Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa
2012-12-30
The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band
2007-05-01
Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.
Immobilization of Pichia pastoris cells containing alcohol oxidase activity
Maleknia, S; Ahmadi, H; Norouzian, D
2011-01-01
Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090
Crystal Structure of Alcohol Oxidase from Pichia pastoris
Valerius, Oliver; Feussner, Ivo; Ficner, Ralf
2016-01-01
FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908
2005-01-01
Spectral and catalytic properties of the flavoenzyme AAO (aryl-alcohol oxidase) from Pleurotus eryngii were investigated using recombinant enzyme. Unlike most flavoprotein oxidases, AAO does not thermodynamically stabilize a flavin semiquinone radical and forms no sulphite adduct. AAO catalyses the oxidative dehydrogenation of a wide range of unsaturated primary alcohols with hydrogen peroxide production. This differentiates the enzyme from VAO (vanillyl-alcohol oxidase), which is specific for phenolic compounds. Moreover, AAO is optimally active in the pH range of 5–6, whereas VAO has an optimum at pH 10. Kinetic studies showed that AAO is most active with p-anisyl alcohol and 2,4-hexadien-1-ol. AAO converts m- and p-chlorinated benzyl alcohols at a similar rate as it does benzyl alcohol, but introduction of a p-methoxy substituent in benzyl alcohol increases the reaction rate approx. 5-fold. AAO also exhibits low activity on aromatic aldehydes. 19F NMR analysis showed that fluorinated benzaldehydes are converted into the corresponding benzoic acids. Inhibition studies revealed that the AAO active site can bind a wide range of aromatic ligands, chavicol (4-allylphenol) and p-anisic (4-methoxybenzoic) acid being the best competitive inhibitors. Uncompetitive inhibition was observed with 4-methoxybenzylamine. The properties described above render AAO a unique oxidase. The possible mechanism of AAO binding and oxidation of substrates is discussed in the light of the results of the inhibition and kinetic studies. PMID:15813702
Analysis of monoamine oxidase A (MAOA) promoter polymorphism in Finnish male alcoholics.
Saito, Takuya; Lachman, Herbert M; Diaz, Libna; Hallikainen, Tero; Kauhanen, Jussi; Salonen, Jukka T; Ryynänen, Olli-Pekka; Karvonen, Matti K; Syvälahti, Erkka; Pohjalainen, Tiina; Hietala, Jarmo; Tiihonen, Jari
2002-03-15
Alterations in monoamine oxidase A (MAOA) expression and enzyme activity may be associated with alcoholism and impulsive behavior. Therefore, functional polymorphisms in the MAOA gene would be good candidates to consider in the interindividual differences that exist in the susceptibility to alcoholism. One variant that has been considered as a candidate in alcoholism is a repeat polymorphism in the MAOA gene promoter. We analyzed a cohort of Finnish males with either type 1 or type 2 alcoholism, as well as controls, for differences in the distribution of MAOA promoter alleles. Based on other studies, we postulated that type 2 alcoholism, which is associated with antisocial behavior, but not type 1 alcoholism, would be correlated with the inheritance of the low promoter activity allele. However, we failed to find a difference in allele distribution in type 1 and type 2 alcoholics. In addition, there was no difference in the allele distribution when each group of alcoholics was compared with controls. However, when both groups of alcoholics were pooled and compared with controls, the difference in allele distribution reached a trend towards significance. Our results suggest a minimal association between the MAOA low activity promoter alleles and alcoholism, regardless of the presence or absence of antisocial behavior. Interestingly, approximately 3% of type 2 alcoholics were found to be heterozygous for the MAOA promoter polymorphism. Since MAOA is X-linked, the heterozygotes are probable cases of Klinefelter's syndrome (47,XXY) suggesting that X-chromosome aneuploidy may increase the risk for developing type 2 alcoholism.
Stepwise Hydrogen Atom and Proton Transfers in Dioxygen Reduction by Aryl-Alcohol Oxidase.
Carro, Juan; Ferreira, Patricia; Martínez, Angel T; Gadda, Giovanni
2018-03-20
The mechanism of dioxygen reduction by the flavoenzyme aryl-alcohol oxidase was investigated with kinetic isotope, viscosity, and pL (pH/pD) effects in rapid kinetics experiments by stopped-flow spectrophotometry of the oxidative half-reaction of the enzyme. Double mixing of the enzyme in a stopped-flow spectrophotometer with [α- 2 H 2 ]- p-methoxybenzyl alcohol and oxygen at varying aging times established a slow rate constant of 0.0023 s -1 for the wash-out of the D atom from the N5 atom of the reduced flavin. Thus, the deuterated substrate could be used to probe the cleavage of the N-H bond of the reduced flavin in the oxidative half-reaction. A significant and pH-independent substrate kinetic isotope effect (KIE) of 1.5 between pH 5.0 and 8.0 demonstrated that H transfer is partially limiting the oxidative half-reaction of the enzyme; a negligible solvent KIE of 1.0 between pD 5.0 and 8.0 proved a fast H + transfer reaction that does not contribute to determining the flavin oxidation rates. Thus, a mechanism for dioxygen reduction in which the H atom originating from the reduced flavin and a H + from a solvent exchangeable site are transferred in separate kinetic steps is proposed. The spectroscopic and kinetic data presented also showed a lack of stabilization of transient flavin intermediates. The substantial differences in the mechanistic details of O 2 reduction by aryl-alcohol oxidase with respect to other alcohol oxidases like choline oxidase, pyranose 2-oxidase, and glucose oxidase further demonstrate the high level of versatility of the flavin cofactor in flavoenzymes.
Tamaru, Yoshiaki; Umezawa, Kiwamu; Yoshida, Makoto
2018-07-01
The aim of the study was to obtain information about the enzymatic properties of aryl-alcohol oxidase from the plant saprophytic basidiomycete Coprinopsis cinerea (rCcAAO), which is classified into the auxiliary activities family 3 subfamily 2 (AA3_2). The gene encoding AAO from the plant saprophytic basidiomycete Coprinopsis cinerea (CcAAO) was cloned, and the recombinant CcAAO (rCcAAO) was heterologously expressed in the methylotrophic yeast Pichia pastoris. The purified rCcAAO showed significant activity not only against trans,trans-2,4-hexadien-1-ol but also against a broad range of aromatic alcohols including aromatic compounds that were reported to be poor substrates for known AAOs. Moreover, site-directed mutagenesis analysis demonstrated that mutants with substitutions from leucine to phenylalanine and tryptophan at position 416 exhibited decreases of activity for aromatic alcohols but still maintained the activity for trans,trans-2,4-hexadien-1-ol. Leucine 416 in CcAAO contributes to the broad substrate specificity against various aromatic alcohols, which is useful for the production of hydrogen peroxide using this enzyme.
Alcohol biosensing by polyamidoamine (PAMAM)/cysteamine/alcohol oxidase-modified gold electrode.
Akin, Mehriban; Yuksel, Merve; Geyik, Caner; Odaci, Dilek; Bluma, Arne; Höpfner, Tim; Beutel, Sascha; Scheper, Thomas; Timur, Suna
2010-01-01
A highly stable and sensitive amperometric alcohol biosensor was developed by immobilizing alcohol oxidase (AOX) through Polyamidoamine (PAMAM) dendrimers on a cysteamine-modified gold electrode surface. Ethanol determination is based on the consumption of dissolved oxygen content due to the enzymatic reaction. The decrease in oxygen level was monitored at -0.7 V vs. Ag/AgCl and correlated with ethanol concentration. Optimization of variables affecting the system was performed. The optimized ethanol biosensor showed a wide linearity from 0.025 to 1.0 mM with 100 s response time and detection limit of (LOD) 0.016 mM. In the characterization studies, besides linearity some parameters such as operational and storage stability, reproducibility, repeatability, and substrate specificity were studied in detail. Stability studies showed a good preservation of the bioanalytical properties of the sensor, 67% of its initial sensitivity was kept after 1 month storage at 4 degrees C. The analytical characteristics of the system were also evaluated for alcohol determination in flow injection analysis (FIA) mode. Finally, proposed biosensor was applied for ethanol analysis in various alcoholic beverage as well as offline monitoring of alcohol production through the yeast cultivation. Copyright 2010 American Institute of Chemical Engineers
Wang, Tso-Jen; Huang, San-Yuan; Lin, Wei-Wen; Lo, Hsin-Yi; Wu, Pei-Lin; Wang, Yu-Shan; Wu, Yi-Syuan; Ko, Huei-Chen; Shih, Jean-Chen; Lu, Ru-Band
2007-01-30
Both monoamine oxidase A (MAOA) and dopamine D(2) receptor (DRD2) genes have been considered as candidate genes for antisocial personality disorder with alcoholism (Antisocial ALC) [Parsian, A., 1999. Sequence analysis of exon 8 of MAO-A gene in alcoholics with antisocial personality and normal controls. Genomics. 45, 290-295.; Samochowiec, J., Lesch, K.P., Rottmann, M., Smolka, M., Syagailo, Y.V., Okladnova, O., Rommelspacher, H., Winterer, G., Schmidt, L.G., Sander, T., 1999. Association of a regulatory polymorphism in the promoter region of the monoamine oxidase A gene with antisocial alcoholism. Psychiatry. Res. 86, 67-72.; Schmidt, L.vG., Sander, T., Kuhn, S., Smolka, M., Rommelspacher, H., Samochowiec, J., Lesch, K.P., 2000. Different allele distribution of a regulatory MAO-A gene promotor polymorphism in antisocial and anxious-depressive alcoholics. J. Neural .Transm. 107, 681-689.]. However, the association between alcoholism and MAOA or DRD2 gene has not been universally accepted [Lee, J.F., Lu, R.B., Ko, H.C., Chang, F.M., Yin, S.J., Pakstis, A.J., Kidd, K.K., 1999. No association between DRD(2) locus and alcoholism after controlling the ADH and ALDH genotypes in Chinese Han population. Alcohol. Clin. Exp. Res. 23, 592-599.; Lu, R.B., Lin, W.W., Lee, J.F., Ko, H.C., Shih, J.C., 2003. Neither antisocial personality disorder nor antisocial alcoholism association with MAOA gene among Han Chinese males in Taiwan. Alcohol. Clin. Exp. Res. 27, 889-893.]. Since dopamine is metabolized to 3,4-dihydroxyphenyl-acetaldehyde (DOPAL) via monoamine oxidase (MAO) [Westerink, B.H., de Vries, J.B., 1985. On the origin of dopamine and its metabolite in predominantly noradrenergic innervated brain areas. Brain. Res. 330, 164-166.], the interaction between MAOA and DRD2 genes might be related to Antisocial ALC. The present study aimed to determine whether Antisocial ALC might be associated with the possible interactions of DRD2 gene with MAOA gene. Of the 231 Han Chinese
van den Heuvel, Robert H. H.; Fraaije, Marco W.; Laane, Colja; van Berkel, Willem J. H.
1998-01-01
The regio- and stereospecific conversion of prochiral 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase was investigated. The enzyme was active, with 4-alkylphenols bearing aliphatic side chains of up to seven carbon atoms. Optimal catalytic efficiency occurred with 4-ethylphenol and 4-n-propylphenols. These short-chain 4-alkylphenols are stereoselectively hydroxylated to the corresponding (R)-1-(4′-hydroxyphenyl)alcohols (F. P. Drijfhout, M. W. Fraaije, H. Jongejan, W. J. H. van Berkel, and M. C. R. Franssen, Biotechnol. Bioeng. 59:171–177, 1998). (S)-1-(4′-Hydroxyphenyl)ethanol was found to be a far better substrate than (R)-1-(4′-hydroxyphenyl)ethanol, explaining why during the enzymatic conversion of 4-ethylphenol nearly no 4-hydroxyacetophenone is formed. Medium-chain 4-alkylphenols were exclusively converted by vanillyl-alcohol oxidase to the corresponding 1-(4′-hydroxyphenyl)alkenes. The relative cis-trans stereochemistry of these reactions was strongly dependent on the nature of the alkyl side chain. The enzymatic conversion of 4-sec-butylphenol resulted in two (4′-hydroxyphenyl)-sec-butene isomers with identical masses but different fragmentation patterns. We conclude that the water accessibility of the enzyme active site and the orientation of the hydrophobic alkyl side chain of the substrate are of major importance in determining the regiospecific and stereochemical outcome of vanillyl-alcohol oxidase-mediated conversions of 4-alkylphenols. PMID:9791114
A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.
Hnaien, M; Lagarde, F; Jaffrezic-Renault, N
2010-04-15
A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. (c) 2009 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aliyu, S.U.; Upahi, L.
The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effectsmore » described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.« less
Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin
2016-09-01
Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.
Kjellander, Marcus; Götz, Kathrin; Liljeruhm, Josefine; Boman, Mats; Johansson, Gunnar
2013-04-01
Alcohol oxidase from Pichia pastoris was immobilized on nanoporous aluminium oxide membranes by silanization and activation by carbonyldiimidazole to create a flow-through enzyme reactor. Kinetic analysis of the hydrogen peroxide generation was carried out for a number of alcohols using a subsequent reaction with horseradish peroxidase and ABTS. The activity data for the immobilized enzyme showed a general similarity with literature data in solution, and the reactor could generate 80 mmol H2O2/h per litre reactor volume. Horseradish peroxidase was immobilized by the same technique to construct bienzymatic modular reactors. These were used in both single pass mode and circulating mode. Pulsed injections of methanol resulted in a linear relation between response and concentration, allowing quantitative concentration measurement. The immobilized alcohol oxidase retained 58 % of initial activity after 3 weeks of storage and repeated use.
Performance of optical biosensor using alcohol oxidase enzyme for formaldehyde detection
NASA Astrophysics Data System (ADS)
Sari, A. P.; Rachim, A.; Nurlely, Fauzia, V.
2017-07-01
The recent issue in the world is the long exposure of formaldehyde which is can increase the risk of human health, therefore, that is very important to develop a device and method that can be optimized to detect the formaldehyde elements accurately, have a long lifetime and can be fabricated and produced in large quantities. A new and simple prepared optical biosensor for detection of formaldehyde in aqueous solutions using alcohol oxidase (AOX) enzyme was successfully fabricated. The poly-n-butyl acrylic-co-N-acryloxysuccinimide (nBA-NAS) membranes containing chromoionophore ETH5294 were used for immobilization of alcohol oxidase enzyme (AOX). Biosensor response was based on the colour change of chromoionophore as a result of enzymatic oxidation of formaldehyde and correlated with the detection concentration of formaldehyde. The performance of biosensor parameters were measured through the optical absorption value using UV-Vis spectrophotometer including the repeatability, reproducibility, selectivity and lifetime. The results showed that the prepared biosensor has good repeatability (RSD = 1.9 %) and good reproducibility (RSD = 2.1 %). The biosensor was selective formaldehyde with no disturbance by methanol, ethanol, and acetaldehyde, and also stable before 49 days and decrease by 41.77 % after 49 days.
Condino-Neto, A; Whitney, C; Newburger, P E
1998-11-01
We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
Fungal aryl-alcohol oxidase: a peroxide-producing flavoenzyme involved in lignin degradation.
Hernández-Ortega, Aitor; Ferreira, Patricia; Martínez, Angel T
2012-02-01
Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein providing the H(2)O(2) required by ligninolytic peroxidases for fungal degradation of lignin, the key step for carbon recycling in land ecosystems. O(2) activation by Pleurotus eryngii AAO takes place during the redox-cycling of p-methoxylated benzylic metabolites secreted by the fungus. Only Pleurotus AAO sequences were available for years, but the number strongly increased recently due to sequencing of different basidiomycete genomes, and a comparison of 112 GMC (glucose-methanol-choline oxidase) superfamily sequences including 40 AAOs is presented. As shown by kinetic isotope effects, alcohol oxidation by AAO is produced by hydride transfer to the flavin, and hydroxyl proton transfer to a base. Moreover, site-directed mutagenesis studies showed that His502 activates the alcohol substrate by proton abstraction, and this result was extended to other GMC oxidoreductases where the nature of the base was under discussion. However, in contrast with that proposed for GMC oxidoreductases, the two transfers are not stepwise but concerted. Alcohol docking at the buried AAO active site resulted in only one catalytically relevant position for concerted transfer, with the pro-R α-hydrogen at distance for hydride abstraction. The expected hydride-transfer stereoselectivity was demonstrated, for the first time in a GMC oxidoreductase, by using the (R) and (S) enantiomers of α-deuterated p-methoxybenzyl alcohol. Other largely unexplained aspects of AAO catalysis (such as the unexpected specificity on substituted aldehydes) can also be explained in the light of the recent results. Finally, the biotechnological interest of AAO in flavor production is extended by its potential in production of chiral compounds taking advantage from the above-described stereoselectivity.
Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.
2012-01-01
Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa
Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.
1996-01-01
Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590
Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold
2016-10-01
The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions. Copyright © 2016 Elsevier Inc. All rights reserved.
Molecular evolution of the polyamine oxidase gene family in Metazoa
2012-01-01
Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including
Molecular evolution of the polyamine oxidase gene family in Metazoa.
Polticelli, Fabio; Salvi, Daniele; Mariottini, Paolo; Amendola, Roberto; Cervelli, Manuela
2012-06-20
Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs) from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO), it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported monophyletic clades including, respectively, all
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene
Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji
2001-01-01
We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947
Van Hellemond, J J; Simons, B; Millenaar, F F; Tielens, A G
1998-01-01
The constituents of the respiratory chain are believed to differ among the trypanosomatids; bloodstream stages of African trypanosomes and Phytomonas promastigotes oxidize ubiquinol by a ubiquinol:oxygen oxidoreductase, also known as alternative oxidase, whereas Leishmania spp. oxidize ubiquinol via a classic cytochrome-containing respiratory chain. The molecular basis for this elementary difference in ubiquinol oxidation by the mitochondrial electron-transport chain in distinct trypanosomatids was investigated. The presence of a gene encoding the plant-like alternative oxidase could be demonstrated in Phytomonas and Trypanosoma brucei, trypanosomatids that are known to contain alternative oxidase activity. Our results further demonstrated that Leishmania spp. lack a gene encoding the plant-like alternative oxidase, and therefore, all stages of Leishmania spp. will lack the alternative oxidase protein. The observed fundamental differences between the respiratory chains of distinct members of the trypanosomatid family are thus caused by the presence or absence of a gene encoding the plant-like alternative oxidase.
Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry
2015-01-01
Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532
Dijkman, Willem P.
2014-01-01
In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187
Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism.
Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela
2011-08-18
Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?
Kües, Ursula; Rühl, Martin
2011-01-01
Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246
MAOA interacts with the ALDH2 gene in anxiety-depression alcohol dependence.
Lee, Sheng-Yu; Hahn, Cheng-Yi; Lee, Jia-Fu; Huang, San-Yuan; Chen, Shiou-Lan; Kuo, Po-Hsiu; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Chen, Shih-Heng; Ko, Huei-Chen; Lu, Ru-Band
2010-07-01
Alcohol dependence is usually comorbid with anxiety disorder, depressive disorder, or both; this comorbidity may increase drinking behavior. We previously hypothesized that anxiety-depressive alcohol dependence (ANX/DEP ALC) was a genetically specific subtype of alcohol dependence. ANX/DEP ALC may be related to dopamine and serotonin, which are catalyzed by monoamine oxidase A (MAOA) and acetaldehyde dehydrogenase 2 (ALDH2). The aim of this study was to determine whether the interaction between the MAOA and the ALDH2 genes is associated with ANX/DEP ALC. We recruited 383 Han Chinese men in Taiwan: 143 ANX/DEP ALC and 240 healthy controls. The diagnosis of ANX/DEP ALC (alcohol dependence with a past or current history of anxiety, depressive disorder, or both) was made using DSM-IV criteria. Genotypes of ALDH2 and MAOA-uVNTR (variable number of tandem repeat located upstream) were determined using PCR-RFLP. The ALDH2, but not the MAOA-uVNTR, polymorphism was associated with ANX/DEP ALC. After stratifying the MAOA-uVNTR polymorphism, we found a stronger association between the ALDH2*1/*2 and *2/*2 genotypes and the controls in the MAOA-uVNTR 4-repeat subgroup. Logistic regression significantly associated the interaction between ALDH2 and MAOA variants with ANX/DEP ALC. We conclude that the MAOA and ALDH2 genes interact in ANX/DEP ALC. Although the MAOA gene alone is not associated with ANX/DEP ALC, we hypothesize that different variants of MAOA-uVNTR polymorphisms modify the protective effects of the ALDH2*2 allele on ANX/DEP ALC in Han Chinese in Taiwan.
Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab
2014-05-15
Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. © 2013 Published by Elsevier B.V.
Neuroimmune Basis of Alcoholic Brain Damage
Crews, Fulton T.; Vetreno, Ryan P.
2017-01-01
Alcohol-induced brain damage likely contributes to the dysfunctional poor decisions associated with alcohol dependence. Human alcoholics have a global loss of brain volume that is most severe in the frontal cortex. Neuroimmune gene induction by binge drinking increases neurodegeneration through increased oxidative stress, particularly NADPH oxidase-induced oxidative stress. In addition, HMGB1-TLR4 and innate immune NF-κB target genes are increased leading to persistent and sensitized neuroimmune responses to ethanol and other agents that release HMGB1 or directly stimulate TLR receptors and/or NMDA receptors. Neuroimmune signaling and glutamate excitotoxicity are linked to alcoholic neurodegeneration. Models of adolescent alcohol abuse lead to significant frontal cortical degeneration and show the most severe loss of hippocampal neurogenesis. Adolescence is a period of high risk for ethanol-induced neurodegeneration and alterations in brain structure, gene expression, and maturation of adult phenotypes. Together, these findings support the hypothesis that adolescence is a period of risk for persistent and long-lasting increases in brain neuroimmune gene expression that promote persistent and long-term increases in alcohol consumption, neuroimmune gene induction, and neurodegeneration that we find associated with alcohol use disorders. PMID:25175868
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells
Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias
2016-01-01
The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells
Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; ...
2016-03-01
The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin
The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.
Alcohol-Induced Histone Acetylation Reveals a Gene Network Involved in Alcohol Tolerance
Ghezzi, Alfredo; Krishnan, Harish R.; Lew, Linda; Prado, Francisco J.; Ong, Darryl S.; Atkinson, Nigel S.
2013-01-01
Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol. PMID:24348266
Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy
Vonck, Janet; Parcej, David N.; Mills, Deryck J.
2016-01-01
The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710
Alcoholism and alternative splicing of candidate genes.
Sasabe, Toshikazu; Ishiura, Shoichi
2010-04-01
Gene expression studies have shown that expression patterns of several genes have changed during the development of alcoholism. Gene expression is regulated not only at the level of transcription but also through alternative splicing of pre-mRNA. In this review, we discuss some of the evidence suggesting that alternative splicing of candidate genes such as DRD2 (encoding dopamine D2 receptor) may form the basis of the mechanisms underlying the pathophysiology of alcoholism. These reports suggest that aberrant expression of splice variants affects alcohol sensitivities, and alcohol consumption also regulates alternative splicing. Thus, investigations of alternative splicing are essential for understanding the molecular events underlying the development of alcoholism.
Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab
2014-01-01
The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075
Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab
2014-01-01
The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application.
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gadda, G.; Orville, A.; Pennati, A.
2008-06-08
Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active sitemore » of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.« less
Isobe, Kimiyasu; Kawakami, Yoshimitsu
2007-03-09
A convection interaction media (trade name CIM, BIA Separation, Ljubljana, Slovenia) isobutyl monolithic disc was prepared by incubating a CIM epoxy monolithic disc with isobutylamine, and it was then applied to the purification of secondary alcohol dehydrogenase (S-ADH) and primary alcohol oxidase (P-AOD). Both enzymes were adsorbed on this column and eluted with high purity. Thus, S-ADH was purified to an electrophoretically homogeneous state by four column chromatographies using CIM DEAE-8 and CIM C4-8 tube monolithic columns, blue-Sepharose column and CIM isobutyl disc monolithic column. P-AOD was also purified to an electrophoretically homogeneous state by three column chromatographies of CIM DEAE-8 tube, CIM C4-8 tube and CIM isobutyl disc columns.
Characterization of two brassinosteroid C-6 oxidase genes in pea.
Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B
2007-04-01
C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea.
Genetic approaches to addiction: genes and alcohol
Ducci, Francesca; Goldman, David
2008-01-01
Aims Alcoholism is a chronic relapsing disorder with an enormous societal impact. Understanding the genetic basis of alcoholism is crucial to characterize individuals' risk and to develop efficacious prevention and treatment strategies. Methods We examined the available scientific literature to provide an overview of different approaches that are being integrated increasingly to advance our knowledge of the genetic bases of alcoholism. Examples of genes that have been shown to influence vulnerability to alcoholism and related phenotypes are also discussed. Results Genetic factors account for more than 50% of the variance in alcoholism liability. Susceptibility loci for alcoholism include both alcohol-specific genes acting either at the pharmacokinetic or pharmacodynamic levels, as well as loci moderating neuronal pathways such as reward, behavioral control and stress resiliency, that are involved in several psychiatric diseases. In recent years, major progress in gene identification has occurred using intermediate phenotypes such as task-related brain activation that confer the advantage of increased power and the opportunity of exploring the neuronal mechanisms through which genetic variation is translated into behavior. Fundamental to the detection of gene effects is also the understanding of the interplay between genes as well as genes/environment interactions. Whole Genome Association studies represent a unique opportunity to identify alcohol-related loci in hypothesis-free fashion. Finally, genome-wide analyses of transcripts and chromatin remodeling promise an increase in our understanding of the genome function and of the mechanisms through which gene and environment cause diseases. Conclusions Although the genetic bases of alcoholism remain largely unknown, there are reasons to think that more genes will be discovered in the future. Multiple and complementary approaches will be required to piece together the mosaic of causation. PMID:18422824
Alcoholism: genes and mechanisms.
Oroszi, Gabor; Goldman, David
2004-12-01
Alcoholism is a chronic relapsing/remitting disease that is frequently unrecognized and untreated, in part because of the partial efficacy of treatment. Only approximately one-third of patients remain abstinent and one-third have fully relapsed 1 year after withdrawal from alcohol, with treated patients doing substantially better than untreated [1]. The partial effectiveness of strategies for prevention and treatment, and variation in clinical course and side effects, represent a challenge and an opportunity to better understand the neurobiology of addiction. The strong heritability of alcoholism suggests the existence of inherited functional variants of genes that alter the metabolism of alcohol and variants of other genes that alter the neurobiologies of reward, executive cognitive function, anxiety/dysphoria, and neuronal plasticity. Each of these neurobiologies has been identified as a critical domain in the addictions. Functional alleles that alter alcoholism-related intermediate phenotypes include common alcohol dehydrogenase 1B and aldehyde dehydrogenase 2 variants that cause the aversive flushing reaction; catechol-O-methyltransferase (COMT) Val158Met leading to differences in three aspects of neurobiology: executive cognitive function, stress/anxiety response, and opioid function; opioid receptor micro1 (OPRM1) Asn40Asp, which may serve as a gatekeeper molecule in the action of naltrexone, a drug used in alcoholism treatment; and HTTLPR, which alters serotonin transporter function and appears to affect stress response and anxiety/dysphoria, which are factors relevant to initial vulnerability, the process of addiction, and relapse.
Palomo, Tomas; Kostrzewa, R M; Beninger, R J; Archer, T
2004-01-01
Factors that confer predisposition and vulnerability for alcoholism and other substance abuse disorders may be described usefully within the gene-environment interplay framework. Thus, it is postulated that heritability provides a major contribution not only to alcohol but also to other substances of abuse. Studies of evoked potential amplitude reduction have provided a highly suitable and testable method for the assessment of both environmentally-determined and heritable characteristics pertaining to substance use and dependence. The different personal attributes that may co-exist with parental influence or exist in a shared, monozygotic relationship contribute to the final expression of addiction. In this connection, it appears that personality disorders are highly prevalent co-morbid conditions among addicted individuals, and, this co-morbidity is likely to be accounted for by multiple complex etiological relationships, not least in adolescent individuals. Co-morbidity associated with deficient executive functioning may be observed too in alcohol-related aggressiveness and crimes of violence. The successful intervention into alcohol dependence and craving brought about by baclofen in both human and animal studies elucidates glutamatergic mechanisms in alcoholism whereas the role of the dopamine transporter, in conjunction with both the noradrenergic and serotonergic transporters, are implicated in cocaine dependence and craving. The role of the cannabinoids in ontogeny through an influence upon the expression of key genes for the development of neurotransmitter systems must be considered. Finally, the particular form of behaviour/characteristic outcome due to childhood circumstance may lie with biological, gene-based determinants, for example individual characteristics of monoamine oxidase (MAO) activity levels, thereby rendering simple predictive measures both redundant and misguiding.
Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab
2015-07-15
A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Lee, Sheng-Yu; Hahn, Cheng-Yi; Lee, Jia-Fu; Chen, Shiou-Lan; Chen, Shih-Heng; Yeh, Tzung Lieh; Kuo, Po-Hsiu; Lee, I Hui; Yang, Yen Kuang; Huang, San-Yuan; Ko, Huei-Chen; Lu, Ru-Band
2009-06-01
Antisocial alcoholism is related to dopamine and serotonin which are catalyzed by monoamine oxidase A (MAOA) and acetaldehyde dehydrogenase 2 (ALDH2). The objective of this study is to determine whether the interaction between the MAOA and the ALDH2 genes is associated with subjects with antisocial personality disorder (ASPD) having alcoholism. A total of 294 Han Chinese men in Taiwan including 132 ASPD with alcoholism (Antisocial ALC) and 162 without alcoholism (Antisocial Non-ALC) were recruited in this study. Alcohol dependence and ASPD were diagnosed according to DSM-IV criteria. Genotypes of ALDH2 and MAOA-uVNTR were determined using PCR-RFLP. A significant difference of ALDH2 polymorphisms (p = 3.39E-05), but not of MAOA, was found among the 2 study groups. However, only after the stratification of the MAOA-uVNTR (variable number of tandem repeat located upstream) 3-repeat, a significant association between Antisocial Non-ALC and ALDH2*1/*2 or *2/*2 genotypes was shown (p = 1.46E-05; odds ratio = 3.913); whereas stratification of MAOA-uVNTR 4-repeat revealed no association. Multiple logistic regression analysis further revealed significant interaction of MAOA and ALDH2 gene in antisocial ALC (odds ratio = 2.927; p = 0.032). The possible interaction of MAOA and ALDH2 gene is associated with Antisocial ALC in Han Chinese males in Taiwan. However, the protective effects of the ALDH2*2 allele against alcoholism might disappear in subjects with ASPD and carrying MAOA-uVNTR 4-repeat allele in the Han Chinese male population.
Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan
2010-01-01
In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125
Vergis, Nikhil; Khamri, Wafa; Beale, Kylie; Sadiq, Fouzia; Aletrari, Mina O; Moore, Celia; Atkinson, Stephen R; Bernsmeier, Christine; Possamai, Lucia A; Petts, Gemma; Ryan, Jennifer M; Abeles, Robin D; James, Sarah; Foxton, Matthew; Hogan, Brian; Foster, Graham R; O'Brien, Alastair J; Ma, Yun; Shawcross, Debbie L; Wendon, Julia A; Antoniades, Charalambos G; Thursz, Mark R
2017-03-01
In order to explain the increased susceptibility to serious infection in alcoholic hepatitis, we evaluated monocyte phagocytosis, aberrations of associated signalling pathways and their reversibility, and whether phagocytic defects could predict subsequent infection. Monocytes were identified from blood samples of 42 patients with severe alcoholic hepatitis using monoclonal antibody to CD14. Phagocytosis and monocyte oxidative burst (MOB) were measured ex vivo using flow cytometry, luminometry and bacterial killing assays. Defects were related to the subsequent development of infection. Intracellular signalling pathways were investigated using western blotting and PCR. Interferon-γ (IFN-γ) was evaluated for its therapeutic potential in reversing phagocytic defects. Paired longitudinal samples were used to evaluate the effect of in vivo prednisolone therapy. MOB, production of superoxide and bacterial killing in response to Escherichia coli were markedly impaired in patients with alcoholic hepatitis. Pretreatment MOB predicted development of infection within two weeks with sensitivity and specificity that were superior to available clinical markers. Accordingly, defective MOB was associated with death at 28 and 90 days. Expression of the gp91 phox subunit of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase was reduced in patients with alcoholic hepatitis demonstrating defective MOB. Monocytes were refractory to IFN-γ stimulation and showed high levels of a negative regulator of cytokine signalling, suppressor of cytokine signalling-1. MOB was unaffected by 7 days in vivo prednisolone therapy. Monocyte oxidative burst and bacterial killing is impaired in alcoholic hepatitis while bacterial uptake by phagocytosis is preserved. Defective MOB is associated with reduced expression of NADPH oxidase in these patients and predicts the development of infection and death. Published by the BMJ Publishing Group Limited. For permission to use (where not already
Genes contributing to the development of alcoholism: an overview.
Edenberg, Howard J
2012-01-01
Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.
Hu, Ming-Chuan; Lee, Sheng-Yu; Wang, Tzu-Yun; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band
2013-01-10
Several studies have hypothesized that genes involved in the dopamine system, including dopamine type-2 receptor (DRD2)-related TaqIA polymorphism and monoamine oxidase-A upstream variable number tandem repeat (uVNTR), may be associated with alcoholism. But their results were contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the DRD2TaqIA and MAOA-uVNTR gene polymorphisms are susceptibility factors for alcoholism comorbid with bipolar disorder (ALC+BP) in Han Chinese in Taiwan. We recruited 101 Han Chinese men with comorbid alcoholism and bipolar disorder, and 328 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequencies of the DRD2TaqIA or the MAOA-uVNTR polymorphisms between the 2 groups. The MAOA-uVNTR 3-repeat had a significant protective effect on the ALC+BP (odds ratio=0.432, p=0.035) but not on the healthy controls. However, the interaction between the MAOA-uVNTR 3-repeat and DRD2 A1/A2 was a risk factor in the ALC+BP (odds ratio=3.451, p=0.018). We indicated the impact of the association between MAOA-uVNTR 3-repeat and DRD2 A1/A2 with ALC+BP. Copyright © 2012 Elsevier Inc. All rights reserved.
Association of monoamine oxidase A gene polymorphism with Alzheimer's disease and Lewy body variant.
Takehashi, Masanori; Tanaka, Seigo; Masliah, Eliezer; Ueda, Kunihiro
2002-07-19
The association between (GT)n dinucleotide repeats in monoamine oxidase gene loci, monoamine oxidase A (MAOA) and B (MAOB), and Parkinson's disease (PD), Alzheimer's disease (AD), and Lewy body variant (LBV) of AD were determined. MAOA-GT polymorphisms were significantly associated with pure AD and LBV. MAOA-GT allele 113 was excessively represented in pure AD and LBV compared with controls. Furthermore, the frequency of females homozygous for MAOA-GT allele 113 was higher in pure AD and LBV than controls by 2.79- and 2.77-fold, respectively. In contrast, there was no association between MAOA-GT or MAOB-GT polymorphisms and PD. These results suggest that polymorphisms within the MAOA gene may have implication in AD pathology shared by pure AD and LBV.
MONOAMINE OXIDASE: From Genes to Behavior
Shih, J. C.; Chen, K.; Ridd, M. J.
2010-01-01
Cloning of MAO (monoamine oxidase) A and B has demonstrated unequivocally that these enzymes are made up of different polypeptides, and our understanding of MAO structure, regulation, and function has been significantly advanced by studies using their cDNA. MAO A and B genes are located on the X-chromosome (Xp11.23) and comprise 15 exons with identical intron-exon organization, which suggests that they are derived from the same ancestral gene. MAO A and B knockout mice exhibit distinct differences in neurotransmitter metabolism and behavior. MAO A knock-out mice have elevated brain levels of serotonin, norephinephrine, and dopamine and manifest aggressive behavior similar to human males with a deletion of MAO A. In contrast, MAO B knock-out mice do not exhibit aggression and only levels of phenylethylamine are increased. Mice lacking MAO B are resistant to the Parkinsongenic neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetra-hydropyridine. Both MAO A and B knock-out mice show increased reactivity to stress. These knock-out mice are valuable models for investigating the role of monoamines in psychoses and neurodegenerative and stress-related disorders. PMID:10202537
Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.
2014-01-01
Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264
Mechanisms of neuroimmune gene induction in alcoholism.
Crews, Fulton T; Vetreno, Ryan P
2016-05-01
Alcoholism is a primary, chronic relapsing disease of brain reward, motivation, memory, and related circuitry. It is characterized by an individual's continued drinking despite negative consequences related to alcohol use, which is exemplified by alcohol use leading to clinically significant impairment or distress. Chronic alcohol consumption increases the expression of innate immune signaling molecules (ISMs) in the brain that alter cognitive processes and promote alcohol drinking. Unraveling the mechanisms of alcohol-induced neuroimmune gene induction is complicated by positive loops of multiple cytokines and other signaling molecules that converge on nuclear factor kappa-light-chain-enhancer of activated B cells and activator protein-1 leading to induction of additional neuroimmune signaling molecules that amplify and expand the expression of ISMs. Studies from our laboratory employing reverse transcription polymerase chain reaction (RT-PCR) to assess mRNA, immunohistochemistry and Western blot analysis to assess protein expression, and others suggest that ethanol increases brain neuroimmune gene and protein expression through two distinct mechanisms involving (1) systemic induction of innate immune molecules that are transported from blood to the brain and (2) the direct release of high-mobility group box 1 (HMGB1) from neurons in the brain. Released HMGB1 signals through multiple receptors, particularly Toll-like receptor (TLR) 4, that potentiate cytokine receptor responses leading to a hyperexcitable state that disrupts neuronal networks and increases excitotoxic neuronal death. Innate immune gene activation in brain is persistent, consistent with the chronic relapsing disease that is alcoholism. Expression of HMGB1, TLRs, and other ISMs is increased several-fold in the human orbital frontal cortex, and expression of these molecules is highly correlated with each other as well as lifetime alcohol consumption and age of drinking onset. The persistent and
Johansson, K; Jönsson-Pettersson, G; Gorton, L; Marko-Varga, G; Csöregi, E
1993-12-01
A reagentless carbon paste electrode chemically modified with covalently bound alcohol oxidase and horse-radish peroxidase was examined as a selective sensor in flow injection and column liquid chromatography. A combination of carbodiimide, glutaraldehyde, and polyethyleneimine was used for immobilizing the enzymes in the paste. The surface of the electrodes was protected by first forming a layer of electropolymerized ortho-phenylenediamine followed by deposition of a cation exchange membrane (Eastman AQ 29D). The electrodes were used for detection of hydrogen peroxide, methanol, ethanol, propanol, isopropanol, and butanol. Preliminary investigations of the use of this sensor for bioprocess control are reported.
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
Ducci, F; Enoch, M-A; Hodgkinson, C; Xu, K; Catena, M; Robin, R W; Goldman, D
2008-03-01
Women who have experienced childhood sexual abuse (CSA) have an increased risk of alcoholism and antisocial personality disorder (ASPD). Among male subjects, a functional polymorphism (MAOA-LPR, monoamine oxidase A linked polymorphic region) in the promoter region of the monoamine oxidase A gene (MAOA) appears to moderate the effect of childhood maltreatment on antisocial behavior. Our aim was to test whether MAOA-LPR influences the impact of CSA on alcoholism and ASPD in a sample of 291 women, 50% of whom have experienced CSA; we also tested whether haplotypes covering the region where both MAOA and monoamine oxidase B (MAOB) genes are located predict risk of alcoholism and ASPD better than the MAOA-LPR locus alone. Participants included 168 alcoholics (39 with ASPD (antisocial alcoholics) and 123 controls (no alcoholics, no ASPD). Antisocial behavior was also modeled as a continuous trait: ASPD symptoms count. The MAOA-LPR low activity allele was associated with alcoholism (P=0.005), particularly antisocial alcoholism (P=0.00009), only among sexually abused subjects. Sexually abused women who were homozygous for the low activity allele had higher rates of alcoholism and ASPD, and more ASPD symptoms, than abused women homozygous for the high activity allele. Heterozygous women displayed an intermediate risk pattern. In contrast, there was no relationship between alcoholism/antisocial behavior and MAOA-LPR genotype among non-abused women. The MAOA-LPR low activity allele was found on three different haplotypes. The most abundant MAOA haplotype containing the MAOA-LPR low activity allele was found in excess among alcoholics (P=0.008) and antisocial alcoholics (P=0.001). Finally, a MAOB haplotype, which we termed haplotype C, was significantly associated with alcoholism (P=0.006), and to a lesser extent with antisocial alcoholism (P=0.03). In conclusions, MAOA seems to moderate the impact of childhood trauma on adult psychopathology in female subjects in the same way
Circadian genes, the stress axis, and alcoholism.
Sarkar, Dipak K
2012-01-01
The body's internal system to control the daily rhythm of the body's functions (i.e., the circadian system), the body's stress response, and the body's neurobiology are highly interconnected. Thus, the rhythm of the circadian system impacts alcohol use patterns; at the same time, alcohol drinking also can alter circadian functions. The sensitivity of the circadian system to alcohol may result from alcohol's effects on the expression of several of the clock genes that regulate circadian function. The stress response system involves the hypothalamus and pituitary gland in the brain and the adrenal glands, as well as the hormones they secrete, including corticotrophin-releasing hormone, adrenocorticotrophic hormone, and glucocorticoids. It is controlled by brain-signaling molecules, including endogenous opioids such as β-endorphin. Alcohol consumption influences the activity of this system and vice versa. Finally, interactions exist between the circadian system, the hypothalamic-pituitary-adrenal axis, and alcohol consumption. Thus, it seems that certain clock genes may control functions of the stress response system and that these interactions are affected by alcohol.
Ethanol modulation of gene networks: implications for alcoholism.
Farris, Sean P; Miles, Michael F
2012-01-01
Alcoholism is a complex disease caused by a confluence of environmental and genetic factors influencing multiple brain pathways to produce a variety of behavioral sequelae, including addiction. Genetic factors contribute to over 50% of the risk for alcoholism and recent evidence points to a large number of genes with small effect sizes as the likely molecular basis for this disease. Recent progress in genomics (microarrays or RNA-Seq) and genetics has led to the identification of a large number of potential candidate genes influencing ethanol behaviors or alcoholism itself. To organize this complex information, investigators have begun to focus on the contribution of gene networks, rather than individual genes, for various ethanol-induced behaviors in animal models or behavioral endophenotypes comprising alcoholism. This chapter reviews some of the methods used for constructing gene networks from genomic data and some of the recent progress made in applying such approaches to the study of the neurobiology of ethanol. We show that rapid technology development in gathering genomic data, together with sophisticated experimental design and a growing collection of analysis tools are producing novel insights for understanding the molecular basis of alcoholism and that such approaches promise new opportunities for therapeutic development. Copyright © 2011 Elsevier Inc. All rights reserved.
Genes and Alcohol Consumption: Studies with Mutant Mice
Mayfield, Jody; Arends, Michael A.; Harris, R. Adron; Blednov, Yuri A.
2017-01-01
In this chapter, we review the effects of global null mutant and overexpressing transgenic mouse lines on voluntary self-administration of alcohol. We examine approximately 200 publications pertaining to the effects of 155 mouse genes on alcohol consumption in different drinking models. The targeted genes vary in function and include neurotransmitter, ion channel, neuroimmune, and neuropeptide signaling systems. The alcohol self-administration models include operant conditioning, two- and four-bottle choice continuous and intermittent access, drinking in the dark limited access, chronic intermittent ethanol, and scheduled high alcohol consumption tests. Comparisons of different drinking models using the same mutant mice are potentially the most informative, and we will highlight those examples. More mutants have been tested for continuous two-bottle choice consumption than any other test; of the 137 mouse genes examined using this model, 97 (72%) altered drinking in at least one sex. Overall, the effects of genetic manipulations on alcohol drinking often depend on the sex of the mice, alcohol concentration and time of access, genetic background, as well as the drinking test. PMID:27055617
USDA-ARS?s Scientific Manuscript database
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...
The genetics of alcoholism: identifying specific genes through family studies.
Edenberg, Howard J; Foroud, Tatiana
2006-09-01
Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.
Gene expression profile analysis of rat cerebellum under acute alcohol intoxication.
Zhang, Yu; Wei, Guangkuan; Wang, Yuehong; Jing, Ling; Zhao, Qingjie
2015-02-25
Acute alcohol intoxication, a common disease causing damage to the central nervous system (CNS) has been primarily studied on the aspects of alcohol addiction and chronic alcohol exposure. The understanding of gene expression change in the CNS during acute alcohol intoxication is still lacking. We established a model for acute alcohol intoxication in SD rats by oral gavage. A rat cDNA microarray was used to profile mRNA expression in the cerebella of alcohol-intoxicated rats (experimental group) and saline-treated rats (control group). A total of 251 differentially expressed genes were identified in response to acute alcohol intoxication, in which 208 of them were up-regulated and 43 were down-regulated. Gene ontology (GO) term enrichment analysis and pathway analysis revealed that the genes involved in the biological processes of immune response and endothelial integrity are among the most severely affected in response to acute alcohol intoxication. We discovered five transcription factors whose consensus binding motifs are overrepresented in the promoter region of differentially expressed genes. Additionally, we identified 20 highly connected hub genes by co-expression analysis, and validated the differential expression of these genes by real-time quantitative PCR. By determining novel biological pathways and transcription factors that have functional implication to acute alcohol intoxication, our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of acute alcoholism. Copyright © 2014 Elsevier B.V. All rights reserved.
Sherva, Richard; Rice, John P; Neuman, Rosalind J; Rochberg, Nanette; Saccone, Nancy L; Bierut, Laura J
2009-05-01
Alcohol dependence is a major cause of morbidity and mortality worldwide and has a strong familial component. Several linkage and association studies have identified chromosomal regions and/or genes that affect alcohol consumption, notably in genes involved in the 2-stage pathway of alcohol metabolism. Here, we use multiple regression models to test for associations and interactions between 2 alcohol-related phenotypes and SNPs in 17 genes involved in alcohol metabolism in a sample of 1,588 European American subjects. The strongest evidence for association after correcting for multiple testing was between rs1229984, a nonsynonymous coding SNP in ADH1B, and DSM-IV symptom count (p = 0.0003). This SNP was also associated with maximum number of drinks in 24 hours (p = 0.0004). Each minor allele at this SNP predicts 45% fewer DSM-IV symptoms and 18% fewer max drinks. Another SNP in a splice site in ALDH1A1 (rs8187974) showed evidence for association with both phenotypes as well (p = 0.02 and 0.004, respectively), but neither association was significant after accounting for multiple testing. Minor alleles at this SNP predict greater alcohol consumption. In addition, pairwise interactions were observed between SNPs in several genes (p = 0.00002). We replicated the large effect of rs1229984 on alcohol behavior, and although not common (MAF = 4%), this polymorphism may be highly relevant from a public health perspective in European Americans. Another SNP, rs8187974, may also affect alcohol behavior but requires replication. Also, interactions between polymorphisms in genes involved in alcohol metabolism are likely determinants of the parameters that ultimately affect alcohol consumption.
