alcohol oxidase promoter: Topics by Science.gov

Sample records for alcohol oxidase promoter

Analysis of monoamine oxidase A (MAOA) promoter polymorphism in Finnish male alcoholics.

PubMed

Saito, Takuya; Lachman, Herbert M; Diaz, Libna; Hallikainen, Tero; Kauhanen, Jussi; Salonen, Jukka T; Ryynänen, Olli-Pekka; Karvonen, Matti K; Syvälahti, Erkka; Pohjalainen, Tiina; Hietala, Jarmo; Tiihonen, Jari

2002-03-15

Alterations in monoamine oxidase A (MAOA) expression and enzyme activity may be associated with alcoholism and impulsive behavior. Therefore, functional polymorphisms in the MAOA gene would be good candidates to consider in the interindividual differences that exist in the susceptibility to alcoholism. One variant that has been considered as a candidate in alcoholism is a repeat polymorphism in the MAOA gene promoter. We analyzed a cohort of Finnish males with either type 1 or type 2 alcoholism, as well as controls, for differences in the distribution of MAOA promoter alleles. Based on other studies, we postulated that type 2 alcoholism, which is associated with antisocial behavior, but not type 1 alcoholism, would be correlated with the inheritance of the low promoter activity allele. However, we failed to find a difference in allele distribution in type 1 and type 2 alcoholics. In addition, there was no difference in the allele distribution when each group of alcoholics was compared with controls. However, when both groups of alcoholics were pooled and compared with controls, the difference in allele distribution reached a trend towards significance. Our results suggest a minimal association between the MAOA low activity promoter alleles and alcoholism, regardless of the presence or absence of antisocial behavior. Interestingly, approximately 3% of type 2 alcoholics were found to be heterozygous for the MAOA promoter polymorphism. Since MAOA is X-linked, the heterozygotes are probable cases of Klinefelter's syndrome (47,XXY) suggesting that X-chromosome aneuploidy may increase the risk for developing type 2 alcoholism.
Immobilization of Pichia pastoris cells containing alcohol oxidase activity

PubMed Central

Maleknia, S; Ahmadi, H; Norouzian, D

2011-01-01

Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090
Crystal Structure of Alcohol Oxidase from Pichia pastoris

PubMed Central

Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

2016-01-01

FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908
Spectral and catalytic properties of aryl-alcohol oxidase, a fungal flavoenzyme acting on polyunsaturated alcohols

PubMed Central

2005-01-01

Spectral and catalytic properties of the flavoenzyme AAO (aryl-alcohol oxidase) from Pleurotus eryngii were investigated using recombinant enzyme. Unlike most flavoprotein oxidases, AAO does not thermodynamically stabilize a flavin semiquinone radical and forms no sulphite adduct. AAO catalyses the oxidative dehydrogenation of a wide range of unsaturated primary alcohols with hydrogen peroxide production. This differentiates the enzyme from VAO (vanillyl-alcohol oxidase), which is specific for phenolic compounds. Moreover, AAO is optimally active in the pH range of 5–6, whereas VAO has an optimum at pH 10. Kinetic studies showed that AAO is most active with p-anisyl alcohol and 2,4-hexadien-1-ol. AAO converts m- and p-chlorinated benzyl alcohols at a similar rate as it does benzyl alcohol, but introduction of a p-methoxy substituent in benzyl alcohol increases the reaction rate approx. 5-fold. AAO also exhibits low activity on aromatic aldehydes. 19F NMR analysis showed that fluorinated benzaldehydes are converted into the corresponding benzoic acids. Inhibition studies revealed that the AAO active site can bind a wide range of aromatic ligands, chavicol (4-allylphenol) and p-anisic (4-methoxybenzoic) acid being the best competitive inhibitors. Uncompetitive inhibition was observed with 4-methoxybenzylamine. The properties described above render AAO a unique oxidase. The possible mechanism of AAO binding and oxidation of substrates is discussed in the light of the results of the inhibition and kinetic studies. PMID:15813702
Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

PubMed Central

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-01-01

The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066
Stepwise Hydrogen Atom and Proton Transfers in Dioxygen Reduction by Aryl-Alcohol Oxidase.

PubMed

Carro, Juan; Ferreira, Patricia; Martínez, Angel T; Gadda, Giovanni

2018-03-20

The mechanism of dioxygen reduction by the flavoenzyme aryl-alcohol oxidase was investigated with kinetic isotope, viscosity, and pL (pH/pD) effects in rapid kinetics experiments by stopped-flow spectrophotometry of the oxidative half-reaction of the enzyme. Double mixing of the enzyme in a stopped-flow spectrophotometer with [α- 2 H 2 ]- p-methoxybenzyl alcohol and oxygen at varying aging times established a slow rate constant of 0.0023 s -1 for the wash-out of the D atom from the N5 atom of the reduced flavin. Thus, the deuterated substrate could be used to probe the cleavage of the N-H bond of the reduced flavin in the oxidative half-reaction. A significant and pH-independent substrate kinetic isotope effect (KIE) of 1.5 between pH 5.0 and 8.0 demonstrated that H transfer is partially limiting the oxidative half-reaction of the enzyme; a negligible solvent KIE of 1.0 between pD 5.0 and 8.0 proved a fast H + transfer reaction that does not contribute to determining the flavin oxidation rates. Thus, a mechanism for dioxygen reduction in which the H atom originating from the reduced flavin and a H + from a solvent exchangeable site are transferred in separate kinetic steps is proposed. The spectroscopic and kinetic data presented also showed a lack of stabilization of transient flavin intermediates. The substantial differences in the mechanistic details of O 2 reduction by aryl-alcohol oxidase with respect to other alcohol oxidases like choline oxidase, pyranose 2-oxidase, and glucose oxidase further demonstrate the high level of versatility of the flavin cofactor in flavoenzymes.
Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

PubMed

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-03-18

The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Protein dynamics promote hydride tunnelling in substrate oxidation by aryl-alcohol oxidase.

PubMed

Carro, Juan; Martínez-Júlvez, Marta; Medina, Milagros; Martínez, Angel T; Ferreira, Patricia

2017-11-01

The temperature dependence of hydride transfer from the substrate to the N5 of the FAD cofactor during the reductive half-reaction of Pleurotus eryngii aryl-alcohol oxidase (AAO) is assessed here. Kinetic isotope effects on both the pre-steady state reduction of the enzyme and its steady-state kinetics, with differently deuterated substrates, suggest an environmentally-coupled quantum-mechanical tunnelling process. Moreover, those kinetic data, along with the crystallographic structure of the enzyme in complex with a substrate analogue, indicate that AAO shows a pre-organized active site that would only require the approaching of the hydride donor and acceptor for the tunnelled transfer to take place. Modification of the enzyme's active-site architecture by replacement of Tyr92, a residue establishing hydrophobic interactions with the substrate analogue in the crystal structure, in the Y92F, Y92L and Y92W variants resulted in different temperature dependence patterns that indicated a role of this residue in modulating the transfer reaction.
Alcohol biosensing by polyamidoamine (PAMAM)/cysteamine/alcohol oxidase-modified gold electrode.

PubMed

Akin, Mehriban; Yuksel, Merve; Geyik, Caner; Odaci, Dilek; Bluma, Arne; Höpfner, Tim; Beutel, Sascha; Scheper, Thomas; Timur, Suna

2010-01-01

A highly stable and sensitive amperometric alcohol biosensor was developed by immobilizing alcohol oxidase (AOX) through Polyamidoamine (PAMAM) dendrimers on a cysteamine-modified gold electrode surface. Ethanol determination is based on the consumption of dissolved oxygen content due to the enzymatic reaction. The decrease in oxygen level was monitored at -0.7 V vs. Ag/AgCl and correlated with ethanol concentration. Optimization of variables affecting the system was performed. The optimized ethanol biosensor showed a wide linearity from 0.025 to 1.0 mM with 100 s response time and detection limit of (LOD) 0.016 mM. In the characterization studies, besides linearity some parameters such as operational and storage stability, reproducibility, repeatability, and substrate specificity were studied in detail. Stability studies showed a good preservation of the bioanalytical properties of the sensor, 67% of its initial sensitivity was kept after 1 month storage at 4 degrees C. The analytical characteristics of the system were also evaluated for alcohol determination in flow injection analysis (FIA) mode. Finally, proposed biosensor was applied for ethanol analysis in various alcoholic beverage as well as offline monitoring of alcohol production through the yeast cultivation. Copyright 2010 American Institute of Chemical Engineers
Regio- and Stereospecific Conversion of 4-Alkylphenols by the Covalent Flavoprotein Vanillyl-Alcohol Oxidase

PubMed Central

van den Heuvel, Robert H. H.; Fraaije, Marco W.; Laane, Colja; van Berkel, Willem J. H.

1998-01-01

The regio- and stereospecific conversion of prochiral 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase was investigated. The enzyme was active, with 4-alkylphenols bearing aliphatic side chains of up to seven carbon atoms. Optimal catalytic efficiency occurred with 4-ethylphenol and 4-n-propylphenols. These short-chain 4-alkylphenols are stereoselectively hydroxylated to the corresponding (R)-1-(4′-hydroxyphenyl)alcohols (F. P. Drijfhout, M. W. Fraaije, H. Jongejan, W. J. H. van Berkel, and M. C. R. Franssen, Biotechnol. Bioeng. 59:171–177, 1998). (S)-1-(4′-Hydroxyphenyl)ethanol was found to be a far better substrate than (R)-1-(4′-hydroxyphenyl)ethanol, explaining why during the enzymatic conversion of 4-ethylphenol nearly no 4-hydroxyacetophenone is formed. Medium-chain 4-alkylphenols were exclusively converted by vanillyl-alcohol oxidase to the corresponding 1-(4′-hydroxyphenyl)alkenes. The relative cis-trans stereochemistry of these reactions was strongly dependent on the nature of the alkyl side chain. The enzymatic conversion of 4-sec-butylphenol resulted in two (4′-hydroxyphenyl)-sec-butene isomers with identical masses but different fragmentation patterns. We conclude that the water accessibility of the enzyme active site and the orientation of the hydrophobic alkyl side chain of the substrate are of major importance in determining the regiospecific and stereochemical outcome of vanillyl-alcohol oxidase-mediated conversions of 4-alkylphenols. PMID:9791114
A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.

PubMed

Hnaien, M; Lagarde, F; Jaffrezic-Renault, N

2010-04-15

A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. (c) 2009 Elsevier B.V. All rights reserved.
Alcohol promotions in Australian supermarket catalogues.

PubMed

Johnston, Robyn; Stafford, Julia; Pierce, Hannah; Daube, Mike

2017-07-01

In Australia, most alcohol is sold as packaged liquor from off-premises retailers, a market increasingly dominated by supermarket chains. Competition between retailers may encourage marketing approaches, for example, discounting, that evidence indicates contribute to alcohol-related harms. This research documented the nature and variety of promotional methods used by two major supermarket retailers to promote alcohol products in their supermarket catalogues. Weekly catalogues from the two largest Australian supermarket chains were reviewed for alcohol-related content over 12 months. Alcohol promotions were assessed for promotion type, product type, number of standard drinks, purchase price and price/standard drink. Each store catalogue included, on average, 13 alcohol promotions/week, with price-based promotions most common. Forty-five percent of promotions required the purchase of multiple alcohol items. Wine was the most frequently promoted product (44%), followed by beer (24%) and spirits (18%). Most (99%) wine cask (2-5 L container) promotions required multiple (two to three) casks to be purchased. The average number of standard drinks required to be purchased to participate in catalogue promotions was 31.7 (SD = 24.9; median = 23.1). The median price per standard drink was $1.49 (range $0.19-$9.81). Cask wines had the lowest cost per standard drink across all product types. Supermarket catalogues' emphasis on low prices/high volumes of alcohol reflects that retailers are taking advantage of limited restrictions on off-premise sales and promotion, which allow them to approach market competition in ways that may increase alcohol-related harms in consumers. Regulation of alcohol marketing should address retailer catalogue promotions. [Johnston R, Stafford J, Pierce H, Daube M. Alcohol promotions in Australian supermarket catalogues. Drug Alcohol Rev 2017;36:456-463]. © 2016 Australasian Professional Society on Alcohol and other Drugs.
In vivo relationship between monoamine oxidase type B and alcohol dehydrogenase: effects of ethanol and phenylethylamine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aliyu, S.U.; Upahi, L.

The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effectsmore » described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.« less
Steady-state generation of hydrogen peroxide: kinetics and stability of alcohol oxidase immobilized on nanoporous alumina.

PubMed

Kjellander, Marcus; Götz, Kathrin; Liljeruhm, Josefine; Boman, Mats; Johansson, Gunnar

2013-04-01

Alcohol oxidase from Pichia pastoris was immobilized on nanoporous aluminium oxide membranes by silanization and activation by carbonyldiimidazole to create a flow-through enzyme reactor. Kinetic analysis of the hydrogen peroxide generation was carried out for a number of alcohols using a subsequent reaction with horseradish peroxidase and ABTS. The activity data for the immobilized enzyme showed a general similarity with literature data in solution, and the reactor could generate 80 mmol H2O2/h per litre reactor volume. Horseradish peroxidase was immobilized by the same technique to construct bienzymatic modular reactors. These were used in both single pass mode and circulating mode. Pulsed injections of methanol resulted in a linear relation between response and concentration, allowing quantitative concentration measurement. The immobilized alcohol oxidase retained 58 % of initial activity after 3 weeks of storage and repeated use.
Performance of optical biosensor using alcohol oxidase enzyme for formaldehyde detection

NASA Astrophysics Data System (ADS)

Sari, A. P.; Rachim, A.; Nurlely, Fauzia, V.

2017-07-01

The recent issue in the world is the long exposure of formaldehyde which is can increase the risk of human health, therefore, that is very important to develop a device and method that can be optimized to detect the formaldehyde elements accurately, have a long lifetime and can be fabricated and produced in large quantities. A new and simple prepared optical biosensor for detection of formaldehyde in aqueous solutions using alcohol oxidase (AOX) enzyme was successfully fabricated. The poly-n-butyl acrylic-co-N-acryloxysuccinimide (nBA-NAS) membranes containing chromoionophore ETH5294 were used for immobilization of alcohol oxidase enzyme (AOX). Biosensor response was based on the colour change of chromoionophore as a result of enzymatic oxidation of formaldehyde and correlated with the detection concentration of formaldehyde. The performance of biosensor parameters were measured through the optical absorption value using UV-Vis spectrophotometer including the repeatability, reproducibility, selectivity and lifetime. The results showed that the prepared biosensor has good repeatability (RSD = 1.9 %) and good reproducibility (RSD = 2.1 %). The biosensor was selective formaldehyde with no disturbance by methanol, ethanol, and acetaldehyde, and also stable before 49 days and decrease by 41.77 % after 49 days.
Fungal aryl-alcohol oxidase: a peroxide-producing flavoenzyme involved in lignin degradation.

PubMed

Hernández-Ortega, Aitor; Ferreira, Patricia; Martínez, Angel T

2012-02-01

Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein providing the H(2)O(2) required by ligninolytic peroxidases for fungal degradation of lignin, the key step for carbon recycling in land ecosystems. O(2) activation by Pleurotus eryngii AAO takes place during the redox-cycling of p-methoxylated benzylic metabolites secreted by the fungus. Only Pleurotus AAO sequences were available for years, but the number strongly increased recently due to sequencing of different basidiomycete genomes, and a comparison of 112 GMC (glucose-methanol-choline oxidase) superfamily sequences including 40 AAOs is presented. As shown by kinetic isotope effects, alcohol oxidation by AAO is produced by hydride transfer to the flavin, and hydroxyl proton transfer to a base. Moreover, site-directed mutagenesis studies showed that His502 activates the alcohol substrate by proton abstraction, and this result was extended to other GMC oxidoreductases where the nature of the base was under discussion. However, in contrast with that proposed for GMC oxidoreductases, the two transfers are not stepwise but concerted. Alcohol docking at the buried AAO active site resulted in only one catalytically relevant position for concerted transfer, with the pro-R α-hydrogen at distance for hydride abstraction. The expected hydride-transfer stereoselectivity was demonstrated, for the first time in a GMC oxidoreductase, by using the (R) and (S) enantiomers of α-deuterated p-methoxybenzyl alcohol. Other largely unexplained aspects of AAO catalysis (such as the unexpected specificity on substituted aldehydes) can also be explained in the light of the recent results. Finally, the biotechnological interest of AAO in flavor production is extended by its potential in production of chiral compounds taking advantage from the above-described stereoselectivity.
NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans

PubMed Central

Ewald, Collin Yvès; Hourihan, John M; Bland, Monet S; Obieglo, Carolin; Katic, Iskra; Moronetti Mazzeo, Lorenza E; Alcedo, Joy; Blackwell, T Keith; Hynes, Nancy E

2017-01-01

Transient increases in mitochondrially-derived reactive oxygen species (ROS) activate an adaptive stress response to promote longevity. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidases produce ROS locally in response to various stimuli, and thereby regulate many cellular processes, but their role in aging remains unexplored. Here, we identified the C. elegans orthologue of mammalian mediator of ErbB2-driven cell motility, MEMO-1, as a protein that inhibits BLI-3/NADPH oxidase. MEMO-1 is complexed with RHO-1/RhoA/GTPase and loss of memo-1 results in an enhanced interaction of RHO-1 with BLI-3/NADPH oxidase, thereby stimulating ROS production that signal via p38 MAP kinase to the transcription factor SKN-1/NRF1,2,3 to promote stress resistance and longevity. Either loss of memo-1 or increasing BLI-3/NADPH oxidase activity by overexpression is sufficient to increase lifespan. Together, these findings demonstrate that NADPH oxidase-induced redox signaling initiates a transcriptional response that protects the cell and organism, and can promote both stress resistance and longevity. DOI: http://dx.doi.org/10.7554/eLife.19493.001 PMID:28085666
Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

PubMed Central

Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

2015-01-01

Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532
Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism.

PubMed

Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela

2011-08-18

Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

PubMed

Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

2014-05-15

Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. © 2013 Published by Elsevier B.V.

The relationship between exposure to alcohol advertising in stores, owning alcohol promotional items, and adolescent alcohol use.

PubMed

Hurtz, Shannon Q; Henriksen, Lisa; Wang, Yun; Feighery, Ellen C; Fortmann, Stephen P

2007-01-01

This paper describes adolescents' exposure to alcohol advertising in stores and to alcohol-branded promotional items and their association with self-reported drinking. A cross-sectional survey was administered in non-tracked required courses to sixth, seventh, and eighth graders (n = 2125) in three California middle schools. Logistic regressions compared the odds of ever (vs. never) drinking and current (vs. ever) drinking after controlling for psychosocial and other risk factors for adolescent alcohol use. Two-thirds of middle school students reported at least weekly visits to liquor, convenience, or small grocery stores where alcohol advertising is widespread. Such exposure was associated with higher odds of ever drinking, but was not associated with current drinking. One-fifth of students reported owning at least one alcohol promotional item. These students were three times more likely to have ever tried drinking and 1.5 times more likely to report current drinking than students without such items. This study provides clear evidence of an association of adolescent drinking with weekly exposure to alcohol advertising in stores and with ownership of alcohol promotional items. Given their potential influence on adolescent drinking behaviour, retail ads, and promotional items for alcohol deserve further study.
Combination of polymorphic variants in serotonin transporter and monoamine oxidase-A genes may influence the risk for early-onset alcoholism.

PubMed

Bordukalo-Niksic, Tatjana; Stefulj, Jasminka; Matosic, Ana; Mokrovic, Gordana; Cicin-Sain, Lipa

2012-12-30

The combinatory effect of polymorphisms in serotonin transporter and monoamine oxidase-A genes on the aetiopathogenesis of alcoholism was investigated in a sample of 714 individuals. Increased frequency of subjects having three 'suspected' genotypes (5-HTTLPR-LL, STin2-1010 and MAO-A 3-repeat allele) was found among type-2 alcoholic patients (P=0.0189). Results highlight serotonergic/genetic contribution to early-onset alcoholism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Serotonin transporter promoter polymorphism and monoamine oxidase type A VNTR allelic variants together influence alcohol binge drinking risk in young women.

PubMed

Herman, Aryeh I; Kaiss, Kristi M; Ma, Rui; Philbeck, John W; Hasan, Asfar; Dasti, Humza; DePetrillo, Paolo B

2005-02-05

The short allelic variant of the serotonin transporter protein promoter polymorphism (5HTTLPR) appears to influence binge drinking in college students. Both monoamine oxidase type A (MAOA) and the serotonin transporter protein are involved in the processing of serotonin, and allelic variants are both associated with differences in the efficiency of expression. We hypothesized that a significant gene x gene interaction would further stratify the risk of binge drinking in this population. Participants were college students (n = 412) who completed the College Alcohol Study, used to measure binge drinking behaviors. Genomic DNA was extracted from saliva for PCR based genotyping. The risk function for binge drinking was modeled using logistic regression, with final model fit P < 0.0005. This model was valid only for Caucasian females (n = 223), but the power to detect sex and ethnic effects was small. Young Caucasian women carrying higher expression MAOA VNTR alleles homozygous for the short allelic variant of the 5HTTLPR demonstrated the highest rate of binge drinking by self-report, odds ratio (genotype odds: population odds) and 95% confidence intervals, 3.11 (1.14-18.10). Individuals carrying higher expression MAOA VNTR alleles carrying at least one long 5HTTLPR allelic variant had the lowest risk of binge drinking 0.46 (0.28-0.71). These results support the hypothesis that binge drinking behavior in young adulthood may be influenced by neurobiological differences in serotonergic function conferred by functional polymorphisms in genes involved in serotonin processing. (c) 2004 Wiley-Liss, Inc.
THE RELATIONSHIP BETWEEN EXPOSURE TO ALCOHOL ADVERTISING IN STORES, OWNING ALCOHOL PROMOTIONAL ITEMS, AND ADOLESCENT ALCOHOL USE

PubMed Central

HURTZ, SHANNON Q.; HENRIKSEN, LISA; WANG, YUN; FEIGHERY, ELLEN C.; FORTMANN, STEPHEN P.

