Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590

Three alcohol dehydrogenase genes and one acetyl-CoA synthetase gene are responsible for ethanol utilization in Yarrowia lipolytica.

PubMed

Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold

2016-10-01

The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular evolution of the polyamine oxidase gene family in Metazoa

PubMed Central

2012-01-01

Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including

Molecular evolution of the polyamine oxidase gene family in Metazoa.

PubMed

Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela

2012-06-20

Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

PubMed Central

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

PubMed Central

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

A gene encoding the plant-like alternative oxidase is present in Phytomonas but absent in Leishmania spp.

PubMed

Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G

1998-01-01

The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.

Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

PubMed Central

Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

2015-01-01

Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187

Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism.

PubMed

Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela

2011-08-18

Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

PubMed Central

Kües, Ursula; Rühl, Martin

2011-01-01

Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

MAOA interacts with the ALDH2 gene in anxiety-depression alcohol dependence.

PubMed

Lee, Sheng-Yu; Hahn, Cheng-Yi; Lee, Jia-Fu; Huang, San-Yuan; Chen, Shiou-Lan; Kuo, Po-Hsiu; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Chen, Shih-Heng; Ko, Huei-Chen; Lu, Ru-Band

2010-07-01

Alcohol dependence is usually comorbid with anxiety disorder, depressive disorder, or both; this comorbidity may increase drinking behavior. We previously hypothesized that anxiety-depressive alcohol dependence (ANX/DEP ALC) was a genetically specific subtype of alcohol dependence. ANX/DEP ALC may be related to dopamine and serotonin, which are catalyzed by monoamine oxidase A (MAOA) and acetaldehyde dehydrogenase 2 (ALDH2). The aim of this study was to determine whether the interaction between the MAOA and the ALDH2 genes is associated with ANX/DEP ALC. We recruited 383 Han Chinese men in Taiwan: 143 ANX/DEP ALC and 240 healthy controls. The diagnosis of ANX/DEP ALC (alcohol dependence with a past or current history of anxiety, depressive disorder, or both) was made using DSM-IV criteria. Genotypes of ALDH2 and MAOA-uVNTR (variable number of tandem repeat located upstream) were determined using PCR-RFLP. The ALDH2, but not the MAOA-uVNTR, polymorphism was associated with ANX/DEP ALC. After stratifying the MAOA-uVNTR polymorphism, we found a stronger association between the ALDH2*1/*2 and *2/*2 genotypes and the controls in the MAOA-uVNTR 4-repeat subgroup. Logistic regression significantly associated the interaction between ALDH2 and MAOA variants with ANX/DEP ALC. We conclude that the MAOA and ALDH2 genes interact in ANX/DEP ALC. Although the MAOA gene alone is not associated with ANX/DEP ALC, we hypothesize that different variants of MAOA-uVNTR polymorphisms modify the protective effects of the ALDH2*2 allele on ANX/DEP ALC in Han Chinese in Taiwan.

A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

PubMed

Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

2014-05-15

Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. © 2013 Published by Elsevier B.V.

Neuroimmune Basis of Alcoholic Brain Damage

PubMed Central

Crews, Fulton T.; Vetreno, Ryan P.

2017-01-01

Alcohol-induced brain damage likely contributes to the dysfunctional poor decisions associated with alcohol dependence. Human alcoholics have a global loss of brain volume that is most severe in the frontal cortex. Neuroimmune gene induction by binge drinking increases neurodegeneration through increased oxidative stress, particularly NADPH oxidase-induced oxidative stress. In addition, HMGB1-TLR4 and innate immune NF-κB target genes are increased leading to persistent and sensitized neuroimmune responses to ethanol and other agents that release HMGB1 or directly stimulate TLR receptors and/or NMDA receptors. Neuroimmune signaling and glutamate excitotoxicity are linked to alcoholic neurodegeneration. Models of adolescent alcohol abuse lead to significant frontal cortical degeneration and show the most severe loss of hippocampal neurogenesis. Adolescence is a period of high risk for ethanol-induced neurodegeneration and alterations in brain structure, gene expression, and maturation of adult phenotypes. Together, these findings support the hypothesis that adolescence is a period of risk for persistent and long-lasting increases in brain neuroimmune gene expression that promote persistent and long-term increases in alcohol consumption, neuroimmune gene induction, and neurodegeneration that we find associated with alcohol use disorders. PMID:25175868

In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

PubMed Central

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

2016-01-01

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

DOE PAGES

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; ...

2016-03-01

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

Alcohol-Induced Histone Acetylation Reveals a Gene Network Involved in Alcohol Tolerance

PubMed Central

Ghezzi, Alfredo; Krishnan, Harish R.; Lew, Linda; Prado, Francisco J.; Ong, Darryl S.; Atkinson, Nigel S.

2013-01-01

Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol. PMID:24348266

Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

PubMed Central

Vonck, Janet; Parcej, David N.; Mills, Deryck J.

2016-01-01

The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

Alcoholism and alternative splicing of candidate genes.

PubMed

Sasabe, Toshikazu; Ishiura, Shoichi

2010-04-01

Gene expression studies have shown that expression patterns of several genes have changed during the development of alcoholism. Gene expression is regulated not only at the level of transcription but also through alternative splicing of pre-mRNA. In this review, we discuss some of the evidence suggesting that alternative splicing of candidate genes such as DRD2 (encoding dopamine D2 receptor) may form the basis of the mechanisms underlying the pathophysiology of alcoholism. These reports suggest that aberrant expression of splice variants affects alcohol sensitivities, and alcohol consumption also regulates alternative splicing. Thus, investigations of alternative splicing are essential for understanding the molecular events underlying the development of alcoholism.

Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

PubMed Central

Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

2014-01-01

The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

PubMed

Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

2014-01-01

The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

PubMed

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gadda, G.; Orville, A.; Pennati, A.

2008-06-08

Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active sitemore » of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.« less

Preparation of convection interaction media isobutyl disc monolithic column and its application to purification of secondary alcohol dehydrogenase and alcohol oxidase.

PubMed

Isobe, Kimiyasu; Kawakami, Yoshimitsu

2007-03-09

A convection interaction media (trade name CIM, BIA Separation, Ljubljana, Slovenia) isobutyl monolithic disc was prepared by incubating a CIM epoxy monolithic disc with isobutylamine, and it was then applied to the purification of secondary alcohol dehydrogenase (S-ADH) and primary alcohol oxidase (P-AOD). Both enzymes were adsorbed on this column and eluted with high purity. Thus, S-ADH was purified to an electrophoretically homogeneous state by four column chromatographies using CIM DEAE-8 and CIM C4-8 tube monolithic columns, blue-Sepharose column and CIM isobutyl disc monolithic column. P-AOD was also purified to an electrophoretically homogeneous state by three column chromatographies of CIM DEAE-8 tube, CIM C4-8 tube and CIM isobutyl disc columns.

Characterization of two brassinosteroid C-6 oxidase genes in pea.

PubMed

Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

2007-04-01

C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.

Genetic approaches to addiction: genes and alcohol

PubMed Central

Ducci, Francesca; Goldman, David

2008-01-01

Aims Alcoholism is a chronic relapsing disorder with an enormous societal impact. Understanding the genetic basis of alcoholism is crucial to characterize individuals' risk and to develop efficacious prevention and treatment strategies. Methods We examined the available scientific literature to provide an overview of different approaches that are being integrated increasingly to advance our knowledge of the genetic bases of alcoholism. Examples of genes that have been shown to influence vulnerability to alcoholism and related phenotypes are also discussed. Results Genetic factors account for more than 50% of the variance in alcoholism liability. Susceptibility loci for alcoholism include both alcohol-specific genes acting either at the pharmacokinetic or pharmacodynamic levels, as well as loci moderating neuronal pathways such as reward, behavioral control and stress resiliency, that are involved in several psychiatric diseases. In recent years, major progress in gene identification has occurred using intermediate phenotypes such as task-related brain activation that confer the advantage of increased power and the opportunity of exploring the neuronal mechanisms through which genetic variation is translated into behavior. Fundamental to the detection of gene effects is also the understanding of the interplay between genes as well as genes/environment interactions. Whole Genome Association studies represent a unique opportunity to identify alcohol-related loci in hypothesis-free fashion. Finally, genome-wide analyses of transcripts and chromatin remodeling promise an increase in our understanding of the genome function and of the mechanisms through which gene and environment cause diseases. Conclusions Although the genetic bases of alcoholism remain largely unknown, there are reasons to think that more genes will be discovered in the future. Multiple and complementary approaches will be required to piece together the mosaic of causation. PMID:18422824

Alcoholism: genes and mechanisms.

PubMed

Oroszi, Gabor; Goldman, David

2004-12-01

Alcoholism is a chronic relapsing/remitting disease that is frequently unrecognized and untreated, in part because of the partial efficacy of treatment. Only approximately one-third of patients remain abstinent and one-third have fully relapsed 1 year after withdrawal from alcohol, with treated patients doing substantially better than untreated [1]. The partial effectiveness of strategies for prevention and treatment, and variation in clinical course and side effects, represent a challenge and an opportunity to better understand the neurobiology of addiction. The strong heritability of alcoholism suggests the existence of inherited functional variants of genes that alter the metabolism of alcohol and variants of other genes that alter the neurobiologies of reward, executive cognitive function, anxiety/dysphoria, and neuronal plasticity. Each of these neurobiologies has been identified as a critical domain in the addictions. Functional alleles that alter alcoholism-related intermediate phenotypes include common alcohol dehydrogenase 1B and aldehyde dehydrogenase 2 variants that cause the aversive flushing reaction; catechol-O-methyltransferase (COMT) Val158Met leading to differences in three aspects of neurobiology: executive cognitive function, stress/anxiety response, and opioid function; opioid receptor micro1 (OPRM1) Asn40Asp, which may serve as a gatekeeper molecule in the action of naltrexone, a drug used in alcoholism treatment; and HTTLPR, which alters serotonin transporter function and appears to affect stress response and anxiety/dysphoria, which are factors relevant to initial vulnerability, the process of addiction, and relapse.

Gene-environment interplay in alcoholism and other substance abuse disorders: expressions of heritability and factors influencing vulnerability.

PubMed

Palomo, Tomas; Kostrzewa, R M; Beninger, R J; Archer, T

2004-01-01

Factors that confer predisposition and vulnerability for alcoholism and other substance abuse disorders may be described usefully within the gene-environment interplay framework. Thus, it is postulated that heritability provides a major contribution not only to alcohol but also to other substances of abuse. Studies of evoked potential amplitude reduction have provided a highly suitable and testable method for the assessment of both environmentally-determined and heritable characteristics pertaining to substance use and dependence. The different personal attributes that may co-exist with parental influence or exist in a shared, monozygotic relationship contribute to the final expression of addiction. In this connection, it appears that personality disorders are highly prevalent co-morbid conditions among addicted individuals, and, this co-morbidity is likely to be accounted for by multiple complex etiological relationships, not least in adolescent individuals. Co-morbidity associated with deficient executive functioning may be observed too in alcohol-related aggressiveness and crimes of violence. The successful intervention into alcohol dependence and craving brought about by baclofen in both human and animal studies elucidates glutamatergic mechanisms in alcoholism whereas the role of the dopamine transporter, in conjunction with both the noradrenergic and serotonergic transporters, are implicated in cocaine dependence and craving. The role of the cannabinoids in ontogeny through an influence upon the expression of key genes for the development of neurotransmitter systems must be considered. Finally, the particular form of behaviour/characteristic outcome due to childhood circumstance may lie with biological, gene-based determinants, for example individual characteristics of monoamine oxidase (MAO) activity levels, thereby rendering simple predictive measures both redundant and misguiding.

Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

PubMed

Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

2015-07-15

A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. Copyright © 2015 Elsevier B.V. All rights reserved.

MAOA-uVNTR polymorphism may modify the protective effect of ALDH2 gene against alcohol dependence in antisocial personality disorder.

PubMed

Lee, Sheng-Yu; Hahn, Cheng-Yi; Lee, Jia-Fu; Chen, Shiou-Lan; Chen, Shih-Heng; Yeh, Tzung Lieh; Kuo, Po-Hsiu; Lee, I Hui; Yang, Yen Kuang; Huang, San-Yuan; Ko, Huei-Chen; Lu, Ru-Band

2009-06-01

Antisocial alcoholism is related to dopamine and serotonin which are catalyzed by monoamine oxidase A (MAOA) and acetaldehyde dehydrogenase 2 (ALDH2). The objective of this study is to determine whether the interaction between the MAOA and the ALDH2 genes is associated with subjects with antisocial personality disorder (ASPD) having alcoholism. A total of 294 Han Chinese men in Taiwan including 132 ASPD with alcoholism (Antisocial ALC) and 162 without alcoholism (Antisocial Non-ALC) were recruited in this study. Alcohol dependence and ASPD were diagnosed according to DSM-IV criteria. Genotypes of ALDH2 and MAOA-uVNTR were determined using PCR-RFLP. A significant difference of ALDH2 polymorphisms (p = 3.39E-05), but not of MAOA, was found among the 2 study groups. However, only after the stratification of the MAOA-uVNTR (variable number of tandem repeat located upstream) 3-repeat, a significant association between Antisocial Non-ALC and ALDH2*1/*2 or *2/*2 genotypes was shown (p = 1.46E-05; odds ratio = 3.913); whereas stratification of MAOA-uVNTR 4-repeat revealed no association. Multiple logistic regression analysis further revealed significant interaction of MAOA and ALDH2 gene in antisocial ALC (odds ratio = 2.927; p = 0.032). The possible interaction of MAOA and ALDH2 gene is associated with Antisocial ALC in Han Chinese males in Taiwan. However, the protective effects of the ALDH2*2 allele against alcoholism might disappear in subjects with ASPD and carrying MAOA-uVNTR 4-repeat allele in the Han Chinese male population.

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Defective monocyte oxidative burst predicts infection in alcoholic hepatitis and is associated with reduced expression of NADPH oxidase.

PubMed

Vergis, Nikhil; Khamri, Wafa; Beale, Kylie; Sadiq, Fouzia; Aletrari, Mina O; Moore, Celia; Atkinson, Stephen R; Bernsmeier, Christine; Possamai, Lucia A; Petts, Gemma; Ryan, Jennifer M; Abeles, Robin D; James, Sarah; Foxton, Matthew; Hogan, Brian; Foster, Graham R; O'Brien, Alastair J; Ma, Yun; Shawcross, Debbie L; Wendon, Julia A; Antoniades, Charalambos G; Thursz, Mark R

2017-03-01

In order to explain the increased susceptibility to serious infection in alcoholic hepatitis, we evaluated monocyte phagocytosis, aberrations of associated signalling pathways and their reversibility, and whether phagocytic defects could predict subsequent infection. Monocytes were identified from blood samples of 42 patients with severe alcoholic hepatitis using monoclonal antibody to CD14. Phagocytosis and monocyte oxidative burst (MOB) were measured ex vivo using flow cytometry, luminometry and bacterial killing assays. Defects were related to the subsequent development of infection. Intracellular signalling pathways were investigated using western blotting and PCR. Interferon-γ (IFN-γ) was evaluated for its therapeutic potential in reversing phagocytic defects. Paired longitudinal samples were used to evaluate the effect of in vivo prednisolone therapy. MOB, production of superoxide and bacterial killing in response to Escherichia coli were markedly impaired in patients with alcoholic hepatitis. Pretreatment MOB predicted development of infection within two weeks with sensitivity and specificity that were superior to available clinical markers. Accordingly, defective MOB was associated with death at 28 and 90 days. Expression of the gp91 phox subunit of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase was reduced in patients with alcoholic hepatitis demonstrating defective MOB. Monocytes were refractory to IFN-γ stimulation and showed high levels of a negative regulator of cytokine signalling, suppressor of cytokine signalling-1. MOB was unaffected by 7 days in vivo prednisolone therapy. Monocyte oxidative burst and bacterial killing is impaired in alcoholic hepatitis while bacterial uptake by phagocytosis is preserved. Defective MOB is associated with reduced expression of NADPH oxidase in these patients and predicts the development of infection and death. Published by the BMJ Publishing Group Limited. For permission to use (where not already

Genes contributing to the development of alcoholism: an overview.

PubMed

Edenberg, Howard J

2012-01-01

Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.

Association study of DRD2 and MAOA genes with subtyped alcoholism comorbid with bipolar disorder in Han Chinese.

PubMed

Hu, Ming-Chuan; Lee, Sheng-Yu; Wang, Tzu-Yun; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band

2013-01-10

Several studies have hypothesized that genes involved in the dopamine system, including dopamine type-2 receptor (DRD2)-related TaqIA polymorphism and monoamine oxidase-A upstream variable number tandem repeat (uVNTR), may be associated with alcoholism. But their results were contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the DRD2TaqIA and MAOA-uVNTR gene polymorphisms are susceptibility factors for alcoholism comorbid with bipolar disorder (ALC+BP) in Han Chinese in Taiwan. We recruited 101 Han Chinese men with comorbid alcoholism and bipolar disorder, and 328 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequencies of the DRD2TaqIA or the MAOA-uVNTR polymorphisms between the 2 groups. The MAOA-uVNTR 3-repeat had a significant protective effect on the ALC+BP (odds ratio=0.432, p=0.035) but not on the healthy controls. However, the interaction between the MAOA-uVNTR 3-repeat and DRD2 A1/A2 was a risk factor in the ALC+BP (odds ratio=3.451, p=0.018). We indicated the impact of the association between MAOA-uVNTR 3-repeat and DRD2 A1/A2 with ALC+BP. Copyright © 2012 Elsevier Inc. All rights reserved.

Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.

PubMed

Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro

2002-07-19

The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.

MONOAMINE OXIDASE: From Genes to Behavior

PubMed Central

Shih, J. C.; Chen, K.; Ridd, M. J.

2010-01-01

Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537

Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264

Mechanisms of neuroimmune gene induction in alcoholism.

PubMed

Crews, Fulton T; Vetreno, Ryan P

2016-05-01

Alcoholism is a primary, chronic relapsing disease of brain reward, motivation, memory, and related circuitry. It is characterized by an individual's continued drinking despite negative consequences related to alcohol use, which is exemplified by alcohol use leading to clinically significant impairment or distress. Chronic alcohol consumption increases the expression of innate immune signaling molecules (ISMs) in the brain that alter cognitive processes and promote alcohol drinking. Unraveling the mechanisms of alcohol-induced neuroimmune gene induction is complicated by positive loops of multiple cytokines and other signaling molecules that converge on nuclear factor kappa-light-chain-enhancer of activated B cells and activator protein-1 leading to induction of additional neuroimmune signaling molecules that amplify and expand the expression of ISMs. Studies from our laboratory employing reverse transcription polymerase chain reaction (RT-PCR) to assess mRNA, immunohistochemistry and Western blot analysis to assess protein expression, and others suggest that ethanol increases brain neuroimmune gene and protein expression through two distinct mechanisms involving (1) systemic induction of innate immune molecules that are transported from blood to the brain and (2) the direct release of high-mobility group box 1 (HMGB1) from neurons in the brain. Released HMGB1 signals through multiple receptors, particularly Toll-like receptor (TLR) 4, that potentiate cytokine receptor responses leading to a hyperexcitable state that disrupts neuronal networks and increases excitotoxic neuronal death. Innate immune gene activation in brain is persistent, consistent with the chronic relapsing disease that is alcoholism. Expression of HMGB1, TLRs, and other ISMs is increased several-fold in the human orbital frontal cortex, and expression of these molecules is highly correlated with each other as well as lifetime alcohol consumption and age of drinking onset. The persistent and

A reagentless amperometric biosensor for alcohol detection in column liquid chromatography based on co-immobilized peroxidase and alcohol oxidase in carbon paste.

PubMed

Johansson, K; Jönsson-Pettersson, G; Gorton, L; Marko-Varga, G; Csöregi, E

1993-12-01

A reagentless carbon paste electrode chemically modified with covalently bound alcohol oxidase and horse-radish peroxidase was examined as a selective sensor in flow injection and column liquid chromatography. A combination of carbodiimide, glutaraldehyde, and polyethyleneimine was used for immobilizing the enzymes in the paste. The surface of the electrodes was protected by first forming a layer of electropolymerized ortho-phenylenediamine followed by deposition of a cation exchange membrane (Eastman AQ 29D). The electrodes were used for detection of hydrogen peroxide, methanol, ethanol, propanol, isopropanol, and butanol. Preliminary investigations of the use of this sensor for bioprocess control are reported.

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

PubMed Central

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

Interaction between a functional MAOA locus and childhood sexual abuse predicts alcoholism and antisocial personality disorder in adult women.

PubMed

Ducci, F; Enoch, M-A; Hodgkinson, C; Xu, K; Catena, M; Robin, R W; Goldman, D

2008-03-01

Women who have experienced childhood sexual abuse (CSA) have an increased risk of alcoholism and antisocial personality disorder (ASPD). Among male subjects, a functional polymorphism (MAOA-LPR, monoamine oxidase A linked polymorphic region) in the promoter region of the monoamine oxidase A gene (MAOA) appears to moderate the effect of childhood maltreatment on antisocial behavior. Our aim was to test whether MAOA-LPR influences the impact of CSA on alcoholism and ASPD in a sample of 291 women, 50% of whom have experienced CSA; we also tested whether haplotypes covering the region where both MAOA and monoamine oxidase B (MAOB) genes are located predict risk of alcoholism and ASPD better than the MAOA-LPR locus alone. Participants included 168 alcoholics (39 with ASPD (antisocial alcoholics) and 123 controls (no alcoholics, no ASPD). Antisocial behavior was also modeled as a continuous trait: ASPD symptoms count. The MAOA-LPR low activity allele was associated with alcoholism (P=0.005), particularly antisocial alcoholism (P=0.00009), only among sexually abused subjects. Sexually abused women who were homozygous for the low activity allele had higher rates of alcoholism and ASPD, and more ASPD symptoms, than abused women homozygous for the high activity allele. Heterozygous women displayed an intermediate risk pattern. In contrast, there was no relationship between alcoholism/antisocial behavior and MAOA-LPR genotype among non-abused women. The MAOA-LPR low activity allele was found on three different haplotypes. The most abundant MAOA haplotype containing the MAOA-LPR low activity allele was found in excess among alcoholics (P=0.008) and antisocial alcoholics (P=0.001). Finally, a MAOB haplotype, which we termed haplotype C, was significantly associated with alcoholism (P=0.006), and to a lesser extent with antisocial alcoholism (P=0.03). In conclusions, MAOA seems to moderate the impact of childhood trauma on adult psychopathology in female subjects in the same way

Circadian genes, the stress axis, and alcoholism.

PubMed

Sarkar, Dipak K

2012-01-01

The body's internal system to control the daily rhythm of the body's functions (i.e., the circadian system), the body's stress response, and the body's neurobiology are highly interconnected. Thus, the rhythm of the circadian system impacts alcohol use patterns; at the same time, alcohol drinking also can alter circadian functions. The sensitivity of the circadian system to alcohol may result from alcohol's effects on the expression of several of the clock genes that regulate circadian function. The stress response system involves the hypothalamus and pituitary gland in the brain and the adrenal glands, as well as the hormones they secrete, including corticotrophin-releasing hormone, adrenocorticotrophic hormone, and glucocorticoids. It is controlled by brain-signaling molecules, including endogenous opioids such as β-endorphin. Alcohol consumption influences the activity of this system and vice versa. Finally, interactions exist between the circadian system, the hypothalamic-pituitary-adrenal axis, and alcohol consumption. Thus, it seems that certain clock genes may control functions of the stress response system and that these interactions are affected by alcohol.

Ethanol modulation of gene networks: implications for alcoholism.

PubMed

Farris, Sean P; Miles, Michael F

2012-01-01

Alcoholism is a complex disease caused by a confluence of environmental and genetic factors influencing multiple brain pathways to produce a variety of behavioral sequelae, including addiction. Genetic factors contribute to over 50% of the risk for alcoholism and recent evidence points to a large number of genes with small effect sizes as the likely molecular basis for this disease. Recent progress in genomics (microarrays or RNA-Seq) and genetics has led to the identification of a large number of potential candidate genes influencing ethanol behaviors or alcoholism itself. To organize this complex information, investigators have begun to focus on the contribution of gene networks, rather than individual genes, for various ethanol-induced behaviors in animal models or behavioral endophenotypes comprising alcoholism. This chapter reviews some of the methods used for constructing gene networks from genomic data and some of the recent progress made in applying such approaches to the study of the neurobiology of ethanol. We show that rapid technology development in gathering genomic data, together with sophisticated experimental design and a growing collection of analysis tools are producing novel insights for understanding the molecular basis of alcoholism and that such approaches promise new opportunities for therapeutic development. Copyright © 2011 Elsevier Inc. All rights reserved.

Genes and Alcohol Consumption: Studies with Mutant Mice

PubMed Central

Mayfield, Jody; Arends, Michael A.; Harris, R. Adron; Blednov, Yuri A.

2017-01-01

In this chapter, we review the effects of global null mutant and overexpressing transgenic mouse lines on voluntary self-administration of alcohol. We examine approximately 200 publications pertaining to the effects of 155 mouse genes on alcohol consumption in different drinking models. The targeted genes vary in function and include neurotransmitter, ion channel, neuroimmune, and neuropeptide signaling systems. The alcohol self-administration models include operant conditioning, two- and four-bottle choice continuous and intermittent access, drinking in the dark limited access, chronic intermittent ethanol, and scheduled high alcohol consumption tests. Comparisons of different drinking models using the same mutant mice are potentially the most informative, and we will highlight those examples. More mutants have been tested for continuous two-bottle choice consumption than any other test; of the 137 mouse genes examined using this model, 97 (72%) altered drinking in at least one sex. Overall, the effects of genetic manipulations on alcohol drinking often depend on the sex of the mice, alcohol concentration and time of access, genetic background, as well as the drinking test. PMID:27055617

Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

The genetics of alcoholism: identifying specific genes through family studies.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2006-09-01

Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

Gene expression profile analysis of rat cerebellum under acute alcohol intoxication.