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
Yokoyama, Akira; Yokoyama, Tetsuji; Matsui, Toshifumi; Mizukami, Takeshi; Kimura, Mitsuru; Matsushita, Sachio; Higuchi, Susumu; Maruyama, Katsuya
2013-01-01
The life-time drinking profiles of Japanese alcoholics have shown that gastrectomy increases susceptibility to alcoholism. We investigated the trends in gastrectomy and alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) genotypes and their interactions in alcoholics. This survey was conducted on 4879 Japanese alcoholic men 40 years of age or older who underwent routine gastrointestinal endoscopic screening during the period 1996-2010. ADH1B/ALDH2 genotyping was performed in 3702 patients. A history of gastrectomy was found in 508 (10.4%) patients. The reason for the gastrectomy was peptic ulcer in 317 patients and gastric cancer in 187 patients. The frequency of gastrectomy had gradually decreased from 13.3% in 1996-2000 to 10.5% in 2001-2005 and to 7.8% in 2006-2010 (P < 0.0001). ADH1B*1/*1 was less frequent in the gastrectomy group than in the non-gastrectomy group (age-adjusted prevalence: 20.4 vs. 27.6%, P = 0.006). ALDH2 genotype distribution did not differ between the two groups. The frequency of inactive ALDH2*1/*2 heterozygotes increased slightly from 13.0% in 1996-2000 to 14.0% in 2001-2005 and to 15.4% in 2006-2010 (P < 0.08). Two alcoholism-susceptibility genotypes, ADH1B*1/*1 and ALDH2*1/*1, modestly but significantly tended not to occur in the same individual (P = 0.026). The frequency of ADH1B*1/*1 decreased with ascending age groups. The high frequency of history of gastrectomy suggested that gastrectomy is still a risk factor for alcoholism, although the percentage decreased during the period. The alcoholism-susceptibility genotype ADH1B*1/*1 was less frequent in the gastrectomy group, suggesting a competitive gene-gastrectomy interaction for alcoholism. A gene-gene interaction and gene-age interactions regarding the ADH1B genotype were observed.
Genetic and environmental influences on the development of alcoholism: resilience vs. risk.
Enoch, Mary-Anne
2006-12-01
The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence.
Alteration of gene expression by alcohol exposure at early neurulation.
Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang
2011-02-21
We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.
Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C
2003-05-01
Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.
Genetic mapping of new seed-expressed polyphenol oxidase genes in wheat (Triticum aestivum L.).
Beecher, Brian S; Carter, Arron H; See, Deven R
2012-05-01
Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. Recently a novel PPO gene family consisting of the PPO-A2, PPO-B2, and PPO-D2 genes has been identified and shown to be expressed in wheat kernels. In this study, the sequences of these five kernel PPO genes were determined for the spring wheat cultivars Louise and Penawawa. The two cultivars were found to be polymorphic at each of the PPO loci. Three novel alleles were isolated from Louise. The Louise X Penawawa mapping population was used to genetically map all five PPO genes. All map to the long arm of homeologous group 2 chromosomes. PPO-A2 was found to be located 8.9 cM proximal to PPO-A1 on the long arm of chromosome 2A. Similarly, PPO-D1 and PPO-D2 were separated by 10.7 cM on the long arm of chromosome 2D. PPO-B2 mapped to the long arm of chromosome 2B and was the site of a novel QTL for polyphenol oxidase activity. Five other PPO QTL were identified in this study. One QTL corresponds to the previously described PPO-D1 locus, one QTL corresponds to the PPO-D2 locus, whereas the remaining three are located on chromosome 2B.
Protein dynamics promote hydride tunnelling in substrate oxidation by aryl-alcohol oxidase.
Carro, Juan; Martínez-Júlvez, Marta; Medina, Milagros; Martínez, Angel T; Ferreira, Patricia
2017-11-01
The temperature dependence of hydride transfer from the substrate to the N5 of the FAD cofactor during the reductive half-reaction of Pleurotus eryngii aryl-alcohol oxidase (AAO) is assessed here. Kinetic isotope effects on both the pre-steady state reduction of the enzyme and its steady-state kinetics, with differently deuterated substrates, suggest an environmentally-coupled quantum-mechanical tunnelling process. Moreover, those kinetic data, along with the crystallographic structure of the enzyme in complex with a substrate analogue, indicate that AAO shows a pre-organized active site that would only require the approaching of the hydride donor and acceptor for the tunnelled transfer to take place. Modification of the enzyme's active-site architecture by replacement of Tyr92, a residue establishing hydrophobic interactions with the substrate analogue in the crystal structure, in the Y92F, Y92L and Y92W variants resulted in different temperature dependence patterns that indicated a role of this residue in modulating the transfer reaction.
Glutamate decarboxylase genes and alcoholism in Han Taiwanese men.
Loh, El-Wui; Lane, Hsien-Yuan; Chen, Chien-Hsiun; Chang, Pi-Shan; Ku, Li-Wen; Wang, Kathy H T; Cheng, Andrew T A
2006-11-01
Glutamate decarboxylase (GAD), the rate-limiting enzyme in the synthesis of gamma-aminobutyric acid (GABA), may be involved in the development of alcoholism. This study examined the possible roles of the genes that code for 2 forms of GAD (GAD1 and GAD2) in the development of alcoholism. An association study was conducted among 140 male alcoholic subjects meeting the DSM-III-R criteria for alcohol dependence and 146 controls recruited from the Han Taiwanese in community and clinical settings. Psychiatric assessment of drinking conditions was conducted using a Chinese version of the Schedules for Clinical Assessment in Neuropsychiatry. The SHEsis and Haploview programs were used in statistical analyses. Nine single-nucleotide polymorphisms (SNPs) at the GAD1 gene were valid for further statistics. Between alcoholic subjects and controls, significant differences were found in genotype distributions of SNP1 (p=0.000), SNP2 (p=0.015), SNP4 (p=0.015), SNP5 (p=0.031), SNP6 (p=0.012), and SNP8 (p=0.004) and in allele distributions of SNP1 (p=0.001), SNP2 (p=0.009), and SNP8 (p=0.009). Permutation tests of SNP1, SNP2, and SNP8 demonstrated significant differences in allele frequencies but not in 2 major haplotype blocks. Three valid SNPs at the GAD2 gene demonstrated no associations with alcoholism. Further permutation tests in the only 1 haplotype block or individual SNPs demonstrated no significant differences. This is the first report indicating a possible significant role of the GAD1 gene in the development of alcohol dependence and/or the course of alcohol withdrawal and outcome of alcoholism.
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...
Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R
2003-10-01
Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.
Quantitative trait locus gene mapping: a new method for locating alcohol response genes.
Crabbe, J C
1996-01-01
Alcoholism is a multigenic trait with important non-genetic determinants. Studies with genetic animal models of susceptibility to several of alcohol's effects suggest that several genes contributing modest effects on susceptibility (Quantitative Trait Loci, or QTLs) are important. A new technique of QTL gene mapping has allowed the identification of the location in mouse genome of several such QTLs. The method is described, and the locations of QTLs affecting the acute alcohol withdrawal reaction are described as an example of the method. Verification of these QTLs in ancillary studies is described and the strengths, limitations, and future directions to be pursued are discussed. QTL mapping is a promising method for identifying genes in rodents with the hope of directly extrapolating the results to the human genome. This review is based on a paper presented at the First International Congress of the Latin American Society for Biomedical Research on Alcoholism, Santiago, Chile, November 1994.
Convergence of GWA and candidate gene studies for alcoholism
Olfson, Emily; Bierut, Laura Jean
2012-01-01
Background Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Methods Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported SNPs in candidate genes were examined in the Study of Alcohol Addiction: Genetics and Addiction (SAGE), a GWA study comparing alcohol dependent and non-dependent subjects. Results Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1 and rs4680 in COMT, are not replicated in SAGE (p> .05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p=0.0052, OR=1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls and the lowest p value of any SNP was .0006. Discussion We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African Ancestry populations. Due to lack of coverage, we were unable to rule out the contribution of other variants and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more
Samochowiec, Agnieszka; Chęć, Magdalena; Kopaczewska, Edyta; Samochowiec, Jerzy; Lesch, Otto; Grochans, Elżbieta; Jasiewicz, Andrzej; Bienkowski, Przemyslaw; Łukasz, Kołodziej; Grzywacz, Anna
2015-01-01
Background: The aim of this study was to examine the association between the MAOA-uVNTR gene polymorphism in a homogeneous subgroups of patients with alcohol dependence categorized according to Lesch’s typology. Methods: DNA was provided from alcohol dependent (AD) patients (n = 370) and healthy control subjects (n = 168) all of Polish descent. The history of alcoholism was obtained using the Polish version of the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA). Samples were genotyped using PCR methods. Results: We found no association between alcohol dependence and MAOA gene polymorphism. Conclusions: Lesch typology is a clinical consequence of the disease and its phenotypic description is too complex for a simple genetic analysis. PMID:25809512
Cytokinin oxidase/dehydrogenase genes in barley and wheat: cloning and heterologous expression.
Galuszka, Petr; Frébortová, Jitka; Werner, Tomás; Yamada, Mamoru; Strnad, Miroslav; Schmülling, Thomas; Frébort, Ivo
2004-10-01
The cloning of two novel genes that encode cytokinin oxidase/dehydrogenase (CKX) in barley is described in this work. Transformation of both genes into Arabidopsis and tobacco showed that at least one of the genes codes for a functional enzyme, as its expression caused a cytokinin-deficient phenotype in the heterologous host plants. Additional cloning of two gene fragments, and an in silico search in the public expressed sequence tag clone databases, revealed the presence of at least 13 more members of the CKX gene family in barley and wheat. The expression of three selected barley genes was analyzed by RT-PCR and found to be organ-specific with peak expression in mature kernels. One barley CKX (HvCKX2) was characterized in detail after heterologous expression in tobacco. Interestingly, this enzyme shows a pH optimum at 4.5 and a preference for cytokinin ribosides as substrates, which may indicate its vacuolar targeting. Different substrate specificities, and the pH profiles of cytokinin-degrading enzymes extracted from different barley tissues, are also presented.
Wongnate, Thanyaporn; Chaiyen, Pimchai
2013-07-01
Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.
Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P
2011-03-01
"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.
ERIC Educational Resources Information Center
May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.
2009-01-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Nawathean, P; Maslov, D A
2000-08-01
By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs.
Chronic smoking and alcoholism change expression of selective genes in the human prefrontal cortex.
Flatscher-Bader, Traute; Wilce, Peter A
2006-05-01
Alcoholism is commonly associated with chronic smoking. A number of gene expression profiles of regions within the human mesocorticolimbic system have identified potential alcohol-sensitive genes; however, the influence of smoking on these changes was not taken into account. This study addressed the impact of alcohol and smoking on the expression of 4 genes, previously identified as alcoholism-sensitive, in the human prefrontal cortex (PFC). mRNA expression of apolipoprotein D, tissue inhibitor of the metalloproteinase 3, high-affinity glial glutamate transporter and midkine, was measured in the PFC of alcoholic subjects and controls with and without smoking comorbidity using real-time polymerase chain reaction. The results show that alcohol affects transcription of some of these genes. Additionally, smoking has a marked influence on gene expression. This study emphasizes the need for careful case selection in future gene expression studies to delineate the adaptive molecular process associated with smoking and alcohol.
A novel proteolytic processing of prolysyl oxidase
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo
2012-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931
A novel proteolytic processing of prolysyl oxidase.
Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo
2011-01-01
Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.
Integrative strategies to identify candidate genes in rodent models of human alcoholism.
Treadwell, Julie A
2006-01-01
The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.
Fine structure of OXI1, the mitochondrial gene coding for subunit II of yeast cytochrome c oxidase.
Weiss-Brummer, B; Guba, R; Haid, A; Schweyen, R J
1979-12-01
Genetic and biochemical studies have been performed with 110 mutants which are defective in cytochrome a·a3 and map in the regions on mit DNA previously designated OXI1 and OXI2. With 88 mutations allocated to OXI1 fine structure mapping was achieved by the analysis of rho (-) deletions. The order of six groups of mutational sites (A 1, A2, B 1, B2, C 1, C2) thus determined was confirmed by oxi i x oxi j recombination analysis.Analysis of mitochondrially translated polypeptides of oxil mutants by SDS-polyacrylamide electrophoresis reveals three classes of mutant patterns: i) similar to wild-tpye (19 mutants); ii) lacking SU II of cytochrome c oxidase (53 mutants); iii) lacking this subunit and exhibiting a single new polypeptide of lower Mr (16 mutants). Mutations of each of these classes are scattered over the OXI1 region without any detectable clustering; this is consistent with the assumption that all oxil mutations studied are within the same gene.New polypeptides observed in oxil mutants of class iii) vary in Mr in the range from 10,500 to 33,000. Those of Mr 17,000 to 33,000 are shown to be antigenically related to subunit II of cytochrome c oxidase. Colinearity is established between the series of new polypeptides of Mr values increasing from 10,500 to 31,500 and the order of the respective mutational sites on the map, e.g. mutations mapping in A 1 generate the smallest and mutations mapping in C2 the largest mutant fragments.From these data we conclude that i) all mutations allocated to the OXI1 region are in the same gene; ii) this gene codes for subunit II of cytochrome c oxidase; iii) the direction of translation is from CAP to 0X12. Out of 19 mutants allocated to OXI2 three exhibit a new polypeptide; these and all the other oxi2 mutants lack subunit III of cytochrome oxidase. This result provides preliminary evidence that the OXI2 region harbours the structural gene for this subunit III.
Herman, Aryeh I; Kaiss, Kristi M; Ma, Rui; Philbeck, John W; Hasan, Asfar; Dasti, Humza; DePetrillo, Paolo B
2005-02-05
The short allelic variant of the serotonin transporter protein promoter polymorphism (5HTTLPR) appears to influence binge drinking in college students. Both monoamine oxidase type A (MAOA) and the serotonin transporter protein are involved in the processing of serotonin, and allelic variants are both associated with differences in the efficiency of expression. We hypothesized that a significant gene x gene interaction would further stratify the risk of binge drinking in this population. Participants were college students (n = 412) who completed the College Alcohol Study, used to measure binge drinking behaviors. Genomic DNA was extracted from saliva for PCR based genotyping. The risk function for binge drinking was modeled using logistic regression, with final model fit P < 0.0005. This model was valid only for Caucasian females (n = 223), but the power to detect sex and ethnic effects was small. Young Caucasian women carrying higher expression MAOA VNTR alleles homozygous for the short allelic variant of the 5HTTLPR demonstrated the highest rate of binge drinking by self-report, odds ratio (genotype odds: population odds) and 95% confidence intervals, 3.11 (1.14-18.10). Individuals carrying higher expression MAOA VNTR alleles carrying at least one long 5HTTLPR allelic variant had the lowest risk of binge drinking 0.46 (0.28-0.71). These results support the hypothesis that binge drinking behavior in young adulthood may be influenced by neurobiological differences in serotonergic function conferred by functional polymorphisms in genes involved in serotonin processing. (c) 2004 Wiley-Liss, Inc.
5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.
Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T
2015-08-01
Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. © 2014 The Authors. FEBS Journal published by John Wiley & Sons Ltd on behalf of FEBS.
Inada, Mari; Kihara, Keisuke; Kono, Tomoya; Sudhakaran, Raja; Mekata, Tohru; Sakai, Masahiro; Yoshida, Terutoyo; Itami, Toshiaki
2013-02-01
In many physiological processes, including the innate immune system, free radicals such as nitric oxide (NO) and reactive oxygen species (ROS) play significant roles. In humans, 2 homologs of Dual oxidases (Duox) generate hydrogen peroxide (H(2)O(2)), which is a type of ROS. Here, we report the identification and characterization of a Duox from kuruma shrimp, Marsupenaeus japonicus. The full-length cDNA sequence of the M. japonicus Dual oxidase (MjDuox) gene contains 4695 bp and was generated using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). The open reading frame of MjDuox encodes a protein of 1498 amino acids with an estimated mass of 173 kDa. In a homology analysis using amino acid sequences, MjDuox exhibited 69.3% sequence homology with the Duox of the red flour beetle, Tribolium castaneum. A transcriptional analysis revealed that the MjDuox mRNA is highly expressed in the gills of healthy kuruma shrimp. In the gills, MjDuox expression reached its peak 60 h after injection with WSSV and decreased to its normal level at 72 h. In gene knockdown experiments of free radical-generating enzymes, the survival rates decreased during the early stages of a white spot syndrome virus (WSSV) infection following the knockdown of the NADPH oxidase (MjNox) or MjDuox genes. In the present study, the identification, cloning and gene knockdown of the kuruma shrimp MjDuox are reported. Duoxes have been identified in vertebrates and some insects; however, few reports have investigated Duoxes in crustaceans. This study is the first to identify and clone a Dual oxidase from a crustacean species. Copyright © 2012 Elsevier Ltd. All rights reserved.
Isolation and characterization of the pea cytochrome c oxidase Vb gene.
Kubo, Nakao; Arimura, Shin-Ichi; Tsutsumi, Nobuhiro; Kadowaki, Koh-Ichi; Hirai, Masashi
2006-11-01
Three copies of the gene that encodes cytochrome c oxidase subunit Vb were isolated from the pea (PscoxVb-1, PscoxVb-2, and PscoxVb-3). Northern Blot and reverse transcriptase-PCR analyses suggest that all 3 genes are transcribed in the pea. Each pea coxVb gene has an N-terminal extended sequence that can encode a mitochondrial targeting signal, called a presequence. The localization of green fluorescent proteins fused with the presequence strongly suggests the targeting of pea COXVb proteins to mitochondria. Each pea coxVb gene has 5 intron sites within the coding region. These are similar to Arabidopsis and rice, although the intron lengths vary greatly. A phylogenetic analysis of coxVb suggests the occurrence of gene duplication events during angiosperm evolution. In particular, 2 duplication events might have occurred in legumes, grasses, and Solanaceae. A comparison of amino acid sequences in COXVb or its counterpart shows the conservation of several amino acids within a zinc finger motif. Interestingly, a homology search analysis showed that bacterial protein COG4391 and a mitochondrial complex I 13 kDa subunit also have similar amino acid compositions around this motif. Such similarity might reflect evolutionary relationships among the 3 proteins.
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-01-01
The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066
Clock genes × stress × reward interactions in alcohol and substance use disorders.
Perreau-Lenz, Stéphanie; Spanagel, Rainer
2015-06-01
Adverse life events and highly stressful environments have deleterious consequences for mental health. Those environmental factors can potentiate alcohol and drug abuse in vulnerable individuals carrying specific genetic risk factors, hence producing the final risk for alcohol- and substance-use disorders development. The nature of these genes remains to be fully determined, but studies indicate their direct or indirect relation to the stress hypothalamo-pituitary-adrenal (HPA) axis and/or reward systems. Over the past decade, clock genes have been revealed to be key-players in influencing acute and chronic alcohol/drug effects. In parallel, the influence of chronic stress and stressful life events in promoting alcohol and substance use and abuse has been demonstrated. Furthermore, the reciprocal interaction of clock genes with various HPA-axis components, as well as the evidence for an implication of clock genes in stress-induced alcohol abuse, have led to the idea that clock genes, and Period genes in particular, may represent key genetic factors to consider when examining gene × environment interaction in the etiology of addiction. The aim of the present review is to summarize findings linking clock genes, stress, and alcohol and substance abuse, and to propose potential underlying neurobiological mechanisms. Copyright © 2015 Elsevier Inc. All rights reserved.
Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian
2007-08-01
A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.
Ewing, Tom A; van Noord, Aster; Paul, Caroline E; van Berkel, Willem J H
2018-01-14
Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para -substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para -phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para -phenol oxidases, facilitating the enzyme engineering of known para- phenol oxidases and the evaluation of the substrate specificity of novel para -phenol oxidases.
Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus
Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds
2016-01-01
The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...
Sugie, Atsushi; Murai, Koji; Takumi, Shigeo
2007-06-01
Mitochondrial alternative oxidase (AOX) is the terminal oxidase responsible for cyanide-insensitive and salicylhydroxamic acid-sensitive respiration in plants. AOX is a key enzyme of the alternative respiration pathway. To study the effects of necrotic cell death on the mitochondrial function, production of reactive oxygen species (ROS), respiration capacities and accumulation patterns of mitochondria-targeted protein-encoding gene transcripts were compared between wild-type, lesion-mimic mutant and hybrid necrosis wheat plants. Around cells with the necrosis symptom, ROS accumulated abundantly in the intercellular spaces. The ratio of the alternative pathway to the cytochrome pathway was markedly enhanced in the necrotic leaves. Transcripts of a wheat AOX gene, Waox1a, were more abundant in a novel lesion-mimic mutant of common wheat than in the wild-type plants. An increased level of the Waox1a transcripts was also observed in hybrid plants containing Ne1 and Ne2 genes. These results indicated that an increase of the wheat AOX transcript level resulted in enhancement of respiration capacity of the alternative pathway in the necrotic cells.
Dick, Danielle M; Edenberg, Howard J; Xuei, Xiaoling; Goate, Alison; Hesselbrock, Victor; Schuckit, Marc; Crowe, Raymond; Foroud, Tatiana
2005-01-05
A substantial body of literature suggests that gamma-aminobutyric acid (GABA) may be involved in the neurochemical pathways contributing to alcohol use and related disorders. Chromosome 5 contains a cluster of GABA(A) receptor genes, GABRA1, GABRA6, GABRB2, and GABRG2, which have been among the most extensively studied in relation to alcohol use. These studies have yielded mixed results. Using data from large, multiplex alcoholic families collected as part of the Collaborative Study on the Genetics of Alcoholism (COGA), we sought to provide more conclusive evidence regarding the role of the GABA(A) receptor genes on chromosome 5. Multiple single nucleotide polymorphisms (SNPs) were tested in each of the four chromosome 5q GABA(A) receptor genes, and we conducted both classic trio-based association analyzes and extended pedigree analyzes. We found no consistent evidence of association with alcohol dependence or alcohol dependence comorbid with antisocial personality disorder (ASPD) for any of the regions tested in the chromosome 5 GABA(A) receptor genes. These analyses suggest that the GABA(A) receptor genes on chromosome 5 do not play a strong role in alcohol dependence. Future studies are planned to test whether these genes are more important in influencing behavioral endophenotypes related to the risk of alcohol dependence. Copyright 2004 Wiley-Liss, Inc.
Allam, Mai A; Saker, Mahmoud M
2017-01-01
The overall objective of this work is to optimize the transformation system for date palm as a first step toward production of date palm clones resistant to noxious pests. A construct harboring the cholesterol oxidase (ChoA) gene, which renders plant resistance against insect attack, is introduced into embryogenic date palm callus using the PDS-1000/He particle bombardment system. The process involves the establishment of embryogenic callus cultures as well as immature embryo-derived microcalli that are used as target tissues for shooting and optimization of transformation conditions. This chapter in addition explains molecular and histochemical assays conducted to confirm gene integration and expression.
Convergence of genome-wide association and candidate gene studies for alcoholism.
Olfson, Emily; Bierut, Laura Jean
2012-12-01
Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of
Bai, Yang; Tan, Yi; Wang, Bo; Miao, Xiao; Chen, Qiang; Zheng, Yang; Cai, Lu
2012-10-01
To investigate whether chronic alcohol consumption induces vascular injury via angiotensin II (Ang II) type 1 (AT1) receptor-dependent superoxide generation, male transgenic mice with knockout of AT1 gene (AT1-KO) and age-matched wild-type (WT) C57BL/6 mice were pair-fed a modified Lieber-DeCarli alcohol or isocaloric maltose dextrin control liquid diet for 2 months. Ethanol content (%, W/V) in the diet was 4.8 (34% of total calories) at initiation, and gradually increased up to 5.4 (38% of total calories). For some WT mice with and without alcohol treatment, superoxide dismutase mimetic (MnTMPyP) was given simultaneously by intraperitoneal injection at 5 mg/kg body weight daily for 2 months. At the end of studies, aortas were harvested for histopathological and immunohistochemical examination. Significant increases in the wall thickness and structural disarrangement of aorta were found in alcohol group, along with significant increases in aortic oxidative and/or nitrosative damage, expressions of NADPH oxidases (NOXs), inflammatory response, cell death and proliferation, and remodelling (fibrosis). However, these pathological changes were completely attenuated in alcohol-treated AT1-KO mice or in alcohol-treated WT mice that were also simultaneously treated with MnTMPyP for 2 months. These results suggest that chronic alcohol consumption may activate NOX via Ang II/AT1 receptor, to generate superoxide and associated peroxynitrite that in turn causes aortic nitrosative damage, inflammation, cell death and proliferation, and remodelling. Therefore, blocking Ang II/AT1 system or scavenging superoxide may become a potential preventive and/therapeutic approach to alcoholic vascular damage. © 2012 The Authors Journal of Cellular and Molecular Medicine © 2012 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Population-based case-control study of DRD2 gene polymorphisms and alcoholism.
Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R
2010-10-01
Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.
Monoamine Oxidase A Gene (MAOA) Associated with Attitude Towards Longshot Risks
Zhong, Songfa; Israel, Salomon; Xue, Hong; Ebstein, Richard P.; Chew, Soo Hong
2009-01-01
Decision making often entails longshot risks involving a small chance of receiving a substantial outcome. People tend to be risk preferring (averse) when facing longshot risks involving significant gains (losses). This differentiation towards longshot risks underpins the markets for lottery as well as for insurance. Both lottery and insurance have emerged since ancient times and continue to play a useful role in the modern economy. In this study, we observe subjects' incentivized choices in a controlled laboratory setting, and investigate their association with a widely studied, promoter-region repeat functional polymorphism in monoamine oxidase A gene (MAOA). We find that subjects with the high activity (4-repeat) allele are characterized by a preference for the longshot lottery and also less insurance purchasing than subjects with the low activity (3-repeat) allele. This is the first result to link attitude towards longshot risks to a specific gene. It complements recent findings on the neurobiological basis of economic risk taking. PMID:20046877
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Zhang, RuiJie; Li, Xia; Jiang, YongShuai; Liu, GuiYou; Li, ChuanXing; Zhang, Fan; Xiao, Yun; Gong, BinSheng
2009-02-01
High-throughout single nucleotide polymorphism detection technology and the existing knowledge provide strong support for mining the disease-related haplotypes and genes. In this study, first, we apply four kinds of haplotype identification methods (Confidence Intervals, Four Gamete Tests, Solid Spine of LD and fusing method of haplotype block) into high-throughout SNP genotype data to identify blocks, then use cluster analysis to verify the effectiveness of the four methods, and select the alcoholism-related SNP haplotypes through risk analysis. Second, we establish a mapping from haplotypes to alcoholism-related genes. Third, we inquire NCBI SNP and gene databases to locate the blocks and identify the candidate genes. In the end, we make gene function annotation by KEGG, Biocarta, and GO database. We find 159 haplotype blocks, which relate to the alcoholism most possibly on chromosome 1 approximately 22, including 227 haplotypes, of which 102 SNP haplotypes may increase the risk of alcoholism. We get 121 alcoholism-related genes and verify their reliability by the functional annotation of biology. In a word, we not only can handle the SNP data easily, but also can locate the disease-related genes precisely by combining our novel strategies of mining alcoholism-related haplotypes and genes with existing knowledge framework.
Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao
2017-01-01
Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149
Rodd, Z A; Bertsch, B A; Strother, W N; Le-Niculescu, H; Balaraman, Y; Hayden, E; Jerome, R E; Lumeng, L; Nurnberger, J I; Edenberg, H J; McBride, W J; Niculescu, A B
2007-08-01
We describe a comprehensive translational approach for identifying candidate genes for alcoholism. The approach relies on the cross-matching of animal model brain gene expression data with human genetic linkage data, as well as human tissue data and biological roles data, an approach termed convergent functional genomics. An analysis of three animal model paradigms, based on inbred alcohol-preferring (iP) and alcohol-non-preferring (iNP) rats, and their response to treatments with alcohol, was used. A comprehensive analysis of microarray gene expression data from five key brain regions (frontal cortex, amygdala, caudate-putamen, nucleus accumbens and hippocampus) was carried out. The Bayesian-like integration of multiple independent lines of evidence, each by itself lacking sufficient discriminatory power, led to the identification of high probability candidate genes, pathways and mechanisms for alcoholism. These data reveal that alcohol has pleiotropic effects on multiple systems, which may explain the diverse neuropsychiatric and medical pathology in alcoholism. Some of the pathways identified suggest avenues for pharmacotherapy of alcoholism with existing agents, such as angiotensin-converting enzyme (ACE) inhibitors. Experiments we carried out in alcohol-preferring rats with an ACE inhibitor show a marked modulation of alcohol intake. Other pathways are new potential targets for drug development. The emergent overall picture is that physical and physiological robustness may permit alcohol-preferring individuals to withstand the aversive effects of alcohol. In conjunction with a higher reactivity to its rewarding effects, they may able to ingest enough of this nonspecific drug for a strong hedonic and addictive effect to occur.
Genetics Home Reference: cytochrome c oxidase deficiency
... are caused by mutations in genes found within nuclear DNA; however, in some rare instances, mutations in genes located within mtDNA cause this condition. The genes associated with cytochrome c oxidase deficiency are involved in energy production in mitochondria through a process called oxidative ...
Wang, Lishi; Huang, Yue; Jiao, Yan; Chen, Hong; Cao, Yanhong; Bennett, Beth; Wang, Yongjun; Gu, Weikuan
2013-01-01
The purpose of this study is to investigate whether expression profiles of alcoholism-relevant genes in different parts of the brain are correlated differently with those in the liver. Four experiments were conducted. First, we used gene expression profiles from five parts of the brain (striatum, prefrontal cortex, nucleus accumbens, hippocampus, and cerebellum) and from liver in a population of recombinant inbred mouse strains to examine the expression association of 10 alcoholism-relevant genes. Second, we conducted the same association analysis between brain structures and the lung. Third, using five randomly selected, nonalcoholism-relevant genes, we conducted the association analysis between brain and liver. Finally, we compared the expression of 10 alcoholism-relevant genes in hippocampus and cerebellum between an alcohol preference strain and a wild-type control. We observed a difference in correlation patterns in expression levels of 10 alcoholism-relevant genes between different parts of the brain with those of liver. We then examined the association of gene expression between alcohol dehydrogenases (Adh1, Adh2, Adh5, and Adh7) and different parts of the brain. The results were similar to those of the 10 genes. Then, we found that the association of those genes between brain structures and lung was different from that of liver. Next, we found that the association patterns of five alcoholism-nonrelevant genes were different from those of 10 alcoholism-relevant genes. Finally, we found that the expression level of 10 alcohol-relevant genes is influenced more in hippocampus than in cerebellum in the alcohol preference strain. Our results show that the expression of alcoholism-relevant genes in liver is differently associated with the expression of genes in different parts of the brain. Because different structural changes in different parts of the brain in alcoholism have been reported, it is important to investigate whether those structural differences in
Bhaskar, Lakkakula V K S; Kumar, Shanmugasundaram Arun
2014-04-01
Alcohol dependence (AD) is one of the major elements that significantly influence drinking pattern that provoke the alcohol-induced organ damage. The structural and neurophysiologic abnormalities in the frontal lobes of chronic alcoholics were revealed by magnetic resonance imaging scans. It is well known that candidate genes involved in dopaminergic pathway are of immense interest to the researchers engaged in a wide range of addictive disorders. Dopaminergic pathway gene polymorphisms are being extensively studied with respect to addictive and behavioral disorders. From the broad literature available, the current review summarizes the specific polymorphisms of dopaminergic genes that play a role in alcohol dependence. No evidence indicating any strong association between AD and polymorphisms of dopamine pathway genes has emerged from the literature. Further studies are warranted, considering a range of alcohol-related traits to determine the genes that influence alcohol dependence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed duringmore » myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.« less
Association and family studies of DRD2 gene polymorphisms in alcohol dependence syndrome.
Małecka, Iwona; Jasiewicz, Andrzej; Suchanecka, Aleksandra; Samochowiec, Jerzy; Grzywacz, Anna
2014-11-06
The human dopamine receptor 2 gene DRD2 plays a central role in susceptibility to Alcohol Dependence Syndrome (ADS). The aim of this study was to evaluate 3 single nucleotide polymorphisms: D2 (rs1076560), Tag1D (rs1800498), Tag1B (rs1079597) located in dopamine receptor 2 DRD2 gene and its role in alcohol dependence. DNA was provided from alcohol dependent (AD) patients (n=171) and healthy control subjects (n=160) all of Polish descent. The history of alcoholism was obtained using the Polish version of the SSAGA (Semi-Structured Assessment for the Genetics of Alcoholism). We conducted case-control association study and transmission disequilibrium test (TDT). Samples were genotyped using real-time PCR method. We did not confirm the association between studied polymorphisms and alcohol dependence syndrome. TDT reveled an adequate transmission of both alleles in the group of alcohol families. The lack of association of studied polymorphisms and ADS does not preclude its participation in the pathogenesis. Further research is needed to determine the actual contribution of DRD2 gene in the pathogenesis of alcoholism.
Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2016-03-18
The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Peroxisomal Targeting, Import, and Assembly of Alcohol Oxidase in Pichia pastoris
Waterham, Hans R.; Russell, Kimberly A.; de Vries, Yne; Cregg, James M.
1997-01-01
Alcohol oxidase (AOX), the first enzyme in the yeast methanol utilization pathway is a homooctameric peroxisomal matrix protein. In peroxisome biogenesis-defective (pex) mutants of the yeast Pichia pastoris, AOX fails to assemble into active octamers and instead forms inactive cytoplasmic aggregates. The apparent inability of AOX to assemble in the cytoplasm contrasts with other peroxisomal proteins that are able to oligomerize before import. To further investigate the import of AOX, we first identified its peroxisomal targeting signal (PTS). We found that sequences essential for targeting AOX are primarily located within the four COOH-terminal amino acids of the protein leucine-alanine-arginine-phenylalanine COOH (LARF). To examine whether AOX can oligomerize before import, we coexpressed AOX without its PTS along with wild-type AOX and determined whether the mutant AOX could be coimported into peroxisomes. To identify the mutant form of AOX, the COOH-terminal LARF sequence of the protein was replaced with a hemagglutinin epitope tag (AOX–HA). Coexpression of AOX–HA with wild-type AOX (AOX-WT) did not result in an increase in the proportion of AOX–HA present in octameric active AOX, suggesting that newly synthesized AOX–HA cannot oligomerize with AOX-WT in the cytoplasm. Thus, AOX cannot initiate oligomerization in the cytoplasm, but must first be targeted to the organelle before assembly begins. PMID:9396748
Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.
Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio
2013-08-01
A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Opioid system genes in alcoholism: a case-control study in Croatian population.
Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J
2013-10-01
Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.
Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.
Castresana, J; Lübben, M; Saraste, M; Higgins, D G
1994-06-01
Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.
Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.
Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W
2016-11-04
By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Altered gene expression in early postnatal monoamine oxidase A knockout mice.
Chen, Kevin; Kardys, Abbey; Chen, Yibu; Flink, Stephen; Tabakoff, Boris; Shih, Jean C
2017-08-15
We reported previously that monoamine oxidase (MAO) A knockout (KO) mice show increased serotonin (5-hydroxytryptamine, 5-HT) levels and autistic-like behaviors characterized by repetitive behaviors, and anti-social behaviors. We showed that administration of the serotonin synthesis inhibitor para-chlorophenylalanine (pCPA) from post-natal day 1 (P1) through 7 (P7) in MAO A KO mice reduced the serotonin level to normal and reverses the repetitive behavior. These results suggested that the altered gene expression at P1 and P7 may be important for the autistic-like behaviors seen in MAO A KO mice and was studied here. In this study, Affymetrix mRNA array data for P1 and P7 MAO A KO mice were analyzed using Partek Genomics Suite and Ingenuity Pathways Analysis to identify genes differentially expressed versus wild-type and assess their functions and relationships. The number of significant differentially expressed genes (DEGs) varied with age: P1 (664) and P7 (3307) [false discovery rate (FDR) <0.05, fold-change (FC) >1.5 for autism-linked genes and >2.0 for functionally categorized genes]. Eight autism-linked genes were differentially expressed in P1 (upregulated: NLGN3, SLC6A2; down-regulated: HTR2C, MET, ADSL, MECP2, ALDH5A1, GRIN3B) while four autism-linked genes were differentially expressed at P7 (upregulated: HTR2B; downregulated: GRIN2D, GRIN2B, CHRNA4). Many other genes involved in neurodevelopment, apoptosis, neurotransmission, and cognitive function were differentially expressed at P7 in MAO A KO mice. This result suggests that modulation of these genes by the increased serotonin may lead to neurodevelopmental alteration in MAO A KO mice and results in autistic-like behaviors. Copyright © 2017 Elsevier B.V. All rights reserved.
Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.
Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping
2015-02-01
Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-01-01
Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Association between alcoholism and the dopamine D4 receptor gene.
Muramatsu, T; Higuchi, S; Murayama, M; Matsushita, S; Hayashida, M
1996-01-01
A point mutation in the aldehyde dehydrogenase 2 gene (ALDH2(2) allele) is considered to be a genetic deterrent for alcoholism; however, 80 of 655 Japanese alcoholics had the mutant allele. Genotype factors that might increase susceptibility by overriding the deterrent showed a higher frequency of a five repeat allele of the dopamine D4 receptor 48 bp repeat polymorphism in alcoholics with ALDH2(2) than in 100 other alcoholics and 144 controls. Alcoholics with the five repeat allele also abused other drugs more often. These data suggest the involvement of the dopamine system in the development of alcoholism and other addictive behaviour. PMID:8929946
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
Pardo-Planas, Oscar; Atiyeh, Hasan K; Prade, Rolf A; Müller, Michael; Wilkins, Mark R
2018-05-01
An A. nidulans strain with a pyridoxine marker was used for continuous production of aryl alcohol oxidase (AAO) in a trickle bed reactor (TBR). Modified medium with reduced zinc, no copper, and 5 g/L ascorbic acid that reduced melanin production and increased AAO productivity under growth limited conditions was used. Two air flow rates, 0.11 L/min (0.1 vvm) and 1.1 L/min (1.0 vvm) were tested. More melanin formation and reduced protein productivity were observed with air flow rate of 1.1 L/min. Three random packings were used as support for the fungus inside the TBR column, two of which were hydrophobic and one which was hydrophilic, and three different dilution rates were tested. The use of GEA BCN 030 hydrophobic packing resulted in greater AAO yield and productivity than the other packings. Increasing dilution rates favored melanin formation and citric, lactic and succinic acid accumulation, which decreased AAO yield and productivity. Copyright © 2018 Elsevier Ltd. All rights reserved.
May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H
2009-07-01
A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Chartier, Karen G.; Dick, Danielle M.; Almasy, Laura; Chan, Grace; Aliev, Fazil; Schuckit, Marc A.; Scott, Denise M.; Kramer, John; Bucholz, Kathleen K.; Bierut, Laura J.; Nurnberger, John; Porjesz, Bernice; Hesselbrock, Victor M.
2016-01-01
Objective: Variations in the genes encoding alcohol dehydrogenase (ADH) enzymes are associated with both alcohol consumption and dependence in multiple populations. Additionally, some environmental factors have been recognized as modifiers of these relationships. This study examined the modifying effect of religious involvement on relationships between ADH gene variants and alcohol consumption–related phenotypes. Method: Subjects were African American, European American, and Hispanic American adults with lifetime exposure to alcohol (N = 7,716; 53% female) from the Collaborative Study on the Genetics of Alcoholism. Genetic markers included ADH1B-rs1229984, ADH1B-rs2066702, ADH1C-rs698, ADH4-rs1042364, and ADH4-rs1800759. Phenotypes were maximum drinks consumed in a 24-hour period and total number of alcohol dependence symptoms according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition. Religious involvement was defined by self-reported religious services attendance. Results: Both religious involvement and ADH1B-rs1229984 were negatively associated with the number of maximum drinks consumed and the number of lifetime alcohol dependence symptoms endorsed. The interactions of religious involvement with ADH1B-rs2066702, ADH1C-rs698, and ADH4-rs1042364 were significantly associated with maximum drinks and alcohol dependence symptoms. Risk variants had weaker associations with maximum drinks and alcohol dependence symptoms as a function of increasing religious involvement. Conclusions: This study provided initial evidence of a modifying effect for religious involvement on relationships between ADH variants and maximum drinks and alcohol dependence symptoms. PMID:27172571
A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.
Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T
2015-01-01
The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. © 2015 by The Mycological Society of America.
Identifying gene networks underlying the neurobiology of ethanol and alcoholism.
Wolen, Aaron R; Miles, Michael F
2012-01-01
For complex disorders such as alcoholism, identifying the genes linked to these diseases and their specific roles is difficult. Traditional genetic approaches, such as genetic association studies (including genome-wide association studies) and analyses of quantitative trait loci (QTLs) in both humans and laboratory animals already have helped identify some candidate genes. However, because of technical obstacles, such as the small impact of any individual gene, these approaches only have limited effectiveness in identifying specific genes that contribute to complex diseases. The emerging field of systems biology, which allows for analyses of entire gene networks, may help researchers better elucidate the genetic basis of alcoholism, both in humans and in animal models. Such networks can be identified using approaches such as high-throughput molecular profiling (e.g., through microarray-based gene expression analyses) or strategies referred to as genetical genomics, such as the mapping of expression QTLs (eQTLs). Characterization of gene networks can shed light on the biological pathways underlying complex traits and provide the functional context for identifying those genes that contribute to disease development.
The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis
Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel
2017-01-01
Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Daniel, Geoffrey; Volc, Jindřich; Filonova, Lada; Plíhal, Ondřej; Kubátová, Elena; Halada, Petr
2007-01-01
A novel alcohol oxidase (AOX) has been purified from mycelial pellets of the wood-degrading basidiomycete Gloeophyllum trabeum and characterized as a homooctameric nonglycosylated protein with native and subunit molecular masses of 628 and 72.4 kDa, containing noncovalently bonded flavin adenine dinucleotide. The isolated AOX cDNA contained an open reading frame of 1,953 bp translating into a polypeptide of 651 amino acids displaying 51 to 53% identity with other published fungal AOX amino acid sequences. The enzyme catalyzed the oxidation of short-chain primary aliphatic alcohols with a preference for methanol (Km = 2.3 mM, kcat = 15.6 s−1). Using polyclonal antibodies and immunofluorescence staining, AOX was localized on liquid culture hyphae and extracellular slime in sections from degraded wood and on cotton fibers. Transmission electron microscopy immunogold labeling localized the enzyme in the hyphal periplasmic space and wall and on extracellular tripartite membranes and slime, while there was no labeling of hyphal peroxisomes. AOX was further shown to be associated with membranous or slime structures secreted by hyphae in wood fiber lumina and within the secondary cell walls of degraded wood fibers. The differences in AOX targeting compared to the known yeast peroxisomal localization were traced to a unique C-terminal sequence of the G. trabeum oxidase, which is apparently responsible for the protein's different translocation. The extracellular distribution and the enzyme's abundance and preference for methanol, potentially available from the demethylation of lignin, all point to a possible role for AOX as a major source of H2O2, a component of Fenton's reagent implicated in the generally accepted mechanisms for brown rot through the production of highly destructive hydroxyl radicals. PMID:17660304
Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho
2004-01-01
Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.
Karpyak, Victor M; Kim, Jeong-Hyun; Biernacka, Joanna M; Wieben, Eric D; Mrazek, David A; Black, John L; Choi, Doo-Sup
2009-04-01
Mpdz gene variations are known contributors of acute alcohol withdrawal severity and seizures in mice. To investigate the relevance of these findings for human alcoholism, we resequenced 46 exons, exon-intron boundaries, and 2 kilobases in the 5' region of the human MPDZ gene in 61 subjects with a history of alcohol withdrawal seizures (AWS), 59 subjects with a history of alcohol withdrawal without AWS, and 64 Coriell samples from self-reported nonalcoholic subjects [all European American (EA) ancestry] and compared with the Mpdz sequences of 3 mouse strains with different propensity to AWS. To explore potential associations of the human MPDZ gene with alcoholism and AWS, single SNP and haplotype analyses were performed using 13 common variants. Sixty-seven new, mostly rare variants were discovered in the human MPDZ gene. Sequence comparison revealed that the human gene does not have variations identical to those comprising Mpdz gene haplotype associated with AWS in mice. We also found no significant association between MPDZ haplotypes and AWS in humans. However, a global test of haplotype association revealed a significant difference in haplotype frequencies between alcohol-dependent subjects without AWS and Coriell controls (p = 0.015), suggesting a potential role of MPDZ in alcoholism and/or related phenotypes other than AWS. Haplotype-specific tests for the most common haplotypes (frequency > 0.05), revealed a specific high-risk haplotype (p = 0.006, maximum statistic p = 0.051), containing rs13297480G allele also found to be significantly more prevalent in alcoholics without AWS compared with nonalcoholic Coriell subjects (p = 0.019). Sequencing of MPDZ gene in individuals with EA ancestry revealed no variations in the sites identical to those associated with AWS in mice. Exploratory haplotype and single SNP association analyses suggest a possible association between the MPDZ gene and alcohol dependence but not AWS. Further functional genomic analysis of MPDZ
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Paternal alcoholism and offspring conduct disorder: evidence for the 'common genes' hypothesis.
Haber, Jon R; Jacob, Theodore; Heath, Andrew C
2005-04-01
Not only are alcoholism and externalizing disorders frequently comorbid, they often co-occur in families across generations; for example, paternal alcoholism predicts offspring conduct disorder just as it does offspring alcoholism. To clarify this relationship, the current study examined the 'common genes' hypothesis utilizing a children-of-twins research design. Participants were male monozygotic (MZ) and dizygotic (DZ) twins from the Vietnam Era Twin Registry who were concordant or discordant for alcohol dependence together with their offspring and the mothers of those offspring. All participants were conducted through a structured psychiatric interview. Offspring risk of conduct disorder was examined as a function of alcoholism genetic risk (due to paternal and co-twin alcohol dependence) and alcoholism environmental risk (due to being reared by a father with an alcohol dependence diagnosis). After controlling for potentially confounding variables, the offspring of alcohol-dependent fathers were significantly more likely to exhibit conduct disorder diagnoses than were offspring of nonalcohol-dependent fathers, thus indicating diagnostic crossover in generational family transmission. Comparing offspring at high genetic and high environmental risk with offspring at high genetic and low environmental risk indicated that genetic factors were most likely responsible for the alcoholism-conduct disorder association. The observed diagnostic crossover (from paternal alcoholism to offspring conduct disorder) across generations in the context of both high and low environmental risk (while genetic risk remained high) supported the common genes hypothesis.
