 2,3-butanediol and ethanol as carbon substrates. We found significant differences in substrate-dependent phenazine production and resulting anodic current generation for the three strains, with the BES isolate KRP1 being overall the best current producer and showing the highest electrochemical activity with glucose as a substrate (19 μA cm(-2) with ∼150 μg ml(-1) phenazine carboxylic acid as a redox mediator). Surprisingly, P. aeruginosa PAO1 showed very low phenazine production and electrochemical activity under all tested conditions. Microbial fuel cells and other microbial bioelectrochemical systems hold great promise for environmental technologies such as wastewater treatment and bioremediation. While there is much emphasis on the development of materials and devices to realize such systems, the investigation and a deeper understanding of the underlying microbiology and ecology are lagging behind. Physiological investigations focus on microorganisms exhibiting direct electron transfer in pure culture systems. Meanwhile, mediated electron transfer with natural redox compounds produced by, for example, Pseudomonas aeruginosa might enable an entire microbial

Glycan involvement in the adhesion of Pseudomonas aeruginosa to tears.

PubMed

Kautto, Liisa; Nguyen-Khuong, Terry; Everest-Dass, Arun; Leong, Andrea; Zhao, Zhenjun; Willcox, Mark D P; Packer, Nicolle H; Peterson, Robyn

2016-04-01

The human eye is constantly bathed by tears, which protect the ocular surface via a variety of mechanisms. The O-linked glycans of tear mucins have long been considered to play a role in binding to pathogens and facilitating their removal in the tear flow. Other conjugated glycans in tears could similarly contribute to pathogen binding and removal but have received less attention. In the work presented here we assessed the contribution of glycan moieties, in particular the protein attached N-glycans, presented by the broad complement of tear proteins to the adhesion of the opportunistic pathogen Pseudomonas aeruginosa, a leading cause of microbial keratitis and ulceration of the cornea. Our adhesion assay involved immobilising the macromolecular components of tears into the wells of a polyvinyl difluoride (PVDF) microtitre filter plate and probing the binding of fluorescently labelled bacteria. Three P. aeruginosa strains were studied: a cytotoxic strain (6206) and an invasive strain (6294) from eye infections, and an invasive strain (320) from a urinary tract infection (UTI). The ocular isolates adhered two to three times more to human tears than to human saliva or porcine gastric mucin, suggesting ocular niche-specific adaptation. Support for the role of the N-glycans carried by human tear proteins in the binding and removal of P. aeruginosa from the eye was shown by: 1) pre-incubation of the bacteria with free component sugars, galactose, mannose, fucose and sialyl lactose (or combination thereof) inhibiting adhesion of all the P. aeruginosa strains to the immobilised tear proteins, with the greatest inhibition of binding of the ocular cytotoxic 6206 and least for the invasive 6294 strain; 2) pre-incubation of the bacteria with N-glycans released from the commercially available human milk lactoferrin, an abundant protein that carries N-linked glycans in tears, inhibiting the adhesion to tears of the ocular bacteria by up to 70%, which was significantly more

Prevalence of genomic island PAPI-1 in clinical isolates of Pseudomonas aeruginosa in Iran.

PubMed

Sadeghifard, Nourkhoda; Rasaei, Seyedeh Zahra; Ghafourian, Sobhan; Zolfaghary, Mohammad Reza; Ranjbar, Reza; Raftari, Mohammad; Mohebi, Reza; Maleki, Abbas; Rahbar, Mohammad

2012-03-01

Pseudomonas aeruginosa, a gram-negative rod-shaped bacterium, is an opportunistic pathogen, which causes various serious diseases in humans and animals. The aims of this study were to evaluate of the presence of genomic island PAPI-1 in Pseudomonas aeruginosa isolated from Reference Laboratory of Ilam, Milad Hospital and Emam Khomeini Hospital, Iran and to study the frequency of extended spectrum beta-lactamases (ESBLs) among isolates. Forty-eight clinical isolates of P. aeruginosa were obtained during April to September 2010, and were evaluated for ESBLs by screening and confirmatory disk diffusion methods and PAPI-1 by PCR. Fifteen of 48 P. aeruginosa isolates were positive for ESBLs and 17 isolates positive for PAPI-1. This was first study of the prevalence of PAPI-1 in clinical isolates of P. aeruginosa in Iran, showing that most of PAPI-1 positive strains had high levels of antibiotic resistance and produced ESBLs.

LED array designing and its bactericidal effect researching on Pseudomonas aeruginosa in vitro

NASA Astrophysics Data System (ADS)

Fang, Jing; Xing, Jin; Gao, Liucun; Shen, Benjian; Kang, Hongxiang; Jie, Liang; Peng, Chen

2015-10-01

Lights with some special waveband and output power density have a bactericidal effect to some special bacteria. In this paper, the bactericidal effect of light at wavelength of 470 nm on P. aeruginosa (ATCC 27853) is researched with different irradiation dose. The light source is a LED array which is obtained by incoherent combine of 36 LEDs with emitting wavelength of 470 nm. The P. aeruginosa suspension is exposed with the LED array at the light power density of 100 mW/cm2 with exposures time of 0, 5, 10, 20, 40, and 80 min, respectively. The numbers of CFU are then determined by serial dilutions on LB agar plates. The bactericidal effect research results of 470 nm LED on P. aeruginosa show that the killing ratio increases with increasing of the exposure time. For the 80 min irradiation, as much as 92.4% reduction of P. aeruginosa is achieved. The results indicate that, in vitro, 470-nm lights produce dose dependent bactericidal effects on P. aeruginosa.

Pseudomonas aeruginosa genotypes acquired by children with cystic fibrosis by age 5-years.

PubMed

Kidd, Timothy J; Ramsay, Kay A; Vidmar, Suzanna; Carlin, John B; Bell, Scott C; Wainwright, Claire E; Grimwood, Keith

2015-05-01

We describe Pseudomonas aeruginosa acquisitions in children with cystic fibrosis (CF) aged ≤5-years, eradication treatment efficacy, and genotypic relationships between upper and lower airway isolates and strains from non-CF sources. Of 168 CF children aged ≤5-years in a bronchoalveolar lavage (BAL)-directed therapy trial, 155 had detailed microbiological results. Overall, 201/271 (74%) P. aeruginosa isolates from BAL and oropharyngeal cultures were available for genotyping, including those collected before and after eradication therapy. Eighty-two (53%) subjects acquired P. aeruginosa, of which most were unique strains. Initial eradication success rate was 90%, but 36 (44%) reacquired P. aeruginosa, with genotypic substitutions more common in BAL (12/14) than oropharyngeal (3/11) cultures. Moreover, oropharyngeal cultures did not predict BAL genotypes reliably. CF children acquire environmental P. aeruginosa strains frequently. However, discordance between BAL and oropharyngeal strains raises questions over upper airway reservoirs and how to best determine eradication in non-expectorating children. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

[Immunization with Bifidobacterium bifidum-vectored OprI vaccine of Pseudomonas aeruginosa enhances inhibitory effect on P. aeruginosa in mice].

PubMed

Liu, Xiao; Li, Wengui

2017-08-01

Objective To study the pulmonary bacterial loads, splenocyte proliferation, distributions of T cell subsets and cell apoptosis in mice immunized with Bifidobacterium bifidum-vectored OprI (Bb-OprI) vaccine of Pseudomonas aeruginosa and challenged with P. aeruginosa PA01 strain. Methods BALB/c mice were immunized with 5×10 9 CFUs of vaccine by intragastric administration, 3 times a week for 3 weeks, and challenged intranasally with 5×10 6 CFUs of PA01 strain at the fourth week after the first immunization. At the second week after the challenge, all mice were sacrificed to separate their lungs and spleens, and the pulmonary bacterial loads were counted. The proliferation of the splenocytes was determined by MTT assay. The splenic CD4 + , CD8 + T cell subsets and the apoptotic rate of splenocytes were detected by flow cytometry. Results The number of pulmonary bacterial colonies in the mice immunized with the vaccine and challenged with PA01 strain decreased, while the proliferation of splenocytes and the proportion of CD4 + T cells markedly increased, and the apoptosis of splenocytes was notably reduced. Conclusion The intragastric vaccination of recombinant Bb-OprI vaccine can increase the proportion of CD4 + T cells and enhance the inhibitory effect on P. aeruginosa.

Inhaled Colistin in Patients with Bronchiectasis and Chronic Pseudomonas aeruginosa Infection

PubMed Central

Foweraker, Juliet E.; Wilkinson, Peter; Kenyon, Robert F.; Bilton, Diana

2014-01-01

Rationale: Chronic infection with Pseudomonas aeruginosa is associated with an increased exacerbation frequency, a more rapid decline in lung function, and increased mortality in patients with bronchiectasis. Objectives: To perform a randomized placebo-controlled study assessing the efficacy and safety of inhaled colistin in patients with bronchiectasis and chronic P. aeruginosa infection. Methods: Patients with bronchiectasis and chronic P. aeruginosa infection were enrolled within 21 days of completing a course of antipseudomonal antibiotics for an exacerbation. Participants were randomized to receive colistin (1 million IU; n = 73) or placebo (0.45% saline; n = 71) via the I-neb twice a day, for up to 6 months. Measurements and Main Results: The primary endpoint was time to exacerbation. Secondary endpoints included time to exacerbation based on adherence recorded by the I-neb, P. aeruginosa bacterial density, quality of life, and safety parameters. All analyses were on the intention-to-treat population. Median time (25% quartile) to exacerbation was 165 (42) versus 111 (52) days in the colistin and placebo groups, respectively (P = 0.11). In adherent patients (adherence quartiles 2–4), the median time to exacerbation was 168 (65) versus 103 (37) days in the colistin and placebo groups, respectively (P = 0.038). P. aeruginosa density was reduced after 4 (P = 0.001) and 12 weeks (P = 0.008) and the St. George’s Respiratory Questionnaire total score was improved after 26 weeks (P = 0.006) in the colistin versus placebo patients, respectively. There were no safety concerns. Conclusions: Although the primary endpoint was not reached, this study shows that inhaled colistin is a safe and effective treatment in adherent patients with bronchiectasis and chronic P. aeruginosa infection. Clinical trial registered with http://www.isrctn.org/ (ISRCTN49790596) PMID:24625200

Outbreak of Pseudomonas aeruginosa folliculitis associated with a swimming pool inflatable.

PubMed Central

Tate, D.; Mawer, S.; Newton, A.

2003-01-01

On 18 February 2002, the Communicable Disease Unit was notified by the local Public Health Service Laboratory of a child with a positive skin swab for Pseudomonas aeruginosa. This child had attended the local swimming pool and played on an inflatable, subsequently presenting to a Primary Care Nurse Practitioner with folliculitis. A total of 35 cases was identified during the outbreak. This paper describes a case-control study and microbiological sampling of the cases, the suspected inflatable and a survey of 10 swimming pool inflatables in the local area. The odds ratio for developing folliculitis following use of the inflatable was 12 (95% CI 1.05-136.80). The strain of P. aeruginosa found on the inflatable was identical to that obtained from skin swabs of cases. Nine of 10 (90%) of the inflatables sampled were colonized by P. aeruginosa. Attention should be given to the problem of routine decontamination of swimming pool inflatables. P. aeruginosa folliculitis needs to be considered in the differential diagnosis of skin rashes in children, especially in Primary Care. PMID:12729186

Molecular Epidemiology of a Pseudomonas aeruginosa Hospital Outbreak Driven by a Contaminated Disinfectant-Soap Dispenser

PubMed Central

Lanini, Simone; D'Arezzo, Silvia; Puro, Vincenzo; Martini, Lorena; Imperi, Francesco; Piselli, Pierluca; Montanaro, Marco; Paoletti, Simonetta; Visca, Paolo; Ippolito, Giuseppe

2011-01-01

Background and Objective Pseudomonas aeruginosa infection represents a main cause of morbidity and mortality among immunocompromised patients. This study describes a fatal epidemic of P. aeruginosa that occurred in a hematology unit in Italy. Methods Retrospective cohort study, prospective surveillance, auditing, extensive testing on healthcare workers and environmental investigation were performed to define the dynamics and potential causes of transmission. RAPD, macrorestriction analyses and sequence typing were used to define relationships between P. aeruginosa isolates. Results Eighteen cases of infection were identified in the different phases of the investigation. Of these, five constitute a significant molecular cluster of infection. A P. aeruginosa strain with the same genetic fingerprint and sequence type (ST175) as clinical isolates strain was also isolated from a heavily contaminated triclosan soap dispenser. Discussion and Conclusions Our results are consistent with the hypothesis that patients became indirectly infected, e.g., during central venous catheter handling through contaminated items, and that the triclosan soap dispenser acted as a common continuous source of P. aeruginosa infection. Since P. aeruginosa is intrinsically unsusceptible to triclosan, the use of triclosan-based disinfectant formulations should be avoided in those healthcare settings hosting patients at high risk of P. aeruginosa infection. PMID:21359222

Isolation and properties of mesosomal membrane fractions from Micrococcus lysodeikticus

PubMed Central

Owen, Peter; Freer, John H.

1972-01-01

1. A method is described for the isolation of pure mesosomal membrane fractions from Micrococcus lysodeikticus. 2. Plasmolysis of cells, before wall digestion, was necessary for effective mesosome release. 3. The effect of mild shearing forces, temperature and time upon the release of mesosomal membrane from protoplasts was investigated. 4. The optimum yield of mesosomal membranes from stable protoplasts was achieved at 10mm-Mg2+. 5. Mesosomal membrane vesicle fractions prepared at differing Mg2+ concentrations above 10mm were similar in chemical composition. 6. Comparison of the properties of peripheral and mesosomal membrane fractions revealed major differences in the distribution of protein components, membrane phosphorus, mannose and dehydrogenase activities between the two fractions. 7. Only cytochrome b556 was detected in mesosomal membranes, whereas peripheral membranes contained a full complement of cytochromes. 8. Preliminary investigations suggested the localization of an autolytic enzyme(s) in the mesosomal vesicles. 9. The anatomy of mesosomal and peripheral membrane have been compared by the negative-staining and freeze-fracture technique. 10. The results are discussed in relation to a plausible role for the mesosome. ImagesPLATE 1PLATE 2PLATE 3PLATE 4 PMID:4655825

Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition.

PubMed

Morales, Eva; Cots, Francesc; Sala, Maria; Comas, Mercè; Belvis, Francesc; Riu, Marta; Salvadó, Margarita; Grau, Santiago; Horcajada, Juan P; Montero, Maria Milagro; Castells, Xavier

2012-05-23

We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain). All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros). In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively). P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact.

Ferritin and ferrihydrite nanoparticles as iron sources for Pseudomonas aeruginosa

PubMed Central

Dehner, Carolyn; Morales-Soto, Nydia; Behera, Rabindra K.; Shrout, Joshua; Theil, Elizabeth C.; Maurice, Patricia A.

2013-01-01

Metabolism of iron derived from insoluble and/ or scarce sources is essential for pathogenic and environmental microbes. The ability of Pseudomonas aeruginosa to acquire iron from exogenous ferritin was assessed; ferritin is an iron-concentrating and antioxidant protein complex composed of a catalytic protein and caged ferrihydrite nanomineral synthesized from Fe(II) and O2 or H2O2. Ferritin and free ferrihydrite supported growth of P. aeruginosa with indistinguishable kinetics and final culture densities. The P. aeruginosa PAO1 mutant (ΔpvdDΔpchEF), which is incapable of siderophore production, grew as well as the wild type when ferritin was the iron source. Such data suggest that P. aeruginosa can acquire iron by siderophore-independent mechanisms, including secretion of small-molecule reductant(s). Protease inhibitors abolished the growth of the siderophore-free strain on ferritins, with only a small effect on growth of the wild type; predictably, protease inhibitors had no effect on growth with free ferrihydrite as the iron source. Proteolytic activity was higher with the siderophore-free strain, suggesting that the role of proteases in the degradation of ferritin is particularly important for iron acquisition in the absence of siderophores. The combined results demonstrate the importance of both free ferrihydrite, a natural environmental form of iron and a model for an insoluble form of partly denatured ferritin called hemosiderin, and caged ferritin iron minerals as bacterial iron sources. Ferritin is also revealed as a growth promoter of opportunistic, pathogenic bacteria such a P. aeruginosa in diseased tissues such as the cystic fibrotic lung, where ferritin concentrations are abnormally high. PMID:23417538

Pseudomonas aeruginosa in Cystic Fibrosis Patients With G551D-CFTR Treated With Ivacaftor

PubMed Central

Heltshe, Sonya L.; Mayer-Hamblett, Nicole; Burns, Jane L.; Khan, Umer; Baines, Arthur; Ramsey, Bonnie W.; Rowe, Steven M.