2014-01-01

Aim This paper describes adolescents’ exposure to alcohol advertising in stores and to alcohol-branded promotional items and their association with self-reported drinking. Methods A cross-sectional survey was administered in non-tracked required courses to sixth, seventh, and eighth graders (n = 2125) in three California middle schools. Logistic regressions compared the odds of ever (vs. never) drinking and current (vs. ever) drinking after controlling for psychosocial and other risk factors for adolescent alcohol use. Results Two-thirds of middle school students reported at least weekly visits to liquor, convenience, or small grocery stores where alcohol advertising is widespread. Such exposure was associated with higher odds of ever drinking, but was not associated with current drinking. One-fifth of students reported owning at least one alcohol promotional item. These students were three times more likely to have ever tried drinking and 1.5 times more likely to report current drinking than students without such items. Conclusions This study provides clear evidence of an association of adolescent drinking with weekly exposure to alcohol advertising in stores and with ownership of alcohol promotional items. Given their potential influence on adolescent drinking behaviour, retail ads, and promotional items for alcohol deserve further study. PMID:17218364
Characterization of an aryl-alcohol oxidase from the plant saprophytic basidiomycete Coprinopsis cinerea with broad substrate specificity against aromatic alcohols.

PubMed

Tamaru, Yoshiaki; Umezawa, Kiwamu; Yoshida, Makoto

2018-07-01

The aim of the study was to obtain information about the enzymatic properties of aryl-alcohol oxidase from the plant saprophytic basidiomycete Coprinopsis cinerea (rCcAAO), which is classified into the auxiliary activities family 3 subfamily 2 (AA3_2). The gene encoding AAO from the plant saprophytic basidiomycete Coprinopsis cinerea (CcAAO) was cloned, and the recombinant CcAAO (rCcAAO) was heterologously expressed in the methylotrophic yeast Pichia pastoris. The purified rCcAAO showed significant activity not only against trans,trans-2,4-hexadien-1-ol but also against a broad range of aromatic alcohols including aromatic compounds that were reported to be poor substrates for known AAOs. Moreover, site-directed mutagenesis analysis demonstrated that mutants with substitutions from leucine to phenylalanine and tryptophan at position 416 exhibited decreases of activity for aromatic alcohols but still maintained the activity for trans,trans-2,4-hexadien-1-ol. Leucine 416 in CcAAO contributes to the broad substrate specificity against various aromatic alcohols, which is useful for the production of hydrogen peroxide using this enzyme.
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

PubMed Central

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

2016-01-01

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

DOE PAGES

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; ...

2016-03-01

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.
In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin

The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.
The Cognitive and Behavioural Impact of Alcohol Promoting and Alcohol Warning Advertisements: An Experimental Study.

PubMed

Brown, Kyle G; Stautz, Kaidy; Hollands, Gareth J; Winpenny, Eleanor M; Marteau, Theresa M

2016-05-01

To assess the immediate effect of alcohol promoting and alcohol warning advertisements on implicit and explicit attitudes towards alcohol and on alcohol seeking behaviour. We conducted a between-participants online experiment in which participants were randomly assigned to view one of three sets of advertisements: (a) alcohol promoting, (b) alcohol warning, or (c) unrelated to alcohol. A total of 373 participants (59.5% female) aged 18-40 (M = 28.03) living in the UK were recruited online through a research agency. Positive and negative implicit attitudes and explicit attitudes towards alcohol were assessed before and after advertisements were viewed. Alcohol seeking behaviour was measured by participants' choice of either an alcohol-related or non-alcohol-related voucher offered ostensibly as a reward for participation. Self-reported past week alcohol consumption was also recorded. There were no main effects on any of the outcome measures. In heavier drinkers, viewing alcohol promoting advertisements increased positive implicit attitudes (standardized beta = 0.15, P = 0.04) and decreased negative implicit attitudes (standardized beta = -0.17, P = 0.02). In heavier drinkers, viewing alcohol warning advertisements decreased negative implicit attitudes (standardized beta = -0.19, P = 0.01). Viewing alcohol promoting advertisements has a cognitive impact on heavier drinkers, increasing positive and reducing negative implicit attitudes towards alcohol. Viewing alcohol warning advertisements reduces negative implicit attitudes towards alcohol in heavier drinkers, suggestive of a reactance effect. © The Author 2015. Medical Council on Alcohol and Oxford University Press.
The Cognitive and Behavioural Impact of Alcohol Promoting and Alcohol Warning Advertisements: An Experimental Study

PubMed Central

Brown, Kyle G.; Stautz, Kaidy; Hollands, Gareth J.; Winpenny, Eleanor M.; Marteau, Theresa M.

2016-01-01

Aims To assess the immediate effect of alcohol promoting and alcohol warning advertisements on implicit and explicit attitudes towards alcohol and on alcohol seeking behaviour. Methods We conducted a between-participants online experiment in which participants were randomly assigned to view one of three sets of advertisements: (a) alcohol promoting, (b) alcohol warning, or (c) unrelated to alcohol. A total of 373 participants (59.5% female) aged 18–40 (M = 28.03) living in the UK were recruited online through a research agency. Positive and negative implicit attitudes and explicit attitudes towards alcohol were assessed before and after advertisements were viewed. Alcohol seeking behaviour was measured by participants' choice of either an alcohol-related or non-alcohol-related voucher offered ostensibly as a reward for participation. Self-reported past week alcohol consumption was also recorded. Results There were no main effects on any of the outcome measures. In heavier drinkers, viewing alcohol promoting advertisements increased positive implicit attitudes (standardized beta = 0.15, P = 0.04) and decreased negative implicit attitudes (standardized beta = −0.17, P = 0.02). In heavier drinkers, viewing alcohol warning advertisements decreased negative implicit attitudes (standardized beta = −0.19, P = 0.01). Conclusions Viewing alcohol promoting advertisements has a cognitive impact on heavier drinkers, increasing positive and reducing negative implicit attitudes towards alcohol. Viewing alcohol warning advertisements reduces negative implicit attitudes towards alcohol in heavier drinkers, suggestive of a reactance effect. PMID:26391367
Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

PubMed Central

Vonck, Janet; Parcej, David N.; Mills, Deryck J.

2016-01-01

The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710
Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yinxi; Liu, Dan; Zhang, Huifeng

Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPHmore » oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to
Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

PubMed Central

Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

2014-01-01

The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075
Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

PubMed

Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

2014-01-01

The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application.
Un-health promotion: results of a survey of alcohol promotion on television.

PubMed

Barton, R; Godfrey, S

1988-06-04

To estimate how widely and to whom alcoholic drinks are promoted 1258 television advertisements were studied over a 10 week period that included the Christmas and New Year holidays in 1986-7. A total of 156 advertisements (12%) promoted alcohol, and this percentage increased significantly over the holiday period to 17%. These advertisements were longer than those advertising other products, and just over half (56%) occupied the first position in commercial breaks. During sports programmes and between the hours of 1800 and 1900 there was an increase in the number of advertisements for alcohol, but there was no difference before and after 2100. It was found that the extent and influence of the promotion of alcohol were great and that such advertising is seen by many children and adolescents.
Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gadda, G.; Orville, A.; Pennati, A.

2008-06-08

Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active sitemore » of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.« less
Preparation of convection interaction media isobutyl disc monolithic column and its application to purification of secondary alcohol dehydrogenase and alcohol oxidase.

PubMed

Isobe, Kimiyasu; Kawakami, Yoshimitsu

2007-03-09

A convection interaction media (trade name CIM, BIA Separation, Ljubljana, Slovenia) isobutyl monolithic disc was prepared by incubating a CIM epoxy monolithic disc with isobutylamine, and it was then applied to the purification of secondary alcohol dehydrogenase (S-ADH) and primary alcohol oxidase (P-AOD). Both enzymes were adsorbed on this column and eluted with high purity. Thus, S-ADH was purified to an electrophoretically homogeneous state by four column chromatographies using CIM DEAE-8 and CIM C4-8 tube monolithic columns, blue-Sepharose column and CIM isobutyl disc monolithic column. P-AOD was also purified to an electrophoretically homogeneous state by three column chromatographies of CIM DEAE-8 tube, CIM C4-8 tube and CIM isobutyl disc columns.
Preventing alcohol-related traffic injury: a health promotion approach.

PubMed

Howat, Peter; Sleet, David; Elder, Randy; Maycock, Bruce

2004-09-01

The conditions that give rise to drinking and driving are complex, with multiple and interrelated causes. Prevention efforts benefit from an approach that relies on the combination of multiple interventions. Health promotion provides a useful framework for conceptualizing and implementing actions to reduce drinking and driving since it involves a combination of educational, behavioral, environmental, and policy approaches. This review draws on data from a range of settings to characterize the effectiveness of various interventions embedded within the health promotion approach. Interventions considered part of the health promotion approach include: (1) economic interventions (2) organizational interventions, (3) policy interventions, and (4) health education interventions, including the use of media, school and community education, and public awareness programs. Effective health promotion strengthens the skills and capabilities of individuals to take action and the capacity of groups or communities to act collectively to exert control over the determinants of alcohol-impaired driving. There is strong evidence for the effectiveness of some components of health promotion, including economic and retailer interventions, alcohol taxation, reducing alcohol availability, legal and legislative strategies, and strategies addressing the servers of alcohol. There is also evidence for the effectiveness of sobriety checkpoints, lower BAC laws, minimum legal drinking age laws, and supportive media promotion programs. Other interventions with moderate evidence of effectiveness include restricting alcohol advertising and promotion, and actions involving counter advertising. Health education interventions alone that have insufficient evidence for effectiveness include passive server training programs, school drug and alcohol education programs, community mobilization efforts, and health warnings. Because each intervention builds on the strengths of every other one, ecological
An investigation of strategies used in alcohol brand marketing and alcohol-related health promotion on Facebook.

PubMed

Lim, Megan Sc; Hare, James D; Carrotte, Elise R; Dietze, Paul M

2016-01-01

Alcohol brands are incorporating social networking sites (SNS) into their marketing programmes. SNS are also being used to reduce alcohol consumption and harms by health promotion organisations. Marketing via SNS can attempt to influence consumers using a range of strategies from traditional marketing, social media, and behaviour change theory. This study systematically quantifies marketing strategies used by alcohol brands and health promoters on Facebook. We identified the 10 most popular alcohol brands and health promotion organisations in Australia on Facebook and extracted all posts from April 2014. A framework was developed, listing 33 SNS marketing strategies. The frequency of use of each strategy in posts was counted for all profiles. The median number of fans of alcohol brands was 189,290 compared with 7562 for health promotion pages. A total of 210 Facebook posts were analysed. Popular marketing strategies included visual attraction, connecting with other organisations, and links to culture and events. Time-specific and day-specific posts and tweets were used more regularly by alcohol brands than health promotion agencies. Alcohol brands remain substantially more popular than health promotion organisations, and this difference is likely driven by offline factors rather than specific use of marketing strategies. However, health promotion organisations can learn from the strategies used by popular brands, particularly in the use of time and day-specific content.
Monitoring food and non-alcoholic beverage promotions to children.

PubMed

Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

2013-10-01

Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

PubMed

Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

2015-07-15

A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Defective monocyte oxidative burst predicts infection in alcoholic hepatitis and is associated with reduced expression of NADPH oxidase.

PubMed

Vergis, Nikhil; Khamri, Wafa; Beale, Kylie; Sadiq, Fouzia; Aletrari, Mina O; Moore, Celia; Atkinson, Stephen R; Bernsmeier, Christine; Possamai, Lucia A; Petts, Gemma; Ryan, Jennifer M; Abeles, Robin D; James, Sarah; Foxton, Matthew; Hogan, Brian; Foster, Graham R; O'Brien, Alastair J; Ma, Yun; Shawcross, Debbie L; Wendon, Julia A; Antoniades, Charalambos G; Thursz, Mark R

2017-03-01

In order to explain the increased susceptibility to serious infection in alcoholic hepatitis, we evaluated monocyte phagocytosis, aberrations of associated signalling pathways and their reversibility, and whether phagocytic defects could predict subsequent infection. Monocytes were identified from blood samples of 42 patients with severe alcoholic hepatitis using monoclonal antibody to CD14. Phagocytosis and monocyte oxidative burst (MOB) were measured ex vivo using flow cytometry, luminometry and bacterial killing assays. Defects were related to the subsequent development of infection. Intracellular signalling pathways were investigated using western blotting and PCR. Interferon-γ (IFN-γ) was evaluated for its therapeutic potential in reversing phagocytic defects. Paired longitudinal samples were used to evaluate the effect of in vivo prednisolone therapy. MOB, production of superoxide and bacterial killing in response to Escherichia coli were markedly impaired in patients with alcoholic hepatitis. Pretreatment MOB predicted development of infection within two weeks with sensitivity and specificity that were superior to available clinical markers. Accordingly, defective MOB was associated with death at 28 and 90 days. Expression of the gp91 phox subunit of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase was reduced in patients with alcoholic hepatitis demonstrating defective MOB. Monocytes were refractory to IFN-γ stimulation and showed high levels of a negative regulator of cytokine signalling, suppressor of cytokine signalling-1. MOB was unaffected by 7 days in vivo prednisolone therapy. Monocyte oxidative burst and bacterial killing is impaired in alcoholic hepatitis while bacterial uptake by phagocytosis is preserved. Defective MOB is associated with reduced expression of NADPH oxidase in these patients and predicts the development of infection and death. Published by the BMJ Publishing Group Limited. For permission to use (where not already
Nicotine administration in the wake-promoting basal forebrain attenuates sleep-promoting effects of alcohol.

PubMed

Sharma, Rishi; Lodhi, Shafi; Sahota, Pradeep; Thakkar, Mahesh M

2015-10-01

Nicotine and alcohol co-abuse is highly prevalent, although the underlying causes are unclear. It has been suggested that nicotine enhances pleasurable effects of alcohol while reducing aversive effects. Recently, we reported that nicotine acts via the basal forebrain (BF) to activate nucleus accumbens and increase alcohol consumption. Does nicotine suppress alcohol-induced aversive effects via the BF? We hypothesized that nicotine may act via the BF to suppress sleep-promoting effects of alcohol. To test this hypothesis, adult male Sprague-Dawley rats were implanted with sleep-recording electrodes and bilateral guides targeted toward the BF. Nicotine (75 pmol/500 nL/side) or artificial cerebrospinal fluid (ACSF; 500 nL/side) was microinjected into the BF followed by intragastric alcohol (ACSF + EtOH and NiC + EtOH groups; 3 g/kg) or water (NiC + W and ACSF + W groups; 10 mL/kg) administration. On completion, rats were killed and processed to localize injection sites in the BF. The statistical analysis revealed a significant effect of treatment on sleep-wakefulness. While rats exposed to alcohol (ACSF + EtOH) displayed strong sleep promotion, nicotine pre-treatment in the BF (NiC + EtOH) attenuated alcohol-induced sleep and normalized sleep-wakefulness. These results suggest that nicotine acts via the BF to suppress the aversive, sleep-promoting effects of alcohol, further supporting the role of BF in alcohol-nicotine co-use. © 2015 International Society for Neurochemistry.
Point-of-sale alcohol promotions in the Perth and Sydney metropolitan areas.

PubMed

Jones, Sandra C; Barrie, Lance; Robinson, Laura; Allsop, Steve; Chikritzhs, Tanya

2012-09-01

Point-of-sale (POS) is increasingly being used as a marketing tool for alcohol products, and there is a growing body of evidence suggesting that these materials are positively associated with drinking and contribute to creating a pro-alcohol environment. The purpose of the present study was to document the nature and extent of POS alcohol promotions in bottle shops in two Australian capital cities. A purposive sample of 24 hotel bottle shops and liquor stores was selected across Sydney (New South Wales) and Perth (Western Australia) and audited for the presence and nature of POS marketing. Point-of-sale promotions were found to be ubiquitous, with an average of 33 promotions per outlet. Just over half were classified as 'non-price' promotions (e.g. giveaways and competitions). Spirits were the most commonly promoted type of alcohol. The average number of standard drinks required to participate in the promotions ranged from 12 for ready to drinks to 22 for beer. Alcohol outlets that were part of supermarket chains had a higher number of promotions, more price-based promotions, and required a greater quantity of alcohol to be purchased to participate in the promotion. The data collected in this study provides a starting point for our understanding of POS promotions in Australia, and poses important questions for future research in this area. © 2012 Australasian Professional Society on Alcohol and other Drugs.
Cross-promotional alcohol discounting in Australia's grocery sector: a barrier to initiatives to curb excessive alcohol consumption?

PubMed

Wardle, Jonathan L; Chang, Sungwon

2015-04-01

Excessive alcohol consumption is an increasing issue internationally. Pricing strategies, including discount restrictions, have been identified as one of the most effective policy means by which to reduce heavy alcohol consumption. In Australia, cross-promotional alcohol discounts are increasingly used by supermarket chains as a marketing tool. The purpose of the present study is to provide preliminary data on the nature and extent of cross-promotional alcohol discounting in the Australian grocery sector. A purposive sample of 34 supermarkets in Australia's three largest cities was selected and minor grocery purchases made to uncover the prevalence and level of cross-promotional alcohol discounting. Cross-promotional 'bundled' discounts were very common with 33 of the 34 supermarkets offering a 'two for one' discount on bottles of wine. Even with minor purchases (mean purchase $1.35), the mean value of discounts received was substantial ($16.23). These results appear to be consistent with claims that major supermarket chains are using alcohol discounts as loss leaders to entice new consumers. These strategies are antithetical to public health strategies aimed at reducing excessive alcohol consumption. Further examination of the impact of major retailers on public health initiatives is warranted, particularly in light of increasing retailer concentration. © 2014 Public Health Association of Australia.
A reagentless amperometric biosensor for alcohol detection in column liquid chromatography based on co-immobilized peroxidase and alcohol oxidase in carbon paste.

PubMed

Johansson, K; Jönsson-Pettersson, G; Gorton, L; Marko-Varga, G; Csöregi, E

1993-12-01

A reagentless carbon paste electrode chemically modified with covalently bound alcohol oxidase and horse-radish peroxidase was examined as a selective sensor in flow injection and column liquid chromatography. A combination of carbodiimide, glutaraldehyde, and polyethyleneimine was used for immobilizing the enzymes in the paste. The surface of the electrodes was protected by first forming a layer of electropolymerized ortho-phenylenediamine followed by deposition of a cation exchange membrane (Eastman AQ 29D). The electrodes were used for detection of hydrogen peroxide, methanol, ethanol, propanol, isopropanol, and butanol. Preliminary investigations of the use of this sensor for bioprocess control are reported.
Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

ERIC Educational Resources Information Center

May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

2009-01-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…
Medicine and the Media: Un-health promotion: results of a survey of alcohol promotion on television

PubMed Central

Barton, Roger; Godfrey, Sally

1988-01-01

To estimate how widely and to whom alcoholic drinks are promoted 1258 television advertisements were studied over a 10 week period that included the Christmas and New Year holidays in 1986-7. A total of 156 advertisements (12%) promoted alcohol, and this percentage increased significantly over the holiday period to 17%. These advertisements were longer than those advertising other products, and just over half (56%) occupied the first position in commercial breaks. During sports programmes and between the hours of 1800 and 1900 there was an increase in the number of advertisements for alcohol, but there was no difference before and after 2100. It was found that the extent and influence of the promotion of alcohol were great and that such advertising is seen by many children and adolescents. PMID:3395835
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

PubMed Central

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

PubMed

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Impact of alcohol-promoting and alcohol-warning advertisements on alcohol consumption, affect, and implicit cognition in heavy-drinking young adults: A laboratory-based randomized controlled trial.

PubMed

Stautz, Kaidy; Frings, Daniel; Albery, Ian P; Moss, Antony C; Marteau, Theresa M

2017-02-01

There is sparse evidence regarding the effect of alcohol-advertising exposure on alcohol consumption among heavy drinkers. This study aimed to assess the immediate effects of alcohol-promoting and alcohol-warning video advertising on objective alcohol consumption in heavy-drinking young adults, and to examine underlying processes. Between-participants randomized controlled trial with three conditions. Two hundred and four young adults (aged 18-25) who self-reported as heavy drinkers were randomized to view one of three sets of 10 video advertisements that included either (1) alcohol-promoting, (2) alcohol-warning, or (3) non-alcohol advertisements. The primary outcome was the proportion of alcoholic beverages consumed in a sham taste test. Affective responses to advertisements, implicit alcohol approach bias, and alcohol attentional bias were assessed as secondary outcomes and possible mediators. Typical alcohol consumption, Internet use, and television use were measured as covariates. There was no main effect of condition on alcohol consumption. Participants exposed to alcohol-promoting advertisements showed increased positive affect and an increased approach/reduced avoidance bias towards alcohol relative to those exposed to non-alcohol advertisements. There was an indirect effect of exposure to alcohol-warning advertisements on reduced alcohol consumption via negative affect experienced in response to these advertisements. Restricting alcohol-promoting advertising could remove a potential influence on positive alcohol-related emotions and cognitions among heavy-drinking young adults. Producing alcohol-warning advertising that generates negative emotion may be an effective strategy to reduce alcohol consumption. Statement of contribution What is already known on this subject? Exposure to alcohol advertising has immediate and distal effects on alcohol consumption. There is some evidence that effects may be larger in heavy drinkers. Alcohol-warning advertising has
Monoamine oxidase-A polymorphisms might modify the association between the dopamine D2 receptor gene and alcohol dependence.

PubMed

Huang, San-Yuan; Lin, Wei-Wen; Wan, Fang-Jung; Chang, Ai-Ju; Ko, Huei-Chen; Wang, Tso-Jen; Wu, Pei-Lin; Lu, Ru-Band

2007-05-01

Low monoamine oxidase (MAO) activity and the neurotransmitter dopamine are 2 important factors in the development of alcohol dependence. MAO is an important enzyme associated with the metabolism of biogenic amines. Therefore, the present study investigates whether the association between the dopamine D2 receptor (DRD2) gene and alcoholism is affected by different polymorphisms of the MAO type A (MAOA) gene. A total of 427 Han Chinese men in Taiwan (201 control subjects and 226 with alcoholism) were recruited for the study. Of the subjects with alcoholism, 108 had pure alcohol dependence (ALC) and 118 had both alcohol dependence and anxiety, depression or both (ANX/DEP ALC). All subjects were assessed with the Chinese Version of the Modified Schedule of Affective Disorders and Schizophrenia-Lifetime. Alcohol dependence, anxiety and major depressive disorders were diagnosed according to Diagnostic and Statistical Manual of Mental Disorders, fourth edition criteria. The genetic variant of the DRD2 gene was only associated with the ANX/DEP ALC phenotype, and the genetic variant of the MAOA gene was associated with pure ALC. Subjects carrying the MAOA 3-repeat allele and genotype A1/A1 of the DRD2 were 3.48 times (95% confidence interval = 1.47-8.25) more likely to be ANX/DEP ALC than the subjects carrying the MAOA 3-repeat allele and DRD2 A2/A2 genotype. The MAOA gene may modify the association between the DRD2 gene and ANX/DEP ALC phenotype.
Deconstructing alcohol use on a night out in England: promotions, preloading and consumption.