Castillo, Jaime; Gáspár, Szilveszter; Sakharov, Ivan; Csöregi, Elisabeth
2003-05-01
Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase/peroxidase bienzyme systems. The H(2)O(2) produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and the newly purified sweet potato peroxidase (SPP) cross-linked to a redox polymer. The developed electrodes were characterized (sensitivity, stability, and performances in organic medium) and compared with similarly built ones using the 'classical' horseradish peroxidase (HRP). The SPP-based electrodes displayed higher sensitivity and better detection limit for putrescine than those using HRP and were also shown to retain their activity in organic phase much better than the HPR based ones. The importance of attractive or repulsive electrostatic interactions between the peroxidases and oxidases (determined by their isoelectric points) were found to play an important role in the sensitivity of the obtained sensors.
Genes, Environments, and Sex Differences in Alcohol Research.
Salvatore, Jessica E; Cho, Seung Bin; Dick, Danielle M
2017-07-01
The study of sex differences has been identified as one way to enhance scientific reproducibility, and the National Institutes of Health (NIH) have implemented a new policy to encourage the explicit examination of sex differences. Our goal here is to address sex differences in behavioral genetic research on alcohol outcomes. We review sex differences for alcohol outcomes and whether the source and magnitude of genetic influences on alcohol consumption and alcohol use disorder (AUD) are the same across sexes; describe common research designs for studying sex-specific gene-by-environment interaction (G × E) effects; and discuss the role of statistical power and theory when testing sex-specific genetic effects. There are robust sex differences for many alcohol outcomes. The weight of evidence suggests that the source and magnitude of genetic influences on alcohol consumption and AUD are the same across sexes. Whether there are sex-specific G × E effects has received less attention to date. The new NIH policy necessitates a systematic approach for studying sex-specific genetic effects in alcohol research. Researchers are encouraged to report power for tests of these effects and to use theory to develop testable hypotheses, especially for studies of G × E.
Candidate genes for alcohol dependence: A genetic association study from India.
Malhotra, Savita; Basu, Debasish; Khullar, Madhu; Ghosh, Abhishek; Chugh, Neera
2016-11-01
Search for candidate genes for alcohol dependence (AD) has been inconsistent and inconclusive. Moreover, most of the research has been confined to a few specific ethnic groups. Hence, the aim of our study was to explore specific candidate genes for AD in north Indian male population. In this clinic-based genetic association study, 210 males with AD and 200 controls matched for age, gender and ethnicity were recruited from the clinic and the general population, respectively. Cases were diagnosed with Semi-structured Assessment for Genetics of Alcoholism-II (SSAGA-II). Single-nucleotide polymorphism genotyping was done by real-time quantitative-polymerase chain reaction (PCR) using Taq Man assay (ABI 7500) fast real-time PCR system. Both at the genotypic level and at allelic frequency, Met158 variant of catechol-O-methyl transferase (COMT) showed significant increase in cases as compared to controls. The frequency of heterozygous genotype (A/G) of gamma-aminobutyric acid receptor A1 (GABRA1) was significantly lower in cases as compared to controls. Likewise, for GABRA2, the frequency of homozygous recessive genotype (G/G) was significantly higher in the control group. With respect to the 5-hydroxytryptamine (5HT) transporter long promoter region (5HTTLPR), cholinergic receptor muscarinic (CHRM2) and alcohol dehydrogenase 1B (ADH1B) genes, there was no significant difference between the cases and the controls. Aldehyde dehydrogenase (ALDH2) gene was found to be monomorphic in our study population. Our study findings showed COMT polymorphism conferring risk and GABRA polymorphism as a protective genotype for Indian male with AD. Genes for alcohol metabolism, serotonin transporter and cholinergic receptor gene polymorphism were perhaps not contributory to AD for Indian population.
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Wu, Lina; McIntosh, Mike; Zhang, Xueji; Ju, Huangxian
2007-12-15
Thionine had strong interaction with carbon nanofiber (CNF) and was used in the non-covalent functionalization of carbon nanofiber for the preparation of stable thionine-CNF nanocomposite with good dispersion. With a simple one-step electrochemical polymerization of thionine-CNF nanocomposite and alcohol oxidase (AOD), a stable poly(thionine)-CNF/AOD biocomposite film was formed on electrode surface. Based on the excellent catalytic activity of the biocomposite film toward reduction of dissolved oxygen, a sensitive ethanol biosensor was proposed. The ethanol biosensor could monitor ethanol ranging from 2.0 to 252 microM with a detection limit of 1.7 microM. It displayed a rapid response, an expanded linear response range as well as excellent reproducibility and stability. The combination of catalytic activity of CNF and the promising feature of the biocomposite with one-step non-manual technique favored the sensitive determination of ethanol with improved analytical capabilities.
Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1
Smesrud, Logan; Tebo, Bradley M.
2016-01-01
ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the
Association of alcohol-metabolizing genes with alcoholism in a Mexican Indian (Otomi) population.
Montano Loza, Aldo J; Ramirez Iglesias, Maria Teresa; Perez Diaz, Ivan; Cruz Castellanos, Socorro; Garcia Andrade, Consuelo; Medina Mora, Maria Elena; Robles Díaz, Guillermo; Kershenobich, David; Gutierrez Reyes, Gabriela
2006-06-01
Association studies provide a powerful approach to link DNA variants and genetic predisposition to complex diseases. In this study, we determined the genotype and allelic frequencies of genes encoding enzymes involved in alcohol metabolism in alcoholic and nonalcoholic subjects of related ethnicity. A total of 118 individuals of Otomi Mexican Indian ancestry were included. Fifty-nine were chronic alcoholics according to WHO criteria and alcohol dependents according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM IV) criteria. They were compared to 59 teetotalers or alcohol consumers of <10 g per day. The restriction fragment length polymorphisms analyzed were ADH1B/MaeIII, ALDH2/MboII, CYP2E1/DraI, CYP2E1/RsaI, and CYP2E1/TaqI. Of the studied polymorphisms, a significant difference between alcoholic and nonalcoholic Otomies was observed only in the CYP2E1/TaqI. The common genotype in alcoholics was A1/A2 (54%), and in nonalcoholics the homozygous A2/A2 (63%) (odds ratio [OR]: 0.28; 95% confidence interval [CI]: 0.13-0.60; P=.002). The frequency of the mutant allele A1 was significantly higher in alcoholics than in nonalcoholics (41 vs. 21%; OR: 2.4; 95% CI: 1.3-4.3; P=.003). This documents the presence of a polymorphism of CYP2E1 that is overexpressed in alcoholic Otomies, in which the variant allele (A1 of CYP2E1/TaqI) is associated with increased susceptibility to alcoholism. The appreciation that this finding may be an additional factor contributing to the high frequency of liver cirrhosis in Otomies requires further investigation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira
1995-12-18
The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD.more » 7 refs., 2 figs., 1 tab.« less
R1, a novel repressor of the human monoamine oxidase A.
Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C
2005-03-25
Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Association of the HTR2A Gene with Alcohol and Heroin Abuse
Cao, Jian; Liu, Xiangtao; Han, Shizhong; Zhang, Clarence K.; Liu, Zongzhi; Li, Dawei
2014-01-01
Positive genetic associations of rs6313 (102T/C at exon 1) and rs6311 (-1438A/G) on the 5-hydroxytryptamine (serotonin) 2A receptor gene (HTR2A or 5-HT2A) were reported for alcohol and drug abuse, however, other association studies failed to produce consistent results supporting the susceptibility of the two single nucleotide polymorphisms (SNPs). To clarify the associations of the HTR2A gene with substance use disorders, we performed a meta-analysis based on the genotypes from the available candidate gene association studies of the two SNPs with alcohol and drug abuse from multiple populations. Evidence of association was found for HTR2A rs6313 in all the combined studies (e.g., allelic P = 0.0048 and OR = 0.86, 95% CI 0.77 – 0.95) and also in the combined studies of alcohol dependence (abuse) (e.g., allelic P = 0.0001 and OR = 0.71, 95% CI 0.59 – 0.85). The same association trend was also observed in the SAGE (Study of Addiction: Genetics and Environment) datasets. The meta-analysis supports a contribution of the HTR2A gene to the susceptibility to substance use disorders, particularly alcohol dependence. PMID:24178752
McBride, William J.; Kimpel, Mark W.; McClintick, Jeanette N.; Ding, Zheng-Ming; Edenberg, Howard J.; Liang, Tiebing; Rodd, Zachary A.; Bell, Richard L.
2014-01-01
The objective of this study was to determine changes in gene expression within the extended amygdala following binge-like alcohol drinking by male adolescent alcohol-preferring (P) rats. Starting at 28 days of age, P rats were given concurrent access to 15 and 30 % ethanol for 3 one-h sessions/day for 5 consecutive days/week for 3 weeks. Rats were killed by decapitation 3 h after the first ethanol access session on the 15th day of drinking. RNA was prepared from micropunch samples of the nucleus accumbens shell (Acb-sh) and central nucleus of the amygdala (CeA). Ethanol intakes were 2.5 – 3.0 g/kg/session. There were 154 and 182 unique named genes that significantly differed (FDR = 0.2) between the water and ethanol group in the Acb-sh and CeA, respectively. Gene Ontology (GO) analyses indicated that adolescent binge drinking produced changes in biological processes involved with cell proliferation and regulation of cellular structure in the Acb-sh, and in neuron projection and positive regulation of cellular organization in the CeA. Ingenuity Pathway Analysis indicated that, in the Acb-sh, there were several major intracellular signaling pathways (e.g., cAMP-mediated and protein kinase A signaling pathways) altered by adolescent drinking, with 3-fold more genes up-regulated than down-regulated in the alcohol group. The cAMP-mediated signaling system was also up-regulated in the CeA of the alcohol group. Weighted gene co-expression network analysis indicated significant G-protein coupled receptor signaling and transmembrane receptor protein kinase signaling categories in the Acb-sh and CeA, respectively. Overall, the results of this study indicated that binge-like alcohol drinking by adolescent P rats is differentially altering the expression of genes in the Acb-sh and CeA, some of which are involved in intracellular signaling pathways and may produce changes in neuronal function. PMID:24355552
Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A
2007-01-01
Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Slutske, Wendy S; Deutsch, Arielle R; Piasecki, Thomas M
2018-05-07
Genetic influences on alcohol involvement are likely to vary as a function of the 'alcohol environment,' given that exposure to alcohol is a necessary precondition for genetic risk to be expressed. However, few gene-environment interaction studies of alcohol involvement have focused on characteristics of the community-level alcohol environment. The goal of this study was to examine whether living in a community with more alcohol outlets would facilitate the expression of the genetic propensity to drink in a genetically-informed national survey of United States young adults. The participants were 2434 18-26-year-old twin, full-, and half-sibling pairs from Wave III of the National Longitudinal Study of Adolescent to Adult Health. Participants completed in-home interviews in which alcohol use was assessed. Alcohol outlet densities were extracted from state-level liquor license databases aggregated at the census tract level to derive the density of outlets. There was evidence that the estimates of genetic and environmental influences on alcohol use varied as a function of the density of alcohol outlets in the community. For example, the heritability of the frequency of alcohol use for those residing in a neighborhood with ten or more outlets was 74% (95% confidence limits = 55-94%), compared with 16% (95% confidence limits = 0-34%) for those in a neighborhood with zero outlets. This moderating effect of alcohol outlet density was not explained by the state of residence, population density, or neighborhood sociodemographic characteristics. The results suggest that living in a neighborhood with many alcohol outlets may be especially high-risk for those individuals who are genetically predisposed to frequently drink.
Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu
2016-01-01
It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.
Bonthius, Daniel J.; Winters, Zachary; Karacay, Bahri; Bousquet, Samantha Larimer; Bonthius, Daniel J.
2014-01-01
The cerebellum is a major target of alcohol-induced damage in the developing brain. However, the cerebella of some children are much more seriously affected than others by prenatal alcohol exposure. As a consequence of in utero alcohol exposure, some children have substantial reductions in cerebellar volume and corresponding neurodevelopmental problems, including microencephaly, ataxia, and balance deficits, while other children who were exposed to similar alcohol quantities are spared. One factor that likely plays a key role in determining the impact of alcohol on the fetal cerebellum is genetics. However, no specific gene variant has yet been identified that worsens cerebellar function as a consequence of developmental alcohol exposure. Previous studies have revealed that mice carrying a homozygous mutation of the gene for neuronal nitric oxide synthase (nNOS−/− mice) have more severe acute alcohol-induced neuronal losses from the cerebellum than wild type mice. Therefore, the goals of this study were to determine whether alcohol induces more severe cerebellum-based behavioral deficits in nNOS−/− mice than in wild type mice and to determine whether these worsened behavior deficits are associated with worsened cerebellar neuronal losses. nNOS−/− mice and their wild type controls received alcohol (0.0, 2.2, or 4.4 mg/g) daily over postnatal days 4–9. In adulthood, the mice underwent behavioral testing, followed by neuronal quantification. Alcohol caused dose-related deficits in rotarod and balance beam performance in both nNOS−/− and wild type mice. However, the alcohol-induced behavioral deficits were substantially worse in the nNOS−/− mice than in wild type. Likewise, alcohol exposure led to losses of Purkinje cells and cerebellar granule cells in mice of both genotypes, but the cell losses were more severe in the nNOS−/− mice than in wild type. Behavioral performances were correlated with neuronal number in the nNOS−/− mice, but not
D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars
2017-06-02
Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
2012-01-01
Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on
McClintick, Jeanette N; McBride, William J; Bell, Richard L; Ding, Zheng-Ming; Liu, Yunlong; Xuei, Xiaoling; Edenberg, Howard J
2018-05-01
Binge drinking of alcohol during adolescence is a serious public health concern with long-term consequences, including decreased hippocampal and prefrontal cortex volume and deficits in memory. We used RNA sequencing to assess the effects of adolescent binge drinking on gene expression in these regions. Male adolescent alcohol-preferring (P) rats were exposed to repeated binge drinking (three 1-h sessions/day during the dark/cycle, 5 days/week for 3 weeks starting at 28 days of age; ethanol intakes of 2.5-3 g/kg/session). Ethanol significantly altered the expression of 416 of 11,727 genes expressed in the ventral hippocampus. Genes and pathways involved in neurogenesis, long-term potentiation, and axonal guidance were decreased, which could relate to the impaired memory function found in subjects with adolescent alcohol binge-like exposure. The decreased expression of myelin and cholesterol genes and apparent decrease in oligodendrocytes in P rats could result in decreased myelination. In the medial prefrontal cortex, 638 of 11,579 genes were altered; genes in cellular stress and inflammatory pathways were increased, as were genes involved in oxidative phosphorylation. Overall, the results of this study suggest that adolescent binge-like alcohol drinking may alter the development of the ventral hippocampus and medial prefrontal cortex and produce long-term consequences on learning and memory, and on control of impulsive behaviors. Copyright © 2017 Elsevier Inc. All rights reserved.
Urwin, Ruth Elizabeth; Nunn, Kenneth Patrick
2005-03-01
The serotonin (5-HT) and norepinephrine (NE) systems are likely involved in the aetiology of anorexia nervosa (AN) as sufferers are premorbidly anxious. Specifically, we hypothesize that genes encoding proteins, which clear 5-HT and NE from the synapse, are prime candidates for affecting susceptibility to AN. Supporting our hypothesis, we earlier showed that the NE transporter (NET) and monoamine oxidase A (MAOA) genes appear to contribute additively to increased risk of developing restricting AN (AN-R). With regard to the MAOA gene, a sequence variant that increases MAOA activity and has suggested association with the anxiety condition, panic disorder was preferentially transmitted from parents to affected children. Here we provide evidence in support of interaction between the MAOA and serotonin transporter (SERT) genes in 114 AN nuclear families (patient with AN plus biological parents). A SERT gene genotype with no apparent individual effect on risk and known to be associated with anxiety is preferentially transmitted to children with AN (chi2 trend=9.457, 1 df, P=0.0021) and AN-R alone (chi2 trend=7.477, 1 df, P=0.0063) when the 'more active' MAOA gene variant is also transmitted. The increased risk of developing the disorder is up to eight times greater than the risk imposed by the MAOA gene variant alone--an example of synergistic epistatic interaction. If independently replicated, our findings to date suggest that we may have identified three genes affecting susceptibility to AN, particularly AN-R: the MAOA, SERT, and NET genes.
Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Garai, Cintia; Furuichi, Takeshi; Kawamoto, Yoshi; Ryu, Heungjin; Inoue-Murayama, Miho
2014-01-01
Androgen receptor gene (AR), monoamine oxidase A gene (MAOA) and monoamine oxidase B gene (MAOB) have been found to have associations with behavioral traits, such as aggressiveness, and disorders in humans. However, the extent to which similar genetic effects might influence the behavior of wild apes is unclear. We examined the loci AR glutamine repeat (ARQ), AR glycine repeat (ARG), MAOA intron 2 dinucleotide repeat (MAin2) and MAOB intron 2 dinucleotide repeat (MBin2) in 32 wild bonobos, Pan paniscus, and compared them with those of chimpanzees, Pan troglodytes, and humans. We found that bonobos were polymorphic on the four loci examined. Both loci MAin2 and MBin2 in bonobos showed a higher diversity than in chimpanzees. Because monoamine oxidase influences aggressiveness, the differences between the polymorphisms of MAin2 and MBin2 in bonobos and chimpanzees may be associated with the differences in aggression between the two species. In order to understand the evolution of these loci and AR, MAOA and MAOB in humans and non-human primates, it would be useful to conduct future studies focusing on the potential association between aggressiveness, and other personality traits, and polymorphisms documented in bonobos. PMID:25606465
NASA Astrophysics Data System (ADS)
Afshari, Esmail; Mazinani, Saeedeh; Ranaei-Siadat, Seyed-Omid; Ghomi, Hamid
2016-11-01
Polymeric nanofiber prepares a suitable situation for enzyme immobilization for variety of applications. In this research, we have fabricated polyvinyl alcohol (PVA)/malonic acid nanofibers using electrospinning. After fabrication of nanofibers, the effect of air, nitrogen, CO2, and argon DBD (dielectric barrier discharge) plasmas on PVA/malonic acid nanofibers were analysed. Among them, air plasma had the most significant effect on glucose oxidase (GOx) immobilization. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrum analysis and X-ray photoelectron spectroscopy (XPS) results revealed that in case of air plasma modified nanofibers, the carboxyl groups on the surface are increased. The scanning electron microscopy (SEM) images showed that, after GOx immobilization, the modified nanofibers with plasma has retained its nanofiber structure. Finally, we analysed reusability and storage stability of GOx immobilized on plasma modified and unmodified nanofibers. The results were more satisfactory for modified nanofibers with respect to unmodified ones.
Borecky, Jirí; Nogueira, Fábio T S; de Oliveira, Kívia A P; Maia, Ivan G; Vercesi, Aníbal E; Arruda, Paulo
2006-01-01
The simultaneous existence of alternative oxidases and uncoupling proteins in plants has raised the question as to why plants need two energy-dissipating systems with apparently similar physiological functions. A probably complete plant uncoupling protein gene family is described and the expression profiles of this family compared with the multigene family of alternative oxidases in Arabidopsis thaliana and sugarcane (Saccharum sp.) employed as dicot and monocot models, respectively. In total, six uncoupling protein genes, AtPUMP1-6, were recognized within the Arabidopsis genome and five (SsPUMP1-5) in a sugarcane EST database. The recombinant AtPUMP5 protein displayed similar biochemical properties as AtPUMP1. Sugarcane possessed four Arabidopsis AOx1-type orthologues (SsAOx1a-1d); no sugarcane orthologue corresponding to Arabidopsis AOx2-type genes was identified. Phylogenetic and expression analyses suggested that AtAOx1d does not belong to the AOx1-type family but forms a new (AOx3-type) family. Tissue-enriched expression profiling revealed that uncoupling protein genes were expressed more ubiquitously than the alternative oxidase genes. Distinct expression patterns among gene family members were observed between monocots and dicots and during chilling stress. These findings suggest that the members of each energy-dissipating system are subject to different cell or tissue/organ transcriptional regulation. As a result, plants may respond more flexibly to adverse biotic and abiotic conditions, in which oxidative stress is involved.
Recovery of choline oxidase activity by in vitro recombination of individual segments.
Heinze, Birgit; Hoven, Nina; O'Connell, Timothy; Maurer, Karl-Heinz; Bartsch, Sebastian; Bornscheuer, Uwe T
2008-11-01
Initial attempts to express a choline oxidase from Arthrobacter pascens (APChO-syn) in Escherichia coli starting from a synthetic gene only led to inactive protein. However, activity was regained by the systematic exchange of individual segments of the gene with segments from a choline oxidase-encoding gene from Arthrobacter globiformis yielding a functional chimeric enzyme. Next, a sequence alignment of the exchanged segment with other choline oxidases revealed a mutation in the APChO-syn, showing that residue 200 was a threonine instead of an asparagine, which is, thus, crucial for confering enzyme activity and, hence, provides an explanation for the initial lack of activity. The active recombinant APChO-syn-T200N variant was biochemically characterized showing an optimum at pH 8.0 and at 37 degrees C. Furthermore, the substrate specificity was examined using N,N-dimethylethanolamine, N-methylethanolamine and 3,3-dimethyl-1-butanol.
Liu, Lei
2012-01-01
Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Alcoholism and alcohol drinking habits predicted from alcohol dehydrogenase genes.
Tolstrup, Janne Schurmann; Nordestgaard, Børge Grønne; Rasmussen, Søren; Tybjaerg-Hansen, Anne; Grønbaek, Morten
2008-06-01
Alcohol drinking habits and alcoholism are partly genetically determined. Alcohol is degraded primarily by alcohol dehydrogenase (ADH) wherein genetic variation that affects the rate of alcohol degradation is found in ADH1B and ADH1C. It is biologically plausible that these variations may be associated with alcohol drinking habits and alcoholism. By genotyping 9080 white men and women from the general population, we found that men and women with ADH1B slow vs fast alcohol degradation drank more alcohol and had a higher risk of everyday drinking, heavy drinking, excessive drinking and of alcoholism. For example, the weekly alcohol intake was 9.8 drinks (95% confidence interval (CI): 9.1-11) among men with the ADH1B.1/1 genotype compared to 7.5 drinks (95% CI: 6.4-8.7) among men with the ADH1B.1/2 genotype, and the odds ratio (OR) for heavy drinking was 3.1 (95% CI: 1.7-5.7) among men with the ADH1B.1/1 genotype compared to men with the ADH1B.1/2 genotype. Furthermore, individuals with ADH1C slow vs fast alcohol degradation had a higher risk of heavy and excessive drinking. For example, the OR for heavy drinking was 1.4 (95% CI: 1.1-1.8) among men with the ADH1C.1/2 genotype and 1.4 (95% CI: 1.0-1.9) among men with the ADH1B.2/2 genotype, compared with men with the ADH1C.1/1 genotype. Results for ADH1B and ADH1C genotypes among men and women were similar. Finally, because slow ADH1B alcohol degradation is found in more than 90% of the white population compared to less than 10% of East Asians, the population attributable risk of heavy drinking and alcoholism by ADH1B.1/1 genotype was 67 and 62% among the white population compared with 9 and 24% among the East Asian population.
Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis
Ingram, Lonnie O.; Conway, Tyrrell
1992-01-01
The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.
Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo
2006-06-01
Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.
2010-01-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Landgren, Sara; Engel, Jörgen A; Hyytiä, Petri; Zetterberg, Henrik; Blennow, Kaj; Jerlhag, Elisabet
2011-08-01
The mechanisms involved in alcohol use disorder, a chronic relapsing brain disorder, are complex and involve various signalling systems in the brain. Recently, the orexigenic peptide ghrelin was shown to be required for alcohol-induced reward, an effect mediated via ghrelin receptors, GHS-R1A, at the level of the cholinergic-dopaminergic reward link. Moreover, ghrelin increases and GHR-R1A antagonists reduce moderate alcohol consumption in mice, and a single nucleotide polymorphism in the GHS-R1A gene has been associated with high alcohol consumption in humans. Therefore, GHS-R1A gene expression and alcohol intake were investigated in high, AA (Alko, Alcohol), versus low, ANA (Alko, Non-Alcohol), alcohol consuming rats as well as in Wistar rats. In the AA and ANA rats plasma ghrelin levels were also measured. GHS-R1A gene expression was increased in AA compared to ANA rats in nucleus accumbens, ventral tegmental area, amygdala, prefrontal cortex and hippocampus. A similar trend was observed in the ventral tegmental area of Wistar rats consuming high amounts of alcohol. Furthermore, the AA rats had significantly smaller reduction of plasma ghrelin levels over time, after several weeks of alcohol exposure, than had the ANA rats. The present study provides further evidence for that the ghrelin signalling system, in particular at the level of the mesocortocolimbic dopamine system, is involved in alcohol consumption, and thus possibly contributes to alcohol use disorder. Therefore the GHS-R1A may constitute a novel candidate for development of new treatment strategies for alcohol dependence. Copyright © 2011 Elsevier B.V. All rights reserved.
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco Javier
2009-11-01
The genetic basis for the predisposition to alcoholic liver cirrhosis (ALC) remains unknown. Increasing evidence supports a role for the nuclear factor (NF)-kappaB, the NF-kappaB inhibitor alpha (NFKBIA), and the peroxisome proliferator-activated receptor (PPAR)-gamma in the pathogenesis of alcoholic liver disease, raising the possibility that common polymorphisms in genes encoding these molecules may confer susceptibility to ALC. The objective of this study was to analyze the relationship between common polymorphisms in NFKB1, NFKBIA, and PPARG2 genes and the presence of ALC. A total of 258 male alcoholics (161 without liver disease and 97 with ALC) and 101 healthy controls were genotyped for the -94ins/delATTG NFKB1, 3'-UTR+126G>A NFKBIA, and 34C>G PPARG2 polymorphisms. The association of these genetic variants with ALC was tested in alcoholic patients with alcohol abuse and alcohol dependence. A logistic regression analysis was further performed to analyze the model of inheritance. We found an association between the presence of the deletion allele in NFKB1 polymorphism and ALC in patients with alcohol dependence. We found no association between NFKBIA and PPARG2 polymorphisms and the presence of ALC. The deletion allele of the -94ins/del NFKB1 polymorphism could be associated with a higher risk of developing ALC through an increase in inflammation, as supported by previous data.
Wang, Tzu-Yun; Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Chen, Shih-Heng; Chu, Chun-Hsien; Huang, San-Yuan; Tzeng, Nian-Sheng; Wang, Chen-Lin; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang; Lu, Ru-Band
2012-07-11
Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism's heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n=120) and antisocial non-alcoholism (AS-N-ALC) group (n=153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan's Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism.
Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J
2015-07-01
Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.
Zhao, Zhongming; Guo, An-Yuan; van den Oord, Edwin J C G; Aliev, Fazil; Jia, Peilin; Edenberg, Howard J; Riley, Brien P; Dick, Danielle M; Bettinger, Jill C; Davies, Andrew G; Grotewiel, Michael S; Schuckit, Marc A; Agrawal, Arpana; Kramer, John; Nurnberger, John I; Kendler, Kenneth S; Webb, Bradley T; Miles, Michael F
2012-01-01
A variety of species and experimental designs have been used to study genetic influences on alcohol dependence, ethanol response, and related traits. Integration of these heterogeneous data can be used to produce a ranked target gene list for additional investigation. In this study, we performed a unique multi-species evidence-based data integration using three microarray experiments in mice or humans that generated an initial alcohol dependence (AD) related genes list, human linkage and association results, and gene sets implicated in C. elegans and Drosophila. We then used permutation and false discovery rate (FDR) analyses on the genome-wide association studies (GWAS) dataset from the Collaborative Study on the Genetics of Alcoholism (COGA) to evaluate the ranking results and weighting matrices. We found one weighting score matrix could increase FDR based q-values for a list of 47 genes with a score greater than 2. Our follow up functional enrichment tests revealed these genes were primarily involved in brain responses to ethanol and neural adaptations occurring with alcoholism. These results, along with our experimental validation of specific genes in mice, C. elegans and Drosophila, suggest that a cross-species evidence-based approach is useful to identify candidate genes contributing to alcoholism.
Genetics Home Reference: isolated sulfite oxidase deficiency
... Metabolic Disorders (CLIMB) March of Dimes: Amino Acid Metabolism Disorders The Compassionate Friends GeneReviews (1 link) Isolated Sulfite Oxidase Deficiency ClinicalTrials.gov (1 link) ClinicalTrials.gov Scientific Articles on PubMed (1 link) PubMed OMIM (1 link) ...
A Novel (S)-6-Hydroxynicotine Oxidase Gene from Shinella sp. Strain HZN7
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong
2014-01-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s−1) and nicotine (Km = 2.03 mM, kcat = 0.396 s−1) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. PMID:25002425
Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.
1998-01-01
The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085
Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.
Clary, D O; Wolstenholme, D R
1983-01-01
Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262
Edenberg, Howard J; Foroud, Tatiana
2013-08-01
Alcohol is widely consumed; however, excessive use creates serious physical, psychological and social problems and contributes to the pathogenesis of many diseases. Alcohol use disorders (that is, alcohol dependence and alcohol abuse) are maladaptive patterns of excessive drinking that lead to serious problems. Abundant evidence indicates that alcohol dependence (alcoholism) is a complex genetic disease, with variations in a large number of genes affecting a person's risk of alcoholism. Some of these genes have been identified, including two genes involved in the metabolism of alcohol (ADH1B and ALDH2) that have the strongest known affects on the risk of alcoholism. Studies continue to reveal other genes in which variants affect the risk of alcoholism or related traits, including GABRA2, CHRM2, KCNJ6 and AUTS2. As more variants are analysed and studies are combined for meta-analysis to achieve increased sample sizes, an improved picture of the many genes and pathways that affect the risk of alcoholism will be possible.
Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.
Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J
2017-04-01
Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on
Landgren, Sara; Berglund, Kristina; Jerlhag, Elisabet; Fahlke, Claudia; Balldin, Jan; Berggren, Ulf; Zetterberg, Henrik; Blennow, Kaj; Engel, Jörgen A
2011-01-01
Components of the brain reward system, i.e. the mesolimbic dopamine, laterodorsal cholinergic and ghrelin signaling systems, have been implicated in alcohol reward in preclinical studies. Genetic variants of these systems have previously been linked to alcohol dependence. Here, we genotyped 31 single nucleotide polymorphisms (SNPs): 1 SNP in the dopamine D₂ receptor (DRD2) gene, 20 SNPs in 5 different nicotinic acetylcholine receptor subunit (CHRN*) genes, and 10 SNPs in the genes encoding pro-ghrelin (GHRL) and its receptor (GHSR), in a pilot study of type 1 alcoholics (n = 84) and healthy controls (n = 32). These individuals were characterized using the Temperament and Character Inventory. None of the SNPs were associated with risk of alcohol dependence in this population. The GG genotype of SNP rs13261190 in the CHRNB3 was associated with increased novelty seeking, while SNPs of the ghrelin signaling system were associated with decreased self-directedness (AA of rs495225, GHSR) and alterations in self-transcendence (AA of both rs42451 and rs35680, GHRL). In conclusion, this pilot study suggests that reward-related genes are associated with altered personality scores in type 1 alcohol dependence, which warrants future studies of these associations in larger study samples. Copyright © 2011 S. Karger AG, Basel.
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini
2018-01-01
Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.
LoParo, Devon; Johansson, Ada; Walum, Hasse; Westberg, Lars; Santtila, Pekka; Waldman, Irwin
2016-07-01
Naturalistic studies of gene-environment interactions (G X E) have been plagued by several limitations, including difficulty isolating specific environmental risk factors from other correlated aspects of the environment, gene-environment correlation (rGE ), and the use of a single genetic variant to represent the influence of a gene. We present results from 235 Finnish young men in two lab studies of aggression and alcohol challenge that attempt to redress these limitations of the extant G X E literature. Specifically, we use a latent variable modeling approach in an attempt to more fully account for genetic variation across the oxytocin receptor gene (OXTR) and to robustly test its main effects on aggression and its interaction with alcohol exposure. We also modeled aggression as a latent variable comprising various indices, including the average and maximum levels of aggression, the earliest trial on which aggression was expressed, and the proportion of trials on which the minimum and maximum levels of aggression were expressed. The best fitting model for the genetic variation across OXTR included six factors derived from an exploratory factor analysis, roughly corresponding to six haplotype blocks. Aggression levels were higher on trials in which participants were administered alcohol, won, or were provoked. There was a significant main effect of OXTR on aggression across studies after controlling for covariates. The interaction of OXTR and alcohol was also significant across studies, such that OXTR had stronger effects on aggression in the alcohol administration condition. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.
Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu
2014-01-01
POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.
Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior
Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti
2009-01-01
Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058
Effects of MAOA-genotype, alcohol consumption, and aging on violent behavior.
Tikkanen, Roope; Sjöberg, Rickard L; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti
2009-03-01
Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype.
Gao, Zhaowei; Li, Zhuofu; Zhang, Yuhong; Huang, Huoqing; Li, Mu; Zhou, Liwei; Tang, Yunming; Yao, Bin; Zhang, Wei
2012-03-01
The glucose oxidase (GOD) gene from Penicillium notatum was expressed in Pichia pastoris. The 1,815 bp gene, god-w, encodes 604 amino acids. Recombinant GOD-w had optimal activity at 35-40°C and pH 6.2 and was stable, from pH 3 to 7 maintaining >75% maximum activity after incubation at 50°C for 1 h. GOD-w worked as well as commercial GODs to improve bread making. To achieve high-level expression of recombinant GOD in P. pastoris, 272 nucleotides involving 228 residues were mutated, consistent with the codon bias of P. pastoris. The optimized recombinant GOD-m yielded 615 U ml(-1) (2.5 g protein l(-1)) in a 3 l fermentor--410% higher than GOD-w (148 U ml(-1)), and thus is a low-cost alternative for the bread baking industry.
Exploiting algal NADPH oxidase for biophotovoltaic energy
Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...
2015-01-29
Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1
Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.
2001-01-01
It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Y Chromosome Regulation of Autism Susceptibility Genes
2009-06-01
with human -like spontaneous mutation. Neuroreport, 2008. 19(7): p. 739-43. 60. Lin, Y.M., et al., Association analysis of monoamine oxidase A gene and...susceptibility genes, including the monoamine oxidase A (MOAA), mediator complex subunit 12 (MED12), homeobox B1 (HOXB1) gastrin-releasing peptide...autism susceptibility genes, the RET proto- oncogene and monoamine oxidase A (MAOA) gene for detail studies. MAOA deaminates monoamines and is involved
A novel (S)-6-hydroxynicotine oxidase gene from Shinella sp. strain HZN7.
Qiu, Jiguo; Wei, Yin; Ma, Yun; Wen, Rongti; Wen, Yuezhong; Liu, Weiping
2014-09-01
Nicotine is an important environmental toxicant in tobacco waste. Shinella sp. strain HZN7 can metabolize nicotine into nontoxic compounds via variations of the pyridine and pyrrolidine pathways. However, the catabolic mechanism of this variant pathway at the gene or enzyme level is still unknown. In this study, two 6-hydroxynicotine degradation-deficient mutants, N7-M9 and N7-W3, were generated by transposon mutagenesis. The corresponding mutant genes, designated nctB and tnp2, were cloned and analyzed. The nctB gene encodes a novel flavin adenine dinucleotide-containing (S)-6-hydroxynicotine oxidase that converts (S)-6-hydroxynicotine into 6-hydroxy-N-methylmyosmine and then spontaneously hydrolyzes into 6-hydroxypseudooxynicotine. The deletion and complementation of the nctB gene showed that this enzyme is essential for nicotine or (S)-6-hydroxynicotine degradation. Purified NctB could also convert (S)-nicotine into N-methylmyosmine, which spontaneously hydrolyzed into pseudooxynicotine. The kinetic constants of NctB toward (S)-6-hydroxynicotine (Km = 0.019 mM, kcat = 7.3 s(-1)) and nicotine (Km = 2.03 mM, kcat = 0.396 s(-1)) indicated that (S)-6-hydroxynicotine is the preferred substrate in vivo. NctB showed no activities toward the R enantiomer of nicotine or 6-hydroxynicotine. Strain HZN7 could degrade (R)-nicotine into (R)-6-hydroxynicotine without any further degradation. The tnp2 gene from mutant N7-W3 encodes a putative transposase, and its deletion did not abolish the nicotine degradation activity. This study advances the understanding of the microbial diversity of nicotine biodegradation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
2012-01-01
Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n = 120) and antisocial non-alcoholism (AS-N-ALC) group (n = 153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism. PMID:22550993
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Flatscher-Bader, T; Zuvela, N; Landis, N; Wilce, P A
2008-01-01
Drugs of abuse including nicotine and alcohol elicit their effect by stimulating the mesocorticolimbic dopaminergic system. There is a high incidence of nicotine dependence in alcoholics. To date only limited data is available on the molecular mechanism underlying the action of alcohol and nicotine in the human brain. This study utilized gene expression screening to identify genes sensitive to chronic alcohol abuse within the ventral tegmental area (VTA) of the human brain. Alcohol-responsive genes encoded proteins primarily involved in structural plasticity and neurotransmitter transport and release. In particular, genes involved with brain-derived neurotrophic factor signalling and glutamatergic transmission were found to be affected. The possibility that glutamate transport was a target of chronic alcohol and/or tobacco abuse was further investigated in an extended case set by measurement of mRNA and protein expression. Expression levels of vesicular glutamate transporters SLC17A6 and SLC17A7 were robustly induced by smoking, an effect that was reduced by alcohol co-exposure. Glutamatergic transmission is vital for the control of the VTA and may also be critical to the weighting of novelty and importance of a stimulus, an essential output of this brain region. We conclude that enduring plasticity within the VTA may be a major molecular mechanism for the maintenance of smoking addiction and that alcohol, nicotine and co-abuse have distinct impacts on glutamatergic transmission with important implications for the control of this core mesolimbic structure.
Functional polymorphisms in the sigma1 receptor gene associated with alcoholism.
Miyatake, Ryosuke; Furukawa, Aizo; Matsushita, Sachio; Higuchi, Susumu; Suwaki, Hiroshi
2004-01-01
Sigma1 receptors are involved in the pathogenesis of drug abuse. Two polymorphisms (GC-241-240TT and Gln2Pro) in the sigma1 receptor gene (SIGMAR1) have been identified. To investigate the role of SIGMAR1 in conveying susceptibility to alcoholism, we performed a functional analysis of polymorphisms in the SIGMAR1 and a case-control study. We initially screened for polymorphisms in the 5'-upstream region. The effects of the polymorphisms on transcriptional activity were determined using a gene reporter assay. The distribution of SIGMAR1 polymorphisms was analyzed in 307 alcoholic and 302 control subjects. A novel T-485A polymorphism was identified. The transcriptional activity of the A-485 allele and the TT-241-240 allele was significantly reduced compared with that of the T-485 allele and the GC-241-240 allele. The frequencies of the A-485 allele (chi2=5.575, df=1, p=.0205) and the TT-241-240/Pro2 haplotype (chi2=21.464, df=1, p<.0001) were significantly higher in control subjects compared with alcoholic subjects. The T-485A and the GC-241-240TT may be functional polymorphisms, and the A-485 allele and TT-241-240/Pro2 haplotype are possible protective factors for the development of alcoholism.
Induction of innate immune genes in brain create the neurobiology of addiction.
Crews, F T; Zou, Jian; Qin, Liya
2011-06-01
Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
Induction of Innate Immune Genes in Brain Create the Neurobiology of Addiction
Crews, FT; Zou, Jian; Qin, Liya
2013-01-01
Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. PMID:21402143
The monoamine oxidase A gene promoter repeat and prostate cancer risk.
White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S
2012-11-01
Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.
Pardo-Planas, Oscar; Prade, Rolf A; Müller, Michael; Atiyeh, Hasan K; Wilkins, Mark R
2017-11-01
An Aspergillus nidulans cell factory was genetically engineered to produce an aryl alcohol oxidase (AAO). The cell factory initiated production of melanin when growth-limited conditions were established using stationary plates and shaken flasks. This phenomenon was more pronounced when the strain was cultured in a trickle bed reactor (TBR). This study investigated different approaches to reduce melanin formation in fungal mycelia and liquid medium in order to increase the enzyme production yield. Removal of copper from the medium recipe reduced melanin formation in agar cultures and increased enzyme activities by 48% in agitated liquid cultures. Copper has been reported as a key element for tyrosinase, an enzyme responsible for melanin production. Ascorbic acid (0.44g/L) stopped melanin accumulation, did not affect growth parameters and resulted in AAO activity that was more than two-fold greater than a control treatment with no ascorbic acid. Copyright © 2017 Elsevier Ltd. All rights reserved.
Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers
Dashti, S. Ghazaleh; Buchanan, Daniel D.; Jayasekara, Harindra; Ouakrim, Driss Ait; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M.; Macrae, Finlay A.; Giles, Graham G.; Parry, Susan; Casey, Graham; Haile, Robert W.; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N.; Lindor, Noralane M.; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko
2016-01-01
Background People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the association between alcohol consumption and colorectal cancer. Results Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (standard deviation) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 grams/day and >28 grams/day were associated with increased colorectal cancer risk (HR, 1.50; 95%CI, 1.09–2.07 and 1.69; 95%CI, 1.07–2.65 respectively; P-trend=0.05), and colon cancer risk (HR, 1.78; 95%CI, 1.27–2.49 and 1.94; 95%CI, 1.19–3.18 respectively; P-trend=0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusion Our data suggests that alcohol consumption, particularly more than 28 grams/day of ethanol (~2 standard drinks of alcohol in the US), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. PMID:27811119
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Zhou, Fasong; Zhang, Ziguo; Gregersen, Per L.; Mikkelsen, Jørn D.; de Neergaard, Eigil; Collinge, David B.; Thordal-Christensen, Hans
1998-01-01
Previously we reported that oxalate oxidase activity increases in extracts of barley (Hordeum vulgare) leaves in response to the powdery mildew fungus (Blumeria [syn. Erysiphe] graminis f.sp. hordei) and proposed this as a source of H2O2 during plant-pathogen interactions. In this paper we show that the N terminus of the major pathogen-response oxalate oxidase has a high degree of sequence identity to previously characterized germin-like oxalate oxidases. Two cDNAs were isolated, pHvOxOa, which represents this major enzyme, and pHvOxOb', representing a closely related enzyme. Our data suggest the presence of only two oxalate oxidase genes in the barley genome, i.e. a gene encoding HvOxOa, which possibly exists in several copies, and a single-copy gene encoding HvOxOb. The use of 3′ end gene-specific probes has allowed us to demonstrate that the HvOxOa transcript accumulates to 6 times the level of the HvOxOb transcript in response to the powdery mildew fungus. The transcripts were detected in both compatible and incompatible interactions with a similar accumulation pattern. The oxalate oxidase is found exclusively in the leaf mesophyll, where it is cell wall located. A model for a signal transduction pathway in which oxalate oxidase plays a central role is proposed for the regulation of the hypersensitive response. PMID:9576772
Suchankova, Petra; Yan, Jia; Schwandt, Melanie L; Stangl, Bethany L; Jerlhag, Elisabet; Engel, Jörgen A; Hodgkinson, Colin A; Ramchandani, Vijay A; Leggio, Lorenzo
2017-07-01
The orexigenic peptide ghrelin may enhance the incentive value of food-, drug- and alcohol-related rewards. Consistent with preclinical findings, human studies indicate a role of ghrelin in alcohol use disorders (AUD). In the present study an a priori hypothesis-driven analysis was conducted to investigate whether a Leu72Met missense polymorphism (rs696217) in the prepro-ghrelin gene (GHRL), is associated with AUD, alcohol consumption and subjective responses to alcohol. Association analysis was performed using the National Institute on Alcohol Abuse and Alcoholism (NIAAA) clinical sample, comprising AUD individuals and controls (N = 1127). Then, a post-hoc analysis using data from a human laboratory study of intravenous alcohol self-administration (IV-ASA, N = 144) was performed to investigate the association of this SNP with subjective responses following a fixed dose of alcohol (priming phase) and alcohol self-administration (ad libitum phase). The case-control study revealed a trend association (N = 1127, OR = 0.665, CI = 0.44-1.01, P = 0.056) between AUD diagnosis and Leu72Met. In AUD subjects, the SNP was associated with significantly lower average drinks per day (n = 567, β = -2.49, 95% CI = -4.34 to -0.64, P = 0.008) and significantly fewer heavy drinking days (n = 567, β = -12.00, 95% CI = -19.10 to -4.89, P < 0.001). The IV-ASA study further revealed that 72Met carriers had greater subjective responses to alcohol (P < 0.05) when compared to Leu72Leu both at priming and during ad lib self-administration. Although preliminary, these findings suggest that the Leu72Leu genotype may lead to increased risk of AUD possibly via mechanisms involving a lower response to alcohol resulting in excessive alcohol consumption. Further investigations are warranted. We investigated whether a Leu72Met missense polymorphism in the prepro-ghrelin gene, is associated with alcohol use disorder, alcohol consumption and subjective responses to alcohol. Although preliminary
A Hepatocyte-Mimicking Antidote for Alcohol Intoxication.