2015-01-01

Background. Ivacaftor improves outcomes in cystic fibrosis (CF) patients with the G551D mutation; however, effects on respiratory microbiology are largely unknown. This study examines changes in CF respiratory pathogens with ivacaftor and correlates them with baseline characteristics and clinical response. Methods. The G551D Observational Study enrolled a longitudinal observational cohort of US patients with CF aged 6 years and older with at least 1 copy of the G551D mutation. Results were linked with retrospective and prospective culture data in the US Cystic Fibrosis Foundation's National Patient Registry. Pseudomonas aeruginosa infection category in the year before and year after ivacaftor was compared and correlated with clinical findings. Results. Among 151 participants prescribed ivacaftor, 29% (26/89) who were culture positive for P. aeruginosa the year prior to ivacaftor use were culture negative the year following treatment; 88% (52/59) of those P. aeruginosa free remained uninfected. The odds of P. aeruginosa positivity in the year after ivacaftor compared with the year prior were reduced by 35% (odds ratio [OR], 0.65; P < .001). Ivacaftor was also associated with reduced odds of mucoid P. aeruginosa (OR, 0.77; P = .013) and Aspergillus (OR, 0.47; P = .039), but not Staphylococcus aureus or other common CF pathogens. Patients with intermittent culture positivity and higher forced expiratory volume in 1 second (FEV1) were most likely to turn culture negative. Reduction in P. aeruginosa was not associated with change in FEV1, body mass index, or hospitalizations. Conclusions. Pseudomonas aeruginosa culture positivity was significantly reduced following ivacaftor treatment. Efficacious CFTR modulation may contribute to lower frequency of culture positivity for P. aeruginosa and other respiratory pathogens, particularly in patients with less established disease. PMID:25425629

Pseudomonas aeruginosa in cystic fibrosis patients with G551D-CFTR treated with ivacaftor.

PubMed

Heltshe, Sonya L; Mayer-Hamblett, Nicole; Burns, Jane L; Khan, Umer; Baines, Arthur; Ramsey, Bonnie W; Rowe, Steven M

2015-03-01

Ivacaftor improves outcomes in cystic fibrosis (CF) patients with the G551D mutation; however, effects on respiratory microbiology are largely unknown. This study examines changes in CF respiratory pathogens with ivacaftor and correlates them with baseline characteristics and clinical response. The G551D Observational Study enrolled a longitudinal observational cohort of US patients with CF aged 6 years and older with at least 1 copy of the G551D mutation. Results were linked with retrospective and prospective culture data in the US Cystic Fibrosis Foundation's National Patient Registry. Pseudomonas aeruginosa infection category in the year before and year after ivacaftor was compared and correlated with clinical findings. Among 151 participants prescribed ivacaftor, 29% (26/89) who were culture positive for P. aeruginosa the year prior to ivacaftor use were culture negative the year following treatment; 88% (52/59) of those P. aeruginosa free remained uninfected. The odds of P. aeruginosa positivity in the year after ivacaftor compared with the year prior were reduced by 35% (odds ratio [OR], 0.65; P < .001). Ivacaftor was also associated with reduced odds of mucoid P. aeruginosa (OR, 0.77; P = .013) and Aspergillus (OR, 0.47; P = .039), but not Staphylococcus aureus or other common CF pathogens. Patients with intermittent culture positivity and higher forced expiratory volume in 1 second (FEV1) were most likely to turn culture negative. Reduction in P. aeruginosa was not associated with change in FEV1, body mass index, or hospitalizations. Pseudomonas aeruginosa culture positivity was significantly reduced following ivacaftor treatment. Efficacious CFTR modulation may contribute to lower frequency of culture positivity for P. aeruginosa and other respiratory pathogens, particularly in patients with less established disease. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For

Pseudomonas aeruginosa gshA Mutant Is Defective in Biofilm Formation, Swarming, and Pyocyanin Production

PubMed Central

Van Laar, Tricia A.; Esani, Saika; Birges, Tyler J.; Hazen, Bethany; Thomas, Jason M.

2018-01-01

ABSTRACT Pseudomonas aeruginosa is a ubiquitous Gram-negative bacterium that can cause severe opportunistic infections. The principal redox buffer employed by this organism is glutathione (GSH). To assess the role of GSH in the virulence of P. aeruginosa, a number of analyses were performed using a mutant strain deficient in gshA, which does not produce GSH. The mutant strain exhibited a growth delay in minimal medium compared to the wild-type strain. Furthermore, the gshA mutant was defective in biofilm and persister cell formation and in swimming and swarming motility and produced reduced levels of pyocyanin, a key virulence factor. Finally, the gshA mutant strain demonstrated increased sensitivity to methyl viologen (a redox cycling agent) as well as the thiol-reactive antibiotics fosfomycin and rifampin. Taken together, these data suggest a key role for GSH in the virulence of P. aeruginosa. IMPORTANCE Pseudomonas aeruginosa is a ubiquitous bacterium that can cause severe opportunistic infections, including many hospital-acquired infections. It is also a major cause of infections in patients with cystic fibrosis. P. aeruginosa is intrinsically resistant to a number of drugs and is capable of forming biofilms that are difficult to eradicate with antibiotics. The number of drug-resistant strains is also increasing, making treatment of P. aeruginosa infections very difficult. Thus, there is an urgent need to understand how P. aeruginosa causes disease in order to find novel ways to treat infections. We show that the principal redox buffer, glutathione (GSH), is involved in intrinsic resistance to the fosfomycin and rifampin antibiotics. We further demonstrate that GSH plays a role in P. aeruginosa disease and infection, since a mutant lacking GSH has less biofilm formation, is less able to swarm, and produces less pyocyanin, a pigment associated with infection. PMID:29669887

Electrochemical sensors for identifying pyocyanin production in clinical Pseudomonas aeruginosa isolates.

PubMed

Sismaet, Hunter J; Pinto, Ameet J; Goluch, Edgar D

2017-11-15

In clinical practice, delays in obtaining culture results impact patient care and the ability to tailor antibiotic therapy. Despite the advancement of rapid molecular diagnostics, the use of plate cultures inoculated from swab samples continues to be the standard practice in clinical care. Because the inoculation culture process can take between 24 and 48h before a positive identification test can be run, there is an unmet need to develop rapid throughput methods for bacterial identification. Previous work has shown that pyocyanin can be used as a rapid, redox-active biomarker for identifying Pseudomonas aeruginosa in clinical infections. However, further validation is needed to confirm pyocyanin production occurs in all clinical strains of P. aeruginosa. Here, we validate this electrochemical detection strategy using clinical isolates obtained from patients with hospital-acquired infections or with cystic fibrosis. Square-wave voltammetric scans of 94 different clinical P. aeruginosa isolates were taken to measure the concentration of pyocyanin. The results showed that all isolates produced measureable concentrations of pyocyanin with production rates correlated with patient symptoms and comorbidity. Further bioinformatics analysis confirmed that 1649 genetically sequenced strains (99.9%) of P. aeruginosa possess the two genes (PhzM and PhzS) necessary to produce pyocyanin, supporting the specificity of this biomarker. Confirming the production of pyocyanin by all clinically-relevant strains of P. aeruginosa is a significant step towards validating this strategy for rapid, point-of-care diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

An outbreak of hospital-acquired Pseudomonas aeruginosa infection caused by contaminated bottled water in intensive care units.

PubMed

Eckmanns, T; Oppert, M; Martin, M; Amorosa, R; Zuschneid, I; Frei, U; Rüden, H; Weist, K

2008-05-01

This study describes an outbreak of Pseudomonas aeruginosa infections caused by contaminated bottled still water (BSW) in six intensive care units (ICUs) of a German university hospital. Clinical and environmental samples from these units were cultured and genotyped by amplified fragment-length polymorphism and pulsed-field gel electrophoresis analysis. Microbiological results were reviewed on a weekly basis to determine the number of P. aeruginosa infections and colonisations of ICU patients. Clinical specimens from 19 ICU patients--15 infections and four colonisations--yielded the same strain of P. aeruginosa. Furthermore, four of 103 environmental samples also yielded P. aeruginosa. However, only a P. aeruginosa strain isolated from unopened BSW was genetically identical to the P. aeruginosa strain isolated from the patients. In the 42-week period before the outbreak, the mean weekly number of new ICU patients infected or colonised with P. aeruginosa was 46.9 (95% CI 40.7-53.1)/1000 bed-days. During the 6-week period of the outbreak, the weekly number of new patients with P. aeruginosa was 88.9 (95% CI 54.3-122.2)/1000 bed-days. This number returned to the previous level after removal of the BSW. Thus, the microbiological and epidemiological findings revealed that the outbreak was related to BSW contaminated with P. aeruginosa. It was concluded that all untested BSW should be removed from ICUs.

Predicting the growth situation of Pseudomonas aeruginosa on agar plates and meat stuffs using gas sensors

PubMed Central

Gu, Xinzhe; Sun, Ye; Tu, Kang; Dong, Qingli; Pan, Leiqing

2016-01-01

A rapid method of predicting the growing situation of Pseudomonas aeruginosa is presented. Gas sensors were used to acquire volatile compounds generated by P. aeruginosa on agar plates and meat stuffs. Then, optimal sensors were selected to simulate P. aeruginosa growth using modified Logistic and Gompertz equations by odor changes. The results showed that the responses of S8 or S10 yielded high coefficients of determination (R2) of 0.89–0.99 and low root mean square errors (RMSE) of 0.06–0.17 for P. aeruginosa growth, fitting the models on the agar plate. The responses of S9, S4 and the first principal component of 10 sensors fit well with the growth of P. aeruginosa inoculated in meat stored at 4 °C and 20 °C, with R2 of 0.73–0.96 and RMSE of 0.25–1.38. The correlation coefficients between the fitting models, as measured by electronic nose responses, and the colony counts of P. aeruginosa were high, ranging from 0.882 to 0.996 for both plate and meat samples. Also, gas chromatography–mass spectrometry results indicated the presence of specific volatiles of P. aeruginosa on agar plates. This work demonstrated an acceptable feasibility of using gas sensors—a rapid, easy and nondestructive method for predicting P. aeruginosa growth. PMID:27941841

A diagnostic PCR assay for the detection of an Australian epidemic strain of Pseudomonas aeruginosa

PubMed Central

2010-01-01

Background Chronic lung infection with the bacterium Pseudomonas aeruginosa is one of the hallmarks of cystic fibrosis (CF) and is associated with worsening lung function, increased hospitalisation and reduced life expectancy. A virulent clonal strain of P. aeruginosa (Australian epidemic strain I; AES-I) has been found to be widespread in CF patients in eastern Australia. Methods Suppression subtractive hybridization (SSH) was employed to identify genetic sequences that are present in the AES-I strain but absent from the sequenced reference strain PAO1. We used PCR to evaluate the distribution of several of the AES-I loci amongst a collection of 188 P. aeruginosa isolates which was comprised of 35 AES-I isolates (as determined by PFGE), 78 non-AES-I CF isolates including other epidemic CF strains as well as 69 P. aeruginosa isolates from other clinical and environmental sources. Results We have identified a unique AES-I genetic locus that is present in all 35 AES-I isolates tested and not present in any of the other 153 P. aeruginosa strains examined. We have used this unique AES-I locus to develop a diagnostic PCR and a real-time PCR assay to detect the presence of P. aeruginosa and AES-I in patient sputum samples. Conclusions We have developed diagnostic PCR assays that are 100% sensitive and 100% specific for the P. aeruginosa strain AES-I. We have also shown that Whatman FTA® Elute cards may be used with PCR-based assays to rapidly detect the presence of P. aeruginosa strains in CF sputum. PMID:20637114

Characteristics of carbapenem-resistant Pseudomonas aeruginosa strains in patients with ventilator-associated pneumonia in intensive care units.

PubMed

Vitkauskienė, Astra; Skrodenienė, Erika; Dambrauskienė, Asta; Bakšytė, Giedrė; Macas, Andrius; Sakalauskas, Raimundas

2011-01-01

The aim of this study was to determine the characteristics of carbapenem-resistant Pseudomonas aeruginosa (P. aeruginosa) strains and 5-year changes in resistance in a tertiary university hospital. The study included 90 and 101 randomly selected P. aeruginosa strains serotyped in 2003 and 2008, respectively. The standardized disk diffusion test and E-test were used to determine resistance to antibiotics. P. aeruginosa strains were considered to have high-level resistance if a minimum inhibitory concentration (MIC) for imipenem or meropenem was >32 µg/mL. To identify serogroups, sera containing specific antibodies against O group antigens of P. aeruginosa were used. P. aeruginosa isolates resistant to imipenem or/and meropenem were screened for metallo-β-lactamase (MBL) production by using the MBL E-test. Comparison of the changes in resistance of P. aeruginosa strains to carbapenems within the 5-year period revealed that the level of resistance to imipenem increased. In 2003, 53.3% of P. aeruginosa strains were found to be highly resistant to imipenem, while in 2008, this percentage increased to 87.8% (P=0.01). The prevalence of MBL-producing strains increased from 15.8% in 2003 to 61.9% in 2008 (P<0.001). In 2003 and 2008, carbapenem-resistant P. aeruginosa strains were more often resistant to ciprofloxacin and gentamicin than carbapenem-sensitive strains. In 2008, carbapenem-resistant strains additionally were more often resistant to ceftazidime, cefepime, aztreonam, piperacillin, and amikacin than carbapenem-sensitive strains. MBL-producing P. aeruginosa strains belonged more often to the O:11 serogroup than MBL-non-producing strains (51.7% vs. 34.3%, P<0.05). A greater percentage of non-MBL-producing strains had low MICs against ciprofloxacin and amikacin as compared with MBL-producing strains. The results of our study emphasize the need to restrict the spread of O:11 serogroup P. aeruginosa strains and usage of carbapenems to treat infections with P

Pseudomonas aeruginosa ventilator-associated pneumonia management

PubMed Central

Ramírez-Estrada, Sergio; Borgatta, Bárbara; Rello, Jordi

2016-01-01

Ventilator-associated pneumonia is the most common infection in intensive care unit patients associated with high morbidity rates and elevated economic costs; Pseudomonas aeruginosa is one of the most frequent bacteria linked with this entity, with a high attributable mortality despite adequate treatment that is increased in the presence of multiresistant strains, a situation that is becoming more common in intensive care units. In this manuscript, we review the current management of ventilator-associated pneumonia due to P. aeruginosa, the most recent antipseudomonal agents, and new adjunctive therapies that are shifting the way we treat these infections. We support early initiation of broad-spectrum antipseudomonal antibiotics in present, followed by culture-guided monotherapy de-escalation when susceptibilities are available. Future management should be directed at blocking virulence; the role of alternative strategies such as new antibiotics, nebulized treatments, and vaccines is promising. PMID:26855594

In-Vivo Expression Profiling of Pseudomonas aeruginosa Infections Reveals Niche-Specific and Strain-Independent Transcriptional Programs

PubMed Central

Bielecki, Piotr; Puchałka, Jacek; Wos-Oxley, Melissa L.; Loessner, Holger; Glik, Justyna; Kawecki, Marek; Nowak, Mariusz; Tümmler, Burkhard; Weiss, Siegfried; dos Santos, Vítor A. P. Martins

2011-01-01

Pseudomonas aeruginosa is a threatening, opportunistic pathogen causing disease in immunocompromised individuals. The hallmark of P. aeruginosa virulence is its multi-factorial and combinatorial nature. It renders such bacteria infectious for many organisms and it is often resistant to antibiotics. To gain insights into the physiology of P. aeruginosa during infection, we assessed the transcriptional programs of three different P. aeruginosa strains directly after isolation from burn wounds of humans. We compared the programs to those of the same strains using two infection models: a plant model, which consisted of the infection of the midrib of lettuce leaves, and a murine tumor model, which was obtained by infection of mice with an induced tumor in the abdomen. All control conditions of P. aeruginosa cells growing in suspension and as a biofilm were added to the analysis. We found that these different P. aeruginosa strains express a pool of distinct genetic traits that are activated under particular infection conditions regardless of their genetic variability. The knowledge herein generated will advance our understanding of P. aeruginosa virulence and provide valuable cues for the definition of prospective targets to develop novel intervention strategies. PMID:21931663

In-vivo expression profiling of Pseudomonas aeruginosa infections reveals niche-specific and strain-independent transcriptional programs.

PubMed

Bielecki, Piotr; Puchałka, Jacek; Wos-Oxley, Melissa L; Loessner, Holger; Glik, Justyna; Kawecki, Marek; Nowak, Mariusz; Tümmler, Burkhard; Weiss, Siegfried; dos Santos, Vítor A P Martins

2011-01-01

Pseudomonas aeruginosa is a threatening, opportunistic pathogen causing disease in immunocompromised individuals. The hallmark of P. aeruginosa virulence is its multi-factorial and combinatorial nature. It renders such bacteria infectious for many organisms and it is often resistant to antibiotics. To gain insights into the physiology of P. aeruginosa during infection, we assessed the transcriptional programs of three different P. aeruginosa strains directly after isolation from burn wounds of humans. We compared the programs to those of the same strains using two infection models: a plant model, which consisted of the infection of the midrib of lettuce leaves, and a murine tumor model, which was obtained by infection of mice with an induced tumor in the abdomen. All control conditions of P. aeruginosa cells growing in suspension and as a biofilm were added to the analysis. We found that these different P. aeruginosa strains express a pool of distinct genetic traits that are activated under particular infection conditions regardless of their genetic variability. The knowledge herein generated will advance our understanding of P. aeruginosa virulence and provide valuable cues for the definition of prospective targets to develop novel intervention strategies.

Lactoferrin-derived peptides and Lactoferricin chimera inhibit virulence factor production and biofilm formation in Pseudomonas aeruginosa.