PubMed

McClatchley, Kirstie; Shorter, Gillian W; Chalmers, Jenny

2014-07-01

To examine alcohol consumed during a drinking event (a single drinking occasion) by those attending public house/on-trade establishments on nights with standard pricing and nights with promotional prices. Data (n = 425) were collected in an ecological momentary assessment over eight nights in two locations (Midlands and London) on both promotional and standard (Saturday) nights. Multiple regression was used to predict event alcohol consumption by sex, age, type of night, alcohol preloading behaviour, marital and employment status, education, Alcohol Use Disorders Identification Test alcohol consumption questions separately or total AUDIT-C and social group size. Mean (UK) units consumed were 11.8 (London) and 14.4 (Midlands). In London, consumption was similar on promotional and standard nights, but in the Midlands, standard night consumption was three units higher. Preloading was reported by 30%; more common on standard nights. Regression analyses revealed being male, preloading and past-year total AUDIT-C were associated with higher event consumption. However, when AUDIT-C questions were added separately, being a standard night was associated with increased event consumption and different AUDIT-C questions were significantly associated with event consumption in each location. Event consumption reflected heavy episodic drinking and was influenced by price. Promotional night consumption either matched standard Saturday night consumption or was slightly lower. In London, there was a significant preference for drinking at least one promotional beverage on promotional nights. On standard nights, consumption was over a wider range of venues, and preloading with off-trade alcohol was more likely. © 2014 Australasian Professional Society on Alcohol and other Drugs.
Association between a promoter variant in the monoamine oxidase A gene and schizophrenia.

PubMed

Jönsson, Erik G; Norton, Nadine; Forslund, Kaj; Mattila-Evenden, Marja; Rylander, Gunnar; Asberg, Marie; Owen, Michael J; Sedvall, Göran C

2003-05-01

Monoaminergic transmission has been implicated in the pathophysiology of schizophrenia. We investigated a putative functional promoter polymorphism in the monoamine oxidase A (MAOA) gene in schizophrenic patients (n=133) and control subjects (n=377). In men, there was an association between the less efficiently transcribed alleles and schizophrenia (chi(2)=4.01, df=1, p<0.05). In women, no significant differences were found. The present results support the involvement of the MAOA gene in men with schizophrenia in the investigated Swedish population but should be interpreted with caution until replicated.
Neuroimmune Basis of Alcoholic Brain Damage

PubMed Central

Crews, Fulton T.; Vetreno, Ryan P.

2017-01-01

Alcohol-induced brain damage likely contributes to the dysfunctional poor decisions associated with alcohol dependence. Human alcoholics have a global loss of brain volume that is most severe in the frontal cortex. Neuroimmune gene induction by binge drinking increases neurodegeneration through increased oxidative stress, particularly NADPH oxidase-induced oxidative stress. In addition, HMGB1-TLR4 and innate immune NF-κB target genes are increased leading to persistent and sensitized neuroimmune responses to ethanol and other agents that release HMGB1 or directly stimulate TLR receptors and/or NMDA receptors. Neuroimmune signaling and glutamate excitotoxicity are linked to alcoholic neurodegeneration. Models of adolescent alcohol abuse lead to significant frontal cortical degeneration and show the most severe loss of hippocampal neurogenesis. Adolescence is a period of high risk for ethanol-induced neurodegeneration and alterations in brain structure, gene expression, and maturation of adult phenotypes. Together, these findings support the hypothesis that adolescence is a period of risk for persistent and long-lasting increases in brain neuroimmune gene expression that promote persistent and long-term increases in alcohol consumption, neuroimmune gene induction, and neurodegeneration that we find associated with alcohol use disorders. PMID:25175868
Periostin promotes liver fibrogenesis by activating lysyl oxidase in hepatic stellate cells.

PubMed

Kumar, Pradeep; Smith, Tekla; Raeman, Reben; Chopyk, Daniel M; Brink, Hannah; Liu, Yunshan; Sulchek, Todd; Anania, Frank A

2018-06-25

Liver fibrosis arises from dysregulated wound healing due to persistent inflammatory hepatic injury. Periostin is a non-structural extracellular matrix protein that promotes organ fibrosis in adults. Here, we sought to identify the molecular mechanisms in periostin-mediated hepatic fibrosis. Hepatic fibrosis in periostin -/- mice was attenuated as evidenced by significantly reduced collagen fibril density and liver stiffness compared with those in WT controls. A single dose of carbon tetrachloride caused similar acute liver injury in periostin -/- and WT littermates, and we did not detect significant differences in transaminases and major fibrosis-related hepatic gene expression between these two genotypes. Activated hepatic stellate cells (HSCs) are the major periostin-producing liver cell type. We found that in primary rat HSCs in vitro, periostin significantly increases the expression levels and activities of lysyl oxidase (LOX) and lysyl oxidase-like (LOXL) isoforms 1-3. Periostin also induced expression of intra- and extracellular collagen type 1 and fibronectin in HSCs. Interestingly, periostin stimulated phosphorylation of SMAD2/3, which was sustained despite sh-RNA mediated knockdown of transforming growth factor β (TGFβ) receptor I and II, indicating that periostin periostin-mediated SMAD2/3 phosphorylation is independent of TGFβ receptors. Moreover, periostin induced the phosphorylation of focal adhesion kinase (FAK) and AKT in HSCs. Notably, si-RNA mediated FAK knockdown failed to block periostin-induced SMAD2/3 phosphorylation. These results suggest that periostin promotes enhanced matrix stiffness in chronic liver disease by activating LOX and LOXL, independently of TGFβ receptors. Hence, targeting periostin may be of therapeutic benefit in combating hepatic fibrosis. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

DOE PAGES

Lu, Yongwu; Yu, Fei; Hu, Jin; ...

2012-04-12

Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cumore » (111) was the active site for mixed alcohols synthesis, Fe 2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.« less
The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

PubMed

Wongnate, Thanyaporn; Chaiyen, Pimchai

2013-07-01

Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.
Social Norms Tactics to Promote a Campus Alcohol Coalition

ERIC Educational Resources Information Center

Vinci, Debra M.; Philen, Robert C.; Walch, Susan E.; Kennedy, Rebecca; Harrell, Mica; Rime, Carla; Matthews, Jaclyn

2010-01-01

Background: Social norms posters usually contain a normative message, branding, campaign tagline and sponsoring coalition/contact information. There are limited data on which campaign components promote recognition of Campus Alcohol Coalitions (CAC). Purpose: To determine the most effective media channels/incentives to promote recognition of CAC…
The monoamine oxidase A gene promoter repeat and prostate cancer risk.

PubMed

White, Thomas A; Kwon, Erika M; Fu, Rong; Lucas, Jared M; Ostrander, Elaine A; Stanford, Janet L; Nelson, Peter S

2012-11-01

Amine catabolism by monoamine oxidase A (MAOA) contributes to oxidative stress, which plays a role in prostate cancer (PCa) development and progression. An upstream variable-number tandem repeat (uVNTR) in the MAOA promoter influences gene expression and activity, and may thereby affect PCa susceptibility. Caucasian (n = 2,572) men from two population-based case-control studies of PCa were genotyped for the MAOA-VNTR. Logistic regression was used to assess PCa risk in relation to genotype. Common alleles of the MAOA-VNTR were not associated with the relative risk of PCa, nor did the relationship differ by clinical features of the disease. The rare 5-copy variant (frequency: 0.5% in cases; 1.8% in controls), however, was associated with a reduced PCa risk (odds ratio, OR = 0.30, 95% CI 0.13-0.71). A rare polymorphism of the MAOA promoter previously shown to confer low expression was associated with a reduced risk of developing PCa. This novel finding awaits confirmation in other study populations. Copyright © 2012 Wiley Periodicals, Inc.

R1, a novel repressor of the human monoamine oxidase A.

PubMed

Chen, Kevin; Ou, Xiao-Ming; Chen, Gao; Choi, Si Ho; Shih, Jean C

2005-03-25

Monoamine oxidase catalyzes the oxidative deamination of a number of neurotransmitters. A deficiency in monoamine oxidase A results in aggressive behavior in both humans and mice. Studies on the regulation of monoamine oxidase A gene expression have shown that the Sp1 family is important for monoamine oxidase A expression. To search for novel transcription factors, the sequences of three Sp1 sites in the monoamine oxidase A core promoter were used in the yeast one-hybrid system to screen a human cDNA library. A novel repressor, R1 (RAM2), has been cloned. The R1 cDNA encodes a protein with 454 amino acids and an open reading frame at the 5'-end. The transfection of R1 in a human neuroblastoma cell line, SK-N-BE (2)-C, inhibited the monoamine oxidase A promoter and enzymatic activity. The degree of inhibition of monoamine oxidase A by R1 correlated with the level of R1 protein expression. R1 was also found to repress monoamine oxidase A promoter activity within a natural chromatin environment. A gel-shift assay indicated that the endogenous R1 protein in SK-N-BE (2)-C cells interacted with the R1 binding sequence. R1 also bound directly to the natural monoamine oxidase A promoter in vivo as shown by chromatin immunoprecipitation assay. Immunocytochemical analysis showed that R1 was expressed in both cytosol and nucleus, which suggested a role for R1 in transcriptional regulation. Northern blot analysis revealed the presence of endogenous R1 mRNA in human brain and peripheral tissues. Taken together, this study shows that R1 is a novel repressor that inhibits monoamine oxidase A gene expression.
Monoamine Oxidase A Promoter Variable Number of Tandem Repeats (MAOA-uVNTR) in Alcoholics According to Lesch Typology

PubMed Central

Samochowiec, Agnieszka; Chęć, Magdalena; Kopaczewska, Edyta; Samochowiec, Jerzy; Lesch, Otto; Grochans, Elżbieta; Jasiewicz, Andrzej; Bienkowski, Przemyslaw; Łukasz, Kołodziej; Grzywacz, Anna

2015-01-01

Background: The aim of this study was to examine the association between the MAOA-uVNTR gene polymorphism in a homogeneous subgroups of patients with alcohol dependence categorized according to Lesch’s typology. Methods: DNA was provided from alcohol dependent (AD) patients (n = 370) and healthy control subjects (n = 168) all of Polish descent. The history of alcoholism was obtained using the Polish version of the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA). Samples were genotyped using PCR methods. Results: We found no association between alcohol dependence and MAOA gene polymorphism. Conclusions: Lesch typology is a clinical consequence of the disease and its phenotypic description is too complex for a simple genetic analysis. PMID:25809512
Alcohol consumption promotes mammary tumor growth and insulin sensitivity

PubMed Central

Hong, Jina; Holcomb, Valerie B.; Tekle, Samrawit A.; Fan, Betty; Núñez, Nomelí P.

2010-01-01

Epidemiological data show that in women, alcohol has a beneficial effect by increasing insulin sensitivity but also a deleterious effect by increasing breast cancer risk. These effects have not been shown concurrently in an animal model of breast cancer. Our objective is to identify a mouse model of breast cancer whereby alcohol increases insulin sensitivity and promotes mammary tumorigenesis. Our results from the glucose tolerance test and the homeostasis model assessment show that alcohol consumption improved insulin sensitivity. However, alcohol-consuming mice developed larger mammary tumors and developed them earlier than water-consuming mice. In vitro results showed that alcohol exposure increased the invasiveness of breast cancer cells in a dose-dependent manner. Thus, this animal model, an in vitro model of breast cancer, may be used to elucidate the mechanism(s) by which alcohol affects breast cancer. PMID:20202743
An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

PubMed

Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

2016-09-01

Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.
Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin.

USDA-ARS?s Scientific Manuscript database

Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...
Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin

USDA-ARS?s Scientific Manuscript database

Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...
5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

PubMed

Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

2015-08-01

Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. © 2014 The Authors. FEBS Journal published by John Wiley & Sons Ltd on behalf of FEBS.
The arachidonic acid-binding protein S100A8/A9 promotes NADPH oxidase activation by interaction with p67phox and Rac-2.

PubMed

Kerkhoff, Claus; Nacken, Wolfgang; Benedyk, Malgorzata; Dagher, Marie Claire; Sopalla, Claudia; Doussiere, Jacques

2005-03-01

The Ca2+- and arachidonic acid-binding S100A8/A9 protein complex was recently identified by in vitro studies as a novel partner of the phagocyte NADPH oxidase. The present study demonstrated its functional relevance by the impaired oxidase activity in neutrophil-like NB4 cells, after specific blockage of S100A9 expression, and bone marrow polymorphonuclear neutrophils from S100A9-/- mice. The impaired oxidase activation could also be mimicked in a cell-free system by pretreatment of neutrophil cytosol with an S100A9-specific antibody. Further analyses gave insights into the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. In vitro analysis of oxidase activation as well as protein-protein interaction studies revealed that S100A8 is the privileged interaction partner for the NADPH oxidase complex since it bound to p67phox and Rac, whereas S100A9 did interact with neither p67phox nor p47phox. Moreover, S100A8/A9 transferred the cofactor arachidonic acid to NADPH oxidase as shown by the impotence of a mutant S100A8/A9 complex unable to bind arachidonic acid to enhance NADPH oxidase activity. It is concluded that S100A8/A9 plays an important role in phagocyte NADPH oxidase activation.
A Xylenol Orange-Based Screening Assay for the Substrate Specificity of Flavin-Dependent para-Phenol Oxidases.

PubMed

Ewing, Tom A; van Noord, Aster; Paul, Caroline E; van Berkel, Willem J H

2018-01-14

Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para -substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para -phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para -phenol oxidases, facilitating the enzyme engineering of known para- phenol oxidases and the evaluation of the substrate specificity of novel para -phenol oxidases.
Price-based promotions of alcohol: legislative consistencies and inconsistencies across the Australian retail, entertainment and media sectors.

PubMed

Wardle, Jon

2015-05-01

Excessive alcohol consumption is a major public health issue internationally, with alcohol consumption being recognised as a leading cause of preventable illness and major social burden. To help ameliorate the risks and harms associated with alcohol consumption, all levels of governments have explored various legislative and regulatory provisions to support responsible alcohol consumption, service and promotion. In this article, using Australia as a case study, the legislative environment around responsible alcohol promotion and consumption across the Australian retail, entertainment and media sectors will be explored, with a focus on pricing and volume-based discounts. Whilst the potential harm and effect of both the licensed and non-licensed sectors appears to be widely acknowledged as similar in both scope and size of effect, legislative protections overwhelmingly focus solely on reducing the risks associated with alcohol consumption in licensed premises. This article explores the legislative provisions around preventing excessive alcohol consumption through promotional and marketing activities, and notes that whilst the licensed premises sector is facing increasing legislative restrictions, the off-premises sector remains unregulated and in some cases has even had existing restrictions removed, despite forming an increasing part of the alcohol chain in Australia. There appear to be inconsistencies and regulatory gaps in relation to price-based and volume-based discount alcohol promotions. Regulatory loopholes allow the retail sector in particular to use discounted alcohol as a promotional tool, in a way that is inconsistent with the goals of public health alcohol legislation, and in a way which would be illegal in any other sector. There appears to be a compelling case for introducing new restrictions, or extending existing restrictions, on these forms of promotion across all sectors involved in alcohol promotion, and there is considerable evidence that there
Non-advertising alcohol promotions in licensed premises: does the Code of Practice ensure responsible promotion of alcohol?

PubMed

Jones, Sandra C; Lynch, Melissa

2007-09-01

Binge drinking is a major public health issue in Australia, particularly among young people. There has been a considerable focus on alcohol advertising, among both researchers and policy makers, resulting in efforts to bring about some level of regulation of unacceptable advertising practices. However - despite the existence of a Code of Practice for Responsible Promotion of Liquor Products which provides 'a framework of practices which are considered acceptable and reasonable' for licensed premises - there are few, if any, data on the nature and extent of promotions which could arguably fall under either 'acceptable' or 'unacceptable' practices. Over an 8-week period we monitored promotions offered by licensed venues (pubs, bars and clubs) in the Wollongong central area. Seventeen venues were identified, and each venue was visited daily for 1 week. Trained research assistants took notes on all promotions/events in visited venues, including both manufacturer- and management-initiated. We identified a range of different types of promotions, including low cost and free drinks. Some of the promotions identified could be seen to have a positive public health impact, such as free food and free transport. However, the majority of promotions were of a nature likely to increase the likelihood of excessive drinking. It is evident from this review that there are numerous examples of promotions which breach both the spirit and the letter of the Code. It is equally evident that the system for monitoring compliance with the Code is fundamentally inadequate.
Sildenafil Promotes eNOS Activation and Inhibits NADPH Oxidase in the Transgenic Sickle Cell Mouse Penis

PubMed Central

Musicki, Biljana; Bivalacqua, Trinity J.; Champion, Hunter C.; Burnett, Arthur L.

2014-01-01

Introduction Sickle cell disease (SCD)-associated vasculopathy in the penis is characterized by aberrant nitric oxide and phosphodiesterase (PDE) 5 signaling, and by increased oxidative stress. Preliminary clinical trials show that continuous treatment with PDE5 inhibitor sildenafil unassociated with sexual activity decreases priapic activity in patients with SCD. However, the mechanism of its vasculoprotective effect in the penis remains unclear. Aims We evaluated whether continuous administration of PDE5 inhibitor sildenafil promotes eNOS function at posttranslational levels and decreases superoxide-producing enzyme NADPH oxidase activity in the sickle cell mouse penis. Methods SCD transgenic mice were used as an animal model of SCD. WT mice served as controls. Mice received treatment with the PDE5 inhibitor sildenafil (100 mg/kg/day) or vehicle for 3 weeks. eNOS phosphorylation on Ser-1177 (positive regulatory site), eNOS interactions with heat-shock protein 90 (HSP90) (positive regulator), phosphorylated AKT (upstream mediator of eNOS phosphorylation on Ser-1177), an NADPH oxidase catalytic subunit gp91(phox), and a marker of oxidative stress (4-hydroxy-2-nonenal [HNE]) were measured by Western blot. Main Outcome Measures Effect of continuous sildenafil treatment on eNOS posttranslational activation, NADPH oxidase catalytic subunit, and oxidative stress in the penis of the sickle cell mouse. Results Continuous treatment with sildenafil reversed (P < 0.05) the abnormalities in protein expressions of P-eNOS (Ser-1177), eNOS/HSP90 interaction, P-AKT, protein expression of gp91(phox), and 4-HNE, in the sickle cell mouse penis. Sildenafil treatment of WT mice did not affect any of these parameters. Conclusion Our findings that sildenafil enhances eNOS activation and inhibits NADPH oxidase function in the sickle cell mouse penis offers a vasculoprotective molecular basis for the therapeutic effect of sildenafil in the penis in association with SCD. PMID:24251665
Sildenafil promotes eNOS activation and inhibits NADPH oxidase in the transgenic sickle cell mouse penis.

PubMed

Musicki, Biljana; Bivalacqua, Trinity J; Champion, Hunter C; Burnett, Arthur L

2014-02-01

Sickle cell disease (SCD)-associated vasculopathy in the penis is characterized by aberrant nitric oxide and phosphodiesterase (PDE) 5 signaling, and by increased oxidative stress. Preliminary clinical trials show that continuous treatment with PDE5 inhibitor sildenafil unassociated with sexual activity decreases priapic activity in patients with SCD. However, the mechanism of its vasculoprotective effect in the penis remains unclear. We evaluated whether continuous administration of PDE5 inhibitor sildenafil promotes eNOS function at posttranslational levels and decreases superoxide-producing enzyme NADPH oxidase activity in the sickle cell mouse penis. SCD transgenic mice were used as an animal model of SCD. WT mice served as controls. Mice received treatment with the PDE5 inhibitor sildenafil (100 mg/kg/day) or vehicle for 3 weeks. eNOS phosphorylation on Ser-1177 (positive regulatory site), eNOS interactions with heat-shock protein 90 (HSP90) (positive regulator), phosphorylated AKT (upstream mediator of eNOS phosphorylation on Ser-1177), an NADPH oxidase catalytic subunit gp91(phox), and a marker of oxidative stress (4-hydroxy-2-nonenal [HNE]) were measured by Western blot. Effect of continuous sildenafil treatment on eNOS posttranslational activation, NADPH oxidase catalytic subunit, and oxidative stress in the penis of the sickle cell mouse. Continuous treatment with sildenafil reversed (P < 0.05) the abnormalities in protein expressions of P-eNOS (Ser-1177), eNOS/HSP90 interaction, P-AKT, protein expression of gp91(phox), and 4-HNE, in the sickle cell mouse penis. Sildenafil treatment of WT mice did not affect any of these parameters. Our findings that sildenafil enhances eNOS activation and inhibits NADPH oxidase function in the sickle cell mouse penis offers a vasculoprotective molecular basis for the therapeutic effect of sildenafil in the penis in association with SCD. © 2013 International Society for Sexual Medicine.
Peroxisomal Targeting, Import, and Assembly of Alcohol Oxidase in Pichia pastoris

PubMed Central

Waterham, Hans R.; Russell, Kimberly A.; de Vries, Yne; Cregg, James M.