PubMed

Zhang, Yu; Wei, Guangkuan; Wang, Yuehong; Jing, Ling; Zhao, Qingjie

2015-02-25

Acute alcohol intoxication, a common disease causing damage to the central nervous system (CNS) has been primarily studied on the aspects of alcohol addiction and chronic alcohol exposure. The understanding of gene expression change in the CNS during acute alcohol intoxication is still lacking. We established a model for acute alcohol intoxication in SD rats by oral gavage. A rat cDNA microarray was used to profile mRNA expression in the cerebella of alcohol-intoxicated rats (experimental group) and saline-treated rats (control group). A total of 251 differentially expressed genes were identified in response to acute alcohol intoxication, in which 208 of them were up-regulated and 43 were down-regulated. Gene ontology (GO) term enrichment analysis and pathway analysis revealed that the genes involved in the biological processes of immune response and endothelial integrity are among the most severely affected in response to acute alcohol intoxication. We discovered five transcription factors whose consensus binding motifs are overrepresented in the promoter region of differentially expressed genes. Additionally, we identified 20 highly connected hub genes by co-expression analysis, and validated the differential expression of these genes by real-time quantitative PCR. By determining novel biological pathways and transcription factors that have functional implication to acute alcohol intoxication, our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of acute alcoholism. Copyright © 2014 Elsevier B.V. All rights reserved.

Associations and interactions between SNPs in the alcohol metabolizing genes and alcoholism phenotypes in European Americans.

PubMed

Sherva, Richard; Rice, John P; Neuman, Rosalind J; Rochberg, Nanette; Saccone, Nancy L; Bierut, Laura J

2009-05-01

Alcohol dependence is a major cause of morbidity and mortality worldwide and has a strong familial component. Several linkage and association studies have identified chromosomal regions and/or genes that affect alcohol consumption, notably in genes involved in the 2-stage pathway of alcohol metabolism. Here, we use multiple regression models to test for associations and interactions between 2 alcohol-related phenotypes and SNPs in 17 genes involved in alcohol metabolism in a sample of 1,588 European American subjects. The strongest evidence for association after correcting for multiple testing was between rs1229984, a nonsynonymous coding SNP in ADH1B, and DSM-IV symptom count (p = 0.0003). This SNP was also associated with maximum number of drinks in 24 hours (p = 0.0004). Each minor allele at this SNP predicts 45% fewer DSM-IV symptoms and 18% fewer max drinks. Another SNP in a splice site in ALDH1A1 (rs8187974) showed evidence for association with both phenotypes as well (p = 0.02 and 0.004, respectively), but neither association was significant after accounting for multiple testing. Minor alleles at this SNP predict greater alcohol consumption. In addition, pairwise interactions were observed between SNPs in several genes (p = 0.00002). We replicated the large effect of rs1229984 on alcohol behavior, and although not common (MAF = 4%), this polymorphism may be highly relevant from a public health perspective in European Americans. Another SNP, rs8187974, may also affect alcohol behavior but requires replication. Also, interactions between polymorphisms in genes involved in alcohol metabolism are likely determinants of the parameters that ultimately affect alcohol consumption.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

PubMed

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Trends in gastrectomy and ADH1B and ALDH2 genotypes in Japanese alcoholic men and their gene-gastrectomy, gene-gene and gene-age interactions for risk of alcoholism.

PubMed

Yokoyama, Akira; Yokoyama, Tetsuji; Matsui, Toshifumi; Mizukami, Takeshi; Kimura, Mitsuru; Matsushita, Sachio; Higuchi, Susumu; Maruyama, Katsuya

2013-01-01

The life-time drinking profiles of Japanese alcoholics have shown that gastrectomy increases susceptibility to alcoholism. We investigated the trends in gastrectomy and alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) genotypes and their interactions in alcoholics. This survey was conducted on 4879 Japanese alcoholic men 40 years of age or older who underwent routine gastrointestinal endoscopic screening during the period 1996-2010. ADH1B/ALDH2 genotyping was performed in 3702 patients. A history of gastrectomy was found in 508 (10.4%) patients. The reason for the gastrectomy was peptic ulcer in 317 patients and gastric cancer in 187 patients. The frequency of gastrectomy had gradually decreased from 13.3% in 1996-2000 to 10.5% in 2001-2005 and to 7.8% in 2006-2010 (P < 0.0001). ADH1B*1/*1 was less frequent in the gastrectomy group than in the non-gastrectomy group (age-adjusted prevalence: 20.4 vs. 27.6%, P = 0.006). ALDH2 genotype distribution did not differ between the two groups. The frequency of inactive ALDH2*1/*2 heterozygotes increased slightly from 13.0% in 1996-2000 to 14.0% in 2001-2005 and to 15.4% in 2006-2010 (P < 0.08). Two alcoholism-susceptibility genotypes, ADH1B*1/*1 and ALDH2*1/*1, modestly but significantly tended not to occur in the same individual (P = 0.026). The frequency of ADH1B*1/*1 decreased with ascending age groups. The high frequency of history of gastrectomy suggested that gastrectomy is still a risk factor for alcoholism, although the percentage decreased during the period. The alcoholism-susceptibility genotype ADH1B*1/*1 was less frequent in the gastrectomy group, suggesting a competitive gene-gastrectomy interaction for alcoholism. A gene-gene interaction and gene-age interactions regarding the ADH1B genotype were observed.

Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

PubMed

Enoch, Mary-Anne

2006-12-01

The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence.

Alteration of gene expression by alcohol exposure at early neurulation.

PubMed

Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang

2011-02-21

We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.

Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).

PubMed

Beecher, Brian S; Carter, Arron H; See, Deven R

2012-05-01

Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.

Protein dynamics promote hydride tunnelling in substrate oxidation by aryl-alcohol oxidase.

PubMed

Carro, Juan; Martínez-Júlvez, Marta; Medina, Milagros; Martínez, Angel T; Ferreira, Patricia

2017-11-01

The temperature dependence of hydride transfer from the substrate to the N5 of the FAD cofactor during the reductive half-reaction of Pleurotus eryngii aryl-alcohol oxidase (AAO) is assessed here. Kinetic isotope effects on both the pre-steady state reduction of the enzyme and its steady-state kinetics, with differently deuterated substrates, suggest an environmentally-coupled quantum-mechanical tunnelling process. Moreover, those kinetic data, along with the crystallographic structure of the enzyme in complex with a substrate analogue, indicate that AAO shows a pre-organized active site that would only require the approaching of the hydride donor and acceptor for the tunnelled transfer to take place. Modification of the enzyme's active-site architecture by replacement of Tyr92, a residue establishing hydrophobic interactions with the substrate analogue in the crystal structure, in the Y92F, Y92L and Y92W variants resulted in different temperature dependence patterns that indicated a role of this residue in modulating the transfer reaction.

Glutamate decarboxylase genes and alcoholism in Han Taiwanese men.

PubMed

Loh, El-Wui; Lane, Hsien-Yuan; Chen, Chien-Hsiun; Chang, Pi-Shan; Ku, Li-Wen; Wang, Kathy H T; Cheng, Andrew T A

2006-11-01

Glutamate decarboxylase (GAD), the rate-limiting enzyme in the synthesis of gamma-aminobutyric acid (GABA), may be involved in the development of alcoholism. This study examined the possible roles of the genes that code for 2 forms of GAD (GAD1 and GAD2) in the development of alcoholism. An association study was conducted among 140 male alcoholic subjects meeting the DSM-III-R criteria for alcohol dependence and 146 controls recruited from the Han Taiwanese in community and clinical settings. Psychiatric assessment of drinking conditions was conducted using a Chinese version of the Schedules for Clinical Assessment in Neuropsychiatry. The SHEsis and Haploview programs were used in statistical analyses. Nine single-nucleotide polymorphisms (SNPs) at the GAD1 gene were valid for further statistics. Between alcoholic subjects and controls, significant differences were found in genotype distributions of SNP1 (p=0.000), SNP2 (p=0.015), SNP4 (p=0.015), SNP5 (p=0.031), SNP6 (p=0.012), and SNP8 (p=0.004) and in allele distributions of SNP1 (p=0.001), SNP2 (p=0.009), and SNP8 (p=0.009). Permutation tests of SNP1, SNP2, and SNP8 demonstrated significant differences in allele frequencies but not in 2 major haplotype blocks. Three valid SNPs at the GAD2 gene demonstrated no associations with alcoholism. Further permutation tests in the only 1 haplotype block or individual SNPs demonstrated no significant differences. This is the first report indicating a possible significant role of the GAD1 gene in the development of alcohol dependence and/or the course of alcohol withdrawal and outcome of alcoholism.

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

PubMed

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

USDA-ARS?s Scientific Manuscript database

The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

PubMed

Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

2003-10-01

Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.

Quantitative trait locus gene mapping: a new method for locating alcohol response genes.

PubMed

Crabbe, J C

1996-01-01

Alcoholism is a multigenic trait with important non-genetic determinants. Studies with genetic animal models of susceptibility to several of alcohol's effects suggest that several genes contributing modest effects on susceptibility (Quantitative Trait Loci, or QTLs) are important. A new technique of QTL gene mapping has allowed the identification of the location in mouse genome of several such QTLs. The method is described, and the locations of QTLs affecting the acute alcohol withdrawal reaction are described as an example of the method. Verification of these QTLs in ancillary studies is described and the strengths, limitations, and future directions to be pursued are discussed. QTL mapping is a promising method for identifying genes in rodents with the hope of directly extrapolating the results to the human genome. This review is based on a paper presented at the First International Congress of the Latin American Society for Biomedical Research on Alcoholism, Santiago, Chile, November 1994.

Convergence of GWA and candidate gene studies for alcoholism

PubMed Central

Olfson, Emily; Bierut, Laura Jean

2012-01-01

Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more

Monoamine Oxidase A Promoter Variable Number of Tandem Repeats (MAOA-uVNTR) in Alcoholics According to Lesch Typology

PubMed Central

Samochowiec, Agnieszka; Chęć, Magdalena; Kopaczewska, Edyta; Samochowiec, Jerzy; Lesch, Otto; Grochans, Elżbieta; Jasiewicz, Andrzej; Bienkowski, Przemyslaw; Łukasz, Kołodziej; Grzywacz, Anna

2015-01-01

Background: The aim of this study was to examine the association between the MAOA-uVNTR gene polymorphism in a homogeneous subgroups of patients with alcohol dependence categorized according to Lesch’s typology. Methods: DNA was provided from alcohol dependent (AD) patients (n = 370) and healthy control subjects (n = 168) all of Polish descent. The history of alcoholism was obtained using the Polish version of the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA). Samples were genotyped using PCR methods. Results: We found no association between alcohol dependence and MAOA gene polymorphism. Conclusions: Lesch typology is a clinical consequence of the disease and its phenotypic description is too complex for a simple genetic analysis. PMID:25809512

Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.

PubMed

Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo

2004-10-01

The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.

The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

PubMed

Wongnate, Thanyaporn; Chaiyen, Pimchai

2013-07-01

Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

PubMed Central

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

PubMed

Nawathean, P; Maslov, D A

2000-08-01

By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.

Chronic smoking and alcoholism change expression of selective genes in the human prefrontal cortex.

PubMed

Flatscher-Bader, Traute; Wilce, Peter A

2006-05-01

Alcoholism is commonly associated with chronic smoking. A number of gene expression profiles of regions within the human mesocorticolimbic system have identified potential alcohol-sensitive genes; however, the influence of smoking on these changes was not taken into account. This study addressed the impact of alcohol and smoking on the expression of 4 genes, previously identified as alcoholism-sensitive, in the human prefrontal cortex (PFC). mRNA expression of apolipoprotein D, tissue inhibitor of the metalloproteinase 3, high-affinity glial glutamate transporter and midkine, was measured in the PFC of alcoholic subjects and controls with and without smoking comorbidity using real-time polymerase chain reaction. The results show that alcohol affects transcription of some of these genes. Additionally, smoking has a marked influence on gene expression. This study emphasizes the need for careful case selection in future gene expression studies to delineate the adaptive molecular process associated with smoking and alcohol.

A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931

A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.

PubMed

Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J

1979-12-01

Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.

Serotonin transporter promoter polymorphism and monoamine oxidase type A VNTR allelic variants together influence alcohol binge drinking risk in young women.

PubMed

Herman, Aryeh I; Kaiss, Kristi M; Ma, Rui; Philbeck, John W; Hasan, Asfar; Dasti, Humza; DePetrillo, Paolo B

2005-02-05

The short allelic variant of the serotonin transporter protein promoter polymorphism (5HTTLPR) appears to influence binge drinking in college students. Both monoamine oxidase type A (MAOA) and the serotonin transporter protein are involved in the processing of serotonin, and allelic variants are both associated with differences in the efficiency of expression. We hypothesized that a significant gene x gene interaction would further stratify the risk of binge drinking in this population. Participants were college students (n = 412) who completed the College Alcohol Study, used to measure binge drinking behaviors. Genomic DNA was extracted from saliva for PCR based genotyping. The risk function for binge drinking was modeled using logistic regression, with final model fit P < 0.0005. This model was valid only for Caucasian females (n = 223), but the power to detect sex and ethnic effects was small. Young Caucasian women carrying higher expression MAOA VNTR alleles homozygous for the short allelic variant of the 5HTTLPR demonstrated the highest rate of binge drinking by self-report, odds ratio (genotype odds: population odds) and 95% confidence intervals, 3.11 (1.14-18.10). Individuals carrying higher expression MAOA VNTR alleles carrying at least one long 5HTTLPR allelic variant had the lowest risk of binge drinking 0.46 (0.28-0.71). These results support the hypothesis that binge drinking behavior in young adulthood may be influenced by neurobiological differences in serotonergic function conferred by functional polymorphisms in genes involved in serotonin processing. (c) 2004 Wiley-Liss, Inc.

5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

PubMed

Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

2015-08-01

Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. © 2014 The Authors. FEBS Journal published by John Wiley & Sons Ltd on behalf of FEBS.

Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization.

PubMed

Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki

2013-02-01

In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.

Isolation and characterization of the pea cytochrome c oxidase Vb gene.

PubMed

Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi

2006-11-01

Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

PubMed Central

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-01-01

The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

Clock genes × stress × reward interactions in alcohol and substance use disorders.

PubMed

Perreau-Lenz, Stéphanie; Spanagel, Rainer

2015-06-01

Adverse life events and highly stressful environments have deleterious consequences for mental health. Those environmental factors can potentiate alcohol and drug abuse in vulnerable individuals carrying specific genetic risk factors, hence producing the final risk for alcohol- and substance-use disorders development. The nature of these genes remains to be fully determined, but studies indicate their direct or indirect relation to the stress hypothalamo-pituitary-adrenal (HPA) axis and/or reward systems. Over the past decade, clock genes have been revealed to be key-players in influencing acute and chronic alcohol/drug effects. In parallel, the influence of chronic stress and stressful life events in promoting alcohol and substance use and abuse has been demonstrated. Furthermore, the reciprocal interaction of clock genes with various HPA-axis components, as well as the evidence for an implication of clock genes in stress-induced alcohol abuse, have led to the idea that clock genes, and Period genes in particular, may represent key genetic factors to consider when examining gene × environment interaction in the etiology of addiction. The aim of the present review is to summarize findings linking clock genes, stress, and alcohol and substance abuse, and to propose potential underlying neurobiological mechanisms. Copyright © 2015 Elsevier Inc. All rights reserved.

Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.

A Xylenol Orange-Based Screening Assay for the Substrate Specificity of Flavin-Dependent para-Phenol Oxidases.

PubMed

Ewing, Tom A; van Noord, Aster; Paul, Caroline E; van Berkel, Willem J H

2018-01-14

Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para -substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para -phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para -phenol oxidases, facilitating the enzyme engineering of known para- phenol oxidases and the evaluation of the substrate specificity of novel para -phenol oxidases.

Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...

Alteration of respiration capacity and transcript accumulation level of alternative oxidase genes in necrosis lines of common wheat.

PubMed

Sugie, Atsushi; Murai, Koji; Takumi, Shigeo

2007-06-01

Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.

No association of the GABAA receptor genes on chromosome 5 with alcoholism in the collaborative study on the genetics of alcoholism sample.

PubMed

Dick, Danielle M; Edenberg, Howard J; Xuei, Xiaoling; Goate, Alison; Hesselbrock, Victor; Schuckit, Marc; Crowe, Raymond; Foroud, Tatiana

2005-01-05

A substantial body of literature suggests that gamma-aminobutyric acid (GABA) may be involved in the neurochemical pathways contributing to alcohol use and related disorders. Chromosome 5 contains a cluster of GABA(A) receptor genes, GABRA1, GABRA6, GABRB2, and GABRG2, which have been among the most extensively studied in relation to alcohol use. These studies have yielded mixed results. Using data from large, multiplex alcoholic families collected as part of the Collaborative Study on the Genetics of Alcoholism (COGA), we sought to provide more conclusive evidence regarding the role of the GABA(A) receptor genes on chromosome 5. Multiple single nucleotide polymorphisms (SNPs) were tested in each of the four chromosome 5q GABA(A) receptor genes, and we conducted both classic trio-based association analyzes and extended pedigree analyzes. We found no consistent evidence of association with alcohol dependence or alcohol dependence comorbid with antisocial personality disorder (ASPD) for any of the regions tested in the chromosome 5 GABA(A) receptor genes. These analyses suggest that the GABA(A) receptor genes on chromosome 5 do not play a strong role in alcohol dependence. Future studies are planned to test whether these genes are more important in influencing behavioral endophenotypes related to the risk of alcohol dependence. Copyright 2004 Wiley-Liss, Inc.

Microprojectile Bombardment Transformation of Date Palm Using the Insecticidal Cholesterol Oxidase (ChoA) Gene.

PubMed

Allam, Mai A; Saker, Mahmoud M

2017-01-01

The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of

Deletion of angiotensin II type 1 receptor gene or scavenge of superoxide prevents chronic alcohol-induced aortic damage and remodelling.

PubMed

Bai, Yang; Tan, Yi; Wang, Bo; Miao, Xiao; Chen, Qiang; Zheng, Yang; Cai, Lu

2012-10-01

To investigate whether chronic alcohol consumption induces vascular injury via angiotensin II (Ang II) type 1 (AT1) receptor-dependent superoxide generation, male transgenic mice with knockout of AT1 gene (AT1-KO) and age-matched wild-type (WT) C57BL/6 mice were pair-fed a modified Lieber-DeCarli alcohol or isocaloric maltose dextrin control liquid diet for 2 months. Ethanol content (%, W/V) in the diet was 4.8 (34% of total calories) at initiation, and gradually increased up to 5.4 (38% of total calories). For some WT mice with and without alcohol treatment, superoxide dismutase mimetic (MnTMPyP) was given simultaneously by intraperitoneal injection at 5 mg/kg body weight daily for 2 months. At the end of studies, aortas were harvested for histopathological and immunohistochemical examination. Significant increases in the wall thickness and structural disarrangement of aorta were found in alcohol group, along with significant increases in aortic oxidative and/or nitrosative damage, expressions of NADPH oxidases (NOXs), inflammatory response, cell death and proliferation, and remodelling (fibrosis). However, these pathological changes were completely attenuated in alcohol-treated AT1-KO mice or in alcohol-treated WT mice that were also simultaneously treated with MnTMPyP for 2 months. These results suggest that chronic alcohol consumption may activate NOX via Ang II/AT1 receptor, to generate superoxide and associated peroxynitrite that in turn causes aortic nitrosative damage, inflammation, cell death and proliferation, and remodelling. Therefore, blocking Ang II/AT1 system or scavenging superoxide may become a potential preventive and/therapeutic approach to alcoholic vascular damage. © 2012 The Authors Journal of Cellular and Molecular Medicine © 2012 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks

PubMed Central

Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong

2009-01-01

Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877

Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Novel strategies to mine alcoholism-related haplotypes and genes by combining existing knowledge framework.

PubMed

Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng

2009-02-01

High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.

Gene-Gene-Environment Interactions of Serotonin Transporter, Monoamine Oxidase A and Childhood Maltreatment Predict Aggressive Behavior in Chinese Adolescents

PubMed Central

Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao

2017-01-01

Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149

Candidate genes, pathways and mechanisms for alcoholism: an expanded convergent functional genomics approach.

PubMed

Rodd, Z A; Bertsch, B A; Strother, W N; Le-Niculescu, H; Balaraman, Y; Hayden, E; Jerome, R E; Lumeng, L; Nurnberger, J I; Edenberg, H J; McBride, W J; Niculescu, A B

2007-08-01

We describe a comprehensive translational approach for identifying candidate genes for alcoholism. The approach relies on the cross-matching of animal model brain gene expression data with human genetic linkage data, as well as human tissue data and biological roles data, an approach termed convergent functional genomics. An analysis of three animal model paradigms, based on inbred alcohol-preferring (iP) and alcohol-non-preferring (iNP) rats, and their response to treatments with alcohol, was used. A comprehensive analysis of microarray gene expression data from five key brain regions (frontal cortex, amygdala, caudate-putamen, nucleus accumbens and hippocampus) was carried out. The Bayesian-like integration of multiple independent lines of evidence, each by itself lacking sufficient discriminatory power, led to the identification of high probability candidate genes, pathways and mechanisms for alcoholism. These data reveal that alcohol has pleiotropic effects on multiple systems, which may explain the diverse neuropsychiatric and medical pathology in alcoholism. Some of the pathways identified suggest avenues for pharmacotherapy of alcoholism with existing agents, such as angiotensin-converting enzyme (ACE) inhibitors. Experiments we carried out in alcohol-preferring rats with an ACE inhibitor show a marked modulation of alcohol intake. Other pathways are new potential targets for drug development. The emergent overall picture is that physical and physiological robustness may permit alcohol-preferring individuals to withstand the aversive effects of alcohol. In conjunction with a higher reactivity to its rewarding effects, they may able to ingest enough of this nonspecific drug for a strong hedonic and addictive effect to occur.

Genetics Home Reference: cytochrome c oxidase deficiency

MedlinePlus

... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...

Expression of alcoholism-relevant genes in the liver are differently correlated to different parts of the brain.

PubMed

Wang, Lishi; Huang, Yue; Jiao, Yan; Chen, Hong; Cao, Yanhong; Bennett, Beth; Wang, Yongjun; Gu, Weikuan

2013-01-01

The purpose of this study is to investigate whether expression profiles of alcoholism-relevant genes in different parts of the brain are correlated differently with those in the liver. Four experiments were conducted. First, we used gene expression profiles from five parts of the brain (striatum, prefrontal cortex, nucleus accumbens, hippocampus, and cerebellum) and from liver in a population of recombinant inbred mouse strains to examine the expression association of 10 alcoholism-relevant genes. Second, we conducted the same association analysis between brain structures and the lung. Third, using five randomly selected, nonalcoholism-relevant genes, we conducted the association analysis between brain and liver. Finally, we compared the expression of 10 alcoholism-relevant genes in hippocampus and cerebellum between an alcohol preference strain and a wild-type control. We observed a difference in correlation patterns in expression levels of 10 alcoholism-relevant genes between different parts of the brain with those of liver. We then examined the association of gene expression between alcohol dehydrogenases (Adh1, Adh2, Adh5, and Adh7) and different parts of the brain. The results were similar to those of the 10 genes. Then, we found that the association of those genes between brain structures and lung was different from that of liver. Next, we found that the association patterns of five alcoholism-nonrelevant genes were different from those of 10 alcoholism-relevant genes. Finally, we found that the expression level of 10 alcohol-relevant genes is influenced more in hippocampus than in cerebellum in the alcohol preference strain. Our results show that the expression of alcoholism-relevant genes in liver is differently associated with the expression of genes in different parts of the brain. Because different structural changes in different parts of the brain in alcoholism have been reported, it is important to investigate whether those structural differences in

Polymorphisms in genes encoding dopamine signalling pathway and risk of alcohol dependence: a systematic review.

PubMed

Bhaskar, Lakkakula V K S; Kumar, Shanmugasundaram Arun

2014-04-01

Alcohol dependence (AD) is one of the major elements that significantly influence drinking pattern that provoke the alcohol-induced organ damage. The structural and neurophysiologic abnormalities in the frontal lobes of chronic alcoholics were revealed by magnetic resonance imaging scans. It is well known that candidate genes involved in dopaminergic pathway are of immense interest to the researchers engaged in a wide range of addictive disorders. Dopaminergic pathway gene polymorphisms are being extensively studied with respect to addictive and behavioral disorders. From the broad literature available, the current review summarizes the specific polymorphisms of dopaminergic genes that play a role in alcohol dependence. No evidence indicating any strong association between AD and polymorphisms of dopamine pathway genes has emerged from the literature. Further studies are warranted, considering a range of alcohol-related traits to determine the genes that influence alcohol dependence.

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less

Association and family studies of DRD2 gene polymorphisms in alcohol dependence syndrome.