PubMed

Xu, G; Xiong, W; Hu, Q; Zuo, P; Shao, B; Lan, F; Lu, X; Xu, Y; Xiong, S

2010-10-01

To investigate the bactericidal activity of lactoferrin-derived peptides and a new LF-derived peptides chimera (LFchimera) against P. aeruginosa and the influence on virulence factors of P. aeruginosa. Lactoferricin (LFcin) and lactoferrampin (LFampin) are highly bioactive peptides isolated from the N-terminal region of lactoferrin (LF) by pepsin digestion. In this study, we designed LFchimera containing LFcin amino acids 17-30 and LFampin amino acids 268-284. Pseudomonas aeruginosa cells were incubated in medium with peptides at different concentrations, and then the assays of viability, pyocyanin, elastase activity and biofilm formation of P. aeruginosa were performed. We found that the concentration-dependent antibactericidal activity and down-regulating pyocyanin, elastase and biofilm formation of LFchimera were significantly stronger than those of LF, LFcin, LFampin or LFcin plus LFampin. Our results indicated that LF, LFcin, LFampin and LFchimera were potential candidates to combat P. aeruginosa, and LFchimera was the most effective in them. The new LFchimera has better activity against P. aeruginosa than LF, LFcin and LFampin and may be a promising new compound for treatment of P. aeruginosa infection. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Cystic Fibrosis Transmembrane Conductance Regulator is an Epithelial Cell Receptor for Clearance of Pseudomonas aeruginosa from the Lung

NASA Astrophysics Data System (ADS)

Pier, Gerald B.; Grout, Martha; Zaidi, Tanweer S.

1997-10-01

The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride ion channel, but its relationship to the primary clinical manifestation of CF, chronic Pseudomonas aeruginosa pulmonary infection, is unclear. We report that CFTR is a cellular receptor for binding, endocytosing, and clearing P. aeruginosa from the normal lung. Murine cells expressing recombinant human wild-type CFTR ingested 30-100 times as many P. aeruginosa as cells lacking CFTR or expressing mutant Δ F508 CFTR protein. Purified CFTR inhibited ingestion of P. aeruginosa by human airway epithelial cells. The first extracellular domain of CFTR specifically bound to P. aeruginosa and a synthetic peptide of this region inhibited P. aeruginosa internalization in vivo, leading to increased bacterial lung burdens. CFTR clears P. aeruginosa from the lung, indicating a direct connection between mutations in CFTR and the clinical consequences of CF.

Bioleaching of copper oxide ore by Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Shabani, M. A.; Irannajad, M.; Azadmehr, A. R.; Meshkini, M.

2013-12-01

Bioleaching is an environmentally friendly method for extraction of metal from ores. In this study, bioleaching of copper oxide ore by Pseudomonas aeruginosa was investigated. Pseudomonas aeruginosa is a heterotrophic bacterium that can produce various organic acids in an appropriate culture medium, and these acids can operate as leaching agents. The parameters, such as particle size, glucose percentage in the culture medium, bioleaching time, and solid/liquid ratio were optimized. Optimum bioleaching conditions were found as follows: particle size of 150-177 μm, glucose percentage of 6%, bioleaching time of 8 d, and solid/liquid ratio of 1:80. Under these conditions, 53% of copper was extracted.

Research on fluorescence detection method of Microcystis aeruginosa

NASA Astrophysics Data System (ADS)

Wang, Xiao-xiong

2017-07-01

The paper studied the viability determination of Microcystis aeruginosa by FDA and PI staining. The staining results were measured by fluorescence microscopy. The results indicated that viable and dead cells were stained as bright green and red fluorescent respectively by FDA and PI. Through PI-FDA dual color fluorescence staining, the color of green and red distinct obviously by fluorescence microscope. The staining rate has relation with the cell density. If the cell density of M. aeruginosa was 1.0×107-1.0×109 cell·mL-1, the staining rate would be 100.0% or 98.0% by PI and of FDA respectively.

Relationship between cystic fibrosis respiratory tract bacterial communities and age, genotype, antibiotics and Pseudomonas aeruginosa.

PubMed

Klepac-Ceraj, Vanja; Lemon, Katherine P; Martin, Thomas R; Allgaier, Martin; Kembel, Steven W; Knapp, Alixandra A; Lory, Stephen; Brodie, Eoin L; Lynch, Susan V; Bohannan, Brendan J M; Green, Jessica L; Maurer, Brian A; Kolter, Roberto

2010-05-01

Polymicrobial bronchopulmonary infections in cystic fibrosis (CF) cause progressive lung damage and death. Although the arrival of Pseudomonas aeruginosa often heralds a more rapid rate of pulmonary decline, there is significant inter-individual variation in the rate of decline, the causes of which remain poorly understood. By coupling culture-independent methods with ecological analyses, we discovered correlations between bacterial community profiles and clinical disease markers in respiratory tracts of 45 children with CF. Bacterial community complexity was inversely correlated with patient age, presence of P. aeruginosa and antibiotic exposure, and was related to CF genotype. Strikingly, bacterial communities lacking P. aeruginosa were much more similar to each other than were those containing P. aeruginosa, regardless of antibiotic exposure. This suggests that community composition might be a better predictor of disease progression than the presence of P. aeruginosa alone and deserves further study.

Pseudomonas aeruginosa prevalence, antibiotic resistance and antimicrobial use in Chinese burn wards from 2007 to 2014

PubMed Central

Dou, Yi; Guo, Feng; Zhou, Zengding; Shi, Yan

2017-01-01

Objective To assess the application of antibacterial agents, alongside pathogen prevalence and Pseudomonas aeruginosa drug resistance, with the aim of understanding the impact of inappropriate antibacterial use. Methods This retrospective study assessed bacteria from wounds, catheters, blood, faeces, urine and sputum of hospitalized patients in burn wards between 2007 and 2014. The intensity of use of antibacterial agents and resistance of P. aeruginosa to common anti-Gram-negative antibiotics were measured. Results Annual detection rates of Staphylococcus aureus were significantly decreased, whereas annual detection rates of P. aeruginosa and Klebsiella pneumoniae were significantly increased. Multidrug-resistant strains of P. aeruginosa were increased. The intensity of use of some anti-Gramnegative antibiotics positively correlated with resistance rates of P. aeruginosa to similar antimicrobials. Conclusion In burn wards, more attention should be paid to P. aeruginosa and K. pneumoniae. The use of ciprofloxacin, ceftazidime and cefoperazone/sulbactam should be limited to counter the related increase in resistance levels. PMID:28443385

Survival, recovery and microcystin release of Microcystis aeruginosa in cold or dark condition

NASA Astrophysics Data System (ADS)

Ding, Yi; Gan, Nanqin; Liu, Jin; Zheng, Lingling; Li, Lin; Song, Lirong

2017-03-01

Microcystis often dominates phytoplankton in eutrophic lakes and must survive a long period of cold or dark conditions. However, the survival strategies of Microcystis to withstand cold or dark stress are less well known. In this study, we conducted experiments on the responses of two toxic Microcystis aeruginosa strains (FACHB-905 and FACHB-915) and their microcystin release in conditions of low temperature (15°C or 4°C, with illumination) or darkness, and subsequent recovery in standard conditions (25°C with illumination). On exposure to 15°C, a small decrease in cell viability was observed, but the cell number increased gradually, suggesting that M. aeruginosa FACHB-905 and FACHB-915 cells seem in general tolerant in 15°C. Interestingly, our results show that a higher carotenoid content and microcystin release potentially enhance the fitness of surviving cells at 15°C. M. aeruginosa cells exposed to lower temperature light stress (4°C) did not completely lose viability and retained the ability to reinitiate growth. In darkness, the maximum quantum yield ( F v/ F m) and the maximum electron transport rate (ETRmax) values and cell viability of M. aeruginosa cells gradually decreased with time. During the recovery period, the photosynthetic efficiency of M. aeruginosa reverted to the normal level. Additionally, M. aeruginosa FACHB-905 and FACHB-915 exposed to low temperature had increased caspase-3-like activity and DNA fragmentation, which suggests the occurrence of a type of cell death in M. aeruginosa cells under cold stress similar to programmed cell death. Overall, our findings could confer certain advantages on the Microcystis for surviving cold or dark conditions encountered in the annual cycle, and help explain its repeated occurrence in water blooms in large and shallow lakes.

Chemical Inhibition of Kynureninase Reduces Pseudomonas aeruginosa Quorum Sensing and Virulence Factor Expression.

PubMed

Kasper, Stephen H; Bonocora, Richard P; Wade, Joseph T; Musah, Rabi Ann; Cady, Nathaniel C

2016-04-15

The opportunistic pathogen Pseudomonas aeruginosa utilizes multiple quorum sensing (QS) pathways to coordinate an arsenal of virulence factors. We previously identified several cysteine-based compounds inspired by natural products from the plant Petiveria alliacea which are capable of antagonizing multiple QS circuits as well as reducing P. aeruginosa biofilm formation. To understand the global effects of such compounds on virulence factor production and elucidate their mechanism of action, RNA-seq transcriptomic analysis was performed on P. aeruginosa PAO1 exposed to S-phenyl-l-cysteine sulfoxide, the most potent inhibitor from the prior study. Exposure to this inhibitor down-regulated expression of several QS-regulated virulence operons (e.g., phenazine biosynthesis, type VI secretion systems). Interestingly, many genes that were differentially regulated pertain to the related metabolic pathways that yield precursors of pyochelin, tricarboxylic acid cycle intermediates, phenazines, and Pseudomonas quinolone signal (PQS). Activation of the MexT-regulon was also indicated, including the multidrug efflux pump encoded by mexEF-oprN, which has previously been shown to inhibit QS and pathogenicity. Deeper investigation of the metabolites involved in these systems revealed that S-phenyl-l-cysteine sulfoxide has structural similarity to kynurenine, a precursor of anthranilate, which is critical for P. aeruginosa virulence. By supplementing exogenous anthranilate, the QS-inhibitory effect was reversed. Finally, it was shown that S-phenyl-l-cysteine sulfoxide competitively inhibits P. aeruginosa kynureninase (KynU) activity in vitro and reduces PQS production in vivo. The kynurenine pathway has been implicated in P. aeruginosa QS and virulence factor expression; however, this is the first study to show that targeted inhibition of KynU affects P. aeruginosa gene expression and QS, suggesting a potential antivirulence strategy.

Royal Jelly Inhibits Pseudomonas aeruginosa Adherence and Reduces Excessive Inflammatory Responses in Human Epithelial Cells

PubMed Central

Susilowati, Heni; Amoh, Takashi; Hirao, Kouji; Hirota, Katsuhiko; Matsuo, Takashi; Miyake, Yoichiro

2017-01-01

Pseudomonas aeruginosa is a Gram-negative bacterium and causes respiratory infection especially in elderly patients. Royal jelly has been used worldwide as a traditional remedy and as a nutrient; however, the effect against P. aeruginosa is unclear. The aim of this study was to analyze antibacterial, antiadherent, and anti-inflammatory effects of royal jelly against P. aeruginosa. Wild-type strain PAO1 and clinical isolates of P. aeruginosa were used for antibacterial assay and antiadherent assay to abiotic surface and epithelial cells, which are pharynx (Detroit 562) and lung (NCI-H292) epithelial cells. In anti-inflammatory assay, epithelial cells were pretreated with royal jelly before bacterial exposure to investigate its inhibitory effect on interleukin (IL-8) and macrophage inflammatory protein-3α/CCL20 overproduction. Although royal jelly did not have antibacterial activity at concentration of 50% w/v, antiadherent activity was confirmed on the abiotic surface and epithelial cells under concentration of 25%. Pretreatment with royal jelly significantly inhibited overproduction of IL-8 and CCL20 from both cells. These results demonstrated that royal jelly inhibits P. aeruginosa adherence and protects epithelial cells from excessive inflammatory responses against P. aeruginosa infection. Our findings suggested that royal jelly may be a useful supplement as complementary and alternative medicine for preventing respiratory infection caused by P. aeruginosa. PMID:29075644

Royal Jelly Inhibits Pseudomonas aeruginosa Adherence and Reduces Excessive Inflammatory Responses in Human Epithelial Cells.

PubMed

Susilowati, Heni; Murakami, Keiji; Yumoto, Hiromichi; Amoh, Takashi; Hirao, Kouji; Hirota, Katsuhiko; Matsuo, Takashi; Miyake, Yoichiro

2017-01-01

Pseudomonas aeruginosa is a Gram-negative bacterium and causes respiratory infection especially in elderly patients. Royal jelly has been used worldwide as a traditional remedy and as a nutrient; however, the effect against P. aeruginosa is unclear. The aim of this study was to analyze antibacterial, antiadherent, and anti-inflammatory effects of royal jelly against P. aeruginosa . Wild-type strain PAO1 and clinical isolates of P. aeruginosa were used for antibacterial assay and antiadherent assay to abiotic surface and epithelial cells, which are pharynx (Detroit 562) and lung (NCI-H292) epithelial cells. In anti-inflammatory assay, epithelial cells were pretreated with royal jelly before bacterial exposure to investigate its inhibitory effect on interleukin (IL-8) and macrophage inflammatory protein-3 α /CCL20 overproduction. Although royal jelly did not have antibacterial activity at concentration of 50% w/v, antiadherent activity was confirmed on the abiotic surface and epithelial cells under concentration of 25%. Pretreatment with royal jelly significantly inhibited overproduction of IL-8 and CCL20 from both cells. These results demonstrated that royal jelly inhibits P. aeruginosa adherence and protects epithelial cells from excessive inflammatory responses against P. aeruginosa infection. Our findings suggested that royal jelly may be a useful supplement as complementary and alternative medicine for preventing respiratory infection caused by P. aeruginosa .

Synergistic Efficacy of Aedes aegypti Antimicrobial Peptide Cecropin A2 and Tetracycline against Pseudomonas aeruginosa

PubMed Central

Zheng, Zhaojun; Tharmalingam, Nagendran; Liu, Qingzhong; Kim, Wooseong; Fuchs, Beth Burgwyn; Zhang, Rijun; Vilcinskas, Andreas

2017-01-01

ABSTRACT The increasing prevalence of antibiotic resistance has created an urgent need for alternative drugs with new mechanisms of action. Antimicrobial peptides (AMPs) are promising candidates that could address the spread of multidrug-resistant bacteria, either alone or in combination with conventional antibiotics. We studied the antimicrobial efficacy and bactericidal mechanism of cecropin A2, a 36-residue α-helical cationic peptide derived from Aedes aegypti cecropin A, focusing on the common pathogen Pseudomonas aeruginosa. The peptide showed little hemolytic activity and toxicity toward mammalian cells, and the MICs against most clinical P. aeruginosa isolates were 32 to 64 μg/ml, and its MICs versus other Gram-negative bacteria were 2 to 32 μg/ml. Importantly, cecropin A2 demonstrated synergistic activity against P. aeruginosa when combined with tetracycline, reducing the MICs of both agents by 8-fold. The combination was also effective in vivo in the P. aeruginosa/Galleria mellonella model (P < 0.001). We found that cecropin A2 bound to P. aeruginosa lipopolysaccharides, permeabilized the membrane, and interacted with the bacterial genomic DNA, thus facilitating the translocation of tetracycline into the cytoplasm. In summary, the combination of cecropin A2 and tetracycline demonstrated synergistic antibacterial activity against P. aeruginosa in vitro and in vivo, offering an alternative approach for the treatment of P. aeruginosa infections. PMID:28483966

A case of orbital apex syndrome due to Pseudomonas aeruginosa infection

PubMed Central

Kusunoki, Takeshi; Kase, Kaori; Ikeda, Katsuhisa

2011-01-01

Orbital apex syndrome is commonly been thought to have a poor prognosis. Many cases of this syndrome have been reported to be caused by paranasal sinus mycosis. We encountered a very rare case (60-year-old woman) of sinusitis with orbital apex syndrome due to Pseudomonas aeruginosa infection. She had received insulin and dialysis for diabtes and diabetic nephropathy, moreover anticoagulants after heart by-pass surgery. She underwent endoscopic sinus operation and was treated with antibiotics, but her loss of left vision did not improve. Recently, sinusitis cases due to Pseudomonas aeruginosa were reported to be a increasing. Therefore, we should consider the possibility of Pseudomonas aeruginosa as well as mycosis as infections of the sinus, especially inpatients who are immunocompromised body. PMID:24765368

A case of orbital apex syndrome due to Pseudomonas aeruginosa infection.

PubMed

Kusunoki, Takeshi; Kase, Kaori; Ikeda, Katsuhisa

2011-09-28

Orbital apex syndrome is commonly been thought to have a poor prognosis. Many cases of this syndrome have been reported to be caused by paranasal sinus mycosis. We encountered a very rare case (60-year-old woman) of sinusitis with orbital apex syndrome due to Pseudomonas aeruginosa infection. She had received insulin and dialysis for diabtes and diabetic nephropathy, moreover anticoagulants after heart by-pass surgery. She underwent endoscopic sinus operation and was treated with antibiotics, but her loss of left vision did not improve. Recently, sinusitis cases due to Pseudomonas aeruginosa were reported to be a increasing. Therefore, we should consider the possibility of Pseudomonas aeruginosa as well as mycosis as infections of the sinus, especially inpatients who are immunocompromised body.

Physiological effects of a bactericidal protein from human polymorphonuclear leukocytes on Pseudomonas aeruginosa.