1997-01-01

Alcohol oxidase (AOX), the first enzyme in the yeast methanol utilization pathway is a homooctameric peroxisomal matrix protein. In peroxisome biogenesis-defective (pex) mutants of the yeast Pichia pastoris, AOX fails to assemble into active octamers and instead forms inactive cytoplasmic aggregates. The apparent inability of AOX to assemble in the cytoplasm contrasts with other peroxisomal proteins that are able to oligomerize before import. To further investigate the import of AOX, we first identified its peroxisomal targeting signal (PTS). We found that sequences essential for targeting AOX are primarily located within the four COOH-terminal amino acids of the protein leucine-alanine-arginine-phenylalanine COOH (LARF). To examine whether AOX can oligomerize before import, we coexpressed AOX without its PTS along with wild-type AOX and determined whether the mutant AOX could be coimported into peroxisomes. To identify the mutant form of AOX, the COOH-terminal LARF sequence of the protein was replaced with a hemagglutinin epitope tag (AOX–HA). Coexpression of AOX–HA with wild-type AOX (AOX-WT) did not result in an increase in the proportion of AOX–HA present in octameric active AOX, suggesting that newly synthesized AOX–HA cannot oligomerize with AOX-WT in the cytoplasm. Thus, AOX cannot initiate oligomerization in the cytoplasm, but must first be targeted to the organelle before assembly begins. PMID:9396748
Discovery of a Xylooligosaccharide Oxidase from Myceliophthora thermophila C1.

PubMed

Ferrari, Alessandro R; Rozeboom, Henriëtte J; Dobruchowska, Justyna M; van Leeuwen, Sander S; Vugts, Aniek S C; Koetsier, Martijn J; Visser, Jaap; Fraaije, Marco W

2016-11-04

By inspection of the predicted proteome of the fungus Myceliophthora thermophila C1 for vanillyl-alcohol oxidase (VAO)-type flavoprotein oxidases, a putative oligosaccharide oxidase was identified. By homologous expression and subsequent purification, the respective protein could be obtained. The protein was found to contain a bicovalently bound FAD cofactor. By screening a large number of carbohydrates, several mono- and oligosaccharides could be identified as substrates. The enzyme exhibits a strong substrate preference toward xylooligosaccharides; hence it is named xylooligosaccharide oxidase (XylO). Chemical analyses of the product formed upon oxidation of xylobiose revealed that the oxidation occurs at C1, yielding xylobionate as product. By elucidation of several XylO crystal structures (in complex with a substrate mimic, xylose, and xylobiose), the residues that tune the unique substrate specificity and regioselectivity could be identified. The discovery of this novel oligosaccharide oxidase reveals that the VAO-type flavoprotein family harbors oxidases tuned for specific oligosaccharides. The unique substrate profile of XylO hints at a role in the degradation of xylan-derived oligosaccharides by the fungus M. thermophila C1. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
The marketing of alcohol to college students: the role of low prices and special promotions.

PubMed

Kuo, Meichun; Wechsler, Henry; Greenberg, Patty; Lee, Hang

2003-10-01

Heavy episodic or binge drinking has been recognized as a major problem on American college campuses affecting the health, safety, and education of students. The present study examines the alcohol environment surrounding college campuses and assesses the impact on students' drinking. This environment includes alcohol promotions, price specials, and advertising at drinking establishments that serve beer for on-premise consumption as well as retail outlets that sell beer for off-premise consumption. The study used student self-report data from the 2001 College Alcohol Study (CAS) and direct observational assessments by trained observers who visited alcohol establishments in communities where the participating colleges were located. The analytic sample included more than 10,000 students as well as 830 on-premise and 1684 off-premise establishments at 118 colleges. Alcohol specials, promotions, and advertisements were prevalent in the alcohol outlets around college campuses. Almost three quarters of on-premise establishments offered specials on weekends, and almost one half of the on-premise establishments and more than 60% of off-premise establishments provided at least one type of beer promotion. The availability of large volumes of alcohol (24- and 30-can cases of beer, kegs, party balls), low sale prices, and frequent promotions and advertisements at both on- and off-premise establishments were associated with higher binge drinking rates on the college campuses. In addition, an overall measure of on- and off-premise establishments was positively associated with the total number of drinks consumed. The regulation of marketing practices such as sale prices, promotions, and advertisements may be important strategies to reduce binge drinking and its accompanying problems.
Interaction between a functional MAOA locus and childhood sexual abuse predicts alcoholism and antisocial personality disorder in adult women.

PubMed

Ducci, F; Enoch, M-A; Hodgkinson, C; Xu, K; Catena, M; Robin, R W; Goldman, D

2008-03-01

Women who have experienced childhood sexual abuse (CSA) have an increased risk of alcoholism and antisocial personality disorder (ASPD). Among male subjects, a functional polymorphism (MAOA-LPR, monoamine oxidase A linked polymorphic region) in the promoter region of the monoamine oxidase A gene (MAOA) appears to moderate the effect of childhood maltreatment on antisocial behavior. Our aim was to test whether MAOA-LPR influences the impact of CSA on alcoholism and ASPD in a sample of 291 women, 50% of whom have experienced CSA; we also tested whether haplotypes covering the region where both MAOA and monoamine oxidase B (MAOB) genes are located predict risk of alcoholism and ASPD better than the MAOA-LPR locus alone. Participants included 168 alcoholics (39 with ASPD (antisocial alcoholics) and 123 controls (no alcoholics, no ASPD). Antisocial behavior was also modeled as a continuous trait: ASPD symptoms count. The MAOA-LPR low activity allele was associated with alcoholism (P=0.005), particularly antisocial alcoholism (P=0.00009), only among sexually abused subjects. Sexually abused women who were homozygous for the low activity allele had higher rates of alcoholism and ASPD, and more ASPD symptoms, than abused women homozygous for the high activity allele. Heterozygous women displayed an intermediate risk pattern. In contrast, there was no relationship between alcoholism/antisocial behavior and MAOA-LPR genotype among non-abused women. The MAOA-LPR low activity allele was found on three different haplotypes. The most abundant MAOA haplotype containing the MAOA-LPR low activity allele was found in excess among alcoholics (P=0.008) and antisocial alcoholics (P=0.001). Finally, a MAOB haplotype, which we termed haplotype C, was significantly associated with alcoholism (P=0.006), and to a lesser extent with antisocial alcoholism (P=0.03). In conclusions, MAOA seems to moderate the impact of childhood trauma on adult psychopathology in female subjects in the same way
MAOA expression predicts vulnerability for alcohol use.

PubMed

Cervera-Juanes, R; Wilhem, L J; Park, B; Lee, R; Locke, J; Helms, C; Gonzales, S; Wand, G; Jones, S R; Grant, K A; Ferguson, B

2016-04-01

The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12 months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naive subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared with control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios among the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse.
Continuous aryl alcohol oxidase production under growth-limited conditions using a trickle bed reactor.

PubMed

Pardo-Planas, Oscar; Atiyeh, Hasan K; Prade, Rolf A; Müller, Michael; Wilkins, Mark R

2018-05-01

An A. nidulans strain with a pyridoxine marker was used for continuous production of aryl alcohol oxidase (AAO) in a trickle bed reactor (TBR). Modified medium with reduced zinc, no copper, and 5 g/L ascorbic acid that reduced melanin production and increased AAO productivity under growth limited conditions was used. Two air flow rates, 0.11 L/min (0.1 vvm) and 1.1 L/min (1.0 vvm) were tested. More melanin formation and reduced protein productivity were observed with air flow rate of 1.1 L/min. Three random packings were used as support for the fungus inside the TBR column, two of which were hydrophobic and one which was hydrophilic, and three different dilution rates were tested. The use of GEA BCN 030 hydrophobic packing resulted in greater AAO yield and productivity than the other packings. Increasing dilution rates favored melanin formation and citric, lactic and succinic acid accumulation, which decreased AAO yield and productivity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

PubMed

Enoch, Mary-Anne

2006-12-01

The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence.

Generating disulfides with the quiescin sulfhydryl oxidases

PubMed Central

Heckler, Erin J.; Rancy, Pumtiwitt C.; Kodali, Vamsi K.; Thorpe, Colin

2008-01-01

The Quiescin-sulfhydryl oxidase (QSOX) family of flavoenzymes catalyzes the direct and facile insertion of disulfide bonds into unfolded reduced proteins with concomitant reduction of oxygen to hydrogen peroxide. This review discusses the chemical mechanism of these enzymes and the involvement of thioredoxin and flavin-binding domains in catalysis. The variability of CxxC motifs in the QSOX family is highlighted and attention is drawn to the steric factors that may promote efficient thiol/disulfide exchange during oxidative protein folding. The varied cellular location of these multi-domain sulfhydryl oxidases is reviewed and potential intracellular and extracellular roles are summarized. Finally, this review identifies important unresolved questions concerning this ancient family of sulfhydryl oxidases. PMID:17980160
Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking

PubMed Central

Lei, Kelly; Wegner, Scott A.; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W.

2016-01-01

Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in
Characteristics of Gloeophyllum trabeum Alcohol Oxidase, an Extracellular Source of H2O2 in Brown Rot Decay of Wood▿

PubMed Central

Daniel, Geoffrey; Volc, Jindřich; Filonova, Lada; Plíhal, Ondřej; Kubátová, Elena; Halada, Petr

2007-01-01

A novel alcohol oxidase (AOX) has been purified from mycelial pellets of the wood-degrading basidiomycete Gloeophyllum trabeum and characterized as a homooctameric nonglycosylated protein with native and subunit molecular masses of 628 and 72.4 kDa, containing noncovalently bonded flavin adenine dinucleotide. The isolated AOX cDNA contained an open reading frame of 1,953 bp translating into a polypeptide of 651 amino acids displaying 51 to 53% identity with other published fungal AOX amino acid sequences. The enzyme catalyzed the oxidation of short-chain primary aliphatic alcohols with a preference for methanol (Km = 2.3 mM, kcat = 15.6 s−1). Using polyclonal antibodies and immunofluorescence staining, AOX was localized on liquid culture hyphae and extracellular slime in sections from degraded wood and on cotton fibers. Transmission electron microscopy immunogold labeling localized the enzyme in the hyphal periplasmic space and wall and on extracellular tripartite membranes and slime, while there was no labeling of hyphal peroxisomes. AOX was further shown to be associated with membranous or slime structures secreted by hyphae in wood fiber lumina and within the secondary cell walls of degraded wood fibers. The differences in AOX targeting compared to the known yeast peroxisomal localization were traced to a unique C-terminal sequence of the G. trabeum oxidase, which is apparently responsible for the protein's different translocation. The extracellular distribution and the enzyme's abundance and preference for methanol, potentially available from the demethylation of lignin, all point to a possible role for AOX as a major source of H2O2, a component of Fenton's reagent implicated in the generally accepted mechanisms for brown rot through the production of highly destructive hydroxyl radicals. PMID:17660304
A pilot study investigating of the nature of point-of-sale alcohol promotions in bottle shops in a large Australian regional city.

PubMed

Jones, Sandra C; Lynch, Melissa

2007-08-01

The promotion of alcohol by retailers and media can contribute to a culture of excessive alcohol consumption, but the effect of non-advertising alcohol promotions has largely been neglected. This study sought to gather initial data on this important area. An observational study of alcohol point-of-sale promotions in the Wollongong CBD area, conducted in July-August 2005. We identified 17 different promotions in three categories: gift with purchase; competitions; and buy some, get some free. Given previous research demonstrating the relationship between increased alcohol consumption and both ownership of alcohol-related merchandise and reduced per unit price, it appears that point-of-sale promotions may have the potential to further increase alcohol consumption among young people. Only when the extent and impact of such promotions is demonstrated will we be in a position to effectively advocate for appropriate regulations to ensure young people are not exposed to marketing strategies that further increase their exposure to alcohol-related harms.
NADPH Oxidases in Vascular Pathology

PubMed Central

Konior, Anna; Schramm, Agata; Czesnikiewicz-Guzik, Marta

2014-01-01

Abstract Significance: Reactive oxygen species (ROS) play a critical role in vascular disease. While there are many possible sources of ROS, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases play a central role. They are a source of “kindling radicals,” which affect other enzymes, such as nitric oxide synthase endothelial nitric oxide synthase or xanthine oxidase. This is important, as risk factors for atherosclerosis (hypertension, diabetes, hypercholesterolemia, and smoking) regulate the expression and activity of NADPH oxidases in the vessel wall. Recent Advances: There are seven isoforms in mammals: Nox1, Nox2, Nox3, Nox4, Nox5, Duox1 and Duox2. Nox1, Nox2, Nox4, and Nox5 are expressed in endothelium, vascular smooth muscle cells, fibroblasts, or perivascular adipocytes. Other homologues have not been found or are expressed at very low levels; their roles have not been established. Nox1/Nox2 promote the development of endothelial dysfunction, hypertension, and inflammation. Nox4 may have a role in protecting the vasculature during stress; however, when its activity is increased, it may be detrimental. Calcium-dependent Nox5 has been implicated in oxidative damage in human atherosclerosis. Critical Issues: NADPH oxidase-derived ROS play a role in vascular pathology as well as in the maintenance of normal physiological vascular function. We also discuss recently elucidated mechanisms such as the role of NADPH oxidases in vascular protection, vascular inflammation, pulmonary hypertension, tumor angiogenesis, and central nervous system regulation of vascular function and hypertension. Future Directions: Understanding the role of individual oxidases and interactions between homologues in vascular disease is critical for efficient pharmacological regulation of vascular NADPH oxidases in both the laboratory and clinical practice. Antioxid. Redox Signal. 20, 2794–2814. PMID:24180474
Bienzyme biosensors for glucose, ethanol and putrescine built on oxidase and sweet potato peroxidase.

PubMed

Castillo, Jaime; Gáspár, Szilveszter; Sakharov, Ivan; Csöregi, Elisabeth

2003-05-01

Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase/peroxidase bienzyme systems. The H(2)O(2) produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and the newly purified sweet potato peroxidase (SPP) cross-linked to a redox polymer. The developed electrodes were characterized (sensitivity, stability, and performances in organic medium) and compared with similarly built ones using the 'classical' horseradish peroxidase (HRP). The SPP-based electrodes displayed higher sensitivity and better detection limit for putrescine than those using HRP and were also shown to retain their activity in organic phase much better than the HPR based ones. The importance of attractive or repulsive electrostatic interactions between the peroxidases and oxidases (determined by their isoelectric points) were found to play an important role in the sensitivity of the obtained sensors.
#WaysToRelax: developing an online alcohol-related health promotion animation for people aged 55 and older.

PubMed

Ferguson, Nyssa; Savic, Michael; Manning, Victoria; Lubman, Daniel

2017-04-27

Alcohol use among middle-aged and older adults (55 years and older) is increasingly becoming a public health concern. Despite this, there is relatively little research on the experiences of alcohol use and related concerns among people aged 55 and older to inform tailored and engaging health promotion activities. To address this gap, we aimed to develop an engaging alcohol-related health promotion resource for people aged 55 and older. We drew on a research-into-action approach, which involved: 1) thematic analysis of alcohol-related concerns in online counselling transcripts of 70 people aged 55 and older, 2) a review of health promotion literature, and 3) consultation with consumers of alcohol and other drug services, and carers. The research phase highlighted that people aged 55 and older were concerned that their reliance on alcohol use to manage stress had become a habit they wanted to shift. Alongside this, the literature showed that people aged 55 and older were often dismissive of conventional health promotion activities, and pointed to the benefits of conveying health promotion messages through animation. In response, we developed an animation to stimulate reflection and thought about other ways to relax and manage stress. We drew on health promotion principles to ensure that the animation had a positive message and was engaging without being ageist or paternalistic. It was further refined with input from consumers and carers, who thought the animation was appropriate, appealing and useful. Future activities will include further dissemination and evaluation of the animation and associated activities.
Baclofen promotes alcohol abstinence in alcohol dependent cirrhotic patients with hepatitis C virus (HCV) infection

PubMed Central

Leggio, L.; Ferrulli, A.; Zambon, A.; Caputo, F.; Kenna, G.A.; Swift, R.M.; Addolorato, G.

2016-01-01

Hepatitis C virus (HCV) and alcoholic liver disease (ALD), either alone or in combination, count for more than two thirds of all liver diseases in the Western world. There is no safe level of drinking in HCV-infected patients and the most effective goal for these patients is total abstinence. Baclofen, a GABAB receptor agonist, represents a promising pharmacotherapy for alcohol dependence (AD). Previously, we performed a randomized clinical trial (RCT), which demonstrated the safety and efficacy of baclofen in patients affected by AD and cirrhosis. The goal of this post-hoc analysis was to explore baclofen's effect in a subgroup of alcohol-dependent HCV-infected cirrhotic patients. Any patient with HCV infection was selected for this analysis. Among the 84 subjects randomized in the main trial, 24 alcohol-dependent cirrhotic patients had a HCV infection; 12 received baclofen 10mg t.i.d. and 12 received placebo for 12-weeks. With respect to the placebo group (3/12, 25.0%), a significantly higher number of patients who achieved and maintained total alcohol abstinence was found in the baclofen group (10/12, 83.3%; p=0.0123). Furthermore, in the baclofen group, compared to placebo, there was a significantly higher increase in albumin values from baseline (p=0.0132) and a trend toward a significant reduction in INR levels from baseline (p=0.0716). In conclusion, baclofen was safe and significantly more effective than placebo in promoting alcohol abstinence, and improving some LFTs (i.e. albumin, INR) in alcohol-dependent HCV-infected cirrhotic patients. Baclofen may represent a clinically relevant alcohol pharmacotherapy for these patients. PMID:22244707
Amperometric sensor for ethanol based on one-step electropolymerization of thionine-carbon nanofiber nanocomposite containing alcohol oxidase.

PubMed

Wu, Lina; McIntosh, Mike; Zhang, Xueji; Ju, Huangxian

2007-12-15

Thionine had strong interaction with carbon nanofiber (CNF) and was used in the non-covalent functionalization of carbon nanofiber for the preparation of stable thionine-CNF nanocomposite with good dispersion. With a simple one-step electrochemical polymerization of thionine-CNF nanocomposite and alcohol oxidase (AOD), a stable poly(thionine)-CNF/AOD biocomposite film was formed on electrode surface. Based on the excellent catalytic activity of the biocomposite film toward reduction of dissolved oxygen, a sensitive ethanol biosensor was proposed. The ethanol biosensor could monitor ethanol ranging from 2.0 to 252 microM with a detection limit of 1.7 microM. It displayed a rapid response, an expanded linear response range as well as excellent reproducibility and stability. The combination of catalytic activity of CNF and the promising feature of the biocomposite with one-step non-manual technique favored the sensitive determination of ethanol with improved analytical capabilities.
Adipogenesis-related increase of semicarbazide-sensitive amine oxidase and monoamine oxidase in human adipocytes.

PubMed

Bour, Sandy; Daviaud, Danièle; Gres, Sandra; Lefort, Corinne; Prévot, Danielle; Zorzano, Antonio; Wabitsch, Martin; Saulnier-Blache, Jean-Sébastien; Valet, Philippe; Carpéné, Christian

2007-08-01

A strong induction of semicarbazide-sensitive amine oxidase (SSAO) has previously been reported during murine preadipocyte lineage differentiation but it remains unknown whether this emergence also occurs during adipogenesis in man. Our aim was to compare SSAO and monoamine oxidase (MAO) expression during in vitro differentiation of human preadipocytes and in adipose and stroma-vascular fractions of human fat depots. A human preadipocyte cell strain from a patient with Simpson-Golabi-Behmel syndrome was first used to follow amine oxidase expression during in vitro differentiation. Then, human preadipocytes isolated from subcutaneous adipose tissues were cultured under conditions promoting ex vivo adipose differentiation and tested for MAO and SSAO expression. Lastly, human adipose tissue was separated into mature adipocyte and stroma-vascular fractions for analyses of MAO and SSAO at mRNA, protein and activity levels. Both SSAO and MAO were increased from undifferentiated preadipocytes to lipid-laden cells in all the models: 3T3-F442A and 3T3-L1 murine lineages, human SGBS cell strain or human preadipocytes in primary culture. In human subcutaneous adipose tissue, the adipocyte-enriched fraction exhibited seven-fold higher amine oxidase activity and contained three- to seven-fold higher levels of mRNAs encoded by MAO-A, MAO-B, AOC3 and AOC2 genes than the stroma-vascular fraction. MAO-A and AOC3 genes accounted for the majority of their respective MAO and SSAO activities in human adipose tissue. Most of the SSAO and MAO found in adipose tissue originated from mature adipocytes. Although the mechanism and role of adipogenesis-related increase in amine oxidase expression remain to be established, the resulting elevated levels of amine oxidase activities found in human adipocytes may be of potential interest for therapeutic intervention in obesity.
Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

PubMed Central

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
[Oxygen and the superoxide anion. Modulation of NADPH oxidase?].

PubMed

Delbosc, S; Cristol, J P; Descomps, B; Chénard, J; Sirois, P

2001-01-01

Oxidative stress which results from an imbalance between oxidant production and antioxidant defense mechanisms can promote modifications of lipids, proteins and nucleic acids. This review focuses on the different pathways leading to Reactive Oxygen Species (ROS) production in particular on NADPH oxidase activation. This enzyme is localized in numerous cells including phagocytes and vascular cells and composed of membrane and cytosolic sub-units. The activation of the NADPH oxidase is largely involved in inflammation associated diseases such as asthma, Systemic Inflammatory Response Syndrome and aging associated diseases such as atherosclerosis and neurodeneratives diseases. The modulation of NADPH oxidase could be a way to limit or prevent the development of these diseases.
The Illinois Alcoholism Prevention Initiative: A State-Wide Health Promotion and Primary Prevention Project.

ERIC Educational Resources Information Center

Floyd, Jerald D.

Two resource centers were funded by the Illinois Alcoholism Prevention Initiative to facilitate primary prevention and health promotion efforts at the local level. Located in DeKalb and Springfield, the centers assisted the Illinois State Department of Mental Health and Developmental Disabilities Division of Alcoholism in building a body of…
Surface modification of polyvinyl alcohol/malonic acid nanofibers by gaseous dielectric barrier discharge plasma for glucose oxidase immobilization

NASA Astrophysics Data System (ADS)

Afshari, Esmail; Mazinani, Saeedeh; Ranaei-Siadat, Seyed-Omid; Ghomi, Hamid

2016-11-01

Polymeric nanofiber prepares a suitable situation for enzyme immobilization for variety of applications. In this research, we have fabricated polyvinyl alcohol (PVA)/malonic acid nanofibers using electrospinning. After fabrication of nanofibers, the effect of air, nitrogen, CO2, and argon DBD (dielectric barrier discharge) plasmas on PVA/malonic acid nanofibers were analysed. Among them, air plasma had the most significant effect on glucose oxidase (GOx) immobilization. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrum analysis and X-ray photoelectron spectroscopy (XPS) results revealed that in case of air plasma modified nanofibers, the carboxyl groups on the surface are increased. The scanning electron microscopy (SEM) images showed that, after GOx immobilization, the modified nanofibers with plasma has retained its nanofiber structure. Finally, we analysed reusability and storage stability of GOx immobilized on plasma modified and unmodified nanofibers. The results were more satisfactory for modified nanofibers with respect to unmodified ones.
Promotion or suppression of glucose isomerization in subcritical aqueous straight- and branched-chain alcohols.