PubMed

Małecka, Iwona; Jasiewicz, Andrzej; Suchanecka, Aleksandra; Samochowiec, Jerzy; Grzywacz, Anna

2014-11-06

The human dopamine receptor 2 gene DRD2 plays a central role in susceptibility to Alcohol Dependence Syndrome (ADS). The aim of this study was to evaluate 3 single nucleotide polymorphisms: D2 (rs1076560), Tag1D (rs1800498), Tag1B (rs1079597) located in dopamine receptor 2 DRD2 gene and its role in alcohol dependence. DNA was provided from alcohol dependent (AD) patients (n=171) and healthy control subjects (n=160) all of Polish descent. The history of alcoholism was obtained using the Polish version of the SSAGA (Semi-Structured Assessment for the Genetics of Alcoholism). We conducted case-control association study and transmission disequilibrium test (TDT). Samples were genotyped using real-time PCR method. We did not confirm the association between studied polymorphisms and alcohol dependence syndrome. TDT reveled an adequate transmission of both alleles in the group of alcohol families. The lack of association of studied polymorphisms and ADS does not preclude its participation in the pathogenesis. Further research is needed to determine the actual contribution of DRD2 gene in the pathogenesis of alcoholism.

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

PubMed

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-03-18

The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Peroxisomal Targeting, Import, and Assembly of Alcohol Oxidase in Pichia pastoris

PubMed Central

Waterham, Hans R.; Russell, Kimberly A.; de Vries, Yne; Cregg, James M.

1997-01-01

Alcohol oxidase (AOX), the first enzyme in the yeast methanol utilization pathway is a homooctameric peroxisomal matrix protein. In peroxisome biogenesis-defective (pex) mutants of the yeast Pichia pastoris, AOX fails to assemble into active octamers and instead forms inactive cytoplasmic aggregates. The apparent inability of AOX to assemble in the cytoplasm contrasts with other peroxisomal proteins that are able to oligomerize before import. To further investigate the import of AOX, we first identified its peroxisomal targeting signal (PTS). We found that sequences essential for targeting AOX are primarily located within the four COOH-terminal amino acids of the protein leucine-alanine-arginine-phenylalanine COOH (LARF). To examine whether AOX can oligomerize before import, we coexpressed AOX without its PTS along with wild-type AOX and determined whether the mutant AOX could be coimported into peroxisomes. To identify the mutant form of AOX, the COOH-terminal LARF sequence of the protein was replaced with a hemagglutinin epitope tag (AOX–HA). Coexpression of AOX–HA with wild-type AOX (AOX-WT) did not result in an increase in the proportion of AOX–HA present in octameric active AOX, suggesting that newly synthesized AOX–HA cannot oligomerize with AOX-WT in the cytoplasm. Thus, AOX cannot initiate oligomerization in the cytoplasm, but must first be targeted to the organelle before assembly begins. PMID:9396748

Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

PubMed

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-08-01

A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

PubMed

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Opioid system genes in alcoholism: a case-control study in Croatian population.

PubMed

Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

2013-10-01

Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.

Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.

PubMed

Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W

2016-11-04

By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Altered gene expression in early postnatal monoamine oxidase A knockout mice.

PubMed

Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C

2017-08-15

We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.

Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

PubMed

Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

2015-02-01

Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

PubMed Central

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-01-01

Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

PubMed

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Association between alcoholism and the dopamine D4 receptor gene.

PubMed Central

Muramatsu, T; Higuchi, S; Murayama, M; Matsushita, S; Hayashida, M

1996-01-01

A point mutation in the aldehyde dehydrogenase 2 gene (ALDH2(2) allele) is considered to be a genetic deterrent for alcoholism; however, 80 of 655 Japanese alcoholics had the mutant allele. Genotype factors that might increase susceptibility by overriding the deterrent showed a higher frequency of a five repeat allele of the dopamine D4 receptor 48 bp repeat polymorphism in alcoholics with ALDH2(2) than in 100 other alcoholics and 144 controls. Alcoholics with the five repeat allele also abused other drugs more often. These data suggest the involvement of the dopamine system in the development of alcoholism and other addictive behaviour. PMID:8929946

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

PubMed

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Continuous aryl alcohol oxidase production under growth-limited conditions using a trickle bed reactor.

PubMed

Pardo-Planas, Oscar; Atiyeh, Hasan K; Prade, Rolf A; Müller, Michael; Wilkins, Mark R

2018-05-01

An A. nidulans strain with a pyridoxine marker was used for continuous production of aryl alcohol oxidase (AAO) in a trickle bed reactor (TBR). Modified medium with reduced zinc, no copper, and 5 g/L ascorbic acid that reduced melanin production and increased AAO productivity under growth limited conditions was used. Two air flow rates, 0.11 L/min (0.1 vvm) and 1.1 L/min (1.0 vvm) were tested. More melanin formation and reduced protein productivity were observed with air flow rate of 1.1 L/min. Three random packings were used as support for the fungus inside the TBR column, two of which were hydrophobic and one which was hydrophilic, and three different dilution rates were tested. The use of GEA BCN 030 hydrophobic packing resulted in greater AAO yield and productivity than the other packings. Increasing dilution rates favored melanin formation and citric, lactic and succinic acid accumulation, which decreased AAO yield and productivity. Copyright © 2018 Elsevier Ltd. All rights reserved.

Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Interactions Between Alcohol Metabolism Genes and Religious Involvement in Association With Maximum Drinks and Alcohol Dependence Symptoms

PubMed Central

Chartier, Karen G.; Dick, Danielle M.; Almasy, Laura; Chan, Grace; Aliev, Fazil; Schuckit, Marc A.; Scott, Denise M.; Kramer, John; Bucholz, Kathleen K.; Bierut, Laura J.; Nurnberger, John; Porjesz, Bernice; Hesselbrock, Victor M.

2016-01-01

Objective: Variations in the genes encoding alcohol dehydrogenase (ADH) enzymes are associated with both alcohol consumption and dependence in multiple populations. Additionally, some environmental factors have been recognized as modifiers of these relationships. This study examined the modifying effect of religious involvement on relationships between ADH gene variants and alcohol consumption–related phenotypes. Method: Subjects were African American, European American, and Hispanic American adults with lifetime exposure to alcohol (N = 7,716; 53% female) from the Collaborative Study on the Genetics of Alcoholism. Genetic markers included ADH1B-rs1229984, ADH1B-rs2066702, ADH1C-rs698, ADH4-rs1042364, and ADH4-rs1800759. Phenotypes were maximum drinks consumed in a 24-hour period and total number of alcohol dependence symptoms according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Religious involvement was defined by self-reported religious services attendance. Results: Both religious involvement and ADH1B-rs1229984 were negatively associated with the number of maximum drinks consumed and the number of lifetime alcohol dependence symptoms endorsed. The interactions of religious involvement with ADH1B-rs2066702, ADH1C-rs698, and ADH4-rs1042364 were significantly associated with maximum drinks and alcohol dependence symptoms. Risk variants had weaker associations with maximum drinks and alcohol dependence symptoms as a function of increasing religious involvement. Conclusions: This study provided initial evidence of a modifying effect for religious involvement on relationships between ADH variants and maximum drinks and alcohol dependence symptoms. PMID:27172571

A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

PubMed

Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

2015-01-01

The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.

Identifying gene networks underlying the neurobiology of ethanol and alcoholism.

PubMed

Wolen, Aaron R; Miles, Michael F

2012-01-01

For complex disorders such as alcoholism, identifying the genes linked to these diseases and their specific roles is difficult. Traditional genetic approaches, such as genetic association studies (including genome-wide association studies) and analyses of quantitative trait loci (QTLs) in both humans and laboratory animals already have helped identify some candidate genes. However, because of technical obstacles, such as the small impact of any individual gene, these approaches only have limited effectiveness in identifying specific genes that contribute to complex diseases. The emerging field of systems biology, which allows for analyses of entire gene networks, may help researchers better elucidate the genetic basis of alcoholism, both in humans and in animal models. Such networks can be identified using approaches such as high-throughput molecular profiling (e.g., through microarray-based gene expression analyses) or strategies referred to as genetical genomics, such as the mapping of expression QTLs (eQTLs). Characterization of gene networks can shed light on the biological pathways underlying complex traits and provide the functional context for identifying those genes that contribute to disease development.

The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

PubMed

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

PubMed

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Characteristics of Gloeophyllum trabeum Alcohol Oxidase, an Extracellular Source of H2O2 in Brown Rot Decay of Wood▿

PubMed Central

Daniel, Geoffrey; Volc, Jindřich; Filonova, Lada; Plíhal, Ondřej; Kubátová, Elena; Halada, Petr

2007-01-01

A novel alcohol oxidase (AOX) has been purified from mycelial pellets of the wood-degrading basidiomycete Gloeophyllum trabeum and characterized as a homooctameric nonglycosylated protein with native and subunit molecular masses of 628 and 72.4 kDa, containing noncovalently bonded flavin adenine dinucleotide. The isolated AOX cDNA contained an open reading frame of 1,953 bp translating into a polypeptide of 651 amino acids displaying 51 to 53% identity with other published fungal AOX amino acid sequences. The enzyme catalyzed the oxidation of short-chain primary aliphatic alcohols with a preference for methanol (Km = 2.3 mM, kcat = 15.6 s−1). Using polyclonal antibodies and immunofluorescence staining, AOX was localized on liquid culture hyphae and extracellular slime in sections from degraded wood and on cotton fibers. Transmission electron microscopy immunogold labeling localized the enzyme in the hyphal periplasmic space and wall and on extracellular tripartite membranes and slime, while there was no labeling of hyphal peroxisomes. AOX was further shown to be associated with membranous or slime structures secreted by hyphae in wood fiber lumina and within the secondary cell walls of degraded wood fibers. The differences in AOX targeting compared to the known yeast peroxisomal localization were traced to a unique C-terminal sequence of the G. trabeum oxidase, which is apparently responsible for the protein's different translocation. The extracellular distribution and the enzyme's abundance and preference for methanol, potentially available from the demethylation of lignin, all point to a possible role for AOX as a major source of H2O2, a component of Fenton's reagent implicated in the generally accepted mechanisms for brown rot through the production of highly destructive hydroxyl radicals. PMID:17660304

Association of polymorphisms in nicotinic acetylcholine receptor alpha 4 subunit gene (CHRNA4), mu-opioid receptor gene (OPRM1), and ethanol-metabolizing enzyme genes with alcoholism in Korean patients.

PubMed

Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho

2004-01-01

Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.

Sequence variations of the human MPDZ gene and association with alcoholism in subjects with European ancestry.

PubMed

Karpyak, Victor M; Kim, Jeong-Hyun; Biernacka, Joanna M; Wieben, Eric D; Mrazek, David A; Black, John L; Choi, Doo-Sup

2009-04-01

Mpdz gene variations are known contributors of acute alcohol withdrawal severity and seizures in mice. To investigate the relevance of these findings for human alcoholism, we resequenced 46 exons, exon-intron boundaries, and 2 kilobases in the 5' region of the human MPDZ gene in 61 subjects with a history of alcohol withdrawal seizures (AWS), 59 subjects with a history of alcohol withdrawal without AWS, and 64 Coriell samples from self-reported nonalcoholic subjects [all European American (EA) ancestry] and compared with the Mpdz sequences of 3 mouse strains with different propensity to AWS. To explore potential associations of the human MPDZ gene with alcoholism and AWS, single SNP and haplotype analyses were performed using 13 common variants. Sixty-seven new, mostly rare variants were discovered in the human MPDZ gene. Sequence comparison revealed that the human gene does not have variations identical to those comprising Mpdz gene haplotype associated with AWS in mice. We also found no significant association between MPDZ haplotypes and AWS in humans. However, a global test of haplotype association revealed a significant difference in haplotype frequencies between alcohol-dependent subjects without AWS and Coriell controls (p = 0.015), suggesting a potential role of MPDZ in alcoholism and/or related phenotypes other than AWS. Haplotype-specific tests for the most common haplotypes (frequency > 0.05), revealed a specific high-risk haplotype (p = 0.006, maximum statistic p = 0.051), containing rs13297480G allele also found to be significantly more prevalent in alcoholics without AWS compared with nonalcoholic Coriell subjects (p = 0.019). Sequencing of MPDZ gene in individuals with EA ancestry revealed no variations in the sites identical to those associated with AWS in mice. Exploratory haplotype and single SNP association analyses suggest a possible association between the MPDZ gene and alcohol dependence but not AWS. Further functional genomic analysis of MPDZ

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Paternal alcoholism and offspring conduct disorder: evidence for the 'common genes' hypothesis.

PubMed

Haber, Jon R; Jacob, Theodore; Heath, Andrew C

2005-04-01

Not only are alcoholism and externalizing disorders frequently comorbid, they often co-occur in families across generations; for example, paternal alcoholism predicts offspring conduct disorder just as it does offspring alcoholism. To clarify this relationship, the current study examined the 'common genes' hypothesis utilizing a children-of-twins research design. Participants were male monozygotic (MZ) and dizygotic (DZ) twins from the Vietnam Era Twin Registry who were concordant or discordant for alcohol dependence together with their offspring and the mothers of those offspring. All participants were conducted through a structured psychiatric interview. Offspring risk of conduct disorder was examined as a function of alcoholism genetic risk (due to paternal and co-twin alcohol dependence) and alcoholism environmental risk (due to being reared by a father with an alcohol dependence diagnosis). After controlling for potentially confounding variables, the offspring of alcohol-dependent fathers were significantly more likely to exhibit conduct disorder diagnoses than were offspring of nonalcohol-dependent fathers, thus indicating diagnostic crossover in generational family transmission. Comparing offspring at high genetic and high environmental risk with offspring at high genetic and low environmental risk indicated that genetic factors were most likely responsible for the alcoholism-conduct disorder association. The observed diagnostic crossover (from paternal alcoholism to offspring conduct disorder) across generations in the context of both high and low environmental risk (while genetic risk remained high) supported the common genes hypothesis.

Bienzyme biosensors for glucose, ethanol and putrescine built on oxidase and sweet potato peroxidase.

PubMed

Castillo, Jaime; Gáspár, Szilveszter; Sakharov, Ivan; Csöregi, Elisabeth

2003-05-01

Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase/peroxidase bienzyme systems. The H(2)O(2) produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and the newly purified sweet potato peroxidase (SPP) cross-linked to a redox polymer. The developed electrodes were characterized (sensitivity, stability, and performances in organic medium) and compared with similarly built ones using the 'classical' horseradish peroxidase (HRP). The SPP-based electrodes displayed higher sensitivity and better detection limit for putrescine than those using HRP and were also shown to retain their activity in organic phase much better than the HPR based ones. The importance of attractive or repulsive electrostatic interactions between the peroxidases and oxidases (determined by their isoelectric points) were found to play an important role in the sensitivity of the obtained sensors.

Genes, Environments, and Sex Differences in Alcohol Research.

PubMed

Salvatore, Jessica E; Cho, Seung Bin; Dick, Danielle M

2017-07-01

The study of sex differences has been identified as one way to enhance scientific reproducibility, and the National Institutes of Health (NIH) have implemented a new policy to encourage the explicit examination of sex differences. Our goal here is to address sex differences in behavioral genetic research on alcohol outcomes. We review sex differences for alcohol outcomes and whether the source and magnitude of genetic influences on alcohol consumption and alcohol use disorder (AUD) are the same across sexes; describe common research designs for studying sex-specific gene-by-environment interaction (G × E) effects; and discuss the role of statistical power and theory when testing sex-specific genetic effects. There are robust sex differences for many alcohol outcomes. The weight of evidence suggests that the source and magnitude of genetic influences on alcohol consumption and AUD are the same across sexes. Whether there are sex-specific G × E effects has received less attention to date. The new NIH policy necessitates a systematic approach for studying sex-specific genetic effects in alcohol research. Researchers are encouraged to report power for tests of these effects and to use theory to develop testable hypotheses, especially for studies of G × E.

Candidate genes for alcohol dependence: A genetic association study from India.

PubMed

Malhotra, Savita; Basu, Debasish; Khullar, Madhu; Ghosh, Abhishek; Chugh, Neera

2016-11-01

Search for candidate genes for alcohol dependence (AD) has been inconsistent and inconclusive. Moreover, most of the research has been confined to a few specific ethnic groups. Hence, the aim of our study was to explore specific candidate genes for AD in north Indian male population. In this clinic-based genetic association study, 210 males with AD and 200 controls matched for age, gender and ethnicity were recruited from the clinic and the general population, respectively. Cases were diagnosed with Semi-structured Assessment for Genetics of Alcoholism-II (SSAGA-II). Single-nucleotide polymorphism genotyping was done by real-time quantitative-polymerase chain reaction (PCR) using Taq Man assay (ABI 7500) fast real-time PCR system. Both at the genotypic level and at allelic frequency, Met158 variant of catechol-O-methyl transferase (COMT) showed significant increase in cases as compared to controls. The frequency of heterozygous genotype (A/G) of gamma-aminobutyric acid receptor A1 (GABRA1) was significantly lower in cases as compared to controls. Likewise, for GABRA2, the frequency of homozygous recessive genotype (G/G) was significantly higher in the control group. With respect to the 5-hydroxytryptamine (5HT) transporter long promoter region (5HTTLPR), cholinergic receptor muscarinic (CHRM2) and alcohol dehydrogenase 1B (ADH1B) genes, there was no significant difference between the cases and the controls. Aldehyde dehydrogenase (ALDH2) gene was found to be monomorphic in our study population. Our study findings showed COMT polymorphism conferring risk and GABRA polymorphism as a protective genotype for Indian male with AD. Genes for alcohol metabolism, serotonin transporter and cholinergic receptor gene polymorphism were perhaps not contributory to AD for Indian population.

Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

PubMed Central

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

PubMed

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Amperometric sensor for ethanol based on one-step electropolymerization of thionine-carbon nanofiber nanocomposite containing alcohol oxidase.

PubMed

Wu, Lina; McIntosh, Mike; Zhang, Xueji; Ju, Huangxian

2007-12-15

Thionine had strong interaction with carbon nanofiber (CNF) and was used in the non-covalent functionalization of carbon nanofiber for the preparation of stable thionine-CNF nanocomposite with good dispersion. With a simple one-step electrochemical polymerization of thionine-CNF nanocomposite and alcohol oxidase (AOD), a stable poly(thionine)-CNF/AOD biocomposite film was formed on electrode surface. Based on the excellent catalytic activity of the biocomposite film toward reduction of dissolved oxygen, a sensitive ethanol biosensor was proposed. The ethanol biosensor could monitor ethanol ranging from 2.0 to 252 microM with a detection limit of 1.7 microM. It displayed a rapid response, an expanded linear response range as well as excellent reproducibility and stability. The combination of catalytic activity of CNF and the promising feature of the biocomposite with one-step non-manual technique favored the sensitive determination of ethanol with improved analytical capabilities.

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the

Association of alcohol-metabolizing genes with alcoholism in a Mexican Indian (Otomi) population.

PubMed

Montano Loza, Aldo J; Ramirez Iglesias, Maria Teresa; Perez Diaz, Ivan; Cruz Castellanos, Socorro; Garcia Andrade, Consuelo; Medina Mora, Maria Elena; Robles Díaz, Guillermo; Kershenobich, David; Gutierrez Reyes, Gabriela

2006-06-01

Association studies provide a powerful approach to link DNA variants and genetic predisposition to complex diseases. In this study, we determined the genotype and allelic frequencies of genes encoding enzymes involved in alcohol metabolism in alcoholic and nonalcoholic subjects of related ethnicity. A total of 118 individuals of Otomi Mexican Indian ancestry were included. Fifty-nine were chronic alcoholics according to WHO criteria and alcohol dependents according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM IV) criteria. They were compared to 59 teetotalers or alcohol consumers of <10 g per day. The restriction fragment length polymorphisms analyzed were ADH1B/MaeIII, ALDH2/MboII, CYP2E1/DraI, CYP2E1/RsaI, and CYP2E1/TaqI. Of the studied polymorphisms, a significant difference between alcoholic and nonalcoholic Otomies was observed only in the CYP2E1/TaqI. The common genotype in alcoholics was A1/A2 (54%), and in nonalcoholics the homozygous A2/A2 (63%) (odds ratio [OR]: 0.28; 95% confidence interval [CI]: 0.13-0.60; P=.002). The frequency of the mutant allele A1 was significantly higher in alcoholics than in nonalcoholics (41 vs. 21%; OR: 2.4; 95% CI: 1.3-4.3; P=.003). This documents the presence of a polymorphism of CYP2E1 that is overexpressed in alcoholic Otomies, in which the variant allele (A1 of CYP2E1/TaqI) is associated with increased susceptibility to alcoholism. The appreciation that this finding may be an additional factor contributing to the high frequency of liver cirrhosis in Otomies requires further investigation.

Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira

1995-12-18

The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.

Association of the HTR2A Gene with Alcohol and Heroin Abuse

PubMed Central

Cao, Jian; Liu, Xiangtao; Han, Shizhong; Zhang, Clarence K.; Liu, Zongzhi; Li, Dawei

2014-01-01

Positive genetic associations of rs6313 (102T/C at exon 1) and rs6311 (-1438A/G) on the 5-hydroxytryptamine (serotonin) 2A receptor gene (HTR2A or 5-HT2A) were reported for alcohol and drug abuse, however, other association studies failed to produce consistent results supporting the susceptibility of the two single nucleotide polymorphisms (SNPs). To clarify the associations of the HTR2A gene with substance use disorders, we performed a meta-analysis based on the genotypes from the available candidate gene association studies of the two SNPs with alcohol and drug abuse from multiple populations. Evidence of association was found for HTR2A rs6313 in all the combined studies (e.g., allelic P = 0.0048 and OR = 0.86, 95% CI 0.77 – 0.95) and also in the combined studies of alcohol dependence (abuse) (e.g., allelic P = 0.0001 and OR = 0.71, 95% CI 0.59 – 0.85). The same association trend was also observed in the SAGE (Study of Addiction: Genetics and Environment) datasets. The meta-analysis supports a contribution of the HTR2A gene to the susceptibility to substance use disorders, particularly alcohol dependence. PMID:24178752

Changes in Gene Expression within the Extended Amygdala following Binge-Like Alcohol Drinking by Adolescent Alcohol-Preferring (P) Rats

PubMed Central

McBride, William J.; Kimpel, Mark W.; McClintick, Jeanette N.; Ding, Zheng-Ming; Edenberg, Howard J.; Liang, Tiebing; Rodd, Zachary A.; Bell, Richard L.

2014-01-01

The objective of this study was to determine changes in gene expression within the extended amygdala following binge-like alcohol drinking by male adolescent alcohol-preferring (P) rats. Starting at 28 days of age, P rats were given concurrent access to 15 and 30 % ethanol for 3 one-h sessions/day for 5 consecutive days/week for 3 weeks. Rats were killed by decapitation 3 h after the first ethanol access session on the 15th day of drinking. RNA was prepared from micropunch samples of the nucleus accumbens shell (Acb-sh) and central nucleus of the amygdala (CeA). Ethanol intakes were 2.5 – 3.0 g/kg/session. There were 154 and 182 unique named genes that significantly differed (FDR = 0.2) between the water and ethanol group in the Acb-sh and CeA, respectively. Gene Ontology (GO) analyses indicated that adolescent binge drinking produced changes in biological processes involved with cell proliferation and regulation of cellular structure in the Acb-sh, and in neuron projection and positive regulation of cellular organization in the CeA. Ingenuity Pathway Analysis indicated that, in the Acb-sh, there were several major intracellular signaling pathways (e.g., cAMP-mediated and protein kinase A signaling pathways) altered by adolescent drinking, with 3-fold more genes up-regulated than down-regulated in the alcohol group. The cAMP-mediated signaling system was also up-regulated in the CeA of the alcohol group. Weighted gene co-expression network analysis indicated significant G-protein coupled receptor signaling and transmembrane receptor protein kinase signaling categories in the Acb-sh and CeA, respectively. Overall, the results of this study indicated that binge-like alcohol drinking by adolescent P rats is differentially altering the expression of genes in the Acb-sh and CeA, some of which are involved in intracellular signaling pathways and may produce changes in neuronal function. PMID:24355552

Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

PubMed Central

Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

2007-01-01

Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

PubMed Central

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

Neighborhood alcohol outlet density and genetic influences on alcohol use: evidence for gene-environment interaction.

PubMed

Slutske, Wendy S; Deutsch, Arielle R; Piasecki, Thomas M

2018-05-07

Genetic influences on alcohol involvement are likely to vary as a function of the 'alcohol environment,' given that exposure to alcohol is a necessary precondition for genetic risk to be expressed. However, few gene-environment interaction studies of alcohol involvement have focused on characteristics of the community-level alcohol environment. The goal of this study was to examine whether living in a community with more alcohol outlets would facilitate the expression of the genetic propensity to drink in a genetically-informed national survey of United States young adults. The participants were 2434 18-26-year-old twin, full-, and half-sibling pairs from Wave III of the National Longitudinal Study of Adolescent to Adult Health. Participants completed in-home interviews in which alcohol use was assessed. Alcohol outlet densities were extracted from state-level liquor license databases aggregated at the census tract level to derive the density of outlets. There was evidence that the estimates of genetic and environmental influences on alcohol use varied as a function of the density of alcohol outlets in the community. For example, the heritability of the frequency of alcohol use for those residing in a neighborhood with ten or more outlets was 74% (95% confidence limits = 55-94%), compared with 16% (95% confidence limits = 0-34%) for those in a neighborhood with zero outlets. This moderating effect of alcohol outlet density was not explained by the state of residence, population density, or neighborhood sociodemographic characteristics. The results suggest that living in a neighborhood with many alcohol outlets may be especially high-risk for those individuals who are genetically predisposed to frequently drink.

Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

2016-01-01

It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

Importance of genetics in fetal alcohol effects: null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits

PubMed Central

Bonthius, Daniel J.; Winters, Zachary; Karacay, Bahri; Bousquet, Samantha Larimer; Bonthius, Daniel J.