PubMed

Hovde, C J; Gray, B H

1986-04-01

The physiological changes seen in Pseudomonas aeruginosa after exposure to a bactericidal protein (BP) from the granules of human polymorphonuclear leukocytes were studied. It was demonstrated, using radiolabeled proline or leucine, that both the rate of cellular uptake and amino acid incorporation into trichloroacetic acid-insoluble material were markedly decreased immediately after exposure to BP. The rate of O2 consumption by P. aeruginosa was decreased immediately after exposure to BP and continued to decline exponentially until it ceased completely 30 min after exposure to BP. In the presence of 30 mM CaCl2 or MgCl2, bacteria were protected from death due to BP and respiration rates were unaffected. The cellular ATP pool of P. aeruginosa remained constant for up to 2 h after exposure to BP. Membrane depolarization was measured by the influx of the lipophilic anion thiocyanate. It was shown that the cytoplasmic membrane of P. aeruginosa was partially depolarized after exposure to BP. Purified BP killed 95% of 5 X 10(6) CFU of P. aeruginosa at a concentration of 60 to 100 ng of protein per ml. Although the concentration of bacteria and BP varied with each type of experiment, the BP/bacteria ratio required to cause a 95 to 99% loss in viability remained constant. We propose that cytoplasmic membrane depolarization is the biochemical lesion responsible for the other physiological changes seen and ultimately for the death of P. aeruginosa induced by BP.

Pyoverdine and Proteases Affect the Response of Pseudomonas aeruginosa to Gallium in Human Serum

PubMed Central

Bonchi, Carlo; Frangipani, Emanuela; Imperi, Francesco

2015-01-01

Gallium is an iron mimetic which has recently been repurposed as an antibacterial agent due to its capability to disrupt bacterial iron metabolism. In this study, the antibacterial activity of gallium nitrate [Ga(NO3)3] was investigated in complement-free human serum (HS) on 55 Pseudomonas aeruginosa clinical isolates from cystic fibrosis and non-cystic fibrosis patients. The susceptibility of P. aeruginosa to Ga(NO3)3 in HS was dependent on the bacterial ability to acquire iron from serum binding proteins (i.e., transferrin). The extent of serum protein degradation correlated well with P. aeruginosa growth in HS, while pyoverdine production did not. However, pyoverdine-deficient P. aeruginosa strains were unable to grow in HS and overcome iron restriction, albeit capable of releasing proteases. Predigestion of HS with proteinase K promoted the growth of all strains, irrespective of their ability to produce proteases and/or pyoverdine. The MICs of Ga(NO3)3 were higher in HS than in an iron-poor Casamino Acids medium, where proteolysis does not affect iron availability. Coherently, strains displaying high proteolytic activity were less susceptible to Ga(NO3)3 in HS. Our data support a model in which both pyoverdine and proteases affect the response of P. aeruginosa to Ga(NO3)3 in HS. The relatively high Ga(NO3)3 concentration required to inhibit the growth of highly proteolytic P. aeruginosa isolates in HS poses a limitation to the potential of Ga(NO3)3 in the treatment of P. aeruginosa bloodstream infections. PMID:26149986

Oral ofloxacin therapy of Pseudomonas aeruginosa sepsis in mice after irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brook, I.; Ledney, G.D.

Death subsequent to whole-body irradiation is associated with gram-negative bacterial sepsis. The effect of oral therapy with the new quinolone ofloxacin for orally acquired Pseudomonas aeruginosa infection was tested in B6D2F1 mice exposed to 7.0 Gy of bilateral radiation from 60Co. A dose of 10(7) organisms was given orally 2 days after irradiation, and therapy was started 1 day later. Only 4 of 20 untreated mice (20%) survived for at least 30 days compared with 19 of 20 mice (95%) treated with ofloxacin (P less than 0.005). P. aeruginosa was isolated from the livers of 21 to 28 untreated micemore » (75%), compared with only 2 of 30 treated mice (P less than 0.005). Ofloxacin reduced colonization of the ileum by P. aeruginosa; 24 of 28 untreated mice (86%) harbored the organisms, compared with only 5 of 30 (17%) with ofloxacin (P less than 0.005). This experiment was replicated twice, and similar results were obtained. These data illustrate the efficacy of the quinolone ofloxacin for oral therapy of orally acquired P. aeruginosa infection in irradiated hosts.« less

Antibiotic strategies for eradicating Pseudomonas aeruginosa in people with cystic fibrosis.

PubMed

Langton Hewer, Simon C; Smyth, Alan R

2017-04-25

Respiratory tract infection with Pseudomonas aeruginosa occurs in most people with cystic fibrosis. Once chronic infection is established, Pseudomonas aeruginosa is virtually impossible to eradicate and is associated with increased mortality and morbidity. Early infection may be easier to eradicate.This is an update of a Cochrane review first published in 2003, and previously updated in 2006, 2009 and 2014. To determine whether antibiotic treatment of early Pseudomonas aeruginosa infection in children and adults with cystic fibrosis eradicates the organism, delays the onset of chronic infection, and results in clinical improvement. To evaluate whether there is evidence that a particular antibiotic strategy is superior to or more cost-effective than other strategies and to compare the adverse effects of different antibiotic strategies (including respiratory infection with other micro-organisms). We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Most recent search: 10 October 2016. We included randomised controlled trials of people with cystic fibrosis, in whom Pseudomonas aeruginosa had recently been isolated from respiratory secretions. We compared combinations of inhaled, oral or intravenous antibiotics with placebo, usual treatment or other combinations of inhaled, oral or intravenous antibiotics. We excluded non-randomised trials, cross-over trials, and those utilising historical controls. Both authors independently selected trials, assessed risk of bias and extracted data. The search identified 60 trials; seven trials (744 participants) with a duration between 28 days and 27 months were eligible for inclusion. Three of the trials are over 10 years old and their results may be less applicable today given the changes in standard treatment. Some of the trials had low

Carbenicillin and gentamicin in the treatment of Pseudomonas aeruginosa infection

PubMed Central

Yuce, Kemal; van Rooyen, C. E.

1971-01-01

The administration separately and sequentially of carbenicillin and gentamicin eradicated Ps. aeruginosa infections, during the period over which they were given, in all of 25 critically ill patients. Electron microscopy revealed differences in the action of these two antibiotics against Ps. aeruginosa in vitro. Culture studies showed synergism between them and destruction by gentamicin of the carbenicillin-induced long, filamentous form of the organism. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6 PMID:5004774

Production of Pseudomonas aeruginosa Intercellular Small Signaling Molecules in Human Burn Wounds

PubMed Central

Que, Yok-Ai; Hazan, Ronen; Ryan, Colleen M.; Milot, Sylvain; Lépine, François; Lydon, Martha; Rahme, Laurence G.

2011-01-01

Pseudomonas aeruginosa has developed a complex cell-to-cell communication system that relies on low-molecular weight excreted molecules to control the production of its virulence factors. We previously characterized the transcriptional regulator MvfR, that controls a major network of acute virulence functions in P. aeruginosa through the control of its ligands, the 4-hydroxy-2-alkylquinolines (HAQs)—4-hydroxy-2-heptylquinoline (HHQ) and 3,4-dihydroxy-2-heptylquinoline (PQS). Though HHQ and PQS are produced in infected animals, their ratios differ from those in bacterial cultures. Because these molecules are critical for the potency of activation of acute virulence functions, here we investigated whether they are also produced during human P. aeruginosa acute wound infection and whether their ratio is similar to that observed in P. aeruginosa-infected mice. We found that a clinically relevant P. aeruginosa isolate produced detectable levels of HAQs with ratios of HHQ and PQS that were similar to those produced in burned and infected animals, and not resembling ratios in bacterial cultures. These molecules could be isolated from wound tissue as well as from drainage liquid. These results demonstrate for the first time that HAQs can be isolated and quantified from acute human wound infection sites and validate the relevance of previous studies conducted in mammalian models of infection. PMID:23533774

Anti-infective properties of Lactobacillus fermentum against Staphylococcus aureus and Pseudomonas aeruginosa.

PubMed

Varma, Parvathi; Nisha, N; Dinesh, Kavitha R; Kumar, Anil V; Biswas, Raja

2011-01-01

Surgical wounds and implant-associated Staphylococcus aureus and Pseudomonas aeruginosa infections are often difficult to treat because of limited susceptibility of several of these strains to conventional antibiotics. As a result, there is a constant need for new alternative drugs. The aim of this study was to investigate the antimicrobial properties of Lactobacillus fermentum, a probiotic bacterium, which we have isolated from colonic biopsies. The inhibition of S. aureus and P. aeruginosa growth was evaluated by coincubating with L. fermentum strains. Growth inhibition was tested for several of their clinical isolates using agar well diffusion assays. For biofilm assay S. aureus and P. aeruginosa were grown on the glass slides and in 96-well plates in presence of 2.5 μg/ml culture filtrate of L. fermentum. Biofilms were photographed using confocal microscope or stained with 0.1% crystal violet. Reduction in the cytotoxicity of S. aureus and P. aeruginosa was observed in presence of 2.5 μg/ml L. fermentum-spent media. Using in vitroexperiments, we showed that L. fermentum-secreted compound(s) inhibits the growth, cytotoxicity and biofilm formation of several S. aureus and P. aeruginosa strains. Compound(s) present in the culture supernatant of L. fermentum may have promising applications in treating hospital-acquired infections. Copyright © 2011 S. Karger AG, Basel.

Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition

PubMed Central

2012-01-01

Background We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. Methods A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain). All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Results Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros). In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively). Conclusions P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact. PMID:22621745

Pseudomonas aeruginosa proteolytically alters the interleukin 22-dependent lung mucosal defense.

PubMed

Guillon, Antoine; Brea, Deborah; Morello, Eric; Tang, Aihua; Jouan, Youenn; Ramphal, Reuben; Korkmaz, Brice; Perez-Cruz, Magdiel; Trottein, Francois; O'Callaghan, Richard J; Gosset, Philippe; Si-Tahar, Mustapha

2017-08-18

The IL-22 signaling pathway is critical for regulating mucosal defense and limiting bacterial dissemination. IL-22 is unusual among interleukins because it does not directly regulate the function of conventional immune cells, but instead targets cells at outer body barriers, such as respiratory epithelial cells. Consequently, IL-22 signaling participates in the maintenance of the lung mucosal barrier by controlling cell proliferation and tissue repair, and enhancing the production of specific chemokines and anti-microbial peptides. Pseudomonas aeruginosa is a major pathogen of ventilator-associated pneumonia and causes considerable lung tissue damage. A feature underlying the pathogenicity of this bacterium is its capacity to persist and develop in the host, particularly in the clinical context of nosocomial lung infections. We aimed to investigate the ability of P. auruginosa to disrupt immune-epithelial cells cross-talk. We found that P. aeruginosa escapes the host mucosal defenses by degrading IL-22, leading to severe inhibition of IL-22-mediated immune responses. We demonstrated in vitro that, protease IV, a type 2 secretion system-dependent serine protease, is responsible for the degradation of IL-22 by P. aeruginosa. Moreover, the major anti-proteases molecules present in the lungs were unable to inhibit protease IV enzymatic activity. In addition, tracheal aspirates of patients infected by P. aeruginosa contain protease IV activity which further results in IL-22 degradation. This so far undescribed cleavage of IL-22 by a bacterial protease is likely to be an immune-evasion strategy that contributes to P. aeruginosa-triggered respiratory infections.

Comparative In Vitro Efficacy of Doripenem and Imipenem Against Multi-Drug Resistant Pseudomonas aeruginosa.

PubMed

Wali, Nadia; Mirza, Irfan Ali

2016-04-01

To compare the in vitro efficacy of doripenem and imipenem against multi-drug resistant (MDR) Pseudomonas aeruginosa from various clinical specimens. Descriptive cross-sectional study. Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from November 2012 to November 2013. MDR Pseudomonas aeruginosa isolates from various clinical samples were included in the study. Susceptibility of Pseudomonas aeruginosa against doripenem and imipenem was performed by E-test strip and agar dilution methods. The results were interpreted as recommended by Clinical Laboratory Standard Institute (CLSI) guidelines. The maximum number of Pseudomonas aeruginosa were isolated from pure pus and pus swabs. In vitro efficacy of doripenem was found to be more effective as compared to imipenem against MDR Pseudomonas aeruginosa with both E-test strip and agar dilution methods. Overall, p-values of 0.014 and 0.037 were observed when susceptibility patterns of doripenem and imipenem were evaluated with E-test strip and agar dilution methods. In vitro efficacy of doripenem was found to be better against MDR Pseudomonas aeruginosaas compared to imipenem when tested by both E-test and agar dilution methods.

New method for investigation of cells and other biological objects in analytical cytology

NASA Astrophysics Data System (ADS)

Bilyi, Olexander I.; Getman, Vasyl B.; Kostyukevych, Sergey A.

2001-05-01

New method and instrument intended for checking the content of biology particles in dimension band 0.1-10.0 mkm in water flow is described in this report. The instrument measures the intensity of light scattered by the particles suspended in liquid flow when they are crossing the laser beam. The results of studying light scattered by platelet and bacterium's such a Pseudomonas aeruginosa, Escherichia coli, Micrococcus lutteus in such a liquid mediums as physiological solution and glucose solution are described.

SERS detection of the biomarker hydrogen cyanide from Pseudomonas aeruginosa cultures isolated from cystic fibrosis patients

NASA Astrophysics Data System (ADS)

Lauridsen, Rikke Kragh; Sommer, Lea M.; Johansen, Helle Krogh; Rindzevicius, Tomas; Molin, Søren; Jelsbak, Lars; Engelsen, Søren Balling; Boisen, Anja

2017-03-01

Pseudomonas aeruginosa is the primary cause of chronic airway infections in cystic fibrosis (CF) patients. Persistent infections are seen from the first P. aeruginosa culture in about 75% of young CF patients, and it is important to discover new ways to detect P. aeruginosa at an earlier stage. The P. aeruginosa biomarker hydrogen cyanide (HCN) contains a triple bond, which is utilized in this study because of the resulting characteristic C≡N peak at 2135 cm-1 in a Raman spectrum. The Raman signal was enhanced by surface-enhanced Raman spectroscopy (SERS) on a Au-coated SERS substrate. After long-term infection, a mutation in the patho-adaptive lasR gene can alter the expression of HCN, which is why it is sometimes not possible to detect HCN in the breath of chronically infected patients. Four P. aeruginosa reference strains and 12 clinical P. aeruginosa strains isolated from CF children were evaluated, and HCN was clearly detected from overnight cultures of all wild type-like isolates and half of the later isolates from the same patients. The clinical impact could be that P. aeruginosa infections could be detected at an earlier stage, because daily breath sampling with an immediate output could be possible with a point-of-care SERS device.

Flagellar motility is a key determinant of the magnitude of the inflammasome response to Pseudomonas aeruginosa.

PubMed

Patankar, Yash R; Lovewell, Rustin R; Poynter, Matthew E; Jyot, Jeevan; Kazmierczak, Barbara I; Berwin, Brent

2013-06-01

We previously demonstrated that bacterial flagellar motility is a fundamental mechanism by which host phagocytes bind and ingest bacteria. Correspondingly, loss of bacterial motility, consistently observed in clinical isolates from chronic Pseudomonas aeruginosa infections, enables bacteria to evade association and ingestion of P. aeruginosa by phagocytes both in vitro and in vivo. Since bacterial interactions with the phagocyte cell surface are required for type three secretion system-dependent NLRC4 inflammasome activation by P. aeruginosa, we hypothesized that reduced bacterial association with phagocytes due to loss of bacterial motility, independent of flagellar expression, will lead to reduced inflammasome activation. Here we report that inflammasome activation is reduced in response to nonmotile P. aeruginosa. Nonmotile P. aeruginosa elicits reduced IL-1β production as well as caspase-1 activation by peritoneal macrophages and bone marrow-derived dendritic cells in vitro. Importantly, nonmotile P. aeruginosa also elicits reduced IL-1β levels in vivo in comparison to those elicited by wild-type P. aeruginosa. This is the first demonstration that loss of bacterial motility results in reduced inflammasome activation and antibacterial IL-1β host response. These results provide a critical insight into how the innate immune system responds to bacterial motility and, correspondingly, how pathogens have evolved mechanisms to evade the innate immune system.

Flagellar Motility Is a Key Determinant of the Magnitude of the Inflammasome Response to Pseudomonas aeruginosa

PubMed Central

Patankar, Yash R.; Lovewell, Rustin R.; Poynter, Matthew E.; Jyot, Jeevan; Kazmierczak, Barbara I.

2013-01-01

We previously demonstrated that bacterial flagellar motility is a fundamental mechanism by which host phagocytes bind and ingest bacteria. Correspondingly, loss of bacterial motility, consistently observed in clinical isolates from chronic Pseudomonas aeruginosa infections, enables bacteria to evade association and ingestion of P. aeruginosa by phagocytes both in vitro and in vivo. Since bacterial interactions with the phagocyte cell surface are required for type three secretion system-dependent NLRC4 inflammasome activation by P. aeruginosa, we hypothesized that reduced bacterial association with phagocytes due to loss of bacterial motility, independent of flagellar expression, will lead to reduced inflammasome activation. Here we report that inflammasome activation is reduced in response to nonmotile P. aeruginosa. Nonmotile P. aeruginosa elicits reduced IL-1β production as well as caspase-1 activation by peritoneal macrophages and bone marrow-derived dendritic cells in vitro. Importantly, nonmotile P. aeruginosa also elicits reduced IL-1β levels in vivo in comparison to those elicited by wild-type P. aeruginosa. This is the first demonstration that loss of bacterial motility results in reduced inflammasome activation and antibacterial IL-1β host response. These results provide a critical insight into how the innate immune system responds to bacterial motility and, correspondingly, how pathogens have evolved mechanisms to evade the innate immune system. PMID:23529619

Genotyping of Pseudomonas aeruginosa isolates from lung transplant recipients and aquatic environment-detected in-hospital transmission.