PubMed

Gao, Da-Ming; Kobayashi, Takashi; Adachi, Shuji

2015-01-01

The influence of water-miscible alcohols (methanol, 1-propanol, 2-propanol, and t-butyl alcohol) on the isomerization of glucose to fructose and mannose was investigated under subcritical aqueous conditions (180-200 °C). Primary and secondary alcohols promoted the conversion and isomerization of glucose to afford fructose and mannose with high and low selectivity, respectively. On the other hand, the decomposition (side-reaction) of glucose was suppressed in the presence of the primary and secondary alcohols compared with that in subcritical water. The yield of fructose increased with increasing concentration of the primary and secondary alcohols, and the species of the primary and secondary alcohols tested had little effect on the isomerization behavior of glucose. In contrast, the isomerization of glucose was suppressed in subcritical aqueous t-butyl alcohol. Both the conversion of glucose and the yield of fructose decreased with increasing concentration of t-butyl alcohol. In addition, mannose was not detected in reactions using subcritical aqueous t-butyl alcohol.
Discovery and Characterization of a 5-Hydroxymethylfurfural Oxidase from Methylovorus sp. Strain MP688

PubMed Central

Dijkman, Willem P.

2014-01-01

In the search for useful and renewable chemical building blocks, 5-hydroxymethylfurfural (HMF) has emerged as a very promising candidate, as it can be prepared from sugars. HMF can be oxidized to 2,5-furandicarboxylic acid (FDCA), which is used as a substitute for petroleum-based terephthalate in polymer production. On the basis of a recently identified bacterial degradation pathway for HMF, candidate genes responsible for selective HMF oxidation have been identified. Heterologous expression of a protein from Methylovorus sp. strain MP688 in Escherichia coli and subsequent enzyme characterization showed that the respective gene indeed encodes an efficient HMF oxidase (HMFO). HMFO is a flavin adenine dinucleotide-containing oxidase and belongs to the glucose-methanol-choline-type flavoprotein oxidase family. Intriguingly, the activity of HMFO is not restricted to HMF, as it is active with a wide range of aromatic primary alcohols and aldehydes. The enzyme was shown to be relatively thermostable and active over a broad pH range. This makes HMFO a promising oxidative biocatalyst that can be used for the production of FDCA from HMF, a reaction involving both alcohol and aldehyde oxidations. PMID:24271187
POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

PubMed

Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

2014-01-01

POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5.
Monoamine oxidase a promoter gene associated with problem behavior in adults with intellectual/developmental disabilities.

PubMed

May, Michael E; Srour, Ali; Hedges, Lora K; Lightfoot, David A; Phillips, John A; Blakely, Randy D; Kennedy, Craig H

2009-07-01

A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a gender, ethnicity, and age-matched contrast sample. About 43% (15/35) of adults with intellectual/developmental disabilities and problem behavior possessed the low-efficiency version of the MAOA gene. In comparison, 20% (7/35) of adults with intellectual/developmental disabilities and no problem behavior and 20% (7/35) of the contrast group had the short-allele MAOA polymorphism. Therefore, a common variant in the MAOA gene may be associated with problem behavior in adults with intellectual/developmental disabilities.
Electron and Fluorescence Microscopy of Extracellular Glucan and Aryl-Alcohol Oxidase during Wheat-Straw Degradation by Pleurotus eryngii

PubMed Central

Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.

1998-01-01

The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085
Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior

PubMed Central

Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

2009-01-01

Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058

Effects of MAOA-genotype, alcohol consumption, and aging on violent behavior.

PubMed

Tikkanen, Roope; Sjöberg, Rickard L; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

2009-03-01

Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype.
Can human rights standards help protect children and youth from the detrimental impact of alcohol beverage marketing and promotional activities?

PubMed

Chapman, Audrey R

2017-01-01

The alcohol industry in the Latin American and Caribbean (LAC) region promotes demand for alcohol products actively through a number of channels, including advertising and sponsorship of sports and other events. This paper evaluates whether human rights instruments that Latin American countries have ratified can be used to limit children's exposure to alcohol advertising and promotion. A review was conducted of the text of, and interpretative documents related to, a series of international and regional human rights instruments ratified by most countries in the LAC region that enumerate the right to health. The Convention on the Rights of the Child has the most relevant provisions to protect children and youth from alcohol promotion and advertising. Related interpretive documents by the United Nations Committee on the Rights of the Child affirm that corporations hold duties to respect and protect children's right to health. Human rights norms and law can be used to regulate or eliminate alcohol beverage marketing and promotional activities in the Latin American region. The paper recommends developing a human rights based Framework Convention on Alcohol Control to provide guidance. © 2016 Society for the Study of Addiction.
NADPH Oxidase-Driven Phagocyte Recruitment Controls Candida albicans Filamentous Growth and Prevents Mortality

PubMed Central

Brothers, Kimberly M.; Gratacap, Remi L.; Barker, Sarah E.; Newman, Zachary R.; Norum, Ashley; Wheeler, Robert T.

2013-01-01

Candida albicans is a human commensal and clinically important fungal pathogen that grows as both yeast and hyphal forms during human, mouse and zebrafish infection. Reactive oxygen species (ROS) produced by NADPH oxidases play diverse roles in immunity, including their long-appreciated function as microbicidal oxidants. Here we demonstrate a non-traditional mechanistic role of NADPH oxidase in promoting phagocyte chemotaxis and intracellular containment of fungi to limit filamentous growth. We exploit the transparent zebrafish model to show that failed NADPH oxidase-dependent phagocyte recruitment to C. albicans in the first four hours post-infection permits fungi to germinate extracellularly and kill the host. We combine chemical and genetic tools with high-resolution time-lapse microscopy to implicate both phagocyte oxidase and dual-specific oxidase in recruitment, suggesting that both myeloid and non-myeloid cells promote chemotaxis. We show that early non-invasive imaging provides a robust tool for prognosis, strongly connecting effective early immune response with survival. Finally, we demonstrate a new role of a key regulator of the yeast-to-hyphal switching program in phagocyte-mediated containment, suggesting that there are species-specific methods for modulation of NADPH oxidase-independent immune responses. These novel links between ROS-driven chemotaxis and fungal dimorphism expand our view of a key host defense mechanism and have important implications for pathogenesis. PMID:24098114
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

PubMed

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

PubMed

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Point-of-purchase alcohol marketing and promotion by store type--United States, 2000-2001.

PubMed

2003-04-11

Alcohol consumption is the third leading preventable cause of death in the United States, accounting for approximately 100,000 deaths annually. Efforts to reduce the adverse health and social consequences from alcohol use include policies to restrict access to alcohol among underaged persons (i.e., persons aged <21 years) and to reduce alcohol-impaired driving among persons of all ages. Recent studies have focused on alcohol marketing as a potentially important contributor to alcohol consumption, particularly among underage drinkers. Point-of-purchase (POP) (i.e., on-site) marketing, including alcohol advertising and placement, can increase alcohol sales and consumption substantially, thereby increasing the risk for various alcohol-related health outcomes, including alcohol-impaired driving and interpersonal violence. To assess the type and frequency of POP alcohol marketing, researchers with the ImpacTeen Project collected and analyzed store observation data during 2000-2001 from 3,961 alcohol retailers in 329 communities throughout the United States. This report summarizes the results of the study, which indicate that POP alcohol marketing is extensive in certain store types frequented by teenagers and young adults. Public health agencies and policy makers should work with liquor control boards to reduce POP marketing that could promote risky or underage drinking.
Cross sectional survey on association between alcohol, betel- nut, cigarette consumption and health promoting behavior of industrial workers in Ghaziabad.

PubMed

Arora, Dimple; Marya, Charu Mohan; Menon, Ipseeta; Oberoi, Sukhvinder Singh; Dhingra, Chandan; Anand, Richa

2015-01-01

The work force in industries are at risk of developing unduly high rates of health and behaviour related problems including abuse of alcohol, betel nut and cigarette (alcohol, betel nut and cigarette consumption). This study describes the relationships between alcohol, betel nut and cigarette consumption and health promoting behaviour among industrial workers. A cross sectional survey was conducted on workers in various industries of Ghaziabad city with concerned authority permission. A sample size of 732 workers was calculated based on pilot study. Through Simple random sampling 732 workers in 20 to 50 years age group with informed consent were interviewed through structured, pretested, validated questionnaire in vernacular language by one calibrated investigator. Data on socio demography, alcohol, betel nut and cigarette consumption pattern and health behaviour were collected. The association between health promoting behaviour and alcohol, betel nut and cigarette consumption was analysed by Logistic regression and Chi-square test through SPSS 16 at p<0.05 and 95%CI as significant. Total prevalence of alcohol, betel nut and cigarette consumption in study population was 88%. The prevalence of individual alcohol, betel nut and cigarette consumption were 82%, 68% and 79% respectively. Combined alcohol, betel nut and cigarette prevalence in study population was 58%. Alcohol and cigarette users were significantly higher (p<0.001) in 30 to 40 years age group with lower level of education having poor attitude towards health promoting behaviour, poor oral hygiene practices and rare indulgence in regular physical exercise. This study stimulate further research on exploring methods to prevent initiation of health risk behaviour and promote healthy behaviour with cessation help for the current alcohol, betel nut and cigarette users.
Chronic Alcohol Ingestion in Rats Alters Lung Metabolism, Promotes Lipid Accumulation, and Impairs Alveolar Macrophage Functions

PubMed Central

Romero, Freddy; Shah, Dilip; Duong, Michelle; Stafstrom, William; Hoek, Jan B.; Kallen, Caleb B.; Lang, Charles H.

2014-01-01

Chronic alcoholism impairs pulmonary immune homeostasis and predisposes to inflammatory lung diseases, including infectious pneumonia and acute respiratory distress syndrome. Although alcoholism has been shown to alter hepatic metabolism, leading to lipid accumulation, hepatitis, and, eventually, cirrhosis, the effects of alcohol on pulmonary metabolism remain largely unknown. Because both the lung and the liver actively engage in lipid synthesis, we hypothesized that chronic alcoholism would impair pulmonary metabolic homeostasis in ways similar to its effects in the liver. We reasoned that perturbations in lipid metabolism might contribute to the impaired pulmonary immunity observed in people who chronically consume alcohol. We studied the metabolic consequences of chronic alcohol consumption in rat lungs in vivo and in alveolar epithelial type II cells and alveolar macrophages (AMs) in vitro. We found that chronic alcohol ingestion significantly alters lung metabolic homeostasis, inhibiting AMP-activated protein kinase, increasing lipid synthesis, and suppressing the expression of genes essential to metabolizing fatty acids (FAs). Furthermore, we show that these metabolic alterations promoted a lung phenotype that is reminiscent of alcoholic fatty liver and is characterized by marked accumulation of triglycerides and free FAs within distal airspaces, AMs, and, to a lesser extent, alveolar epithelial type II cells. We provide evidence that the metabolic alterations in alcohol-exposed rats are mechanistically linked to immune impairments in the alcoholic lung: the elevations in FAs alter AM phenotypes and suppress both phagocytic functions and agonist-induced inflammatory responses. In summary, our work demonstrates that chronic alcohol ingestion impairs lung metabolic homeostasis and promotes pulmonary immune dysfunction. These findings suggest that therapies aimed at reversing alcohol-related metabolic alterations might be effective for preventing and
The Belief that Alcohol Use is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

PubMed Central

Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

2011-01-01

This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year. PMID:23519434
The Belief that Alcohol Use is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents.

PubMed

Henry, Kimberly L; Shtivelband, Annette; Comello, Maria Leonora G; Slater, Michael D

2011-08-01

This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40 schools were analyzed using a structural equation model. Autonomy was negatively correlated with intention to use alcohol and subsequent alcohol use at a later wave, and intention to use fully mediated the effect of autonomy on subsequent alcohol use. These results are consistent with the proposition that when personal autonomy is perceived as inconsistent with alcohol use among younger adolescents, students indicate a lower intention to use alcohol and use less alcohol during the following school year.
Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Treesearch

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Prevention of melanin formation during aryl alcohol oxidase production under growth-limited conditions using an Aspergillus nidulans cell factory.

PubMed

Pardo-Planas, Oscar; Prade, Rolf A; Müller, Michael; Atiyeh, Hasan K; Wilkins, Mark R

2017-11-01

An Aspergillus nidulans cell factory was genetically engineered to produce an aryl alcohol oxidase (AAO). The cell factory initiated production of melanin when growth-limited conditions were established using stationary plates and shaken flasks. This phenomenon was more pronounced when the strain was cultured in a trickle bed reactor (TBR). This study investigated different approaches to reduce melanin formation in fungal mycelia and liquid medium in order to increase the enzyme production yield. Removal of copper from the medium recipe reduced melanin formation in agar cultures and increased enzyme activities by 48% in agitated liquid cultures. Copper has been reported as a key element for tyrosinase, an enzyme responsible for melanin production. Ascorbic acid (0.44g/L) stopped melanin accumulation, did not affect growth parameters and resulted in AAO activity that was more than two-fold greater than a control treatment with no ascorbic acid. Copyright © 2017 Elsevier Ltd. All rights reserved.
Receptivity to alcohol marketing predicts initiation of alcohol use.

PubMed

Henriksen, Lisa; Feighery, Ellen C; Schleicher, Nina C; Fortmann, Stephen P

2008-01-01

This longitudinal study examined the influence of alcohol advertising and promotions on the initiation of alcohol use. A measure of receptivity to alcohol marketing was developed from research about tobacco marketing. Recall and recognition of alcohol brand names were also examined. Data were obtained from in-class surveys of sixth, seventh, and eighth graders at baseline and 12-month follow-up. Participants who were classified as never drinkers at baseline (n = 1,080) comprised the analysis sample. Logistic regression models examined the association of advertising receptivity at baseline with any alcohol use and current drinking at follow-up, adjusting for multiple risk factors, including peer alcohol use, school performance, risk taking, and demographics. At baseline, 29% of never drinkers either owned or wanted to use an alcohol branded promotional item (high receptivity), 12% students named the brand of their favorite alcohol ad (moderate receptivity), and 59% were not receptive to alcohol marketing. Approximately 29% of adolescents reported any alcohol use at follow-up; 13% reported drinking at least 1 or 2 days in the past month. Never drinkers who reported high receptivity to alcohol marketing at baseline were 77% more likely to initiate drinking by follow-up than those were not receptive. Smaller increases in the odds of alcohol use at follow-up were associated with better recall and recognition of alcohol brand names at baseline. Alcohol advertising and promotions are associated with the uptake of drinking. Prevention programs may reduce adolescents' receptivity to alcohol marketing by limiting their exposure to alcohol ads and promotions and by increasing their skepticism about the sponsors' marketing tactics.
Receptivity to alcohol marketing predicts initiation of alcohol use

PubMed Central

Henriksen, Lisa; Feighery, Ellen C.; Schleicher, Nina C.; Fortmann, Stephen P.

2008-01-01

Purpose This longitudinal study examined the influence of alcohol advertising and promotions on the initiation of alcohol use. A measure of receptivity to alcohol marketing was developed from research about tobacco marketing. Recall and recognition of alcohol brand names were also examined. Methods Data were obtained from in-class surveys of 6th, 7th, and 8th graders at baseline and 12-month follow-up. Participants who were classified as never drinkers at baseline (n=1,080) comprised the analysis sample. Logistic regression models examined the association of advertising receptivity at baseline with any alcohol use and current drinking at follow-up, adjusting for multiple risk factors, including peer alcohol use, school performance, risk taking, and demographics. Results At baseline, 29% of never drinkers either owned or wanted to use an alcohol branded promotional item (high receptivity), 12% students named the brand of their favorite alcohol ad (moderate receptivity) and 59% were not receptive to alcohol marketing. Approximately 29% of adolescents reported any alcohol use at follow-up; 13% reported drinking at least 1 or 2 days in the past month. Never drinkers who reported high receptivity to alcohol marketing at baseline were 77% more likely to initiate drinking by follow-up than those were not receptive. Smaller increases in the odds of alcohol use at follow-up were associated with better recall and recognition of alcohol brand names at baseline. Conclusions Alcohol advertising and promotions are associated with the uptake of drinking. Prevention programs may reduce adolescents’ receptivity to alcohol marketing by limiting their exposure to alcohol ads and promotions and by increasing their skepticism about the sponsors’ marketing tactics. PMID:18155027
High glucose condition increases NADPH oxidase activity in endothelial microparticles that promote vascular inflammation.

PubMed

Jansen, Felix; Yang, Xiaoyan; Franklin, Bernardo S; Hoelscher, Marion; Schmitz, Theresa; Bedorf, Jörg; Nickenig, Georg; Werner, Nikos

2013-04-01

Diabetes is a major risk factor for cardiovascular diseases. Circulating endothelial microparticles (EMP) are increased in diabetic patients, but their potential contribution in atherogenesis is unclear. We sought to determine the role of EMP derived under high glucose conditions in the development of atherosclerosis. EMP were generated from human coronary endothelial cells (HCAEC) exposed to high glucose concentrations in order to mimic diabetic conditions. These EMP were defined as 'injured' EMP (iEMP) and their effects were compared with EMP generated from 'healthy' untreated HCAEC. iEMP injection significantly impaired endothelial function in ApoE(-/-) mice compared with EMP and vehicle treatment. Immunofluorescent experiments showed increased macrophage infiltration and adhesion protein expression in atherosclerotic lesions of iEMP-treated ApoE(-/-) mice compared with controls. To further investigate the underlying mechanism of iEMP-induced vascular inflammation, additional in vitro experiments were performed. iEMP, but not EMP, induced activation of HCAEC in a time- and dose-dependent manner and increased monocyte adhesion. Further experiments demonstrated that iEMP induced activation of HCAEC by phosphorylation of p38 into its biologically active form phospho-p38. Inhibition of p38 activation abrogated iEMP-dependent induction of adhesion proteins and monocyte adhesion on HCAEC. Moreover, we could demonstrate that iEMP show increased NADPH oxidase activity and contain significantly higher level of reactive oxygen species (ROS) than EMP. iEMP triggered ROS production in HCAEC and thereby activate p38 in an ROS-dependent manner. High glucose condition increases NADPH oxidase activity in endothelial microparticles that amplify endothelial inflammation and impair endothelial function by promoting activation of the endothelium. These findings provide new insights into the pathogenesis of diabetes-associated atherosclerosis.
Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

PubMed

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
A Hepatocyte-Mimicking Antidote for Alcohol Intoxication.

PubMed

Xu, Duo; Han, Hui; He, Yuxin; Lee, Harrison; Wu, Di; Liu, Fang; Liu, Xiangsheng; Liu, Yang; Lu, Yunfeng; Ji, Cheng

2018-04-11

Alcohol intoxication causes serious diseases, whereas current treatments are mostly supportive and unable to remove alcohol efficiently. Upon alcohol consumption, alcohol is sequentially oxidized to acetaldehyde and acetate by the endogenous alcohol dehydrogenase and aldehyde dehydrogenase, respectively. Inspired by the metabolism of alcohol, a hepatocyte-mimicking antidote for alcohol intoxication through the codelivery of the nanocapsules of alcohol oxidase (AOx), catalase (CAT), and aldehyde dehydrogenase (ALDH) to the liver, where AOx and CAT catalyze the oxidation of alcohol to acetaldehyde, while ALDH catalyzes the oxidation of acetaldehyde to acetate. Administered to alcohol-intoxicated mice, the antidote rapidly accumulates in the liver and enables a significant reduction of the blood alcohol concentration. Moreover, blood acetaldehyde concentration is maintained at an extremely low level, significantly contributing to liver protection. Such an antidote, which can eliminate alcohol and acetaldehyde simultaneously, holds great promise for the treatment of alcohol intoxication and poisoning and can provide therapeutic benefits. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Belief that Alcohol Use Is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

ERIC Educational Resources Information Center

Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

2011-01-01

This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…
Phosphatidylinositol 3-Kinase Plays a Vital Role in Regulation of Rice Seed Vigor via Altering NADPH Oxidase Activity

PubMed Central

Liu, Jian; Zhou, Jun; Xing, Da

2012-01-01

Phosphatidylinositol 3-kinase (PI3K) has been reported to be important in normal plant growth and stress responses. In this study, it was verified that PI3K played a vital role in rice seed germination through regulating NADPH oxidase activity. Suppression of PI3K activity by inhibitors wortmannin or LY294002 could abate the reactive oxygen species (ROS) formation, which resulted in disturbance to the seed germination. And then, the signal cascades that PI3K promoted the ROS liberation was also evaluated. Diphenylene iodonium (DPI), an NADPH oxidase inhibitor, suppressed most of ROS generation in rice seed germination, which suggested that NADPH oxidase was the main source of ROS in this process. Pharmacological experiment and RT-PCR demonstrated that PI3K promoted the expression of Os rboh9. Moreover, functional analysis by native PAGE and the measurement of the 2, 3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazo-lium-5- carboxanilide (XTT) formazan concentration both showed that PI3K promoted the activity of NADPH oxidase. Furthermore, the western blot analysis of OsRac-1 demonstrated that the translocation of Rac-1 from cytoplasm to plasma membrane, which was known as a key factor in the assembly of NADPH oxidase, was suppressed by treatment with PI3K inhibitors, resulting in the decreased activity of NADPH oxidase. Taken together, these data favored the novel conclusion that PI3K regulated NADPH oxidase activity through modulating the recruitment of Rac-1 to plasma membrane and accelerated the process of rice seed germination. PMID:22448275
Tobacco and Alcohol Use in People With Mild/Moderate Intellectual Disabilities: Giving Voice to Their Health Promotion Needs.