2014-01-01

The cerebellum is a major target of alcohol-induced damage in the developing brain. However, the cerebella of some children are much more seriously affected than others by prenatal alcohol exposure. As a consequence of in utero alcohol exposure, some children have substantial reductions in cerebellar volume and corresponding neurodevelopmental problems, including microencephaly, ataxia, and balance deficits, while other children who were exposed to similar alcohol quantities are spared. One factor that likely plays a key role in determining the impact of alcohol on the fetal cerebellum is genetics. However, no specific gene variant has yet been identified that worsens cerebellar function as a consequence of developmental alcohol exposure. Previous studies have revealed that mice carrying a homozygous mutation of the gene for neuronal nitric oxide synthase (nNOS−/− mice) have more severe acute alcohol-induced neuronal losses from the cerebellum than wild type mice. Therefore, the goals of this study were to determine whether alcohol induces more severe cerebellum-based behavioral deficits in nNOS−/− mice than in wild type mice and to determine whether these worsened behavior deficits are associated with worsened cerebellar neuronal losses. nNOS−/− mice and their wild type controls received alcohol (0.0, 2.2, or 4.4 mg/g) daily over postnatal days 4–9. In adulthood, the mice underwent behavioral testing, followed by neuronal quantification. Alcohol caused dose-related deficits in rotarod and balance beam performance in both nNOS−/− and wild type mice. However, the alcohol-induced behavioral deficits were substantially worse in the nNOS−/− mice than in wild type. Likewise, alcohol exposure led to losses of Purkinje cells and cerebellar granule cells in mice of both genotypes, but the cell losses were more severe in the nNOS−/− mice than in wild type. Behavioral performances were correlated with neuronal number in the nNOS−/− mice, but not

Genetic variation and epigenetic modification of the prodynorphin gene in peripheral blood cells in alcoholism.

PubMed

D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars

2017-06-02

Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

PubMed Central

2012-01-01

Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

Gene expression changes in the ventral hippocampus and medial prefrontal cortex of adolescent alcohol-preferring (P) rats following binge-like alcohol drinking.

PubMed

McClintick, Jeanette N; McBride, William J; Bell, Richard L; Ding, Zheng-Ming; Liu, Yunlong; Xuei, Xiaoling; Edenberg, Howard J

2018-05-01

Binge drinking of alcohol during adolescence is a serious public health concern with long-term consequences, including decreased hippocampal and prefrontal cortex volume and deficits in memory. We used RNA sequencing to assess the effects of adolescent binge drinking on gene expression in these regions. Male adolescent alcohol-preferring (P) rats were exposed to repeated binge drinking (three 1-h sessions/day during the dark/cycle, 5 days/week for 3 weeks starting at 28 days of age; ethanol intakes of 2.5-3 g/kg/session). Ethanol significantly altered the expression of 416 of 11,727 genes expressed in the ventral hippocampus. Genes and pathways involved in neurogenesis, long-term potentiation, and axonal guidance were decreased, which could relate to the impaired memory function found in subjects with adolescent alcohol binge-like exposure. The decreased expression of myelin and cholesterol genes and apparent decrease in oligodendrocytes in P rats could result in decreased myelination. In the medial prefrontal cortex, 638 of 11,579 genes were altered; genes in cellular stress and inflammatory pathways were increased, as were genes involved in oxidative phosphorylation. Overall, the results of this study suggest that adolescent binge-like alcohol drinking may alter the development of the ventral hippocampus and medial prefrontal cortex and produce long-term consequences on learning and memory, and on control of impulsive behaviors. Copyright © 2017 Elsevier Inc. All rights reserved.

Epistatic interaction between the monoamine oxidase A and serotonin transporter genes in anorexia nervosa.

PubMed

Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick

2005-03-01

The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.

Androgen receptor and monoamine oxidase polymorphism in wild bonobos

PubMed Central

Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho

2014-01-01

Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465

Surface modification of polyvinyl alcohol/malonic acid nanofibers by gaseous dielectric barrier discharge plasma for glucose oxidase immobilization

NASA Astrophysics Data System (ADS)

Afshari, Esmail; Mazinani, Saeedeh; Ranaei-Siadat, Seyed-Omid; Ghomi, Hamid

2016-11-01

Polymeric nanofiber prepares a suitable situation for enzyme immobilization for variety of applications. In this research, we have fabricated polyvinyl alcohol (PVA)/malonic acid nanofibers using electrospinning. After fabrication of nanofibers, the effect of air, nitrogen, CO2, and argon DBD (dielectric barrier discharge) plasmas on PVA/malonic acid nanofibers were analysed. Among them, air plasma had the most significant effect on glucose oxidase (GOx) immobilization. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrum analysis and X-ray photoelectron spectroscopy (XPS) results revealed that in case of air plasma modified nanofibers, the carboxyl groups on the surface are increased. The scanning electron microscopy (SEM) images showed that, after GOx immobilization, the modified nanofibers with plasma has retained its nanofiber structure. Finally, we analysed reusability and storage stability of GOx immobilized on plasma modified and unmodified nanofibers. The results were more satisfactory for modified nanofibers with respect to unmodified ones.

The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots.

PubMed

Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo

2006-01-01

The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.

Recovery of choline oxidase activity by in vitro recombination of individual segments.

PubMed

Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T

2008-11-01

Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.

Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

PubMed

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Alcoholism and alcohol drinking habits predicted from alcohol dehydrogenase genes.

PubMed

Tolstrup, Janne Schurmann; Nordestgaard, Børge Grønne; Rasmussen, Søren; Tybjaerg-Hansen, Anne; Grønbaek, Morten

2008-06-01

Alcohol drinking habits and alcoholism are partly genetically determined. Alcohol is degraded primarily by alcohol dehydrogenase (ADH) wherein genetic variation that affects the rate of alcohol degradation is found in ADH1B and ADH1C. It is biologically plausible that these variations may be associated with alcohol drinking habits and alcoholism. By genotyping 9080 white men and women from the general population, we found that men and women with ADH1B slow vs fast alcohol degradation drank more alcohol and had a higher risk of everyday drinking, heavy drinking, excessive drinking and of alcoholism. For example, the weekly alcohol intake was 9.8 drinks (95% confidence interval (CI): 9.1-11) among men with the ADH1B.1/1 genotype compared to 7.5 drinks (95% CI: 6.4-8.7) among men with the ADH1B.1/2 genotype, and the odds ratio (OR) for heavy drinking was 3.1 (95% CI: 1.7-5.7) among men with the ADH1B.1/1 genotype compared to men with the ADH1B.1/2 genotype. Furthermore, individuals with ADH1C slow vs fast alcohol degradation had a higher risk of heavy and excessive drinking. For example, the OR for heavy drinking was 1.4 (95% CI: 1.1-1.8) among men with the ADH1C.1/2 genotype and 1.4 (95% CI: 1.0-1.9) among men with the ADH1B.2/2 genotype, compared with men with the ADH1C.1/1 genotype. Results for ADH1B and ADH1C genotypes among men and women were similar. Finally, because slow ADH1B alcohol degradation is found in more than 90% of the white population compared to less than 10% of East Asians, the population attributable risk of heavy drinking and alcoholism by ADH1B.1/1 genotype was 67 and 62% among the white population compared with 9 and 24% among the East Asian population.

Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell

1992-01-01

The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

Association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population.

PubMed

Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo

2006-06-01

Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

PubMed Central

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

2010-01-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

PubMed

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Expression of the gene encoding the ghrelin receptor in rats selected for differential alcohol preference.

PubMed

Landgren, Sara; Engel, Jörgen A; Hyytiä, Petri; Zetterberg, Henrik; Blennow, Kaj; Jerlhag, Elisabet

2011-08-01

The mechanisms involved in alcohol use disorder, a chronic relapsing brain disorder, are complex and involve various signalling systems in the brain. Recently, the orexigenic peptide ghrelin was shown to be required for alcohol-induced reward, an effect mediated via ghrelin receptors, GHS-R1A, at the level of the cholinergic-dopaminergic reward link. Moreover, ghrelin increases and GHR-R1A antagonists reduce moderate alcohol consumption in mice, and a single nucleotide polymorphism in the GHS-R1A gene has been associated with high alcohol consumption in humans. Therefore, GHS-R1A gene expression and alcohol intake were investigated in high, AA (Alko, Alcohol), versus low, ANA (Alko, Non-Alcohol), alcohol consuming rats as well as in Wistar rats. In the AA and ANA rats plasma ghrelin levels were also measured. GHS-R1A gene expression was increased in AA compared to ANA rats in nucleus accumbens, ventral tegmental area, amygdala, prefrontal cortex and hippocampus. A similar trend was observed in the ventral tegmental area of Wistar rats consuming high amounts of alcohol. Furthermore, the AA rats had significantly smaller reduction of plasma ghrelin levels over time, after several weeks of alcohol exposure, than had the ANA rats. The present study provides further evidence for that the ghrelin signalling system, in particular at the level of the mesocortocolimbic dopamine system, is involved in alcohol consumption, and thus possibly contributes to alcohol use disorder. Therefore the GHS-R1A may constitute a novel candidate for development of new treatment strategies for alcohol dependence. Copyright © 2011 Elsevier B.V. All rights reserved.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

PubMed

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

A functional polymorphism of the NFKB1 gene increases the risk for alcoholic liver cirrhosis in patients with alcohol dependence.

PubMed

Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco Javier

2009-11-01

The genetic basis for the predisposition to alcoholic liver cirrhosis (ALC) remains unknown. Increasing evidence supports a role for the nuclear factor (NF)-kappaB, the NF-kappaB inhibitor alpha (NFKBIA), and the peroxisome proliferator-activated receptor (PPAR)-gamma in the pathogenesis of alcoholic liver disease, raising the possibility that common polymorphisms in genes encoding these molecules may confer susceptibility to ALC. The objective of this study was to analyze the relationship between common polymorphisms in NFKB1, NFKBIA, and PPARG2 genes and the presence of ALC. A total of 258 male alcoholics (161 without liver disease and 97 with ALC) and 101 healthy controls were genotyped for the -94ins/delATTG NFKB1, 3'-UTR+126G>A NFKBIA, and 34C>G PPARG2 polymorphisms. The association of these genetic variants with ALC was tested in alcoholic patients with alcohol abuse and alcohol dependence. A logistic regression analysis was further performed to analyze the model of inheritance. We found an association between the presence of the deletion allele in NFKB1 polymorphism and ALC in patients with alcohol dependence. We found no association between NFKBIA and PPARG2 polymorphisms and the presence of ALC. The deletion allele of the -94ins/del NFKB1 polymorphism could be associated with a higher risk of developing ALC through an increase in inflammation, as supported by previous data.

Interaction between serotonin transporter and serotonin receptor 1 B genes polymorphisms may be associated with antisocial alcoholism.

PubMed

Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band

2012-07-11

Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n=120) and antisocial non-alcoholism (AS-N-ALC) group (n=153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan's Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.

KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

PubMed

Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

2015-07-01

Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

Multi-species data integration and gene ranking enrich significant results in an alcoholism genome-wide association study.

PubMed

Zhao, Zhongming; Guo, An-Yuan; van den Oord, Edwin J C G; Aliev, Fazil; Jia, Peilin; Edenberg, Howard J; Riley, Brien P; Dick, Danielle M; Bettinger, Jill C; Davies, Andrew G; Grotewiel, Michael S; Schuckit, Marc A; Agrawal, Arpana; Kramer, John; Nurnberger, John I; Kendler, Kenneth S; Webb, Bradley T; Miles, Michael F

2012-01-01

A variety of species and experimental designs have been used to study genetic influences on alcohol dependence, ethanol response, and related traits. Integration of these heterogeneous data can be used to produce a ranked target gene list for additional investigation. In this study, we performed a unique multi-species evidence-based data integration using three microarray experiments in mice or humans that generated an initial alcohol dependence (AD) related genes list, human linkage and association results, and gene sets implicated in C. elegans and Drosophila. We then used permutation and false discovery rate (FDR) analyses on the genome-wide association studies (GWAS) dataset from the Collaborative Study on the Genetics of Alcoholism (COGA) to evaluate the ranking results and weighting matrices. We found one weighting score matrix could increase FDR based q-values for a list of 47 genes with a score greater than 2. Our follow up functional enrichment tests revealed these genes were primarily involved in brain responses to ethanol and neural adaptations occurring with alcoholism. These results, along with our experimental validation of specific genes in mice, C. elegans and Drosophila, suggest that a cross-species evidence-based approach is useful to identify candidate genes contributing to alcoholism.

Genetics Home Reference: isolated sulfite oxidase deficiency

MedlinePlus

... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...

A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7

PubMed Central

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong

2014-01-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425

Electron and Fluorescence Microscopy of Extracellular Glucan and Aryl-Alcohol Oxidase during Wheat-Straw Degradation by Pleurotus eryngii

PubMed Central

Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.

1998-01-01

The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085

Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

PubMed Central

Clary, D O; Wolstenholme, D R

1983-01-01

Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

Genetics and alcoholism.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2013-08-01

Alcohol is widely consumed; however, excessive use creates serious physical, psychological and social problems and contributes to the pathogenesis of many diseases. Alcohol use disorders (that is, alcohol dependence and alcohol abuse) are maladaptive patterns of excessive drinking that lead to serious problems. Abundant evidence indicates that alcohol dependence (alcoholism) is a complex genetic disease, with variations in a large number of genes affecting a person's risk of alcoholism. Some of these genes have been identified, including two genes involved in the metabolism of alcohol (ADH1B and ALDH2) that have the strongest known affects on the risk of alcoholism. Studies continue to reveal other genes in which variants affect the risk of alcoholism or related traits, including GABRA2, CHRM2, KCNJ6 and AUTS2. As more variants are analysed and studies are combined for meta-analysis to achieve increased sample sizes, an improved picture of the many genes and pathways that affect the risk of alcoholism will be possible.

Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

PubMed

Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

2017-04-01

Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on

Reward-related genes and personality traits in alcohol-dependent individuals: a pilot case control study.

PubMed

Landgren, Sara; Berglund, Kristina; Jerlhag, Elisabet; Fahlke, Claudia; Balldin, Jan; Berggren, Ulf; Zetterberg, Henrik; Blennow, Kaj; Engel, Jörgen A

2011-01-01

Components of the brain reward system, i.e. the mesolimbic dopamine, laterodorsal cholinergic and ghrelin signaling systems, have been implicated in alcohol reward in preclinical studies. Genetic variants of these systems have previously been linked to alcohol dependence. Here, we genotyped 31 single nucleotide polymorphisms (SNPs): 1 SNP in the dopamine D₂ receptor (DRD2) gene, 20 SNPs in 5 different nicotinic acetylcholine receptor subunit (CHRN*) genes, and 10 SNPs in the genes encoding pro-ghrelin (GHRL) and its receptor (GHSR), in a pilot study of type 1 alcoholics (n = 84) and healthy controls (n = 32). These individuals were characterized using the Temperament and Character Inventory. None of the SNPs were associated with risk of alcohol dependence in this population. The GG genotype of SNP rs13261190 in the CHRNB3 was associated with increased novelty seeking, while SNPs of the ghrelin signaling system were associated with decreased self-directedness (AA of rs495225, GHSR) and alterations in self-transcendence (AA of both rs42451 and rs35680, GHRL). In conclusion, this pilot study suggests that reward-related genes are associated with altered personality scores in type 1 alcohol dependence, which warrants future studies of these associations in larger study samples. Copyright © 2011 S. Karger AG, Basel.

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

PubMed

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

PubMed

Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

2016-04-15

The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.

Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

PubMed

Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

2018-01-01

Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

Rigorous tests of gene-environment interactions in a lab study of the oxytocin receptor gene (OXTR), alcohol exposure, and aggression.

PubMed

LoParo, Devon; Johansson, Ada; Walum, Hasse; Westberg, Lars; Santtila, Pekka; Waldman, Irwin

2016-07-01

Naturalistic studies of gene-environment interactions (G X E) have been plagued by several limitations, including difficulty isolating specific environmental risk factors from other correlated aspects of the environment, gene-environment correlation (rGE ), and the use of a single genetic variant to represent the influence of a gene. We present results from 235 Finnish young men in two lab studies of aggression and alcohol challenge that attempt to redress these limitations of the extant G X E literature. Specifically, we use a latent variable modeling approach in an attempt to more fully account for genetic variation across the oxytocin receptor gene (OXTR) and to robustly test its main effects on aggression and its interaction with alcohol exposure. We also modeled aggression as a latent variable comprising various indices, including the average and maximum levels of aggression, the earliest trial on which aggression was expressed, and the proportion of trials on which the minimum and maximum levels of aggression were expressed. The best fitting model for the genetic variation across OXTR included six factors derived from an exploratory factor analysis, roughly corresponding to six haplotype blocks. Aggression levels were higher on trials in which participants were administered alcohol, won, or were provoked. There was a significant main effect of OXTR on aggression across studies after controlling for covariates. The interaction of OXTR and alcohol was also significant across studies, such that OXTR had stronger effects on aggression in the alcohol administration condition. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.

Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior

PubMed Central

Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

2009-01-01

Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058

Effects of MAOA-genotype, alcohol consumption, and aging on violent behavior.

PubMed

Tikkanen, Roope; Sjöberg, Rickard L; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

2009-03-01

Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype.

High-level expression of the Penicillium notatum glucose oxidase gene in Pichia pastoris using codon optimization.

PubMed

Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei

2012-03-01

The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.

Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less

Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345

Y Chromosome Regulation of Autism Susceptibility Genes

DTIC Science & Technology

2009-06-01

with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved

A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.

PubMed

Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping

2014-09-01

Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Interaction between Serotonin Transporter and Serotonin Receptor 1 B genes polymorphisms may be associated with antisocial alcoholism

PubMed Central

2012-01-01

Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n = 120) and antisocial non-alcoholism (AS-N-ALC) group (n = 153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism. PMID:22550993

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

PubMed

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Smoking and alcoholism target genes associated with plasticity and glutamate transmission in the human ventral tegmental area.

PubMed

Flatscher-Bader, T; Zuvela, N; Landis, N; Wilce, P A

2008-01-01

Drugs of abuse including nicotine and alcohol elicit their effect by stimulating the mesocorticolimbic dopaminergic system. There is a high incidence of nicotine dependence in alcoholics. To date only limited data is available on the molecular mechanism underlying the action of alcohol and nicotine in the human brain. This study utilized gene expression screening to identify genes sensitive to chronic alcohol abuse within the ventral tegmental area (VTA) of the human brain. Alcohol-responsive genes encoded proteins primarily involved in structural plasticity and neurotransmitter transport and release. In particular, genes involved with brain-derived neurotrophic factor signalling and glutamatergic transmission were found to be affected. The possibility that glutamate transport was a target of chronic alcohol and/or tobacco abuse was further investigated in an extended case set by measurement of mRNA and protein expression. Expression levels of vesicular glutamate transporters SLC17A6 and SLC17A7 were robustly induced by smoking, an effect that was reduced by alcohol co-exposure. Glutamatergic transmission is vital for the control of the VTA and may also be critical to the weighting of novelty and importance of a stimulus, an essential output of this brain region. We conclude that enduring plasticity within the VTA may be a major molecular mechanism for the maintenance of smoking addiction and that alcohol, nicotine and co-abuse have distinct impacts on glutamatergic transmission with important implications for the control of this core mesolimbic structure.

Functional polymorphisms in the sigma1 receptor gene associated with alcoholism.

PubMed

Miyatake, Ryosuke; Furukawa, Aizo; Matsushita, Sachio; Higuchi, Susumu; Suwaki, Hiroshi

2004-01-01

Sigma1 receptors are involved in the pathogenesis of drug abuse. Two polymorphisms (GC-241-240TT and Gln2Pro) in the sigma1 receptor gene (SIGMAR1) have been identified. To investigate the role of SIGMAR1 in conveying susceptibility to alcoholism, we performed a functional analysis of polymorphisms in the SIGMAR1 and a case-control study. We initially screened for polymorphisms in the 5'-upstream region. The effects of the polymorphisms on transcriptional activity were determined using a gene reporter assay. The distribution of SIGMAR1 polymorphisms was analyzed in 307 alcoholic and 302 control subjects. A novel T-485A polymorphism was identified. The transcriptional activity of the A-485 allele and the TT-241-240 allele was significantly reduced compared with that of the T-485 allele and the GC-241-240 allele. The frequencies of the A-485 allele (chi2=5.575, df=1, p=.0205) and the TT-241-240/Pro2 haplotype (chi2=21.464, df=1, p<.0001) were significantly higher in control subjects compared with alcoholic subjects. The T-485A and the GC-241-240TT may be functional polymorphisms, and the A-485 allele and TT-241-240/Pro2 haplotype are possible protective factors for the development of alcoholism.

Induction of innate immune genes in brain create the neurobiology of addiction.

PubMed

Crews, F T; Zou, Jian; Qin, Liya

2011-06-01

Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

Induction of Innate Immune Genes in Brain Create the Neurobiology of Addiction

PubMed Central

Crews, FT; Zou, Jian; Qin, Liya

2013-01-01

Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. PMID:21402143

The monoamine oxidase A gene promoter repeat and prostate cancer risk.

PubMed

White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

2012-11-01

Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

Prevention of melanin formation during aryl alcohol oxidase production under growth-limited conditions using an Aspergillus nidulans cell factory.

PubMed

Pardo-Planas, Oscar; Prade, Rolf A; Müller, Michael; Atiyeh, Hasan K; Wilkins, Mark R

2017-11-01

An Aspergillus nidulans cell factory was genetically engineered to produce an aryl alcohol oxidase (AAO). The cell factory initiated production of melanin when growth-limited conditions were established using stationary plates and shaken flasks. This phenomenon was more pronounced when the strain was cultured in a trickle bed reactor (TBR). This study investigated different approaches to reduce melanin formation in fungal mycelia and liquid medium in order to increase the enzyme production yield. Removal of copper from the medium recipe reduced melanin formation in agar cultures and increased enzyme activities by 48% in agitated liquid cultures. Copper has been reported as a key element for tyrosinase, an enzyme responsible for melanin production. Ascorbic acid (0.44g/L) stopped melanin accumulation, did not affect growth parameters and resulted in AAO activity that was more than two-fold greater than a control treatment with no ascorbic acid. Copyright © 2017 Elsevier Ltd. All rights reserved.

Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers

PubMed Central

Dashti, S. Ghazaleh; Buchanan, Daniel D.; Jayasekara, Harindra; Ouakrim, Driss Ait; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M.; Macrae, Finlay A.; Giles, Graham G.; Parry, Susan; Casey, Graham; Haile, Robert W.; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N.; Lindor, Noralane M.; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

2016-01-01

Background People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association between alcohol consumption and colorectal cancer. Results Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (standard deviation) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 grams/day and >28 grams/day were associated with increased colorectal cancer risk (HR, 1.50; 95%CI, 1.09–2.07 and 1.69; 95%CI, 1.07–2.65 respectively; P-trend=0.05), and colon cancer risk (HR, 1.78; 95%CI, 1.27–2.49 and 1.94; 95%CI, 1.19–3.18 respectively; P-trend=0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusion Our data suggests that alcohol consumption, particularly more than 28 grams/day of ethanol (~2 standard drinks of alcohol in the US), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. PMID:27811119

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Molecular Characterization of the Oxalate Oxidase Involved in the Response of Barley to the Powdery Mildew Fungus1

PubMed Central

Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans

1998-01-01

Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772

The Leu72Met Polymorphism of the Prepro-ghrelin Gene is Associated With Alcohol Consumption and Subjective Responses to Alcohol: Preliminary Findings.

PubMed

Suchankova, Petra; Yan, Jia; Schwandt, Melanie L; Stangl, Bethany L; Jerlhag, Elisabet; Engel, Jörgen A; Hodgkinson, Colin A; Ramchandani, Vijay A; Leggio, Lorenzo

2017-07-01

The orexigenic peptide ghrelin may enhance the incentive value of food-, drug- and alcohol-related rewards. Consistent with preclinical findings, human studies indicate a role of ghrelin in alcohol use disorders (AUD). In the present study an a priori hypothesis-driven analysis was conducted to investigate whether a Leu72Met missense polymorphism (rs696217) in the prepro-ghrelin gene (GHRL), is associated with AUD, alcohol consumption and subjective responses to alcohol. Association analysis was performed using the National Institute on Alcohol Abuse and Alcoholism (NIAAA) clinical sample, comprising AUD individuals and controls (N = 1127). Then, a post-hoc analysis using data from a human laboratory study of intravenous alcohol self-administration (IV-ASA, N = 144) was performed to investigate the association of this SNP with subjective responses following a fixed dose of alcohol (priming phase) and alcohol self-administration (ad libitum phase). The case-control study revealed a trend association (N = 1127, OR = 0.665, CI = 0.44-1.01, P = 0.056) between AUD diagnosis and Leu72Met. In AUD subjects, the SNP was associated with significantly lower average drinks per day (n = 567, β = -2.49, 95% CI = -4.34 to -0.64, P = 0.008) and significantly fewer heavy drinking days (n = 567, β = -12.00, 95% CI = -19.10 to -4.89, P < 0.001). The IV-ASA study further revealed that 72Met carriers had greater subjective responses to alcohol (P < 0.05) when compared to Leu72Leu both at priming and during ad lib self-administration. Although preliminary, these findings suggest that the Leu72Leu genotype may lead to increased risk of AUD possibly via mechanisms involving a lower response to alcohol resulting in excessive alcohol consumption. Further investigations are warranted. We investigated whether a Leu72Met missense polymorphism in the prepro-ghrelin gene, is associated with alcohol use disorder, alcohol consumption and subjective responses to alcohol. Although preliminary

A Hepatocyte-Mimicking Antidote for Alcohol Intoxication.