Xu, Duo; Han, Hui; He, Yuxin; Lee, Harrison; Wu, Di; Liu, Fang; Liu, Xiangsheng; Liu, Yang; Lu, Yunfeng; Ji, Cheng
2018-04-11
Alcohol intoxication causes serious diseases, whereas current treatments are mostly supportive and unable to remove alcohol efficiently. Upon alcohol consumption, alcohol is sequentially oxidized to acetaldehyde and acetate by the endogenous alcohol dehydrogenase and aldehyde dehydrogenase, respectively. Inspired by the metabolism of alcohol, a hepatocyte-mimicking antidote for alcohol intoxication through the codelivery of the nanocapsules of alcohol oxidase (AOx), catalase (CAT), and aldehyde dehydrogenase (ALDH) to the liver, where AOx and CAT catalyze the oxidation of alcohol to acetaldehyde, while ALDH catalyzes the oxidation of acetaldehyde to acetate. Administered to alcohol-intoxicated mice, the antidote rapidly accumulates in the liver and enables a significant reduction of the blood alcohol concentration. Moreover, blood acetaldehyde concentration is maintained at an extremely low level, significantly contributing to liver protection. Such an antidote, which can eliminate alcohol and acetaldehyde simultaneously, holds great promise for the treatment of alcohol intoxication and poisoning and can provide therapeutic benefits. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Suchankova, Petra; Yan, Jia; Schwandt, Melanie L.; Stangl, Bethany L.; Jerlhag, Elisabet; Engel, Jörgen A.; Hodgkinson, Colin A.; Ramchandani, Vijay A.; Leggio, Lorenzo
2017-01-01
Abstract Aims The orexigenic peptide ghrelin may enhance the incentive value of food-, drug- and alcohol-related rewards. Consistent with preclinical findings, human studies indicate a role of ghrelin in alcohol use disorders (AUD). In the present study an a priori hypothesis-driven analysis was conducted to investigate whether a Leu72Met missense polymorphism (rs696217) in the prepro-ghrelin gene (GHRL), is associated with AUD, alcohol consumption and subjective responses to alcohol. Method Association analysis was performed using the National Institute on Alcohol Abuse and Alcoholism (NIAAA) clinical sample, comprising AUD individuals and controls (N = 1127). Then, a post-hoc analysis using data from a human laboratory study of intravenous alcohol self-administration (IV-ASA, N = 144) was performed to investigate the association of this SNP with subjective responses following a fixed dose of alcohol (priming phase) and alcohol self-administration (ad libitum phase). Results The case-control study revealed a trend association (N = 1127, OR = 0.665, CI = 0.44–1.01, P = 0.056) between AUD diagnosis and Leu72Met. In AUD subjects, the SNP was associated with significantly lower average drinks per day (n = 567, β = −2.49, 95% CI = −4.34 to −0.64, P = 0.008) and significantly fewer heavy drinking days (n = 567, β = −12.00, 95% CI = −19.10 to −4.89, P < 0.001). The IV-ASA study further revealed that 72Met carriers had greater subjective responses to alcohol (P < 0.05) when compared to Leu72Leu both at priming and during ad lib self-administration. Conclusion Although preliminary, these findings suggest that the Leu72Leu genotype may lead to increased risk of AUD possibly via mechanisms involving a lower response to alcohol resulting in excessive alcohol consumption. Further investigations are warranted. Short Summary We investigated whether a Leu72Met missense polymorphism in the prepro-ghrelin gene, is associated with alcohol use disorder, alcohol
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Exercise Training, NADPH Oxidase p22phox Gene Polymorphisms, and Hypertension
FEAIRHELLER, DEBORAH L.; BROWN, MICHAEL D.; PARK, JOON-YOUNG; BRINKLEY, TINA E.; BASU, SAMAR; HAGBERG, JAMES M.; FERRELL, ROBERT E.; FENTY-STEWART, NICOLA M.
2010-01-01
Introduction Oxidative stress that is mediated through NADPH oxidase activity plays a role in the pathology of hypertension, and aerobic exercise training reduces NADPH oxidase activity. The involvement of genetic variation in the p22phox (CYBA) subunit genes in individual oxidative stress responses to aerobic exercise training has yet to be examined in Pre and Stage 1 hypertensives. Methods Ninety-four sedentary Pre and Stage 1 hypertensive adults underwent 6 months of aerobic exercise training at a level of 70% V̇O2max to determine whether the CYBA polymorphisms, C242T and A640G, were associated with changes in urinary 8-iso-prostaglandin F2α (8-iso-PGF2α), urinary nitric oxide metabolites (NOx), and plasma total antioxidant capacity (TAC). Results Demographic and subject characteristics were similar among genotype groups for both polymorphisms. At baseline, a significant (P = 0.03) difference among the C2424T genotype groups in 8-iso-PGF2α levels was detected, with the TT homozygotes having the lowest levels and the CC homozygotes having the highest levels. However, no differences were found at baseline between the A640G genotype groups. After 6 months of aerobic exercise training, there was a significant increase in V̇O2max (P < 0.0001) in the entire study population. In addition, there were significant increases in both urinary 8-iso-PGF2α (P = 0.002) and plasma TAC (P = 0.03) levels and a significant decrease in endogenous urinary NOx (P < 0.0001). Overall, aerobic exercise training elicited no significant differences among genotype groups in either CYBA variant for any of the oxidative stress variables. Conclusions We found that compared with CYBA polymorphisms C242T and A640G, it was aerobic exercise training that had the greatest influence on the selected biomarkers; furthermore, our results suggest that the C242T CYBA variant influences baseline levels of urinary 8-iso-PGF2α but not the aerobic exercise-induced responses. PMID:19516159
Schumann, Gunter; Liu, Chunyu; O’Reilly, Paul; Gao, He; Song, Parkyong; Xu, Bing; Ruggeri, Barbara; Amin, Najaf; Jia, Tianye; Preis, Sarah; Segura Lepe, Marcelo; Akira, Shizuo; Barbieri, Caterina; Baumeister, Sebastian; Cauchi, Stephane; Clarke, Toni-Kim; Enroth, Stefan; Fischer, Krista; Hällfors, Jenni; Harris, Sarah E.; Hieber, Saskia; Hofer, Edith; Hottenga, Jouke-Jan; Johansson, Åsa; Joshi, Peter K.; Kaartinen, Niina; Laitinen, Jaana; Lemaitre, Rozenn; Loukola, Anu; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Mangino, Massimo; Manichaikul, Ani; Mbarek, Hamdi; Milaneschi, Yuri; Moayyeri, Alireza; Mukamal, Kenneth; Nelson, Christopher; Nettleton, Jennifer; Partinen, Eemil; Rawal, Rajesh; Robino, Antonietta; Rose, Lynda; Sala, Cinzia; Satoh, Takashi; Schmidt, Reinhold; Schraut, Katharina; Scott, Robert; Smith, Albert Vernon; Starr, John M.; Teumer, Alexander; Trompet, Stella; Uitterlinden, André G.; Venturini, Cristina; Vergnaud, Anne-Claire; Verweij, Niek; Vitart, Veronique; Vuckovic, Dragana; Wedenoja, Juho; Yengo, Loic; Yu, Bing; Zhang, Weihua; Zhao, Jing Hua; Boomsma, Dorret I.; Chambers, John; Chasman, Daniel I.; Daniela, Toniolo; de Geus, Eco; Deary, Ian; Eriksson, Johan G.; Esko, Tõnu; Eulenburg, Volker; Franco, Oscar H.; Froguel, Philippe; Gieger, Christian; Grabe, Hans J.; Gudnason, Vilmundur; Gyllensten, Ulf; Harris, Tamara B.; Hartikainen, Anna-Liisa; Heath, Andrew C.; Hocking, Lynne; Hofman, Albert; Huth, Cornelia; Jarvelin, Marjo-Riitta; Jukema, J. Wouter; Kaprio, Jaakko; Kooner, Jaspal S.; Kutalik, Zoltan; Lahti, Jari; Langenberg, Claudia; Lehtimäki, Terho; Liu, Yongmei; Madden, Pamela A. F.; Martin, Nicholas; Morrison, Alanna; Penninx, Brenda; Pirastu, Nicola; Psaty, Bruce; Raitakari, Olli; Ridker, Paul; Rose, Richard; Rotter, Jerome I.; Samani, Nilesh J.; Schmidt, Helena; Spector, Tim D.; Stott, David; Strachan, David; Tzoulaki, Ioanna; van der Harst, Pim; van Duijn, Cornelia M.; Marques-Vidal, Pedro; Vollenweider, Peter; Wareham, Nicholas J.; Whitfield, John B.; Wilson, James; Wolffenbuttel, Bruce; Bakalkin, Georgy; Evangelou, Evangelos; Liu, Yun; Rice, Kenneth M.; Desrivières, Sylvane; Kliewer, Steven A.; Müller, Christian P.; Levy, Daniel; Elliott, Paul
2016-01-01
Excessive alcohol consumption is a major public health problem worldwide. Although drinking habits are known to be inherited, few genes have been identified that are robustly linked to alcohol drinking. We conducted a genome-wide association metaanalysis and replication study among >105,000 individuals of European ancestry and identified β-Klotho (KLB) as a locus associated with alcohol consumption (rs11940694; P = 9.2 × 10−12). β-Klotho is an obligate coreceptor for the hormone FGF21, which is secreted from the liver and implicated in macronutrient preference in humans. We show that brain-specific β-Klotho KO mice have an increased alcohol preference and that FGF21 inhibits alcohol drinking by acting on the brain. These data suggest that a liver–brain endocrine axis may play an important role in the regulation of alcohol drinking behavior and provide a unique pharmacologic target for reducing alcohol consumption. PMID:27911795
Identification of NADPH oxidase family members associated with cold stress in strawberry.
Zhang, Yunting; Li, Yali; He, Yuwei; Hu, Wenjie; Zhang, Yong; Wang, Xiaorong; Tang, Haoru
2018-04-01
NADPH oxidase is encoded by a small gene family (Respiratory burst oxidase homologs, Rbohs ) and plays an important role in regulating various biological processes. However, little information about this gene family is currently available for strawberry. In this study, a total of seven Rboh genes were identified from strawberry through genomewide analysis. Gene structure analysis showed the number of exons ranged from 10 to 23, implying that this variation occurred in FvRboh genes by the insertion and distribution of introns; the order and approximate size of exons were relatively conserved. FvRbohC was predicted to localize to the thylakoid membrane of the chloroplast, while other members were computed to localize to the plasma membrane, indicating different functions. Amino acid sequence alignment, conserved domain, and motif analysis showed that all identified FvRbohs had typical features of plant Rbohs. Phylogenetic analysis of Rbohs from strawberry, grape, Arabidopsis, and rice suggested that the FvRbohs could be divided into five subgroups and showed a closer relationship with those from grape and Arabidopsis than those from rice. The expression patterns of FvRboh genes in root, stem, leaf, flower, and fruit revealed robust tissue specificity. The expression levels of FvRbohA and FvRbohD were quickly induced by cold stress, followed by an increase in NADPH oxidase activity, leading to O2- accumulation and triggering the antioxidant reaction by the transient increases in SOD activity. This suggested these two genes may be involved in cold stress and defense responses in strawberry.
Fortuna, Jeffrey L
2010-06-01
Contemporary research has shown that a high number of alcohol-dependent and other drug-dependent individuals have a sweet preference, specifically for foods with a high sucrose concentration. Moreover, both human and animal studies have demonstrated that in some brains the consumption of sugar-rich foods or drinks primes the release of euphoric endorphins and dopamine within the nucleus accumbens, in a manner similar to some drugs of abuse. The neurobiological pathways of drug and "sugar addiction" involve similar neural receptors, neurotransmitters, and hedonic regions in the brain. Craving, tolerance, withdrawal and sensitization have been documented in both human and animal studies. In addition, there appears to be cross sensitization between sugar addiction and narcotic dependence in some individuals. It has also been observed that the biological children of alcoholic parents, particularly alcoholic fathers, are at greater risk to have a strong sweet preference, and this may manifest in some with an eating disorder. In the last two decades research has noted that specific genes may underlie the sweet preference in alcohol- and drug-dependent individuals, as well as in biological children of paternal alcoholics. There also appears to be some common genetic markers between alcohol dependence, bulimia, and obesity, such as the A1 allele gene and the dopamine 2 receptor gene.
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brunner, H.G.; Nelen, M.; Ropers, H.H.
1993-10-22
Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated completemore » MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.« less
Alcohol Consumption and the Risk of Colorectal Cancer for Mismatch Repair Gene Mutation Carriers.
Dashti, S Ghazaleh; Buchanan, Daniel D; Jayasekara, Harindra; Ait Ouakrim, Driss; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M; Macrae, Finlay A; Giles, Graham G; Parry, Susan; Casey, Graham; Haile, Robert W; Gallinger, Steven; Le Marchand, Loïc; Thibodeau, Stephen N; Lindor, Noralane M; Newcomb, Polly A; Potter, John D; Baron, John A; Hopper, John L; Jenkins, Mark A; Win, Aung Ko
2017-03-01
Background: People with germline mutation in one of the DNA mismatch repair (MMR) genes have increased colorectal cancer risk. For these high-risk people, study findings of the relationship between alcohol consumption and colorectal cancer risk have been inconclusive. Methods: 1,925 MMR gene mutations carriers recruited into the Colon Cancer Family Registry who had completed a questionnaire on lifestyle factors were included. Weighted Cox proportional hazard regression models were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association between alcohol consumption and colorectal cancer. Results: Colorectal cancer was diagnosed in 769 carriers (40%) at a mean (SD) age of 42.6 (10.3) years. Compared with abstention, ethanol consumption from any alcoholic beverage up to 14 g/day and >28 g/day was associated with increased colorectal cancer risk (HR, 1.50; 95% CI, 1.09-2.07 and 1.69; 95% CI, 1.07-2.65, respectively; P trend = 0.05), and colon cancer risk (HR, 1.78; 95% CI, 1.27-2.49 and 1.94; 95% CI, 1.19-3.18, respectively; P trend = 0.02). However, there was no clear evidence for an association with rectal cancer risk. Also, there was no evidence for associations between consumption of individual alcoholic beverage types (beer, wine, spirits) and colorectal, colon, or rectal cancer risk. Conclusions: Our data suggest that alcohol consumption, particularly more than 28 g/day of ethanol (∼2 standard drinks of alcohol in the United States), is associated with increased colorectal cancer risk for MMR gene mutation carriers. Impact: Although these data suggested that alcohol consumption in MMR carriers was associated with increased colorectal cancer risk, there was no evidence of a dose-response, and not all types of alcohol consumption were associated with increased risk. Cancer Epidemiol Biomarkers Prev; 26(3); 366-75. ©2016 AACR . ©2016 American Association for Cancer Research.
Johansson, A; Bergman, H; Corander, J; Waldman, I D; Karrani, N; Salo, B; Jern, P; Algars, M; Sandnabba, K; Santtila, P; Westberg, L
2012-03-01
We explored if the disposition to react with aggression while alcohol intoxicated was moderated by polymorphic variants of the oxytocin receptor gene (OXTR). Twelve OXTR polymorphisms were genotyped in 116 Finnish men [aged 18-30, M = 22.7, standard deviation (SD) = 2.4] who were randomly assigned to an alcohol condition in which they received an alcohol dose of 0.7 g pure ethanol/kg body weight or a placebo condition. Aggressive behavior was measured using a laboratory paradigm in which it was operationalized as the level of aversive noise administered to a fictive opponent. No main effects of the polymorphisms on aggressive behavior were found after controlling for multiple testing. The interactive effects between alcohol and two of the OXTR polymorphisms (rs4564970 and rs1488467) on aggressive behavior were nominally significant and remained significant for the rs4564970 when controlled for multiple tests. To the best of our knowledge, this is the first experimental study suggesting interactive effects of specific genetic variants and alcohol on aggressive behavior in humans. © 2011 The Authors. Genes, Brain and Behavior © 2011 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.
Structural and kinetic studies on the Ser101Ala variant of choline oxidase: Catalysis by compromise
DOE Office of Scientific and Technical Information (OSTI.GOV)
Finnegan, S.; Orville, A.; Yuan, H.
2010-09-15
The oxidation of choline catalyzed by choline oxidase includes two reductive half-reactions where FAD is reduced by the alcohol substrate and by an aldehyde intermediate transiently formed in the reaction. Each reductive half-reaction is followed by an oxidative half-reaction where the reduced flavin is oxidized by oxygen. Here, we have used mutagenesis to prepare the Ser101Ala mutant of choline oxidase and have investigated the impact of this mutation on the structural and kinetic properties of the enzyme. The crystallographic structure of the Ser101Ala enzyme indicates that the only differences between the mutant and wild-type enzymes are the lack of amore » hydroxyl group on residue 101 and a more planar configuration of the flavin in the mutant enzyme. Kinetics established that replacement of Ser101 with alanine yields a mutant enzyme with increased efficiencies in the oxidative half-reactions and decreased efficiencies in the reductive half-reactions. This is accompanied by a significant decrease in the overall rate of turnover with choline. Thus, this mutation has revealed the importance of a specific residue for the optimization of the overall turnover of choline oxidase, which requires fine-tuning of four consecutive half-reactions for the conversion of an alcohol to a carboxylic acid.« less
Cloning of a phenol oxidase gene from Acremonium murorum and its expression in Aspergillus awamori.
Gouka, R J; van der Heiden, M; Swarthoff, T; Verrips, C T
2001-06-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60 degrees C) and is fully stable for at least 1 h at 60 degrees C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning.
Cloning of a Phenol Oxidase Gene from Acremonium murorum and Its Expression in Aspergillus awamori
Gouka, Robin J.; van der Heiden, Monique; Swarthoff, Ton; Verrips, C. Theo
2001-01-01
Fungal multicopper oxidases have many potential industrial applications, since they perform reactions under mild conditions. We isolated a phenol oxidase from the fungus Acremonium murorum var. murorum that was capable of decolorizing plant chromophores (such as anthocyanins). This enzyme is of interest in laundry-cleaning products because of its broad specificity for chromophores. We expressed an A. murorum cDNA library in Saccharomyces cerevisiae and subsequently identified enzyme-producing yeast colonies based on their ability to decolor a plant chromophore. The cDNA sequence contained an open reading frame of 1,806 bp encoding an enzyme of 602 amino acids. The phenol oxidase was overproduced by Aspergillus awamori as a fusion protein with glucoamylase, cleaved in vivo, and purified from the culture broth by hydrophobic-interaction chromatography. The phenol oxidase is active at alkaline pH (the optimum for syringaldazine is pH 9) and high temperature (optimum, 60°C) and is fully stable for at least 1 h at 60°C under alkaline conditions. These characteristics and the high production level of 0.6 g of phenol oxidase per liter in shake flasks, which is equimolar with the glucoamylase protein levels, make this enzyme suitable for use in processes that occur under alkaline conditions, such as laundry cleaning. PMID:11375170
Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu
2015-02-01
To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.
Rajangam, Alex S; Gidda, Satinder K; Craddock, Christian; Mullen, Robert T; Dyer, John M; Eastmond, Peter J
2013-01-01
Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WEs) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very-long-chain fatty alcohols, which must be oxidized to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and a fatty aldehyde dehydrogenase (FADH) before they can be β-oxidized. Here, we describe the cloning and characterization of genes for each of these two activities. Jojoba FAO and FADH are 52% and 68% identical to Arabidopsis (Arabidopsis thaliana) FAO3 and ALDH3H1, respectively. The genes are expressed most strongly in the cotyledons of jojoba seedlings following germination, but transcripts can also be detected in vegetative tissues. Proteomic analysis indicated that the FAO and FADH proteins can be detected on wax bodies, but they localized to the endoplasmic reticulum when they were expressed as amino-terminal green fluorescent protein fusions in tobacco (Nicotiana tabacum) leaves. Recombinant jojoba FAO and FADH proteins are active on very-long-chain fatty alcohol and fatty aldehyde substrates, respectively, and have biochemical properties consistent with those previously reported in jojoba cotyledons. Coexpression of jojoba FAO and FADH in Arabidopsis enhanced the in vivo rate of fatty alcohol oxidation more than 4-fold. Taken together, our data suggest that jojoba FAO and FADH constitute the very-long-chain fatty alcohol oxidation pathway that is likely to be necessary for efficient WE mobilization following seed germination.
Yokoyama, A; Muramatsu, T; Omori, T; Matsushita, S; Yoshimizu, H; Higuchi, S; Yokoyama, T; Maruyama, K; Ishii, H
1999-11-01
Studies have consistently demonstrated that inactive aldehyde dehydrogenase-2 (ALDH2), encoded by ALDH2*1/2*2, is closely associated with alcohol-related carcinogenesis. Recently, the contributions of alcohol dehydrogenase-2 (ADH2) polymorphism to alcoholism, esophageal cancer, and the flushing response have also been described. To determine the effects of ALDH2 and ADH2 genotypes in genetically based cancer susceptibility, lymphocyte DNA samples from 668 Japanese alcoholic men more than 40 years of age (91 with and 577 without esophageal cancer) were genotyped and the results were expressed as odds ratios (ORs). This study also tested 82 of the alcoholics with esophageal cancer to determine whether cancer susceptibility is associated with patients' responses to simple questions about current or former flushing after drinking a glass of beer. The frequencies of ADH2*1/2*1 and ALDH2*1/2*2 were significantly higher in alcoholics with, than in those without, esophageal cancer (0.473 vs. 0.289 and 0.560 vs. 0.099, respectively). After adjustment for drinking and smoking, the analysis showed significantly increased cancer risk for alcoholics with either ADH2*1/2*I (OR = 2.03) or ALDH2*1/2*2 (OR = 12.76). For those having ADH2*1/2*1 combined with ALDH2*1/2*2, the esophageal cancer risk was enhanced in a multiplicative fashion (OR = 27.66). Responses to flushing questions showed that only 47.8% of the ALDH2*1/2*2 heterozygotes with ADH2*1/ 2*1, compared with 92.3% of those with ALDH2*1/2*2 and the ADH2*2 allele, reported current or former flushing. Genotyping showed that for alcoholics who reported ever flushing, the questionnaire was 71.4% correct in identifying ALDH2*1/2*2 and 87.9% correct in identifying ALDH2*1/2*1. Japanese alcoholics can be divided into cancer susceptibility groups on the basis of their combined ADH2 and ALDH2 genotypes. The flushing questionnaire can predict high risk ALDH2*1/2*2 fairly accurately in persons with ADH2*2 allele, but a reliable
Landgren, Sara; Jerlhag, Elisabet; Zetterberg, Henrik; Gonzalez-Quintela, Arturo; Campos, Joaquin; Olofsson, Ulrica; Nilsson, Staffan; Blennow, Kaj; Engel, Jörgen A
2008-12-01
Ghrelin, an orexigenic peptide, acts on growth hormone secretagogue receptors (GHS-R1A), expressed in the hypothalamus as well as in important reward nodes such as the ventral tegmental area. Interestingly, ghrelin has been found to activate an important part of the reward systems, i.e., the cholinergic-dopaminergic reward link. Additionally, the rewarding and neurochemical properties of alcohol are, at least in part, mediated via this reward link. There is comorbidity between alcohol dependence and eating disorders. Thus, plasma levels of ghrelin are altered in patients with addictive behaviors such as alcohol and nicotine dependence and in binge eating disorder. This overlap prompted as to investigate the pro-ghrelin and GHS-R1A genes in a haplotype analysis of heavy alcohol-using individuals. A total of 417 Spanish individuals (abstainers, moderate, and heavy alcohol drinkers) were investigated in a haplotype analysis of the pro-ghrelin and GHS-R1A genes. Tag SNPs were chosen using HapMap data and the Tagger and Haploview softwares. These SNPs were then genotyped using TaqMan Allelic Discrimination. SNP rs2232165 of the GHS-R1A gene was associated with heavy alcohol consumption and SNP rs2948694 of the same gene as well as haplotypes of both the pro-ghrelin and the GHS-R1A genes were associated with body mass in heavy alcohol consuming individuals. The present findings are the first to disclose an association between the pro-ghrelin and GHS-R1A genes and heavy alcohol use, further strengthening the role of the ghrelin system in addictive behaviors and brain reward.
Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Yutaka; Kubota, Ryo; Wang, Yimin
In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less
Genome-Wide Gene Set Analysis for Identification of Pathways Associated with Alcohol Dependence
Biernacka, Joanna M.; Geske, Jennifer; Jenkins, Gregory D.; Colby, Colin; Rider, David N.; Karpyak, Victor M.; Choi, Doo-Sup; Fridley, Brooke L.
2013-01-01
It is believed that multiple genetic variants with small individual effects contribute to the risk of alcohol dependence. Such polygenic effects are difficult to detect in genome-wide association studies that test for association of the phenotype with each single nucleotide polymorphism (SNP) individually. To overcome this challenge, gene set analysis (GSA) methods that jointly test for the effects of pre-defined groups of genes have been proposed. Rather than testing for association between the phenotype and individual SNPs, these analyses evaluate the global evidence of association with a set of related genes enabling the identification of cellular or molecular pathways or biological processes that play a role in development of the disease. It is hoped that by aggregating the evidence of association for all available SNPs in a group of related genes, these approaches will have enhanced power to detect genetic associations with complex traits. We performed GSA using data from a genome-wide study of 1165 alcohol dependent cases and 1379 controls from the Study of Addiction: Genetics and Environment (SAGE), for all 200 pathways listed in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Results demonstrated a potential role of the “Synthesis and Degradation of Ketone Bodies” pathway. Our results also support the potential involvement of the “Neuroactive Ligand Receptor Interaction” pathway, which has previously been implicated in addictive disorders. These findings demonstrate the utility of GSA in the study of complex disease, and suggest specific directions for further research into the genetic architecture of alcohol dependence. PMID:22717047
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Reilly, Matthew T; Harris, R Adron; Noronha, Antonio
2012-01-01
Over the last 50 years, researchers have made substantial progress in identifying genetic variations that underlie the complex phenotype of alcoholism. Not much is known, however, about how this genetic variation translates into altered biological function. Genetic animal models recapitulating specific characteristics of the human condition have helped elucidate gene function and the genetic basis of disease. In particular, major advances have come from the ability to manipulate genes through a variety of genetic technologies that provide an unprecedented capacity to determine gene function in the living organism and in alcohol-related behaviors. Even newer genetic-engineering technologies have given researchers the ability to control when and where a specific gene or mutation is activated or deleted, allowing investigators to narrow the role of the gene's function to circumscribed neural pathways and across development. These technologies are important for all areas of neuroscience, and several public and private initiatives are making a new generation of genetic-engineering tools available to the scientific community at large. Finally, high-throughput "next-generation sequencing" technologies are set to rapidly increase knowledge of the genome, epigenome, and transcriptome, which, combined with genetically engineered mouse mutants, will enhance insight into biological function. All of these resources will provide deeper insight into the genetic basis of alcoholism.
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Batth, Rituraj; Singh, Kapil; Kumari, Sumita; Mustafiz, Ananda
2017-01-01
Abiotic stress and climate change is the major concern for plant growth and crop yield. Abiotic stresses lead to enhanced accumulation of reactive oxygen species (ROS) consequently resulting in cellular damage and major losses in crop yield. One of the major scavengers of ROS is ascorbate (AA) which acts as first line of defense against external oxidants. An enzyme named ascorbate oxidase (AAO) is known to oxidize AA and deleteriously affect the plant system in response to stress. Genome-wide analysis of AAO gene family has led to the identification of five, three, seven, four, and six AAO genes in Oryza sativa, Arabidopsis, Glycine max, Zea mays, and Sorghum bicolor genomes, respectively. Expression profiling of these genes was carried out in response to various abiotic stresses and during various stages of vegetative and reproductive development using publicly available microarray database. Expression analysis in Oryza sativa revealed tissue specific expression of AAO genes wherein few members were exclusively expressed in either root or shoot. These genes were found to be regulated by both developmental cues as well as diverse stress conditions. The qRT-PCR analysis in response to salinity and drought stress in rice shoots revealed OsAAO2 to be the most stress responsive gene. On the other hand, OsAAO3 and OsAAO4 genes showed enhanced expression in roots under salinity/drought stresses. This study provides lead about important stress responsive AAO genes in various crop plants, which could be used to engineer climate resilient crop plants. PMID:28261251
Shimao, M; Ninomiya, K; Kuno, O; Kato, N; Sakazawa, C
1986-01-01
A novel enzyme, pyrroloquinoline quinone (PQQ)-dependent polyvinyl alcohol (PVA) dehydrogenase, was found in and partially purified from the membrane fraction of a PVA-degrading symbiont, Pseudomonas sp. strain VM15C. The enzyme required PQQ for PVA dehydrogenation with phenazine methosulfate, phenazine ethosulfate, and 2,6-dichlorophenolindophenol as electron acceptors and did not show PVA oxidase activity leading to H2O2 formation. The enzyme was active toward low-molecular-weight secondary alcohols rather than primary alcohols. A membrane-bound PVA oxidase was also present in cells of VM15C. Although the purified oxidase showed a substrate specificity similar to that of PQQ-dependent PVA dehydrogenase and about threefold-higher PVA-dehydrogenating activity with phenazine methosulfate or phenazine ethosulfate than PVA oxidase activity with H2O2 formation, it was shown that the enzyme does not contain PQQ as the coenzyme, and PQQ did not affect its activity. Incubation of the membrane fraction of cells with PVA caused a reduction in the cytochrome(s) of the fraction. Images PMID:3513704
González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.
2004-01-01
The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034
Wang, Wei; Liu, Ji-Hong
2015-01-25
Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhu, Ena C; Soundy, Timothy J; Hu, Yueshan
2017-05-01
Consuming excessive amounts of alcohol has the potential to modify an individual's brain and lead to alcohol dependence. Alcohol use leads to 88,000 deaths every year in the U.S. alone and can lead to other health issues including cancers, such as colorectal cancer, and mental health problems. While drinking behavior varies due to environmental factors, genetic factors also contribute to the risk of alcoholism. Certain genes affecting alcohol metabolism and neurotransmitters have been found to contribute to or inhibit the risk. Geneenvironment interactions may also play a role in the susceptibility of alcoholism. With a better understanding of the different components that can contribute to alcoholism, more personalized treatment could cater to the individual. This review discusses the major genetic factors and some small variants in other genes that contribute to alcoholism, as well as considers the gene-environmental interactions. Copyright© South Dakota State Medical Association.
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys
Peck, Ammon B.; Khan, Saeed R.
2013-01-01
A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917
CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity
Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin
2013-01-01
Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini
2014-06-19
The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Luo, Jie; Xu, Pei; Cao, Peijian; Wan, Hongjian; Lv, Xiaonan; Xu, Shengchun; Wang, Gangjun; Cook, Melloni N.; Jones, Byron C.; Lu, Lu; Wang, Xusheng
2018-01-01
Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses. PMID:29674951
Campillo-Brocal, Jonatan C; Chacón-Verdú, María Dolores; Lucas-Elío, Patricia; Sánchez-Amat, Antonio
2015-03-24
L-Amino acid oxidases (LAOs) have been generally described as flavoproteins that oxidize amino acids releasing the corresponding ketoacid, ammonium and hydrogen peroxide. The generation of hydrogen peroxide gives to these enzymes antimicrobial characteristics. They are involved in processes such as biofilm development and microbial competition. LAOs are of great biotechnological interest in different applications such as the design of biosensors, biotransformations and biomedicine. The marine bacterium Marinomonas mediterranea synthesizes LodA, the first known LAO that contains a quinone cofactor. LodA is encoded in an operon that contains a second gene coding for LodB, a protein required for the post-translational modification generating the cofactor. Recently, GoxA, a quinoprotein with sequence similarity to LodA but with a different enzymatic activity (glycine oxidase instead of lysine-ε-oxidase) has been described. The aim of this work has been to study the distribution of genes similar to lodA and/or goxA in sequenced microbial genomes and to get insight into the evolution of this novel family of proteins through phylogenetic analysis. Genes encoding LodA-like proteins have been detected in several bacterial classes. However, they are absent in Archaea and detected only in a small group of fungi of the class Agaromycetes. The vast majority of the genes detected are in a genome region with a nearby lodB-like gene suggesting a specific interaction between both partner proteins. Sequence alignment of the LodA-like proteins allowed the detection of several conserved residues. All of them showed a Cys and a Trp that aligned with the residues that are forming part of the cysteine tryptophilquinone (CTQ) cofactor in LodA. Phylogenetic analysis revealed that LodA-like proteins can be clustered in different groups. Interestingly, LodA and GoxA are in different groups, indicating that those groups are related to the enzymatic activity of the proteins detected. Genome
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
A genome wide search for alcoholism susceptibility genes.
Hill, Shirley Y; Shen, Sa; Zezza, Nicholas; Hoffman, Eric K; Perlin, Mark; Allan, William
2004-07-01
Alcoholism is currently one of the most serious public health problems in the US. Lifetime prevalence rates are relatively high with one in five men and one in 12 women meeting criteria for this condition. Identification of genetic loci conferring an increased susceptibility to developing alcohol dependence could strengthen prevention efforts by informing individuals of their risk before abusive drinking ensues. Families identified through a double proband methodology have provided an exceptional opportunity for gene-finding because of the increased recurrence risks seen in these sibships. A total of 360 markers for 22 autosomes were spaced at an average distance of 9.4 cM and genotyping performed for 330 members of these multiplex families. Extensive clinical data, personality variation, and event-related potential characteristics were available for reducing heterogeneity and detecting robust linkage signals. Multipoint linkage analysis using different analytic strategies give strong support for loci on chromosomes 1, 2, 6, 7, 10, 12, 14, 16, and 17. Copyright 2004 Wiley-Liss, Inc.
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057
Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad
2015-01-01
Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression.
Rajangam, Alex S.; Gidda, Satinder K.; Craddock, Christian; Mullen, Robert T.; Dyer, John M.; Eastmond, Peter J.
2013-01-01
Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WEs) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very-long-chain fatty alcohols, which must be oxidized to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and a fatty aldehyde dehydrogenase (FADH) before they can be β-oxidized. Here, we describe the cloning and characterization of genes for each of these two activities. Jojoba FAO and FADH are 52% and 68% identical to Arabidopsis (Arabidopsis thaliana) FAO3 and ALDH3H1, respectively. The genes are expressed most strongly in the cotyledons of jojoba seedlings following germination, but transcripts can also be detected in vegetative tissues. Proteomic analysis indicated that the FAO and FADH proteins can be detected on wax bodies, but they localized to the endoplasmic reticulum when they were expressed as amino-terminal green fluorescent protein fusions in tobacco (Nicotiana tabacum) leaves. Recombinant jojoba FAO and FADH proteins are active on very-long-chain fatty alcohol and fatty aldehyde substrates, respectively, and have biochemical properties consistent with those previously reported in jojoba cotyledons. Coexpression of jojoba FAO and FADH in Arabidopsis enhanced the in vivo rate of fatty alcohol oxidation more than 4-fold. Taken together, our data suggest that jojoba FAO and FADH constitute the very-long-chain fatty alcohol oxidation pathway that is likely to be necessary for efficient WE mobilization following seed germination. PMID:23166353
Hack, Laura M.; Kalsi, Gursharan; Aliev, Fazil; Kuo, Po-Hsiu; Prescott, Carol A.; Patterson, Diana G.; Walsh, Dermot; Dick, Danielle M.; Riley, Brien P.; Kendler, Kenneth S.
2012-01-01
Background Over 50 years of evidence from research has established that the central dopaminergic reward pathway is likely involved in alcohol dependence (AD). Additional evidence supports a role for dopamine (DA) in other disinhibitory psychopathology, which is often comorbid with AD. Family and twin studies demonstrate that a common genetic component accounts for most of the genetic variance in these traits. Thus, DA-related genes represent putative candidates for the genetic risk that underlies not only AD but also behavioral disinhibition. Many linkage and association studies have examined these relationships with inconsistent results, possibly because of low power, poor marker coverage, and/or an inappropriate correction for multiple testing. Methods We conducted an association study on the products encoded by 10 DA-related genes (DRD1-D5, SLC18A2, SLC6A3, DDC, TH, COMT) using a large, ethnically homogeneous sample with severe AD (n = 545) and screened controls (n = 509). We collected genotypes from linkage disequilibrium (LD)-tagging single nucleotide polymorphisms (SNPs) and employed a gene-based method of correction. We tested for association with AD diagnosis in cases and controls and with a variety of alcohol-related traits (including age-at-onset, initial sensitivity, tolerance, maximum daily drinks, and a withdrawal factor score), disinhibitory symptoms, and a disinhibitory factor score in cases only. A total of 135 SNPs were genotyped using the Illumina GoldenGate and Taqman Assays-on-Demand protocols. Results Of the 101 SNPs entered into standard analysis, 6 independent SNPs from 5 DA genes were associated with AD or a quantitative alcohol-related trait. Two SNPs across 2 genes were associated with a disinhibitory symptom count, while 1 SNP in DRD5 was positive for association with the general disinhibitory factor score. Conclusions Our study provides evidence of modest associations between a small number of DA-related genes and AD as well as a range
Iwasaki, Shinya; Ishiguro, Hiroki; Higuchi, Susumu; Onaivi, Emmanuel S; Arinami, Tadao
2007-08-01
Fatty acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) are the major endocannabinoid metabolic enzymes. Owing to the importance of endocannabinoid system in addiction, the Pro129Thr polymorphism in the FAAH gene has reportedly been associated with substance abuse and dependence in a Caucasian population. To determine whether the single nucleodtide polymorphisms of the FAAH and MGLL genes are associated with alcoholism in a Japanese population. We conducted case-control studies for total 14 tag single nucleotide polymorphisms in those two genes using Japanese 729 patients with alcoholism and 799 healthy controls. Genotype and allele frequencies were compared between these groups. None of these genetic markers, however, showed significant association with alcoholism in Japanese. Whereas we examined associations in a larger sample size between alcoholism and tag single nucleotide polymorphisms that covered most regions of these endocannabinoid metabolic enzyme genes, we found that these are not associated with susceptibility to alcoholism in a Japanese population.
Watanabe, Daisuke; Kaneko, Akie; Sugimoto, Yukiko; Ohnuki, Shinsuke; Takagi, Hiroshi; Ohya, Yoshikazu
2017-02-01
A loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-like protein kinase, is one of the major causes of the high alcoholic fermentation rates in Saccharomyces cerevisiae sake strains closely related to Kyokai no. 7 (K7). However, impairment of Rim15p may not be beneficial under more severe fermentation conditions, such as in the late fermentation stage, as it negatively affects stress responses. To balance stress tolerance and fermentation performance, we inserted the promoter of a gluconeogenic gene, PCK1, into the 5'-untranslated region (5'-UTR) of the RIM15 gene in a laboratory strain to achieve repression of RIM15 gene expression in the glucose-rich early stage with its induction in the stressful late stage of alcoholic fermentation. The promoter-engineered strain exhibited a fermentation rate comparable to that of the RIM15-deleted strain with no decrease in cell viability. The engineered strain achieved better alcoholic fermentation performance than the RIM15-deleted strain under repetitive and high-glucose fermentation conditions. These data demonstrated the validity of promoter engineering of the RIM15 gene that governs inhibitory control of alcoholic fermentation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ono, Sayaka; Morimoto, Norihito; Korenaga, Masataka; Kumazawa, Hideo; Komatsu, Yutaka; Kuge, Itsu; Higashidani, Yoshihumi; Ogura, Katsumi; Sugiura, Tetsuro
2010-11-01
Identification of Diphyllobothrium species has been carried out based on their morphology, especially sexual organs. In addition to these criteria, PCR-based identification methods have been developed recently. A 20 year-old Japanese living in Kochi Prefecture passed tapeworm. He was successfully treated with single dose of gastrografin. We examined the morphologic features of the proglottids and eggs using histology and scanning electron microscope. We also analyzed mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the proglottids. The causative tapeworm species was identified as D. nihonkaiense based on the results of morphologic features and genetic analysis. We discussed the advantage of PCR-based identification methods of Diphyllobothrium species using cox1 sequence in the clinical laboratory.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gorwood, P.; Feingold, J.; Ades, J.
1995-12-18
Numerous studies on the involvement of dopamine receptors in the genetics of alcoholism focused on associations between a polymorphism of the D2 dopamine receptor (DRD2) gene and alcohol dependence. However, the results of these studies are conflicting. Another receptor, the D3 dopamine receptor (DRD3), may be of additional interest since it is specifically located in the limbic area, and in particular in the nucleus accumbens which plays a significant role in the reward process of addiction behavior. We thus tested the association in three independent samples of alcoholic patients, with different origins and various inclusion criteria. No difference in themore » DRD3 gene polymorphism emerged between controls and alcoholic patients, regardless of their origin, inclusion criteria, or presence or absence of the DRD2 TaqI A1-allele. Despite the fact that more information could have been considered and that association studies provide limited information, there is good evidence that this DRD3 polymorphism does not play a major role in the genetic component of alcoholism. 17 refs., 2 tabs.« less
Molecular phylogeny and evolution of alcohol dehydrogenase (Adh) genes in legumes
Fukuda, Tatsuya; Yokoyama, Jun; Nakamura, Toru; Song, In-Ja; Ito, Takuro; Ochiai, Toshinori; Kanno, Akira; Kameya, Toshiaki; Maki, Masayuki
2005-01-01
Background Nuclear genes determine the vast range of phenotypes that are responsible for the adaptive abilities of organisms in nature. Nevertheless, the evolutionary processes that generate the structures and functions of nuclear genes are only now be coming understood. The aim of our study is to isolate the alcohol dehydrogenase (Adh) genes in two distantly related legumes, and use these sequences to examine the molecular evolutionary history of this nuclear gene. Results We isolated the expressed Adh genes from two species of legumes, Sophora flavescens Ait. and Wisteria floribunda DC., by a RT-PCR based approach and found a new Adh locus in addition to homologues of the Adh genes found previously in legumes. To examine the evolution of these genes, we compared the species and gene trees and found gene duplication of the Adh loci in the legumes occurred as an ancient event. Conclusion This is the first report revealing that some legume species have at least two Adh gene loci belonging to separate clades. Phylogenetic analyses suggest that these genes resulted from relatively ancient duplication events. PMID:15836788
Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.
2008-01-01
Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363
Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K.; Li, Changwei; Schwander, Karen; Richard, Melissa A.; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M.; Bielak, Lawrence F.; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P.; Horimoto, Andrea R. V. R.; Lohman, Kurt K.; Manning, Alisa K.; Rankinen, Tuomo; Smith, Albert V.; Wojczynski, Mary K.; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Harris, Sarah E.; He, Meian; Hsu, Fang-Chi; Jackson, Anne U.; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Nolte, Ilja M.; Padmanabhan, Sandosh; Robino, Antonietta; Scott, Robert A.; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O.; Varga, Tibor V.; Vitart, Veronique; Wang, Yajuan; Warren, Helen R.; Wen, Wanqing; Yanek, Lisa R.; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Arking, Dan E.; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L.; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M.; Correa, Adolfo; de las Fuentes, Lisa; de Mutsert, Renée; de Silva, H. Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B.; Ehret, Georg; Eppinga, Ruben N.; Faul, Jessica D.; Felix, Stephan B.; Forouhi, Nita G.; Forrester, Terrence; Franco, Oscar H.; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C. Charles; Gu, Dongfeng; Hagenaars, Saskia P.; Hallmans, Göran; Harris, Tamara B.; He, Jiang; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V.; Ikram, M. Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O.; Koh, Woon-Puay; Krieger, José E.; Kritchevsky, Stephen B.; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A.; Langefeld, Carl D.; Langenberg, Claudia; Launer, Lenore J.; Lehne, Benjamin; Lewis, Cora E.; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A.; Meitinger, Thomas; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L.; Momozawa, Yukihide; Nalls, Mike A.; Nelson, Christopher P.; Sotoodehnia, Nona; Norris, Jill M.; O'Connell, Jeff R.; Palmer, Nicholette D.; Perls, Thomas; Pedersen, Nancy L.; Peters, Annette; Peyser, Patricia A.; Poulter, Neil; Raffel, Leslie J.; Raitakari, Olli T.; Roll, Kathryn; Rose, Lynda M.; Rosendaal, Frits R.; Rotter, Jerome I.; Schmidt, Carsten O.; Schreiner, Pamela J.; Schupf, Nicole; Scott, William R.; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M.; Smith, Jennifer A.; Snieder, Harold; Starr, John M.; Strauch, Konstantin; Stringham, Heather M.; Tan, Nicholas Y. Q.; Tang, Hua; Taylor, Kent D.; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T.; Uitterlinden, André G.; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B.; Becker, Diane M.; Boehnke, Michael; Bowden, Donald W.; Chambers, John C.; Deary, Ian J.; Esko, Tõnu; Farrall, Martin; Franks, Paul W.; Freedman, Barry I.; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S.; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C.; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K. E.; Oldehinkel, Albertine J.; Penninx, Brenda W. J. H.; Polasek, Ozren; Porteous, David J.; Rauramaa, Rainer; Samani, Nilesh J.; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E.; Watkins, Hugh; Weir, David R.; Wickremasinghe, Ananda R.; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K.; Gudnason, Vilmundur; Horta, Bernardo L.; Kardia, Sharon L. R.; Liu, Yongmei; Pereira, Alexandre C.; Psaty, Bruce M.; Ridker, Paul M.; van Dam, Rob M.; Gauderman, W. James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O.; Fornage, Myriam; Rotimi, Charles N.; Cupples, L. Adrienne; Kelly, Tanika N.; Fox, Ervin R.; Hayward, Caroline; van Duijn, Cornelia M.; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Morrison, Alanna C.; Caulfield, Mark J.; Munroe, Patricia B.; Rao, Dabeeru C.; Province, Michael A.; Levy, Daniel
2018-01-01
Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10−5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10−8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10−8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension. PMID:29912962
Feitosa, Mary F; Kraja, Aldi T; Chasman, Daniel I; Sung, Yun J; Winkler, Thomas W; Ntalla, Ioanna; Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K; Li, Changwei; Bentley, Amy R; Brown, Michael R; Schwander, Karen; Richard, Melissa A; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M; Bielak, Lawrence F; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P; Horimoto, Andrea R V R; Lohman, Kurt K; Manning, Alisa K; Rankinen, Tuomo; Smith, Albert V; Tajuddin, Salman M; Wojczynski, Mary K; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Campbell, Archie; Chai, Jin Fang; Chen, Xu; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Hagemeijer, Yanick; Harris, Sarah E; He, Meian; Hsu, Fang-Chi; Jackson, Anne U; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Matoba, Nana; Nolte, Ilja M; Padmanabhan, Sandosh; Riaz, Muhammad; Rueedi, Rico; Robino, Antonietta; Said, M Abdullah; Scott, Robert A; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O; van der Most, Peter J; Varga, Tibor V; Vitart, Veronique; Wang, Yajuan; Ware, Erin B; Warren, Helen R; Weiss, Stefan; Wen, Wanqing; Yanek, Lisa R; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Amini, Marzyeh; Arking, Dan E; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L; Canouil, Mickaël; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M; Correa, Adolfo; de Las Fuentes, Lisa; de Mutsert, Renée; de Silva, H Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B; Ehret, Georg; Eppinga, Ruben N; Evangelou, Evangelos; Faul, Jessica D; Felix, Stephan B; Forouhi, Nita G; Forrester, Terrence; Franco, Oscar H; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C Charles; Gu, Dongfeng; Hagenaars, Saskia P; Hallmans, Göran; Harris, Tamara B; He, Jiang; Heikkinen, Sami; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V; Ikram, M Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O; Koh, Woon-Puay; Krieger, José E; Kritchevsky, Stephen B; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A; Langefeld, Carl D; Langenberg, Claudia; Launer, Lenore J; Lehne, Benjamin; Lewis, Cora E; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A; Meitinger, Thomas; Metspalu, Andres; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L; Momozawa, Yukihide; Nalls, Mike A; Nelson, Christopher P; Sotoodehnia, Nona; Norris, Jill M; O'Connell, Jeff R; Palmer, Nicholette D; Perls, Thomas; Pedersen, Nancy L; Peters, Annette; Peyser, Patricia A; Poulter, Neil; Raffel, Leslie J; Raitakari, Olli T; Roll, Kathryn; Rose, Lynda M; Rosendaal, Frits R; Rotter, Jerome I; Schmidt, Carsten O; Schreiner, Pamela J; Schupf, Nicole; Scott, William R; Sever, Peter S; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M; Smith, Jennifer A; Snieder, Harold; Starr, John M; Strauch, Konstantin; Stringham, Heather M; Tan, Nicholas Y Q; Tang, Hua; Taylor, Kent D; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T; Uitterlinden, André G; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B; Becker, Diane M; Boehnke, Michael; Bowden, Donald W; Chambers, John C; Deary, Ian J; Esko, Tõnu; Farrall, Martin; Franks, Paul W; Freedman, Barry I; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Jonas, Jost Bruno; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K E; Oldehinkel, Albertine J; Penninx, Brenda W J H; Polasek, Ozren; Porteous, David J; Rauramaa, Rainer; Samani, Nilesh J; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E; Wareham, Nicholas J; Watkins, Hugh; Weir, David R; Wickremasinghe, Ananda R; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K; Gudnason, Vilmundur; Horta, Bernardo L; Kardia, Sharon L R; Liu, Yongmei; Pereira, Alexandre C; Psaty, Bruce M; Ridker, Paul M; van Dam, Rob M; Gauderman, W James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O; Fornage, Myriam; Rotimi, Charles N; Cupples, L Adrienne; Kelly, Tanika N; Fox, Ervin R; Hayward, Caroline; van Duijn, Cornelia M; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Rice, Kenneth; Morrison, Alanna C; Elliott, Paul; Caulfield, Mark J; Munroe, Patricia B; Rao, Dabeeru C; Province, Michael A; Levy, Daniel
2018-01-01
Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10-5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10-8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10-8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension.