PubMed

Kerr, Susan; Lawrence, Maggie; Middleton, Alan R; Fitzsimmons, Lorna; Darbyshire, Christopher

2017-07-01

Concerns have been raised about the use/misuse of tobacco and alcohol by people with mild/moderate intellectual disabilities. Aiming to address an identified gap in the current evidence base, this study sought to gain an understanding of the tobacco- and alcohol-related health promotion needs of this client group. Informed by the principles of social cognitive theory, data were collected using focus group and telephone interviews. Participants were 16 people with intellectual disabilities, two family carers and 15 health and social care professionals. Data were analysed using the Framework approach. Four themes were described: being like others; social and emotional influences; understandings, misunderstandings and learning from experience; and choices and challenges. Reasons for smoking and drinking alcohol echoed those of the general population; however, health promotion needs were more complex (e.g. linked to problems with consequential thinking; low levels of self-efficacy). This article provides insight into the tobacco- and alcohol-related health promotion needs of people with intellectual disabilities. There is a need for integrated service provision that addresses both personal and environmental influences on behaviour. © 2016 John Wiley & Sons Ltd.

Structural and kinetic studies on the Ser101Ala variant of choline oxidase: Catalysis by compromise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finnegan, S.; Orville, A.; Yuan, H.

2010-09-15

The oxidation of choline catalyzed by choline oxidase includes two reductive half-reactions where FAD is reduced by the alcohol substrate and by an aldehyde intermediate transiently formed in the reaction. Each reductive half-reaction is followed by an oxidative half-reaction where the reduced flavin is oxidized by oxygen. Here, we have used mutagenesis to prepare the Ser101Ala mutant of choline oxidase and have investigated the impact of this mutation on the structural and kinetic properties of the enzyme. The crystallographic structure of the Ser101Ala enzyme indicates that the only differences between the mutant and wild-type enzymes are the lack of amore » hydroxyl group on residue 101 and a more planar configuration of the flavin in the mutant enzyme. Kinetics established that replacement of Ser101 with alanine yields a mutant enzyme with increased efficiencies in the oxidative half-reactions and decreased efficiencies in the reductive half-reactions. This is accompanied by a significant decrease in the overall rate of turnover with choline. Thus, this mutation has revealed the importance of a specific residue for the optimization of the overall turnover of choline oxidase, which requires fine-tuning of four consecutive half-reactions for the conversion of an alcohol to a carboxylic acid.« less
Impact on alcohol purchasing of a ban on multi-buy promotions: a quasi-experimental evaluation comparing Scotland with England and Wales

PubMed Central

Nakamura, Ryota; Suhrcke, Marc; Pechey, Rachel; Morciano, Marcello; Roland, Martin; Marteau, Theresa M

2014-01-01

Aims To evaluate the impact of the 2011 Scottish ban on multi-buy promotions of alcohol in retail stores. Design and setting Difference-in-differences analysis was used to estimate the impact of the ban on the volume of alcohol purchased by Scottish households, compared with those in England and Wales, between January 2010 and June 2012. Participants A total of 22 356 households in Scotland, England and Wales. Measurements Records of alcohol purchasing from each of four categories (beer and cider, wine, spirits and flavoured alcoholic beverages), as well as total volume of pure alcohol purchased. Findings Controlling for general time trends and household heterogeneity, there was no significant effect of the multi-buy ban in Scotland on volume of alcohol purchased either for the whole population or for individual socio-economic groups. There was also no significant effect on those who were large pre-ban purchasers of alcohol. Most multi-buys were for beer and cider or for wine. The frequency of shopping trips involving beer and cider purchases increased by 9.2% following the ban (P < 0.01), while the number of products purchased on each trip decreased by 8.1% (P < 0.01). For wine, however, these effects were not significant. Conclusions Banning multi-buy promotions for alcohol in Scotland did not reduce alcohol purchasing in the short term. Wider regulation of price promotion and price may be needed to achieve this. PMID:24251415
Promoting Behavior Change from Alcohol Use through Mobile Technology: The Future of Ecological Momentary Assessment

PubMed Central

Cohn, Amy M.; Hunter-Reel, Dorian; Hagman, Brett T.; Mitchell, Jessica

2011-01-01

Background Interactive and mobile technologies (i.e., smartphones such as Blackberries, iPhones, and palm-top computers) show promise as an efficacious and cost-effective means of communicating health-behavior risks, improving public health outcomes, and accelerating behavior change (Abroms and Maibach, 2008). The present study was conducted as a “needs assessment” to examine the current available mobile smartphone applications (e.g., apps) that utilize principles of ecological momentary assessment (EMA) -- daily self-monitoring or near real-time self-assessment of alcohol use behavior -- to promote positive behavior change, alcohol harm reduction, psycho-education about alcohol use, or abstinence from alcohol. Methods Data were collected and analyzed from iTunes for Apple iPhone©. An inventory assessed the number of available apps that directly addressed alcohol use and consumption, alcohol treatment, or recovery, and whether these apps incorporated empirically-based components of alcohol treatment. Results Findings showed that few apps addressed alcohol use behavior change or recovery. Aside from tracking drinking consumption, a minority utilized empirically-based components of alcohol treatment. Some apps claimed they could serve as an intervention, however no empirical evidence was provided. Conclusions More studies are needed to examine the efficacy of mobile technology in alcohol intervention studies. The large gap between availability of mobile apps and their use in alcohol treatment programs indicate several important future directions for research. PMID:21689119
The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

PubMed

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Existence of a novel enzyme, pyrroloquinoline quinone-dependent polyvinyl alcohol dehydrogenase, in a bacterial symbiont, Pseudomonas sp. strain VM15C.

PubMed Central

Shimao, M; Ninomiya, K; Kuno, O; Kato, N; Sakazawa, C

1986-01-01

A novel enzyme, pyrroloquinoline quinone (PQQ)-dependent polyvinyl alcohol (PVA) dehydrogenase, was found in and partially purified from the membrane fraction of a PVA-degrading symbiont, Pseudomonas sp. strain VM15C. The enzyme required PQQ for PVA dehydrogenation with phenazine methosulfate, phenazine ethosulfate, and 2,6-dichlorophenolindophenol as electron acceptors and did not show PVA oxidase activity leading to H2O2 formation. The enzyme was active toward low-molecular-weight secondary alcohols rather than primary alcohols. A membrane-bound PVA oxidase was also present in cells of VM15C. Although the purified oxidase showed a substrate specificity similar to that of PQQ-dependent PVA dehydrogenase and about threefold-higher PVA-dehydrogenating activity with phenazine methosulfate or phenazine ethosulfate than PVA oxidase activity with H2O2 formation, it was shown that the enzyme does not contain PQQ as the coenzyme, and PQQ did not affect its activity. Incubation of the membrane fraction of cells with PVA caused a reduction in the cytochrome(s) of the fraction. Images PMID:3513704
Impact on alcohol purchasing of a ban on multi-buy promotions: a quasi-experimental evaluation comparing Scotland with England and Wales.

PubMed

Nakamura, Ryota; Suhrcke, Marc; Pechey, Rachel; Morciano, Marcello; Roland, Martin; Marteau, Theresa M

2014-04-01

To evaluate the impact of the 2011 Scottish ban on multi-buy promotions of alcohol in retail stores. Difference-in-differences analysis was used to estimate the impact of the ban on the volume of alcohol purchased by Scottish households, compared with those in England and Wales, between January 2010 and June 2012. A total of 22 356 households in Scotland, England and Wales. Records of alcohol purchasing from each of four categories (beer and cider, wine, spirits and flavoured alcoholic beverages), as well as total volume of pure alcohol purchased. Controlling for general time trends and household heterogeneity, there was no significant effect of the multi-buy ban in Scotland on volume of alcohol purchased either for the whole population or for individual socio-economic groups. There was also no significant effect on those who were large pre-ban purchasers of alcohol. Most multi-buys were for beer and cider or for wine. The frequency of shopping trips involving beer and cider purchases increased by 9.2% following the ban (P < 0.01), while the number of products purchased on each trip decreased by 8.1% (P < 0.01). For wine, however, these effects were not significant. Banning multi-buy promotions for alcohol in Scotland did not reduce alcohol purchasing in the short term. Wider regulation of price promotion and price may be needed to achieve this. © 2013 The Authors. Addiction published by John Wiley & Sons Ltd on behalf of Society for the Study of Addiction.
Promoter engineering of the Saccharomyces cerevisiae RIM15 gene for improvement of alcoholic fermentation rates under stress conditions.

PubMed

Watanabe, Daisuke; Kaneko, Akie; Sugimoto, Yukiko; Ohnuki, Shinsuke; Takagi, Hiroshi; Ohya, Yoshikazu

2017-02-01

A loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-like protein kinase, is one of the major causes of the high alcoholic fermentation rates in Saccharomyces cerevisiae sake strains closely related to Kyokai no. 7 (K7). However, impairment of Rim15p may not be beneficial under more severe fermentation conditions, such as in the late fermentation stage, as it negatively affects stress responses. To balance stress tolerance and fermentation performance, we inserted the promoter of a gluconeogenic gene, PCK1, into the 5'-untranslated region (5'-UTR) of the RIM15 gene in a laboratory strain to achieve repression of RIM15 gene expression in the glucose-rich early stage with its induction in the stressful late stage of alcoholic fermentation. The promoter-engineered strain exhibited a fermentation rate comparable to that of the RIM15-deleted strain with no decrease in cell viability. The engineered strain achieved better alcoholic fermentation performance than the RIM15-deleted strain under repetitive and high-glucose fermentation conditions. These data demonstrated the validity of promoter engineering of the RIM15 gene that governs inhibitory control of alcoholic fermentation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Magazine alcohol advertising compliance with the Australian Alcoholic Beverages Advertising Code.

PubMed

Donovan, Kati; Donovan, Rob; Howat, Peter; Weller, Narelle

2007-01-01

The purpose of this study was to assess the frequency and content of alcoholic beverage advertisements and sales promotions in magazines popular with adolescents and young people in Australia, and assess the extent to which the ads complied with Australia's self-regulatory Alcoholic Beverages Advertising Code (ABAC). Alcohol advertisements and promotions were identified in a sample of 93 magazines popular with young people. The identified items were coded against 28 measures constructed to assess the content of the items against the five sections of the ABAC. Two thirds of the magazines contained at least one alcohol advertisement or promotion with a total of 142 unique items identified: 80 were brand advertisements and 62 were other types of promotional items (i.e. sales promotions, event sponsorships, cross promotions with other marketers and advertorials). It was found that 52% of items appeared to contravene at least one section of the ABAC. The two major apparent breaches related to section B--the items having a strong appeal to adolescents (34%) and to section C--promoting positive social, sexual and psychological expectancies of consumption (28%). It was also found that promotional items appeared to breach the ABAC as often as did advertisements. It is concluded that the self-regulating system appears not to be working for the alcoholic beverages industry in Australia and that increased government surveillance and regulation should be considered, giving particular emphasis to the inclusion of promotional items other than brand advertising.
Alcohol consumption promotes diethylnitrosamine-induced hepatocarcinogenesis in male mice through the activation of the Wnt/Beta-catenin signaling pathway

USDA-ARS?s Scientific Manuscript database

Although alcohol effects within the liver have been extensively studied, the complex mechanisms by which alcohol causes liver cancer are not well understood. It has been suggested that ethanol (EtOH) metabolism promotes tumor growth by increasing hepatocyte proliferation. In this study, we develop...
What should be done about policy on alcohol pricing and promotions? Australian experts' views of policy priorities: a qualitative interview study.

PubMed

Fogarty, Andrea S; Chapman, Simon

2013-06-25

Alcohol policy priorities in Australia have been set by the National Preventative Health Task Force, yet significant reform has not occurred. News media coverage of these priorities has not reported public health experts as in agreement and Government has not acted upon the legislative recommendations made. We investigate policy experts' views on alcohol policy priorities with a view to establishing levels of accord and providing suggestions for future advocates. We conducted semi-structured in depth interviews with alcohol policy experts and advocates around Australia. Open-ended questions examined participants' thoughts on existing policy recommendations, obvious policy priorities and specifically, the future of national reforms to price and promotions policies. All transcripts were analysed for major themes and points of agreement or disagreement. Twenty one alcohol policy experts agreed that pricing policies are a top national priority and most agreed that "something should be done" about alcohol advertising. Volumetric taxation and minimum pricing were regarded as the most important price policies, yet differences emerged in defining the exact form of a proposed volumetric tax. Important differences in perspective emerged regarding alcohol promotions, with lack of agreement about the preferred form regulations should take, where to start and who the policy should be directed at. Very few discussed online advertising and social networks. Despite existing policy collaborations, a clear 'cut through' message is yet to be endorsed by all alcohol control advocates. There is a need to articulate and promote in greater detail the specifics of policy reforms to minimum pricing, volumetric taxation and restrictions on alcohol advertising, particularly regarding sporting sponsorships and new media.
Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Possible interaction between MAOA and DRD2 genes associated with antisocial alcoholism among Han Chinese men in Taiwan.

PubMed

Wang, Tso-Jen; Huang, San-Yuan; Lin, Wei-Wen; Lo, Hsin-Yi; Wu, Pei-Lin; Wang, Yu-Shan; Wu, Yi-Syuan; Ko, Huei-Chen; Shih, Jean-Chen; Lu, Ru-Band

2007-01-30

Both monoamine oxidase A (MAOA) and dopamine D(2) receptor (DRD2) genes have been considered as candidate genes for antisocial personality disorder with alcoholism (Antisocial ALC) [Parsian, A., 1999. Sequence analysis of exon 8 of MAO-A gene in alcoholics with antisocial personality and normal controls. Genomics. 45, 290-295.; Samochowiec, J., Lesch, K.P., Rottmann, M., Smolka, M., Syagailo, Y.V., Okladnova, O., Rommelspacher, H., Winterer, G., Schmidt, L.G., Sander, T., 1999. Association of a regulatory polymorphism in the promoter region of the monoamine oxidase A gene with antisocial alcoholism. Psychiatry. Res. 86, 67-72.; Schmidt, L.vG., Sander, T., Kuhn, S., Smolka, M., Rommelspacher, H., Samochowiec, J., Lesch, K.P., 2000. Different allele distribution of a regulatory MAO-A gene promotor polymorphism in antisocial and anxious-depressive alcoholics. J. Neural .Transm. 107, 681-689.]. However, the association between alcoholism and MAOA or DRD2 gene has not been universally accepted [Lee, J.F., Lu, R.B., Ko, H.C., Chang, F.M., Yin, S.J., Pakstis, A.J., Kidd, K.K., 1999. No association between DRD(2) locus and alcoholism after controlling the ADH and ALDH genotypes in Chinese Han population. Alcohol. Clin. Exp. Res. 23, 592-599.; Lu, R.B., Lin, W.W., Lee, J.F., Ko, H.C., Shih, J.C., 2003. Neither antisocial personality disorder nor antisocial alcoholism association with MAOA gene among Han Chinese males in Taiwan. Alcohol. Clin. Exp. Res. 27, 889-893.]. Since dopamine is metabolized to 3,4-dihydroxyphenyl-acetaldehyde (DOPAL) via monoamine oxidase (MAO) [Westerink, B.H., de Vries, J.B., 1985. On the origin of dopamine and its metabolite in predominantly noradrenergic innervated brain areas. Brain. Res. 330, 164-166.], the interaction between MAOA and DRD2 genes might be related to Antisocial ALC. The present study aimed to determine whether Antisocial ALC might be associated with the possible interactions of DRD2 gene with MAOA gene. Of the 231 Han Chinese
Tobacco and Alcohol Use in People with Mild/Moderate Intellectual Disabilities: Giving Voice to Their Health Promotion Needs

ERIC Educational Resources Information Center

Kerr, Susan; Lawrence, Maggie; Middleton, Alan R.; Fitzsimmons, Lorna; Darbyshire, Christopher

2017-01-01

Background: Concerns have been raised about the use/misuse of tobacco and alcohol by people with mild/moderate intellectual disabilities. Aiming to address an identified gap in the current evidence base, this study sought to gain an understanding of the tobacco- and alcohol-related health promotion needs of this client group. Methods: Informed by…
NADPH oxidase mediates depressive behavior induced by chronic stress in mice.

PubMed

Seo, Ji-Seon; Park, Jin-Young; Choi, Juli; Kim, Tae-Kyung; Shin, Joo-Hyun; Lee, Ja-Kyeong; Han, Pyung-Lim

2012-07-11

Stress is a potent risk factor for depression, yet the underlying mechanism is not clearly understood. In the present study, we explored the mechanism of development and maintenance of depression in a stress-induced animal model. Mice restrained for 2 h daily for 14 d showed distinct depressive behavior, and the altered behavior persisted for >3 months in the absence of intervention. Acute restraint induced a surge of oxidative stress in the brain, and stress-induced oxidative stress progressively increased with repetition of stress. In vitro, the stress hormone glucocorticoid generated superoxide via upregulation of NADPH oxidase. Consistently, repeated restraints increased the expression of the key subunits of NADPH oxidase, p47phox and p67phox, in the brain. Moreover, stressed brains markedly upregulated the expression of p47phox to weak restress evoked in the poststress period, and this molecular response was reminiscent of amplified ROS surge to restress. Pharmacological inhibition of NADPH oxidase by the NADPH oxidase inhibitor apocynin during the stress or poststress period completely blocked depressive behavior. Consistently, heterozygous p47phox knock-out mice (p47phox(+/-)) or molecular inhibition of p47phox with Lenti shRNA-p47phox in the hippocampus suppressed depressive behavior. These results suggest that repeated stress promotes depressive behavior through the upregulation of NADPH oxidase and the resultant metabolic oxidative stress, and that the inhibition of NADPH oxidase provides beneficial antidepression effects.
Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

PubMed

Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

2015-02-01

To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.
Changes in the methylation status of DAT, SERT, and MeCP2 gene promoters in the blood cell in families exposed to alcohol during the periconceptional period.

PubMed

Lee, Bom-Yi; Park, So-Yeon; Ryu, Hyun-Mee; Shin, Chan-Young; Ko, Ki-Nam; Han, Jung-Yeol; Koren, Gideon; Cho, Youl-Hee

2015-02-01

Alcohol exposure has been shown to cause devastating effects on neurobehavioral development in numerous animal and human studies. The alteration of DNA methylation levels in gene-specific promoter regions has been investigated in some studies of human alcoholics. This study was aimed to investigate whether social alcohol consumption during periconceptional period is associated with epigenetic alteration and its generational transmission in the blood cells. We investigated patterns of alcohol intake in a prospective cohort of 355 pairs of pregnant women and their spouses who reported alcohol intake during the periconceptional period. A subpopulation of 164 families was established for the epigenetic study based on the availability of peripheral blood and cord blood DNA. The relative methylation changes of dopamine transporter (DAT), serotonin transporter (SERT), and methyl CpG binding protein 2 (MeCP2) gene promoters were analyzed using methylation-specific endonuclease digestion followed by quantitative real-time polymerase chain reaction. The relative methylation level of the DAT gene promoter was decreased in the group of mothers reporting above moderate drinking (p = 0.029) and binge drinking (p = 0.037) during pregnancy. The relative methylation level of the DAT promoter was decreased in the group of fathers reporting heavy binge drinking (p = 0.003). The relative methylation levels of the SERT gene promoter were decreased in the group of newborns of light drinking mothers before pregnancy (p = 0.012) and during pregnancy (p = 0.003). The methylation level in the MeCP2 promoter region of babies whose mothers reported above moderate drinking during pregnancy was increased (p = 0.02). In addition, methylation pattern in the DAT promoter region of babies whose fathers reported heavy binge drinking was decreased (p = 0.049). These findings suggest that periconceptional alcohol intake may cause epigenetic changes in specific locus of parental and
Regulation of the nitric oxide oxidase activity of myeloperoxidase by pharmacological agents.

PubMed

Maiocchi, Sophie L; Morris, Jonathan C; Rees, Martin D; Thomas, Shane R

2017-07-01

The leukocyte-derived heme enzyme myeloperoxidase (MPO) is released extracellularly during inflammation and impairs nitric oxide (NO) bioavailability by directly oxidizing NO or producing NO-consuming substrate radicals. Here, structurally diverse pharmacological agents with activities as MPO substrates/inhibitors or antioxidants were screened for their effects on MPO NO oxidase activity in human plasma and physiological model systems containing endogenous MPO substrates/antioxidants (tyrosine, urate, ascorbate). Hydrazide-based irreversible/reversible MPO inhibitors (4-ABAH, isoniazid) or the sickle cell anaemia drug, hydroxyurea, all promoted MPO NO oxidase activity. This involved the capacity of NO to antagonize MPO inhibition by hydrazide-derived radicals and/or the ability of drug-derived radicals to stimulate MPO turnover thereby increasing NO consumption by MPO redox intermediates or NO-consuming radicals. In contrast, the mechanism-based irreversible MPO inhibitor 2-thioxanthine, potently inhibited MPO turnover and NO consumption. Although the phenolics acetaminophen and resveratrol initially increased MPO turnover and NO consumption, they limited the overall extent of NO loss by rapidly depleting H 2 O 2 and promoting the formation of ascorbyl radicals, which inefficiently consume NO. The vitamin E analogue trolox inhibited MPO NO oxidase activity in ascorbate-depleted fluids by scavenging NO-consuming tyrosyl and urate radicals. Tempol and related nitroxides decreased NO consumption in ascorbate-replete fluids by scavenging MPO-derived ascorbyl radicals. Indoles or apocynin yielded marginal effects. Kinetic analyses rationalized differences in drug activities and identified criteria for the improved inhibition of MPO NO oxidase activity. This study reveals that widely used agents have important implications for MPO NO oxidase activity under physiological conditions, highlighting new pharmacological strategies for preserving NO bioavailability during
Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T

PubMed Central

Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong

2016-01-01

Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324
What should be done about policy on alcohol pricing and promotions? Australian experts’ views of policy priorities: a qualitative interview study

PubMed Central

2013-01-01

Background Alcohol policy priorities in Australia have been set by the National Preventative Health Task Force, yet significant reform has not occurred. News media coverage of these priorities has not reported public health experts as in agreement and Government has not acted upon the legislative recommendations made. We investigate policy experts’ views on alcohol policy priorities with a view to establishing levels of accord and providing suggestions for future advocates. Methods We conducted semi-structured in depth interviews with alcohol policy experts and advocates around Australia. Open-ended questions examined participants’ thoughts on existing policy recommendations, obvious policy priorities and specifically, the future of national reforms to price and promotions policies. All transcripts were analysed for major themes and points of agreement or disagreement. Results Twenty one alcohol policy experts agreed that pricing policies are a top national priority and most agreed that “something should be done” about alcohol advertising. Volumetric taxation and minimum pricing were regarded as the most important price policies, yet differences emerged in defining the exact form of a proposed volumetric tax. Important differences in perspective emerged regarding alcohol promotions, with lack of agreement about the preferred form regulations should take, where to start and who the policy should be directed at. Very few discussed online advertising and social networks. Conclusions Despite existing policy collaborations, a clear ‘cut through’ message is yet to be endorsed by all alcohol control advocates. There is a need to articulate and promote in greater detail the specifics of policy reforms to minimum pricing, volumetric taxation and restrictions on alcohol advertising, particularly regarding sporting sponsorships and new media. PMID:23800324

The use of glucose oxidase and catalase for the enzymatic reduction of the potential ethanol content in wine.