PubMed

Xu, Duo; Han, Hui; He, Yuxin; Lee, Harrison; Wu, Di; Liu, Fang; Liu, Xiangsheng; Liu, Yang; Lu, Yunfeng; Ji, Cheng

2018-04-11

Alcohol intoxication causes serious diseases, whereas current treatments are mostly supportive and unable to remove alcohol efficiently. Upon alcohol consumption, alcohol is sequentially oxidized to acetaldehyde and acetate by the endogenous alcohol dehydrogenase and aldehyde dehydrogenase, respectively. Inspired by the metabolism of alcohol, a hepatocyte-mimicking antidote for alcohol intoxication through the codelivery of the nanocapsules of alcohol oxidase (AOx), catalase (CAT), and aldehyde dehydrogenase (ALDH) to the liver, where AOx and CAT catalyze the oxidation of alcohol to acetaldehyde, while ALDH catalyzes the oxidation of acetaldehyde to acetate. Administered to alcohol-intoxicated mice, the antidote rapidly accumulates in the liver and enables a significant reduction of the blood alcohol concentration. Moreover, blood acetaldehyde concentration is maintained at an extremely low level, significantly contributing to liver protection. Such an antidote, which can eliminate alcohol and acetaldehyde simultaneously, holds great promise for the treatment of alcohol intoxication and poisoning and can provide therapeutic benefits. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Leu72Met Polymorphism of the Prepro-ghrelin Gene is Associated With Alcohol Consumption and Subjective Responses to Alcohol: Preliminary Findings

PubMed Central

Suchankova, Petra; Yan, Jia; Schwandt, Melanie L.; Stangl, Bethany L.; Jerlhag, Elisabet; Engel, Jörgen A.; Hodgkinson, Colin A.; Ramchandani, Vijay A.; Leggio, Lorenzo

2017-01-01

Abstract Aims The orexigenic peptide ghrelin may enhance the incentive value of food-, drug- and alcohol-related rewards. Consistent with preclinical findings, human studies indicate a role of ghrelin in alcohol use disorders (AUD). In the present study an a priori hypothesis-driven analysis was conducted to investigate whether a Leu72Met missense polymorphism (rs696217) in the prepro-ghrelin gene (GHRL), is associated with AUD, alcohol consumption and subjective responses to alcohol. Method Association analysis was performed using the National Institute on Alcohol Abuse and Alcoholism (NIAAA) clinical sample, comprising AUD individuals and controls (N = 1127). Then, a post-hoc analysis using data from a human laboratory study of intravenous alcohol self-administration (IV-ASA, N = 144) was performed to investigate the association of this SNP with subjective responses following a fixed dose of alcohol (priming phase) and alcohol self-administration (ad libitum phase). Results The case-control study revealed a trend association (N = 1127, OR = 0.665, CI = 0.44–1.01, P = 0.056) between AUD diagnosis and Leu72Met. In AUD subjects, the SNP was associated with significantly lower average drinks per day (n = 567, β = −2.49, 95% CI = −4.34 to −0.64, P = 0.008) and significantly fewer heavy drinking days (n = 567, β = −12.00, 95% CI = −19.10 to −4.89, P < 0.001). The IV-ASA study further revealed that 72Met carriers had greater subjective responses to alcohol (P < 0.05) when compared to Leu72Leu both at priming and during ad lib self-administration. Conclusion Although preliminary, these findings suggest that the Leu72Leu genotype may lead to increased risk of AUD possibly via mechanisms involving a lower response to alcohol resulting in excessive alcohol consumption. Further investigations are warranted. Short Summary We investigated whether a Leu72Met missense polymorphism in the prepro-ghrelin gene, is associated with alcohol use disorder, alcohol

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis

PubMed Central

Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-01-01

Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587

Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension

PubMed Central

FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.

2010-01-01

Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159

KLB is associated with alcohol drinking, and its gene product β-Klotho is necessary for FGF21 regulation of alcohol preference

PubMed Central

Schumann, Gunter; Liu, Chunyu; O’Reilly, Paul; Gao, He; Song, Parkyong; Xu, Bing; Ruggeri, Barbara; Amin, Najaf; Jia, Tianye; Preis, Sarah; Segura Lepe, Marcelo; Akira, Shizuo; Barbieri, Caterina; Baumeister, Sebastian; Cauchi, Stephane; Clarke, Toni-Kim; Enroth, Stefan; Fischer, Krista; Hällfors, Jenni; Harris, Sarah E.; Hieber, Saskia; Hofer, Edith; Hottenga, Jouke-Jan; Johansson, Åsa; Joshi, Peter K.; Kaartinen, Niina; Laitinen, Jaana; Lemaitre, Rozenn; Loukola, Anu; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Mangino, Massimo; Manichaikul, Ani; Mbarek, Hamdi; Milaneschi, Yuri; Moayyeri, Alireza; Mukamal, Kenneth; Nelson, Christopher; Nettleton, Jennifer; Partinen, Eemil; Rawal, Rajesh; Robino, Antonietta; Rose, Lynda; Sala, Cinzia; Satoh, Takashi; Schmidt, Reinhold; Schraut, Katharina; Scott, Robert; Smith, Albert Vernon; Starr, John M.; Teumer, Alexander; Trompet, Stella; Uitterlinden, André G.; Venturini, Cristina; Vergnaud, Anne-Claire; Verweij, Niek; Vitart, Veronique; Vuckovic, Dragana; Wedenoja, Juho; Yengo, Loic; Yu, Bing; Zhang, Weihua; Zhao, Jing Hua; Boomsma, Dorret I.; Chambers, John; Chasman, Daniel I.; Daniela, Toniolo; de Geus, Eco; Deary, Ian; Eriksson, Johan G.; Esko, Tõnu; Eulenburg, Volker; Franco, Oscar H.; Froguel, Philippe; Gieger, Christian; Grabe, Hans J.; Gudnason, Vilmundur; Gyllensten, Ulf; Harris, Tamara B.; Hartikainen, Anna-Liisa; Heath, Andrew C.; Hocking, Lynne; Hofman, Albert; Huth, Cornelia; Jarvelin, Marjo-Riitta; Jukema, J. Wouter; Kaprio, Jaakko; Kooner, Jaspal S.; Kutalik, Zoltan; Lahti, Jari; Langenberg, Claudia; Lehtimäki, Terho; Liu, Yongmei; Madden, Pamela A. F.; Martin, Nicholas; Morrison, Alanna; Penninx, Brenda; Pirastu, Nicola; Psaty, Bruce; Raitakari, Olli; Ridker, Paul; Rose, Richard; Rotter, Jerome I.; Samani, Nilesh J.; Schmidt, Helena; Spector, Tim D.; Stott, David; Strachan, David; Tzoulaki, Ioanna; van der Harst, Pim; van Duijn, Cornelia M.; Marques-Vidal, Pedro; Vollenweider, Peter; Wareham, Nicholas J.; Whitfield, John B.; Wilson, James; Wolffenbuttel, Bruce; Bakalkin, Georgy; Evangelou, Evangelos; Liu, Yun; Rice, Kenneth M.; Desrivières, Sylvane; Kliewer, Steven A.; Müller, Christian P.; Levy, Daniel; Elliott, Paul

2016-01-01

Excessive alcohol consumption is a major public health problem worldwide. Although drinking habits are known to be inherited, few genes have been identified that are robustly linked to alcohol drinking. We conducted a genome-wide association metaanalysis and replication study among >105,000 individuals of European ancestry and identified β-Klotho (KLB) as a locus associated with alcohol consumption (rs11940694; P = 9.2 × 10−12). β-Klotho is an obligate coreceptor for the hormone FGF21, which is secreted from the liver and implicated in macronutrient preference in humans. We show that brain-specific β-Klotho KO mice have an increased alcohol preference and that FGF21 inhibits alcohol drinking by acting on the brain. These data suggest that a liver–brain endocrine axis may play an important role in the regulation of alcohol drinking behavior and provide a unique pharmacologic target for reducing alcohol consumption. PMID:27911795

Identification of NADPH oxidase family members associated with cold stress in strawberry.

PubMed

Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru

2018-04-01

NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.

Sweet preference, sugar addiction and the familial history of alcohol dependence: shared neural pathways and genes.

PubMed

Fortuna, Jeffrey L

2010-06-01

Contemporary research has shown that a high number of alcohol-dependent and other drug-dependent individuals have a sweet preference, specifically for foods with a high sucrose concentration. Moreover, both human and animal studies have demonstrated that in some brains the consumption of sugar-rich foods or drinks primes the release of euphoric endorphins and dopamine within the nucleus accumbens, in a manner similar to some drugs of abuse. The neurobiological pathways of drug and "sugar addiction" involve similar neural receptors, neurotransmitters, and hedonic regions in the brain. Craving, tolerance, withdrawal and sensitization have been documented in both human and animal studies. In addition, there appears to be cross sensitization between sugar addiction and narcotic dependence in some individuals. It has also been observed that the biological children of alcoholic parents, particularly alcoholic fathers, are at greater risk to have a strong sweet preference, and this may manifest in some with an eating disorder. In the last two decades research has noted that specific genes may underlie the sweet preference in alcohol- and drug-dependent individuals, as well as in biological children of paternal alcoholics. There also appears to be some common genetic markers between alcohol dependence, bulimia, and obesity, such as the A1 allele gene and the dopamine 2 receptor gene.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

PubMed Central

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brunner, H.G.; Nelen, M.; Ropers, H.H.

1993-10-22

Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less

Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.

PubMed

Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko

2017-03-01

Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.

Alcohol and aggressive behavior in men--moderating effects of oxytocin receptor gene (OXTR) polymorphisms.

PubMed

Johansson, A; Bergman, H; Corander, J; Waldman, I D; Karrani, N; Salo, B; Jern, P; Algars, M; Sandnabba, K; Santtila, P; Westberg, L

2012-03-01

We explored if the disposition to react with aggression while alcohol intoxicated was moderated by polymorphic variants of the oxytocin receptor gene (OXTR). Twelve OXTR polymorphisms were genotyped in 116 Finnish men [aged 18-30, M = 22.7, standard deviation (SD) = 2.4] who were randomly assigned to an alcohol condition in which they received an alcohol dose of 0.7 g pure ethanol/kg body weight or a placebo condition. Aggressive behavior was measured using a laboratory paradigm in which it was operationalized as the level of aversive noise administered to a fictive opponent. No main effects of the polymorphisms on aggressive behavior were found after controlling for multiple testing. The interactive effects between alcohol and two of the OXTR polymorphisms (rs4564970 and rs1488467) on aggressive behavior were nominally significant and remained significant for the rs4564970 when controlled for multiple tests. To the best of our knowledge, this is the first experimental study suggesting interactive effects of specific genetic variants and alcohol on aggressive behavior in humans. © 2011 The Authors. Genes, Brain and Behavior © 2011 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Structural and kinetic studies on the Ser101Ala variant of choline oxidase: Catalysis by compromise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finnegan, S.; Orville, A.; Yuan, H.

2010-09-15

The oxidation of choline catalyzed by choline oxidase includes two reductive half-reactions where FAD is reduced by the alcohol substrate and by an aldehyde intermediate transiently formed in the reaction. Each reductive half-reaction is followed by an oxidative half-reaction where the reduced flavin is oxidized by oxygen. Here, we have used mutagenesis to prepare the Ser101Ala mutant of choline oxidase and have investigated the impact of this mutation on the structural and kinetic properties of the enzyme. The crystallographic structure of the Ser101Ala enzyme indicates that the only differences between the mutant and wild-type enzymes are the lack of amore » hydroxyl group on residue 101 and a more planar configuration of the flavin in the mutant enzyme. Kinetics established that replacement of Ser101 with alanine yields a mutant enzyme with increased efficiencies in the oxidative half-reactions and decreased efficiencies in the reductive half-reactions. This is accompanied by a significant decrease in the overall rate of turnover with choline. Thus, this mutation has revealed the importance of a specific residue for the optimization of the overall turnover of choline oxidase, which requires fine-tuning of four consecutive half-reactions for the conversion of an alcohol to a carboxylic acid.« less

Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.

PubMed

Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T

2001-06-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.

Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori

PubMed Central

Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo

2001-01-01

Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170

Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

Molecular characterization of the fatty alcohol oxidation pathway for wax-ester mobilization in germinated jojoba seeds.

PubMed

Rajangam, Alex S; Gidda, Satinder K; Craddock, Christian; Mullen, Robert T; Dyer, John M; Eastmond, Peter J

2013-01-01

Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WEs) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very-long-chain fatty alcohols, which must be oxidized to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and a fatty aldehyde dehydrogenase (FADH) before they can be β-oxidized. Here, we describe the cloning and characterization of genes for each of these two activities. Jojoba FAO and FADH are 52% and 68% identical to Arabidopsis (Arabidopsis thaliana) FAO3 and ALDH3H1, respectively. The genes are expressed most strongly in the cotyledons of jojoba seedlings following germination, but transcripts can also be detected in vegetative tissues. Proteomic analysis indicated that the FAO and FADH proteins can be detected on wax bodies, but they localized to the endoplasmic reticulum when they were expressed as amino-terminal green fluorescent protein fusions in tobacco (Nicotiana tabacum) leaves. Recombinant jojoba FAO and FADH proteins are active on very-long-chain fatty alcohol and fatty aldehyde substrates, respectively, and have biochemical properties consistent with those previously reported in jojoba cotyledons. Coexpression of jojoba FAO and FADH in Arabidopsis enhanced the in vivo rate of fatty alcohol oxidation more than 4-fold. Taken together, our data suggest that jojoba FAO and FADH constitute the very-long-chain fatty alcohol oxidation pathway that is likely to be necessary for efficient WE mobilization following seed germination.

Alcohol and aldehyde dehydrogenase gene polymorphisms influence susceptibility to esophageal cancer in Japanese alcoholics.

PubMed

Yokoyama, A; Muramatsu, T; Omori, T; Matsushita, S; Yoshimizu, H; Higuchi, S; Yokoyama, T; Maruyama, K; Ishii, H

1999-11-01

Studies have consistently demonstrated that inactive aldehyde dehydrogenase-2 (ALDH2), encoded by ALDH2*1/2*2, is closely associated with alcohol-related carcinogenesis. Recently, the contributions of alcohol dehydrogenase-2 (ADH2) polymorphism to alcoholism, esophageal cancer, and the flushing response have also been described. To determine the effects of ALDH2 and ADH2 genotypes in genetically based cancer susceptibility, lymphocyte DNA samples from 668 Japanese alcoholic men more than 40 years of age (91 with and 577 without esophageal cancer) were genotyped and the results were expressed as odds ratios (ORs). This study also tested 82 of the alcoholics with esophageal cancer to determine whether cancer susceptibility is associated with patients' responses to simple questions about current or former flushing after drinking a glass of beer. The frequencies of ADH2*1/2*1 and ALDH2*1/2*2 were significantly higher in alcoholics with, than in those without, esophageal cancer (0.473 vs. 0.289 and 0.560 vs. 0.099, respectively). After adjustment for drinking and smoking, the analysis showed significantly increased cancer risk for alcoholics with either ADH2*1/2*I (OR = 2.03) or ALDH2*1/2*2 (OR = 12.76). For those having ADH2*1/2*1 combined with ALDH2*1/2*2, the esophageal cancer risk was enhanced in a multiplicative fashion (OR = 27.66). Responses to flushing questions showed that only 47.8% of the ALDH2*1/2*2 heterozygotes with ADH2*1/ 2*1, compared with 92.3% of those with ALDH2*1/2*2 and the ADH2*2 allele, reported current or former flushing. Genotyping showed that for alcoholics who reported ever flushing, the questionnaire was 71.4% correct in identifying ALDH2*1/2*2 and 87.9% correct in identifying ALDH2*1/2*1. Japanese alcoholics can be divided into cancer susceptibility groups on the basis of their combined ADH2 and ALDH2 genotypes. The flushing questionnaire can predict high risk ALDH2*1/2*2 fairly accurately in persons with ADH2*2 allele, but a reliable

Association of pro-ghrelin and GHS-R1A gene polymorphisms and haplotypes with heavy alcohol use and body mass.

PubMed

Landgren, Sara; Jerlhag, Elisabet; Zetterberg, Henrik; Gonzalez-Quintela, Arturo; Campos, Joaquin; Olofsson, Ulrica; Nilsson, Staffan; Blennow, Kaj; Engel, Jörgen A

2008-12-01

Ghrelin, an orexigenic peptide, acts on growth hormone secretagogue receptors (GHS-R1A), expressed in the hypothalamus as well as in important reward nodes such as the ventral tegmental area. Interestingly, ghrelin has been found to activate an important part of the reward systems, i.e., the cholinergic-dopaminergic reward link. Additionally, the rewarding and neurochemical properties of alcohol are, at least in part, mediated via this reward link. There is comorbidity between alcohol dependence and eating disorders. Thus, plasma levels of ghrelin are altered in patients with addictive behaviors such as alcohol and nicotine dependence and in binge eating disorder. This overlap prompted as to investigate the pro-ghrelin and GHS-R1A genes in a haplotype analysis of heavy alcohol-using individuals. A total of 417 Spanish individuals (abstainers, moderate, and heavy alcohol drinkers) were investigated in a haplotype analysis of the pro-ghrelin and GHS-R1A genes. Tag SNPs were chosen using HapMap data and the Tagger and Haploview softwares. These SNPs were then genotyped using TaqMan Allelic Discrimination. SNP rs2232165 of the GHS-R1A gene was associated with heavy alcohol consumption and SNP rs2948694 of the same gene as well as haplotypes of both the pro-ghrelin and the GHS-R1A genes were associated with body mass in heavy alcohol consuming individuals. The present findings are the first to disclose an association between the pro-ghrelin and GHS-R1A genes and heavy alcohol use, further strengthening the role of the ghrelin system in addictive behaviors and brain reward.

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Genome-Wide Gene Set Analysis for Identification of Pathways Associated with Alcohol Dependence

PubMed Central

Biernacka, Joanna M.; Geske, Jennifer; Jenkins, Gregory D.; Colby, Colin; Rider, David N.; Karpyak, Victor M.; Choi, Doo-Sup; Fridley, Brooke L.

2013-01-01

It is believed that multiple genetic variants with small individual effects contribute to the risk of alcohol dependence. Such polygenic effects are difficult to detect in genome-wide association studies that test for association of the phenotype with each single nucleotide polymorphism (SNP) individually. To overcome this challenge, gene set analysis (GSA) methods that jointly test for the effects of pre-defined groups of genes have been proposed. Rather than testing for association between the phenotype and individual SNPs, these analyses evaluate the global evidence of association with a set of related genes enabling the identification of cellular or molecular pathways or biological processes that play a role in development of the disease. It is hoped that by aggregating the evidence of association for all available SNPs in a group of related genes, these approaches will have enhanced power to detect genetic associations with complex traits. We performed GSA using data from a genome-wide study of 1165 alcohol dependent cases and 1379 controls from the Study of Addiction: Genetics and Environment (SAGE), for all 200 pathways listed in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Results demonstrated a potential role of the “Synthesis and Degradation of Ketone Bodies” pathway. Our results also support the potential involvement of the “Neuroactive Ligand Receptor Interaction” pathway, which has previously been implicated in addictive disorders. These findings demonstrate the utility of GSA in the study of complex disease, and suggest specific directions for further research into the genetic architecture of alcohol dependence. PMID:22717047

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

PubMed Central

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Using genetically engineered animal models in the postgenomic era to understand gene function in alcoholism.

PubMed

Reilly, Matthew T; Harris, R Adron; Noronha, Antonio

2012-01-01

Over the last 50 years, researchers have made substantial progress in identifying genetic variations that underlie the complex phenotype of alcoholism. Not much is known, however, about how this genetic variation translates into altered biological function. Genetic animal models recapitulating specific characteristics of the human condition have helped elucidate gene function and the genetic basis of disease. In particular, major advances have come from the ability to manipulate genes through a variety of genetic technologies that provide an unprecedented capacity to determine gene function in the living organism and in alcohol-related behaviors. Even newer genetic-engineering technologies have given researchers the ability to control when and where a specific gene or mutation is activated or deleted, allowing investigators to narrow the role of the gene's function to circumscribed neural pathways and across development. These technologies are important for all areas of neuroscience, and several public and private initiatives are making a new generation of genetic-engineering tools available to the scientific community at large. Finally, high-throughput "next-generation sequencing" technologies are set to rapidly increase knowledge of the genome, epigenome, and transcriptome, which, combined with genetically engineered mouse mutants, will enhance insight into biological function. All of these resources will provide deeper insight into the genetic basis of alcoholism.

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Transcript Profiling Reveals the Presence of Abiotic Stress and Developmental Stage Specific Ascorbate Oxidase Genes in Plants

PubMed Central

Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda

2017-01-01

Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251

Existence of a novel enzyme, pyrroloquinoline quinone-dependent polyvinyl alcohol dehydrogenase, in a bacterial symbiont, Pseudomonas sp. strain VM15C.

PubMed Central

Shimao, M; Ninomiya, K; Kuno, O; Kato, N; Sakazawa, C

1986-01-01

A novel enzyme, pyrroloquinoline quinone (PQQ)-dependent polyvinyl alcohol (PVA) dehydrogenase, was found in and partially purified from the membrane fraction of a PVA-degrading symbiont, Pseudomonas sp. strain VM15C. The enzyme required PQQ for PVA dehydrogenation with phenazine methosulfate, phenazine ethosulfate, and 2,6-dichlorophenolindophenol as electron acceptors and did not show PVA oxidase activity leading to H2O2 formation. The enzyme was active toward low-molecular-weight secondary alcohols rather than primary alcohols. A membrane-bound PVA oxidase was also present in cells of VM15C. Although the purified oxidase showed a substrate specificity similar to that of PQQ-dependent PVA dehydrogenase and about threefold-higher PVA-dehydrogenating activity with phenazine methosulfate or phenazine ethosulfate than PVA oxidase activity with H2O2 formation, it was shown that the enzyme does not contain PQQ as the coenzyme, and PQQ did not affect its activity. Incubation of the membrane fraction of cells with PVA caused a reduction in the cytochrome(s) of the fraction. Images PMID:3513704

Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

PubMed Central

González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

2004-01-01

The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

PubMed

Wang, Wei; Liu, Ji-Hong

2015-01-25

Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetics of Alcoholism.

PubMed

Zhu, Ena C; Soundy, Timothy J; Hu, Yueshan

2017-05-01

Consuming excessive amounts of alcohol has the potential to modify an individual's brain and lead to alcohol dependence. Alcohol use leads to 88,000 deaths every year in the U.S. alone and can lead to other health issues including cancers, such as colorectal cancer, and mental health problems. While drinking behavior varies due to environmental factors, genetic factors also contribute to the risk of alcoholism. Certain genes affecting alcohol metabolism and neurotransmitters have been found to contribute to or inhibit the risk. Geneenvironment interactions may also play a role in the susceptibility of alcoholism. With a better understanding of the different components that can contribute to alcoholism, more personalized treatment could cater to the individual. This review discusses the major genetic factors and some small variants in other genes that contribute to alcoholism, as well as considers the gene-environmental interactions. Copyright© South Dakota State Medical Association.

NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

PubMed Central

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Integrating Genetic and Gene Co-expression Analysis Identifies Gene Networks Involved in Alcohol and Stress Responses

PubMed Central

Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N.; Jones, Byron C.; Lu, Lu; Wang, Xusheng

2018-01-01

Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses. PMID:29674951

Distribution in microbial genomes of genes similar to lodA and goxA which encode a novel family of quinoproteins with amino acid oxidase activity.

PubMed

Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio

2015-03-24

L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

PubMed Central

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

PubMed

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

A genome wide search for alcoholism susceptibility genes.

PubMed

Hill, Shirley Y; Shen, Sa; Zezza, Nicholas; Hoffman, Eric K; Perlin, Mark; Allan, William

2004-07-01

Alcoholism is currently one of the most serious public health problems in the US. Lifetime prevalence rates are relatively high with one in five men and one in 12 women meeting criteria for this condition. Identification of genetic loci conferring an increased susceptibility to developing alcohol dependence could strengthen prevention efforts by informing individuals of their risk before abusive drinking ensues. Families identified through a double proband methodology have provided an exceptional opportunity for gene-finding because of the increased recurrence risks seen in these sibships. A total of 360 markers for 22 autosomes were spaced at an average distance of 9.4 cM and genotyping performed for 330 members of these multiplex families. Extensive clinical data, personality variation, and event-related potential characteristics were available for reducing heterogeneity and detecting robust linkage signals. Multipoint linkage analysis using different analytic strategies give strong support for loci on chromosomes 1, 2, 6, 7, 10, 12, 14, 16, and 17. Copyright 2004 Wiley-Liss, Inc.

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

PubMed

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

PubMed Central

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

PubMed

Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

2015-01-01

Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.

Molecular Characterization of the Fatty Alcohol Oxidation Pathway for Wax-Ester Mobilization in Germinated Jojoba Seeds1[W

PubMed Central

Rajangam, Alex S.; Gidda, Satinder K.; Craddock, Christian; Mullen, Robert T.; Dyer, John M.; Eastmond, Peter J.