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.
Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela
2014-01-01
Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.
Barak, S; Nejidat, A; Heimer, Y; Volokita, M
2001-03-01
The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.
Buades-Rotger, Macià; Gallardo-Pujol, David
2014-01-01
Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607
Reilly, Matthew T.; Harris, R. Adron; Noronha, Antonio
2012-01-01
Over the last 50 years, researchers have made substantial progress in identifying genetic variations that underlie the complex phenotype of alcoholism. Not much is known, however, about how this genetic variation translates into altered biological function. Genetic animal models recapitulating specific characteristics of the human condition have helped elucidate gene function and the genetic basis of disease. In particular, major advances have come from the ability to manipulate genes through a variety of genetic technologies that provide an unprecedented capacity to determine gene function in the living organism and in alcohol-related behaviors. Even newer genetic-engineering technologies have given researchers the ability to control when and where a specific gene or mutation is activated or deleted, allowing investigators to narrow the role of the gene’s function to circumscribed neural pathways and across development. These technologies are important for all areas of neuroscience, and several public and private initiatives are making a new generation of genetic-engineering tools available to the scientific community at large. Finally, high-throughput “next-generation sequencing” technologies are set to rapidly increase knowledge of the genome, epigenome, and transcriptome, which, combined with genetically engineered mouse mutants, will enhance insight into biological function. All of these resources will provide deeper insight into the genetic basis of alcoholism. PMID:23134044
Repunte-Canonigo, Vez; Lutjens, Robert; van der Stap, Lena D; Sanna, Pietro Paolo
2007-03-23
Intermittent models of alcohol exposure that mimic human patterns of alcohol consumption produce profound physiological and biochemical changes and induce rapid increases in alcohol self-administration. We used high-density oligonucleotide microarrays to investigate gene expression changes during chronic intermittent alcohol exposure in three brain regions that receive mesocorticolimbic dopaminergic projections and that are believed to be involved in alcohol's reinforcing actions: the medial prefrontal cortex, the nucleus accumbens and the amygdala. An independent replication of the experiment was used for RT-PCR validation of the microarray results. The protein kinase A inhibitor alpha (PKI-alpha, Pkia), a member of the endogenous PKI family implicated in reducing nuclear PKA activity, was found to be increased in all three regions tested. Conversely, we observed a downregulation of the expression of several PKA-regulated transcripts in one or more of the brain regions studied, including the activity and neurotransmitter-regulated early gene (Ania) - 1, -3, -7, -8, the transcription factors Egr1 and NGFI-B (Nr4a1) and the neuropeptide NPY. Reduced expression of PKA-regulated genes in mesocorticolimbic projection areas may have motivational significance in the rapid increase in alcohol self-administration induced by intermittent alcohol exposure.
Alcoholism is associated with GALR3 but not two other galanin receptor genes.
Belfer, I; Hipp, H; Bollettino, A; McKnight, C; Evans, C; Virkkunen, M; Albaugh, B; Max, M B; Goldman, D; Enoch, M A
2007-07-01
The neuropeptide galanin is widely expressed in the periphery and the central nervous system and mediates diverse physiological processes and behaviors including alcohol abuse, depression and anxiety. Four genes encoding galanin and its receptors have been identified (GAL, GALR1, GALR2 and GALR3). Recently we found that GAL haplotypes were associated with alcoholism, raising the possibility that genetic variation in GALR1, GALR2 and GALR3 might also alter alcoholism risk. Tag single nucleotide polymorphisms (SNPs) were identified by genotyping SNP panels in controls from five populations. For the association study with alcoholism, six GALR1, four GALR2 and four GALR3 SNPs were genotyped in a large cohort of Finnish alcoholics and non-alcoholics. GALR3 showed a significant association with alcoholism that was driven by one SNP (rs3,091,367). Moreover, the combination of the GALR3 rs3,091,367 risk allele and GAL risk haplotypes led to a modestly increased odds ratio (OR) for alcoholism (2.4) as compared with the effect of either GAL (1.9) or GALR3 alone (1.4). Likewise, the combination of the GALR3 and GAL risk diplotypes led to an increased OR for alcoholism (4.6) as compared with the effect of either GAL (2.0) or GALR3 alone (1.6). There was no effect of GALR1 or GALR2 on alcoholism risk. This evidence suggests that GALR3 mediates the alcoholism-related actions of galanin.
Mkaouar-Rebai, Emna; Ellouze, Emna; Chamkha, Imen; Kammoun, Fatma; Triki, Chahnez; Fakhfakh, Faiza
2011-01-01
Cytochrome c oxidase is an essential component of the mitochondrial respiratory chain that catalyzes the reduction of molecular oxygen by reduced cytochrome c. In this study, the authors report the second mutation associated with Leigh syndrome in the blood and buccal mucosa of 2 affected members of a Tunisian family. It was a novel heteroplasmic missense mitochondrial mutation at nucleotide 9478 in the gene specifying subunit III of cytochrome c oxidase substituting the valine at position 91 to alanine in a highly conserved amino acid. It was found with a high mutant load in tissues derived from endoderm (buccal mucosa) and mesoderm (blood). However, it was nearly absent in tissue derived from ectoderm (hair follicles). It was absent in 120 healthy controls, and PolyPhen analysis showed that the hydropathy index changed from +1.276 to +0.242, and the number of structures of the 3D protein decreased from 39 to 32.
Wang, Huihui; Liu, Baobao; Li, Hongyan; Zhang, Shicui
2016-01-10
Polyamine oxidases (PAOs) have been identified in a wide variety of animals, as well as in fungi and plant. Generally, plant PAOs oxidize spermine (Spm), spermidine (Spd) and their acetylated derivatives, N(1)-acetylspermine (N(1)-Aspm) and N(1)-acetylspermidine (N(1)-Aspd), while yeast PAOs oxidize Spm, N(1)-Aspm and N(1)-Aspd, but not Spd. By contrast, two different enzymes, namely spermine oxidase (SMO) and acetylpolyamine oxidase (APAO), specifically catalyze the oxidation of Spm and N(1)-Aspm/N(1)-Aspd, respectively. However, our knowledge on the biochemical and structural characterization of PAOs remains rather limited, and their evolutionary history is still enigmatic. In this study, two amphioxus (Branchiostoma japonicum) PAO genes, named Bjpao1 and Bjpao2, were cloned and characterized. Both Bjpao1 and Bjpao2 displayed distinct tissue-specific expression patterns. Notably, rBjPAO1 oxidized both spermine and spermidine, but not N(1)-acetylspermine, whereas rBjPAO2 oxidizes both spermidine and N(1)-acetylspermine, but not spermine. To understand structure-function relationship, the enzymatic activities of mutant BjPAOs that were generated by site-directed mutagenesis and expressed in E. coli were examined, The results indicate that the residues H64, K301 and T460 in rBjPAO1, and H69, K315 and T467 in rBjPAO2 were all involved in substrate binding and enzyme catalytic activity to some extent. Based on our results and those of others, a model depicting the divergent evolution and functional specialization of vertebrate SMO and APAO genes is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.
Kita, K; Konishi, K; Anraku, Y
1986-01-01
Two terminal oxidase complexes, cytochrome b-562-o complex and cytochrome b-558-d complex, are isolated in highly purified forms which show ubiquinol oxidase activities. From the result of steady-state kinetics of cytochromes in the membrane and E'm values of purified cytochromes, we propose a branched arrangement of the late exponential phase of aerobic growth, as shown in Fig. 10. Cytochrome b-556 is reduced by several dehydrogenases and the gene for this cytochrome (cybA) is located in the sdh gene cluster. Recently, we found another low-potential b-type cytochrome, cytochrome b-561 (Em' = 20 mV), which is also reduced by dehydrogenases. The position of this new cytochrome in the aerobic respiratory chain is under investigation. Two terminal oxidase complexes branch at the site of ubiquinone-8, and the Km value for oxygen of the purified cytochrome b-558-d complex is about 8-fold lower than that of the purified cytochrome b-562-o complex when ubiquinol-1 is used as substrate. This result is consistent with the idea that the cytochrome b-558-d complex is synthesized as an alternative oxidase for more efficient utilization of oxygen at low oxygen concentration. Thus, E. coli cells can maintain efficient oxidative energy conservation over a wide range of oxygen pressures by simply changing the contents of the two terminal oxidases, each of which functions as a coupling site.
Veazey, Kylee J; Carnahan, Mindy N; Muller, Daria; Miranda, Rajesh C; Golding, Michael C
2013-07-01
From studies using a diverse range of model organisms, we now acknowledge that epigenetic changes to chromatin structure provide a plausible link between environmental teratogens and alterations in gene expression leading to disease. Observations from a number of independent laboratories indicate that ethanol (EtOH) has the capacity to act as a powerful epigenetic disruptor and potentially derail the coordinated processes of cellular differentiation. In this study, we sought to examine whether primary neurospheres cultured under conditions maintaining stemness were susceptible to alcohol-induced alterations in the histone code. We focused our studies on trimethylated histone 3 lysine 4 and trimethylated histone 3 lysine 27, as these are 2 of the most prominent posttranslational histone modifications regulating stem cell maintenance and neural differentiation. Primary neurosphere cultures were maintained under conditions promoting the stem cell state and treated with EtOH for 5 days. Control and EtOH-treated cellular extracts were examined using a combination of quantitative RT-PCR and chromatin immunoprecipitation techniques. We find that the regulatory regions of genes controlling both neural precursor cell identity and processes of differentiation exhibited significant declines in the enrichment of the chromatin marks examined. Despite these widespread changes in chromatin structure, only a small subset of genes including Dlx2, Fabp7, Nestin, Olig2, and Pax6 displayed EtOH-induced alterations in transcription. Unexpectedly, the majority of chromatin-modifying enzymes examined including members of the Polycomb Repressive Complex displayed minimal changes in expression and localization. Only transcripts encoding Dnmt1, Uhrf1, Ehmt1, Ash2 l, Wdr5, and Kdm1b exhibited significant differences. Our results indicate that primary neurospheres maintained as stem cells in vitro are susceptible to alcohol-induced perturbation of the histone code and errors in the epigenetic
Gene-Environment Correlation and Interaction in Peer Effects on Adolescent Alcohol and Tobacco Use
Harden, K. Paige; Hill, Jennifer E.; Turkheimer, Eric; Emery, Robert E.
2010-01-01
Peer relationships are commonly thought to be critical for adolescent socialization, including the development of negative health behaviors such as alcohol and tobacco use. The interplay between genetic liability and peer influences on the development of adolescent alcohol and tobacco use was examined using a nationally-representative sample of adolescent sibling pairs and their best friends. Genetic factors, some of them related to an adolescent's own substance use and some of them independent of use, were associated with increased exposure to best friends with heavy substance use—a gene-environment correlation. Moreover, adolescents who were genetically liable to substance use were more vulnerable to the adverse influences of their best friends—a gene-environment interaction. PMID:18368474
Stanton, Thad B.; Rosey, Everett L.; Kennedy, Michael J.; Jensen, Neil S.; Bosworth, Brad T.
1999-01-01
Brachyspira (Serpulina) hyodysenteriae, the etiologic agent of swine dysentery, uses the enzyme NADH oxidase to consume oxygen. To investigate possible roles for NADH oxidase in the growth and virulence of this anaerobic spirochete, mutant strains deficient in oxidase activity were isolated and characterized. The cloned NADH oxidase gene (nox; GenBank accession no. U19610) on plasmid pER218 was inactivated by replacing 321 bp of coding sequence with either a gene for chloramphenicol resistance (cat) or a gene for kanamycin resistance (kan). The resulting plasmids, respectively, pCmΔNOX and pKmΔNOX, were used to transform wild-type B. hyodysenteriae B204 cells and generate the antibiotic-resistant strains Nox-Cm and Nox-Km. PCR and Southern hybridization analyses indicated that the chromosomal wild-type nox genes in these strains had been replaced, through allelic exchange, by the inactivated nox gene containing cat or kan. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western immunoblot analysis revealed that both nox mutant cell lysates were missing the 48-kDa Nox protein. Soluble NADH oxidase activity levels in cell lysates of Nox-Cm and Nox-Km were reduced 92 to 96% compared to the activity level in parent strain B204. In an aerotolerance test, cells of both nox mutants were at least 100-fold more sensitive to oxygen exposure than were cells of the wild-type parent strain B204. In swine experimental infections, both nox mutants were less virulent than strain B204 in that fewer animals were colonized by the mutant cells and infected animals displayed mild, transient signs of disease, with no deaths. These results provide evidence that NADH oxidase serves to protect B. hyodysenteriae cells against oxygen toxicity and that the enzyme, in that role, contributes to the pathogenic ability of the spirochete. PMID:10543819
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred
2016-11-01
Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. Copyright © 2016. Published by Elsevier Ltd.
Schmetterer, Georg; Valladares, Ana; Pils, Dietmar; Steinbach, Susanne; Pacher, Margit; Muro-Pastor, Alicia M.; Flores, Enrique; Herrero, Antonia
2001-01-01
Three genes, coxB, coxA, and coxC, found in a clone from a gene library of the cyanobacterium Anabaena variabilis strain ATCC 29413, were identified by hybridization with an oligonucleotide specific for aa3-type cytochrome c oxidases. Deletion of these genes from the genome of A. variabilis strain ATCC 29413 FD yielded strain CSW1, which displayed no chemoheterotrophic growth and an impaired cytochrome c oxidase activity. Photoautotrophic growth of CSW1, however, was unchanged, even with dinitrogen as the nitrogen source. A higher cytochrome c oxidase activity was detected in membrane preparations from dinitrogen-grown CSW1 than from nitrate-grown CSW1, but comparable activities of respiratory oxygen uptake were found in the wild type and in CSW1. Our data indicate that the identified cox gene cluster is essential for fructose-dependent growth in the dark, but not for growth on dinitrogen, and that other terminal respiratory oxidases are expressed in this cyanobacterium. Transcription analysis showed that coxBAC constitutes an operon which is expressed from two transcriptional start points. The use of one of them was stimulated by fructose. PMID:11591688
Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae
2010-10-01
DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Wu, Ying-Hui; Fischer, David F; Swaab, Dick F
2007-09-05
Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman
2015-12-01
Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.
Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N
2002-04-01
Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.
Genes involved in stress response and alcohol use among high-risk African American youth.
Goyal, Neeru; Aliev, Fazil; Latendresse, Shawn J; Kertes, Darlene A; Bolland, John M; Byck, Gayle R; Mustanski, Brian; Salvatore, Jessica E; Dick, Danielle M
2016-01-01
Genetic and environmental factors influence substance use behaviors in youth. One of the known environmental risk factors is exposure to life stressors. The aim of this project is to study the interaction between NR3C1 and CRHBP, genes thought to be involved in stress pathways, exposure to stressful life events, and adolescent alcohol use/misuse. The sample included 541 African American individuals (ages 13-18) from the Genes, Environment, and Neighborhood Initiative, a subset of the Mobile Youth Survey sample from whom DNA and more extensive phenotypic data were collected. Participants were selected from high-poverty neighborhoods in Mobile, Alabama, with potential exposure to a variety of extreme life stressors. A measure of stressful life events was significantly predictive of alcohol use/misuse. In addition, this association was significantly dependent upon the number of putative risk variants at rs1715749, a single-nucleotide polymorphism (SNP) in CRHBP (P ≤ .006). There was no significant interaction between NR3C1 and stressful life events with respect to alcohol use/misuse, after taking into account multiple testing. These findings suggest that CRHBP variants are potentially relevant for adolescent alcohol use/misuse among African American youth populations being reared within the context of stressful life events and warrant replication.
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.
Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J
1996-01-01
The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115
Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong
2016-01-01
Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324
Xu, Ting; Wang, Ya-Ting; Liang, Wu-Sheng; Yao, Fei; Li, Yong-Hong; Li, Dian-Rong; Wang, Hao; Wang, Zheng-Yi
2013-06-01
Sclerotinia sclerotiorum is a filamentous fungal pathogen that can infect many economically important crops and vegetables. Alternative oxidase is the terminal oxidase of the alternative respiratory pathway in fungal mitochondria. The function of alternative oxidase was investigated in the regulation of sensitivity of S. sclerotiorum to two commercial fungicides, azoxystrobin and procymidone which have different fungitoxic mechanisms. Two isolates of S. sclerotiorum were sensitive to both fungicides. Application of salicylhydroxamic acid, a specific inhibitor of alternative oxidase, significantly increased the values of effective concentration causing 50% mycelial growth inhibition (EC50) of azoxystrobin to both S. sclerotiorum isolates, whereas notably decreased the EC50 values of procymidone. In mycelial respiration assay azoxystrobin displayed immediate inhibitory effect on cytochrome pathway capacity, but had no immediate effect on alternative pathway capacity. In contrast, procymidone showed no immediate impact on capacities of both cytochrome and alternative pathways in the mycelia. However, alternative oxidase encoding gene (aox) transcript and protein levels, alternative respiration pathway capacity of the mycelia were obviously increased by pre-treatment for 24 h with both azoxystrobin and procymidone. These results indicate that alternative oxidase was involved in the regulation of sensitivity of S. sclerotiorum to the fungicides azoxystrobin and procymidone, and that both fungicides could affect aox gene expression and the alternative respiration pathway capacity development in mycelia of this fungal pathogen.
Klein, Jonathon D; Sherrill, Jeremy B; Morello, Gabriella M; San Miguel, Phillip J; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M; Lumeng, Lawrence; Lossie, Amy C
2014-01-01
Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.
Klarich, DawnKylee S.; Penprase, Jerrold; Cintora, Patricia; Medrano, Octavio; Erwin, Danielle; Brasser, Susan M.; Hong, Mee Young
2017-01-01
Excessive alcohol consumption is a risk factor associated with colorectal cancer; however, some studies have reported that moderate alcohol consumption may not contribute additional risk for developing colorectal cancer while others suggest that moderate alcohol consumption provides a protective effect that reduces colorectal cancer risk. The purpose of this study was to determine the effects of moderate voluntary alcohol (20% ethanol) intake on alternate days for 3 months in outbred Wistar rats on risk factors associated with colorectal cancer development. Colonic gene expression of cyclooxygenase-2, RelA, 8-oxoguanine DNA glycosylase 1, superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glutathione-S-transferase M1, and aldehyde dehydrogenase 2 were determined. Blood alcohol content, liver function enzyme activities, and 8-oxo-deoxyguanosine DNA adducts were also assessed. Alcohol-treated rats were found to have significantly lower 8-oxo-deoxyguanosine levels in blood, a marker of DNA damage. Alanine aminotransferase and lactate dehydrogenase were both significantly lower in the alcohol group. Moderate alcohol significantly decreased cyclooxygenase-2 gene expression, an inflammatory marker associated with colorectal cancer risk. The alcohol group had significantly increased glutathione-S-transferase M1 expression, an antioxidant enzyme that helps detoxify carcinogens, such as acetaldehyde, and significantly increased aldehyde dehydrogenase 2 expression, which allows for greater acetaldehyde clearance. Increased expression of glutathione-S-transferase M1 and aldehyde dehydrogenase 2 likely contributed to reduce mucosal damage that is caused by acetaldehyde accumulation. These results indicate that moderate alcohol may reduce the risk for colorectal cancer development, which was evidenced by reduced inflammation activity and lower DNA damage after alcohol exposure. PMID:28599714
Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič
2018-04-23
Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WE) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very long-chain fatty alcohols, which must be oxidised to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and ...
Rationally engineered flavin-dependent oxidase reveals steric control of dioxygen reduction.
Zafred, Domen; Steiner, Barbara; Teufelberger, Andrea R; Hromic, Altijana; Karplus, P Andrew; Schofield, Christopher J; Wallner, Silvia; Macheroux, Peter
2015-08-01
The ability of flavoenzymes to reduce dioxygen varies greatly, and is controlled by the protein environment, which may cause either a rapid reaction (oxidases) or a sluggish reaction (dehydrogenases). Previously, a 'gatekeeper' amino acid residue was identified that controls the reactivity to dioxygen in proteins from the vanillyl alcohol oxidase superfamily of flavoenzymes. We have identified an alternative gatekeeper residue that similarly controls dioxygen reactivity in the grass pollen allergen Phl p 4, a member of this superfamily that has glucose dehydrogenase activity and the highest redox potential measured in a flavoenzyme. A substitution at the alternative gatekeeper site (I153V) transformed the enzyme into an efficient oxidase by increasing dioxygen reactivity by a factor of 60,000. An inverse exchange (V169I) in the structurally related berberine bridge enzyme (BBE) decreased its dioxygen reactivity by a factor of 500. Structural and biochemical characterization of these and additional variants showed that our model enzymes possess a cavity that binds an anion and resembles the 'oxyanion hole' in the proximity of the flavin ring. We showed also that steric control of access to this site is the most important parameter affecting dioxygen reactivity in BBE-like enzymes. Analysis of flavin-dependent oxidases from other superfamilies revealed similar structural features, suggesting that dioxygen reactivity may be governed by a common mechanistic principle. Structural data are available in PDB database under the accession numbers 4PVE, 4PVH, 4PVJ, 4PVK, 4PWB, 4PWC and 4PZF. © 2015 FEBS.
NADPH oxidases in the arbuscular mycorrhizal symbiosis.
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules.
NADPH oxidases in the arbuscular mycorrhizal symbiosis
Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa
2016-01-01
ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627
Edenberg, Howard J; Foroud, Tatiana
2014-01-01
Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Lidö, Helga Höifödt; Jonsson, Susanne; Hyytiä, Petri; Ericson, Mia; Söderpalm, Bo
2017-05-01
The glycine transporter-1 inhibitor Org25935 is a promising candidate in a treatment concept for alcohol use disorder targeting the glycine system. Org25935 inhibits ethanol-induced dopamine elevation in brain reward regions and reduces ethanol intake in Wistar rats. This study aimed to further characterise the compound and used ethanol consumption, behavioral measures, and gene expression as parameters to investigate the effects in Wistar rats and, as pharmacogenetic comparison, Alko-Alcohol (AA) rats. Animals were provided limited access to ethanol in a two-bottle free-choice paradigm with daily drug administration. Acute effects of Org25935 were estimated using locomotor activity and neurobehavioral status. Effects on gene expression in Wistar rats were measured with qPCR. The higher but not the lower dose of Org25935 reduced alcohol intake in Wistar rats. Unexpectedly, Org25935 reduced both ethanol and water intake and induced strong CNS-depressive effects in AA-rats (withdrawn from further studies). Neurobehavioral effects by Org25935 differed between the strains (AA-rats towards sedation). Org25935 did not affect gene expression at the mRNA level in the glycine system of Wistar rats. The data indicate a small therapeutic range for the anti-alcohol properties of Org25935, a finding that may guide further evaluations of the clinical utility of GlyT-1 inhibitors. The results point to the importance of pharmacogenetic considerations when developing drugs for alcohol-related medical concerns. Despite the lack of successful clinical outcomes, to date, the heterogeneity of drug action of Org25935 and similar agents and the unmet medical need justify further studies of glycinergic compounds in alcohol use disorder.
Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu
2016-01-01
The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723
Lydall, Gregory John; Bass, Nicholas J; McQuillin, Andrew; Lawrence, Jacob; Anjorin, Adebayo; Kandaswamy, Radhika; Pereira, Ana; Guerrini, Irene; Curtis, David; Vine, Anna E; Sklar, Pamela; Purcell, Shaun M; Gurling, Hugh Malcolm Douglas
2011-12-01
Alcoholism and affective disorders are both strongly comorbid and heritable. We have investigated the genetic comorbidity between bipolar affective disorder and alcoholism. A genome-wide allelic association study of 506 patients from the University College London bipolar disorder case-control sample and 510 ancestrally matched supernormal controls. One hundred forty-three of the bipolar patients fulfilled the Research Diagnostic Criteria diagnosis of alcoholism. A total of 372 193 single nucleotide polymorphisms (SNPs) were genotyped. Genes previously shown to be associated with alcoholism and addiction phenotypes were then tested for association in the bipolar alcoholic sample using gene-wise permutation tests of all SNPs genotyped within a 50-kb region flanking each gene. Several central nervous system genes showed significant (P<0.05) gene-wise evidence of association with bipolar alcoholism. The genes implicated, which replicated genes previously shown to be associated with alcoholism were: cadherin 11, collagen type 11 α2, neuromedin U receptor 2, exportin7, and semaphorin-associated protein 5A. The SNPs most strongly implicated in bipolar alcoholism, but, which did not meet conventional genome-wide significance criteria were the insulin-like growth factor-binding protein 7, carboxypeptidase O, cerebellin 2, and the cadherin 12 genes. We have confirmed the role of some genes previously shown to be associated with alcoholism in the comorbid bipolar alcoholism subgroup. In this subgroup, bipolar disorder may lower the threshold for the phenotypic expression of these alcoholism susceptibility genes. We also show that some genes may independently increase susceptibility to affective disorder and alcoholism.
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.
Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver
2011-07-20
Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.
Viña-Gonzalez, Javier; Elbl, Katarina; Ponte, Xavier; Valero, Francisco; Alcalde, Miguel
2018-07-01
Aryl-alcohol oxidase (AAO) plays a fundamental role in the fungal ligninolytic secretome, acting as a supplier of H 2 O 2 . Despite its highly selective mechanism of action, the presence of this flavooxidase in different biotechnological settings has hitherto been hampered by the lack of appropriate heterologous expression systems. We recently described the functional expression of the AAO from Pleurotus eryngii in Saccharomyces cerevisiae by fusing a chimeric signal peptide (preαproK) and applying structure-guided evolution. Here, we have obtained an AAO secretion variant that is readily expressed in S. cerevisiae and overproduced in Pichia pastoris. First, the functional expression of AAO in S. cerevisiae was enhanced through the in vivo shuffling of a panel of secretion variants, followed by the focused evolution of the preαproK peptide. The outcome of this evolutionary campaign-an expression variant that accumulated 4 mutations in the chimeric signal peptide, plus two mutations in the mature protein- showed 350-fold improved secretion (4.5 mg/L) and was stable. This secretion mutant was cloned into P. pastoris and fermented in a fed-batch bioreactor to enhance production to 25 mg/L. While both recombinant AAO from S. cerevisiae and P. pastoris were subjected to the same N-terminal processing and had a similar pH activity profile, they differed in their kinetic parameters and thermostability. The strong glycosylation observed in the evolved AAO from S. cerevisiae underpinned this effect, since when the mutant was produced in the glycosylation-deficient S. cerevisiae strain Δkre2, its kinetic parameters and thermostability were comparable to its poorly glycosylated P. pastoris recombinant counterpart. © 2018 Wiley Periodicals, Inc.
Relations of blood pressure to angiotensinogen gene T174M polymorphism and alcohol intake.
Takashima, Yutaka; Kokaze, Akatsuki; Matsunaga, Naomi; Yoshida, Masao; Sekiguchi, Kanako; Sekine, Yasuko; Sumiya, Yu
2003-07-01
To clarify the interactive effects of alcohol intake and angiotensinogen gene codon 174 (T174M) polymorphisms on blood pressure in Japanese male workers. On the basis of data from health examinations, nutrition survey and T174M genotype analysis conducted for 185 Japanese male workers at 2000, the prevalence of high-normal blood pressure (HNBP) and hypertension were compared between the four subgroups crossed by two T174M genotype categories ('TT' type, and 'TM or MM' type) and two alcohol intake categories (less than 13.7 g per day, and 13.7 g or more per day). Furthermore, for 95 subjects who had been normotensive at 1998 among them, risk of development into HNBP or hypertension at 2000 were compared across the four subgroups. The findings showed that the HNBP prevalence adjusted for age, body mass index, smoking habits and sodium intake in 2000 was significantly (p=0.03) greater in 'TM or MM' type (57.9%) than in 'TT' type (24.9%) in subjects with 13.7 g or more of daily alcohol intake, whereas no difference in this parameter was found between the two genotypes in those with less than 13.7 g of daily alcohol intake (18.2% and 18.3%, respectively). The risk for development into HNBP at 2000 was also greatest in 'TM or MM' type with 13.7 g or more of daily alcohol intake among the four subgroups, although there were not significant differences between the four subgroups. The prevalence of hypertension or development risk for hypertension did not significantly differ between the four subgroups. Therefore, it can be seen that alcohol drinking might be specifically associated with the HNBP in M allele carriers of angiotensinogen gene T174M polymorphism.
Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude
2017-09-01
Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.
Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu
2009-04-01
To develop microbial production method for prenyl alcohols (e.g., (E,E)-farnesol (FOH), (E)-nerolidol (NOH), and (E,E,E)-geranylgeraniol (GGOH)), the genes encoding enzymes in the mevalonate and prenyl diphosphate pathways were overexpressed in Saccharomyces cerevisiae, and the resultant transformants were evaluated as to the production of these alcohols. Overexpression of the gene encoding hydroxymethylglutaryl (HMG)-CoA reductase was most effective among the genes tested. A derivative of S. cerevisiae ATCC 200589, which was selected through screening, was found to be the most suitable host for the production. On cultivation of the resultant transformant, in which the HMG-CoA reductase gene was overexpressed, in a 5-liter bench-scale jar fermenter for 7 d, the production of FOH, NOH, and GGOH reached 145.7, 98.8, and 2.46 mg/l, respectively.
Sata, F; Yamada, H; Kishi, R; Minakami, H
2012-10-01
Epidemiological studies have suggested that the condition of recurrent pregnancy loss (RPL) may be multifactorial, with both genetic predisposition and environmental factors potentially involved in its pathogenesis. The aim of this study is to elucidate the associations between maternal folate, alcohol and energy metabolism-related gene polymorphisms and the risk of RPL. This case-control study, which involved 116 cases with two or more instances of RPL and 306 fertile controls, was performed in the city of Sapporo, Japan. The associations between eight single nucleotide polymorphisms of folate, alcohol and energy metabolism-related genes [methylenetetrahydrofolate reductase (MTHFR), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), alcohol dehydrogenase 1B (ADH1B), aldehyde dehydrogenase 2 (ALDH2), beta-3-adrenergic receptor (ADRB3) and peroxisome proliferator-activated receptor gamma (PPARG)], and RPL were assessed. Without consideration of cigarette smoking or alcohol use, the risk of RPL significantly decreased in women with the MTHFR rs1801133 TT, MTR rs1805087 AG or ALDH2 rs671 AA genotype (P < 0.05). The risk of RPL associated with cigarette smoking and alcohol use decreased significantly in women carrying the MTHFR rs1801133 T allele [odds ratio (OR), 0.51; 95% confidence interval (CI), 0.27-0.95]. Similarly, the risk of RPL significantly decreased in women carrying the MTR rs1805087 G allele (OR, 0.44; 95% CI, 0.23-0.85). Our findings suggest that maternal gene polymorphisms related to folate metabolism may decrease the risk of RPL. Molecular epidemiological studies are needed to unequivocally elucidate the multifactorial effects of both genetic and environmental factors on human fecundity.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Rinker, Jennifer A.; Fulmer, Diana B.; Trantham-Davidson, Heather; Smith, Maren L.; Williams, Robert W.; Lopez, Marcelo F.; Randall, Patrick K.; Chandler, L. Judson; Miles, Michael F.; Becker, Howard C.; Mulholland, Patrick J.
2016-01-01
Alcohol (ethanol) dependence is a chronic relapsing brain disorder partially influenced by genetics and characterized by an inability to regulate harmful levels of drinking. Emerging evidence has linked genes that encode KV7, KIR, and KCa2 K+ channels with variation in alcohol-related behaviors in rodents and humans. This led us to experimentally test relations between K+ channel genes and escalation of drinking in a chronic intermittent ethanol (CIE) exposure model of dependence in BXD recombinant inbred strains of mice. Transcript levels for K+ channel genes in the prefrontal cortex (PFC) and nucleus accumbens (NAc) covary with voluntary ethanol drinking in a non-dependent cohort. Transcripts that encode KV7 channels covary negatively with drinking in non-dependent BXD strains. Using a pharmacological approach to validate the genetic findings, C57BL/6J mice were allowed intermittent access to ethanol to establish baseline consumption before they were treated with retigabine, an FDA-approved KV7 channel positive modulator. Systemic administration significantly reduced drinking, and consistent with previous evidence, retigabine was more effective at reducing voluntary consumption in high-drinking than low-drinking subjects. We evaluated the specific K+ channel genes that were most sensitive to CIE exposure and identified a gene subset in the NAc and PFC dysregulated in the alcohol-dependent BXD cohort. CIE-induced modulation of nine genes in the NAc and six genes in the PFC covaried well with the changes in drinking induced by ethanol dependence. Here we identified novel candidate genes in the NAc and PFC that are regulated by ethanol dependence and correlate with voluntary drinking in non-dependent and dependent BXD mice. The findings that Kcnq expression correlate with drinking and that retigabine reduces consumption suggest that KV7 channels could be pharmacogenetic targets to treat individuals with alcohol addiction. PMID:27432260
Li, Jun; Bardag-Gorce, F; Joan, Oliva; French, BA; Dedes, J; French, SW
2010-01-01
Propranolol, a beta adrenergic blocker prevents the blood alcohol (BAL) cycle in rats fed ethanol intragastrically at a constant rate by preventing the cyclic changes in the metabolic rate caused by fluctuating levels of norepinephrine released into the blood. The change in the rate of metabolism changes the rate of alcohol elimination in the blood which causes the BAL to cycle. Microarray analysis of the livers from the rats fed ethanol and propranolol showed similar changes in clusters of functionally related gene expressions. The controls and the trough of the cycle differed dramatically from the cluster pattern seen in the rats at the peaks of the blood alcohol cycle. The changes in gene expression induced by ethanol were similar when propranolol was fed without ethanol especially with the changes in the kinases and phosphatases, Toll-like receptor signaling and cytokine-cytokine receptor interaction were also changed. The changes in gene expression caused by ethanol and propranolol feeding are alike probably because both drugs induce β adrenergic receptor desensitization. PMID:19925788
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
Lydall, Gregory J; Bass, Nicholas J; McQuillin, Andrew; Lawrence, Jacob; Anjorin, Adebayo; Kandaswamy, Radhika; Pereira, Ana; Guerrini, Irene; Curtis, David; Vine, Anna E; Sklar, Pamela; Purcell, Shaun M; Gurling, Hugh MD
2012-01-01
Objectives Alcoholism and affective disorders are both strongly comorbid and heritable. We have investigated the genetic comorbidity between bipolar affective disorder and alcoholism. Methods A genome-wide allelic association study of 506 patients from the University College London (UCL) bipolar disorder case control sample and 510 ancestrally-matched supernormal controls. 143 of the bipolar subjects fulfilled the research diagnostic criteria (RDC) diagnosis of alcoholism. 372,193 single nucleotide polymorphisms (SNPs) were genotyped. Genes previously shown to be associated with alcoholism and addiction phenotypes were then tested for association in the bipolar alcoholic sample using gene wise permutation tests of all SNPs genotyped within a 50kb region flanking each gene. Results Several CNS genes showed significant (p<0.05) gene wise evidence of association with bipolar alcoholism. The genes implicated which replicated previously identified associations with alcoholism were: cadherin 11 (CDH11), collagen type XI alpha 2 (COL11A2), neuromedin U receptor 2 (NMUR2), exportin7 (XP07) and semaphorin associated protein 5A (SEMA5A). The SNPs most strongly implicated in bipolar alcoholism, but which did not meet conventional genome-wide significance criteria were the insulin-like growth factor binding protein 7 (IGFBP7), carboxypeptidase O (CPO), cerebellin 2 (CBLN2), and the cadherin 12 (CDH12) genes. Conclusions We have confirmed the role of some genes previously shown to be associated with alcoholism in the comorbid bipolar alcoholism subgroup. In this subgroup bipolar disorder may lower the threshold for the phenotypic expression of these alcoholism susceptibility genes. We also show that some genes may independently increase susceptibility to affective disorder and alcoholism. PMID:21876473
NADPH Oxidase-Dependent Signaling in Endothelial Cells: Role in Physiology and Pathophysiology
Ushio-Fukai, Masuko; Malik, Asrar B.
2009-01-01
Abstract Reactive oxygen species (ROS) including superoxide (O2·−) and hydrogen peroxide (H2O2) are produced endogenously in response to cytokines, growth factors; G-protein coupled receptors, and shear stress in endothelial cells (ECs). ROS function as signaling molecules to mediate various biological responses such as gene expression, cell proliferation, migration, angiogenesis, apoptosis, and senescence in ECs. Signal transduction activated by ROS, “oxidant signaling,” has received intense investigation. Excess amount of ROS contribute to various pathophysiologies, including endothelial dysfunction, atherosclerosis, hypertension, diabetes, and acute respiratory distress syndrome (ARDS). The major source of ROS in EC is a NADPH oxidase. The prototype phagaocytic NADPH oxidase is composed of membrane-bound gp91phox and p22hox, as well as cytosolic subunits such as p47phox, p67phox and small GTPase Rac. In ECs, in addition to all the components of phagocytic NADPH oxidases, homologues of gp91phox (Nox2) including Nox1, Nox4, and Nox5 are expressed. The aim of this review is to provide an overview of the emerging area of ROS derived from NADPH oxidase and oxidant signaling in ECs linked to physiological and pathophysiological functions. Understanding these mechanisms may provide insight into the NADPH oxidase and oxidant signaling components as potential therapeutic targets. Antioxid. Redox Signal. 11, 791–810. PMID:18783313
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Muhammad, Izhar; Jing, Xiu-Qing; Shalmani, Abdullah; Ali, Muhammad; Yi, Shi; Gan, Peng-Fei; Li, Wen-Qiang; Liu, Wen-Ting; Chen, Kun-Ming
2018-05-12
The ferric reduction oxidase (FRO) gene family is involved in various biological processes widely found in plants and may play an essential role in metal homeostasis, tolerance and intricate signaling networks in response to a number of abiotic stresses. Our study describes the identification, characterization and evolutionary relationships of FRO genes families. Here, total 50 FRO genes in Plantae and 15 ‘FRO like’ genes in non-Plantae were retrieved from 16 different species. The entire FRO genes have been divided into seven clades according to close similarity in biological and functional behavior. Three conserved domains were common in FRO genes while in two FROs sub genome have an extra NADPH-Ox domain, separating the function of plant FROs. OsFRO1 and OsFRO7 genes were expressed constitutively in rice plant. Real-time RT-PCR analysis demonstrated that the expression of OsFRO1 was high in flag leaf, and OsFRO7 gene expression was maximum in leaf blade and flag leaf. Both genes showed vigorous expressions level in response to different abiotic and hormones treatments. Moreover, the expression of both genes was also substantial under heavy metal stresses. OsFRO1 gene expression was triggered following 6 h under Zn, Pb, Co and Ni treatments, whereas OsFRO7 gene expression under Fe, Pb and Ni after 12 h, Zn and Cr after 6 h, and Mn and Co after 3 h treatments. These findings suggest the possible involvement of both the genes under abiotic and metal stress and the regulation of phytohormones. Therefore, our current work may provide the foundation for further functional characterization of rice FRO genes family.
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Giacomelli, Lisa
2013-01-01
Gibberellins (GAs) are involved in the regulation of flowering and fruit-set in grapes (Vitis vinifera L.), but the molecular mechanisms behind this process are mostly unknown. In this work, the family of grapevine GA oxidases involved in the biosynthesis and deactivation of GAs was characterized. Six putative GA 20-oxidase (GA20ox), three GA 3-oxidase (GA3ox), and eight GA 2-oxidase (GA2ox) proteins, the latter further divided into five C19-GA 2ox and three C20-GA2ox proteins, were identified. Phylogenetic analyses suggest a common origin of the GA3ox and C19-GA2ox groups and challenge previous evolutionary models. In vitro analysis revealed that all GA3ox and GA20ox enzymes prefer substrates of the non-13-hydroxylation pathway. In addition, ectopic expression of GA2ox genes in Arabidopsis thaliana confirmed the activity of their encoded proteins in vivo. The results show that bioactive GA1 accumulates in opening grapevine flowers, whereas at later developmental stages only GA4 is detected in the setting fruit. By studying the expression pattern of the grapevine GA oxidase genes in different organs, and at different stages of flowering and fruit-set, it is proposed that the pool of bioactive GAs is controlled by a fine regulation of the abundance and localization of GA oxidase transcripts. PMID:24006417
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Wang, Meiling; Wang, Yong; Wu, Hongqi; Xu, Jing; Li, Tingting; Hegebarth, Daniela; Jetter, Reinhard; Chen, Letian; Wang, Zhonghua
2016-01-01
Cuticular waxes play crucial roles in protecting plants against biotic and abiotic stresses. They are complex mixtures of very-long-chain fatty acids and their derivatives, including C20–C32 fatty alcohols. Here, we report the identification of 32 FAR-like genes and the detailed characterization of TaFAR2, TaFAR3 and TaFAR4, wax biosynthetic genes encoding fatty acyl-coenzyme A reductase (FAR) in wheat leaf cuticle. Heterologous expression of the three TaFARs in wild-type yeast and mutated yeast showed that TaFAR2, TaFAR3 and TaFAR4 were predominantly responsible for the accumulation of C18:0, C28:0 and C24:0 primary alcohols, respectively. Transgenic expression of the three TaFARs in tomato fruit and Arabidopsis cer4 mutant led to increased production of C22:0–C30:0 primary alcohols. GFP-fusion protein injection assay showed that the three encoded TaFAR proteins were localized to the endoplasmic reticulum (ER), the site of wax biosynthesis. The transcriptional expression of the three TaFAR genes was induced by cold, salt, drought and ABA. Low air humidity led to increased expression of TaFAR genes and elevated wax accumulation in wheat leaves. Collectively, these data suggest that TaFAR2, TaFAR3 and TaFAR4 encode active alcohol-forming FARs involved in the synthesis of primary alcohol in wheat leaf and the response to environmental stresses. PMID:27112792
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6
Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun
2015-01-01
Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
NADPH oxidase inhibitors: a patent review.
Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam
2011-08-01
NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.
Education and alcohol use: A study of gene-environment interaction in young adulthood.
Barr, Peter B; Salvatore, Jessica E; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J; Kaprio, Jaakko; Dick, Danielle M
2016-08-01
The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N = 3402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one's position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.
Education and Alcohol Use: A Study of Gene-Environment Interaction in Young Adulthood
Barr, Peter B.; Salvatore, Jessica E.; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J.; Kaprio, Jaakko; Dick, Danielle M.
2016-01-01
The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N=3,402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one’s position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. PMID:27367897
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Chi, Ming; Bhagwat, Basdeo; Lane, W David; Tang, Guiliang; Su, Yinquan; Sun, Runcang; Oomah, B Dave; Wiersma, Paul A; Xiang, Yu
2014-03-11
Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. StuPPO1 to StuPPO4 genes contributed to browning
Foshee, Vangie A; Benefield, Thad S; Puvanesarajah, Samantha; Reyes, Heath Luz McNaughton; Haberstick, Brett C; Smolen, Andrew; Ennett, Susan T; Suchindran, Chirayath
2015-03-01
Studies report that alcohol use is related to partner violence, but for many, alcohol use does not culminate in violence against partners. Guided by a self-regulatory failure framework, we predicted that alcohol use would be more strongly associated with dating violence perpetration among adolescents with genotypes linked to impulsivity and emotional reactivity. The hypothesis was tested using random coefficient modeling of data from a multi-wave longitudinal study spanning grades 8-12 (ages 13-18) (n = 1,475). Analyses adjusted for multiple testing and race, and the potential for gene by environment correlation was examined. As predicted, alcohol use was more strongly associated with dating violence among adolescents who had a high rather than a low multilocus genetic profile composed of five genetic markers that influence dopamine signaling. Alcohol use was more strongly related to dating violence among boys with long rather than short 5-HTTLPR alleles, the opposite of the prediction. MAOA-uVNTR did not interact with alcohol, but it had a main effect on dating violence by boys in later grades in the expected direction: boys with more low activity alleles perpetrated more dating violence. Exploratory analyses found variation in findings by race. Our findings demonstrate the importance of incorporating genes into etiological studies of adolescent dating violence, which to date has not been done. Aggr. Behav. Aggr. Behav. 42:189-203, 2015. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.