PubMed

Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred

2016-11-01

Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. Copyright © 2016. Published by Elsevier Ltd.
[Activation of the alternative oxidase of Yarrowia lipolytica by adenosine 5'-monophosphate].

PubMed

Medentsev, A G; Arinbasarova, A Iu; Smirnova, N M; Akimenko, V K

2004-01-01

The study of the effect of nucleoside phosphates on the activity of cyanide-resistant oxidase in the mitochondria and the submitochondrial particles of Yarrowia lipolytica showed that adenosine monophosphate (5'-AMP, AMP) did not stimulate the respiration of the intact mitochondria. The incubation of the mitochondria at room temperature (25 degrees C) for 3-5 h or their treatment with ultrasound, phospholipase A, and detergent Triton X-100 at a low temperature inactivated the cyanide-resistant alternative oxidase. The inactivated alternative oxidase could be reactivated by AMP. The reactivating effect of AMP was enhanced by azolectin. Some other nucleoside phosphates also showed reactivating ability in the following descending order. AMP = GMP > GDP > GTP > XMP > IMP. The apparent reaction rate constant Km for AMP upon the reactivation of the alternative oxidase of mitochondria treated with Triton X-100 or incubated at 25 degrees C was 12.5 and 20 microM, respectively. The Km for AMP upon the reactivation of the alternative oxidase of submitochondrial particles was 15 microM. During the incubation of yeast cells under conditions promoting the development of alternative oxidase, the content of adenine nucleotides (AMP, ADP, and ATP) in the cells and their respiration tended to decrease. The subsequent addition of cyanide to the cells activated their respiration, diminished the intracellular content of ATP three times, and augmented the content of AMP five times. These data suggest that the stimulation of cell respiration by cyanide may be due to the activation of alternative oxidase by AMP.
The urban environment of alcohol: a study on the availability, promotion and visibility of its use in the neighborhoods of Barcelona.

PubMed

Villalbí, Joan R; Espelt, Albert; Sureda, Xisca; Bosque-Prous, Marina; Teixidó-Compañó, Ester; Puigcorbé, Susanna; Franco, Manuel; Brugal, M Teresa

2018-01-15

This paper describes the presence of alcohol in the public space, assessing establishments that offer it, its advertising, and signs of consumption, as factors that may influence its consumption. Descriptive observational study based on cluster sampling with two-step selection. Results are described, and the spatial association between variables is assessed. In the 20 census tracts studied, 306 premises were identified that offered alcoholic beverages: 204 were on-premises and 102 were off-premises, mainly supermarkets and food retail stores. Their spatial distribution was uneven, concentrated in two central districts. We identified 72 publicity items, mostly sponsorship of musical events. There were many promotional items linked to on- premises, especially in their terraces. Five people were detected promoting consumption or selling alcohol in the Old Town. In each time slot, between 39 and 51 signs of consumption on the public space were observed (mostly abandoned beer cans), more frequent at night and in the Old Town. There is an association between the presence of establishments that offer alcohol and advertising. There is no relationship between these variables and signs of consumption in the public space; these are concentrated in the Old Town, which has greater presence of tourism. The urban environment is characterized by elements that stimulate alcohol use and its distribution is uneven, with a strong influence of tourism-related activities. Further regulation of alcohol promotion, availability and consumption in the public space may change its social image and decrease its use.
NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

PubMed

Vlahos, Ross; Selemidis, Stavros

2014-12-01

Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Nox4 NADPH oxidase-derived reactive oxygen species, via endogenous carbon monoxide, promote survival of brain endothelial cells during TNF-α-induced apoptosis

PubMed Central

Basuroy, Shyamali; Tcheranova, Dilyara; Bhattacharya, Sujoy; Leffler, Charles W.

2011-01-01

We investigated the role of reactive oxygen species (ROS) in promoting cell survival during oxidative stress induced by the inflammatory mediator tumor necrosis factor-α (TNF-α) in cerebral microvascular endothelial cells (CMVEC) from newborn piglets. Nox4 is the major isoform of NADPH oxidase responsible for TNF-α-induced oxidative stress and apoptosis in CMVEC. We present novel data that Nox4 NADPH oxidase-derived ROS also initiate a cell survival mechanism by increasing production of a gaseous antioxidant mediator carbon monoxide (CO) by constitutive heme oxygenase-2 (HO-2). TNF-α rapidly enhanced endogenous CO production in a superoxide- and NADPH oxidase-dependent manner in CMVEC with innate, but not with small interfering RNA (siRNA)-downregulated Nox4 activity. CORM-A1, a CO-releasing compound, inhibited Nox4-mediated ROS production and enhanced cell survival in TNF-α-challenged CMVEC. The ROS-induced CO-mediated survival mechanism requires functional interactions between the protein kinase B/Akt and extracellular signal-related kinase (ERK)/p38 MAPK signaling pathways activated by TNF-α. In Akt siRNA-transfected CMVEC and in cells with pharmacologically inhibited Akt, Erk1/2, and p38 mitogen-activated protein kinase (MAPK) activities, CORM-A1 was no longer capable of blocking Nox4 activation and apoptosis caused by TNF-α. Overall, Nox4 NADPH oxidase-derived ROS initiate both death and survival pathways in TNF-α-challenged CMVEC. The ROS-dependent cell survival pathway is mediated by an endogenous antioxidant CO, which inhibits Nox4 activation via a mechanism that includes Akt, ERK1/2, and p38 MAPK signaling pathways. The ability of CO to inhibit TNF-α-induced ERK1/2 and p38 MAPK activities in an Akt-dependent manner appears to be the key element in ROS-dependent survival of endothelial cells during TNF-α-mediated brain inflammatory disease. PMID:21123734
A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.

PubMed Central

Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J

1996-01-01

The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115
Molecular characterization of the fatty alcohol oxidation pathway for wax-ester mobilization in germinated jojoba seeds

USDA-ARS?s Scientific Manuscript database

Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WE) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very long-chain fatty alcohols, which must be oxidised to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and ...
Apoptosis of enterocytes and nitration of junctional complex proteins promote alcohol-induced gut leakiness and liver injury.

PubMed

Cho, Young-Eun; Yu, Li-Rong; Abdelmegeed, Mohamed A; Yoo, Seong-Ho; Song, Byoung-Joon

2018-07-01

junctional complex proteins, in promoting binge alcohol-induced gut leakiness and endotoxemia, contributing to inflammatory liver disease. Binge alcohol exposure causes gut leakiness, contributing to increased endotoxemia and inflammatory liver injury. Our results demonstrated for the first time the critical roles of apoptosis of enterocytes and nitration followed by ubiquitin-dependent proteolytic degradation of the junctional complex proteins in promoting this gut leakiness and endotoxemia. These results provide insight into the molecular mechanisms of alcohol-induced inflammatory liver disease. Published by Elsevier B.V.
Rationally engineered flavin-dependent oxidase reveals steric control of dioxygen reduction.

PubMed

Zafred, Domen; Steiner, Barbara; Teufelberger, Andrea R; Hromic, Altijana; Karplus, P Andrew; Schofield, Christopher J; Wallner, Silvia; Macheroux, Peter

2015-08-01

The ability of flavoenzymes to reduce dioxygen varies greatly, and is controlled by the protein environment, which may cause either a rapid reaction (oxidases) or a sluggish reaction (dehydrogenases). Previously, a 'gatekeeper' amino acid residue was identified that controls the reactivity to dioxygen in proteins from the vanillyl alcohol oxidase superfamily of flavoenzymes. We have identified an alternative gatekeeper residue that similarly controls dioxygen reactivity in the grass pollen allergen Phl p 4, a member of this superfamily that has glucose dehydrogenase activity and the highest redox potential measured in a flavoenzyme. A substitution at the alternative gatekeeper site (I153V) transformed the enzyme into an efficient oxidase by increasing dioxygen reactivity by a factor of 60,000. An inverse exchange (V169I) in the structurally related berberine bridge enzyme (BBE) decreased its dioxygen reactivity by a factor of 500. Structural and biochemical characterization of these and additional variants showed that our model enzymes possess a cavity that binds an anion and resembles the 'oxyanion hole' in the proximity of the flavin ring. We showed also that steric control of access to this site is the most important parameter affecting dioxygen reactivity in BBE-like enzymes. Analysis of flavin-dependent oxidases from other superfamilies revealed similar structural features, suggesting that dioxygen reactivity may be governed by a common mechanistic principle. Structural data are available in PDB database under the accession numbers 4PVE, 4PVH, 4PVJ, 4PVK, 4PWB, 4PWC and 4PZF. © 2015 FEBS.
Chronic alcohol intake promotes tumor growth in a diethylnitrosamine-induced hepatocarcinogenesis mouse model through increased Wnt/Beta-catenin signaling

USDA-ARS?s Scientific Manuscript database

Ethanol (EtOH) metabolism is involved in both initiating and promoting mechanisms in hepatocellular carcinoma progression in chronic alcoholics. In this study, we developed a mouse model to test the hypothesis that chronic EtOH consumption promotes tumor growth irrespective of EtOH-related initiati...
Spermine oxidase maintains basal skeletal muscle gene expression and fiber size and is strongly repressed by conditions that cause skeletal muscle atrophy

PubMed Central

Bongers, Kale S.; Fox, Daniel K.; Kunkel, Steven D.; Stebounova, Larissa V.; Murry, Daryl J.; Pufall, Miles A.; Ebert, Scott M.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.

2014-01-01

Skeletal muscle atrophy is a common and debilitating condition that remains poorly understood at the molecular level. To better understand the mechanisms of muscle atrophy, we used mouse models to search for a skeletal muscle protein that helps to maintain muscle mass and is specifically lost during muscle atrophy. We discovered that diverse causes of muscle atrophy (limb immobilization, fasting, muscle denervation, and aging) strongly reduced expression of the enzyme spermine oxidase. Importantly, a reduction in spermine oxidase was sufficient to induce muscle fiber atrophy. Conversely, forced expression of spermine oxidase increased muscle fiber size in multiple models of muscle atrophy (immobilization, fasting, and denervation). Interestingly, the reduction of spermine oxidase during muscle atrophy was mediated by p21, a protein that is highly induced during muscle atrophy and actively promotes muscle atrophy. In addition, we found that spermine oxidase decreased skeletal muscle mRNAs that promote muscle atrophy (e.g., myogenin) and increased mRNAs that help to maintain muscle mass (e.g., mitofusin-2). Thus, in healthy skeletal muscle, a relatively low level of p21 permits expression of spermine oxidase, which helps to maintain basal muscle gene expression and fiber size; conversely, during conditions that cause muscle atrophy, p21 expression rises, leading to reduced spermine oxidase expression, disruption of basal muscle gene expression, and muscle fiber atrophy. Collectively, these results identify spermine oxidase as an important positive regulator of muscle gene expression and fiber size, and elucidate p21-mediated repression of spermine oxidase as a key step in the pathogenesis of skeletal muscle atrophy. PMID:25406264
Regulating NETosis: Increasing pH Promotes NADPH Oxidase-Dependent NETosis

PubMed Central

Khan, Meraj A.; Philip, Lijy M.; Cheung, Guillaume; Vadakepeedika, Shawn; Grasemann, Hartmut; Sweezey, Neil; Palaniyar, Nades

2018-01-01

Neutrophils migrating from the blood (pH 7.35–7.45) into the surrounding tissues encounter changes in extracellular pH (pHe) conditions. Upon activation of NADPH oxidase 2 (Nox), neutrophils generate large amounts of H+ ions reducing the intracellular pH (pHi). Nevertheless, how extracellular pH regulates neutrophil extracellular trap (NET) formation (NETosis) is not clearly established. We hypothesized that increasing pH increases Nox-mediated production of reactive oxygen species (ROS) and neutrophil protease activity, stimulating NETosis. Here, we found that raising pHe (ranging from 6.6 to 7.8; every 0.2 units) increased pHi of both activated and resting neutrophils within 10–20 min (Seminaphtharhodafluor dual fluorescence measurements). Since Nox activity generates H+ ions, pHi is lower in neutrophils that are activated compared to resting. We also found that higher pH stimulated Nox-dependent ROS production (R123 generation; flow cytometry, plate reader assay, and imaging) during spontaneous and phorbol myristate acetate-induced NETosis (Sytox Green assays, immunoconfocal microscopy, and quantifying NETs). In neutrophils that are activated and not resting, higher pH stimulated histone H4 cleavage (Western blots) and NETosis. Raising pH increased Escherichia coli lipopolysaccharide-, Pseudomonas aeruginosa (Gram-negative)-, and Staphylococcus aureus (Gram-positive)-induced NETosis. Thus, higher pHe promoted Nox-dependent ROS production, protease activity, and NETosis; lower pH has the opposite effect. These studies provided mechanistic steps of pHe-mediated regulation of Nox-dependent NETosis. Raising pH either by sodium bicarbonate or Tris base (clinically known as Tris hydroxymethyl aminomethane, tromethamine, or THAM) increases NETosis. Each Tris molecule can bind 3H+ ions, whereas each bicarbonate HCO3− ion binds 1H+ ion. Therefore, the amount of Tris solution required to cause the same increase in pH level is less than that of equimolar
Regulating NETosis: Increasing pH Promotes NADPH Oxidase-Dependent NETosis.

PubMed

Khan, Meraj A; Philip, Lijy M; Cheung, Guillaume; Vadakepeedika, Shawn; Grasemann, Hartmut; Sweezey, Neil; Palaniyar, Nades

2018-01-01

Neutrophils migrating from the blood (pH 7.35-7.45) into the surrounding tissues encounter changes in extracellular pH (pH e ) conditions. Upon activation of NADPH oxidase 2 (Nox), neutrophils generate large amounts of H + ions reducing the intracellular pH (pH i ). Nevertheless, how extracellular pH regulates neutrophil extracellular trap (NET) formation (NETosis) is not clearly established. We hypothesized that increasing pH increases Nox-mediated production of reactive oxygen species (ROS) and neutrophil protease activity, stimulating NETosis. Here, we found that raising pH e (ranging from 6.6 to 7.8; every 0.2 units) increased pH i of both activated and resting neutrophils within 10-20 min (Seminaphtharhodafluor dual fluorescence measurements). Since Nox activity generates H + ions, pH i is lower in neutrophils that are activated compared to resting. We also found that higher pH stimulated Nox-dependent ROS production (R123 generation; flow cytometry, plate reader assay, and imaging) during spontaneous and phorbol myristate acetate-induced NETosis (Sytox Green assays, immunoconfocal microscopy, and quantifying NETs). In neutrophils that are activated and not resting, higher pH stimulated histone H4 cleavage (Western blots) and NETosis. Raising pH increased Escherichia coli lipopolysaccharide-, Pseudomonas aeruginosa (Gram-negative)-, and Staphylococcus aureus (Gram-positive)-induced NETosis. Thus, higher pH e promoted Nox-dependent ROS production, protease activity, and NETosis; lower pH has the opposite effect. These studies provided mechanistic steps of pH e -mediated regulation of Nox-dependent NETosis. Raising pH either by sodium bicarbonate or Tris base (clinically known as Tris hydroxymethyl aminomethane, tromethamine, or THAM) increases NETosis. Each Tris molecule can bind 3H + ions, whereas each bicarbonate HCO3 - ion binds 1H + ion. Therefore, the amount of Tris solution required to cause the same increase in pH level is less than that of equimolar
Functional expression of aryl-alcohol oxidase in Saccharomyces cerevisiae and Pichia pastoris by directed evolution.

PubMed

Viña-Gonzalez, Javier; Elbl, Katarina; Ponte, Xavier; Valero, Francisco; Alcalde, Miguel

2018-07-01

Aryl-alcohol oxidase (AAO) plays a fundamental role in the fungal ligninolytic secretome, acting as a supplier of H 2 O 2 . Despite its highly selective mechanism of action, the presence of this flavooxidase in different biotechnological settings has hitherto been hampered by the lack of appropriate heterologous expression systems. We recently described the functional expression of the AAO from Pleurotus eryngii in Saccharomyces cerevisiae by fusing a chimeric signal peptide (preαproK) and applying structure-guided evolution. Here, we have obtained an AAO secretion variant that is readily expressed in S. cerevisiae and overproduced in Pichia pastoris. First, the functional expression of AAO in S. cerevisiae was enhanced through the in vivo shuffling of a panel of secretion variants, followed by the focused evolution of the preαproK peptide. The outcome of this evolutionary campaign-an expression variant that accumulated 4 mutations in the chimeric signal peptide, plus two mutations in the mature protein- showed 350-fold improved secretion (4.5 mg/L) and was stable. This secretion mutant was cloned into P. pastoris and fermented in a fed-batch bioreactor to enhance production to 25 mg/L. While both recombinant AAO from S. cerevisiae and P. pastoris were subjected to the same N-terminal processing and had a similar pH activity profile, they differed in their kinetic parameters and thermostability. The strong glycosylation observed in the evolved AAO from S. cerevisiae underpinned this effect, since when the mutant was produced in the glycosylation-deficient S. cerevisiae strain Δkre2, its kinetic parameters and thermostability were comparable to its poorly glycosylated P. pastoris recombinant counterpart. © 2018 Wiley Periodicals, Inc.
Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

PubMed Central

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
Direct comparison of gluco-oligosaccharide oxidase variants and glucose oxidase: substrate range and H2O2 stability.

PubMed

Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R

2016-11-21

Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.
The role of multifamily therapy in promoting retention in treatment of alcohol and cocaine dependence.

PubMed

Conner, K R; Shea, R R; McDermott, M P; Grolling, R; Tocco, R V; Baciewicz, G

1998-01-01

The authors present a model for incorporating multifamily therapy in the treatment of chemical dependency and investigate the association of family participation in multifamily therapy group with treatment retention in a sample of 164 alcohol- and/or cocaine-dependent outpatients. Results indicate that level of family attendance at a multifamily group strongly predicted completion of short-term and long-term out-patient treatment. Effects were greater for cocaine-dependent than for alcohol-dependent subjects in analyses of short-term treatment retention. Multifamily therapy may be a powerful method to engage patients families in treatment and promote treatment retention, especially in the early, intensive phases of treatment for cocaine dependency.
Early adolescent adversity inflates threat estimation in females and promotes alcohol use initiation in both sexes.

PubMed

Walker, Rachel A; Andreansky, Christopher; Ray, Madelyn H; McDannald, Michael A

2018-06-01

Childhood adversity is associated with exaggerated threat processing and earlier alcohol use initiation. Conclusive links remain elusive, as childhood adversity typically co-occurs with detrimental socioeconomic factors, and its impact is likely moderated by biological sex. To unravel the complex relationships among childhood adversity, sex, threat estimation, and alcohol use initiation, we exposed female and male Long-Evans rats to early adolescent adversity (EAA). In adulthood, >50 days following the last adverse experience, threat estimation was assessed using a novel fear discrimination procedure in which cues predict a unique probability of footshock: danger (p = 1.00), uncertainty (p = .25), and safety (p = .00). Alcohol use initiation was assessed using voluntary access to 20% ethanol, >90 days following the last adverse experience. During development, EAA slowed body weight gain in both females and males. In adulthood, EAA selectively inflated female threat estimation, exaggerating fear to uncertainty and safety, but promoted alcohol use initiation across sexes. Meaningful relationships between threat estimation and alcohol use initiation were not observed, underscoring the independent effects of EAA. Results isolate the contribution of EAA to adult threat estimation, alcohol use initiation, and reveal moderation by biological sex. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Analysis of promoter polymorphism in monoamine oxidase A (MAOA) gene in completed suicide on Slovenian population.

PubMed

Uršič, Katarina; Zupanc, Tomaž; Paska, Alja Videtič

2018-04-23

Suicide is a well-defined public health problem and is a complex phenomenon influenced by a number of different risk factors, including genetic ones. Numerous studies have examined serotonin system genes. Monoamine oxidase A (MAO-A) is an outer mitochondrial membrane enzyme which is involved in the metabolic pathway of serotonin degradation. Upstream variable number of tandem repeats (uVNTR) in the promoter region of MAOA gene affects the activity of transcription. In the present study we genotyped MAOA-uVNTR polymorphism in 266 suicide victims and 191 control subjects of Slovenian population, which ranks among the European and world populations with the highest suicide rate. Genotyping was performed with polymerase chain reaction and agarose gel electrophoresis. Using a separate statistical analysis for female and male subjects we determined the differences in genotype distributions of MAOA-uVNTR polymorphism between the studied groups. Statistical analysis showed a trend towards 3R allele and suicide, and associated 3R allele with non-violent suicide method on stratified data (20 suicide victims). This is the first study associating highly suicidal Slovenian population with MAOA-uVNTR polymorphism. Copyright © 2018 Elsevier B.V. All rights reserved.
NADPH oxidase inhibitors: a patent review.