PubMed

Johansson, Ewa; Welinder-Olsson, Christina; Gilljam, Marita

2014-02-01

Lung infection with Pseudomonas aeruginosa is common in lung transplant recipients and may lead to severe complications. Bacteriological surveillance aims to detect transmission of microbes between hospital environment and patients. We sought to determine whether genotyping of P. aeruginosa isolates could improve identifications of pathways of infection. From 2004 to 2009, we performed genotyping with multiple-locus variable number of tandem repeats analysis (MLVA) and pulsed-field gel electrophoresis (PFGE) of P. aeruginosa isolates cultured from lung transplant recipients at Sahlgrenska University Hospital, Gothenburg. During a small outbreak in 2008, cultivation and genotyping of isolates from sink and drains samples from the hospital ward were performed. Pseudomona aeruginosa from 11/18 patients were genotyped to unique strains. The remaining seven patients were carriers of a P. aeruginosa strain of cluster A genotype. Pseudomona aeruginosa was isolated in 4/8 water samples, typed by MLVA also as cluster A genotype and confirmed by PFGE to be similar or identical to the isolates from four transplanted patients. In conclusion, genotyping of isolates revealed a clonal relationship between patient and water isolates, indicating in-hospital transmission of P. aeruginosa. We suggest genotyping with MLVA for rapid routine surveillance, with the PFGE method used for extended, confirmatory analyses. © 2013 APMIS. Published by John Wiley & Sons Ltd.

Induced Formation of Chelating Agents by Pseudomonas aeruginosa Grown in Presence of Thorium and Uranium

DTIC Science & Technology

1985-07-01

aerugiaosa PAO-l, Saccharomyces cerevisiae, Aspergillus niger , P. fluorescens, Escherichia coli, and Thiobacillus ferroxidans. Interaction of these...shown that P. aeruginosa CSU has..a-••reference for uranium while P. aeruginosa PAO-l, Aspergillus niger and-P. fluorescens exhibits a preference for...exhibits a preference for chromium. Aspergillus niger under identical conditions is chromium and manganese selective. P. aeruginosa when grown in th

Insights into the binding interactions of autochthonous dissolved organic matter released from Microcystis aeruginosa with pyrene using spectroscopy.

PubMed

Yang, Chenghu; Liu, Yangzhi; Zhu, Yaxian; Zhang, Yong

2016-03-15

The autochthonous dissolved organic matter (DOM) released by Microcystis aeruginosa (M. aeruginosa-DOM) during its growth period was characterized by spectroscopy. Furthermore, the relationships between the M. aeruginosa-DOM spectroscopic descriptors and the pyrene binding coefficient (KDOC) values were explored. The results showed that the spectroscopic characteristics of the M. aeruginosa-DOM and the binding properties of pyrene were dynamically changed along with the algae growth. Pearson correlation analysis demonstrated that a higher pyrene KDOC value was observed for the M. aeruginosa-DOM that has a higher humification index (HIX) value, a lower biological index (BIX) value and a lower absorption ratio (E2/E3). The presence of protein-like and long-wavelength-excited humic-like components may impose negative and positive effects on binding of pyrene by the M. aeruginosa-DOM, respectively. Principal component analysis (PCA) further supported that the binding affinity of pyrene may be primarily influenced by the humification degree of the M. aeruginosa-DOM. Copyright © 2016 Elsevier Ltd. All rights reserved.

In vivo antioxidative property, antimicrobial and wound healing activity of flower extracts of Pyrostegia venusta (Ker Gawl) Miers.

PubMed

Roy, Purabi; Amdekar, Sarika; Kumar, Avnish; Singh, Rambir; Sharma, Poonam; Singh, Vinod

2012-03-06

Pyrostegia venusta (Ker Gawl) Miers. (Bignoniaceae), has been traditionally used as a remedy for treating white patches and infections on the skin (leukoderma, vitiligo). To investigate wound healing and antimicrobial activity of flower extract of Pyrostegia venusta, including in vivo antioxidant activity. Methanolic extracts of Pyrostegia venusta flowers were studied for wound healing efficiency along with its effect on pro-inflammatory and anti-inflammatory cytokines was assessed using excision and incision model of wound repair in Wistar rats. Healing was assessed by the rate of wound contraction, tensile strength, breaking strength, hydroxyproline and hexosamine content. Antimicrobial activity of the flower extract against twelve microorganisms was also assessed. In vivo antioxidant activity was performed to understand the mechanism of wound healing potency. The results indicated that Pyrostegia venusta extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. Hydroxyproline and hexosamine expression were also correlative with the healing pattern observed. Pyrostegia venusta extract exhibited moderate antimicrobial activity against the organisms: Bacillus subtilis, Staphylococcus epidermidis, Staphylococcus pyogenes, Staphylococcus aureus, Escherichia coli, Micrococcus luteus, Enterobacter aerogenes, Salmonella typhi, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Candida tropicana. During early wound healing phase TNF-α and IL-6 level were found to be up regulated by Pyrostegia venusta treatment. Increased wound contraction and tensile strength, augmented hydroxyproline and hexosamine content along with antioxidative activity and moderate antimicrobial activity support the early wound healing exhibited by Pyrostegia venusta flower extract. Induction in cytokine production may be one of the mechanisms involved in accelerating the wound healing by Pyrostegia venusta extract. Results suggest

Antituberculotic activity of actinobacteria isolated from the rare habitats.

PubMed

Hussain, A; Rather, M A; Shah, A M; Bhat, Z S; Shah, A; Ahmad, Z; Parvaiz Hassan, Q

2017-09-01

A distinctive screening procedure resulted in the isolation and identification of antituberculotic actinobacteria. In this course, a total of 125 actinobacteria were isolated from various soil samples from untapped areas in Northwestern Himalayas, India. The antibacterial screening showed that 26 isolates inhibited the growth of at least one of the tested bacterial pathogens including Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (ATCC 12228), Bacillus subtilis (ATCC 11774), Micrococcus luteus (ATCC 10240), Escherichia coli (10536), Pseudomonas aeruginosa (ATCC 10145) and Klebsiella pneumonia (ATCC BAA-2146). The production media was optimized for the active strains by estimation of their extract value by the quantification of the ethyl acetate extract. The screening of fermentation products from the selected 26 bioactive isolates revealed that 10 strains have metabolites antagonistic against the standard H37Rv strain of Mycobacterium tuberculosis. The characterization by 16S rRNA gene sequencing and phylogenetic analysis demonstrated the diverse nature of these antituberculosis strains. The secondary metabolites of potent, rare strain, Lentzea violacea AS08 exhibited promising antituberculosis activity with minimal inhibitory concentration (MIC) of 3·9 μg ml -1 . The metabolites identified by gas chromatography-mass spectrometry (GC-MS) included, Phenol, 2,5-bis (1, 1-dimethylethyl), n-Hexadecanoic acid, Hexadecanoic acid methyl-ester, Hexadecanoic acid ethyl-ester and, 9,12-Octadecadienoyl chloride(Z,Z) are biologically significant molecules. The study presents the isolation of rare actinobacteria from untapped sites in the Northwestern Himalayas and their in vitro potential against Mycobacterium tuberculosis for their metabolites. The study revealed that exploring the untapped natural sources as one of the resourceful approaches for the discovery of new natural products. This study also provided strong evidence for the ability of rare and

Spectroscopic study, antimicrobial activity and crystal structures of N-(2-hydroxy-5-nitrobenzalidene)4-aminomorpholine and N-(2-hydroxy-1-naphthylidene)4-aminomorpholine

NASA Astrophysics Data System (ADS)

Yıldız, Mustafa; Ünver, Hüseyin; Dülger, Başaran; Erdener, Diğdem; Ocak, Nazan; Erdönmez, Ahmet; Durlu, Tahsin Nuri

2005-03-01

Schiff bases N-(2-hydroxy-3-nitrobenzalidene)4-aminomorpholine ( 1) and N-(2-hydroxy-1-naphthylidene)4-aminomorpholine ( 2) were synthesized from the reaction of 4-aminomorpholine with 2-hydroxy-5-nitrobenzaldehyde and 2-hydroxy-1-naphthaldehyde. Compounds 1 and 2 were characterized by elemental analysis, IR, 1H NMR, 13C NMR and UV-Visible techniques. The UV-Visible spectra of the Schiff bases with OH group in ortho position to the imino group were studied in polar and nonpolar solvents in acidic and basic media. The structures of compounds 1 and 2 have been examined cyrstallographically, for two compounds exist as dominant form of enol-imines in both the solutions and solid state. The title compounds 1 and 2 crystallize in the monoclinic space group P2 1/ c and P2 1/ n with unit cell parameters: a=8.410(1) and 11.911(3), b=6.350(9) and 4.860(9), c=21.728(3) and 22.381(6) Å, β=90.190(1) and 95.6(2)°, V=1160.6(3) and 1289.5(5) Å 3, Dx=1.438 and 1.320 g cm -3, respectively. The crystal structures were solved by direct methods and refined by full-matrix least squares. The antimicrobial activities of compounds 1 and 2 have also been studied. The antimicrobial activities of the ligands have been screened in vitro against the organisms Escherichia coli ATCC 11230, Staphylococcus aureus ATCC 6538, Klebsiella pneumoniae UC57, Micrococcus luteus La 2971, Proteus vulgaris ATCC 8427, Pseudomonas aeruginosa ATCC 27853, Mycobacterium smegmatis CCM 2067, Bacillus cereus ATCC 7064, Listeria monocytogenes ATCC 15313, Candida albicans ATCC 10231, Kluyveromyces fragilis NRRL 2415, Rhodotorula rubra DSM 70403, Debaryomyces hansenii DSM 70238 and Hanseniaspora guilliermondii DSM 3432.

Synthesis, structural characterization and photoluminescence properties of a novel La(III) complex

NASA Astrophysics Data System (ADS)

Köse, Muhammet; Ceyhan, Gökhan; Atcı, Emine; McKee, Vickie; Tümer, Mehmet

2015-05-01

In this study, a novel La(III) complex [La(H2L)2(NO3)3(MeOH)] of a Schiff base ligand was synthesized and characterized by spectroscopic and analytical methods. Single crystals of the complex suitable for X-ray diffraction study were obtained by slow diffusion of diethyl ether into a MeOH solution of the complex which was found to crystallise as [La(H2L)2(NO3)3(MeOH)]ṡ2MeOHṡH2O. The structure was solved in monoclinic crystal system, P21/n space group with unit cell parameters a = 10.5641(11), b = 12.6661(16), c = 16.0022(17) Å, α = 67.364(2), β = 83.794(2)°, γ = 70.541(2)°, V = 1862.9(4) Å3 and Z = 2 with R final value of 0.526. In the complex, the La(III) ion is ten-coordinated by O atoms, five of which come from three nitrate ions, four from the two Schiff base ligands and one from MeOH oxygen atom. The Schiff base ligands in the structure are in a zwitter ion form with the phenolic H transferred to the imine N atom. Thermal properties of the La(III) complex were examined by thermogravimetric analysis and the complex was found to be thermally stable up to 310 °C. The Schiff base ligand and its La(II) complex were screened for their in vitro antimicrobial activity against Bacillus megaterium, Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus (Gram positive bacteria), Klebsiella pneumonia, Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa (Gram negative bacteria), Candida albicans,Yarrowia lipolytica (fungus) and Saccharomyces cerevisiae (yeast). The complex shows more antimicrobial activity than the free ligand.

Antiphagocytic Effect of Slime from a Mucoid Strain of Pseudomonas aeruginosa

PubMed Central

Schwarzmann, Stephen; Boring, John R.

1971-01-01

Mucoid strains of Pseudomonas aeruginosa produce a viscid slime when grown on the surface of agar media. These strains are known to colonize persistently the tracheobronchial tree of children with cystic fibrosis. Colonization may result from inhibition of phagocytosis due to slime produced by the organism. Slime separated from one mucoid strain was examined to determine whether it possessed antiphagocytic activity in vitro. Cells of P. aeruginosa, Escherichia coli, and Staphylococcus aureus were rapidly phagocytized by rabbit polymorphonuclear leukocytes when mixtures were rotated for 2 hr at 37 C in the absence of slime. The addition of relatively small amounts of slime to bacteria and leukocytes inhibited phagocytosis as measured by phagocytic killing of the organisms. Inhibition was found to be most complete with P. aeruginosa. PMID:16558051

Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

PubMed Central

Kimoto, Hideyuki; Yoshimune, Kazuaki; Matsuyma, Hidetoshi; Yumoto, Isao

2012-01-01

A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2) under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA) at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA) at a moderate rate, in order to adapt to high concentration of H2O2. PMID:22408420

Resistance to antibiotics in clinical isolates of Pseudomonas aeruginosa.

PubMed

Sevillano, E; Valderrey, C; Canduela, M J; Umaran, A; Calvo, F; Gallego, L

2006-01-01

To analyse the global resistance to some antibiotics used to treat nosocomial infections by Pseudomonas aeruginosa, specially to carbapenems, and its relationship with the presence of carbapenemases, OXA, VIM and IMP. The study included 229 P. aeruginosa isolates from a Hospital in Northern Spain (year 2002). Susceptibility to antimicrobial agents was determined by the analysis of the MIC. Genetic typing was carried out by RAPD-PCR fingerprinting with primer ERIC-2. Genetic experiments to detect class-1 integrons were performed by PCR with primers 5'CS and 3'CS. Detection of carbapenemases was done by phenotypic (Hodge test and DDST) and genotypic methods (PCR with primers for imp, vim1, vim2 and oxa40 genes). 23.9% of isolates were resistant to ceftazidime, 35.9% to cefotaxime, 5.3% to amikacin, 54.9% to gentamicin, 14.6% to imipenem and 6.6% to meropenem. Isolates resistant to imipenem (33) were furtherly tested. Genetic typing didn't show clonal relatedness among the most of the isolates. Class-1 integrons were present in most isolates (sizes 600-1700 bp). Phenotypic methods for carbapenemases showed 5 positive isolates. Genotypic methods showed the presence of two isolates with the oxa40 gene. Meropenem, amikacin and imipenem were the most active agents to treat infections caused by Pseudomonas aeruginosa. In our study, the presence of carbapenemase enzymes wasn't high. Phenotypic tests cannot be considered as accurate screening tool to detect carbapenemases. This is the fist report of the oxa40 gene in Pseudomonas aeruginosa isolates.

One time quantitative PCR detection of Pseudomonas aeruginosa to discriminate intermittent from chronic infection in cystic fibrosis.

PubMed

Boutin, Sébastien; Weitnauer, Michael; Hassel, Selina; Graeber, Simon Y; Stahl, Mirjam; Dittrich, A Susanne; Mall, Marcus A; Dalpke, Alexander H

2018-05-01

Chronic airway infection with Pseudomonas aeruginosa is a major risk factor of progression of lung disease in patients with cystic fibrosis (CF). Chronic P. aeruginosa infection evolves from intermittent infection that is amenable to antibiotic eradication, whereas chronically adapted P. aeruginosa becomes resistant to antibiotic therapy. Discrimination of intermittent versus chronic infection is therefore of high therapeutic relevance, yet the available diagnostic methods are only partly satisfactory. The aim of the present study was, therefore, to evaluate the usage of quantitative PCR (qPCR) to measure pathogen abundance and to discriminate between intermittent and chronic Pseudomonas infection in patients with CF. Using an established qPCR protocol, we analyzed the abundance of P. aeruginosa in 141 throats swabs and 238 sputa from CF patients with intermittent or chronic infection with P. aeruginosa, as determined by standard culture based diagnostics. We observed a large increase of abundance of P. aeruginosa in throat swabs and sputum samples from patients with chronic compared to intermittent infections with P. aeruginosa. The data show that abundance of P. aeruginosa as measured by qPCR is a valuable tool to discriminate intermittent from chronic infection. Of note, P. aeruginosa burden seems more sensitive than mucoidity phenotype to discriminate chronic from intermittent strains. Furthermore we observed that molecular detection in throat swabs was linked to a viable culture in the sputum when sputum was available. This result is of special interest in young patients with cystic fibrosis that often cannot expectorate sputum. We also observed that qPCR in comparison to culture detected the infection earlier. The results suggest that qPCR detection and quantification of P. aeruginosa is a precious tool to be added to the diagnostic toolbox in cystic fibrosis. Copyright © 2018 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Pyoverdine and proteases affect the response of Pseudomonas aeruginosa to gallium in human serum.