2013-01-01

Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WEs) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very-long-chain fatty alcohols, which must be oxidized to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and a fatty aldehyde dehydrogenase (FADH) before they can be β-oxidized. Here, we describe the cloning and characterization of genes for each of these two activities. Jojoba FAO and FADH are 52% and 68% identical to Arabidopsis (Arabidopsis thaliana) FAO3 and ALDH3H1, respectively. The genes are expressed most strongly in the cotyledons of jojoba seedlings following germination, but transcripts can also be detected in vegetative tissues. Proteomic analysis indicated that the FAO and FADH proteins can be detected on wax bodies, but they localized to the endoplasmic reticulum when they were expressed as amino-terminal green fluorescent protein fusions in tobacco (Nicotiana tabacum) leaves. Recombinant jojoba FAO and FADH proteins are active on very-long-chain fatty alcohol and fatty aldehyde substrates, respectively, and have biochemical properties consistent with those previously reported in jojoba cotyledons. Coexpression of jojoba FAO and FADH in Arabidopsis enhanced the in vivo rate of fatty alcohol oxidation more than 4-fold. Taken together, our data suggest that jojoba FAO and FADH constitute the very-long-chain fatty alcohol oxidation pathway that is likely to be necessary for efficient WE mobilization following seed germination. PMID:23166353

Limited Associations of Dopamine System Genes With Alcohol Dependence and Related Traits in the Irish Affected Sib Pair Study of Alcohol Dependence (IASPSAD)

PubMed Central

Hack, Laura M.; Kalsi, Gursharan; Aliev, Fazil; Kuo, Po-Hsiu; Prescott, Carol A.; Patterson, Diana G.; Walsh, Dermot; Dick, Danielle M.; Riley, Brien P.; Kendler, Kenneth S.

2012-01-01

Background Over 50 years of evidence from research has established that the central dopaminergic reward pathway is likely involved in alcohol dependence (AD). Additional evidence supports a role for dopamine (DA) in other disinhibitory psychopathology, which is often comorbid with AD. Family and twin studies demonstrate that a common genetic component accounts for most of the genetic variance in these traits. Thus, DA-related genes represent putative candidates for the genetic risk that underlies not only AD but also behavioral disinhibition. Many linkage and association studies have examined these relationships with inconsistent results, possibly because of low power, poor marker coverage, and/or an inappropriate correction for multiple testing. Methods We conducted an association study on the products encoded by 10 DA-related genes (DRD1-D5, SLC18A2, SLC6A3, DDC, TH, COMT) using a large, ethnically homogeneous sample with severe AD (n = 545) and screened controls (n = 509). We collected genotypes from linkage disequilibrium (LD)-tagging single nucleotide polymorphisms (SNPs) and employed a gene-based method of correction. We tested for association with AD diagnosis in cases and controls and with a variety of alcohol-related traits (including age-at-onset, initial sensitivity, tolerance, maximum daily drinks, and a withdrawal factor score), disinhibitory symptoms, and a disinhibitory factor score in cases only. A total of 135 SNPs were genotyped using the Illumina GoldenGate and Taqman Assays-on-Demand protocols. Results Of the 101 SNPs entered into standard analysis, 6 independent SNPs from 5 DA genes were associated with AD or a quantitative alcohol-related trait. Two SNPs across 2 genes were associated with a disinhibitory symptom count, while 1 SNP in DRD5 was positive for association with the general disinhibitory factor score. Conclusions Our study provides evidence of modest associations between a small number of DA-related genes and AD as well as a range

Association study between alcoholism and endocannabinoid metabolic enzyme genes encoding fatty acid amide hydrolase and monoglyceride lipase in a Japanese population.

PubMed

Iwasaki, Shinya; Ishiguro, Hiroki; Higuchi, Susumu; Onaivi, Emmanuel S; Arinami, Tadao

2007-08-01

Fatty acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) are the major endocannabinoid metabolic enzymes. Owing to the importance of endocannabinoid system in addiction, the Pro129Thr polymorphism in the FAAH gene has reportedly been associated with substance abuse and dependence in a Caucasian population. To determine whether the single nucleodtide polymorphisms of the FAAH and MGLL genes are associated with alcoholism in a Japanese population. We conducted case-control studies for total 14 tag single nucleotide polymorphisms in those two genes using Japanese 729 patients with alcoholism and 799 healthy controls. Genotype and allele frequencies were compared between these groups. None of these genetic markers, however, showed significant association with alcoholism in Japanese. Whereas we examined associations in a larger sample size between alcoholism and tag single nucleotide polymorphisms that covered most regions of these endocannabinoid metabolic enzyme genes, we found that these are not associated with susceptibility to alcoholism in a Japanese population.

Promoter engineering of the Saccharomyces cerevisiae RIM15 gene for improvement of alcoholic fermentation rates under stress conditions.

PubMed

Watanabe, Daisuke; Kaneko, Akie; Sugimoto, Yukiko; Ohnuki, Shinsuke; Takagi, Hiroshi; Ohya, Yoshikazu

2017-02-01

A loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-like protein kinase, is one of the major causes of the high alcoholic fermentation rates in Saccharomyces cerevisiae sake strains closely related to Kyokai no. 7 (K7). However, impairment of Rim15p may not be beneficial under more severe fermentation conditions, such as in the late fermentation stage, as it negatively affects stress responses. To balance stress tolerance and fermentation performance, we inserted the promoter of a gluconeogenic gene, PCK1, into the 5'-untranslated region (5'-UTR) of the RIM15 gene in a laboratory strain to achieve repression of RIM15 gene expression in the glucose-rich early stage with its induction in the stressful late stage of alcoholic fermentation. The promoter-engineered strain exhibited a fermentation rate comparable to that of the RIM15-deleted strain with no decrease in cell viability. The engineered strain achieved better alcoholic fermentation performance than the RIM15-deleted strain under repetitive and high-glucose fermentation conditions. These data demonstrated the validity of promoter engineering of the RIM15 gene that governs inhibitory control of alcoholic fermentation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

[Molecular identification of human Diphyllobothrium nihonkaiense using mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence].

PubMed

Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro

2010-11-01

Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.

Lack of association between alcohol-dependence and D3 dopamine receptor gene in three independent samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gorwood, P.; Feingold, J.; Ades, J.

1995-12-18

Numerous studies on the involvement of dopamine receptors in the genetics of alcoholism focused on associations between a polymorphism of the D2 dopamine receptor (DRD2) gene and alcohol dependence. However, the results of these studies are conflicting. Another receptor, the D3 dopamine receptor (DRD3), may be of additional interest since it is specifically located in the limbic area, and in particular in the nucleus accumbens which plays a significant role in the reward process of addiction behavior. We thus tested the association in three independent samples of alcoholic patients, with different origins and various inclusion criteria. No difference in themore » DRD3 gene polymorphism emerged between controls and alcoholic patients, regardless of their origin, inclusion criteria, or presence or absence of the DRD2 TaqI A1-allele. Despite the fact that more information could have been considered and that association studies provide limited information, there is good evidence that this DRD3 polymorphism does not play a major role in the genetic component of alcoholism. 17 refs., 2 tabs.« less

Molecular phylogeny and evolution of alcohol dehydrogenase (Adh) genes in legumes

PubMed Central

Fukuda, Tatsuya; Yokoyama, Jun; Nakamura, Toru; Song, In-Ja; Ito, Takuro; Ochiai, Toshinori; Kanno, Akira; Kameya, Toshiaki; Maki, Masayuki

2005-01-01

Background Nuclear genes determine the vast range of phenotypes that are responsible for the adaptive abilities of organisms in nature. Nevertheless, the evolutionary processes that generate the structures and functions of nuclear genes are only now be coming understood. The aim of our study is to isolate the alcohol dehydrogenase (Adh) genes in two distantly related legumes, and use these sequences to examine the molecular evolutionary history of this nuclear gene. Results We isolated the expressed Adh genes from two species of legumes, Sophora flavescens Ait. and Wisteria floribunda DC., by a RT-PCR based approach and found a new Adh locus in addition to homologues of the Adh genes found previously in legumes. To examine the evolution of these genes, we compared the species and gene trees and found gene duplication of the Adh loci in the legumes occurred as an ancient event. Conclusion This is the first report revealing that some legume species have at least two Adh gene loci belonging to separate clades. Phylogenetic analyses suggest that these genes resulted from relatively ancient duplication events. PMID:15836788

Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

PubMed Central

Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

2008-01-01

Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363

Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries

PubMed Central

Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K.; Li, Changwei; Schwander, Karen; Richard, Melissa A.; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M.; Bielak, Lawrence F.; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P.; Horimoto, Andrea R. V. R.; Lohman, Kurt K.; Manning, Alisa K.; Rankinen, Tuomo; Smith, Albert V.; Wojczynski, Mary K.; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Harris, Sarah E.; He, Meian; Hsu, Fang-Chi; Jackson, Anne U.; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Nolte, Ilja M.; Padmanabhan, Sandosh; Robino, Antonietta; Scott, Robert A.; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O.; Varga, Tibor V.; Vitart, Veronique; Wang, Yajuan; Warren, Helen R.; Wen, Wanqing; Yanek, Lisa R.; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Arking, Dan E.; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L.; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M.; Correa, Adolfo; de las Fuentes, Lisa; de Mutsert, Renée; de Silva, H. Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B.; Ehret, Georg; Eppinga, Ruben N.; Faul, Jessica D.; Felix, Stephan B.; Forouhi, Nita G.; Forrester, Terrence; Franco, Oscar H.; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C. Charles; Gu, Dongfeng; Hagenaars, Saskia P.; Hallmans, Göran; Harris, Tamara B.; He, Jiang; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V.; Ikram, M. Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O.; Koh, Woon-Puay; Krieger, José E.; Kritchevsky, Stephen B.; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A.; Langefeld, Carl D.; Langenberg, Claudia; Launer, Lenore J.; Lehne, Benjamin; Lewis, Cora E.; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A.; Meitinger, Thomas; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L.; Momozawa, Yukihide; Nalls, Mike A.; Nelson, Christopher P.; Sotoodehnia, Nona; Norris, Jill M.; O'Connell, Jeff R.; Palmer, Nicholette D.; Perls, Thomas; Pedersen, Nancy L.; Peters, Annette; Peyser, Patricia A.; Poulter, Neil; Raffel, Leslie J.; Raitakari, Olli T.; Roll, Kathryn; Rose, Lynda M.; Rosendaal, Frits R.; Rotter, Jerome I.; Schmidt, Carsten O.; Schreiner, Pamela J.; Schupf, Nicole; Scott, William R.; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M.; Smith, Jennifer A.; Snieder, Harold; Starr, John M.; Strauch, Konstantin; Stringham, Heather M.; Tan, Nicholas Y. Q.; Tang, Hua; Taylor, Kent D.; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T.; Uitterlinden, André G.; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B.; Becker, Diane M.; Boehnke, Michael; Bowden, Donald W.; Chambers, John C.; Deary, Ian J.; Esko, Tõnu; Farrall, Martin; Franks, Paul W.; Freedman, Barry I.; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S.; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C.; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K. E.; Oldehinkel, Albertine J.; Penninx, Brenda W. J. H.; Polasek, Ozren; Porteous, David J.; Rauramaa, Rainer; Samani, Nilesh J.; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E.; Watkins, Hugh; Weir, David R.; Wickremasinghe, Ananda R.; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K.; Gudnason, Vilmundur; Horta, Bernardo L.; Kardia, Sharon L. R.; Liu, Yongmei; Pereira, Alexandre C.; Psaty, Bruce M.; Ridker, Paul M.; van Dam, Rob M.; Gauderman, W. James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O.; Fornage, Myriam; Rotimi, Charles N.; Cupples, L. Adrienne; Kelly, Tanika N.; Fox, Ervin R.; Hayward, Caroline; van Duijn, Cornelia M.; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Morrison, Alanna C.; Caulfield, Mark J.; Munroe, Patricia B.; Rao, Dabeeru C.; Province, Michael A.; Levy, Daniel

2018-01-01

Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10−5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10−8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10−8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension. PMID:29912962

Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.

PubMed

Feitosa, Mary F; Kraja, Aldi T; Chasman, Daniel I; Sung, Yun J; Winkler, Thomas W; Ntalla, Ioanna; Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K; Li, Changwei; Bentley, Amy R; Brown, Michael R; Schwander, Karen; Richard, Melissa A; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M; Bielak, Lawrence F; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P; Horimoto, Andrea R V R; Lohman, Kurt K; Manning, Alisa K; Rankinen, Tuomo; Smith, Albert V; Tajuddin, Salman M; Wojczynski, Mary K; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Campbell, Archie; Chai, Jin Fang; Chen, Xu; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Hagemeijer, Yanick; Harris, Sarah E; He, Meian; Hsu, Fang-Chi; Jackson, Anne U; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Matoba, Nana; Nolte, Ilja M; Padmanabhan, Sandosh; Riaz, Muhammad; Rueedi, Rico; Robino, Antonietta; Said, M Abdullah; Scott, Robert A; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O; van der Most, Peter J; Varga, Tibor V; Vitart, Veronique; Wang, Yajuan; Ware, Erin B; Warren, Helen R; Weiss, Stefan; Wen, Wanqing; Yanek, Lisa R; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Amini, Marzyeh; Arking, Dan E; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L; Canouil, Mickaël; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M; Correa, Adolfo; de Las Fuentes, Lisa; de Mutsert, Renée; de Silva, H Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B; Ehret, Georg; Eppinga, Ruben N; Evangelou, Evangelos; Faul, Jessica D; Felix, Stephan B; Forouhi, Nita G; Forrester, Terrence; Franco, Oscar H; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C Charles; Gu, Dongfeng; Hagenaars, Saskia P; Hallmans, Göran; Harris, Tamara B; He, Jiang; Heikkinen, Sami; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V; Ikram, M Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O; Koh, Woon-Puay; Krieger, José E; Kritchevsky, Stephen B; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A; Langefeld, Carl D; Langenberg, Claudia; Launer, Lenore J; Lehne, Benjamin; Lewis, Cora E; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A; Meitinger, Thomas; Metspalu, Andres; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L; Momozawa, Yukihide; Nalls, Mike A; Nelson, Christopher P; Sotoodehnia, Nona; Norris, Jill M; O'Connell, Jeff R; Palmer, Nicholette D; Perls, Thomas; Pedersen, Nancy L; Peters, Annette; Peyser, Patricia A; Poulter, Neil; Raffel, Leslie J; Raitakari, Olli T; Roll, Kathryn; Rose, Lynda M; Rosendaal, Frits R; Rotter, Jerome I; Schmidt, Carsten O; Schreiner, Pamela J; Schupf, Nicole; Scott, William R; Sever, Peter S; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M; Smith, Jennifer A; Snieder, Harold; Starr, John M; Strauch, Konstantin; Stringham, Heather M; Tan, Nicholas Y Q; Tang, Hua; Taylor, Kent D; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T; Uitterlinden, André G; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B; Becker, Diane M; Boehnke, Michael; Bowden, Donald W; Chambers, John C; Deary, Ian J; Esko, Tõnu; Farrall, Martin; Franks, Paul W; Freedman, Barry I; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Jonas, Jost Bruno; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K E; Oldehinkel, Albertine J; Penninx, Brenda W J H; Polasek, Ozren; Porteous, David J; Rauramaa, Rainer; Samani, Nilesh J; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E; Wareham, Nicholas J; Watkins, Hugh; Weir, David R; Wickremasinghe, Ananda R; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K; Gudnason, Vilmundur; Horta, Bernardo L; Kardia, Sharon L R; Liu, Yongmei; Pereira, Alexandre C; Psaty, Bruce M; Ridker, Paul M; van Dam, Rob M; Gauderman, W James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O; Fornage, Myriam; Rotimi, Charles N; Cupples, L Adrienne; Kelly, Tanika N; Fox, Ervin R; Hayward, Caroline; van Duijn, Cornelia M; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Rice, Kenneth; Morrison, Alanna C; Elliott, Paul; Caulfield, Mark J; Munroe, Patricia B; Rao, Dabeeru C; Province, Michael A; Levy, Daniel

2018-01-01

Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10-5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10-8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10-8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

PubMed

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

PubMed Central

Buades-Rotger, Macià; Gallardo-Pujol, David

2014-01-01

Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

Using Genetically Engineered Animal Models in the Postgenomic Era to Understand Gene Function in Alcoholism

PubMed Central

Reilly, Matthew T.; Harris, R. Adron; Noronha, Antonio

2012-01-01

Over the last 50 years, researchers have made substantial progress in identifying genetic variations that underlie the complex phenotype of alcoholism. Not much is known, however, about how this genetic variation translates into altered biological function. Genetic animal models recapitulating specific characteristics of the human condition have helped elucidate gene function and the genetic basis of disease. In particular, major advances have come from the ability to manipulate genes through a variety of genetic technologies that provide an unprecedented capacity to determine gene function in the living organism and in alcohol-related behaviors. Even newer genetic-engineering technologies have given researchers the ability to control when and where a specific gene or mutation is activated or deleted, allowing investigators to narrow the role of the gene’s function to circumscribed neural pathways and across development. These technologies are important for all areas of neuroscience, and several public and private initiatives are making a new generation of genetic-engineering tools available to the scientific community at large. Finally, high-throughput “next-generation sequencing” technologies are set to rapidly increase knowledge of the genome, epigenome, and transcriptome, which, combined with genetically engineered mouse mutants, will enhance insight into biological function. All of these resources will provide deeper insight into the genetic basis of alcoholism. PMID:23134044

Increased expression of protein kinase A inhibitor alpha (PKI-alpha) and decreased PKA-regulated genes in chronic intermittent alcohol exposure.

PubMed

Repunte-Canonigo, Vez; Lutjens, Robert; van der Stap, Lena D; Sanna, Pietro Paolo

2007-03-23

Intermittent models of alcohol exposure that mimic human patterns of alcohol consumption produce profound physiological and biochemical changes and induce rapid increases in alcohol self-administration. We used high-density oligonucleotide microarrays to investigate gene expression changes during chronic intermittent alcohol exposure in three brain regions that receive mesocorticolimbic dopaminergic projections and that are believed to be involved in alcohol's reinforcing actions: the medial prefrontal cortex, the nucleus accumbens and the amygdala. An independent replication of the experiment was used for RT-PCR validation of the microarray results. The protein kinase A inhibitor alpha (PKI-alpha, Pkia), a member of the endogenous PKI family implicated in reducing nuclear PKA activity, was found to be increased in all three regions tested. Conversely, we observed a downregulation of the expression of several PKA-regulated transcripts in one or more of the brain regions studied, including the activity and neurotransmitter-regulated early gene (Ania) - 1, -3, -7, -8, the transcription factors Egr1 and NGFI-B (Nr4a1) and the neuropeptide NPY. Reduced expression of PKA-regulated genes in mesocorticolimbic projection areas may have motivational significance in the rapid increase in alcohol self-administration induced by intermittent alcohol exposure.

Alcoholism is associated with GALR3 but not two other galanin receptor genes.

PubMed

Belfer, I; Hipp, H; Bollettino, A; McKnight, C; Evans, C; Virkkunen, M; Albaugh, B; Max, M B; Goldman, D; Enoch, M A

2007-07-01

The neuropeptide galanin is widely expressed in the periphery and the central nervous system and mediates diverse physiological processes and behaviors including alcohol abuse, depression and anxiety. Four genes encoding galanin and its receptors have been identified (GAL, GALR1, GALR2 and GALR3). Recently we found that GAL haplotypes were associated with alcoholism, raising the possibility that genetic variation in GALR1, GALR2 and GALR3 might also alter alcoholism risk. Tag single nucleotide polymorphisms (SNPs) were identified by genotyping SNP panels in controls from five populations. For the association study with alcoholism, six GALR1, four GALR2 and four GALR3 SNPs were genotyped in a large cohort of Finnish alcoholics and non-alcoholics. GALR3 showed a significant association with alcoholism that was driven by one SNP (rs3,091,367). Moreover, the combination of the GALR3 rs3,091,367 risk allele and GAL risk haplotypes led to a modestly increased odds ratio (OR) for alcoholism (2.4) as compared with the effect of either GAL (1.9) or GALR3 alone (1.4). Likewise, the combination of the GALR3 and GAL risk diplotypes led to an increased OR for alcoholism (4.6) as compared with the effect of either GAL (2.0) or GALR3 alone (1.6). There was no effect of GALR1 or GALR2 on alcoholism risk. This evidence suggests that GALR3 mediates the alcoholism-related actions of galanin.

Molecular-clinical correlation in a family with a novel heteroplasmic Leigh syndrome missense mutation in the mitochondrial cytochrome c oxidase III gene.

PubMed

Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza

2011-01-01

Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.

Identification and biochemical characterization of polyamine oxidases in amphioxus: Implications for emergence of vertebrate-specific spermine and acetylpolyamine oxidases.

PubMed

Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui

2016-01-10

Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.

Purification and properties of two terminal oxidase complexes of Escherichia coli aerobic respiratory chain.

PubMed

Kita, K; Konishi, K; Anraku, Y

1986-01-01

Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.

Alcohol-induced epigenetic alterations to developmentally crucial genes regulating neural stemness and differentiation.

PubMed

Veazey, Kylee J; Carnahan, Mindy N; Muller, Daria; Miranda, Rajesh C; Golding, Michael C

2013-07-01

From studies using a diverse range of model organisms, we now acknowledge that epigenetic changes to chromatin structure provide a plausible link between environmental teratogens and alterations in gene expression leading to disease. Observations from a number of independent laboratories indicate that ethanol (EtOH) has the capacity to act as a powerful epigenetic disruptor and potentially derail the coordinated processes of cellular differentiation. In this study, we sought to examine whether primary neurospheres cultured under conditions maintaining stemness were susceptible to alcohol-induced alterations in the histone code. We focused our studies on trimethylated histone 3 lysine 4 and trimethylated histone 3 lysine 27, as these are 2 of the most prominent posttranslational histone modifications regulating stem cell maintenance and neural differentiation. Primary neurosphere cultures were maintained under conditions promoting the stem cell state and treated with EtOH for 5 days. Control and EtOH-treated cellular extracts were examined using a combination of quantitative RT-PCR and chromatin immunoprecipitation techniques. We find that the regulatory regions of genes controlling both neural precursor cell identity and processes of differentiation exhibited significant declines in the enrichment of the chromatin marks examined. Despite these widespread changes in chromatin structure, only a small subset of genes including Dlx2, Fabp7, Nestin, Olig2, and Pax6 displayed EtOH-induced alterations in transcription. Unexpectedly, the majority of chromatin-modifying enzymes examined including members of the Polycomb Repressive Complex displayed minimal changes in expression and localization. Only transcripts encoding Dnmt1, Uhrf1, Ehmt1, Ash2 l, Wdr5, and Kdm1b exhibited significant differences. Our results indicate that primary neurospheres maintained as stem cells in vitro are susceptible to alcohol-induced perturbation of the histone code and errors in the epigenetic

Gene-Environment Correlation and Interaction in Peer Effects on Adolescent Alcohol and Tobacco Use

PubMed Central

Harden, K. Paige; Hill, Jennifer E.; Turkheimer, Eric; Emery, Robert E.

2010-01-01

Peer relationships are commonly thought to be critical for adolescent socialization, including the development of negative health behaviors such as alcohol and tobacco use. The interplay between genetic liability and peer influences on the development of adolescent alcohol and tobacco use was examined using a nationally-representative sample of adolescent sibling pairs and their best friends. Genetic factors, some of them related to an adolescent's own substance use and some of them independent of use, were associated with increased exposure to best friends with heavy substance use—a gene-environment correlation. Moreover, adolescents who were genetically liable to substance use were more vulnerable to the adverse influences of their best friends—a gene-environment interaction. PMID:18368474

Isolation, Oxygen Sensitivity, and Virulence of NADH Oxidase Mutants of the Anaerobic Spirochete Brachyspira (Serpulina) hyodysenteriae, Etiologic Agent of Swine Dysentery

PubMed Central

Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.

1999-01-01

Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

PubMed

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

The use of glucose oxidase and catalase for the enzymatic reduction of the potential ethanol content in wine.

PubMed

Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred

2016-11-01

Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. Copyright © 2016. Published by Elsevier Ltd.

The coxBAC Operon Encodes a Cytochrome c Oxidase Required for Heterotrophic Growth in the Cyanobacterium Anabaena variabilis Strain ATCC 29413

PubMed Central

Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia

2001-01-01

Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

2015-12-01

Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

PubMed

Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

2002-04-01

Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

Genes involved in stress response and alcohol use among high-risk African American youth.

PubMed

Goyal, Neeru; Aliev, Fazil; Latendresse, Shawn J; Kertes, Darlene A; Bolland, John M; Byck, Gayle R; Mustanski, Brian; Salvatore, Jessica E; Dick, Danielle M

2016-01-01

Genetic and environmental factors influence substance use behaviors in youth. One of the known environmental risk factors is exposure to life stressors. The aim of this project is to study the interaction between NR3C1 and CRHBP, genes thought to be involved in stress pathways, exposure to stressful life events, and adolescent alcohol use/misuse. The sample included 541 African American individuals (ages 13-18) from the Genes, Environment, and Neighborhood Initiative, a subset of the Mobile Youth Survey sample from whom DNA and more extensive phenotypic data were collected. Participants were selected from high-poverty neighborhoods in Mobile, Alabama, with potential exposure to a variety of extreme life stressors. A measure of stressful life events was significantly predictive of alcohol use/misuse. In addition, this association was significantly dependent upon the number of putative risk variants at rs1715749, a single-nucleotide polymorphism (SNP) in CRHBP (P ≤ .006). There was no significant interaction between NR3C1 and stressful life events with respect to alcohol use/misuse, after taking into account multiple testing. These findings suggest that CRHBP variants are potentially relevant for adolescent alcohol use/misuse among African American youth populations being reared within the context of stressful life events and warrant replication.

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

PubMed

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.