Jiang, Xiao-hua; Yang, Hui; Yang, Jing-fang; Dong, Xiu-min; Xu, Qun-yuan; Chen, Biao
2003-06-01
To study the association between the polymorphism of human monoamine oxidase type A (MAO-A) gene and Parkinson's disease(PD). Fnu4HI restriction fragment length polymorphism(RFLP) and PCR-RFLP were used to detect the mutation of MAO-A gene. The frequencies of alleles and genotypes at the MAO-A Fnu4HI locus on the X chromosome in different PD group were compared with those of the control group. It was found that the frequencies of G allele in the patients with PD and controls were 0.613 and 0.527 respectively, P=0.039 "the frequencies of TT genotype were 0.303 and 0.415(P=0.014), and the frequencies of GG genotype were 0.564 and 0.451 respectively(P=0.021). When the patients were divided into two groups by age-onset, significant difference in the allelic and genotypic frequencies was observed only between early-onset PD group and control group. And when the PD patients were grouped by sex, significant difference was observed only between male PD group and male control group (the frequencies of G allele being 0.669 and 0.500 respectively, P=0.005). This study revealed significant differences between PD group and control group in allelic and genotypic frequencies. The findings supported the hypothesis about an association between MAO-A gene and PD, suggesting that age at onset of PD and gender predisposition might be related to the putative association, and Fnu4HI SNP be a risk factor for PD.
The CRHR1 Gene, Trauma Exposure, and Alcoholism Risk: A Test of G × E Effects
Ray, Lara A.; Sehl, Mary; Bujarski, Spencer; Hutchison, Kent; Blaine, Sara; Enoch, Mary-Anne
2014-01-01
The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. Based on the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and SNPs in predicting the risk for alcoholism. Phenotypic data on 2,533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment (SAGE) genome-wide association study (GWAS). Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes / SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (p = 0.029) and two haplotypes in the distal block 2 (p = 0.026, 0.042) that showed nominally significant (corrected p < .025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (p = 0.019) and rs242924 (p = 0.019). In block 2, rs17689966 (p = 0.018) showed significant, and rs173365 (p = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic CRF system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. PMID:23473364
The CRHR1 gene, trauma exposure, and alcoholism risk: a test of G × E effects.
Ray, L A; Sehl, M; Bujarski, S; Hutchison, K; Blaine, S; Enoch, M-A
2013-06-01
The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. On the basis of the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and single-nucleotide polymorphisms (SNPs) in predicting the risk for alcoholism. Phenotypic data on 2533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment genome-wide association study. Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes/SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (P = 0.029) and two haplotypes in the distal block 2 (P = 0.026, 0.042) that showed nominally significant (corrected P < 0.025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (P = 0.019) and rs242924 (P = 0.019). In block 2, rs17689966 (P = 0.018) showed significant and rs173365 (P = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic corticotropin-releasing factor system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci. © 2013 John Wiley & Sons Ltd and International Behavioural and Neural
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Yong, Hoi-Sen; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes—PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship. PMID:29216281
Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih
2015-05-17
No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population.
Osterndorff-Kahanek, Elizabeth; Ponomarev, Igor; Blednov, Yuri A.; Harris, R. Adron
2013-01-01
Chronically available alcohol escalates drinking in mice and a single injection of the immune activator lipopolysaccharide can mimic this effect and result in a persistent increase in alcohol consumption. We hypothesized that chronic alcohol drinking and lipopolysaccharide injections will produce some similar molecular changes that play a role in regulation of alcohol intake. We investigated the molecular mechanisms of chronic alcohol consumption or lipopolysaccharide insult by gene expression profiling in prefrontal cortex and liver of C57BL/6J mice. We identified similar patterns of transcriptional changes among four groups of animals, three consuming alcohol (vs water) in different consumption tests and one injected with lipopolysaccharide (vs. vehicle). The three tests of alcohol consumption are the continuous chronic two bottle choice (Chronic), two bottle choice available every other day (Chronic Intermittent) and limited access to one bottle of ethanol (Drinking in the Dark). Gene expression changes were more numerous and marked in liver than in prefrontal cortex for the alcohol treatments and similar in the two tissues for lipopolysaccharide. Many of the changes were unique to each treatment, but there was significant overlap in prefrontal cortex for Chronic-Chronic Intermittent and for Chronic Intermittent-lipopolysaccharide and in liver all pairs showed overlap. In silico cell-type analysis indicated that lipopolysaccharide had strongest effects on brain microglia and liver Kupffer cells. Pathway analysis detected a prefrontal cortex-based dopamine-related (PPP1R1B, DRD1, DRD2, FOSB, PDNY) network that was highly over-represented in the Chronic Intermittent group, with several genes from the network being also regulated in the Chronic and lipopolysaccharide (but not Drinking in the Dark) groups. Liver showed a CYP and GST centered metabolic network shared in part by all four treatments. We demonstrate common consequences of chronic alcohol consumption and
Eprintsev, A T; Mal'tseva, E V; Shatskikh, A S; Popov, V N
2011-01-01
The involvement of active oxygen forms in the regulation of the expression of mitochondrial respiratory chain components, which are not related to energy storing, has been in vitro and in vivo studied in Lycopersicum esculentum L. The highest level of transcription of genes encoding alternative oxidase and NADH dehydrogenase has been observed in green tomato leaves. It has been shown that even low H2O2 concentrations activate both aoxlalpha and ndb1 genes, encoding alternative oxidase and external mitochondrial rotenone-insensitive NADH dehydrogenase, respectively. According to our results, in the case of an oxidative stress, alternative oxidase and NADH dehydrogenase are coexpressed in tomato plant tissues, and active oxygen forms serve as the secondary messengers of their coexpression.
Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.
Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C
2001-05-01
Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.
Alcohol Alert: Genetics of Alcoholism
... Reilly, M.T.; et al. Mpdz is a quantitative trait gene for drug withdrawal seizures. Nature Neuroscience 7(7):699–700, 2014. PMID: 15208631 . 12 Hurley, T.D., and Edenberg, H.J. Genes encoding enzymes involved in ethanol metabolism. Alcohol Research & Health 34:339–344, 2012 13 Yokoyama, A.; ...
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Bakri, M M; Rich, A M; Cannon, R D; Holmes, A R
2015-02-01
Alcohol consumption is a risk factor for oral cancer, possibly via its conversion to acetaldehyde, a known carcinogen. The oral commensal yeast Candida albicans may be one of the agents responsible for this conversion intra-orally. The alcohol dehydrogenase (Adh) family of enzymes are involved in acetaldehyde metabolism in yeast but, for C. albicans it is not known which family member is responsible for the conversion of ethanol to acetaldehyde. In this study we determined the expression of mRNAs from three C. albicans Adh genes (CaADH1, CaADH2 and CaCDH3) for cells grown in different culture media at different growth phases by Northern blot analysis and quantitative reverse transcription polymerase chain reaction. CaADH1 was constitutively expressed under all growth conditions but there was differential expression of CaADH2. CaADH3 expression was not detected. To investigate whether CaAdh1p or CaAdh2p can contribute to alcohol catabolism in C. albicans, each gene from the reference strain C. albicans SC5314 was expressed in Saccharomyces cerevisiae. Cell extracts from an CaAdh1p-expressing S. cerevisiae recombinant, but not an CaAdh2p-expressing recombinant, or an empty vector control strain, possessed ethanol-utilizing Adh activity above endogenous S. cerevisiae activity. Furthermore, expression of C. albicans Adh1p in a recombinant S. cerevisiae strain in which the endogenous ScADH2 gene (known to convert ethanol to acetaldehyde in this yeast) had been deleted, conferred an NAD-dependent ethanol-utilizing, and so acetaldehyde-producing, Adh activity. We conclude that CaAdh1p is the enzyme responsible for ethanol use under in vitro growth conditions, and may contribute to the intra-oral production of acetaldehyde. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
Genetic risk prediction and neurobiological understanding of alcoholism.
Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefer, F; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B
2014-05-20
We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) was used to generate a genetic risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. A panel of all the nominally significant P-value single-nucleotide length polymorphisms (SNPs) in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) were used to generate a Genetic Risk Prediction Score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol-dependent individuals from controls in an independent German test cohort. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress
Genetic research: who is at risk for alcoholism.
Foroud, Tatiana; Edenberg, Howard J; Crabbe, John C
2010-01-01
The National Institute on Alcohol Abuse and Alcoholism (NIAAA) was founded 40 years ago to help elucidate the biological underpinnings of alcohol dependence, including the potential contribution of genetic factors. Twin, adoption, and family studies conclusively demonstrated that genetic factors account for 50 to 60 percent of the variance in risk for developing alcoholism. Case-control studies and linkage analyses have helped identify DNA variants that contribute to increased risk, and the NIAAA-sponsored Collaborative Studies on Genetics of Alcoholism (COGA) has the expressed goal of identifying contributing genes using state-of-the-art genetic technologies. These efforts have ascertained several genes that may contribute to an increased risk of alcoholism, including certain variants encoding alcohol-metabolizing enzymes and neurotransmitter receptors. Genome-wide association studies allowing the analysis of millions of genetic markers located throughout the genome will enable discovery of further candidate genes. In addition to these human studies, genetic animal models of alcohol's effects and alcohol use have greatly advanced our understanding of the genetic basis of alcoholism, resulting in the identification of quantitative trait loci and allowing for targeted manipulation of candidate genes. Novel research approaches-for example, into epigenetic mechanisms of gene regulation-also are under way and undoubtedly will further clarify the genetic basis of alcoholism.
An overview of the genetic susceptibility to alcoholism.
Buscemi, Loredana; Turchi, Chiara
2011-01-01
Alcoholism is a multifactorial, genetically influenced disorder. It is a major health and social issue, a highly frequent disease and a cause of premature death. It is also the most expensive addictive disorder due to morbidity, mortality, societal and legal problems. Besides their involvement in alcohol-related fatalities, forensic scientists are also required to assess driving and working ability as well as permanent invalidity due to alcohol-related conditions. Greater knowledge of the genetic basis of alcoholism could improve prevention by identifying specific risk factors and mechanisms, leading to effective therapeutic strategies and eventually to personalized treatments. This overview of the recent scientific literature on the genetic basis of alcoholism summarizes the analytical strategies currently applied to the identification of candidate genes involved in alcohol-use disorders (AUDs) and discusses some genes and related phenotypes that have been shown to influence the risk of alcoholism. Alcoholism is a complex heterogeneous genetic disease. It is a quantitative disorder, in which the combined incidence of multiple genetic factors and environmental factors varies from one subject to another. Family, twin and adoption studies indicate that 50-60% of the risk of alcoholism is due to genetic factors. Risk loci for AUDs include both genes involved in alcohol pharmacokinetics and pharmacodynamics as well as genes moderating neurophysiological responses such as impulsivity, disinhibition, sensation-seeking and externalizing behaviours. Alcoholism also co-exists with other addictions and psychiatric disorders. Such co-morbidity suggests the existence of shared aetiological factors. Despite several genes that influence the risk for AUDs having been identified, the genetic bases of alcoholism remain largely unknown. Particularly the mechanism of action or the understanding of the physiology of some genes, as well as the gene-environment interactions, is still
2005-11-01
Frequencies of alleles and genotypes for alcohol dehydrogenase gene ADH1B (arg47his polymorphism), associated with alcohol tolerance/sensitivity, were determined. It was demonstrated that the frequency of allele ADH1B*47his, corresponding to atypical alcohol dehydrogenase variant in Russians, Ukrainians, Iranians, and mountain-dwellers of the Pamirs constituted 3, 7, 24, and 22%, respectively. The frequencies established were consistent with the allele frequency distribution pattern among the populations of Eurasia. Russians and Ukrainians were indistinguishable from other European populations relative to the frequency of allele ADH1B*47his, and consequently, relative to specific features of ethanol metabolic pathways. The data obtained provide refinement of the geographic pattern of ADH1B*47his frequency distribution in Eurasia.
Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco-Javier
2009-03-01
Preliminary data suggest that polymorphisms in cytokine genes may be involved in the genetic predisposition to alcoholic liver cirrhosis or alcohol use disorders. We thus analyze the association between these diseases and the following polymorphisms: -33T>C IL4, -174 G>C IL6, -251 T>A IL8 and 1188 A>C IL12B. 258 male alcoholics (161 without liver disease and 97 with liver cirrhosis) and 101 healthy controls were genotyped for the above mentioned polymorphisms. We examined the relationship between genotype and allele frequencies and the presence of disease, as well as the correlation with combinations of putative pro-inflammatory genotypes. Haplotypes were inferred using the expectation-maximization algorithm and haplotype frequencies were compared. We found no statistically significant association between any of these polymorphisms or the combinations of pro-inflammatory polymorphisms and the risk of alcoholic liver cirrhosis or alcohol abuse or dependence. Haplotype analysis of the IL4 and IL12B polymorphisms did not show any statistical relationship either. Our results do not support the hypothesis that the analyzed polymorphisms confer differences in alcoholic liver cirrhosis or alcohol use disorders susceptibility.
Genetic risk prediction and neurobiological understanding of alcoholism
Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B
2014-01-01
We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) was used to generate a genetic risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress-reactive animal model cross-validation. We also tested this small panel of genes in two other independent test cohorts from the United States, one with alcohol dependence (P=0.00012) and one with alcohol abuse (a less severe form of alcoholism; P=0.0094). SNCA by itself was able to separate alcoholics from controls in the alcohol-dependent cohort (P=0.000013) and the alcohol abuse
Targeting NADPH oxidases in vascular pharmacology
Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J
2012-01-01
Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondeletion” Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease. ImagesFigure 2Figure 3 PMID:2773935
Qi, Jing; Dong, Zhen; Zhang, Yu-Xing
2015-12-01
The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.
MAOA expression predicts vulnerability for alcohol use.
Cervera-Juanes, R; Wilhem, L J; Park, B; Lee, R; Locke, J; Helms, C; Gonzales, S; Wand, G; Jones, S R; Grant, K A; Ferguson, B
2016-04-01
The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12 months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naive subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared with control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios among the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse.
Kristjansson, Sean D; Agrawal, Arpana; Lessov-Schlaggar, Christina N; Madden, Pamela A F; Cooper, M Lynne; Bucholz, Kathleen K; Sher, Kenneth J; Lynskey, Michael T; Heath, Andrew C
2012-01-01
Motivational models of alcohol use propose that the motivation to consume alcohol is the final common pathway to its use. Both alcohol consumption and drinking motives are influenced by latent genetic factors that partially overlap. This study investigated whether drinking motives mediate the associations between alcohol consumption and 2 single-nucleotide polymorphisms (SNPs) from genes involved in serotonin (TPH2; rs1386496) and dopamine synthesis (DDC; rs3779084). Based on earlier work showing that enhancement and coping motives were heritable in regular smokers but not in nonregular smokers, we hypothesized these motives would mediate the relationships between alcohol consumption and these SNPs in regular smokers. Drinking motives data were available from 830 young adult female twins (n = 344 regular smokers and n = 486 never/nonregular smokers). We used confirmatory factor analyses to model enhancement, coping, and alcohol consumption factors and to conduct mediation analyses in the regular smoker and never/nonregular smoker groups. Our hypothesis was partially supported. The relationship between alcohol consumption and rs1386496 was not mediated by drinking motives in either group. However, in the regular smokers, the relationship between alcohol consumption and rs3779084 was mediated by enhancement and coping motives. Carriers of the rs3779084 minor allele who were regular smokers reported more motivation to consume alcohol. Given this pattern of results was absent in the never/nonregular smokers, our results are consistent with a gene × smoking status interaction. In regular smokers, variability at the locus marked by rs3779084 in the DDC gene appears to index biologically based individual differences in the motivation to consume alcohol to attain or improve a positive affective state or to relieve a negative one. These results could be because of increased sensitivity to the reinforcing effects of alcohol among minor allele carriers who smoke, which might
Poyau, A; Buchet, K; Godinot, C
1999-12-03
The human SURF1 gene encoding a protein involved in cytochrome c oxidase (COX) assembly, is mutated in most patients presenting Leigh syndrome associated with COX deficiency. Proteins homologous to the human Surf1 have been identified in nine eukaryotes and six prokaryotes using database alignment tools, structure prediction and/or cDNA sequencing. Their sequence comparison revealed a remarkable Surf1 conservation during evolution and put forward at least four highly conserved domains that should be essential for Surf1 function. In Paracoccus denitrificans, the Surf1 homologue is found in the quinol oxidase operon, suggesting that Surf1 is associated with a primitive quinol oxidase which belongs to the same superfamily as cytochrome oxidase.
Variation of types of alcoholism: review and subtypes identified in Han Chinese.
Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Lu, Ru-Band
2014-01-03
Alcoholism, as it has been hypothesized, is caused by a highly heterogeneous genetic load. Since 1960, many reports have used the bio-psycho-social approach to subtype alcoholism; however, no subtypes have been genetically validated. We reviewed and compared the major single-gene, multiple-gene, and gene-to-gene interaction studies on alcoholism published during the past quarter-century, including many recent studies that have made contributions to the subtyping of alcoholism. Four subtypes of alcoholism have been reported: [1] pure alcoholism, [2] anxiety/depression alcoholism, [3] antisocial alcoholism, and [4] mixed alcoholism. Most of the important studies focused on three genes: DRD2, MAOA, and ALDH2. Therefore, our review focuses on these three genes. © 2013.
Reyes-Gibby, Cielito C; Yuan, Christine; Wang, Jian; Yeung, Sai-Ching J; Shete, Sanjay
2015-06-05
Addictions to alcohol and tobacco, known risk factors for cancer, are complex heritable disorders. Addictive behaviors have a bidirectional relationship with pain. We hypothesize that the associations between alcohol, smoking, and opioid addiction observed in cancer patients have a genetic basis. Therefore, using bioinformatics tools, we explored the underlying genetic basis and identified new candidate genes and common biological pathways for smoking, alcohol, and opioid addiction. Literature search showed 56 genes associated with alcohol, smoking and opioid addiction. Using Core Analysis function in Ingenuity Pathway Analysis software, we found that ERK1/2 was strongly interconnected across all three addiction networks. Genes involved in immune signaling pathways were shown across all three networks. Connect function from IPA My Pathway toolbox showed that DRD2 is the gene common to both the list of genetic variations associated with all three addiction phenotypes and the components of the brain neuronal signaling network involved in substance addiction. The top canonical pathways associated with the 56 genes were: 1) calcium signaling, 2) GPCR signaling, 3) cAMP-mediated signaling, 4) GABA receptor signaling, and 5) G-alpha i signaling. Cancer patients are often prescribed opioids for cancer pain thus increasing their risk for opioid abuse and addiction. Our findings provide candidate genes and biological pathways underlying addiction phenotypes, which may be future targets for treatment of addiction. Further study of the variations of the candidate genes could allow physicians to make more informed decisions when treating cancer pain with opioid analgesics.
Vetreno, Ryan P; Qin, Liya; Crews, Fulton T
2013-11-01
Adolescence is characterized behaviorally by increased impulsivity and risk-taking that declines in parallel with maturation of the prefrontal cortex and executive function. In the brain, the receptor for advanced glycation end products (RAGE) is critically involved in neurodevelopment and neuropathology. In humans, the risk of alcoholism is greatly increased in those who begin drinking between 13 and 15years of age, and adolescents binge drink more than any other age group. We have previously found that alcoholism is associated with increased expression of neuroimmune genes. This manuscript tested the hypothesis that adolescent binge drinking upregulates RAGE and Toll-like receptor (TLR) 4 as well as their endogenous agonist, high-mobility group box 1 (HMGB1). Immunohistochemistry, Western blot, and mRNA analyses found that RAGE expression was increased in the human post-mortem alcoholic orbitofrontal cortex (OFC). Further, an earlier age of drinking onset correlated with increased expression of RAGE, TLR4, and HMGB1. To determine if alcohol contributed to these changes, we used an adolescent binge ethanol model in rats (5.0g/kg, i.g., 2-day on/2-day off from postnatal day [P] 25 to P55) and assessed neuroimmune gene expression. We found an age-associated decline of RAGE expression from late adolescence (P56) to young adulthood (P80). Adolescent intermittent ethanol exposure did not alter RAGE expression at P56, but increased RAGE in the young adult PFC (P80). Adolescent intermittent ethanol exposure also increased TLR4 and HMGB1 expression at P56 that persisted into young adulthood (P80). Assessment of young adult frontal cortex mRNA (RT-PCR) found increased expression of proinflammatory cytokines, oxidases, and neuroimmune agonists at P80, 25days after ethanol treatment. Together, these human and animal data support the hypothesis that an early age of drinking onset upregulates RAGE/TLR4-HMGB1 and other neuroimmune genes that persist into young adulthood and
Nishitani, Goh; Yoshida, Masaki
2018-06-01
This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.
2014-01-01
Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes
Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays
Vinu Mohan, A. M.; Windmiller, Joshua Ray; Mishra, Rupesh K.; Wang, Joseph
2017-01-01
The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan layer, along with an outer Nafion layer. The resulting microneedle-based enzyme electrode displays an interference-free ethanol detection in artificial interstitial fluid without compromising its sensitivity, stability and response time. The skin penetration ability and the efficaciousness of the biosensor performance towards subcutaneous alcohol monitoring was substantiated by the ex vivo mice skin model analysis. Our results reveal that the new microneedle sensor holds considerable promise for continuous non-invasive alcohol monitoring in real-life situations. PMID:28088750
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Khalyfa, Abdelnaby; Capdevila, Oscar Sans; Kheirandish-Gozal, Leila; Khalyfa, Ahamed A.; Kim, Jinkwan
2012-01-01
Abstract Pediatric obstructive sleep apnea (OSA) may lead to neurocognitive dysfunction, but not in everyone affected. The frequencies of NADPH oxidase (NOX) polymorphisms in the p22phox subunit were similar between children with OSA and controls, except for rs6520785 and rs4673, the latter being significantly more frequent among the OSA children without deficits than with deficits (p<0.02). Similarly, 8-hydroxydeoxyguanine urine levels and NOX activity were lower among children without cognitive deficits and particularly among those with the rs4673 polymorphism. Thus, polymorphisms within the NOX gene or its functional subunits may account for important components of the variance in cognitive function deficits associated with OSA in children. Antioxid. Redox Signal. 16, 171–177. PMID:21902598
The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea.
Giesbert, Sabine; Schürg, Timo; Scheele, Sandra; Tudzynski, Paul
2008-05-01
The role of reactive oxygen species (ROS) in interactions between phytopathogenic fungi and their hosts is well established. An oxidative burst mainly caused by superoxide formation by membrane-associated NADPH oxidases is an essential element of plant defence reactions. Apart from primary effects, ROS play a major role as a second messenger in host response. Recently, NADPH oxidase (nox)-encoding genes have been identified in filamentous fungi. Functional analyses have shown that these fungal enzymes are involved in sexual differentiation, and there is growing evidence that they also affect developmental programmes involved in fungus-plant interactions. Here we show that in the biotrophic plant pathogen Claviceps purpurea deletion of the cpnox1 gene, probably encoding an NADPH oxidase, has impact on germination of conidia and pathogenicity: Deltacpnox1 mutants can penetrate the host epidermis, but they are impaired in colonization of the plant ovarian tissue. In the few cases where macroscopic signs of infection (honeydew) appear, they are extremely delayed and fully developed sclerotia have never been observed. C. purpurea Nox1 is important for the interaction with its host, probably by directly affecting pathogenic differentiation of the fungus.
NADPH Oxidases in Vascular Pathology
Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta
2014-01-01
Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474
Ceci, Roberta; Duranti, Guglielmo; Leonetti, Alessia; Pietropaoli, Stefano; Spinozzi, Federico; Marcocci, Lucia; Amendola, Roberto; Cecconi, Francesco; Sabatini, Stefania; Mariottini, Paolo; Cervelli, Manuela
2017-02-01
Spermine oxidase oxidizes spermine to produce H 2 O 2 , spermidine, and 3-aminopropanal. It is involved in cell drug response, apoptosis, and in the etiology of several pathologies, including cancer. Spermine oxidase is an important positive regulator of muscle gene expression and fiber size and, when repressed, leads to muscle atrophy. We have generated a transgenic mouse line overexpressing Smox gene in all organs, named Total-Smox. The spermine oxidase overexpression was revealed by β-Gal staining and reverse-transcriptase/PCR analysis, in all tissues analysed. Spermine oxidase activity resulted higher in Total-Smox than controls. Considering the important role of this enzyme in muscle physiology, we have focused our study on skeletal muscle and heart of Total-Smox mice by measuring redox status and oxidative damage. We assessed the redox homeostasis through the analysis of the reduced/oxidized glutathione ratio. Chronic H 2 O 2 production induced by spermine oxidase overexpression leads to a cellular redox state imbalance in both tissues, although they show different redox adaptation. In skeletal muscle, catalase and glutathione S-transferase activities were significantly increased in Total-Smox mice compared to controls. In the heart, no differences were found in CAT activity level, while GST activity decreased compared to controls. The skeletal muscle showed a lower oxidative damage than in the heart, evaluated by lipid peroxidation and protein carbonylation. Altogether, our findings illustrate that skeletal muscle adapts more efficiently than heart to oxidative stress H 2 O 2 -induced. The Total-Smox line is a new genetic model useful to deepen our knowledge on the role of spermine oxidase in muscle atrophy and muscular pathological conditions like dystrophy. Copyright © 2016 Elsevier Inc. All rights reserved.
Molecular basis of alcoholism.
Most, Dana; Ferguson, Laura; Harris, R Adron
2014-01-01
Acute alcohol intoxication causes cellular changes in the brain that last for hours, while chronic alcohol use induces widespread neuroadaptations in the nervous system that can last a lifetime. Chronic alcohol use and the progression into dependence involve the remodeling of synapses caused by changes in gene expression produced by alcohol. The progression of alcohol use, abuse, and dependence can be divided into stages, which include intoxication, withdrawal, and craving. Each stage is associated with specific changes in gene expression, cellular function, brain circuits, and ultimately behavior. What are the molecular mechanisms underlying the transition from recreational use (acute) to dependence (chronic)? What cellular adaptations result in drug memory retention, leading to the persistence of addictive behaviors, even after prolonged drug abstinence? Research into the neurobiology of alcoholism aims to answer these questions. This chapter will describe the molecular adaptations caused by alcohol use and dependence, and will outline key neurochemical participants in alcoholism at the molecular level, which are also potential targets for therapy. © 2014 Elsevier B.V. All rights reserved.
Treutlein, Jens; Streit, Fabian; Juraeva, Dilafruz; Degenhardt, Franziska; Rietschel, Liz; Forstner, Andreas J.; Ridinger, Monika; Dukal, Helene; Foo, Jerome C.; Soyka, Michael; Maier, Wolfgang; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Müller-Myhsok, Bertram; Lucae, Susanne; Ising, Marcus; Stickel, Felix; Berg, Thomas; Roggenbuck, Ulla; Jöckel, Karl-Heinz; Scholz, Henrike; Zimmermann, Ulrich S.; Buch, Stephan; Sommer, Wolfgang H.; Spanagel, Rainer; Brors, Benedikt; Cichon, Sven; Mann, Karl; Kiefer, Falk; Hampe, Jochen; Rosendahl, Jonas; Nöthen, Markus M.; Rietschel, Marcella
2017-01-01
The present study investigated the genetic contribution to alcohol dependence (AD) using genome-wide association data from three German samples. These comprised patients with: (i) AD; (ii) chronic alcoholic pancreatitis (ACP); and (iii) alcohol-related liver cirrhosis (ALC). Single marker, gene-based, and pathway analyses were conducted. A significant association was detected for the ADH1B locus in a gene-based approach (puncorrected = 1.2 × 10−6; pcorrected = 0.020). This was driven by the AD subsample. No association with ADH1B was found in the combined ACP + ALC sample. On first inspection, this seems surprising, since ADH1B is a robustly replicated risk gene for AD and may therefore be expected to be associated also with subgroups of AD patients. The negative finding in the ACP + ALC sample, however, may reflect genetic stratification as well as random fluctuation of allele frequencies in the cases and controls, demonstrating the importance of large samples in which the phenotype is well assessed. PMID:28714907
Treutlein, Jens; Frank, Josef; Streit, Fabian; Reinbold, Céline S; Juraeva, Dilafruz; Degenhardt, Franziska; Rietschel, Liz; Witt, Stephanie H; Forstner, Andreas J; Ridinger, Monika; Strohmaier, Jana; Wodarz, Norbert; Dukal, Helene; Foo, Jerome C; Hoffmann, Per; Herms, Stefan; Heilmann-Heimbach, Stefanie; Soyka, Michael; Maier, Wolfgang; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Müller-Myhsok, Bertram; Lucae, Susanne; Ising, Marcus; Stickel, Felix; Berg, Thomas; Roggenbuck, Ulla; Jöckel, Karl-Heinz; Scholz, Henrike; Zimmermann, Ulrich S; Buch, Stephan; Sommer, Wolfgang H; Spanagel, Rainer; Brors, Benedikt; Cichon, Sven; Mann, Karl; Kiefer, Falk; Hampe, Jochen; Rosendahl, Jonas; Nöthen, Markus M; Rietschel, Marcella
2017-07-17
The present study investigated the genetic contribution to alcohol dependence (AD) using genome-wide association data from three German samples. These comprised patients with: (i) AD; (ii) chronic alcoholic pancreatitis (ACP); and (iii) alcohol-related liver cirrhosis (ALC). Single marker, gene-based, and pathway analyses were conducted. A significant association was detected for the ADH1B locus in a gene-based approach ( p uncorrected = 1.2 × 10 -6 ; p corrected = 0.020). This was driven by the AD subsample. No association with ADH1B was found in the combined ACP + ALC sample. On first inspection, this seems surprising, since ADH1B is a robustly replicated risk gene for AD and may therefore be expected to be associated also with subgroups of AD patients. The negative finding in the ACP + ALC sample, however, may reflect genetic stratification as well as random fluctuation of allele frequencies in the cases and controls, demonstrating the importance of large samples in which the phenotype is well assessed.
A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family
Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina
2017-01-01
ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of
Johansson, Ada; Westberg, Lars; Sandnabba, Kenneth; Jern, Patrick; Salo, Benny; Santtila, Pekka
2012-09-01
Oxytocin has been implicated in the regulation of social as well as aggressive behaviors, and in a recent study we found that the effect of alcohol on aggressive behavior was moderated by the individual's genotype on an oxytocin receptor gene (OXTR) polymorphism (Johansson et al., 2012). In this study we wanted to deepen and expand the analysis by exploring associations between three (rs1488467, rs4564970, rs1042778) OXTR polymorphisms and aggressive behavior, trait anger as well as anger control in a population-based sample of Finnish men and women (N=3577) aged between 18 and 49 years (M=26.45 years, SD=5.02). A specific aim was to investigate if the polymorphisms would show interactive effects with alcohol consumption on aggressive behavior and trait anger, as well as to explore whether these polymorphisms affect differences in anger control between self-reported sober and intoxicated states. The results showed no main effects of the polymorphisms, however, three interactions between the polymorphisms and alcohol consumption were found. The effect of alcohol consumption on aggressive behavior was moderated by the genotype of the individual on the rs4564970 polymorphism, in line with previous results (Johansson et al., 2012). For trait anger, both the rs1488467 and the rs4564970 polymorphisms interacted with alcohol consumption. It appears that the region of the OXTR gene including both the rs4564970 and the rs1488467 polymorphisms may be involved in the regulation of the relationship between alcohol and aggressive behavior as well as between alcohol and the propensity to react to situations with elevated levels of anger. Copyright © 2012 Elsevier Ltd. All rights reserved.
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-02-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chia-Hsiang Chen; Shih-Hsiang Chien; Hai-Gwo Hwu
1996-09-20
Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42,more » and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.« less
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto
2018-04-01
Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Heterologous Production and Characterization of Two Glyoxal Oxidases from Pycnoporus cinnabarinus
Daou, Marianne; Piumi, François; Cullen, Daniel; Record, Eric
2016-01-01
ABSTRACT The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium is physiologically coupled to lignin-oxidizing peroxidases via generation of extracellular H2O2 and utilizes an array of aldehydes and α-hydroxycarbonyls as the substrates. Two of the predicted glyoxal oxidases of P. cinnabarinus, GLOX1 (PciGLOX1) and GLOX2 (PciGLOX2), were heterologously produced in Aspergillus niger strain D15#26 (pyrG negative) and purified using immobilized metal ion affinity chromatography, yielding 59 and 5 mg of protein for PciGLOX1 and PciGLOX2, respectively. Both proteins were approximately 60 kDa in size and N-glycosylated. The optimum temperature for the activity of these enzymes was 50°C, and the optimum pH was 6. The enzymes retained most of their activity after incubation at 50°C for 4 h. The highest relative activity and the highest catalytic efficiency of both enzymes occurred with glyoxylic acid as the substrate. The two P. cinnabarinus enzymes generally exhibited similar substrate preferences, but PciGLOX2 showed a broader substrate specificity and was significantly more active on 3-phenylpropionaldehyde. IMPORTANCE This study addresses the poorly understood role of how fungal peroxidases obtain an in situ supply of hydrogen peroxide to enable them to oxidize a variety of organic and inorganic compounds. This cooperative activity is intrinsic in the living organism to control the amount of toxic H2O2 in its environment, thus providing a feed-on-demand scenario, and can be used biotechnologically to supply a cheap source of peroxide for the peroxidase reaction. The secretion of multiple glyoxal oxidases by filamentous fungi as part of a lignocellulolytic mechanism suggests a controlled system, especially as these
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.
Genetic Influences on the Development of Alcoholism
Enoch, Mary-Anne
2014-01-01
Alcoholism has a substantial heritability yet the detection of specific genetic influences has largely proved elusive. The strongest findings are with genes encoding alcohol metabolizing enzymes. A few candidate genes such as GABRA2 have shown robust associations with alcoholism. Moreover, it has become apparent that variants in stress-related genes such as CRHR1, may only confer risk in individuals exposed to trauma, particularly in early life. Over the past decade there have been tremendous advances in large scale SNP genotyping technologies allowing for genome-wide associations studies (GWAS). As a result, it is now recognized that genetic risk for alcoholism is likely to be due to common variants in very many genes, each of small effect, although rare variants with large effects might also play a role. This has resulted in a paradigm shift away from gene centric studies towards analyses of gene interactions and gene networks within biologically relevant pathways. PMID:24091936
Genetic influences on the development of alcoholism.
Enoch, Mary-Anne
2013-11-01
Alcoholism has a substantial heritability yet the detection of specific genetic influences has largely proved elusive. The strongest findings are with genes encoding alcohol metabolizing enzymes. A few candidate genes such as GABRA2 have shown robust associations with alcoholism. Moreover, it has become apparent that variants in stress-related genes such as CRHR1, may only confer risk in individuals exposed to trauma, particularly in early life. Over the past decade there have been tremendous advances in large scale SNP genotyping technologies allowing for genome-wide associations studies (GWAS). As a result, it is now recognized that genetic risk for alcoholism is likely to be due to common variants in very many genes, each of small effect, although rare variants with large effects might also play a role. This has resulted in a paradigm shift away from gene centric studies toward analyses of gene interactions and gene networks within biologically relevant pathways.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Bovre, K; Hagen, N; Berdal, B P; Jantzen, E
1977-02-01
Genito-urethral specimens from 3260 women and 1170 men, with ailments suggestive of gonorrhoea, were examined for growth of oxidase positive rodshaped bacteria, as well as of gonococci. Moraxella osloensis was identified in 26 cases (0.64 per cent of women and 0.43 per cent of men). Three patients harboured phenylalanine negative (or weakly reacting) and tryptophan deaminase negative M. phenylpyrouvica and, in three cases, a Flavobacterium species was detected. Among six oropharyngeal specimens from patients suspected of gonorrhoea, two yielded growth of oxidase positive rods, Kingella kingae and Neisseria elongata, respectively, N. gonorrhoeae was isolated from 537 patients, i.e., 12.1 per cent of all cases. The isolates of oxidase positive rods were in most cases completely identified by streptomycin resistance transformation. On this basis, the diagnostic reliability of some morphological and cultural-biochemical tests and gas chromatography was examined. Gas chromatographic analysis of fatty acid and alcohol composition of whole cells proved distinctive of species defined genetically, irrespective of confusing behaviour of some strains in other tests.
Kalia, Nitin P.; Hasenoehrl, Erik J.; Ab Rahman, Nurlilah B.; Koh, Vanessa H.; Ang, Michelle L. T.; Sajorda, Dannah R.; Hards, Kiel; Grüber, Gerhard; Alonso, Sylvie; Cook, Gregory M.; Berney, Michael; Pethe, Kevin
2017-01-01
The recent discovery of small molecules targeting the cytochrome bc1:aa3 in Mycobacterium tuberculosis triggered interest in the terminal respiratory oxidases for antituberculosis drug development. The mycobacterial cytochrome bc1:aa3 consists of a menaquinone:cytochrome c reductase (bc1) and a cytochrome aa3-type oxidase. The clinical-stage drug candidate Q203 interferes with the function of the subunit b of the menaquinone:cytochrome c reductase. Despite the affinity of Q203 for the bc1:aa3 complex, the drug is only bacteriostatic and does not kill drug-tolerant persisters. This raises the possibility that the alternate terminal bd-type oxidase (cytochrome bd oxidase) is capable of maintaining a membrane potential and menaquinol oxidation in the presence of Q203. Here, we show that the electron flow through the cytochrome bd oxidase is sufficient to maintain respiration and ATP synthesis at a level high enough to protect M. tuberculosis from Q203-induced bacterial death. Upon genetic deletion of the cytochrome bd oxidase-encoding genes cydAB, Q203 inhibited mycobacterial respiration completely, became bactericidal, killed drug-tolerant mycobacterial persisters, and rapidly cleared M. tuberculosis infection in vivo. These results indicate a synthetic lethal interaction between the two terminal respiratory oxidases that can be exploited for anti-TB drug development. Our findings should be considered in the clinical development of drugs targeting the cytochrome bc1:aa3, as well as for the development of a drug combination targeting oxidative phosphorylation in M. tuberculosis. PMID:28652330
The Epigenetic Landscape of Alcoholism
Krishnan, Harish R.; Sakharkar, Amul J.; Teppen, Tara L.; Berkel, Tiffani D.M.; Pandey, Subhash C.
2015-01-01
Alcoholism is a complex psychiatric disorder that has a multifactorial etiology. Epigenetic mechanisms are uniquely capable of accounting for the multifactorial nature of the disease in that they are highly stable and are affected by environmental factors, including alcohol itself. Chromatin remodeling causes changes in gene expression in specific brain regions contributing to the endophenotypes of alcoholism such as tolerance and dependence. The epigenetic mechanisms that regulate changes in gene expression observed in addictive behaviors respond not only to alcohol exposure, but also to comorbid psychopathology such as the presence of anxiety and stress. This review summarizes recent developments in epigenetic research that may play a role in alcoholism. We propose that pharmacologically manipulating epigenetic targets, as demonstrated in various preclinical models, holds great therapeutic potential in the treatment and prevention of alcoholism. PMID:25131543
Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays.
Mohan, A M Vinu; Windmiller, Joshua Ray; Mishra, Rupesh K; Wang, Joseph
2017-05-15
The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan layer, along with an outer Nafion layer. The resulting microneedle-based enzyme electrode displays an interference-free ethanol detection in artificial interstitial fluid without compromising its sensitivity, stability and response time. The skin penetration ability and the efficaciousness of the biosensor performance towards subcutaneous alcohol monitoring was substantiated by the ex vivo mice skin model analysis. Our results reveal that the new microneedle sensor holds considerable promise for continuous non-invasive alcohol monitoring in real-life situations. Copyright © 2017 Elsevier B.V. All rights reserved.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE
Hirsch, James G.
1953-01-01
Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805
USDA-ARS?s Scientific Manuscript database
In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...
Lu, Ru-Band; Lee, Jia-Fu; Huang, San-Yuan; Lee, Sheng-Yu; Chang, Yun-Hsuan; Kuo, Po-Hsiu; Chen, Shiou-Lan; Chen, Shih-Heng; Chu, Chun-Hsien; Lin, Wei-Wen; Wu, Pei-Lin; Ko, Huei-Chen
2012-09-01
Previous studies on acetaldehyde dehydrogenase 2 (ALDH2) focused on drinking behavior or alcoholism because the ALDH2*2 allele protects against the risk of developing alcoholism. The mechanism provides that the ALDH2 gene's protective effect is also involved in dopamine metabolism. The interaction of the ALDH2 gene with neurotransmitters, such as dopamine, is suggested to be related to alcoholism. Because alcoholism is often co-morbid with antisocial personality disorder (ASPD), previous association studies on antisocial alcoholism cannot differentiate whether those genes relate to ASPD with alcoholism or ASPD only. This study examined the influence of the interaction effect of the ALDH2*1*1, *1*2 or *2*2 polymorphisms with the dopamine 2 receptor (DRD2) Taq I polymorphism on ASPD. Our 541 Han Chinese male participants were classified into three groups: antisocial alcoholism (ASPD co-morbid with alcohol dependence, antisocial ALC; n = 133), ASPD without alcoholism (ASPD not co-morbid with alcohol dependence, antisocial non-ALC; n = 164) and community controls (healthy volunteers from the community; n = 244). Compared with healthy controls, individuals with the DRD2 A1/A1 and the ALDH2*1/*1 genotypes were at a 5.39 times greater risk for antisocial non-ALC than were those with other genotypes. Our results suggest that the DRD2/ANKK1 and ALDH2 genes interacted in the antisocial non-ALC group; a connection neglected in previous studies caused by not separating antisocial ALC from ASPD. Our study made this distinction and showed that these two genes may be associated ASPD without co-morbid alcoholism. © 2010 The Authors, Addiction Biology © 2010 Society for the Study of Addiction.
Richhardt, Janine; Luchterhand, Bettina; Büchs, Jochen
2013-01-01
The obligatory aerobic acetic acid bacterium Gluconobacter oxydans oxidizes a variety of substrates in the periplasm by membrane-bound dehydrogenases, which transfer the reducing equivalents to ubiquinone. Two quinol oxidases, cytochrome bo3 and cytochrome bd, then catalyze transfer of the electrons from ubiquinol to molecular oxygen. In this study, mutants lacking either of these terminal oxidases were characterized. Deletion of the cydAB genes for cytochrome bd had no obvious influence on growth, whereas the lack of the cyoBACD genes for cytochrome bo3 severely reduced the growth rate and the cell yield. Using a respiration activity monitoring system and adjusting different levels of oxygen availability, hints of a low-oxygen affinity of cytochrome bd oxidase were obtained, which were supported by measurements of oxygen consumption in a respirometer. The H+/O ratio of the ΔcyoBACD mutant with mannitol as the substrate was 0.56 ± 0.11 and more than 50% lower than that of the reference strain (1.26 ± 0.06) and the ΔcydAB mutant (1.31 ± 0.16), indicating that cytochrome bo3 oxidase is the main component for proton extrusion via the respiratory chain. Plasmid-based overexpression of cyoBACD led to increased growth rates and growth yields, both in the wild type and the ΔcyoBACD mutant, suggesting that cytochrome bo3 might be a rate-limiting factor of the respiratory chain. PMID:23852873
Agostinelli, Enzo; Vianello, Fabio; Magliulo, Giuseppe; Thomas, Thresia; Thomas, T J
2015-01-01
Nanotechnology for cancer gene therapy is an emerging field. Nucleic acids, polyamine analogues and cytotoxic products of polyamine oxidation, generated in situ by an enzyme-catalyzed reaction, can be developed for nanotechnology-based cancer therapeutics with reduced systemic toxicity and improved therapeutic efficacy. Nucleic acid-based gene therapy approaches depend on the compaction of DNA/RNA to nanoparticles and polyamine analogues are excellent agents for the condensation of nucleic acids to nanoparticles. Polyamines and amine oxidases are found in higher levels in tumours compared to that of normal tissues. Therefore, the metabolism of polyamines spermidine and spermine, and their diamine precursor, putrescine, can be targets for antineoplastic therapy since these naturally occurring alkylamines are essential for normal mammalian cell growth. Intracellular polyamine concentrations are maintained at a cell type-specific set point through the coordinated and highly regulated interplay between biosynthesis, transport, and catabolism. In particular, polyamine catabolism involves copper-containing amine oxidases. Several studies showed an important role of these enzymes in developmental and disease-related processes in animals through the control of polyamine homeostasis in response to normal cellular signals, drug treatment, and environmental and/or cellular stress. The production of toxic aldehydes and reactive oxygen species (ROS), H2O2 in particular, by these oxidases suggests a mechanism by which amine oxidases can be exploited as antineoplastic drug targets. The combination of bovine serum amine oxidase (BSAO) and polyamines prevents tumour growth, particularly well if the enzyme has been conjugated with a biocompatible hydrogel polymer. The findings described herein suggest that enzymatically formed cytotoxic agents activate stress signal transduction pathways, leading to apoptotic cell death. Consequently, superparamagnetic nanoparticles or other
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cruz-Fuentes, C.; Carmarena, B.; Eroza, V.
1994-09-01
The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 tomore » 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.« less
Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y
2007-06-01
In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.
Taki, Faten A; Abdel-Rahman, Abdel A; Zhang, Baohong
2014-01-01
Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2) is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR). The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs) as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder) was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO), ovariectomized rats in the absence (OVX) or presence of E2 (OVXE2). These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.
Carrigan, Matthew A.; Uryasev, Oleg; Davis, Ross P.; Zhai, LanMin; Hurley, Thomas D.; Benner, Steven A.
2012-01-01
Background Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s), where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs) and hominoids. Methodology/Principal Findings To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines). Database mining then identified novel ADH1 paralogs in both macaque (an OWM) and marmoset (a NWM). These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding) sequences and intronic sequences. Conclusions/Significance We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels). The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs) and catarrhines (OWMs and hominoids) having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra
2013-01-01
Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms. PMID:23669573
The epigenetic landscape of alcoholism.
Krishnan, Harish R; Sakharkar, Amul J; Teppen, Tara L; Berkel, Tiffani D M; Pandey, Subhash C
2014-01-01
Alcoholism is a complex psychiatric disorder that has a multifactorial etiology. Epigenetic mechanisms are uniquely capable of accounting for the multifactorial nature of the disease in that they are highly stable and are affected by environmental factors, including alcohol itself. Chromatin remodeling causes changes in gene expression in specific brain regions contributing to the endophenotypes of alcoholism such as tolerance and dependence. The epigenetic mechanisms that regulate changes in gene expression observed in addictive behaviors respond not only to alcohol exposure but also to comorbid psychopathology such as the presence of anxiety and stress. This review summarizes recent developments in epigenetic research that may play a role in alcoholism. We propose that pharmacologically manipulating epigenetic targets, as demonstrated in various preclinical models, hold great therapeutic potential in the treatment and prevention of alcoholism. © 2014 Elsevier Inc. All rights reserved.