PubMed

Bonchi, Carlo; Frangipani, Emanuela; Imperi, Francesco; Visca, Paolo

2015-09-01

Gallium is an iron mimetic which has recently been repurposed as an antibacterial agent due to its capability to disrupt bacterial iron metabolism. In this study, the antibacterial activity of gallium nitrate [Ga(NO3)3] was investigated in complement-free human serum (HS) on 55 Pseudomonas aeruginosa clinical isolates from cystic fibrosis and non-cystic fibrosis patients. The susceptibility of P. aeruginosa to Ga(NO3)3 in HS was dependent on the bacterial ability to acquire iron from serum binding proteins (i.e., transferrin). The extent of serum protein degradation correlated well with P. aeruginosa growth in HS, while pyoverdine production did not. However, pyoverdine-deficient P. aeruginosa strains were unable to grow in HS and overcome iron restriction, albeit capable of releasing proteases. Predigestion of HS with proteinase K promoted the growth of all strains, irrespective of their ability to produce proteases and/or pyoverdine. The MICs of Ga(NO3)3 were higher in HS than in an iron-poor Casamino Acids medium, where proteolysis does not affect iron availability. Coherently, strains displaying high proteolytic activity were less susceptible to Ga(NO3)3 in HS. Our data support a model in which both pyoverdine and proteases affect the response of P. aeruginosa to Ga(NO3)3 in HS. The relatively high Ga(NO3)3 concentration required to inhibit the growth of highly proteolytic P. aeruginosa isolates in HS poses a limitation to the potential of Ga(NO3)3 in the treatment of P. aeruginosa bloodstream infections. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Pseudomonas aeruginosa clinical and environmental isolates constitute a single population with high phenotypic diversity

PubMed Central

2014-01-01

Background Pseudomonas aeruginosa is an opportunistic pathogen with a high incidence of hospital infections that represents a threat to immune compromised patients. Genomic studies have shown that, in contrast to other pathogenic bacteria, clinical and environmental isolates do not show particular genomic differences. In addition, genetic variability of all the P. aeruginosa strains whose genomes have been sequenced is extremely low. This low genomic variability might be explained if clinical strains constitute a subpopulation of this bacterial species present in environments that are close to human populations, which preferentially produce virulence associated traits. Results In this work, we sequenced the genomes and performed phenotypic descriptions for four non-human P. aeruginosa isolates collected from a plant, the ocean, a water-spring, and from dolphin stomach. We show that the four strains are phenotypically diverse and that this is not reflected in genomic variability, since their genomes are almost identical. Furthermore, we performed a detailed comparative genomic analysis of the four strains studied in this work with the thirteen previously reported P. aeruginosa genomes by means of describing their core and pan-genomes. Conclusions Contrary to what has been described for other bacteria we have found that the P. aeruginosa core genome is constituted by a high proportion of genes and that its pan-genome is thus relatively small. Considering the high degree of genomic conservation between isolates of P. aeruginosa from diverse environments, including human tissues, some implications for the treatment of infections are discussed. This work also represents a methodological contribution for the genomic study of P. aeruginosa, since we provide a database of the comparison of all the proteins encoded by the seventeen strains analyzed. PMID:24773920

Novel drug targets in cell wall biosynthesis exploited by gene disruption in Pseudomonas aeruginosa.

PubMed

Elamin, Ayssar A; Steinicke, Susanne; Oehlmann, Wulf; Braun, Yvonne; Wanas, Hanaa; Shuralev, Eduard A; Huck, Carmen; Maringer, Marko; Rohde, Manfred; Singh, Mahavir

2017-01-01

For clinicians, Pseudomonas aeruginosa is a nightmare pathogen that is one of the top three causes of opportunistic human infections. Therapy of P. aeruginosa infections is complicated due to its natural high intrinsic resistance to antibiotics. Active efflux and decreased uptake of drugs due to cell wall/membrane permeability appear to be important issues in the acquired antibiotic tolerance mechanisms. Bacterial cell wall biosynthesis enzymes have been shown to be essential for pathogenicity of Gram-negative bacteria. However, the role of these targets in virulence has not been identified in P. aeruginosa. Here, we report knockout (k.o) mutants of six cell wall biosynthesis targets (murA, PA4450; murD, PA4414; murF, PA4416; ppiB, PA1793; rmlA, PA5163; waaA, PA4988) in P. aeruginosa PAO1, and characterized these in order to find out whether these genes and their products contribute to pathogenicity and virulence of P. aeruginosa. Except waaA k.o, deletion of cell wall biosynthesis targets significantly reduced growth rate in minimal medium compared to the parent strain. The k.o mutants showed exciting changes in cell morphology and colonial architectures. Remarkably, ΔmurF cells became grossly enlarged. Moreover, the mutants were also attenuated in vivo in a mouse infection model except ΔmurF and ΔwaaA and proved to be more sensitive to macrophage-mediated killing than the wild-type strain. Interestingly, the deletion of the murA gene resulted in loss of virulence activity in mice, and the virulence was restored in a plant model by unknown mechanism. This study demonstrates that cell wall targets contribute significantly to intracellular survival, in vivo growth, and pathogenesis of P. aeruginosa. In conclusion, these findings establish a link between cell wall targets and virulence of P. aeruginosa and thus may lead to development of novel drugs for the treatment of P. aeruginosa infection.

A Biofilm Matrix-Associated Protease Inhibitor Protects Pseudomonas aeruginosa from Proteolytic Attack

PubMed Central

2018-01-01

ABSTRACT Pseudomonas aeruginosa produces an extracellular biofilm matrix that consists of nucleic acids, exopolysaccharides, lipid vesicles, and proteins. In general, the protein component of the biofilm matrix is poorly defined and understudied relative to the other major matrix constituents. While matrix proteins have been suggested to provide many functions to the biofilm, only proteins that play a structural role have been characterized thus far. Here we identify proteins enriched in the matrix of P. aeruginosa biofilms. We then focused on a candidate matrix protein, the serine protease inhibitor ecotin (PA2755). This protein is able to inhibit neutrophil elastase, a bactericidal enzyme produced by the host immune system during P. aeruginosa biofilm infections. We show that ecotin binds to the key biofilm matrix exopolysaccharide Psl and that it can inhibit neutrophil elastase when associated with Psl. Finally, we show that ecotin protects both planktonic and biofilm P. aeruginosa cells from neutrophil elastase-mediated killing. This may represent a novel mechanism of protection for biofilms to increase their tolerance against the innate immune response. PMID:29636440

Antimicrobial Air Filters Using Natural Euscaphis japonica Nanoparticles

PubMed Central

Yun, Ji Ho; Lee, Jung Eun; Lee, Hee Ju; Nho, Chu Won; Bae, Gwi- Nam; Jung, Jae Hee

2015-01-01

Controlling bioaerosols has become more important with increasing participation in indoor activities. Treatments using natural-product nanomaterials are a promising technique because of their relatively low toxicity compared to inorganic nanomaterials such as silver nanoparticles or carbon nanotubes. In this study, antimicrobial filters were fabricated from natural Euscaphis japonica nanoparticles, which were produced by nebulizing E. japonica extract. The coated filters were assessed in terms of pressure drop, antimicrobial activity, filtration efficiency, major chemical components, and cytotoxicity. Pressure drop and antimicrobial activity increased as a function of nanoparticle deposition time (590, 855, and 1150 µg/cm2filter at 3-, 6-, and 9-min depositions, respectively). In filter tests, the antimicrobial efficacy was greater against Staphylococcus epidermidis than Micrococcus luteus; ~61, ~73, and ~82% of M. luteus cells were inactivated on filters that had been coated for 3, 6, and 9 min, respectively, while the corresponding values were ~78, ~88, and ~94% with S. epidermidis. Although statistically significant differences in filtration performance were not observed between samples as a function of deposition time, the average filtration efficacy was slightly higher for S. epidermidis aerosols (~97%) than for M. luteus aerosols (~95%). High-performance liquid chromatography (HPLC) and electrospray ionization-tandem mass spectrometry (ESI/MS) analyses confirmed that the major chemical compounds in the E. japonica extract were 1(ß)-O-galloyl pedunculagin, quercetin-3-O-glucuronide, and kaempferol-3-O-glucoside. In vitro cytotoxicity and disk diffusion tests showed that E. japonica nanoparticles were less toxic and exhibited stronger antimicrobial activity toward some bacterial strains than a reference soluble nickel compound, which is classified as a human carcinogen. This study provides valuable information for the development of a bioaerosol control

Prevalence and spread of pseudomonas aeruginosa and Klebsiella pneumoniae strains in patients with hematological malignancies.

PubMed

Kolar, Milan; Sauer, Pavel; Faber, Edgar; Kohoutova, Jarmila; Stosová, Tatana; Sedlackova, Michaela; Chroma, Magdalena; Koukalova, Dagmar; Indrak, Karel

2009-01-01

The aim of the study was to determine the prevalence of Pseudomonas aeruginosa and Klebsiella pneumoniae strains in patients with acute leukemias, to assess their clinical significance, and to define the sources and ways of their spread using genetic analysis. Thirty-four patients were investigated during the observed period. Twenty-one strains of Pseudomonas aeruginosa and 35 strains of Klebsiella pneumoniae were isolated from patient samples. In the case of Pseudomonas aeruginosa, 47.6% of strains were identified as pathogens and caused infection. By contrast, only 4 isolates (11.4%) of Klebsiella pneumoniae could be regarded as etiological agents of bacterial infection. Based on the obtained results, Klebsiella pneumoniae strains are assumed to be of mostly endogenous origin. In the case of Pseudomonas aeruginosa strains, the proportion of identical strains detected in various patients was higher and exogenous sources were more significant. In addition, our results confirmed the ability of Pseudomonas aeruginosa strains to survive on a particular site in the hospital for a longer time.

Antibiotic Conditioned Growth Medium of Pseudomonas Aeruginosa

ERIC Educational Resources Information Center

Benathen, Isaiah A.; Cazeau, Barbara; Joseph, Njeri

2004-01-01

A simple method to study the consequences of bacterial antibiosis after interspecific competition between microorganisms is presented. Common microorganisms are used as the test organisms and Pseudomonas aeruginosa are used as the source of the inhibitor agents.

Crystal Structure of the Pseudomonas aeruginosa Virulence Factor Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordes, Timothy J.; Worzalla, Gregory A.; Ginster, Aaron M.

2012-09-07

Virulence factor regulator (Vfr) enhances Pseudomonas aeruginosa pathogenicity through its role as a global transcriptional regulator. The crystal structure of Vfr shows that it is a winged-helix DNA-binding protein like its homologue cyclic AMP receptor protein (CRP). In addition to an expected primary cyclic AMP-binding site, a second ligand-binding site is nestled between the N-terminal domain and the C-terminal helix-turn-helix domain. Unlike CRP, Vfr is a symmetric dimer in the absence of DNA. Removal of seven disordered N-terminal residues of Vfr prvents the growth of P. aeruginosa.

Pseudomonas aeruginosa-Candida albicans Interactions: Localization and Fungal Toxicity of a Phenazine Derivative▿

PubMed Central

Gibson, Jane; Sood, Arpana; Hogan, Deborah A.

2009-01-01

Phenazines are redox-active small molecules that play significant roles in the interactions between pseudomonads and diverse eukaryotes, including fungi. When Pseudomonas aeruginosa and Candida albicans were cocultured on solid medium, a red pigmentation developed that was dependent on P. aeruginosa phenazine biosynthetic genes. Through a genetic screen in combination with biochemical experiments, it was found that a P. aeruginosa-produced precursor to pyocyanin, proposed to be 5-methyl-phenazinium-1-carboxylate (5MPCA), was necessary for the formation of the red pigmentation. The 5MPCA-derived pigment was found to accumulate exclusively within fungal cells, where it retained the ability to be reversibly oxidized and reduced, and its detection correlated with decreased fungal viability. Pyocyanin was not required for pigment formation or fungal killing. Spectral analyses showed that the partially purified pigment from within the fungus differed from aeruginosins A and B, two red phenazine derivatives formed late in P. aeruginosa cultures. The red pigment isolated from C. albicans that had been cocultured with P. aeruginosa was heterogeneous and difficult to release from fungal cells, suggesting its modification within the fungus. These findings suggest that intracellular targeting of some phenazines may contribute to their toxicity and that this strategy could be useful in developing new antifungals. PMID:19011064

Evaluation of different phenotypic tests for detection of metallo-β-lactamases in imipenem-resistant Pseudomonas aeruginosa.

PubMed

Sachdeva, Rohit; Sharma, Babita; Sharma, Rajni

2017-01-01

Pseudomonas aeruginosa causes a wide spectrum of infections including bacteremia, pneumonia, urinary tract infection, etc., Metallo-beta-lactamase (MBL) producing P. aeruginosa is an emerging threat and cause of concern as they have emerged as one of the most feared resistance mechanisms. This study was designed to know the prevalence of MBL production in P. aeruginosa and to evaluate the four phenotypic tests for detection of MBL production in imipenem-resistant clinical isolates of P. aeruginosa . Totally, 800 isolates of P. aeruginosa isolated from various clinical samples were evaluated for carbapenem resistance and MBL production. All imipenem-resistant strains were tested for carabapenemase production by modified Hodge test. Screening for MBL production was done by double-disc synergy test and combined disc test (CDT). Confirmation of MBL production was done by the E-test (Ab BioDisk, Solna, Sweden). Out of the 800 isolates of P. aeruginosa , 250 isolates were found resistant to imipenem. Based on the results of E-test, 147 (18.37%) isolates of P. aeruginosa were positive for MBL production. The CDT has the highest sensitivity and specificity for the detection of MBL production as compared to other tests. The results of this study are indicative that MBL production is an important mechanism of carbapenem resistance among P. aeruginosa . Use of simple screening test like CDT will be crucial step toward large-scale monitoring of these emerging resistant determinants. Phenotypic test for MBL production has to be standardized, and all the isolates should be routinely screened for MBL production.

Evaluation of different phenotypic tests for detection of metallo-β-lactamases in imipenem-resistant Pseudomonas aeruginosa

PubMed Central

Sachdeva, Rohit; Sharma, Babita; Sharma, Rajni

2017-01-01

PURPOSE: Pseudomonas aeruginosa causes a wide spectrum of infections including bacteremia, pneumonia, urinary tract infection, etc., Metallo-beta-lactamase (MBL) producing P. aeruginosa is an emerging threat and cause of concern as they have emerged as one of the most feared resistance mechanisms. This study was designed to know the prevalence of MBL production in P. aeruginosa and to evaluate the four phenotypic tests for detection of MBL production in imipenem-resistant clinical isolates of P. aeruginosa. METHODS: Totally, 800 isolates of P. aeruginosa isolated from various clinical samples were evaluated for carbapenem resistance and MBL production. All imipenem-resistant strains were tested for carabapenemase production by modified Hodge test. Screening for MBL production was done by double-disc synergy test and combined disc test (CDT). Confirmation of MBL production was done by the E-test (Ab BioDisk, Solna, Sweden). RESULTS: Out of the 800 isolates of P. aeruginosa, 250 isolates were found resistant to imipenem. Based on the results of E-test, 147 (18.37%) isolates of P. aeruginosa were positive for MBL production. The CDT has the highest sensitivity and specificity for the detection of MBL production as compared to other tests. CONCLUSION: The results of this study are indicative that MBL production is an important mechanism of carbapenem resistance among P. aeruginosa. Use of simple screening test like CDT will be crucial step toward large-scale monitoring of these emerging resistant determinants. Phenotypic test for MBL production has to be standardized, and all the isolates should be routinely screened for MBL production. PMID:28966485

Epidemiology and Characteristics of Metallo-β-Lactamase-Producing Pseudomonas aeruginosa

PubMed Central

Bae, Il Kwon; Jang, In-Ho; Kang, Hyun-Kyung; Lee, Kyungwon

2015-01-01

Metallo-β-lactamase-producing Pseudomonas aeruginosa (MPPA) is an important nosocomial pathogen that shows resistance to all β-lactam antibiotics except monobactams. There are various types of metallo-β-lactamases (MBLs) in carbapenem-resistant P. aeruginosa including Imipenemase (IMP), Verona integron-encoded metallo-β-lactamase (VIM), Sao Paulo metallo-β-lactamase (SPM), Germany imipenemase (GIM), New Delhi metallo-β-lactamase (NDM), Florence imipenemase (FIM). Each MBL gene is located on specific genetic elements including integrons, transposons, plasmids, or on the chromosome, in which they carry genes encoding determinants of resistance to carbapenems and other antibiotics, conferring multidrug resistance to P. aeruginosa. In addition, these genetic elements are transferable to other Gram-negative species, increasing the antimicrobial resistance rate and complicating the treatment of infected patients. Therefore, it is essential to understand the epidemiology, resistance mechanism, and molecular characteristics of MPPA for infection control and prevention of a possible global health crisis. Here, we highlight the characteristics of MPPA. PMID:26157586

Crystal structure of secretory protein Hcp3 from Pseudomonas aeruginosa.

PubMed

Osipiuk, Jerzy; Xu, Xiaohui; Cui, Hong; Savchenko, Alexei; Edwards, Aled; Joachimiak, Andrzej

2011-03-01

The Type VI secretion pathway transports proteins across the cell envelope of Gram-negative bacteria. Pseudomonas aeruginosa, an opportunistic Gram-negative bacterial pathogen infecting humans, uses the type VI secretion pathway to export specific effector proteins crucial for its pathogenesis. The HSI-I virulence locus encodes for several proteins that has been proposed to participate in protein transport including the Hcp1 protein, which forms hexameric rings that assemble into nanotubes in vitro. Two Hcp1 paralogues have been identified in the P. aeruginosa genome, Hsp2 and Hcp3. Here, we present the structure of the Hcp3 protein from P. aeruginosa. The overall structure of the monomer resembles Hcp1 despite the lack of amino-acid sequence similarity between the two proteins. The monomers assemble into hexamers similar to Hcp1. However, instead of forming nanotubes in head-to-tail mode like Hcp1, Hcp3 stacks its rings in head-to-head mode forming double-ring structures.