PubMed Central

Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J

1996-01-01

The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115

Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T

PubMed Central

Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong

2016-01-01

Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324

Involvement of alternative oxidase in the regulation of sensitivity of Sclerotinia sclerotiorum to the fungicides azoxystrobin and procymidone.

PubMed

Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi

2013-06-01

Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.

A snapshot of the hepatic transcriptome: ad libitum alcohol intake suppresses expression of cholesterol synthesis genes in alcohol-preferring (P) rats.

PubMed

Klein, Jonathon D; Sherrill, Jeremy B; Morello, Gabriella M; San Miguel, Phillip J; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M; Lumeng, Lawrence; Lossie, Amy C

2014-01-01

Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.

Effects of Moderate Alcohol Consumption on Gene Expression Related to Colonic Inflammation and Antioxidant Enzymes in Rats

PubMed Central

Klarich, DawnKylee S.; Penprase, Jerrold; Cintora, Patricia; Medrano, Octavio; Erwin, Danielle; Brasser, Susan M.; Hong, Mee Young

2017-01-01

Excessive alcohol consumption is a risk factor associated with colorectal cancer; however, some studies have reported that moderate alcohol consumption may not contribute additional risk for developing colorectal cancer while others suggest that moderate alcohol consumption provides a protective effect that reduces colorectal cancer risk. The purpose of this study was to determine the effects of moderate voluntary alcohol (20% ethanol) intake on alternate days for 3 months in outbred Wistar rats on risk factors associated with colorectal cancer development. Colonic gene expression of cyclooxygenase-2, RelA, 8-oxoguanine DNA glycosylase 1, superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glutathione-S-transferase M1, and aldehyde dehydrogenase 2 were determined. Blood alcohol content, liver function enzyme activities, and 8-oxo-deoxyguanosine DNA adducts were also assessed. Alcohol-treated rats were found to have significantly lower 8-oxo-deoxyguanosine levels in blood, a marker of DNA damage. Alanine aminotransferase and lactate dehydrogenase were both significantly lower in the alcohol group. Moderate alcohol significantly decreased cyclooxygenase-2 gene expression, an inflammatory marker associated with colorectal cancer risk. The alcohol group had significantly increased glutathione-S-transferase M1 expression, an antioxidant enzyme that helps detoxify carcinogens, such as acetaldehyde, and significantly increased aldehyde dehydrogenase 2 expression, which allows for greater acetaldehyde clearance. Increased expression of glutathione-S-transferase M1 and aldehyde dehydrogenase 2 likely contributed to reduce mucosal damage that is caused by acetaldehyde accumulation. These results indicate that moderate alcohol may reduce the risk for colorectal cancer development, which was evidenced by reduced inflammation activity and lower DNA damage after alcohol exposure. PMID:28599714

Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular characterization of the fatty alcohol oxidation pathway for wax-ester mobilization in germinated jojoba seeds

USDA-ARS?s Scientific Manuscript database

Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WE) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very long-chain fatty alcohols, which must be oxidised to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and ...

Rationally engineered flavin-dependent oxidase reveals steric control of dioxygen reduction.

PubMed

Zafred, Domen; Steiner, Barbara; Teufelberger, Andrea R; Hromic, Altijana; Karplus, P Andrew; Schofield, Christopher J; Wallner, Silvia; Macheroux, Peter

2015-08-01

The ability of flavoenzymes to reduce dioxygen varies greatly, and is controlled by the protein environment, which may cause either a rapid reaction (oxidases) or a sluggish reaction (dehydrogenases). Previously, a 'gatekeeper' amino acid residue was identified that controls the reactivity to dioxygen in proteins from the vanillyl alcohol oxidase superfamily of flavoenzymes. We have identified an alternative gatekeeper residue that similarly controls dioxygen reactivity in the grass pollen allergen Phl p 4, a member of this superfamily that has glucose dehydrogenase activity and the highest redox potential measured in a flavoenzyme. A substitution at the alternative gatekeeper site (I153V) transformed the enzyme into an efficient oxidase by increasing dioxygen reactivity by a factor of 60,000. An inverse exchange (V169I) in the structurally related berberine bridge enzyme (BBE) decreased its dioxygen reactivity by a factor of 500. Structural and biochemical characterization of these and additional variants showed that our model enzymes possess a cavity that binds an anion and resembles the 'oxyanion hole' in the proximity of the flavin ring. We showed also that steric control of access to this site is the most important parameter affecting dioxygen reactivity in BBE-like enzymes. Analysis of flavin-dependent oxidases from other superfamilies revealed similar structural features, suggesting that dioxygen reactivity may be governed by a common mechanistic principle. Structural data are available in PDB database under the accession numbers 4PVE, 4PVH, 4PVJ, 4PVK, 4PWB, 4PWC and 4PZF. © 2015 FEBS.

NADPH oxidases in the arbuscular mycorrhizal symbiosis.

PubMed

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.

NADPH oxidases in the arbuscular mycorrhizal symbiosis

PubMed Central

Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

2016-01-01

ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

Genetics of alcoholism.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2014-01-01

Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

PubMed

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

Further characterization of the GlyT-1 inhibitor Org25935: anti-alcohol, neurobehavioral, and gene expression effects.

PubMed

Lidö, Helga Höifödt; Jonsson, Susanne; Hyytiä, Petri; Ericson, Mia; Söderpalm, Bo

2017-05-01

The glycine transporter-1 inhibitor Org25935 is a promising candidate in a treatment concept for alcohol use disorder targeting the glycine system. Org25935 inhibits ethanol-induced dopamine elevation in brain reward regions and reduces ethanol intake in Wistar rats. This study aimed to further characterise the compound and used ethanol consumption, behavioral measures, and gene expression as parameters to investigate the effects in Wistar rats and, as pharmacogenetic comparison, Alko-Alcohol (AA) rats. Animals were provided limited access to ethanol in a two-bottle free-choice paradigm with daily drug administration. Acute effects of Org25935 were estimated using locomotor activity and neurobehavioral status. Effects on gene expression in Wistar rats were measured with qPCR. The higher but not the lower dose of Org25935 reduced alcohol intake in Wistar rats. Unexpectedly, Org25935 reduced both ethanol and water intake and induced strong CNS-depressive effects in AA-rats (withdrawn from further studies). Neurobehavioral effects by Org25935 differed between the strains (AA-rats towards sedation). Org25935 did not affect gene expression at the mRNA level in the glycine system of Wistar rats. The data indicate a small therapeutic range for the anti-alcohol properties of Org25935, a finding that may guide further evaluations of the clinical utility of GlyT-1 inhibitors. The results point to the importance of pharmacogenetic considerations when developing drugs for alcohol-related medical concerns. Despite the lack of successful clinical outcomes, to date, the heterogeneity of drug action of Org25935 and similar agents and the unmet medical need justify further studies of glycinergic compounds in alcohol use disorder.

The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

PubMed Central

Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

2016-01-01

The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

Confirmation of prior evidence of genetic susceptibility to alcoholism in a genome-wide association study of comorbid alcoholism and bipolar disorder.

PubMed

Lydall, Gregory John; Bass, Nicholas J; McQuillin, Andrew; Lawrence, Jacob; Anjorin, Adebayo; Kandaswamy, Radhika; Pereira, Ana; Guerrini, Irene; Curtis, David; Vine, Anna E; Sklar, Pamela; Purcell, Shaun M; Gurling, Hugh Malcolm Douglas

2011-12-01

Alcoholism and affective disorders are both strongly comorbid and heritable. We have investigated the genetic comorbidity between bipolar affective disorder and alcoholism. A genome-wide allelic association study of 506 patients from the University College London bipolar disorder case-control sample and 510 ancestrally matched supernormal controls. One hundred forty-three of the bipolar patients fulfilled the Research Diagnostic Criteria diagnosis of alcoholism. A total of 372 193 single nucleotide polymorphisms (SNPs) were genotyped. Genes previously shown to be associated with alcoholism and addiction phenotypes were then tested for association in the bipolar alcoholic sample using gene-wise permutation tests of all SNPs genotyped within a 50-kb region flanking each gene. Several central nervous system genes showed significant (P<0.05) gene-wise evidence of association with bipolar alcoholism. The genes implicated, which replicated genes previously shown to be associated with alcoholism were: cadherin 11, collagen type 11 α2, neuromedin U receptor 2, exportin7, and semaphorin-associated protein 5A. The SNPs most strongly implicated in bipolar alcoholism, but, which did not meet conventional genome-wide significance criteria were the insulin-like growth factor-binding protein 7, carboxypeptidase O, cerebellin 2, and the cadherin 12 genes. We have confirmed the role of some genes previously shown to be associated with alcoholism in the comorbid bipolar alcoholism subgroup. In this subgroup, bipolar disorder may lower the threshold for the phenotypic expression of these alcoholism susceptibility genes. We also show that some genes may independently increase susceptibility to affective disorder and alcoholism.

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Treesearch

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Functional expression of aryl-alcohol oxidase in Saccharomyces cerevisiae and Pichia pastoris by directed evolution.

PubMed

Viña-Gonzalez, Javier; Elbl, Katarina; Ponte, Xavier; Valero, Francisco; Alcalde, Miguel

2018-07-01

Aryl-alcohol oxidase (AAO) plays a fundamental role in the fungal ligninolytic secretome, acting as a supplier of H 2 O 2 . Despite its highly selective mechanism of action, the presence of this flavooxidase in different biotechnological settings has hitherto been hampered by the lack of appropriate heterologous expression systems. We recently described the functional expression of the AAO from Pleurotus eryngii in Saccharomyces cerevisiae by fusing a chimeric signal peptide (preαproK) and applying structure-guided evolution. Here, we have obtained an AAO secretion variant that is readily expressed in S. cerevisiae and overproduced in Pichia pastoris. First, the functional expression of AAO in S. cerevisiae was enhanced through the in vivo shuffling of a panel of secretion variants, followed by the focused evolution of the preαproK peptide. The outcome of this evolutionary campaign-an expression variant that accumulated 4 mutations in the chimeric signal peptide, plus two mutations in the mature protein- showed 350-fold improved secretion (4.5 mg/L) and was stable. This secretion mutant was cloned into P. pastoris and fermented in a fed-batch bioreactor to enhance production to 25 mg/L. While both recombinant AAO from S. cerevisiae and P. pastoris were subjected to the same N-terminal processing and had a similar pH activity profile, they differed in their kinetic parameters and thermostability. The strong glycosylation observed in the evolved AAO from S. cerevisiae underpinned this effect, since when the mutant was produced in the glycosylation-deficient S. cerevisiae strain Δkre2, its kinetic parameters and thermostability were comparable to its poorly glycosylated P. pastoris recombinant counterpart. © 2018 Wiley Periodicals, Inc.

Relations of blood pressure to angiotensinogen gene T174M polymorphism and alcohol intake.

PubMed

Takashima, Yutaka; Kokaze, Akatsuki; Matsunaga, Naomi; Yoshida, Masao; Sekiguchi, Kanako; Sekine, Yasuko; Sumiya, Yu

2003-07-01

To clarify the interactive effects of alcohol intake and angiotensinogen gene codon 174 (T174M) polymorphisms on blood pressure in Japanese male workers. On the basis of data from health examinations, nutrition survey and T174M genotype analysis conducted for 185 Japanese male workers at 2000, the prevalence of high-normal blood pressure (HNBP) and hypertension were compared between the four subgroups crossed by two T174M genotype categories ('TT' type, and 'TM or MM' type) and two alcohol intake categories (less than 13.7 g per day, and 13.7 g or more per day). Furthermore, for 95 subjects who had been normotensive at 1998 among them, risk of development into HNBP or hypertension at 2000 were compared across the four subgroups. The findings showed that the HNBP prevalence adjusted for age, body mass index, smoking habits and sodium intake in 2000 was significantly (p=0.03) greater in 'TM or MM' type (57.9%) than in 'TT' type (24.9%) in subjects with 13.7 g or more of daily alcohol intake, whereas no difference in this parameter was found between the two genotypes in those with less than 13.7 g of daily alcohol intake (18.2% and 18.3%, respectively). The risk for development into HNBP at 2000 was also greatest in 'TM or MM' type with 13.7 g or more of daily alcohol intake among the four subgroups, although there were not significant differences between the four subgroups. The prevalence of hypertension or development risk for hypertension did not significantly differ between the four subgroups. Therefore, it can be seen that alcohol drinking might be specifically associated with the HNBP in M allele carriers of angiotensinogen gene T174M polymorphism.

AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

PubMed

Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

2017-09-01

Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

Overexpression of the gene encoding HMG-CoA reductase in Saccharomyces cerevisiae for production of prenyl alcohols.

PubMed

Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

2009-04-01

To develop microbial production method for prenyl alcohols (e.g., (E,E)-farnesol (FOH), (E)-nerolidol (NOH), and (E,E,E)-geranylgeraniol (GGOH)), the genes encoding enzymes in the mevalonate and prenyl diphosphate pathways were overexpressed in Saccharomyces cerevisiae, and the resultant transformants were evaluated as to the production of these alcohols. Overexpression of the gene encoding hydroxymethylglutaryl (HMG)-CoA reductase was most effective among the genes tested. A derivative of S. cerevisiae ATCC 200589, which was selected through screening, was found to be the most suitable host for the production. On cultivation of the resultant transformant, in which the HMG-CoA reductase gene was overexpressed, in a 5-liter bench-scale jar fermenter for 7 d, the production of FOH, NOH, and GGOH reached 145.7, 98.8, and 2.46 mg/l, respectively.

Maternal folate, alcohol and energy metabolism-related gene polymorphisms and the risk of recurrent pregnancy loss.

PubMed

Sata, F; Yamada, H; Kishi, R; Minakami, H

2012-10-01

Epidemiological studies have suggested that the condition of recurrent pregnancy loss (RPL) may be multifactorial, with both genetic predisposition and environmental factors potentially involved in its pathogenesis. The aim of this study is to elucidate the associations between maternal folate, alcohol and energy metabolism-related gene polymorphisms and the risk of RPL. This case-control study, which involved 116 cases with two or more instances of RPL and 306 fertile controls, was performed in the city of Sapporo, Japan. The associations between eight single nucleotide polymorphisms of folate, alcohol and energy metabolism-related genes [methylenetetrahydrofolate reductase (MTHFR), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), alcohol dehydrogenase 1B (ADH1B), aldehyde dehydrogenase 2 (ALDH2), beta-3-adrenergic receptor (ADRB3) and peroxisome proliferator-activated receptor gamma (PPARG)], and RPL were assessed. Without consideration of cigarette smoking or alcohol use, the risk of RPL significantly decreased in women with the MTHFR rs1801133 TT, MTR rs1805087 AG or ALDH2 rs671 AA genotype (P < 0.05). The risk of RPL associated with cigarette smoking and alcohol use decreased significantly in women carrying the MTHFR rs1801133 T allele [odds ratio (OR), 0.51; 95% confidence interval (CI), 0.27-0.95]. Similarly, the risk of RPL significantly decreased in women carrying the MTR rs1805087 G allele (OR, 0.44; 95% CI, 0.23-0.85). Our findings suggest that maternal gene polymorphisms related to folate metabolism may decrease the risk of RPL. Molecular epidemiological studies are needed to unequivocally elucidate the multifactorial effects of both genetic and environmental factors on human fecundity.

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

PubMed

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

PubMed

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Differential Potassium Channel Gene Regulation in BXD Mice Reveals Novel Targets for Pharmacogenetic Therapies to Reduce Heavy Alcohol Drinking

PubMed Central

Rinker, Jennifer A.; Fulmer, Diana B.; Trantham-Davidson, Heather; Smith, Maren L.; Williams, Robert W.; Lopez, Marcelo F.; Randall, Patrick K.; Chandler, L. Judson; Miles, Michael F.; Becker, Howard C.; Mulholland, Patrick J.

2016-01-01

Alcohol (ethanol) dependence is a chronic relapsing brain disorder partially influenced by genetics and characterized by an inability to regulate harmful levels of drinking. Emerging evidence has linked genes that encode KV7, KIR, and KCa2 K+ channels with variation in alcohol-related behaviors in rodents and humans. This led us to experimentally test relations between K+ channel genes and escalation of drinking in a chronic intermittent ethanol (CIE) exposure model of dependence in BXD recombinant inbred strains of mice. Transcript levels for K+ channel genes in the prefrontal cortex (PFC) and nucleus accumbens (NAc) covary with voluntary ethanol drinking in a non-dependent cohort. Transcripts that encode KV7 channels covary negatively with drinking in non-dependent BXD strains. Using a pharmacological approach to validate the genetic findings, C57BL/6J mice were allowed intermittent access to ethanol to establish baseline consumption before they were treated with retigabine, an FDA-approved KV7 channel positive modulator. Systemic administration significantly reduced drinking, and consistent with previous evidence, retigabine was more effective at reducing voluntary consumption in high-drinking than low-drinking subjects. We evaluated the specific K+ channel genes that were most sensitive to CIE exposure and identified a gene subset in the NAc and PFC dysregulated in the alcohol-dependent BXD cohort. CIE-induced modulation of nine genes in the NAc and six genes in the PFC covaried well with the changes in drinking induced by ethanol dependence. Here we identified novel candidate genes in the NAc and PFC that are regulated by ethanol dependence and correlate with voluntary drinking in non-dependent and dependent BXD mice. The findings that Kcnq expression correlate with drinking and that retigabine reduces consumption suggest that KV7 channels could be pharmacogenetic targets to treat individuals with alcohol addiction. PMID:27432260

THE EFFECT OF PROPRANOLOL ON GENE EXPRESSION DURING THE BLOOD ALCOHOL CYCLE OF RATS FED ETHANOL INTRAGASTRICALLY

PubMed Central

Li, Jun; Bardag-Gorce, F; Joan, Oliva; French, BA; Dedes, J; French, SW

2010-01-01

Propranolol, a beta adrenergic blocker prevents the blood alcohol (BAL) cycle in rats fed ethanol intragastrically at a constant rate by preventing the cyclic changes in the metabolic rate caused by fluctuating levels of norepinephrine released into the blood. The change in the rate of metabolism changes the rate of alcohol elimination in the blood which causes the BAL to cycle. Microarray analysis of the livers from the rats fed ethanol and propranolol showed similar changes in clusters of functionally related gene expressions. The controls and the trough of the cycle differed dramatically from the cluster pattern seen in the rats at the peaks of the blood alcohol cycle. The changes in gene expression induced by ethanol were similar when propranolol was fed without ethanol especially with the changes in the kinases and phosphatases, Toll-like receptor signaling and cytokine-cytokine receptor interaction were also changed. The changes in gene expression caused by ethanol and propranolol feeding are alike probably because both drugs induce β adrenergic receptor desensitization. PMID:19925788

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

PubMed

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

PubMed

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Confirmation of prior evidence of genetic susceptibility to alcoholism in a genome wide association study of comorbid alcoholism and bipolar disorder

PubMed Central

Lydall, Gregory J; Bass, Nicholas J; McQuillin, Andrew; Lawrence, Jacob; Anjorin, Adebayo; Kandaswamy, Radhika; Pereira, Ana; Guerrini, Irene; Curtis, David; Vine, Anna E; Sklar, Pamela; Purcell, Shaun M; Gurling, Hugh MD

2012-01-01

Objectives Alcoholism and affective disorders are both strongly comorbid and heritable. We have investigated the genetic comorbidity between bipolar affective disorder and alcoholism. Methods A genome-wide allelic association study of 506 patients from the University College London (UCL) bipolar disorder case control sample and 510 ancestrally-matched supernormal controls. 143 of the bipolar subjects fulfilled the research diagnostic criteria (RDC) diagnosis of alcoholism. 372,193 single nucleotide polymorphisms (SNPs) were genotyped. Genes previously shown to be associated with alcoholism and addiction phenotypes were then tested for association in the bipolar alcoholic sample using gene wise permutation tests of all SNPs genotyped within a 50kb region flanking each gene. Results Several CNS genes showed significant (p<0.05) gene wise evidence of association with bipolar alcoholism. The genes implicated which replicated previously identified associations with alcoholism were: cadherin 11 (CDH11), collagen type XI alpha 2 (COL11A2), neuromedin U receptor 2 (NMUR2), exportin7 (XP07) and semaphorin associated protein 5A (SEMA5A). The SNPs most strongly implicated in bipolar alcoholism, but which did not meet conventional genome-wide significance criteria were the insulin-like growth factor binding protein 7 (IGFBP7), carboxypeptidase O (CPO), cerebellin 2 (CBLN2), and the cadherin 12 (CDH12) genes. Conclusions We have confirmed the role of some genes previously shown to be associated with alcoholism in the comorbid bipolar alcoholism subgroup. In this subgroup bipolar disorder may lower the threshold for the phenotypic expression of these alcoholism susceptibility genes. We also show that some genes may independently increase susceptibility to affective disorder and alcoholism. PMID:21876473

NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology

PubMed Central

Ushio-Fukai, Masuko; Malik, Asrar B.

2009-01-01

Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Comparative in Silico Analysis of Ferric Reduction Oxidase (FRO) Genes Expression Patterns in Response to Abiotic Stresses, Metal and Hormone Applications.

PubMed

Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming

2018-05-12

The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Treesearch

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Gibberellin metabolism in Vitis vinifera L. during bloom and fruit-set: functional characterization and evolution of grapevine gibberellin oxidases

PubMed Central

Giacomelli, Lisa

2013-01-01

Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

PubMed

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Three TaFAR genes function in the biosynthesis of primary alcohols and the response to abiotic stresses in Triticum aestivum

PubMed Central

Wang, Meiling; Wang, Yong; Wu, Hongqi; Xu, Jing; Li, Tingting; Hegebarth, Daniela; Jetter, Reinhard; Chen, Letian; Wang, Zhonghua

2016-01-01

Cuticular waxes play crucial roles in protecting plants against biotic and abiotic stresses. They are complex mixtures of very-long-chain fatty acids and their derivatives, including C20–C32 fatty alcohols. Here, we report the identification of 32 FAR-like genes and the detailed characterization of TaFAR2, TaFAR3 and TaFAR4, wax biosynthetic genes encoding fatty acyl-coenzyme A reductase (FAR) in wheat leaf cuticle. Heterologous expression of the three TaFARs in wild-type yeast and mutated yeast showed that TaFAR2, TaFAR3 and TaFAR4 were predominantly responsible for the accumulation of C18:0, C28:0 and C24:0 primary alcohols, respectively. Transgenic expression of the three TaFARs in tomato fruit and Arabidopsis cer4 mutant led to increased production of C22:0–C30:0 primary alcohols. GFP-fusion protein injection assay showed that the three encoded TaFAR proteins were localized to the endoplasmic reticulum (ER), the site of wax biosynthesis. The transcriptional expression of the three TaFAR genes was induced by cold, salt, drought and ABA. Low air humidity led to increased expression of TaFAR genes and elevated wax accumulation in wheat leaves. Collectively, these data suggest that TaFAR2, TaFAR3 and TaFAR4 encode active alcohol-forming FARs involved in the synthesis of primary alcohol in wheat leaf and the response to environmental stresses. PMID:27112792

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6

Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822

NADPH oxidase inhibitors: a patent review.

PubMed

Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

2011-08-01

NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

Education and alcohol use: A study of gene-environment interaction in young adulthood.

PubMed

Barr, Peter B; Salvatore, Jessica E; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J; Kaprio, Jaakko; Dick, Danielle M

2016-08-01

The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N = 3402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one's position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Education and Alcohol Use: A Study of Gene-Environment Interaction in Young Adulthood

PubMed Central

Barr, Peter B.; Salvatore, Jessica E.; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J.; Kaprio, Jaakko; Dick, Danielle M.

2016-01-01

The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N=3,402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one’s position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. PMID:27367897

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

PubMed

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs.

PubMed

Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu

2014-03-11

Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning

Self-regulatory failure and the perpetration of adolescent dating violence: Examining an alcohol use by gene explanation.

PubMed

Foshee, Vangie A; Benefield, Thad S; Puvanesarajah, Samantha; Reyes, Heath Luz McNaughton; Haberstick, Brett C; Smolen, Andrew; Ennett, Susan T; Suchindran, Chirayath

2015-03-01

Studies report that alcohol use is related to partner violence, but for many, alcohol use does not culminate in violence against partners. Guided by a self-regulatory failure framework, we predicted that alcohol use would be more strongly associated with dating violence perpetration among adolescents with genotypes linked to impulsivity and emotional reactivity. The hypothesis was tested using random coefficient modeling of data from a multi-wave longitudinal study spanning grades 8-12 (ages 13-18) (n = 1,475). Analyses adjusted for multiple testing and race, and the potential for gene by environment correlation was examined. As predicted, alcohol use was more strongly associated with dating violence among adolescents who had a high rather than a low multilocus genetic profile composed of five genetic markers that influence dopamine signaling. Alcohol use was more strongly related to dating violence among boys with long rather than short 5-HTTLPR alleles, the opposite of the prediction. MAOA-uVNTR did not interact with alcohol, but it had a main effect on dating violence by boys in later grades in the expected direction: boys with more low activity alleles perpetrated more dating violence. Exploratory analyses found variation in findings by race. Our findings demonstrate the importance of incorporating genes into etiological studies of adolescent dating violence, which to date has not been done. Aggr. Behav. Aggr. Behav. 42:189-203, 2015. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.

[Relationship between the Fnu4HI site polymorphism of monoamine oxidase A gene and Parkinson's disease].

PubMed

Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao

2003-06-01

To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.