Laqua, C; Zill, P; Koller, G; Preuss, U; Soyka, M
2015-03-01
We have analysed the MAOA-uVNTR polymorphism in the promoter region of the X-chromosomal monoamine oxidase A (MAOA) gene. The first aim was to examine the association between the MAOA genotype and the alcoholic phenotype. In the second part of the paper we have analysed the association of the MAOA genotype with impulsive and aggressive behaviour. Genotypes with 3 or 5-repeat alleles (MAOA-L-genotype) were reported to be associated with impulsive and aggressive traits. The MAOA genotype was determined in 371 male alcohol-dependent subjects and 236 male controls all of German descent. Behavioural and personality traits were evaluated using the self-report questionnaires Barratt Impulsiveness Scale (BIS), Buss Durkee Hostility Inventory (BDHI), Temperament and Character Inventory (TCI) and NEO-Five Factor Inventory (NEO-FFI). A median split in BIS, Buss Durkee Physical Assault, Buss Durkee Irritability, TCI and NEO-FFI was conducted. No association could be detected between the MAOA genotype and the alcoholic phenotype. Based on the results of the BIS questionnaire, we were able to make out an association between the MAOA-L genotype and higher levels of impulsivity (p = 0.043). Furthermore - without reaching statistical significance - we detected a very slight association between the MAOA-L genotype and higher scores in the BDHI subcategory physical aggression (p = 0.058). Taken together, these findings suggest that the MAOA-L genotype is to some extent associated with impulsive and antisocial personality traits in alcoholic men. Further studies on that question are needed. © Georg Thieme Verlag KG Stuttgart · New York.
Evaluation of Gene Modification Strategies for the Development of Low-Alcohol-Wine Yeasts
Kutyna, D. R.; Solomon, M. R.; Black, C. A.; Borneman, A.; Henschke, P. A.; Pretorius, I. S.; Chambers, P. J.
2012-01-01
Saccharomyces cerevisiae has evolved a highly efficient strategy for energy generation which maximizes ATP energy production from sugar. This adaptation enables efficient energy generation under anaerobic conditions and limits competition from other microorganisms by producing toxic metabolites, such as ethanol and CO2. Yeast fermentative and flavor capacity forms the biotechnological basis of a wide range of alcohol-containing beverages. Largely as a result of consumer demand for improved flavor, the alcohol content of some beverages like wine has increased. However, a global trend has recently emerged toward lowering the ethanol content of alcoholic beverages. One option for decreasing ethanol concentration is to use yeast strains able to divert some carbon away from ethanol production. In the case of wine, we have generated and evaluated a large number of gene modifications that were predicted, or known, to impact ethanol formation. Using the same yeast genetic background, 41 modifications were assessed. Enhancing glycerol production by increasing expression of the glyceraldehyde-3-phosphate dehydrogenase gene, GPD1, was the most efficient strategy to lower ethanol concentration. However, additional modifications were needed to avoid negatively affecting wine quality. Two strains carrying several stable, chromosomally integrated modifications showed significantly lower ethanol production in fermenting grape juice. Strain AWRI2531 was able to decrease ethanol concentrations from 15.6% (vol/vol) to 13.2% (vol/vol), whereas AWRI2532 lowered ethanol content from 15.6% (vol/vol) to 12% (vol/vol) in both Chardonnay and Cabernet Sauvignon juices. Both strains, however, produced high concentrations of acetaldehyde and acetoin, which negatively affect wine flavor. Further modifications of these strains allowed reduction of these metabolites. PMID:22729542
Neuroimmune Function and the Consequences of Alcohol Exposure
Crews, Fulton T.; Sarkar, Dipak K.; Qin, Liya; Zou, Jian; Boyadjieva, Nadka; Vetreno, Ryan P.
2015-01-01
Induction of neuroimmune genes by binge drinking increases neuronal excitability and oxidative stress, contributing to the neurobiology of alcohol dependence and causing neurodegeneration. Ethanol exposure activates signaling pathways featuring high-mobility group box 1 and Toll-like receptor 4 (TLR4), resulting in induction of the transcription factor nuclear factor kappa-light-chain-enhancer of activated B cells, which regulates expression of several cytokine genes involved in innate immunity, and its target genes. This leads to persistent neuroimmune responses to ethanol that stimulate TLRs and/or certain glutamate receptors (i.e., N-methyl-d-aspartate receptors). Alcohol also alters stress responses, causing elevation of peripheral cytokines, which further sensitize neuroimmune responses to ethanol. Neuroimmune signaling and glutamate excitotoxicity are linked to alcoholic neurodegeneration. Models of alcohol abuse have identified significant frontal cortical degeneration and loss of hippocampal neurogenesis, consistent with neuroimmune activation pathology contributing to these alcohol-induced, long-lasting changes in the brain. These alcohol-induced long-lasting increases in brain neuroimmune-gene expression also may contribute to the neurobiology of alcohol use disorder. PMID:26695754
Yakovlev, Igor A; Hietala, Ari M; Courty, Pierre-Emmanuel; Lundell, Taina; Solheim, Halvor; Fossdal, Carl Gunnar
2013-07-01
The pathogenic white-rot basidiomycete Heterobasidion irregulare is able to remove lignin and hemicellulose prior to cellulose during the colonization of root and stem xylem of conifer and broadleaf trees. We identified and followed the regulation of expression of genes belonging to families encoding ligninolytic enzymes. In comparison with typical white-rot fungi, the H. irregulare genome has exclusively the short-manganese peroxidase type encoding genes (6 short-MnPs) and thereby a slight contraction in the pool of class II heme-containing peroxidases, but an expansion of the MCO laccases with 17 gene models. Furthermore, the genome shows a versatile set of other oxidoreductase genes putatively involved in lignin oxidation and conversion, including 5 glyoxal oxidases, 19 quinone-oxidoreductases and 12 aryl-alcohol oxidases. Their genetic multiplicity and gene-specific regulation patterns on cultures based on defined lignin, cellulose or Norway spruce lignocellulose substrates suggest divergent specificities and physiological roles for these enzymes. While the short-MnP encoding genes showed similar transcript levels upon fungal growth on heartwood and reaction zone (RZ), a xylem defense tissue rich in phenolic compounds unique to trees, a subset of laccases showed higher gene expression in the RZ cultures. In contrast, other oxidoreductases depending on initial MnP activity showed generally lower transcript levels on RZ than on heartwood. These data suggest that the rate of fungal oxidative conversion of xylem lignin differs between spruce RZ and heartwood. It is conceivable that in RZ part of the oxidoreductase activities of laccases are related to the detoxification of phenolic compounds involved in host-defense. Expression of the several short-MnP enzymes indicated an important role for these enzymes in effective delignification of wood by H. irregulare. Copyright © 2013 Elsevier Inc. All rights reserved.
Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer
2013-10-01
Paik, J.H. 2011. FoxO family members in cancer. Cancer biology & therapy 12:253-259. 31. Myatt, S.S., and Lam , E.W. 2007. The emerging roles of...J.B., Chen, K., Li, Y., Lau , Y.F., and Shih, J.C. 2009. Regulation of monoamine oxidase A by the SRY gene on the Y chromosome. FASEB journal
Lo, Jonathan; Zheng, Tianyong; Hon, Shuen; Olson, Daniel G; Lynd, Lee R
2015-04-01
Thermoanaerobacterium saccharolyticum and Clostridium thermocellum are anaerobic thermophilic bacteria being investigated for their ability to produce biofuels from plant biomass. The bifunctional alcohol and aldehyde dehydrogenase gene, adhE, is present in these bacteria and has been known to be important for ethanol formation in other anaerobic alcohol producers. This study explores the inactivation of the adhE gene in C. thermocellum and T. saccharolyticum. Deletion of adhE reduced ethanol production by >95% in both T. saccharolyticum and C. thermocellum, confirming that adhE is necessary for ethanol formation in both organisms. In both adhE deletion strains, fermentation products shifted from ethanol to lactate production and resulted in lower cell density and longer time to reach maximal cell density. In T. saccharolyticum, the adhE deletion strain lost >85% of alcohol dehydrogenase (ADH) activity. Aldehyde dehydrogenase (ALDH) activity did not appear to be affected, although ALDH activity was low in cell extracts. Adding ubiquinone-0 to the ALDH assay increased activity in the T. saccharolyticum parent strain but did not increase activity in the adhE deletion strain, suggesting that ALDH activity was inhibited. In C. thermocellum, the adhE deletion strain lost >90% of ALDH and ADH activity in cell extracts. The C. thermocellum adhE deletion strain contained a point mutation in the lactate dehydrogenase gene, which appears to deregulate its activation by fructose 1,6-bisphosphate, leading to constitutive activation of lactate dehydrogenase. Thermoanaerobacterium saccharolyticum and Clostridium thermocellum are bacteria that have been investigated for their ability to produce biofuels from plant biomass. They have been engineered to produce higher yields of ethanol, yet questions remain about the enzymes responsible for ethanol formation in these bacteria. The genomes of these bacteria encode multiple predicted aldehyde and alcohol dehydrogenases which could be
Radhakrishnan, Nitin; Park, Jongwon; Kim, Chang-Soo
2012-01-01
Utilizing a simple fluidic structure, we demonstrate the improved performance of oxidase-based enzymatic biosensors. Electrolysis of water is utilized to generate bubbles to manipulate the oxygen microenvironment close to the biosensor in a fluidic channel. For the proper enzyme reactions to occur, a simple mechanical procedure of manipulating bubbles was developed to maximize the oxygen level while minimizing the pH change after electrolysis. The sensors show improved sensitivities based on the oxygen dependency of enzyme reaction. In addition, this oxygen-rich operation minimizes the ratio of electrochemical interference signal by ascorbic acid during sensor operation (i.e., amperometric detection of hydrogen peroxide). Although creatinine sensors have been used as the model system in this study, this method is applicable to many other biosensors that can use oxidase enzymes (e.g., glucose, alcohol, phenol, etc.) to implement a viable component for in-line fluidic sensor systems. PMID:23012527
Alcohol-related Genes Show an Enrichment of Associations with a Persistent Externalizing Factor
Ashenhurst, James R.; Harden, K. Paige; Corbin, William R.; Fromme, Kim
2016-01-01
Research using twins has found that much of the variability in externalizing phenotypes – including alcohol and drug use, impulsive personality traits, risky sex and property crime – is explained by genetic factors. Nevertheless, identification of specific genes and variants associated with these traits has proven to be difficult, likely because individual differences in externalizing are explained by many genes of small individual effect. Moreover, twin research indicates that heritable variance in externalizing behaviors is mostly shared across the externalizing spectrum rather than specific to any behavior. We use a longitudinal, “deep phenotyping” approach to model a general externalizing factor reflecting persistent engagement in a variety of socially problematic behaviors measured at eleven assessment occasions spanning early adulthood (ages 18 to 28). In an ancestrally homogenous sample of non-Hispanic Whites (N = 337), we then tested for enrichment of associations between the persistent externalizing factor and a set of 3,281 polymorphisms within 104 genes that were previously identified as associated with alcohol-use behaviors. Next we tested for enrichment among domain-specific factors (e.g., property crime) composed of residual variance not accounted for by the common factor. Significance was determined relative to bootstrapped empirical thresholds derived from permutations of phenotypic data. Results indicated significant enrichment of genetic associations for persistent externalizing, but not for domain-specific factors. Consistent with twin research findings, these results suggest that genetic variants are broadly associated with externalizing behaviors rather than unique to specific behaviors. General Scientific Summary This study shows that variation in 104 genes is associated with socially problematic “externalizing” behavior, including substance misuse, property crime, risky sex, and aspects of impulsive personality. Importantly, this
Alcoholism: recent advances in epidemiology, biochemistry and genetics.
Ginter, E; Simko, V
2009-01-01
Countries traditionally consuming beer and wine have high alcohol consumption as compared to East Asia, where the fact of low alcoholism prevalence can be attributed to a defect in metabolic degradation of ethanol. Dependence on alcohol is multifactorial and is related to a complex interplay of metabolic, genetic, social and environmental factors. Repetitive alcohol ingestion and its resulting dependence is associated with false euphoria triggered by an inhibition of glutamate receptors and other brain neurotransmitters, namely dopamine and serotonine. Genetic polymorphisms of genes encoding the alcohol metabolism enzymes and neurotransmitter signaling molecules in dopamine, gamma aminobutyric acid, opioid and serotonin systems, are involved in individual variations for susceptibility to alcohol dependence. Prominent progress has been achieved toward identification of genes related to alcoholism. Six genes were described on chromosomes 4, 7, 8, 11, 15 and 20, which are known to have influence on neuronal signal transfer and generation of dopamine receptors. It is suggested that such genes carry the risk for alcoholism. In the last years, the role of (GABA) receptors in the development of alcoholism is studied in detail. In future it may be possible to separate the genetic, enzymatic and environmental factors that are responsible for increased vulnerability of some individuals to alcohol abuse (Fig. 2, Tab. 1, Ref. 19). Full Text (Free, PDF) www.bmj.sk.
Colmenero, Jordi; Bataller, Ramón; Sancho-Bru, Pau; Domínguez, Marlene; Moreno, Montserrat; Forns, Xavier; Bruguera, Miquel; Arroyo, Vicente; Brenner, David A; Ginès, Pere
2009-10-01
Angiotensin II promotes liver fibrogenesis by stimulating nonphagocytic NADPH oxidase (NOX)-induced oxidative stress. Angiotensin II type 1 (AT1) receptor blockers attenuate experimental liver fibrosis, yet their effects in human liver fibrosis are unknown. We investigated the effects of losartan on hepatic expression of fibrogenic, inflammatory, and NOX genes in patients with chronic hepatitis C (CHC). Fourteen patients with CHC and liver fibrosis received oral losartan (50 mg/day) for 18 mo. Liver biopsies were performed at baseline and after treatment. The degree of inflammation and fibrosis was evaluated by histological analysis (METAVIR). Collagen content was measured by morphometric quantification of Sirius red staining. Overall collagen content and fibrosis stage remained stable in the whole series, yet the fibrosis stage decreased in seven patients. Inflammatory activity improved in seven patients. The effect of losartan on hepatic expression of 31 profibrogenic and inflammatory genes and components of the NOX complex was assessed by quantitative PCR. Losartan treatment was associated with a significant decrease in the expression of several profibrogenic and NOX genes including procollagen alpha1(I) and alpha1(IV), urokinase-type plasminogen activator, metalloproteinase type 2, NOX activator 1 (NOXA-1) and organizer 1 (NOXO-1), and Rac-1. Losartan was well tolerated in all patients and was effective in attenuating the activity of the systemic renin-angiotensin system. No effects on serum liver tests or viral load were observed. We conclude that prolonged administration of losartan, an oral AT1 receptor blocker, is associated with downregulation of NOX components and fibrogenic genes in patients with CHC. Controlled studies are warranted to assess the effect of AT1 receptor blockers in chronic liver injury.
Pietan, Lucas L.; Spradling, Theresa A.
2016-01-01
In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589
Cleveland, H Harrington; Griffin, Amanda M; Wolf, Pedro S A; Wiebe, Richard P; Schlomer, Gabriel L; Feinberg, Mark E; Greenberg, Mark T; Spoth, Richard L; Redmond, Cleve; Vandenbergh, David J
2018-01-01
This study investigated the oxytocin receptor (OXTR) gene's moderation of associations between exposure to a substance misuse intervention, average peer substance use, and adolescents' own alcohol use during the 9th-grade. OXTR genetic risk was measured using five single nucleotide polymorphisms (SNPs), and peer substance use was based on youths' nominated closest friends' own reports of alcohol, cigarette, and marijuana use, based on data from the PROSPER project. Regression models revealed several findings. First, low OXTR risk was linked to affiliating with friends who reported less substance use in the intervention condition but not the control condition. Second, affiliating with high substance-using friends predicted youth alcohol risk regardless of OXTR risk or intervention condition. Third, although high OXTR risk youth in the intervention condition who associated with low substance-using friends reported somewhat higher alcohol use than comparable youth in the control group, the absolute level of alcohol use among these youth was still among the lowest in the sample.
Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa
2014-01-01
A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284
Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa
2014-01-27
A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification.
Ray, Lara A
2011-01-01
Neurobiological theories of addiction have highlighted disruption in stress pathways as a central feature of addictive disorders, and pharmacological treatments targeting stress mechanisms hold great promise. This study examines genetic determinants of stress-induced and cue-induced craving in heavy drinkers by testing single-nucleotide polymorphisms (SNPs) of the corticotrophin-releasing hormone binding protein (CRH-BP) gene and the mu-opioid receptor (OPRM1) gene. This study combines guided imagery stress exposure and in vivo alcohol cue exposure in a sample of 64 (23 women) non-treatment-seeking heavy drinkers. Analyses, uncorrected for multiple comparisons, revealed that a tag SNP of the CRH-BP gene (rs10055255) moderated stress-induced craving in this sample. The same SNP predicted greater affective responses to the stress manipulation, including greater levels of subjective tension and negative mood. The Asp40 allele of the OPRM1 was associated with greater cue-induced alcohol craving following the neutral imagery condition. These initial results extend recent preclinical and clinical findings implicating the CRH-BP in stress-related alcoholism and confirm the role of the Asp40 allele of the OPRM1 gene in reward-driven alcohol phenotypes. Human laboratory models of stress and cue-induced craving may be useful in pharmacotherapy development targeting dysregulation of stress systems. Larger studies are needed to validate these preliminary findings, which should also be extended to clinical samples. Copyright © 2010 by the Research Society on Alcoholism.
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Sigawi, Sasi; Nitzan, Yeshayahu
2014-01-01
Aliphatic amines, including methylamine, are air-pollutants, due to their intensive use in industry and the natural degradation of proteins, amino acids, and other nitrogen-containing compounds in biological samples. It is necessary to develop systems for removal of methylamine from the air, since airborne methylamine has a negative effect on human health. The primary amine oxidase (primary amine : oxygen oxidoreductase (deaminating) or amine oxidase, AMO; EC 1.4.3.21), a copper-containing enzyme from the thermotolerant yeast Hansenula polymorpha which was overexpressed in baker's yeast Saccharomyces cerevisiae, was tested for its ability to oxidize airborne methylamine. A continuous fluidized bed bioreactor (CFBR) was designed to enable bioconversion of airborne methylamine by AMO immobilized in calcium alginate (CA) beads. The results demonstrated that the bioreactor with immobilized AMO eliminates nearly 97% of the airborne methylamine. However, the enzymatic activity of AMO causes formation of formaldehyde. A two-step bioconversion process was therefore proposed. In the first step, airborne methylamine was fed into a CFBR which contained immobilized AMO. In the second step, the gas flow was passed through another CFBR, with alcohol oxidase from the yeast H. polymorpha immobilized in CA, in order to decompose the formaldehyde formed in the first step. The proposed system provided almost total elimination of the airborne methylamine and the formaldehyde. PMID:24672387
Harrison-Findik, Duygu Dee; Lu, Sizhao
2015-05-06
This study investigates the regulation of hepcidin, the key iron-regulatory molecule, by alcohol and hydrogen peroxide (H2O2) in glutathione peroxidase-1 (gpx-1(-/-)) and catalase (catalase(-/-)) knockout mice. For alcohol studies, 10% ethanol was administered in the drinking water for 7 days. Gpx-1(-/-) displayed significantly higher hepatic H2O2 levels than catalase(-/-) compared to wild-type mice, as measured by 2'-7'-dichlorodihydrofluorescein diacetate (DCFH-DA). The basal level of liver hepcidin expression was attenuated in gpx-1(-/-) mice. Alcohol increased H2O2 production in catalase(-/-) and wild-type, but not gpx-1(-/-), mice. Hepcidin expression was inhibited in alcohol-fed catalase(-/-) and wild-type mice. In contrast, alcohol elevated hepcidin expression in gpx-1(-/-) mice. Gpx-1(-/-) mice also displayed higher level of basal liver CHOP protein expression than catalase(-/-) mice. Alcohol induced CHOP and to a lesser extent GRP78/BiP expression, but not XBP1 splicing or binding of CREBH to hepcidin gene promoter, in gpx-1(-/-) mice. The up-regulation of hepatic ATF4 mRNA levels, which was observed in gpx-1(-/-) mice, was attenuated by alcohol. In conclusion, our findings strongly suggest that H2O2 inhibits hepcidin expression in vivo. Synergistic induction of CHOP by alcohol and H2O2, in the absence of gpx-1, stimulates liver hepcidin gene expression by ER stress independent of CREBH.
Johnson, Kenneth R; Marden, Coleen C; Ward-Bailey, Patricia; Gagnon, Leona H; Bronson, Roderick T; Donahue, Leah Rae
2007-07-01
Dual oxidases generate the hydrogen peroxide needed by thyroid peroxidase for the incorporation of iodine into thyroglobulin, an essential step in thyroid hormone synthesis. Mutations in the human dual oxidase 2 gene, DUOX2, have been shown to underlie several cases of congenital hypothyroidism. We report here the first mouse Duox2 mutation, which provides a new genetic model for studying the specific function of DUOX2 in the thyroid gland and in other organ systems where it is hypothesized to play a role. We mapped the new spontaneous mouse mutation to chromosome 2 and identified it as a T>G base pair change in exon 16 of Duox2. The mutation changes a highly conserved valine to glycine at amino acid position 674 (V674G) and was named "thyroid dyshormonogenesis" (symbol thyd) to signify a defect in thyroid hormone synthesis. Thyroid glands of mutant mice are goitrous and contain few normal follicles, and anterior pituitaries are dysplastic. Serum T(4) in homozygotes is about one-tenth the level of controls and is accompanied by a more than 100-fold increase in TSH. The weight of adult mutant mice is approximately half that of littermate controls, and serum IGF-I is reduced. The cochleae of mutant mice exhibit abnormalities characteristic of hypothyroidism, including a delayed formation of the inner sulcus and tunnel of Corti and an abnormally thickened tectorial membrane. Hearing thresholds of adult mutant mice are on average 50-60 decibels (dB) above those of controls.
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-01-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by ∆nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in ∆nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and ∆nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of ∆nox2, lacking the NADPH oxidase 2 gene, ∆nor1, and transcription factor deletion mutant ∆ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi. PMID:24407906
Ray, Lara A; Miranda, Robert; Tidey, Jennifer W; McGeary, John E; MacKillop, James; Gwaltney, Chad J; Rohsenow, Damaris J; Swift, Robert M; Monti, Peter M
2010-02-01
Polymorphisms of the mu-opioid receptor (OPRM1) and dopamine D4 receptor (DRD4) genes are associated with subjective responses to alcohol and urge to drink under laboratory conditions. This study examined these associations in the natural environment using ecological momentary assessment. Participants were non-treatment-seeking heavy drinkers (n = 112, 52% female, 61% alcohol dependent) who enrolled in a study of naltrexone effects on craving and drinking in the natural environment. Data were culled from 5 consecutive days of drinking reports prior to medication randomization. Analyses revealed that, after drinking, carriers of the Asp40 allele of the OPRM1 gene reported higher overall levels of vigor and lower levels negative mood, as compared to homozygotes for the Asn40 variant. Carriers of the long allele (i.e., >or=7 tandem repeats) of the DRD4 endorsed greater urge to drink than homozygotes for the short allele. Effects of OPRM1 and DRD4 variable-number-of-tandem-repeats genotypes appear to be alcohol dose-dependent. Specifically, carriers of the DRD4-L allele reported slight decreases in urge to drink at higher levels of estimated blood alcohol concentration (eBAC), and Asp40 carriers reported decreases in vigor and increases in negative mood as eBAC rose, as compared to carriers of the major allele for each gene. Self-reported vigor and urge to drink were positively associated with alcohol consumption within the same drinking episode. This study extends findings on subjective intoxication, urge to drink, and their genetic bases from controlled laboratory to naturalistic settings.
Bazov, Igor; Sarkisyan, Daniil; Kononenko, Olga; Watanabe, Hiroyuki; Karpyak, Victor M; Yakovleva, Tatiana; Bakalkin, Georgy
2018-06-20
Molecular changes in cortical areas of addicted brain may underlie cognitive impairment and loss of control over intake of addictive substances and alcohol. Prodynorphin (PDYN) gives rise to dynorphin (DYNs) opioid peptides which target kappa-opioid receptor (KOR). DYNs mediate alcohol-induced impairment of learning and memory, while KOR antagonists block excessive, compulsive-like drug and alcohol self-administration in animal models. In human brain, the DYN/KOR system may undergo adaptive changes, which along with neuronal loss, may contribute to alcohol-associated cognitive deficit. We addressed this hypothesis by comparing the expression levels and co-expression (transcriptionally coordinated) patterns of PDYN and KOR (OPRK1) genes in dorsolateral prefrontal cortex (dlPFC) between human alcoholics and controls. Postmortem brain specimens of 53 alcoholics and 55 controls were analyzed. PDYN was found to be downregulated in dlPFC of alcoholics, while OPRK1 transcription was not altered. PDYN downregulation was confined to subgroup of subjects carrying C, a high-risk allele of PDYN promoter SNP rs1997794 associated with alcoholism. Changes in PDYN expression did not depend on the decline in neuronal proportion in alcoholics, and thereby may be attributed to transcriptional adaptations in alcoholic brain. Absolute expression levels of PDYN were lower compared to those of OPRK1, suggesting that PDYN expression is a limiting factor in the DYN/KOR signaling, and that the PDYN downregulation diminishes efficacy of DYN/KOR signaling in dlPFC of human alcoholics. The overall outcome of the DYN/KOR downregulation may be disinhibition of neurotransmission, which when overactivated could contribute to formation of alcohol-related behavior.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed thatmore » 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.« less
Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E
2014-01-01
Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.
Mitochondrial Group II Introns, Cytochrome c Oxidase, and Senescence in Podospora anserina†
Begel, Odile; Boulay, Jocelyne; Albert, Beatrice; Dufour, Eric; Sainsard-Chanet, Annie
1999-01-01
Podospora anserina is a filamentous fungus with a limited life span. It expresses a degenerative syndrome called senescence, which is always associated with the accumulation of circular molecules (senDNAs) containing specific regions of the mitochondrial chromosome. A mobile group II intron (α) has been thought to play a prominent role in this syndrome. Intron α is the first intron of the cytochrome c oxidase subunit I gene (COX1). Mitochondrial mutants that escape the senescence process are missing this intron, as well as the first exon of the COX1 gene. We describe here the first mutant of P. anserina that has the α sequence precisely deleted and whose cytochrome c oxidase activity is identical to that of wild-type cells. The integration site of the intron is slightly modified, and this change prevents efficient homing of intron α. We show here that this mutant displays a senescence syndrome similar to that of the wild type and that its life span is increased about twofold. The introduction of a related group II intron into the mitochondrial genome of the mutant does not restore the wild-type life span. These data clearly demonstrate that intron α is not the specific senescence factor but rather an accelerator or amplifier of the senescence process. They emphasize the role that intron α plays in the instability of the mitochondrial chromosome and the link between this instability and longevity. Our results strongly support the idea that in Podospora, “immortality” can be acquired not by the absence of intron α but rather by the lack of active cytochrome c oxidase. PMID:10330149
Radi, Abeer; Lange, Theo; Niki, Tomoya; Koshioka, Masaji; Lange, Maria João Pimenta
2006-01-01
Immature pumpkin (Cucurbita maxima) seeds contain gibberellin (GA) oxidases with unique catalytic properties resulting in GAs of unknown function for plant growth and development. Overexpression of pumpkin GA 7-oxidase (CmGA7ox) in Arabidopsis (Arabidopsis thaliana) resulted in seedlings with elongated roots, taller plants that flower earlier with only a little increase in bioactive GA4 levels compared to control plants. In the same way, overexpression of the pumpkin GA 3-oxidase1 (CmGA3ox1) resulted in a GA overdose phenotype with increased levels of endogenous GA4. This indicates that, in Arabidopsis, 7-oxidation and 3-oxidation are rate-limiting steps in GA plant hormone biosynthesis that control plant development. With an opposite effect, overexpression of pumpkin seed-specific GA 20-oxidase1 (CmGA20ox1) in Arabidopsis resulted in dwarfed plants that flower late with reduced levels of GA4 and increased levels of physiological inactive GA17 and GA25 and unexpected GA34 levels. Severe dwarfed plants were obtained by overexpression of the pumpkin GA 2-oxidase1 (CmGA2ox1) in Arabidopsis. This dramatic change in phenotype was accompanied by a considerable decrease in the levels of bioactive GA4 and an increase in the corresponding inactivation product GA34 in comparison to control plants. In this study, we demonstrate the potential of four pumpkin GA oxidase-encoding genes to modulate the GA plant hormone pool and alter plant stature and development. PMID:16384902
NASA Technical Reports Server (NTRS)
Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)
1995-01-01
In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Yokoyama, A; Muramatsu, T; Omori, T; Yokoyama, T; Matsushita, S; Higuchi, S; Maruyama, K; Ishii, H
2001-03-01
Alcohol dehydrogenase-2 (ADH2) and aldehyde dehydrogenase-2 (ALDH2) gene polymorphisms play roles in ethanol metabolism, drinking behavior and esophageal carcinogenesis in Japanese; however, the combined influence of ADH2 and ALDH2 genotypes on other aerodigestive tract cancers have not been investigated. ADH2/ALDH2 genotyping was performed on lymphocyte DNA samples from Japanese alcoholic men (526 cancer-free; 159 with solitary or multiple aerodigestive tract cancers, including 33 oropharyngolaryngeal, 112 esophageal, 38 stomach and 22 multiple primary cancers in two or three organs). After adjustment for age, drinking and smoking habits, and ADH2/ALDH2 genotypes, the presence of either ADH2*1/2*1 or ALDH2*1/2*2 significantly increased the risk for oropharyngolaryngeal cancer [odds ratios (ORs), 6.68 with ADH2*1/2*1 and 18.52 with ALDH2*1/2*2] and esophageal cancer (ORs, 2.64 and 13.50, respectively). For patients with both ADH2*1/2*1 and ALDH2*1/2*2, the risks for oropharyngolaryngeal and esophageal cancers were enhanced in a multiplicative fashion (OR = 121.77 and 40.40, respectively). A positive association with ALDH2*1/2*2 alone was observed for stomach cancer patients who also had oropharyngolaryngeal and/or esophageal cancer (OR = 110.58), but it was not observed for those with stomach cancer alone. Furthermore, in the presence of ALDH2*1/2*2, the risks for multiple intra-esophageal cancers (OR = 3.43) and for esophageal cancer with oropharyngolaryngeal and/or stomach cancer (OR = 3.95) were higher than the risks for solitary intra-esophageal cancer and for esophageal cancer alone, but these tendencies were not observed for ADH2*1/2*1 genotype. Alcoholics' population attributable risks due to ADH2/ALDH2 polymorphisms were estimated to be 82.0% for oropharyngolaryngeal cancer and 63.9% for esophageal cancer.
Preconception Alcohol Increases Offspring Vulnerability to Stress
Jabbar, Shaima; Chastain, Lucy G; Gangisetty, Omkaram; Cabrera, Miguel A; Sochacki, Kamil; Sarkar, Dipak K
2016-01-01
The effect of preconception drinking by the mother on the life-long health outcomes of her children is not known, and therefore, in this study using an animal model, we determined the impact of preconception alcohol drinking of the mother on offspring stress response during adulthood. In our preconception alcohol exposure model, adult female rats were fed with 6.7% alcohol in their diet for 4 weeks, went without alcohol for 3 weeks and were bred to generate male and female offspring. Preconception alcohol-exposed offsprings' birth weight, body growth, stress response, anxiety-like behaviors, and changes in stress regulatory gene and protein hormone levels were evaluated. In addition, roles of epigenetic mechanisms in preconception alcohol effects were determined. Alcohol feeding three weeks prior to conception significantly affected pregnancy outcomes of female rats, with respect to delivery period and birth weight of offspring, without affecting maternal care behaviors. Preconception alcohol negatively affected offspring adult health, producing an increased stress hormone response to an immune challenge. In addition, preconception alcohol was associated with changes in expression and methylation profiles of stress regulatory genes in various brain areas. These changes in stress regulatory genes were normalized following treatment with a DNA methylation blocker during the postnatal period. These data highlight the novel possibility that preconception alcohol affects the inheritance of stress-related diseases possibly by epigenetic mechanisms. PMID:27296153
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Harrison-Findik, Duygu Dee; Lu, Sizhao
2015-01-01
This study investigates the regulation of hepcidin, the key iron-regulatory molecule, by alcohol and hydrogen peroxide (H2O2) in glutathione peroxidase-1 (gpx-1−/−) and catalase (catalase−/−) knockout mice. For alcohol studies, 10% ethanol was administered in the drinking water for 7 days. Gpx-1−/− displayed significantly higher hepatic H2O2 levels than catalase−/− compared to wild-type mice, as measured by 2'-7'-dichlorodihydrofluorescein diacetate (DCFH-DA). The basal level of liver hepcidin expression was attenuated in gpx-1−/− mice. Alcohol increased H2O2 production in catalase−/− and wild-type, but not gpx-1−/−, mice. Hepcidin expression was inhibited in alcohol-fed catalase−/− and wild-type mice. In contrast, alcohol elevated hepcidin expression in gpx-1−/− mice. Gpx-1−/− mice also displayed higher level of basal liver CHOP protein expression than catalase−/− mice. Alcohol induced CHOP and to a lesser extent GRP78/BiP expression, but not XBP1 splicing or binding of CREBH to hepcidin gene promoter, in gpx-1−/− mice. The up-regulation of hepatic ATF4 mRNA levels, which was observed in gpx-1−/− mice, was attenuated by alcohol. In conclusion, our findings strongly suggest that H2O2 inhibits hepcidin expression in vivo. Synergistic induction of CHOP by alcohol and H2O2, in the absence of gpx-1, stimulates liver hepcidin gene expression by ER stress independent of CREBH. PMID:25955433
Whole-genome association studies of alcoholism with loci linked to schizophrenia susceptibility.
Namkung, Junghyun; Kim, Youngchul; Park, Taesung
2005-12-30
Alcoholism is a complex disease. There have been many reports on significant comorbidity between alcoholism and schizophrenia. For the genetic study of complex diseases, association analysis has been recommended because of its higher power than that of the linkage analysis for detecting genes with modest effects on disease. To identify alcoholism susceptibility loci, we performed genome-wide single-nucleotide polymorphisms (SNP) association tests, which yielded 489 significant SNPs at the 1% significance level. The association tests showed that tsc0593964 (P-value 0.000013) on chromosome 7 was most significantly associated with alcoholism. From 489 SNPs, 74 genes were identified. Among these genes, GABRA1 is a member of the same gene family with GABRA2 that was recently reported as alcoholism susceptibility gene. By comparing 74 genes to the published results of various linkage studies of schizophrenia, we identified 13 alcoholism associated genes that were located in the regions reported to be linked to schizophrenia. These 13 identified genes can be important candidate genes to study the genetic mechanism of co-occurrence of both diseases.
2012-01-01
Background With the increasing stress from oil price and environmental pollution, aroused attention has been paid to the microbial production of chemicals from renewable sources. The C12/14 and C16/18 alcohols are important feedstocks for the production of surfactants and detergents, which are widely used in the most respected consumer detergents, cleaning products and personal care products worldwide. Though bioproduction of fatty alcohols has been carried out in engineered E. coli, several key problems have not been solved in earlier studies, such as the quite low production of C16/18 alcohol, the lack of optimization of the fatty alcohol biosynthesis pathway, and the uncharacterized performance of the engineered strains in scaled-up system. Results We improved the fatty alcohol production by systematically optimizing the fatty alcohol biosynthesis pathway, mainly targeting three key steps from fatty acyl-acyl carrier proteins (ACPs) to fatty alcohols, which are sequentially catalyzed by thioesterase, acyl-coenzyme A (CoA) synthase and fatty acyl-CoA reductase. By coexpression of thioesterase gene BTE, acyl-CoA synthase gene fadD and fatty acyl-CoA reductase gene acr1, 210.1 mg/L C12/14 alcohol was obtained. A further optimization of expression level of BTE, fadD and acr1 increased the C12/14 alcohol production to 449.2 mg/L, accounting for 75.0% of the total fatty alcohol production (598.6 mg/L). In addition, by coexpression of thioesterase gene ‘tesA, acyl-CoA synthase gene fadD and fatty acyl-CoA reductase gene FAR, 101.5 mg/L C16/18 alcohol was obtained, with C16/18 alcohol accounting for 89.2% of the total fatty alcohol production. Conclusions To our knowledge, this is the first report on selective production of C12/14 and C16/18 alcohols by microbial fermentation. This work achieved high-specificity production of both C12/14 and C16/18 alcohols. The encouraging 598.6 mg/L of fatty alcohols represents the highest titer reported so far. In
Glaser, Yi G.; Zubieta, Jon-Kar; Hsu, David T.; Villafuerte, Sandra; Mickey, Brian J.; Trucco, Elisa M.; Burmeister, Margit; Zucker, Robert A.
2014-01-01
Variations in the corticotropin-releasing hormone receptor 1 (CRHR1) gene have been found to interact with stress in modulating excessive alcohol consumption. However, the neural mechanisms through which CRHR1 influences this risk in humans is largely unknown. This study examined the influence of an intronic CRHR1 gene variant, rs110402, on brain responses to negative emotional words, negative emotional traits, and alcohol use in adolescents and young adults at high risk for alcoholism. Childhood stress was investigated as a potential moderator. Using functional magnetic resonance imaging, we found that a region in the right ventrolateral prefrontal cortex (rVLPFC) was more engaged during negative emotional word processing in G homozygotes than in A allele carriers (p(FWE corrected) < 0.01, N = 77). Moreover, an indirect effect of genotype on negative emotionality via rVLPFC activation (p < 0.05, N = 69) was observed, which was further moderated by childhood stress (p < 0.05, N = 63). Specifically, with low childhood stress, G homozygotes exhibited lower levels of negative emotionality associated with greater rVLPFC activation, suggesting that the rVLPFC is involved in reappraisal that neutralizes negative emotional responses. In addition, we found that genotype indirectly modulated excessive alcohol consumption (p < 0.05, N = 69). Specifically, G homozygotes showed greater rVLPFC activation and had lower levels of negative emotionality, which were associated with fewer binge-drinking days and fewer alcohol related problems. This work provides support for a model in which CRHR1 gene variation modulates the risk of problem drinking via an internalizing/negative affect pathway involving rVLPFC and reappraisal of negative emotion. PMID:24623788
Glaser, Yi G; Zubieta, Jon-Kar; Hsu, David T; Villafuerte, Sandra; Mickey, Brian J; Trucco, Elisa M; Burmeister, Margit; Zucker, Robert A; Heitzeg, Mary M
2014-03-12
Variations in the corticotropin-releasing hormone receptor 1 (CRHR1) gene have been found to interact with stress in modulating excessive alcohol consumption. However, the neural mechanisms through which CRHR1 influences this risk in humans is largely unknown. This study examined the influence of an intronic CRHR1 gene variant, rs110402, on brain responses to negative emotional words, negative emotional traits, and alcohol use in adolescents and young adults at high risk for alcoholism. Childhood stress was investigated as a potential moderator. Using functional magnetic resonance imaging, we found that a region in the right ventrolateral prefrontal cortex (rVLPFC) was more engaged during negative emotional word processing in G homozygotes than in A allele carriers (p(FWE corrected) < 0.01, N = 77). Moreover, an indirect effect of genotype on negative emotionality via rVLPFC activation (p < 0.05, N = 69) was observed, which was further moderated by childhood stress (p < 0.05, N = 63). Specifically, with low childhood stress, G homozygotes exhibited lower levels of negative emotionality associated with greater rVLPFC activation, suggesting that the rVLPFC is involved in reappraisal that neutralizes negative emotional responses. In addition, we found that genotype indirectly modulated excessive alcohol consumption (p < 0.05, N = 69). Specifically, G homozygotes showed greater rVLPFC activation and had lower levels of negative emotionality, which were associated with fewer binge-drinking days and fewer alcohol related problems. This work provides support for a model in which CRHR1 gene variation modulates the risk of problem drinking via an internalizing/negative affect pathway involving rVLPFC and reappraisal of negative emotion.
Genome-wide association study of alcohol dependence
Treutlein, Jens; Cichon, Sven; Ridinger, Monika; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Moessner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Fehr, Christoph; Scherbaum, Norbert; Steffens, Michael; Ludwig, Kerstin U.; Frank, Josef; Wichmann, H.- Erich; Schreiber, Stefan; Dragano, Nico; Sommer, Wolfgang; Leonardi-Essmann, Fernando; Lourdusamy, Anbarasu; Gebicke-Haerter, Peter; Wienker, Thomas F.; Sullivan, Patrick F.; Nöthen, Markus M.; Kiefer, Falk; Spanagel, Rainer; Mann, Karl; Rietschel, Marcella
2014-01-01
Context Identification of genes contributing to alcohol dependence will improve our understanding of the mechanisms underlying this disorder. Objective To identify susceptibility genes for alcohol dependence through a genome-wide association study (GWAS) and follow-up study in a population of German male inpatients with an early age at onset. Design The GWAS included 487 male inpatients with DSM-IV alcohol dependence with an age at onset below 28 years and 1,358 population based control individuals. The follow-up study included 1,024 male inpatients and 996 age-matched male controls. All subjects were of German descent. The GWAS tested 524,396 single nucleotide polymorphisms (SNPs). All SNPs with p<10-4 were subjected to the follow-up study. In addition, nominally significant SNPs from those genes that had also shown expression changes in rat brains after chronic alcohol consumption were selected for the follow-up step. Results The GWAS produced 121 SNPs with nominal p<10-4. These, together with 19 additional SNPs from homologs of rat genes showing differential expression, were genotyped in the follow-up sample. Fifteen SNPs showed significant association with the same allele as in the GWAS. In the combined analysis, two closely linked intergenic SNPs met genome-wide significance (rs7590720 p=9.72×10-9; rs1344694 p=1.69×10-8). They are located on chromosome 2q35, a region which has been implicated in linkage studies for alcohol phenotypes. Nine SNPs were located in genes, including CDH13 and ADH1C genes which have been reported to be associated with alcohol dependence. Conclusion This is the first GWAS and follow-up study to identify a genome-wide significant association in alcohol dependence. Further independent studies are required to confirm these findings. PMID:19581569
Meijles, Daniel N.; Fan, Lampson M.; Howlin, Brendan J.; Li, Jian-Mei
2014-01-01
Phagocyte superoxide production by a multicomponent NADPH oxidase is important in host defense against microbial invasion. However inappropriate NADPH oxidase activation causes inflammation. Endothelial cells express NADPH oxidase and endothelial oxidative stress due to prolonged NADPH oxidase activation predisposes many diseases. Discovering the mechanism of NADPH oxidase activation is essential for developing novel treatment of these diseases. The p47phox is a key regulatory subunit of NADPH oxidase; however, due to the lack of full protein structural information, the mechanistic insight of p47phox phosphorylation in NADPH oxidase activation remains incomplete. Based on crystal structures of three functional domains, we generated a computational structural model of the full p47phox protein. Using a combination of in silico phosphorylation, molecular dynamics simulation and protein/protein docking, we discovered that the C-terminal tail of p47phox is critical for stabilizing its autoinhibited structure. Ser-379 phosphorylation disrupts H-bonds that link the C-terminal tail to the autoinhibitory region (AIR) and the tandem Src homology 3 (SH3) domains, allowing the AIR to undergo phosphorylation to expose the SH3 pocket for p22phox binding. These findings were confirmed by site-directed mutagenesis and gene transfection of p47phox−/− coronary microvascular cells. Compared with wild-type p47phox cDNA transfected cells, the single mutation of S379A completely blocked p47phox membrane translocation, binding to p22phox and endothelial O2⨪ production in response to acute stimulation of PKC. p47phox C-terminal tail plays a key role in stabilizing intramolecular interactions at rest. Ser-379 phosphorylation is a molecular switch which initiates p47phox conformational changes and NADPH oxidase-dependent superoxide production by cells. PMID:24970888
Miao, Xiao; Lv, Huayi; Wang, Bo; Chen, Qiang; Miao, Lining; Su, Guanfang; Tan, Yi
2013-01-01
To investigate how chronic alcohol consumption affects adult visual nervous system and whether renin-angiotensin system (RAS) is involved in this pathogenic process. Male transgenic mice with angiotensin II (Ang II) type 1 (AT1) receptor gene knockout (AT1-KO) and age-matched wild-type (WT) mice were pair-fed a modified Lieber-DeCarli alcohol or isocaloric maltose dextrin control liquid diet for 2 months. At the end of the study, retinas were harvested and subjected to histopathological and immunohistochemical examination. We found that chronic alcohol consumption significantly increased retinal ganglion cell (RGC) apoptosis in the retina of WT mice, but not AT1-KO mice, detected by terminal deoxynucleotidyl-transferase-mediated dUTP-nick-end labeling staining and caspase 3 activation, along with an up-regulation of AT1 expression in RGC. At the same time, the phosphorylation of P53 in RGCs was significantly increased for both WT and AT1-KO mice exposed to alcohol, which could be significantly, although partially, prevented by AT1 gene deletion. We further examined the expression of vascular endothelial growth factor (VEGF) and CD31, and found that alcohol treatment significantly decreased the expression of VEGF and CD31 in RGCs of WT mice, but not AT1-KO mice. Taken together, our study demonstrates that the induction of RGC apoptosis by chronic alcohol exposure may be related to p53-activation and VEGF depression, all which are partially dependent of AT1 receptor activation.
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
NASA Astrophysics Data System (ADS)
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Yeast ERV2p is the first microsomal FAD-linked sulfhydryl oxidase of the Erv1p/Alrp protein family.