FpvA receptor involvement in pyoverdine biosynthesis in Pseudomonas aeruginosa.

PubMed

Shen, Jiangsheng; Meldrum, Allison; Poole, Keith

2002-06-01

Alignment of the Pseudomonas aeruginosa ferric pyoverdine receptor, FpvA, with similar ferric-siderophore receptors revealed that the mature protein carries an extension of ca. 70 amino acids at its N terminus, an extension shared by the ferric pseudobactin receptors of P. putida. Deletion of fpvA from the chromosome of P. aeruginosa reduced pyoverdine production in this organism, as a result of a decline in expression of genes (e.g., pvdD) associated with the biosynthesis of the pyoverdine peptide moiety. Wild-type fpvA restored pvd expression in the mutant, thereby complementing its pyoverdine deficiency, although a deletion derivative of fpvA encoding a receptor lacking the N terminus of the mature protein did not. The truncated receptor was, however, functional in pyoverdine-mediated iron uptake, as evidenced by its ability to promote pyoverdine-dependent growth in an iron-restricted medium. These data are consistent with the idea that the N-terminal extension plays a role in FpvA-mediated pyoverdine biosynthesis in P. aeruginosa.

Biosorption of uranium by Pseudomonas aeruginosa strain CSU: Characterization and comparison studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, M.Z.C.; Norman, J.M.; Faison, B.D.

1996-07-20

Pseudomonas aeruginosa strain CSU, a nongenetically engineered bacterial strain known to bind dissolved hexavalent uranium (as UO{sub 2}{sup 2+} and/or its cationic hydroxo complexes) was characterized with respect to its sorptive activity. The uranium biosorption equilibrium could be described by the Langmuir isotherm. The rate of uranium adsorption increased following permeabilization of the outer and/or cytoplasmic membrane by organic solvents such as acetone. P. aeruginosa CSU biomass was significantly more sorptive toward uranium than certain novel, patented biosorbents derived from algal or fungal biomass sources. P. aeruginosa CSU biomass was also competitive with commercial cation-exchange resins, particularly in the presencemore » of dissolved transition metals. Uranium binding by P. aeruginosa CSU was clearly pH dependent. Uranium loading capacity increased with increasing pH under acidic conditions, presumably as a function of uranium speciation and due to the H{sup +} competition at some binding sites. Nevertheless, preliminary evidence suggests that this microorganism is also capable of binding anionic hexavalent uranium complexes. Ferric iron was a strong inhibitor of uranium binding to P. aeruginosa CSU biomass, and the presence of uranium also decreased the Fe{sup 3+} loading when the biomass was not saturated with Fe{sup 3+}. Thus, a two-state process in which iron and uranium are removed in consecutive steps was proposed for efficient use of the biomass as a biosorbent in uranium removal from mine wastewater, especially acidic leachates.« less

Killing of Pseudomonas aeruginosa by Chicken Cathelicidin-2 Is Immunogenically Silent, Preventing Lung Inflammation In Vivo

PubMed Central

Coorens, Maarten; Banaschewski, Brandon J. H.; Baer, Brandon J.; Yamashita, Cory; van Dijk, Albert; Veldhuizen, Ruud A. W.; Veldhuizen, Edwin J. A.

2017-01-01

ABSTRACT The development of antibiotic resistance by Pseudomonas aeruginosa is a major concern in the treatment of bacterial pneumonia. In the search for novel anti-infective therapies, the chicken-derived peptide cathelicidin-2 (CATH-2) has emerged as a potential candidate, with strong broad-spectrum antimicrobial activity and the ability to limit inflammation by inhibiting Toll-like receptor 2 (TLR2) and TLR4 activation. However, as it is unknown how CATH-2 affects inflammation in vivo, we investigated how CATH-2-mediated killing of P. aeruginosa affects lung inflammation in a murine model. First, murine macrophages were used to determine whether CATH-2-mediated killing of P. aeruginosa reduced proinflammatory cytokine production in vitro. Next, a murine lung model was used to analyze how CATH-2-mediated killing of P. aeruginosa affects neutrophil and macrophage recruitment as well as cytokine/chemokine production in the lung. Our results show that CATH-2 kills P. aeruginosa in an immunogenically silent manner both in vitro and in vivo. Treatment with CATH-2-killed P. aeruginosa showed reduced neutrophil recruitment to the lung as well as inhibition of cytokine and chemokine production, compared to treatment with heat- or gentamicin-killed bacteria. Together, these results show the potential for CATH-2 as a dual-activity antibiotic in bacterial pneumonia, which can both kill P. aeruginosa and prevent excessive inflammation. PMID:28947647

Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

PubMed

Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

2003-12-06

Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

Visualization of microbiological processes underlying stress relaxation in Pseudomonas aeruginosa biofilms.

PubMed

Peterson, Brandon W; Busscher, Henk J; Sharma, Prashant K; van der Mei, Henny C

2014-06-01

Bacterial biofilms relieve themselves from external stresses through internal rearrangement, as mathematically modeled in many studies, but never microscopically visualized for their underlying microbiological processes. The aim of this study was to visualize rearrangement processes occurring in mechanically deformed biofilms using confocal-laser-scanning-microscopy after SYTO9 (green-fluorescent) and calcofluor-white (blue-fluorescent) staining to visualize bacteria and extracellular-polymeric matrix substances, respectively. We apply 20% uniaxial deformation to Pseudomonas aeruginosa biofilms and fix deformed biofilms prior to staining, after allowing different time-periods for relaxation. Two isogenic P. aeruginosa strains with different abilities to produce extracellular polymeric substances (EPS) were used. By confocal-laser-scanning-microscopy all biofilms showed intensity distributions for fluorescence from which rearrangement of EPS and bacteria in deformed biofilms were derived. For the P. aeruginosa strain producing EPS, bacteria could not find new, stable positions within 100 s after deformation, while EPS moved toward deeper layers within 20 s. Bacterial rearrangement was not seen in P. aeruginosa biofilms deficient in production of EPS. Thus, EPS is required to stimulate bacterial rearrangement in mechanically deformed biofilms within the time-scale of our experiments, and the mere presence of water is insufficient to induce bacterial movement, likely due to its looser association with the bacteria.

Molecular identification and genotyping of Pseudomonas aeruginosa isolated from cystic fibrosis and non-cystic fibrosis patients with bronchiectasis.

PubMed

Eusebio, Nadia; Amorim, Adelina A; Gamboa, Fernanda; Araujo, Ricardo

2015-03-01

There is no standard methodology for the molecular identification and genotyping of Pseudomonas aeruginosa which are frequently isolated in bronchiectasis patients. Hence, the main goal of this work was to propose a methodology capable to simultaneously identify and genotype, in less than 6 h, clinical P. aeruginosa collected from cystic fibrosis (CF) and non-CF patients with bronchiectasis. Molecular analyses were conducted in clinical isolates by testing the newly colony-PCR strategy and SNaPaer assay. A total of 207 isolates of P. aeruginosa were collected from clinical samples. To assess the assay specificity, other Gram-negative non-aeruginosa bacteria, namely Pseudomonas and Burkholderia, were tested. The complete group of 23 markers included in the SNaPaer panel was observed exclusively in P. aeruginosa; more than 18 markers failed in other bacteria. A total of 43 SnaP profiles were obtained for clinical P. aeruginosa, being the profiles highly patient-specific. Six CF patients were colonized with P. aeruginosa isolates with very distinct SnaP profiles, particularly following adjustments on antibiotic therapy, thus suggesting changes on the dynamics and dominance of these bacteria. SnaPaer proved to be a good and reliable tool for identification and genotyping of clinical P. aeruginosa in a single-tube multiplex PCR. Combined with the proposed colony-PCR strategy, SnaPaer assay facilitates the molecular analysis of P. aeruginosa. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

1H NMR-Based Global Metabolic Studies of Pseudomonas aeruginosa upon Exposure of the Quorum Sensing Inhibitor Resveratrol.

PubMed

Chen, Tongtong; Sheng, Jiyang; Fu, Yonghong; Li, Minghui; Wang, Junsong; Jia, Ai-Qun

2017-02-03

Quorum sensing (QS) is a process of bacterial communication that has been a novel target for drug discovery. Pyocyanin quantification assay confirmed that resveratrol was an effective quorum sensing inhibitor (QSI) against Pseudomonas aeruginosa PAO1. In this study, the global metabolite changes of P. aeruginosa PAO1 exposed to QSI resveratrol were investigated by 1 H NMR spectroscopy. A total of 40 metabolites containing amino acids, organic acid, organic amine, and energy storage compounds were identified. The changed metabolic profile indicated that resveratrol influenced pathways including oxidative stress, protein synthesis, and energy metabolism. Oxidative stress could upregulate the expression of genes related to QS in P. aeruginosa. It suggested that resveratrol could inhibit the QS systems in P. aeruginosa PAO1 by relieving oxidative stress due to its antioxidant activity. On the other hand, resveratrol could attenuate the pathogenicity of P. aeruginosa PAO1 by disturbing the TCA cycle so that anaerobic respiration could suppress the virulence because anaerobiosis could induce the loss of cytotoxicity regulated by QS in P. aeruginosa. These findings deepened our comprehending of the metabolic responses of P. aeruginosa PAO1 to resveratrol and pinpointed the possible underlying mechanism of resveratrol's inhibition effect on QS in P. aeruginosa PAO1.

Whole Microorganisms Studied by Pyrolysis-Gas Chromatography-Mass Spectrometry: Significance for Extraterrestrial Life Detection Experiments 1

PubMed Central

Simmonds, Peter G.

1970-01-01

Pyrolysis-gas chromatography-mass spectrometric studies of two microorganisms, Micrococcus luteus and Bacillus subtilis var. niger, indicate that the majority of thermal fragments originate from the principal classes of bio-organic matter found in living systems such as protein and carbohydrate. Furthermore, there is a close qualitative similarity between the type of pyrolysis products found in microorganisms and the pyrolysates of other biological materials. Conversely, there is very little correlation between microbial pyrolysates and comparable pyrolysis studies of meteoritic and fossil organic matter. These observations will aid in the interpretation of a soil organic analysis experiment to be performed on the surface of Mars in 1975. The science payload of this landed mission will include a combined pyrolysis-gas chromatography-mass spectrometry instrument as well as several “direct biology experiments” which are designed to search for extraterrestrial life. PMID:16349890

An antibacterial ortho-quinone diterpenoid and its derivatives from Caryopteris mongolica.

PubMed

Saruul, Erdenebileg; Murata, Toshihiro; Selenge, Erdenechimeg; Sasaki, Kenroh; Yoshizaki, Fumihiko; Batkhuu, Javzan

2015-06-15

To identify antibacterial components in traditional Mongolian medicinal plant Caryopteris mongolica, an ortho-quinone abietane caryopteron A (1) and three its derivatives caryopteron B-D (2-4) were isolated from the roots of the plant together with three known abietanes demethylcryptojaponol (5), 6α-hydroxydemethyl cryptojaponol (6), and 14-deoxycoleon U (7). The chemical structures of these abietane derivatives were elucidated on the basis of spectroscopic data. Compounds 1-4 had C-13 methylcyclopropane substructures, and 2-4 had a hexanedioic anhydride ring C instead of ortho-quinone in 1. The stereochemistry of these compound was assumed from NOE spectra and ECD Cotton effects. Compounds 1 and 5-7 showed antibacterial activities against the Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, and Micrococcus luteus, being 1 the more potent. Copyright © 2015 Elsevier Ltd. All rights reserved.

Chemical constituents and antimicrobial activity of the essential oil of Lantana xenica.

PubMed

Juliani, Hector R; Biurrun, Fernando; Koroch, Adolfina R; Oliva, M M; Demo, Mirta S; Trippi, Victorio S; Zygadlo, Julio A

2002-08-01

The aim of this work was to evaluate the chemical composition of Lantana xenica essential oil and its antimicrobial activity. The oil from the aerial parts of Lantana xenica Mold. (Verbenacea) was obtained by steam distillation and analyzed by gas chromatography/mass spectrometry. The major constituent of the oil was (E)-caryophyllene (35.2 %), with minor amounts of gamma-cadinene (13.3 %), alpha-pinene (9.3 %), ocimene (9.2 %) and germacrene D (6.6 %). The antimicrobial assays showed that the essential oil of L. xenica inhibited the growth of Bacillus cereus and Proteus mirabilis and both bacteria were inhibited by (E)-caryophyllene, the major component of the oil. Enterococcus faecalis, Staphylococcus epidermidis and S. aureus showed a lower inhibition. The bacteria Micrococcus luteus, Klebsiella sp., Escherichia coli and the yeast Candida albicans were insensitive to both the oil and (E)-caryophyllene.

Enzymatic synthesis of polymers containing nicotinamide mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

NASA Technical Reports Server (NTRS)

Liu, Rihe; Orgel, Leslie E.

1995-01-01

Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

The complex interplay of iron, biofilm formation, and mucoidy affecting antimicrobial resistance of Pseudomonas aeruginosa

PubMed Central

Oglesby-Sherrouse, Amanda G.; Djapgne, Louise; Nguyen, Angela T.; Vasil, Adriana I.; Vasil, Michael L.

2014-01-01

Pseudomonas aeruginosa is a Gram-negative opportunistic bacterial pathogen that is refractory to a variety of current antimicrobial therapeutic regimens. Complicating treatment of such infections is the ability of P. aeruginosa to form biofilms, as well as several innate and acquired resistance mechanisms. Previous studies suggest iron plays a role in resistance to antimicrobial therapy, including the efficacy of an FDA-approved iron chelator, deferasirox (DSX), or Gallium, an iron analog, in potentiating antibiotic-dependent killing of P. aeruginosa biofilms. Here we show that iron-replete conditions enhance resistance of P. aeruginosa nonbiofilm growth against tobramycin and tigecycline. Interestingly, the mechanism of iron-enhanced resistance to each of these antibiotics is distinct. Whereas pyoverdine-mediated iron uptake is important for optimal resistance to tigecycline, it does not enhance tobramycin resistance. In contrast, heme supplementation results in increased tobramycin resistance, while having no significant effect on tigecycline resistance. Thus, non-siderophore bound iron plays an important role in resistance to tobramycin, while pyoverdine increases the ability of P. aeruginosa to resist tigecycline treatment. Lastly, we show that iron increases the minimal concentration of tobramycin, but not tigecycline, required to eradicate P. aeruginosa biofilms. Moreover, iron depletion blocks the previous observed induction of biofilm formation by sub-inhibitory concentrations of tobramycin, suggesting iron and tobramycin signal through overlapping regulatory pathways to affect biofilm formation. These data further support the role of iron in P. aeruginosa antibiotic resistance, providing yet another compelling case for targeting iron acquisition for future antimicrobial drug development. PMID:24436170

Tracking Polymicrobial Metabolism in Cystic Fibrosis Airways: Pseudomonas aeruginosa Metabolism and Physiology Are Influenced by Rothia mucilaginosa-Derived Metabolites.

PubMed

Gao, Bei; Gallagher, Tara; Zhang, Ying; Elbadawi-Sidhu, Mona; Lai, Zijuan; Fiehn, Oliver; Whiteson, Katrine L

2018-04-25

Due to a lack of effective immune clearance, the airways of cystic fibrosis patients are colonized by polymicrobial communities. One of the most widespread and destructive opportunistic pathogens is Pseudomonas aeruginosa ; however, P. aeruginosa does not colonize the airways alone. Microbes that are common in the oral cavity, such as Rothia mucilaginosa , are also present in cystic fibrosis patient sputum and have metabolic capacities different from those of P. aeruginosa Here we examine the metabolic interactions of P. aeruginosa and R. mucilaginosa using stable-isotope-assisted metabolomics. Glucose-derived 13 C was incorporated into glycolysis metabolites, namely, lactate and acetate, and some amino acids in R. mucilaginosa grown aerobically and anaerobically. The amino acid glutamate was unlabeled in the R. mucilaginosa supernatant but incorporated the 13 C label after P. aeruginosa was cross-fed the R. mucilaginosa supernatant in minimal medium and artificial-sputum medium. We provide evidence that P. aeruginosa utilizes R. mucilaginosa -produced metabolites as precursors for generation of primary metabolites, including glutamate. IMPORTANCE Pseudomonas aeruginosa is a dominant and persistent cystic fibrosis pathogen. Although P. aeruginosa is accompanied by other microbes in the airways of cystic fibrosis patients, few cystic fibrosis studies show how P. aeruginosa is affected by the metabolism of other bacteria. Here, we demonstrate that P. aeruginosa generates primary metabolites using substrates produced by another microbe that is prevalent in the airways of cystic fibrosis patients, Rothia mucilaginosa These results indicate that P. aeruginosa may get a metabolic boost from its microbial neighbor, which might contribute to its pathogenesis in the airways of cystic fibrosis patients.

Evolution and adaptation in Pseudomonas aeruginosa biofilms driven by mismatch repair system-deficient mutators.