The CRHR1 Gene, Trauma Exposure, and Alcoholism Risk: A Test of G × E Effects

PubMed Central

Ray, Lara A.; Sehl, Mary; Bujarski, Spencer; Hutchison, Kent; Blaine, Sara; Enoch, Mary-Anne

2014-01-01

The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. Based on the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and SNPs in predicting the risk for alcoholism. Phenotypic data on 2,533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment (SAGE) genome-wide association study (GWAS). Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes / SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (p = 0.029) and two haplotypes in the distal block 2 (p = 0.026, 0.042) that showed nominally significant (corrected p < .025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (p = 0.019) and rs242924 (p = 0.019). In block 2, rs17689966 (p = 0.018) showed significant, and rs173365 (p = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic CRF system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. PMID:23473364

The CRHR1 gene, trauma exposure, and alcoholism risk: a test of G × E effects.

PubMed

Ray, L A; Sehl, M; Bujarski, S; Hutchison, K; Blaine, S; Enoch, M-A

2013-06-01

The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. On the basis of the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and single-nucleotide polymorphisms (SNPs) in predicting the risk for alcoholism. Phenotypic data on 2533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment genome-wide association study. Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes/SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (P = 0.029) and two haplotypes in the distal block 2 (P = 0.026, 0.042) that showed nominally significant (corrected P < 0.025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (P = 0.019) and rs242924 (P = 0.019). In block 2, rs17689966 (P = 0.018) showed significant and rs173365 (P = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic corticotropin-releasing factor system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

PubMed

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281

Genetic polymorphisms of ADH1B, ADH1C and ALDH2 in Turkish alcoholics: lack of association with alcoholism and alcoholic cirrhosis.

PubMed

Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih

2015-05-17

No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population.

Gene Expression in Brain and Liver Produced by Three Different Regimens of Alcohol Consumption in Mice: Comparison with Immune Activation

PubMed Central

Osterndorff-Kahanek, Elizabeth; Ponomarev, Igor; Blednov, Yuri A.; Harris, R. Adron

2013-01-01

Chronically available alcohol escalates drinking in mice and a single injection of the immune activator lipopolysaccharide can mimic this effect and result in a persistent increase in alcohol consumption. We hypothesized that chronic alcohol drinking and lipopolysaccharide injections will produce some similar molecular changes that play a role in regulation of alcohol intake. We investigated the molecular mechanisms of chronic alcohol consumption or lipopolysaccharide insult by gene expression profiling in prefrontal cortex and liver of C57BL/6J mice. We identified similar patterns of transcriptional changes among four groups of animals, three consuming alcohol (vs water) in different consumption tests and one injected with lipopolysaccharide (vs. vehicle). The three tests of alcohol consumption are the continuous chronic two bottle choice (Chronic), two bottle choice available every other day (Chronic Intermittent) and limited access to one bottle of ethanol (Drinking in the Dark). Gene expression changes were more numerous and marked in liver than in prefrontal cortex for the alcohol treatments and similar in the two tissues for lipopolysaccharide. Many of the changes were unique to each treatment, but there was significant overlap in prefrontal cortex for Chronic-Chronic Intermittent and for Chronic Intermittent-lipopolysaccharide and in liver all pairs showed overlap. In silico cell-type analysis indicated that lipopolysaccharide had strongest effects on brain microglia and liver Kupffer cells. Pathway analysis detected a prefrontal cortex-based dopamine-related (PPP1R1B, DRD1, DRD2, FOSB, PDNY) network that was highly over-represented in the Chronic Intermittent group, with several genes from the network being also regulated in the Chronic and lipopolysaccharide (but not Drinking in the Dark) groups. Liver showed a CYP and GST centered metabolic network shared in part by all four treatments. We demonstrate common consequences of chronic alcohol consumption and

[Involvement of hydrogen peroxide in the regulation of coexpression of alternative oxidase and rotenone-insensitive NADH dehydrogenase in tomato leaves and calluses].

PubMed

Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N

2011-01-01

The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.

Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

PubMed

Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

2001-05-01

Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

Alcohol Alert: Genetics of Alcoholism

MedlinePlus

... Reilly, M.T.; et al. Mpdz is a quantitative trait gene for drug withdrawal seizures. Nature Neuroscience 7(7):699–700, 2014. PMID: 15208631 . 12 Hurley, T.D., and Edenberg, H.J. Genes encoding enzymes involved in ethanol metabolism. Alcohol Research & Health 34:339–344, 2012 13 Yokoyama, A.; ...

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

In vitro expression of Candida albicans alcohol dehydrogenase genes involved in acetaldehyde metabolism.

PubMed

Bakri, M M; Rich, A M; Cannon, R D; Holmes, A R

2015-02-01

Alcohol consumption is a risk factor for oral cancer, possibly via its conversion to acetaldehyde, a known carcinogen. The oral commensal yeast Candida albicans may be one of the agents responsible for this conversion intra-orally. The alcohol dehydrogenase (Adh) family of enzymes are involved in acetaldehyde metabolism in yeast but, for C. albicans it is not known which family member is responsible for the conversion of ethanol to acetaldehyde. In this study we determined the expression of mRNAs from three C. albicans Adh genes (CaADH1, CaADH2 and CaCDH3) for cells grown in different culture media at different growth phases by Northern blot analysis and quantitative reverse transcription polymerase chain reaction. CaADH1 was constitutively expressed under all growth conditions but there was differential expression of CaADH2. CaADH3 expression was not detected. To investigate whether CaAdh1p or CaAdh2p can contribute to alcohol catabolism in C. albicans, each gene from the reference strain C. albicans SC5314 was expressed in Saccharomyces cerevisiae. Cell extracts from an CaAdh1p-expressing S. cerevisiae recombinant, but not an CaAdh2p-expressing recombinant, or an empty vector control strain, possessed ethanol-utilizing Adh activity above endogenous S. cerevisiae activity. Furthermore, expression of C. albicans Adh1p in a recombinant S. cerevisiae strain in which the endogenous ScADH2 gene (known to convert ethanol to acetaldehyde in this yeast) had been deleted, conferred an NAD-dependent ethanol-utilizing, and so acetaldehyde-producing, Adh activity. We conclude that CaAdh1p is the enzyme responsible for ethanol use under in vitro growth conditions, and may contribute to the intra-oral production of acetaldehyde. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Norrie disease gene is distinct from the monoamine oxidase genes.

PubMed

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Genetic risk prediction and neurobiological understanding of alcoholism.

PubMed

Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefer, F; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B

2014-05-20

We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG  (n=135 genes, 713 SNPs) was used to generate a genetic  risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating  alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. A panel of all the nominally significant P-value single-nucleotide length polymorphisms (SNPs) in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) were used to generate a Genetic Risk Prediction Score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol-dependent individuals from controls in an independent German test cohort. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress

Genetic research: who is at risk for alcoholism.

PubMed

Foroud, Tatiana; Edenberg, Howard J; Crabbe, John C

2010-01-01

The National Institute on Alcohol Abuse and Alcoholism (NIAAA) was founded 40 years ago to help elucidate the biological underpinnings of alcohol dependence, including the potential contribution of genetic factors. Twin, adoption, and family studies conclusively demonstrated that genetic factors account for 50 to 60 percent of the variance in risk for developing alcoholism. Case-control studies and linkage analyses have helped identify DNA variants that contribute to increased risk, and the NIAAA-sponsored Collaborative Studies on Genetics of Alcoholism (COGA) has the expressed goal of identifying contributing genes using state-of-the-art genetic technologies. These efforts have ascertained several genes that may contribute to an increased risk of alcoholism, including certain variants encoding alcohol-metabolizing enzymes and neurotransmitter receptors. Genome-wide association studies allowing the analysis of millions of genetic markers located throughout the genome will enable discovery of further candidate genes. In addition to these human studies, genetic animal models of alcohol's effects and alcohol use have greatly advanced our understanding of the genetic basis of alcoholism, resulting in the identification of quantitative trait loci and allowing for targeted manipulation of candidate genes. Novel research approaches-for example, into epigenetic mechanisms of gene regulation-also are under way and undoubtedly will further clarify the genetic basis of alcoholism.

An overview of the genetic susceptibility to alcoholism.

PubMed

Buscemi, Loredana; Turchi, Chiara

2011-01-01

Alcoholism is a multifactorial, genetically influenced disorder. It is a major health and social issue, a highly frequent disease and a cause of premature death. It is also the most expensive addictive disorder due to morbidity, mortality, societal and legal problems. Besides their involvement in alcohol-related fatalities, forensic scientists are also required to assess driving and working ability as well as permanent invalidity due to alcohol-related conditions. Greater knowledge of the genetic basis of alcoholism could improve prevention by identifying specific risk factors and mechanisms, leading to effective therapeutic strategies and eventually to personalized treatments. This overview of the recent scientific literature on the genetic basis of alcoholism summarizes the analytical strategies currently applied to the identification of candidate genes involved in alcohol-use disorders (AUDs) and discusses some genes and related phenotypes that have been shown to influence the risk of alcoholism. Alcoholism is a complex heterogeneous genetic disease. It is a quantitative disorder, in which the combined incidence of multiple genetic factors and environmental factors varies from one subject to another. Family, twin and adoption studies indicate that 50-60% of the risk of alcoholism is due to genetic factors. Risk loci for AUDs include both genes involved in alcohol pharmacokinetics and pharmacodynamics as well as genes moderating neurophysiological responses such as impulsivity, disinhibition, sensation-seeking and externalizing behaviours. Alcoholism also co-exists with other addictions and psychiatric disorders. Such co-morbidity suggests the existence of shared aetiological factors. Despite several genes that influence the risk for AUDs having been identified, the genetic bases of alcoholism remain largely unknown. Particularly the mechanism of action or the understanding of the physiology of some genes, as well as the gene-environment interactions, is still

[Polymorphism of alcohol dehydrogenase gene ADH1B in eastern Slavic and Iranian-speaking populations].

PubMed

2005-11-01

Frequencies of alleles and genotypes for alcohol dehydrogenase gene ADH1B (arg47his polymorphism), associated with alcohol tolerance/sensitivity, were determined. It was demonstrated that the frequency of allele ADH1B*47his, corresponding to atypical alcohol dehydrogenase variant in Russians, Ukrainians, Iranians, and mountain-dwellers of the Pamirs constituted 3, 7, 24, and 22%, respectively. The frequencies established were consistent with the allele frequency distribution pattern among the populations of Eurasia. Russians and Ukrainians were indistinguishable from other European populations relative to the frequency of allele ADH1B*47his, and consequently, relative to specific features of ethanol metabolic pathways. The data obtained provide refinement of the geographic pattern of ADH1B*47his frequency distribution in Eurasia.

Common polymorphisms in interleukin genes (IL4, IL6, IL8 and IL12) are not associated with alcoholic liver disease or alcoholism in Spanish men.

PubMed

Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco-Javier

2009-03-01

Preliminary data suggest that polymorphisms in cytokine genes may be involved in the genetic predisposition to alcoholic liver cirrhosis or alcohol use disorders. We thus analyze the association between these diseases and the following polymorphisms: -33T>C IL4, -174 G>C IL6, -251 T>A IL8 and 1188 A>C IL12B. 258 male alcoholics (161 without liver disease and 97 with liver cirrhosis) and 101 healthy controls were genotyped for the above mentioned polymorphisms. We examined the relationship between genotype and allele frequencies and the presence of disease, as well as the correlation with combinations of putative pro-inflammatory genotypes. Haplotypes were inferred using the expectation-maximization algorithm and haplotype frequencies were compared. We found no statistically significant association between any of these polymorphisms or the combinations of pro-inflammatory polymorphisms and the risk of alcoholic liver cirrhosis or alcohol abuse or dependence. Haplotype analysis of the IL4 and IL12B polymorphisms did not show any statistical relationship either. Our results do not support the hypothesis that the analyzed polymorphisms confer differences in alcoholic liver cirrhosis or alcohol use disorders susceptibility.

Genetic risk prediction and neurobiological understanding of alcoholism

PubMed Central

Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B

2014-01-01

We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG  (n=135 genes, 713 SNPs) was used to generate a genetic  risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating  alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress-reactive animal model cross-validation. We also tested this small panel of genes in two other independent test cohorts from the United States, one with alcohol dependence (P=0.00012) and one with alcohol abuse (a less severe form of alcoholism; P=0.0094). SNCA by itself was able to separate alcoholics from controls in the alcohol-dependent cohort (P=0.000013) and the alcohol abuse

Targeting NADPH oxidases in vascular pharmacology

PubMed Central

Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the

Norrie disease gene is distinct from the monoamine oxidase genes

PubMed Central

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

MAOA expression predicts vulnerability for alcohol use.

PubMed

Cervera-Juanes, R; Wilhem, L J; Park, B; Lee, R; Locke, J; Helms, C; Gonzales, S; Wand, G; Jones, S R; Grant, K A; Ferguson, B

2016-04-01

The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12 months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naive subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared with control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios among the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse.

The relationship between rs3779084 in the dopa decarboxylase (DDC) gene and alcohol consumption is mediated by drinking motives in regular smokers.

PubMed

Kristjansson, Sean D; Agrawal, Arpana; Lessov-Schlaggar, Christina N; Madden, Pamela A F; Cooper, M Lynne; Bucholz, Kathleen K; Sher, Kenneth J; Lynskey, Michael T; Heath, Andrew C

2012-01-01

Motivational models of alcohol use propose that the motivation to consume alcohol is the final common pathway to its use. Both alcohol consumption and drinking motives are influenced by latent genetic factors that partially overlap. This study investigated whether drinking motives mediate the associations between alcohol consumption and 2 single-nucleotide polymorphisms (SNPs) from genes involved in serotonin (TPH2; rs1386496) and dopamine synthesis (DDC; rs3779084). Based on earlier work showing that enhancement and coping motives were heritable in regular smokers but not in nonregular smokers, we hypothesized these motives would mediate the relationships between alcohol consumption and these SNPs in regular smokers. Drinking motives data were available from 830 young adult female twins (n = 344 regular smokers and n = 486 never/nonregular smokers). We used confirmatory factor analyses to model enhancement, coping, and alcohol consumption factors and to conduct mediation analyses in the regular smoker and never/nonregular smoker groups. Our hypothesis was partially supported. The relationship between alcohol consumption and rs1386496 was not mediated by drinking motives in either group. However, in the regular smokers, the relationship between alcohol consumption and rs3779084 was mediated by enhancement and coping motives. Carriers of the rs3779084 minor allele who were regular smokers reported more motivation to consume alcohol. Given this pattern of results was absent in the never/nonregular smokers, our results are consistent with a gene × smoking status interaction. In regular smokers, variability at the locus marked by rs3779084 in the DDC gene appears to index biologically based individual differences in the motivation to consume alcohol to attain or improve a positive affective state or to relieve a negative one. These results could be because of increased sensitivity to the reinforcing effects of alcohol among minor allele carriers who smoke, which might

Sequence conservation from human to prokaryotes of Surf1, a protein involved in cytochrome c oxidase assembly, deficient in Leigh syndrome.

PubMed

Poyau, A; Buchet, K; Godinot, C

1999-12-03

The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.

Variation of types of alcoholism: review and subtypes identified in Han Chinese.

PubMed

Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Lu, Ru-Band

2014-01-03

Alcoholism, as it has been hypothesized, is caused by a highly heterogeneous genetic load. Since 1960, many reports have used the bio-psycho-social approach to subtype alcoholism; however, no subtypes have been genetically validated. We reviewed and compared the major single-gene, multiple-gene, and gene-to-gene interaction studies on alcoholism published during the past quarter-century, including many recent studies that have made contributions to the subtyping of alcoholism. Four subtypes of alcoholism have been reported: [1] pure alcoholism, [2] anxiety/depression alcoholism, [3] antisocial alcoholism, and [4] mixed alcoholism. Most of the important studies focused on three genes: DRD2, MAOA, and ALDH2. Therefore, our review focuses on these three genes. © 2013.

Gene network analysis shows immune-signaling and ERK1/2 as novel genetic markers for multiple addiction phenotypes: alcohol, smoking and opioid addiction.

PubMed

Reyes-Gibby, Cielito C; Yuan, Christine; Wang, Jian; Yeung, Sai-Ching J; Shete, Sanjay

2015-06-05

Addictions to alcohol and tobacco, known risk factors for cancer, are complex heritable disorders. Addictive behaviors have a bidirectional relationship with pain. We hypothesize that the associations between alcohol, smoking, and opioid addiction observed in cancer patients have a genetic basis. Therefore, using bioinformatics tools, we explored the underlying genetic basis and identified new candidate genes and common biological pathways for smoking, alcohol, and opioid addiction. Literature search showed 56 genes associated with alcohol, smoking and opioid addiction. Using Core Analysis function in Ingenuity Pathway Analysis software, we found that ERK1/2 was strongly interconnected across all three addiction networks. Genes involved in immune signaling pathways were shown across all three networks. Connect function from IPA My Pathway toolbox showed that DRD2 is the gene common to both the list of genetic variations associated with all three addiction phenotypes and the components of the brain neuronal signaling network involved in substance addiction. The top canonical pathways associated with the 56 genes were: 1) calcium signaling, 2) GPCR signaling, 3) cAMP-mediated signaling, 4) GABA receptor signaling, and 5) G-alpha i signaling. Cancer patients are often prescribed opioids for cancer pain thus increasing their risk for opioid abuse and addiction. Our findings provide candidate genes and biological pathways underlying addiction phenotypes, which may be future targets for treatment of addiction. Further study of the variations of the candidate genes could allow physicians to make more informed decisions when treating cancer pain with opioid analgesics.

Increased receptor for advanced glycation end product expression in the human alcoholic prefrontal cortex is linked to adolescent drinking.

PubMed

Vetreno, Ryan P; Qin, Liya; Crews, Fulton T

2013-11-01

Adolescence is characterized behaviorally by increased impulsivity and risk-taking that declines in parallel with maturation of the prefrontal cortex and executive function. In the brain, the receptor for advanced glycation end products (RAGE) is critically involved in neurodevelopment and neuropathology. In humans, the risk of alcoholism is greatly increased in those who begin drinking between 13 and 15years of age, and adolescents binge drink more than any other age group. We have previously found that alcoholism is associated with increased expression of neuroimmune genes. This manuscript tested the hypothesis that adolescent binge drinking upregulates RAGE and Toll-like receptor (TLR) 4 as well as their endogenous agonist, high-mobility group box 1 (HMGB1). Immunohistochemistry, Western blot, and mRNA analyses found that RAGE expression was increased in the human post-mortem alcoholic orbitofrontal cortex (OFC). Further, an earlier age of drinking onset correlated with increased expression of RAGE, TLR4, and HMGB1. To determine if alcohol contributed to these changes, we used an adolescent binge ethanol model in rats (5.0g/kg, i.g., 2-day on/2-day off from postnatal day [P] 25 to P55) and assessed neuroimmune gene expression. We found an age-associated decline of RAGE expression from late adolescence (P56) to young adulthood (P80). Adolescent intermittent ethanol exposure did not alter RAGE expression at P56, but increased RAGE in the young adult PFC (P80). Adolescent intermittent ethanol exposure also increased TLR4 and HMGB1 expression at P56 that persisted into young adulthood (P80). Assessment of young adult frontal cortex mRNA (RT-PCR) found increased expression of proinflammatory cytokines, oxidases, and neuroimmune agonists at P80, 25days after ethanol treatment. Together, these human and animal data support the hypothesis that an early age of drinking onset upregulates RAGE/TLR4-HMGB1 and other neuroimmune genes that persist into young adulthood and

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

PubMed Central

2014-01-01

Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays

PubMed Central

Vinu Mohan, A. M.; Windmiller, Joshua Ray; Mishra, Rupesh K.; Wang, Joseph

2017-01-01

The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan layer, along with an outer Nafion layer. The resulting microneedle-based enzyme electrode displays an interference-free ethanol detection in artificial interstitial fluid without compromising its sensitivity, stability and response time. The skin penetration ability and the efficaciousness of the biosensor performance towards subcutaneous alcohol monitoring was substantiated by the ex vivo mice skin model analysis. Our results reveal that the new microneedle sensor holds considerable promise for continuous non-invasive alcohol monitoring in real-life situations. PMID:28088750

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

PubMed Central

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Cognitive Function in Prepubertal Children with Obstructive Sleep Apnea: A Modifying Role for NADPH Oxidase p22 Subunit Gene Polymorphisms?

PubMed Central

Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan

2012-01-01

Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598

The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.

PubMed

Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul

2008-05-01

The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.

NADPH Oxidases in Vascular Pathology

PubMed Central

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474

Adaptive responses of heart and skeletal muscle to spermine oxidase overexpression: Evaluation of a new transgenic mouse model.

PubMed

Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela

2017-02-01

Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular basis of alcoholism.

PubMed

Most, Dana; Ferguson, Laura; Harris, R Adron

2014-01-01

Acute alcohol intoxication causes cellular changes in the brain that last for hours, while chronic alcohol use induces widespread neuroadaptations in the nervous system that can last a lifetime. Chronic alcohol use and the progression into dependence involve the remodeling of synapses caused by changes in gene expression produced by alcohol. The progression of alcohol use, abuse, and dependence can be divided into stages, which include intoxication, withdrawal, and craving. Each stage is associated with specific changes in gene expression, cellular function, brain circuits, and ultimately behavior. What are the molecular mechanisms underlying the transition from recreational use (acute) to dependence (chronic)? What cellular adaptations result in drug memory retention, leading to the persistence of addictive behaviors, even after prolonged drug abstinence? Research into the neurobiology of alcoholism aims to answer these questions. This chapter will describe the molecular adaptations caused by alcohol use and dependence, and will outline key neurochemical participants in alcoholism at the molecular level, which are also potential targets for therapy. © 2014 Elsevier B.V. All rights reserved.

Genetic Contribution to Alcohol Dependence: Investigation of a Heterogeneous German Sample of Individuals with Alcohol Dependence, Chronic Alcoholic Pancreatitis, and Alcohol-Related Cirrhosis

PubMed Central

Treutlein, Jens; Streit, Fabian; Juraeva, Dilafruz; Degenhardt, Franziska; Rietschel, Liz; Forstner, Andreas J.; Ridinger, Monika; Dukal, Helene; Foo, Jerome C.; Soyka, Michael; Maier, Wolfgang; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Müller-Myhsok, Bertram; Lucae, Susanne; Ising, Marcus; Stickel, Felix; Berg, Thomas; Roggenbuck, Ulla; Jöckel, Karl-Heinz; Scholz, Henrike; Zimmermann, Ulrich S.; Buch, Stephan; Sommer, Wolfgang H.; Spanagel, Rainer; Brors, Benedikt; Cichon, Sven; Mann, Karl; Kiefer, Falk; Hampe, Jochen; Rosendahl, Jonas; Nöthen, Markus M.; Rietschel, Marcella

2017-01-01

The present study investigated the genetic contribution to alcohol dependence (AD) using genome-wide association data from three German samples. These comprised patients with: (i) AD; (ii) chronic alcoholic pancreatitis (ACP); and (iii) alcohol-related liver cirrhosis (ALC). Single marker, gene-based, and pathway analyses were conducted. A significant association was detected for the ADH1B locus in a gene-based approach (puncorrected = 1.2 × 10−6; pcorrected = 0.020). This was driven by the AD subsample. No association with ADH1B was found in the combined ACP + ALC sample. On first inspection, this seems surprising, since ADH1B is a robustly replicated risk gene for AD and may therefore be expected to be associated also with subgroups of AD patients. The negative finding in the ACP + ALC sample, however, may reflect genetic stratification as well as random fluctuation of allele frequencies in the cases and controls, demonstrating the importance of large samples in which the phenotype is well assessed. PMID:28714907

Genetic Contribution to Alcohol Dependence: Investigation of a Heterogeneous German Sample of Individuals with Alcohol Dependence, Chronic Alcoholic Pancreatitis, and Alcohol-Related Cirrhosis.

PubMed

Treutlein, Jens; Frank, Josef; Streit, Fabian; Reinbold, Céline S; Juraeva, Dilafruz; Degenhardt, Franziska; Rietschel, Liz; Witt, Stephanie H; Forstner, Andreas J; Ridinger, Monika; Strohmaier, Jana; Wodarz, Norbert; Dukal, Helene; Foo, Jerome C; Hoffmann, Per; Herms, Stefan; Heilmann-Heimbach, Stefanie; Soyka, Michael; Maier, Wolfgang; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Müller-Myhsok, Bertram; Lucae, Susanne; Ising, Marcus; Stickel, Felix; Berg, Thomas; Roggenbuck, Ulla; Jöckel, Karl-Heinz; Scholz, Henrike; Zimmermann, Ulrich S; Buch, Stephan; Sommer, Wolfgang H; Spanagel, Rainer; Brors, Benedikt; Cichon, Sven; Mann, Karl; Kiefer, Falk; Hampe, Jochen; Rosendahl, Jonas; Nöthen, Markus M; Rietschel, Marcella

2017-07-17

The present study investigated the genetic contribution to alcohol dependence (AD) using genome-wide association data from three German samples. These comprised patients with: (i) AD; (ii) chronic alcoholic pancreatitis (ACP); and (iii) alcohol-related liver cirrhosis (ALC). Single marker, gene-based, and pathway analyses were conducted. A significant association was detected for the ADH1B locus in a gene-based approach ( p uncorrected = 1.2 × 10 -6 ; p corrected = 0.020). This was driven by the AD subsample. No association with ADH1B was found in the combined ACP + ALC sample. On first inspection, this seems surprising, since ADH1B is a robustly replicated risk gene for AD and may therefore be expected to be associated also with subgroups of AD patients. The negative finding in the ACP + ALC sample, however, may reflect genetic stratification as well as random fluctuation of allele frequencies in the cases and controls, demonstrating the importance of large samples in which the phenotype is well assessed.

A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of