Gerber, J; Mühlenhoff, U; Hofhaus, G; Lill, R; Lisowsky, T
2001-06-29
Saccharomyces cerevisiae Erv2p was identified previously as a distant homologue of Erv1p, an essential mitochondrial protein exhibiting sulfhydryl oxidase activity. Expression of the ERV2 (essential for respiration and vegetative growth 2) gene from a high-copy plasmid cannot substitute for the lack of ERV1, suggesting that the two proteins perform nonredundant functions. Here, we show that the deletion of the ERV2 gene or the depletion of Erv2p by regulated gene expression is not associated with any detectable growth defects. Erv2p is located in the microsomal fraction, distinguishing it from the mitochondrial Erv1p. Despite their distinct subcellular localization, the two proteins exhibit functional similarities. Both form dimers in vivo and in vitro, contain a conserved YPCXXC motif in their carboxyl-terminal part, bind flavin adenine dinucleotide (FAD) as a cofactor, and catalyze the formation of disulfide bonds in protein substrates. The catalytic activity, the ability to form dimers, and the binding of FAD are associated with the carboxyl-terminal domain of the protein. Our findings identify Erv2p as the first microsomal member of the Erv1p/Alrp protein family of FAD-linked sulfhydryl oxidases. We propose that Erv2p functions in the generation of microsomal disulfide bonds acting in parallel with Ero1p, the essential, FAD-dependent oxidase of protein disulfide isomerase.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Marjonen, Heidi; Sierra, Alejandra; Nyman, Anna; Rogojin, Vladimir; Gröhn, Olli; Linden, Anni-Maija; Hautaniemi, Sampsa; Kaminen-Ahola, Nina
2015-01-01
The adverse effects of alcohol consumption during pregnancy are known, but the molecular events that lead to the phenotypic characteristics are unclear. To unravel the molecular mechanisms, we have used a mouse model of gestational ethanol exposure, which is based on maternal ad libitum ingestion of 10% (v/v) ethanol for the first 8 days of gestation (GD 0.5-8.5). Early neurulation takes place by the end of this period, which is equivalent to the developmental stage early in the fourth week post-fertilization in human. During this exposure period, dynamic epigenetic reprogramming takes place and the embryo is vulnerable to the effects of environmental factors. Thus, we hypothesize that early ethanol exposure disrupts the epigenetic reprogramming of the embryo, which leads to alterations in gene regulation and life-long changes in brain structure and function. Genome-wide analysis of gene expression in the mouse hippocampus revealed altered expression of 23 genes and three miRNAs in ethanol-exposed, adolescent offspring at postnatal day (P) 28. We confirmed this result by using two other tissues, where three candidate genes are known to express actively. Interestingly, we found a similar trend of upregulated gene expression in bone marrow and main olfactory epithelium. In addition, we observed altered DNA methylation in the CpG islands upstream of the candidate genes in the hippocampus. Our MRI study revealed asymmetry of brain structures in ethanol-exposed adult offspring (P60): we detected ethanol-induced enlargement of the left hippocampus and decreased volume of the left olfactory bulb. Our study indicates that ethanol exposure in early gestation can cause changes in DNA methylation, gene expression, and brain structure of offspring. Furthermore, the results support our hypothesis of early epigenetic origin of alcohol-induced disorders: changes in gene regulation may have already taken place in embryonic stem cells and therefore can be seen in different tissue
Du, Yanlei; Wan, Yu-Jui Yvonne
2009-12-01
Alcoholism is a polygenic disorder resulting from reward deficiency; polymorphisms in reward genes including serotonin transporter (5-HTT)-linked polymorphic region (5-HTTLPR), A118G in opioid receptor mu1 (OPRM1), and -141C Insertion/Deletion (Ins/Del) in dopamine receptor D2 (DRD2) as well as environmental factors (education and marital status) might affect the risk of alcoholism. Objective of the current study was to examine the main and interacting effect of these 3 polymorphisms and 2 environmental factors in contribution to alcoholism in Mexican Americans. Genotyping of 5-HTTLPR, OPRM1 A118G, and DRD2-141C Ins/Del was performed in 365 alcoholics and 338 nonalcoholic controls of Mexican Americans who were gender- and age-matched. Alcoholics were stratified according to tertiles of MAXDRINKS, which denotes the largest number of drinks consumed in one 24-hour period. Data analysis was done in the entire data set and in each alcoholic stratum. Multinomial logistic regression was conducted to explore the main effect of 3 polymorphisms and 2 environmental factors (education and marital status); classification tree, generalized multifactor dimensionality reduction (GMDR) analysis, and polymorphism interaction analysis version 2.0 (PIA 2) program were used to study factor interaction. Main effect of education, OPRM1, and DRD2 was detected in alcoholic stratum of moderate and/or largest MAXDRINKS with education < or =12 years, OPRM1 118 A/A, and DRD2 -141C Ins/Ins being risk factors. Classification tree analysis, GMDR analysis, and PIA 2 program all supported education*OPRM1 interaction in alcoholics of largest MAXDRINKS with education < or =12 years coupled with OPRM1 A/A being a high risk factor; dendrogram showed synergistic interaction between these 2 factors; dosage-effect response was also observed for education*OPRM1 interaction. No definite effect of marital status and 5-HTTLPR in pathogenesis of alcoholism was observed. Our results suggest main effect of
Hammel, K E; Mozuch, M D; Jensen, K A; Kersten, P J
1994-11-15
Oxidative C alpha-C beta cleavage of the arylglycerol beta-aryl ether lignin model 1-(3,4-dimethoxy-phenyl)-2-phenoxypropane-1,3-diol (I) by Phanerochaete chrysosporium lignin peroxidase in the presence of limiting H2O2 was enhanced 4-5-fold by glyoxal oxidase from the same fungus. Further investigation showed that each C alpha-C beta cleavage reaction released 0.8-0.9 equiv of glycolaldehyde, a glyoxal oxidase substrate. The identification of glycolaldehyde was based on 13C NMR spectrometry of reaction product obtained from beta-, gamma-, and beta,gamma-13C-substituted I, and quantitation was based on an enzymatic NADH-linked assay. The oxidation of glycolaldehyde by glyoxal oxidase yielded 0.9 oxalate and 2.8 H2O2 per reaction, as shown by quantitation of oxalate as 2,3-dihydroxyquinoxaline after derivatization with 1,2-diaminobenzene and by quantitation of H2O2 in coupled spectrophotometric assays with veratryl alcohol and lignin peroxidase. These results suggest that the C alpha-C beta cleavage of I by lignin peroxidase in the presence of glyoxal oxidase should regenerate as many as 3 H2O2. Calculations based on the observed enhancement of LiP-catalyzed C alpha-C beta cleavage by glyoxal oxidase showed that approximately 2 H2O2 were actually regenerated per cleavage of I when both enzymes were present. The cleavage of arylglycerol beta-aryl ether structures by ligninolytic enzymes thus recycles H2O2 to support subsequent cleavage reactions.
A new amperometric enzyme electrode for alcohol determination.
Gülce, H; Gülce, A; Kavanoz, M; Coşkun, H; Yildiz, A
2002-06-01
A new enzyme electrode for the determination of alcohols was developed by immobilizing alcohol oxidase in polvinylferrocenium matrix coated on a Pt electrode surface. The amperometric response due to the electrooxidation of enzymatically generated H(2)O(2) was measured at a constant potential of +0.70 V versus SCE. The effects of substrate, buffer and enzyme concentrations, pH and temperature on the response of the electrode were investigated. The optimum pH was found to be pH 8.0 at 30 degrees C. The steady-state current of this enzyme electrode was reproducible within +/-5.0% of the relative error. The sensitivity of the enzyme electrode decreased in the following order: methanol>ethanol>n-butanol>benzyl alcohol. The linear response was observed up to 3.7 mM for methanol, 3.0 mM for ethanol, 6.2 mM for n-butanol, and 5.2 mM for benzyl alcohol. The apparent Michaelis-Menten constant (K(Mapp)) value and the activation energy, E(a), of this immobilized enzyme system were found to be 5.78 mM and 38.07 kJ/mol for methanol, respectively.
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Hao, Yanwei; Huang, Binbin; Jia, Dongyu; Mann, Taylor; Jiang, Xinyi; Qiu, Yuxing; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu; Liu, Taibo
2018-05-15
Polyamines (PAs) are implicated in developmental processes and stress responses of plants. Polyamine oxidases (PAOs), flavin adenine dinucleotide-dependent enzymes that function in PA catabolism, play a critical role. Even though PAO gene families of Arabidopsis and rice have been intensely characterized and their expression in response to developmental and environmental changes has been investigated, little is known about PAOs in tomato (Solanum lycopersicum). We found seven PAO genes in S. lycopersicum and named them SlPAO1∼7. Plant PAOs form four clades in phylogenetic analysis, of which SlPAO1 belongs to clade-I, SlPAO6 and SlPAO7 to clade-III, and the residual four (SlPAO2∼5) to clade-IV, while none belongs to clade-II. All the clade-IV members in tomato also retain the putative peroxisomal-targeting signals in their carboxy termini, suggesting their peroxisome localization. SlPAO1 to SlPAO5 genes consist of 10 exons and 9 introns, while SlPAO6 and SlPAO7 are intronless genes. To address the individual roles of SlPAOs, we analyzed their expression in various tissues and during flowering and fruit development. The expression of SlPAO2∼4 was constitutively high, while that of the other SlPAO members was relatively lower. We further analyzed the expressional changes of SlPAOs upon abiotic stresses, oxidative stresses, phytohormone application, and PA application. Based on the data obtained, we discuss the distinctive roles of SlPAOs. Copyright © 2018 Elsevier GmbH. All rights reserved.
Overview of the Genetics of Alcohol Use Disorder
Tawa, Elisabeth A.; Hall, Samuel D.; Lohoff, Falk W.
2016-01-01
Aims Alcohol Use Disorder (AUD) is a chronic psychiatric illness characterized by harmful drinking patterns leading to negative emotional, physical, and social ramifications. While the underlying pathophysiology of AUD is poorly understood, there is substantial evidence for a genetic component; however, identification of universal genetic risk variants for AUD has been difficult. Recent efforts in the search for AUD susceptibility genes will be reviewed in this article. Methods In this review, we provide an overview of genetic studies on AUD, including twin studies, linkage studies, candidate gene studies, and genome-wide association studies (GWAS). Results Several potential genetic susceptibility factors for AUD have been identified, but the genes of alcohol metabolism, alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH), have been found to be protective against the development of AUD. GWAS have also identified a heterogeneous list of SNPs associated with AUD and alcohol-related phenotypes, emphasizing the complexity and heterogeneity of the disorder. In addition, many of these findings have small effect sizes when compared to alcohol metabolism genes, and biological relevance is often unknown. Conclusions Although studies spanning multiple approaches have suggested a genetic basis for AUD, identification of the genetic risk variants has been challenging. Some promising results are emerging from GWAS studies; however, larger sample sizes are needed to improve GWAS results and resolution. As the field of genetics is rapidly developing, whole genome sequencing could soon become the new standard of interrogation of the genes and neurobiological pathways which contribute to the complex phenotype of AUD. Short summary This review examines the genetic underpinnings of Alcohol Use Disorder (AUD), with an emphasis on GWAS approaches for identifying genetic risk variants. The most promising results associated with AUD and alcohol-related phenotypes have included
X chromosome inactivation in women with alcoholism.
Manzardo, Ann M; Henkhaus, Rebecca; Hidaka, Brandon; Penick, Elizabeth C; Poje, Albert B; Butler, Merlin G
2012-08-01
All female mammals with 2 X chromosomes balance gene expression with males having only 1 X by inactivating one of their X chromosomes (X chromosome inactivation [XCI]). Analysis of XCI in females offers the opportunity to investigate both X-linked genetic factors and early embryonic development that may contribute to alcoholism. Increases in the prevalence of skewing of XCI in women with alcoholism could implicate biological risk factors. The pattern of XCI was examined in DNA isolated in blood from 44 adult women meeting DSM-IV criteria for an alcohol use disorder and 45 control women with no known history of alcohol abuse or dependence. XCI status was determined by analyzing digested and undigested polymerase chain reaction (PCR) products of the polymorphic androgen receptor (AR) gene located on the X chromosome. Subjects were categorized into 3 groups based upon the degree of XCI skewness: random (50:50 to 64:36%), moderately skewed (65:35 to 80:20%), and highly skewed (>80:20%). XCI status from informative women with alcoholism was found to be random in 59% (n = 26), moderately skewed in 27% (n = 12), or highly skewed in 14% (n = 6). Control subjects showed 60, 29, and 11%, respectively. The distribution of skewed XCI observed among women with alcoholism did not differ statistically from that of control subjects (χ(2) test = 0.14, 2 df, p = 0.93). Our data did not support an increase in XCI skewness among women with alcoholism or implicate early developmental events associated with embryonic cell loss or unequal (nonrandom) expression of X-linked gene(s) or defects in alcoholism among women. Copyright © 2012 by the Research Society on Alcoholism.
Salameh, Habeeb; Raff, Evan; Erwin, Angelika; Seth, Devanshi; Nischalke, Hans Dieter; Falleti, Edmondo; Burza, Maria Antonella; Leathert, Julian; Romeo, Stefano; Molinaro, Antonio; Corradini, Stefano Ginanni; Toniutto, Pierluigi; Spengler, Ulrich; Ulrich, Spengler; Daly, Ann; Day, Christopher P; Kuo, Yong-Fang; Singal, Ashwani K
2015-06-01
The genetic polymorphism with an isoleucine-to-methionine substitution at position 148 (rs738409 C>G) in the patatin-like phospholipase domain protein 3 (PNPLA3) gene confers risk of steatosis. PNPLA3 polymorphism is shown to be associated with alcoholic liver disease (ALD). We performed a systematic review and meta-analysis to examine association of this genetic polymorphism with ALD spectrum and its severity. Medline, Embase, and Cochrane Library were searched for studies on association of PNPLA3 polymorphism and ALD spectrum: alcoholic fatty liver (AFL), alcoholic liver injury (ALI), alcoholic cirrhosis (AC), and hepatocellular carcinoma (HCC). Pooled data are reported as odds ratio (OR) with 95% confidence interval. Heterogeneity was assessed using the I(2) statistics and publication bias using Egger's test and Begg and Mazumdar's test. Individual participant data obtained from five studies were used for subgroup analyses. Among 10 studies included in this pooled analysis, compared with controls, OR for rs738409 CG and GG among ALI patients was 1.45 (1.24-1.69) and 2.22 (1.50-3.28), respectively, compared with CC. Respective OR among AC patients was 2.09 (1.79-2.44) and 3.37 (2.49-4.58) and among AC patients with HCC was 2.87 (1.61-5.10) and 12.41 (6.99-22.03). Data for AFL were inconsistent. Among ALD patients, OR of CG and GG genotypes was 2.62 (1.73-3.97) and 8.45 (2.52-28.37), respectively, for AC compared with fatty liver (FL) patients. Similar OR for AC compared with ALI was 1.98 (1.24-3.17) and 3.86 (1.18-12.60). The OR for CG and GG genotypes among AC patients for HCC occurrence was 1.43 (0.76-2.72) and 2.81 (1.57-5.01), respectively. Individual participant data analysis showed age to predispose to AC among ALI patients. PNPLA3 genetic polymorphism (rs738409 C>G) is associated with increased risk for the entire spectrum of ALD among drinkers including ALI, AC, and HCC. Studies are needed to clarify association of PNPLA3 polymorphism and steatosis in
He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry
2011-01-01
Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Xu, Zhaofa; Luo, Jintao; Li, Yu; Ma, Long
2014-01-01
Iodine is an essential trace element for life. Iodide deficiency can lead to defective biosynthesis of thyroid hormones and is a major cause of hypothyroidism and mental retardation. Excess iodide intake, however, has been linked to different thyroidal diseases. How excess iodide causes harmful effects is not well understood. Here, we found that the nematode Caenorhabditis elegans exhibits developmental arrest and other pleiotropic defects when exposed to excess iodide. To identify the responsible genes, we performed a forward genetic screen and isolated 12 mutants that can survive in excess iodide. These mutants define at least four genes, two of which we identified as bli-3 and tsp-15. bli-3 encodes the C. elegans ortholog of the mammalian dual oxidase DUOX1 and tsp-15 encodes the tetraspanin protein TSP-15, which was previously shown to interact with BLI-3. The C. elegans dual oxidase maturation factor DOXA-1 is also required for the arresting effect of excess iodide. Finally, we detected a dramatically increased biogenesis of reactive oxygen species in animals treated with excess iodide, and this effect can be partially suppressed by bli-3 and tsp-15 mutations. We propose that the BLI-3/TSP-15/DOXA-1 dual oxidase complex is required for the toxic pleiotropic effects of excess iodide. PMID:25480962
Zahs, Anita; Curtis, Brenda J.; Waldschmidt, Thomas J.; Brown, Lou Ann S.; Gauthier, Theresa W.; Choudhry, Mashkoor A.; Kovacs, Elizabeth J.; Bird, Melanie D.
2013-01-01
On November 18, 2011, the 16th annual Alcohol and Immunology Research Interest Group (AIRIG) meeting was held at Loyola University Medical Center in Maywood, Illinois. The focus of this year’s meeting was alcohol’s effect on epigenetic changes and possible outcomes induced by these changes. Two sessions, which consisted of talks from invited speakers as well as presentations of selected abstracts, were held in addition to a poster session. Participants presented information on alcohol-induced alterations in histone modifications and gene expression along with immunologic responses to alcohol. Speakers shared new research specifically on histone deacetylase enzyme expression and modifications due to alcohol and the downstream effect of these modifications may have on gene expression and tissue damage. Additional studies suggested that alcohol exacerbates inflammation when combined with other insults such as infection, trauma, inhalation injury, and disease. PMID:22738858
USDA-ARS?s Scientific Manuscript database
Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...
Using expression genetics to study the neurobiology of ethanol and alcoholism.
Farris, Sean P; Wolen, Aaron R; Miles, Michael F
2010-01-01
Recent simultaneous progress in human and animal model genetics and the advent of microarray whole genome expression profiling have produced prodigious data sets on genetic loci, potential candidate genes, and differential gene expression related to alcoholism and ethanol behaviors. Validated target genes or gene networks functioning in alcoholism are still of meager proportions. Genetical genomics, which combines genetic analysis of both traditional phenotypes and whole genome expression data, offers a potential methodology for characterizing brain gene networks functioning in alcoholism. This chapter will describe concepts, approaches, and recent findings in the field of genetical genomics as it applies to alcohol research. Copyright 2010 Elsevier Inc. All rights reserved.
Erv1p from Saccharomyces cerevisiae is a FAD-linked sulfhydryl oxidase.
Lee, J; Hofhaus, G; Lisowsky, T
2000-07-14
The yeast ERV1 gene encodes a small polypeptide of 189 amino acids that is essential for mitochondrial function and for the viability of the cell. In this study we report the enzymatic activity of this protein as a flavin-linked sulfhydryl oxidase catalyzing the formation of disulfide bridges. Deletion of the amino-terminal part of Erv1p shows that the enzyme activity is located in the 15 kDa carboxy-terminal domain of the protein. This fragment of Erv1p still binds FAD and catalyzes the formation of disulfide bonds but is no longer able to form dimers like the complete protein. The carboxy-terminal fragment contains a conserved CXXC motif that is present in all homologous proteins from yeast to human. Thus Erv1p represents the first FAD-linked sulfhydryl oxidase from yeast and the first of these enzymes that is involved in mitochondrial biogenesis.
NASA Astrophysics Data System (ADS)
Idris, Sarada; A. Bakar, Ahmad Ashrif; Thevy Ratnam, Chantara; Kamaruddin, Nur Hasiba; Shaari, Sahbudin
2017-04-01
This paper describes the immobilization of glucose oxidase, GOx onto polymer matrix comprising of poly(pyrrole), PPy and poly(vinyl alcohol), PVA using gamma irradiation technique. Py/PVA-GOx film was prepared by spreading PVA:GOx, 1:1 solution onto dried pyrrole film and exposed to gamma irradiation from cobalt 60 source at doses ranging from 0 to 60 kGy. The films were subjected to structural and morphological analyses by using Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), Scanning electron microscope (SEM), Field emission scanning electron microscope (FESEM) and Atomic-force microscopy (AFM) techniques. Similar studies were also made on pristine pyrrole film which served as control. The SEM and FTIR spectra of Py/PVA-GOx film revealed that pyrrole has been successfully polymerized through irradiation-induced reactions. The results on the morphological properties of the samples characterize using FESEM, SEM and AFM further confirmed the occurrence of radiation-induced modification of Py/PVA-GOx film. The FTIR spectra showed the existence of intermolecular interaction between polymer matrix and GOx indicating that GOx had been successfully immobilized onto Ppy/PVA matrix by radiation-induced reactions. Results revealed that radiation induced reactions such as polymerization of pyrrole, crosslinking of PVA, grafting between the adjacent PVA and pyrrole molecules as well as immobilization of GOx onto Ppy/PVA matrix occurred simultaneously upon gamma irradiation. The optimum dose for GOx immobilization in the polymer matrix found to be 40 kGy. Therefore it is clear that this irradiation technique offered a simple single process to produce Py/PVA-GOx film without additional crosslinking and polymerization agents.
NASA Astrophysics Data System (ADS)
Hamid, Nur Athirah Abd; Ismail, Ismanizan
2013-11-01
Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.
Wei, Yahong; Fu, Jing; Wu, Jianying; Jia, Xinmiao; Zhou, Yunheng; Li, Cuidan; Dong, Mengxing; Wang, Shanshan; Zhang, Ju; Chen, Fei
2018-01-01
Polyvinyl alcohol (PVA) is used widely in industry, and associated environmental pollution is a serious problem. Herein, we report a novel, efficient PVA degrader, Stenotrophomonas rhizophila QL-P4, isolated from fallen leaves from a virgin forest in the Qinling Mountains. The complete genome was obtained using single-molecule real-time (SMRT) technology and corrected using Illumina sequencing. Bioinformatics analysis revealed eight PVA/vinyl alcohol oligomer (OVA)-degrading genes. Of these, seven genes were predicted to be involved in the classic intracellular PVA/OVA degradation pathway, and one (BAY15_3292) was identified as a novel PVA oxidase. Five PVA/OVA-degrading enzymes were purified and characterized. One of these, BAY15_1712, a PVA dehydrogenase (PVADH), displayed high catalytic efficiency toward PVA and OVA substrate. All reported PVADHs only have PVA-degrading ability. Most importantly, we discovered a novel PVA oxidase (BAY15_3292) that exhibited higher PVA-degrading efficiency than the reported PVADHs. Further investigation indicated that BAY15_3292 plays a crucial role in PVA degradation in S. rhizophila QL-P4. Knocking out BAY15_3292 resulted in a significant decline in PVA-degrading activity in S. rhizophila QL-P4. Interestingly, we found that BAY15_3292 possesses exocrine activity, which distinguishes it from classic PVADHs. Transparent circle experiments further proved that BAY15_3292 greatly affects extracellular PVA degradation in S. rhizophila QL-P4. The exocrine characteristics of BAY15_3292 facilitate its potential application to PVA bioremediation. In addition, we report three new efficient secondary alcohol dehydrogenases (SADHs) with OVA-degrading ability in S. rhizophila QL-P4; in contrast, only one OVA-degrading SADH was reported previously. IMPORTANCE With the widespread application of PVA in industry, PVA-related environmental pollution is an increasingly serious issue. Because PVA is difficult to degrade, it accumulates in aquatic
Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting
2016-01-01
The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Folate, Alcohol, and Liver Disease
Medici, Valentina; Halsted, Charles H.
2013-01-01
Alcoholic liver disease (ALD) is typically associated with folate deficiency, which is the result of reduced dietary folate intake, intestinal malabsorption, reduced liver uptake and storage, and increased urinary folate excretion. Folate deficiency favors the progression of liver disease through mechanisms that include its effects on methionine metabolism with consequences for DNA synthesis and stability and the epigenetic regulation of gene expression involved in pathways of liver injury. This paper reviews the pathogenesis of alcoholic liver disease with particular focus on ethanol-induced alterations in methionine metabolism which may act in synergy with folate deficiency to decrease antioxidant defense as well as DNA stability while regulating epigenetic mechanisms of relevant gene expressions. We also review the current evidence available on potential treatments of alcoholic liver disease based on correcting abnormalities in methionine metabolism and the methylation regulation of relevant gene expressions. PMID:23136133
Approach to the genetics of alcoholism: a review based on pathophysiology.
Köhnke, Michael D
2008-01-01
Alcohol dependence is a common disorder with a heterogenous etiology. The results of family, twin and adoption studies on alcoholism are reviewed. These studies have revealed a heritability of alcoholism of over 50%. After evaluating the results, it was epidemiologically stated that alcoholism is heterogenous complex disorder with a multiple genetic background. Modern molecular genetic techniques allow examining specific genes involved in the pathophysiology of complex diseases such as alcoholism. Strategies for gene identification are introduced to the reader, including family-based and association studies. The susceptibility genes that are in the focus of this article have been chosen because they are known to encode for underlying mechanisms that are linked to the pathophysiology of alcoholism or that are important for the pharmacotherapeutic approaches in the treatment of alcohol dependence. Postulated candidate genes of the metabolism of alcohol and of the involved neurotransmitter systems are introduced. Genetic studies on alcoholism examining the metabolism of alcohol and the dopaminergic, GABAergic, glutamatergic, opioid, cholinergic and serotonergic neurotransmitter systems as well as the neuropeptide Y are presented. The results are critically discussed followed by a discussion of possible consequences.
Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants
Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.
1980-01-01
Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438
Lermontova, Inna; Grimm, Bernhard
2000-01-01
The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
Wojnar, Marcin; Brower, Kirk J; Strobbe, Stephen; Ilgen, Mark; Matsumoto, Halina; Nowosad, Izabela; Sliwerska, Elzbieta; Burmeister, Margit
2009-04-01
The purpose of this study was to examine relationships between genetic markers of central serotonin (5-HT) and dopamine function, and risk for post-treatment relapse, in a sample of alcohol-dependent patients. The study included 154 patients from addiction treatment programs in Poland, who met DSM-IV criteria for alcohol dependence. After assessing demographics, severity of alcohol use, suicidality, impulsivity, depression, hopelessness, and severity of alcohol use at baseline, patients were followed for approximately 1 year to evaluate treatment outcomes. Genetic polymorphisms in several genes (TPH2, SLC6A4, HTR1A, HTR2A, COMT, and BDNF) were tested as predictors of relapse (defined as any drinking during follow-up) while controlling for baseline measures. Of 154 eligible patients, 123 (80%) completed follow-up and 48% (n = 59) of these individuals relapsed. Patients with the Val allele in the Val66Met BDNF polymorphism and the Met allele in the Val158Met COMT polymorphism were more likely to relapse. Only the BDNF Val/Val genotype predicted post-treatment relapse [odds ratio (OR) = 2.62; p = 0.019], and time to relapse (OR = 2.57; p = 0.002), after adjusting for baseline measures and other significant genetic markers. When the analysis was restricted to patients with a family history of alcohol dependence (n = 73), the associations between the BDNF Val/Val genotype and relapse (OR = 5.76, p = 0.0045) and time to relapse (hazard ratio = 4.93, p = 0.001) were even stronger. The Val66Met BDNF gene polymorphism was associated with a higher risk and earlier occurrence of relapse among patients treated for alcohol dependence. The study suggests a relationship between genetic markers and treatment outcomes in alcohol dependence. Because a large number of statistical tests were conducted for this study and the literature on genetics and relapse is so novel, the results should be considered as hypothesis generating and need to be replicated in independent studies.
Wojnar, Marcin; Brower, Kirk J.; Strobbe, Stephen; Ilgen, Mark; Matsumoto, Halina; Nowosad, Izabela; Sliwerska, Elzbieta; Burmeister, Margit
2009-01-01
Background The purpose of this study was to examine relationships between genetic markers of central serotonin and dopamine function, and risk for post-treatment relapse, in a sample of alcohol-dependent patients. Methods The study included 154 patients from addiction treatment programs in Poland, who met DSM-IV criteria for alcohol dependence. After assessing demographics, severity of alcohol use, suicidality, impulsivity, depression, hopelessness, and severity of alcohol use at baseline, patients were followed for approximately one year to evaluate treatment outcomes. Genetic polymorphisms in several genes (TPH2, SLC6A4, HTR1A, HTR2A, COMT, BDNF) were tested as predictors of relapse (defined as any drinking during follow-up) while controlling for baseline measures. Results Of 154 eligible patients, 123 (80%) completed follow-up and 48% (n = 59) of these individuals relapsed. Patients with the Val allele in the Val66Met BDNF polymorphism and the Met allele in the Val158Met COMT polymorphism were more likely to relapse. Only the BDNF Val/Val genotype predicted post-treatment relapse (OR = 2.62; p = 0.019), and time to relapse (OR = 2.57; p = 0.002), after adjusting for baseline measures and other significant genetic markers. When the analysis was restricted to patients with a family history of alcohol dependence (n = 73), the associations between the BDNF Val/Val genotype and relapse (OR = 5.76, p = 0.0045) and time to relapse (HR = 4.93, p = 0.001) were even stronger. Conclusions The Val66Met BDNF gene polymorphism was associated with a higher risk and earlier occurrence of relapse among patients treated for alcohol dependence. The study suggests a relationship between genetic markers and treatment outcomes in alcohol dependence. Because a large number of statistical tests were conducted for this study and the literature on genetics and relapse is so novel, the results should be considered as hypothesis generating and need to be replicated in independent studies
Li, Jianmin; Zhu, Huaqing; Shen, E; Wan, Li; Arnold, J. Malcolm O.; Peng, Tianqing
2010-01-01
OBJECTIVE Our recent study demonstrated that Rac1 and NADPH oxidase activation contributes to cardiomyocyte apoptosis in short-term diabetes. This study was undertaken to investigate if disruption of Rac1 and inhibition of NADPH oxidase would prevent myocardial remodeling in chronic diabetes. RESEARCH DESIGN AND METHODS Diabetes was induced by injection of streptozotocin in mice with cardiomyocyte-specific Rac1 knockout and their wild-type littermates. In a separate experiment, wild-type diabetic mice were treated with vehicle or apocynin in drinking water. Myocardial hypertrophy, fibrosis, endoplasmic reticulum (ER) stress, inflammatory response, and myocardial function were investigated after 2 months of diabetes. Isolated adult rat cardiomyocytes were cultured and stimulated with high glucose. RESULTS In diabetic hearts, NADPH oxidase activation, its subunits' expression, and reactive oxygen species production were inhibited by Rac1 knockout or apocynin treatment. Myocardial collagen deposition and cardiomyocyte cross-sectional areas were significantly increased in diabetic mice, which were accompanied by elevated expression of pro-fibrotic genes and hypertrophic genes. Deficiency of Rac1 or apocynin administration reduced myocardial fibrosis and hypertrophy, resulting in improved myocardial function. These effects were associated with a normalization of ER stress markers' expression and inflammatory response in diabetic hearts. In cultured cardiomyocytes, high glucose–induced ER stress was inhibited by blocking Rac1 or NADPH oxidase. CONCLUSIONS Rac1 via NADPH oxidase activation induces myocardial remodeling and dysfunction in diabetic mice. The role of Rac1 signaling may be associated with ER stress and inflammation. Thus, targeting inhibition of Rac1 and NADPH oxidase may be a therapeutic approach for diabetic cardiomyopathy. PMID:20522592
Suchankova, Petra; Nilsson, Staffan; von der Pahlen, Bettina; Santtila, Pekka; Sandnabba, Kenneth; Johansson, Ada; Jern, Patrick; Engel, Jörgen A; Jerlhag, Elisabet
2016-03-01
The multifaceted gut-brain peptide ghrelin and its receptor (GHSR-1a) are implicated in mechanisms regulating not only the energy balance but also the reward circuitry. In our pre-clinical models, we have shown that ghrelin increases whereas GHSR-1a antagonists decrease alcohol consumption and the motivation to consume alcohol in rodents. Moreover, ghrelin signaling is required for the rewarding properties of addictive drugs including alcohol and nicotine in rodents. Given the hereditary component underlying addictive behaviors and disorders, we sought to investigate whether single nucleotide polymorphisms (SNPs) located in the pre-proghrelin gene (GHRL) and GHSR-1a gene (GHSR) are associated with alcohol use, measured by the alcohol use disorders identification test (AUDIT) and smoking. Two SNPs located in GHRL, rs4684677 (Gln90Leu) and rs696217 (Leu72Met), and one in GHSR, rs2948694, were genotyped in a subset (n = 4161) of a Finnish population-based cohort, the Genetics of Sexuality and Aggression project. The effect of these SNPs on AUDIT scores and smoking was investigated using linear and logistic regressions, respectively. We found that the minor allele of the rs2948694 SNP was nominally associated with higher AUDIT scores (P = 0.0204, recessive model) and smoking (P = 0.0002, dominant model). Furthermore, post hoc analyses showed that this risk allele was also associated with increased likelihood of having high level of alcohol problems as determined by AUDIT scores ≥ 16 (P = 0.0043, recessive model). These convergent findings lend further support for the hypothesized involvement of ghrelin signaling in addictive disorders. © 2015 Society for the Study of Addiction.
Nilsson, Staffan; von der Pahlen, Bettina; Santtila, Pekka; Sandnabba, Kenneth; Johansson, Ada; Jern, Patrick; Engel, Jörgen A.; Jerlhag, Elisabet
2015-01-01
Abstract The multifaceted gut‐brain peptide ghrelin and its receptor (GHSR‐1a) are implicated in mechanisms regulating not only the energy balance but also the reward circuitry. In our pre‐clinical models, we have shown that ghrelin increases whereas GHSR‐1a antagonists decrease alcohol consumption and the motivation to consume alcohol in rodents. Moreover, ghrelin signaling is required for the rewarding properties of addictive drugs including alcohol and nicotine in rodents. Given the hereditary component underlying addictive behaviors and disorders, we sought to investigate whether single nucleotide polymorphisms (SNPs) located in the pre‐proghrelin gene (GHRL) and GHSR‐1a gene (GHSR) are associated with alcohol use, measured by the alcohol use disorders identification test (AUDIT) and smoking. Two SNPs located in GHRL, rs4684677 (Gln90Leu) and rs696217 (Leu72Met), and one in GHSR, rs2948694, were genotyped in a subset (n = 4161) of a Finnish population‐based cohort, the Genetics of Sexuality and Aggression project. The effect of these SNPs on AUDIT scores and smoking was investigated using linear and logistic regressions, respectively. We found that the minor allele of the rs2948694 SNP was nominally associated with higher AUDIT scores (P = 0.0204, recessive model) and smoking (P = 0.0002, dominant model). Furthermore, post hoc analyses showed that this risk allele was also associated with increased likelihood of having high level of alcohol problems as determined by AUDIT scores ≥ 16 (P = 0.0043, recessive model). These convergent findings lend further support for the hypothesized involvement of ghrelin signaling in addictive disorders. PMID:26059200
Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael
2017-01-01
In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.
Cervelli, Manuela; Bellavia, Gabriella; D'Amelio, Marcello; Cavallucci, Virve; Moreno, Sandra; Berger, Joachim; Nardacci, Roberta; Marcoli, Manuela; Maura, Guido; Piacentini, Mauro; Amendola, Roberto; Cecconi, Francesco; Mariottini, Paolo
2013-01-01
Spermine oxidase is a FAD-containing enzyme involved in polyamines catabolism, selectively oxidizing spermine to produce H2O2, spermidine, and 3-aminopropanal. Spermine oxidase is highly expressed in the mouse brain and plays a key role in regulating the levels of spermine, which is involved in protein synthesis, cell division and cell growth. Spermine is normally released by neurons at synaptic sites where it exerts a neuromodulatory function, by specifically interacting with different types of ion channels, and with ionotropic glutamate receptors. In order to get an insight into the neurobiological roles of spermine oxidase and spermine, we have deregulated spermine oxidase gene expression producing and characterizing the transgenic mouse model JoSMOrec, conditionally overexpressing the enzyme in the neocortex. We have investigated the effects of spermine oxidase overexpression in the mouse neocortex by transcript accumulation, immunohistochemical analysis, enzymatic assays and polyamine content in young and aged animals. Transgenic JoSMOrec mice showed in the neocortex a higher H2O2 production in respect to Wild-Type controls, indicating an increase of oxidative stress due to SMO overexpression. Moreover, the response of transgenic mice to excitotoxic brain injury, induced by kainic acid injection, was evaluated by analysing the behavioural phenotype, the immunodistribution of neural cell populations, and the ultrastructural features of neocortical neurons. Spermine oxidase overexpression and the consequently altered polyamine levels in the neocortex affects the cytoarchitecture in the adult and aging brain, as well as after neurotoxic insult. It resulted that the transgenic JoSMOrec mouse line is more sensitive to KA than Wild-Type mice, indicating an important role of spermine oxidase during excitotoxicity. These results provide novel evidences of the complex and critical functions carried out by spermine oxidase and spermine in the mammalian brain. PMID
Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.
Okamura, H; Murooka, Y; Harada, T
1976-01-01
Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974
Chantreau, Maxime; Portelette, Antoine; Dauwe, Rebecca; Kiyoto, Shingo; Crônier, David; Morreel, Kris; Arribat, Sandrine; Neutelings, Godfrey; Chabi, Malika; Boerjan, Wout; Yoshinaga, Arata; Mesnard, François; Grec, Sebastien; Chabbert, Brigitte; Hawkins, Simon
2014-01-01
Histochemical screening of a flax ethyl methanesulfonate population led to the identification of 93 independent M2 mutant families showing ectopic lignification in the secondary cell wall of stem bast fibers. We named this core collection the Linum usitatissimum (flax) lbf mutants for lignified bast fibers and believe that this population represents a novel biological resource for investigating how bast fiber plants regulate lignin biosynthesis. As a proof of concept, we characterized the lbf1 mutant and showed that the lignin content increased by 350% in outer stem tissues containing bast fibers but was unchanged in inner stem tissues containing xylem. Chemical and NMR analyses indicated that bast fiber ectopic lignin was highly condensed and rich in G-units. Liquid chromatography-mass spectrometry profiling showed large modifications in the oligolignol pool of lbf1 inner- and outer-stem tissues that could be related to ectopic lignification. Immunological and chemical analyses revealed that lbf1 mutants also showed changes to other cell wall polymers. Whole-genome transcriptomics suggested that ectopic lignification of flax bast fibers could be caused by increased transcript accumulation of (1) the cinnamoyl-CoA reductase, cinnamyl alcohol dehydrogenase, and caffeic acid O-methyltransferase monolignol biosynthesis genes, (2) several lignin-associated peroxidase genes, and (3) genes coding for respiratory burst oxidase homolog NADPH-oxidases necessary to increase H2O2 supply. PMID:25381351
Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells
Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.
2017-01-01
Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230
X Chromosome Inactivation in Women with Alcoholism
Manzardo, Ann M.; Henkhaus, Rebecca; Hidaka, Brandon; Penick, Elizabeth C.; Poje, Albert B.; Butler, Merlin G.
2012-01-01
Background All female mammals with two X chromosomes balance gene expression with males having only one X by inactivating one of their Xs (X chromosome inactivation, XCI). Analysis of XCI in females offers the opportunity to investigate both X-linked genetic factors and early embryonic development that may contribute to alcoholism. Increases in the prevalence of skewing of XCI in women with alcoholism could implicate biological risk factors. Methods The pattern of XCI was examined in DNA isolated in blood from 44 adult females meeting DSM IV criteria for an Alcohol Use Disorder, and 45 control females with no known history of alcohol abuse or dependence. XCI status was determined by analyzing digested and undigested polymerase chain reaction (PCR) products of the polymorphic androgen receptor (AR) gene located on the X chromosome. Subjects were categorized into 3 groups based upon the degree of XCI skewness: random (50:50–64:36), moderately skewed (65:35–80:20) and highly skewed (>80:20). Results XCI status from informative females with alcoholism was found to be random in 59% (n=26), moderately skewed in 27% (n=12) or highly skewed in 14% (n=6). Control subjects showed 60%, 29% and 11%, respectively. The distribution of skewed XCI observed among women with alcoholism did not differ statistically from that of control subjects (χ2 =0.14, 2 df, p=0.93). Conclusions Our data did not support an increase in XCI skewness among women with alcoholism or implicate early developmental events associated with embryonic cell loss or unequal (non-random) expression of X-linked gene(s) or defects in alcoholism among females. PMID:22375556
Zhang, J; Zhang, C; Qi, Y; Dai, L; Ma, H; Guo, X; Xiao, D
2014-11-27
Acetate ester, which are produced by fermenting yeast cells in an enzyme-catalyzed intracellular reaction, are responsible for the fruity character of fermented alcoholic beverages such as Chinese yellow rice wine. Alcohol acetyltransferase (AATase) is currently believed to be the key enzyme responsible for the production of acetate ester. In order to determine the precise role of the ATF2 gene in acetate ester production, an ATF2 gene encoding a type of AATase was overexpressed and the ability of the mutant to form acetate esters (including ethyl acetate, isoamyl acetate, and isobutyl acetate) was investigated. The results showed that after 5 days of fermentation, the concentrations of ethyl acetate, isoamyl acetate, and isobutyl acetate in yellow rice wines fermented with EY2 (pUC-PIA2K) increased to 137.79 mg/L (an approximate 4.9-fold increase relative to the parent cell RY1), 26.68 mg/L, and 7.60 mg/L, respectively. This study confirms that the ATF2 gene plays an important role in the production of acetate ester production during Chinese yellow rice wine fermentation, thereby offering prospects for the development of yellow rice wine yeast starter strains with optimized ester-producing capabilities.
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Helliwell, Chris A.; Chandler, Peter M.; Poole, Andrew; Dennis, Elizabeth S.; Peacock, W. James
2001-01-01
We have shown that ent-kaurenoic acid oxidase, a member of the CYP88A subfamily of cytochrome P450 enzymes, catalyzes the three steps of the gibberellin biosynthetic pathway from ent-kaurenoic acid to GA12. A gibberellin-responsive barley mutant, grd5, accumulates ent-kaurenoic acid in developing grains. Three independent grd5 mutants contain mutations in a gene encoding a member of the CYP88A subfamily of cytochrome P450 enzymes, defined by the maize Dwarf3 protein. Mutation of the Dwarf3 gene gives rise to a gibberellin-responsive dwarf phenotype, but the lesion in the gibberellin biosynthesis pathway has not been identified. Arabidopsis thaliana has two CYP88A genes, both of which are expressed. Yeast strains expressing cDNAs encoding each of the two Arabidopsis and the barley CYP88A enzymes catalyze the three steps of the GA biosynthesis pathway from ent-kaurenoic acid to GA12. Sequence comparison suggests that the maize Dwarf3 locus also encodes ent-kaurenoic acid oxidase. PMID:11172076
USDA-ARS?s Scientific Manuscript database
Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Vokurková, M; Rauchová, H; Řezáčová, L; Vaněčková, I; Zicha, J
2015-01-01
Hypothalamic paraventricular nucleus (PVN) and rostral ventrolateral medulla (RVLM) play an important role in brain control of blood pressure (BP). One of the important mechanisms involved in the pathogenesis of hypertension is the elevation of reactive oxygen species (ROS) production by nicotine adenine dinucleotide phosphate (NADPH) oxidase. The aim of our present study was to investigate NADPH oxidase-mediated superoxide (O(2)(-)) production and to search for the signs of lipid peroxidation in hypothalamus and medulla oblongata as well as in renal medulla and cortex of hypertensive male rats transgenic for the murine Ren-2 renin gene (Ren-2 TGR) and their age-matched normotensive controls - Hannover Sprague Dawley rats (HanSD). We found no difference in the activity of NADPH oxidase measured as a lucigenin-mediated O(2)(-) production in the hypothalamus and medulla oblongata. However, we observed significantly elevated NADPH oxidase in both renal cortex and medulla of Ren-2 TGR compared with HanSD. Losartan (LOS) treatment (10 mg/kg body weight/day) for 2 months (Ren-2 TGR+LOS) did not change NADPH oxidase-dependent O(2)(-) production in the kidney. We detected significantly elevated indirect markers of lipid peroxidation measured as thiobarbituric acid-reactive substances (TBARS) in Ren-2 TGR, while they were significantly decreased in Ren-2 TGR+LOS. In conclusion, the present study shows increased NADPH oxidase activities in renal cortex and medulla with significantly increased TBARS in renal cortex. No significant changes of NADPH oxidase and markers of lipid peroxidation were detected in the studied brain regions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohta, Kazuyoshi; Beall, D.S.; Mejia, J.P.
1991-04-01
Zymomonas mobilis genes for pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adhB) were integrated into the Escherichia coli chromosome within or near the pyruvate formate-lyase gene (pfl). Integration improved the stability of the Z. mobilis genes in E. coli, but further selection was required to increase expression. Spontaneous mutants were selected for resistance to high levels of chloramphenicol that also expressed high levels of the Z. mobilis genes. Analogous mutants were selected for increased expression of alcohol dehydrogenase on aldehyde indicator plates. These mutants were functionally equivalent to the previous plasmid-based strains for the fermentation of xylose and glucose tomore » ethanol. Ethanol concentrations of 54.4 and 41.6 g/liter were obtained from 10% glucose and 8% xylose, respectively. The efficiency of conversion exceeded theoretical limits (0.51 g of ethanol/g of sugar) on the basis of added sugars because of the additional production of ethanol from the catabolism of complex nutrients. Further mutations were introduced to inactivate succinate production (frd) and to block homologous recombination (recA).« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan Xinjuan; Dai Yujie; Li Xing
2011-08-01
Chronic arsenic exposure induces oxidative damage to liver leading to liver fibrosis. We aimed to define the effect of grape seed extract (GSE), an antioxidant dietary supplement, on arsenic-induced liver injury. First, Male Sprague-Dawley rats were exposed to a low level of arsenic in drinking water (30 ppm) with or without GSE (100 mg/kg, every other day by oral gavage) for 12 months and the effect of GSE on arsenic-induced hepatotoxicity was examined. The results from this study revealed that GSE co-treatment significantly attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines and fibrogenic genes. Moreover, GSE reduced arsenic-stimulated Smad2/3more » phosphorylation and protein levels of NADPH oxidase subunits (Nox2, Nox4 and p47phox). Next, we explored the molecular mechanisms underlying GSE inhibition of arsenic toxicity using cultured rat hepatic stellate cells (HSCs). From the in vitro study, we found that GSE dose-dependently reduced arsenic-stimulated ROS production and NADPH oxidase activities. Both NADPH oxidases flavoprotein inhibitor DPI and Nox4 siRNA blocked arsenic-induced ROS production, whereas Nox4 overexpression suppressed the inhibitory effects of GSE on arsenic-induced ROS production and NADPH oxidase activities, as well as expression of TGF-{beta}1, type I procollagen (Coll-I) and {alpha}-smooth muscle actin ({alpha}-SMA) mRNA. We also observed that GSE dose-dependently inhibited TGF-{beta}1-induced transactivation of the TGF-{beta}-induced smad response element p3TP-Lux, and that forced expression of Smad3 attenuated the inhibitory effects of GSE on TGF-{beta}1-induced mRNA expression of Coll-I and {alpha}-SMA. Collectively, GSE could be a potential dietary therapeutic agent for arsenic-induced liver injury through suppression of NADPH oxidase and TGF-{beta}/Smad activation. - Research Highlights: > GSE attenuated arsenic-induced low antioxidant defense, oxidative damage, proinflammatory cytokines
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd
2016-01-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD+. The oxidation of NADH to NAD+ was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. PMID:26930704