PubMed

Luján, Adela M; Maciá, María D; Yang, Liang; Molin, Søren; Oliver, Antonio; Smania, Andrea M

2011-01-01

Pseudomonas aeruginosa is an important opportunistic pathogen causing chronic airway infections, especially in cystic fibrosis (CF) patients. The majority of the CF patients acquire P. aeruginosa during early childhood, and most of them develop chronic infections resulting in severe lung disease, which are rarely eradicated despite intensive antibiotic therapy. Current knowledge indicates that three major adaptive strategies, biofilm development, phenotypic diversification, and mutator phenotypes [driven by a defective mismatch repair system (MRS)], play important roles in P. aeruginosa chronic infections, but the relationship between these strategies is still poorly understood. We have used the flow-cell biofilm model system to investigate the impact of the mutS associated mutator phenotype on development, dynamics, diversification and adaptation of P. aeruginosa biofilms. Through competition experiments we demonstrate for the first time that P. aeruginosa MRS-deficient mutators had enhanced adaptability over wild-type strains when grown in structured biofilms but not as planktonic cells. This advantage was associated with enhanced micro-colony development and increased rates of phenotypic diversification, evidenced by biofilm architecture features and by a wider range and proportion of morphotypic colony variants, respectively. Additionally, morphotypic variants generated in mutator biofilms showed increased competitiveness, providing further evidence for mutator-driven adaptive evolution in the biofilm mode of growth. This work helps to understand the basis for the specific high proportion and role of mutators in chronic infections, where P. aeruginosa develops in biofilm communities.

Evolution and Adaptation in Pseudomonas aeruginosa Biofilms Driven by Mismatch Repair System-Deficient Mutators

PubMed Central

Yang, Liang; Molin, Søren; Oliver, Antonio; Smania, Andrea M.

2011-01-01

Pseudomonas aeruginosa is an important opportunistic pathogen causing chronic airway infections, especially in cystic fibrosis (CF) patients. The majority of the CF patients acquire P. aeruginosa during early childhood, and most of them develop chronic infections resulting in severe lung disease, which are rarely eradicated despite intensive antibiotic therapy. Current knowledge indicates that three major adaptive strategies, biofilm development, phenotypic diversification, and mutator phenotypes [driven by a defective mismatch repair system (MRS)], play important roles in P. aeruginosa chronic infections, but the relationship between these strategies is still poorly understood. We have used the flow-cell biofilm model system to investigate the impact of the mutS associated mutator phenotype on development, dynamics, diversification and adaptation of P. aeruginosa biofilms. Through competition experiments we demonstrate for the first time that P. aeruginosa MRS-deficient mutators had enhanced adaptability over wild-type strains when grown in structured biofilms but not as planktonic cells. This advantage was associated with enhanced micro-colony development and increased rates of phenotypic diversification, evidenced by biofilm architecture features and by a wider range and proportion of morphotypic colony variants, respectively. Additionally, morphotypic variants generated in mutator biofilms showed increased competitiveness, providing further evidence for mutator-driven adaptive evolution in the biofilm mode of growth. This work helps to understand the basis for the specific high proportion and role of mutators in chronic infections, where P. aeruginosa develops in biofilm communities. PMID:22114708

Enterobacter aerogenes metabolites enhance Microcystis aeruginosa biomass recovery for sustainable bioflocculant and biohydrogen production.

PubMed

Xu, Liang; Zhou, Mo; Ju, Hanyu; Zhang, Zhenxing; Zhang, Jiquan; Sun, Caiyun

2018-09-01

We report a recycling bioresource involving harvesting of Microcystis aeruginosa using the bioflocculant (MBF-32) produced by Enterobacter aerogenes followed by the recovery of the harvested M. aeruginosa as the main substrate for the sustainable production of MBF-32 and biohydrogen. The experimental results indicate that the efficiency of bioflocculation exceeded 90% under optimal conditions. The harvested M. aeruginosa was further recycled as the main substrate for the supply of necessary elements. The highest yield (3.6±0.1g/L) of MBF-32 could be obtained from 20g/L of wet biomass of M. aeruginosa with an additional 20g/L of glucose as the extra carbon source. The highest yield of biohydrogen was 35mL of H 2 /g (dw) algal biomass, obtained from 20g/L of wet biomass of M. aeruginosa with an additional 10g/L of glycerol. Transcriptome analyses indicated that MBF-32 was mainly composed of polysaccharide and tyrosine/tryptophan proteins. Furthermore, NADH synthase and polysaccharide export-related genes were found to be up-regulated. Copyright © 2018 Elsevier B.V. All rights reserved.

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

PubMed

Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

2016-01-01

The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

PubMed Central

TEIXEIRA, Bertinellys; RODULFO, Hectorina; CARREÑO, Numirin; GUZMÁN, Militza; SALAZAR, Elsa; DONATO, Marcos DE

2016-01-01

The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America. PMID:27007556

Virulence attributes in Brazilian clinical isolates of Pseudomonas aeruginosa.

PubMed

Silva, Lívia V; Galdino, Anna Clara M; Nunes, Ana Paula F; dos Santos, Kátia R N; Moreira, Beatriz M; Cacci, Luciana C; Sodré, Cátia L; Ziccardi, Mariangela; Branquinha, Marta H; Santos, André L S

2014-11-01

Pseudomonas aeruginosa is an opportunistic human pathogen responsible for causing a huge variety of acute and chronic infections with significant levels of morbidity and mortality. Its success as a pathogen comes from its genetic/metabolic plasticity, intrinsic/acquired antimicrobial resistance, capacity to form biofilm and expression of numerous virulence factors. Herein, we have analyzed the genetic variability, antimicrobial susceptibility as well as the production of metallo-β-lactamases (MBLs) and virulence attributes (elastase, pyocyanin and biofilm) in 96 strains of P. aeruginosa isolated from different anatomical sites of patients attended at Brazilian hospitals. Our results revealed a great genetic variability, in which 86 distinct RAPD types (89.6% of polymorphisms) were detected. Regarding the susceptibility profile, 48 strains (50%) were resistant to the antimicrobials, as follows: 22.92% to the three tested antibiotics, 12.5% to both imipenem and meropenem, 11.46% to ceftazidime only, 2.08% to imipenem only and 1.04% to both ceftazidime and meropenem. Out of the 34 clinical strains of P. aeruginosa resistant to both imipenem and meropenem, 25 (73.53%) were MBL producers by phenotypic method while 12 (35.29%) were PCR positive for the MBL gene SPM-1. All P. aeruginosa strains produced pyocyanin, elastase and biofilm, although in different levels. Some associations were demonstrated among the susceptibility and/or production of these virulence traits with the anatomical site of strain isolation. For instance, almost all strains isolated from urine (85.71%) were resistant to the three antibiotics, while the vast majority of strains isolated from rectum (95%) and mouth (66.67%) were susceptible to all tested antibiotics. Urine isolates produced the highest pyocyanin concentration (20.15±5.65 μg/ml), while strains isolated from pleural secretion and mouth produced elevated elastase activity (1441.43±303.08 FAU) and biofilm formation (OD590 0.676±0

Insights into the respiratory tract microbiota of patients with cystic fibrosis during early Pseudomonas aeruginosa colonization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keravec, Marlène; Mounier, Jérôme; Prestat, Emmanuel

Pseudomonas aeruginosa plays a major role in cystic fibrosis (CF) progression. Therefore, it is important to understand the initial steps of P. aeruginosa infection. The structure and dynamics of CF respiratory tract microbial communities during the early stages of P. aeruginosa colonization were characterized by pyrosequencing and cloning-sequencing. The respiratory microbiota showed high diversity, related to the young age of the CF cohort (mean age 10 years). Wide inter- and intra-individual variations were revealed. A common core microbiota of 5 phyla and 13 predominant genera was found, the majority of which were obligate anaerobes. A few genera were significantly moremore » prevalent in patients never infected by P. aeruginosa. Persistence of an anaerobic core microbiota regardless of P. aeruginosa status suggests a major role of certain anaerobes in the pathophysiology of lung infections in CF. Some genera may be potential biomarkers of pulmonary infection state.« less

Insights into the respiratory tract microbiota of patients with cystic fibrosis during early Pseudomonas aeruginosa colonization

DOE PAGES

Keravec, Marlène; Mounier, Jérôme; Prestat, Emmanuel; ...

2015-08-09

Pseudomonas aeruginosa plays a major role in cystic fibrosis (CF) progression. Therefore, it is important to understand the initial steps of P. aeruginosa infection. The structure and dynamics of CF respiratory tract microbial communities during the early stages of P. aeruginosa colonization were characterized by pyrosequencing and cloning-sequencing. The respiratory microbiota showed high diversity, related to the young age of the CF cohort (mean age 10 years). Wide inter- and intra-individual variations were revealed. A common core microbiota of 5 phyla and 13 predominant genera was found, the majority of which were obligate anaerobes. A few genera were significantly moremore » prevalent in patients never infected by P. aeruginosa. Persistence of an anaerobic core microbiota regardless of P. aeruginosa status suggests a major role of certain anaerobes in the pathophysiology of lung infections in CF. Some genera may be potential biomarkers of pulmonary infection state.« less

In vitro antioxidant, anticholinesterase and antimicrobial activity studies on three Agaricus species with fatty acid compositions and iron contents: a comparative study on the three most edible mushrooms.

PubMed

Öztürk, Mehmet; Duru, Mehmet Emin; Kivrak, Seyda; Mercan-Doğan, Nazime; Türkoglu, Aziz; Özler, Mehmet Ali

2011-06-01

The fatty acids of Agaricus essettei, Agaricus bitorquis and Agaricus bisporus were investigated by using GC and GC-MS. The dominant fatty acids were found to be linoleic (61.82-67.29%) and palmitic (12.67-14.71%) acids among the 13 fatty acids detected in the oils. Total unsaturation for the oils was calculated as 77.50%, 77.44%, and 79.72%, respectively. In vitro antioxidant, anticholinesterase and antimicrobial activities were also studied. The ethyl acetate extract of Agaricus bitorquis showed the highest activity in β-carotene-linoleic acid, DPPH(·) and ABTS(·)(+) assays, while the hexane extract of Agaricus bisporus exhibited the best metal chelating activity. The ethyl acetate and hexane extract of Agaricus bitorquis and the hexane extract of Agaricus essettei showed meaningful butyrylcholinesterase activity being close to that of galantamine. The extracts were found to be effective on Gram (+) bacteria, especially against Micrococcus luteus, Micrococcus flavus, Bacillus subtilis and Bacillus cereus. In conclusion, Agaricus bitorquis and Agaricus essettei demonstrated higher iron content, and better antioxidant, anticholinesterase and antimicrobial activities than those of Agaricus bisporus commonly consumed mushroom. Hence, Agaricus species, particularly Agaricus bitorquis might be useful as antioxidant agents and moderate anticholinesterase agents, and their extracts will probably be used for development of dietary foods, food products and additives. Copyright © 2011 Elsevier Ltd. All rights reserved.

Response surface methodology for cadmium biosorption on Pseudomonas aeruginosa.

PubMed

Ahmady-Asbchin, Salman

2016-01-01

In this research the effects of various physicochemical factors on Cd(2+) biosorption such as initial metal concentration, pH and contact exposure time were studied. This study has shown a Cd(2+) biosorption, equilibrium time of about 5 min for Pseudomonas aeruginosa and the adsorption equilibrium data were well described by Langmuir equation. The maximum capacity for biosorption has been extrapolated to 0.56 mmol.g(-1) for P. aeruginosa. The thermodynamic properties ΔG(0), ΔH(0), and ΔS(0) of Cd(2+) for biosorption were analyzed by the equilibrium constant value obtained from experimented data at different temperatures. The results show that biosorption of Cd(2+) by P. aeruginosa are endothermic and spontaneous with ΔH value of 36.35 J.mol(-1). By response surface methodology, the quadratic model has adequately described the experimental data based on the adjusted determination coefficient (R(2) = 0.98). The optimum conditions for maximum uptake onto the biosorbent were established at 0.5 g.l(-1) biosorbent concentration, pH 6 for the aqueous solution, and a temperature of 30 °C.

Efficacy of methanolic extract of green and black teas against extended-spectrum β-Lactamase-producing Pseudomonas aeruginosa.

PubMed

Taherpour, Arezou; Hashemi, Ali; Erfanimanesh, Soroor; Taki, Elahe

2016-07-01

Pseudomonas aeruginosa is one of the major bacteria causing acute infections. β-Lactamase production is the principal defense mechanism in gram-negative bacteria. The aim of our study was to evaluate the antibacterial activity of Methanolic Extracts of Green and Black Teas on P. aeruginosa Extended Spectrum-β-Lactamases (ESBLs) production. This research was carried out on burn wounds of 245 hospitalized patients in Kerman, Iran. P. aeruginosa ESBLs and MBL producing strains were detected by Combination Disk Diffusion Test (CDDT) and Epsilometer test (E-test) strips, respectively. Minimum inhibitory concentration (MIC) was measured for Ceftazidime, Meropenem, Imipenem, Aztreonam, Cefotaxime and methanollic extracts of Camellia Sinensis (Green Tea). From 245 patients in the burn ward, 120 cases were infected with P. aeruginosa. 41 isolates contained ESBL while MBL was not detected. P. aeruginosa were resistant to Cefotaxime, Aztreonam, Ceftazidime, Meropenem and Imipenem, 72 (60%), 50 (41.66%), 79 (65.83%), 33 (27.5%) and 24 (20%), respectively. Green tea extract had the highest anti-bacterial effect on standard and P. aeruginosa strains in 1.25mg/ml concentration. This study determined that the methanolic extract of green tea has a higher effect against ESBL producing P. aeruginosa than Cefotaxime, Aztreonam and Ceftazidime.

Identification of pilin pools in the membranes of Pseudomonas aeruginosa.

PubMed Central

Watts, T H; Worobec, E A; Paranchych, W

1982-01-01

The proteins of purified inner and outer membranes obtained from Pseudomonas aeruginosa strains PAK and PAK/2Pfs were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and treated with antiserum raised against pure pili. Bound antipilus antibodies were visualized by reaction with 125I-labeled protein A from Staphylococcus aureus. The results showed that there are pools of pilin in both the inner and outer membranes of P. aeruginosa and that the pool size in the multipiliated strain is comparable with that of the wild-type strain. Images PMID:6813311

Analysis of the swimming activity of Pseudomonas aeruginosa by using photonic force microscope

NASA Astrophysics Data System (ADS)

Chan, Chia-Han; Chang, Bo-Jui; Huang, Ying-Jung; Fan, Chia-Chieh; Peng, Hwei-Ling; Chi, Sien; Hsu, Long

2005-08-01

Swimming activity of flagella is a main factor of the motility of bacteria. Flagella expressed on the surface of bacterial species serve as a primary means of motility including swimming. We propose to use optical tweezers to analyze the swimming activity of bacteria. The sample bacteria in the work is Pseudomonas aeruginosa, and it is a gram-negative bacterium and often causes leading to burn wound infections, urinary-tract infections, and pneumonia. The single polar flagellum of P. aeruginosa has been demonstrated to be important virulence and colonization factor of this opportunistic pathogen. We demonstrate a gene to regulate the bacterial swimming activity in P. aeruginosa PAO1 by biological method. However, the change of flagellar morphology was not observed by electron microscopy analysis, suggesting that the gene regulates the flagellar rotation that could not be detected by biological method. PFM exhibits a spatial resolution of a few nanometers to detect the relative position of the probe at an acquisition rate over 1 MHz. By binding a probe such as a bead or a quantum dot on the flagella, we expect the rotation of the probe due to the flagella could be detected. It is expected that the study of the swimming activity of P. aeruginosa provide potent method for the pathogenic role of the flagella in P. aeruginosa.

Light and phosphate competition between Cylindrospermopsis raciborskii and Microcystis aeruginosa is strain dependent.

PubMed

Marinho, Marcelo Manzi; Souza, Maria Betânia Gonçalves; Lürling, Miquel

2013-10-01

The hypothesis that outcomes of phosphorus and light competition between Cylindrospermopsis raciborskii and Microcystis aeruginosa are strain dependent was tested experimentally. Critical requirements of phosphorus (P*) and of light (I*) of two strains of each species were determined through monoculture experiments, which indicated a trade-off between species and also between Microcystis strains. Competition experiments between species were performed using the weakest predicted competitors (with the highest values of P* and of I*) and with the strongest predicted competitors (with the lowest values of P* and of I*). Under light limitation, competition between the weakest competitors led C. raciborskii to dominate. Between the strongest competitors, the opposite was observed, M. aeruginosa displaced C. raciborskii, but both strains co-existed in equilibrium. Under phosphate limitation, competition between the weakest competitors led C. raciborskii to exclude M. aeruginosa, and between the strongest competitors, the opposite was observed, M. aeruginosa displaced C. raciborskii, but the system did not reach an equilibrium and both strains were washed out. Hence, outcomes of the competition depended on the pair of competing strains and not only on species or on type of limitation. We concluded that existence of different trade-offs among strains and between species underlie our results showing that C. raciborskii can either dominate or be displaced by M. aeruginosa when exposed to different conditions of light or phosphate limitation.

Investigation of healthcare-acquired infections associated with Pseudomonas aeruginosa biofilms in taps in neonatal units in Northern Ireland.

PubMed

Walker, J T; Jhutty, A; Parks, S; Willis, C; Copley, V; Turton, J F; Hoffman, P N; Bennett, A M

2014-01-01