PubMed

Kim, Jung-Ae; Neupane, Ganesh Prasad; Lee, Eung Seok; Jeong, Byeong-Seon; Park, Byung Chul; Thapa, Pritam

2011-08-01

NADPH oxidases, a family of multi-subunit enzyme complexes, catalyze the production of reactive oxygen species (ROS), which may contribute to the pathogenesis of a variety of diseases. In addition to the first NADPH oxidase found in phagocytes, four non-phagocytic NADPH oxidase isoforms have been identified, which all differ in their catalytic subunit (Nox1-5) and tissue distribution. This paper provides a comprehensive review of the patent literature on NADPH oxidase inhibitors, small molecule Nox inhibitors, peptides and siRNAs. Since each member of the NADPH oxidase family has great potential as a therapeutic target, several different compounds have been registered as NADPH oxidase inhibitors in the patent literature. As yet, none have gone through clinical trials, and some have not completed preclinical trials, including safety and specificity evaluation. Recently, small molecule pyrazolopyridine and triazolopyrimidine derivatives have been submitted as potent NADPH oxidase inhibitors and reported as first-in-class inhibitors for idiopathic pulmonary fibrosis and acute stroke, respectively. Further clinical efficacy and safety data are warranted to prove their actual clinical utility.

Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

PubMed Central

Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

2001-01-01

We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947
A benzoxazine derivative induces vascular endothelial cell apoptosis in the presence of fibroblast growth factor-2 by elevating NADPH oxidase activity and reactive oxygen species levels.

PubMed

Zhao, Jing; He, Qiuxia; Cheng, Yizhe; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying

2009-09-01

Previously, we found that 6,8-dichloro-2,3-dihydro-3-hydroxymethyl-1,4-benzoxazine (DBO) promoted apoptosis of human umbilical vascular endothelial cells (HUVECs) deprived of growth factors. In this study, we aimed to investigate the effect of DBO and its mechanism of action on angiogenesis and apoptosis of HUVECs in the presence of fibroblast growth factor-2 (FGF-2), which promotes angiogenesis and inhibits apoptosis in vivo and in vitro. DBO significantly inhibited capillary-like tube formation by promoting apoptosis of HUVECs in the presence of FGF-2 in vitro. Furthermore, DBO elevated the levels of reactive oxygen species (ROS) and nitric oxide (NO) and increased the activity of NADPH oxidase and inducible nitric oxide synthase (iNOS) in promoting apoptosis under this condition. Moreover, when NADPH oxidase was inhibited by its specific inhibitor, dibenziodolium chloride (DPI), DBO could not elevate ROS and NO levels in HUVECs. The data suggest that DBO is a new modulator of apoptosis in vitro, and it might function by increasing the activity of NADPH oxidase and iNOS, subsequently elevating the levels of ROS and NO in HUVECs. The findings of this study provide a new small molecule for investigating the FGF-2/NADPH oxidase/iNOS signaling pathway in apoptosis.
Lysyl oxidase-like-2 promotes tumour angiogenesis and is a potential therapeutic target in angiogenic tumours.

PubMed

Zaffryar-Eilot, Shelly; Marshall, Derek; Voloshin, Tali; Bar-Zion, Avinoam; Spangler, Rhyannon; Kessler, Ofra; Ghermazien, Haben; Brekhman, Vera; Suss-Toby, Edith; Adam, Dan; Shaked, Yuval; Smith, Victoria; Neufeld, Gera

2013-10-01

Lysyl oxidase-like 2 (LOXL2), a secreted enzyme that catalyzes the cross-linking of collagen, plays an essential role in developmental angiogenesis. We found that administration of the LOXL2-neutralizing antibody AB0023 inhibited bFGF-induced angiogenesis in Matrigel plug assays and suppressed recruitment of angiogenesis promoting bone marrow cells. Small hairpin RNA-mediated inhibition of LOXL2 expression or inhibition of LOXL2 using AB0023 reduced the migration and network-forming ability of endothelial cells, suggesting that the inhibition of angiogenesis results from a direct effect on endothelial cells. To examine the effects of AB0023 on tumour angiogenesis, AB0023 was administered to mice bearing tumours derived from SKOV-3 ovarian carcinoma or Lewis lung carcinoma (LLC) cells. AB0023 treatment significantly reduced the microvascular density in these tumours but did not inhibit tumour growth. However, treatment of mice bearing SKOV-3-derived tumours with AB0023 also promoted increased coverage of tumour vessels with pericytes and reduced tumour hypoxia, providing evidence that anti-LOXL2 therapy results in the normalization of tumour blood vessels. In agreement with these data, treatment of mice bearing LLC-derived tumours with AB0023 improved the perfusion of the tumour-associated vessels as determined by ultrasonography. Improved perfusion and normalization of tumour vessels after treatment with anti-angiogenic agents were previously found to improve the delivery of chemotherapeutic agents into tumours and to result in an enhancement of chemotherapeutic efficiency. Indeed, treatment with AB0023 significantly enhanced the anti-tumourigenic effects of taxol. Our results suggest that inhibition of LOXL2 may prove beneficial for the treatment of angiogenic tumours.
Pharmacological promotion of autophagy alleviates steatosis and injury in alcoholic and non-alcoholic fatty liver conditions in mice.

PubMed

Lin, Chih-Wen; Zhang, Hao; Li, Min; Xiong, Xiwen; Chen, Xi; Chen, Xiaoyun; Dong, Xiaocheng C; Yin, Xiao-Ming

2013-05-01

Pharmacological approaches can potentially improve fatty liver condition in alcoholic and non-alcoholic fatty liver diseases. The salutary effects of reducing lipid synthesis or promoting lipid oxidation have been well reported, but the benefits of increasing lipid degradation have yet to be well explored. Macroautophagy is a cellular degradation process that can remove subcellular organelles including lipid droplets. We thus investigated whether pharmacological modulation of macroautophagy could be an effective approach to alleviate fatty liver condition and liver injury. C57BL/6 mice were given ethanol via intraperitoneal injection (acute) or by a 4-week oral feeding regime (chronic), or high fat diet for 12 weeks. An autophagy enhancer, carbamazepine or rapamycin, or an autophagy inhibitor, chloroquine, was given before sacrifice. Activation of autophagy, level of hepatic steatosis, and blood levels of triglycerides, liver enzyme, glucose and insulin were measured. In both acute and chronic ethanol condition, macroautophagy was activated. Carbamazepine, as well as rapamycin, enhanced ethanol-induced macroautophagy in hepatocytes in vitro and in vivo. Hepatic steatosis and liver injury were exacerbated by chloroquine, but alleviated by carbamazepine. The protective effects of carbamazepine and rapamycin in reducing steatosis and in improving insulin sensitivity were also demonstrated in high fat diet-induced non-alcoholic fatty liver condition. These findings indicate that pharmacological modulation of macroautophagy in the liver can be an effective strategy for reducing fatty liver condition and liver injury. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
NADPH oxidase 4 limits bone mass by promoting osteoclastogenesis

PubMed Central

Goettsch, Claudia; Babelova, Andrea; Trummer, Olivia; Erben, Reinhold G.; Rauner, Martina; Rammelt, Stefan; Weissmann, Norbert; Weinberger, Valeska; Benkhoff, Sebastian; Kampschulte, Marian; Obermayer-Pietsch, Barbara; Hofbauer, Lorenz C.; Brandes, Ralf P.; Schröder, Katrin

2013-01-01

ROS are implicated in bone diseases. NADPH oxidase 4 (NOX4), a constitutively active enzymatic source of ROS, may contribute to the development of such disorders. Therefore, we studied the role of NOX4 in bone homeostasis. Nox4–/– mice displayed higher bone density and reduced numbers and markers of osteoclasts. Ex vivo, differentiation of monocytes into osteoclasts with RANKL and M-CSF induced Nox4 expression. Loss of NOX4 activity attenuated osteoclastogenesis, which was accompanied by impaired activation of RANKL-induced NFATc1 and c-JUN. In an in vivo model of murine ovariectomy–induced osteoporosis, pharmacological inhibition or acute genetic knockdown of Nox4 mitigated loss of trabecular bone. Human bone obtained from patients with increased osteoclast activity exhibited increased NOX4 expression. Moreover, a SNP of NOX4 was associated with elevated circulating markers of bone turnover and reduced bone density in women. Thus, NOX4 is involved in bone loss and represents a potential therapeutic target for the treatment of osteoporosis. PMID:24216508
Use of marketing to disseminate brief alcohol intervention to general practitioners: promoting health care interventions to health promoters.

PubMed

Lock, C A; Kaner, E F

2000-11-01

Health research findings are of little benefit to patients or society if they do not reach the audience they are intended to influence. Thus, a dissemination strategy is needed to target new findings at its user group and encourage a process of consideration and adoption or rejection. Social marketing techniques can be utilized to aid successful dissemination of research findings and to speed the process by which new information reaches practice. Principles of social marketing include manipulating the marketing mix of product, price, place and promotion. This paper describes the development of a marketing approach and the outcomes from a trial evaluating the effectiveness and cost-effectiveness of manipulating promotional strategies to disseminate actively a screening and brief alcohol intervention (SBI) programme to general practitioners (GPs). The promotional strategies consisted of postal marketing, telemarketing and personal marketing. The study took place in general practices across the Northern and Yorkshire Regional Health Authority. Of the 614 GPs eligible for the study, one per practice, 321 (52%) took the programme and of those available to use it for 3 months (315), 128 (41%) actively considered doing so, 73 (23%) actually went on to use it. Analysis of the specific impact of the three different promotional strategies revealed that while personal marketing was the most effective overall dissemination and implementation strategy, telemarketing was more cost-effective. The findings of our work show that using a marketing approach is promising for conveying research findings to GPs and in particular a focus on promotional strategies can facilitate high levels of uptake and consideration in this target group.
Targeting NADPH oxidases in vascular pharmacology

PubMed Central

Schramm, Agata; Matusik, Paweł; Osmenda, Grzegorz; Guzik, Tomasz J

2012-01-01

Oxidative stress is a molecular dysregulation in reactive oxygen species (ROS) metabolism, which plays a key role in the pathogenesis of atherosclerosis, vascular inflammation and endothelial dysfunction. It is characterized by a loss of nitric oxide (NO) bioavailability. Large clinical trials such as HOPE and HPS have not shown a clinical benefit of antioxidant vitamin C or vitamin E treatment, putting into question the role of oxidative stress in cardiovascular disease. A change in the understanding of the molecular nature of oxidative stress has been driven by the results of these trials. Oxidative stress is no longer perceived as a simple imbalance between the production and scavenging of ROS, but as a dysfunction of enzymes involved in ROS production. NADPH oxidases are at the center of these events, underlying the dysfunction of other oxidases including eNOS uncoupling, xanthine oxidase and mitochondrial dysfunction. Thus NADPH oxidases are important therapeutic targets. Indeed, HMG-CoA reductase inhibitors (statins) as well as drugs interfering with the renin-angiotensin-aldosterone system inhibit NADPH oxidase activation and expression. Angiotensin-converting enzyme (ACE) inhibitors, AT1 receptor antagonists (sartans) and aliskiren, as well as spironolactone or eplerenone, have been discussed. Molecular aspects of NADPH oxidase regulation must be considered, while thinking about novel pharmacological targeting of this family of enzymes consisting of several homologs Nox1, Nox2, Nox3, Nox4 and Nox5 in humans. In order to properly design trials of antioxidant therapies, we must develop reliable techniques for the assessment of local and systemic oxidative stress. Classical antioxidants could be combined with novel oxidase inhibitors. In this review, we discuss NADPH oxidase inhibitors such as VAS2870, VAS3947, GK-136901, S17834 or plumbagin. Therefore, our efforts must focus on generating small molecular weight inhibitors of NADPH oxidases, allowing the
Alcohol disrupts sleep homeostasis.

PubMed

Thakkar, Mahesh M; Sharma, Rishi; Sahota, Pradeep

2015-06-01

Alcohol is a potent somnogen and one of the most commonly used "over the counter" sleep aids. In healthy non-alcoholics, acute alcohol decreases sleep latency, consolidates and increases the quality (delta power) and quantity of NREM sleep during the first half of the night. However, sleep is disrupted during the second half. Alcoholics, both during drinking periods and during abstinences, suffer from a multitude of sleep disruptions manifested by profound insomnia, excessive daytime sleepiness, and altered sleep architecture. Furthermore, subjective and objective indicators of sleep disturbances are predictors of relapse. Finally, within the USA, it is estimated that societal costs of alcohol-related sleep disorders exceeds $18 billion. Thus, although alcohol-associated sleep problems have significant economic and clinical consequences, very little is known about how and where alcohol acts to affect sleep. In this review, we have described our attempts to unravel the mechanism of alcohol-induced sleep disruptions. We have conducted a series of experiments using two different species, rats and mice, as animal models. We performed microdialysis, immunohistochemical, pharmacological, sleep deprivation and lesion studies which suggest that the sleep-promoting effects of alcohol may be mediated via alcohol's action on the mediators of sleep homeostasis: adenosine (AD) and the wake-promoting cholinergic neurons of the basal forebrain (BF). Alcohol, via its action on AD uptake, increases extracellular AD resulting in the inhibition of BF wake-promoting neurons. Since binge alcohol consumption is a highly prevalent pattern of alcohol consumption and disrupts sleep, we examined the effects of binge drinking on sleep-wakefulness. Our results suggest that disrupted sleep homeostasis may be the primary cause of sleep disruption observed following binge drinking. Finally, we have also shown that sleep disruptions observed during acute withdrawal, are caused due to impaired
Responsible alcohol service programs evaluation

DOT National Transportation Integrated Search

1991-06-01

TEAM is a responsible alcohol service program developed for public assembly facilities. Its objectives are to promote responsible alcohol service, enhance safety and enjoyment of fans, reduce potential liability, and reduce alcohol-impaired driving. ...
Segmenting and targeting American university students to promote responsible alcohol use: a case for applying social marketing principles.

PubMed

Deshpande, Sameer; Rundle-Thiele, Sharyn

2011-10-01

The current study contributes to the social marketing literature in the American university binge-drinking context in three innovative ways. First, it profiles drinking segments by "values" and "expectancies" sought from behaviors. Second, the study compares segment values and expectancies of two competing behaviors, that is, binge drinking and participation in alternative activities. Third, the study compares the influence of a variety of factors on both behaviors in each segment. Finally, based on these findings and feedback from eight university alcohol prevention experts, appropriate strategies to promote responsible alcohol use for each segment are proposed.
Isolated sulfite oxidase deficiency.

PubMed

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays

PubMed Central

Vinu Mohan, A. M.; Windmiller, Joshua Ray; Mishra, Rupesh K.; Wang, Joseph

2017-01-01

The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan layer, along with an outer Nafion layer. The resulting microneedle-based enzyme electrode displays an interference-free ethanol detection in artificial interstitial fluid without compromising its sensitivity, stability and response time. The skin penetration ability and the efficaciousness of the biosensor performance towards subcutaneous alcohol monitoring was substantiated by the ex vivo mice skin model analysis. Our results reveal that the new microneedle sensor holds considerable promise for continuous non-invasive alcohol monitoring in real-life situations. PMID:28088750
"Like throwing a bowling ball at a battle ship" audience responses to Australian news stories about alcohol pricing and promotion policies: a qualitative focus group study.

PubMed

Fogarty, Andrea S; Chapman, Simon

2013-01-01

Policies affecting alcohol's price and promotion are effective measures to reduce harms. Yet policies targeting populations are unpopular with the public, whose views can be influenced by news framings of policy narratives. In Australia, alcohol taxation receives high news coverage, while advertising restrictions have not until recently, and narratives are highly contested for each. However, research specifically examining how audiences respond to such news stories is scant. We sought to explore audience understanding of news reports about two alcohol policy proposals. From June to August 2012, 46 participants were recruited for 8 focus groups in age-brackets of young people aged 18-25 years, parents of young people, and adults aged 25 or older. Groups were split by education. Participants were asked their prior knowledge of alcohol policies, before watching and discussing four news stories about alcohol taxation and advertising. Participants were clear that alcohol poses problems, yet thought policy solutions were ineffective in a drinking culture they viewed as unamenable to change and unaffected by alcohol's price or promotion. Without knowledge of its actual effect on consumption, they cited the 2008 alcopops tax as a policy failure, blaming cheaper substitution. Participants had low knowledge of advertising restrictions, yet were concerned about underage exposure. They offered conditional support for restrictions, while doubting its effectiveness. There was marked distrust of statistics and news actors in broadcasts, yet discussions matched previous research findings. News coverage has resulted in strong audience understanding of alcohol related problems but framed solutions have not always provided clear messages, despite audience support for policies. Future advocacy will need to continue recent moves to address the links between alcohol's price and promotion with the drinking culture, as well as facilitate understandings of how this culture is amenable to
AgI /TMG-Promoted Cascade Reaction of Propargyl Alcohols, Carbon Dioxide, and 2-Aminoethanols to 2-Oxazolidinones.

PubMed

Li, Xue-Dong; Song, Qing-Wen; Lang, Xian-Dong; Chang, Yao; He, Liang-Nian

2017-11-17

Chemical valorization of CO 2 to access various value-added compounds has been a long-term and challenging objective from the viewpoint of sustainable chemistry. Herein, a one-pot three-component reaction of terminal propargyl alcohols, CO 2 , and 2-aminoethanols was developed for the synthesis of 2-oxazolidinones and an equal amount of α-hydroxyl ketones promoted by Ag 2 O/TMG (1,1,3,3-tetramethylguanidine) with a TON (turnover number) of up to 1260. By addition of terminal propargyl alcohol, the thermodynamic disadvantage of the conventional 2-aminoethanol/CO 2 coupling was ameliorated. Mechanistic investigations including control experiments, DFT calculation, kinetic and NMR studies suggest that the reaction proceeds through a cascade pathway and TMG could activate propargyl alcohol and 2-aminoethanol through the formation of hydrogen bonds and also activate CO 2 . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Oxidase positive rods from cases of suspected gonorrhoea. A comparison of conventional, gas chromatographic and genetic methods of identification.

PubMed

Bovre, K; Hagen, N; Berdal, B P; Jantzen, E

1977-02-01

Genito-urethral specimens from 3260 women and 1170 men, with ailments suggestive of gonorrhoea, were examined for growth of oxidase positive rodshaped bacteria, as well as of gonococci. Moraxella osloensis was identified in 26 cases (0.64 per cent of women and 0.43 per cent of men). Three patients harboured phenylalanine negative (or weakly reacting) and tryptophan deaminase negative M. phenylpyrouvica and, in three cases, a Flavobacterium species was detected. Among six oropharyngeal specimens from patients suspected of gonorrhoea, two yielded growth of oxidase positive rods, Kingella kingae and Neisseria elongata, respectively, N. gonorrhoeae was isolated from 537 patients, i.e., 12.1 per cent of all cases. The isolates of oxidase positive rods were in most cases completely identified by streptomycin resistance transformation. On this basis, the diagnostic reliability of some morphological and cultural-biochemical tests and gas chromatography was examined. Gas chromatographic analysis of fatty acid and alcohol composition of whole cells proved distinctive of species defined genetically, irrespective of confusing behaviour of some strains in other tests.
Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase.

PubMed

Shao, Beili; Bayraktutan, Ulvi

2014-01-01

Blood-brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2 (•-) generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2 (•-) by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2 (•-) production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase.
Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase

PubMed Central

Shao, Beili; Bayraktutan, Ulvi

2014-01-01

Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444
[Association between the MAOA-uVNTR polymorphism and antisocial personality traits in alcoholic men].

PubMed

Laqua, C; Zill, P; Koller, G; Preuss, U; Soyka, M

2015-03-01

We have analysed the MAOA-uVNTR polymorphism in the promoter region of the X-chromosomal monoamine oxidase A (MAOA) gene. The first aim was to examine the association between the MAOA genotype and the alcoholic phenotype. In the second part of the paper we have analysed the association of the MAOA genotype with impulsive and aggressive behaviour. Genotypes with 3 or 5-repeat alleles (MAOA-L-genotype) were reported to be associated with impulsive and aggressive traits. The MAOA genotype was determined in 371 male alcohol-dependent subjects and 236 male controls all of German descent. Behavioural and personality traits were evaluated using the self-report questionnaires Barratt Impulsiveness Scale (BIS), Buss Durkee Hostility Inventory (BDHI), Temperament and Character Inventory (TCI) and NEO-Five Factor Inventory (NEO-FFI). A median split in BIS, Buss Durkee Physical Assault, Buss Durkee Irritability, TCI and NEO-FFI was conducted. No association could be detected between the MAOA genotype and the alcoholic phenotype. Based on the results of the BIS questionnaire, we were able to make out an association between the MAOA-L genotype and higher levels of impulsivity (p = 0.043). Furthermore - without reaching statistical significance - we detected a very slight association between the MAOA-L genotype and higher scores in the BDHI subcategory physical aggression (p = 0.058). Taken together, these findings suggest that the MAOA-L genotype is to some extent associated with impulsive and antisocial personality traits in alcoholic men. Further studies on that question are needed. © Georg Thieme Verlag KG Stuttgart · New York.
Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays.

PubMed

Mohan, A M Vinu; Windmiller, Joshua Ray; Mishra, Rupesh K; Wang, Joseph

2017-05-15

The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan layer, along with an outer Nafion layer. The resulting microneedle-based enzyme electrode displays an interference-free ethanol detection in artificial interstitial fluid without compromising its sensitivity, stability and response time. The skin penetration ability and the efficaciousness of the biosensor performance towards subcutaneous alcohol monitoring was substantiated by the ex vivo mice skin model analysis. Our results reveal that the new microneedle sensor holds considerable promise for continuous non-invasive alcohol monitoring in real-life situations. Copyright © 2017 Elsevier B.V. All rights reserved.
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

PubMed

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

SPERMINE OXIDASE: AN AMINE OXIDASE WITH SPECIFICITY FOR SPERMINE AND SPERMIDINE

PubMed Central

Hirsch, James G.

1953-01-01

Sheep serum and bovine serum contain an enzyme which brings about a rapid oxidative deamination of certain biological amines. This enzyme differs from previously described amine oxidases in several regards and especially in its substrate specificity. Studies thus far indicate that only spermine and the closely related compound spermidine serve as substrates for the enzyme in sheep serum. For this reason, the enzyme has been named spermine oxidase. Spermine oxidase is active in a variety of fluids of various ionic strength and buffer composition. The reaction takes place between pH 6.0 and pH 8.0 with an optimal rate in the vicinity of neutrality. Under certain conditions, the rate of oxygen consumption during the initial phase of the reaction is independent of the concentration of substrate. The diminution in rate observed during the latter phase of the enzymatic attack appears to be due to an alteration in the kinetics at low concentrations of substrate, or to competitive inhibition by a product of the reaction. Carbonyl reagents almost completely block the action of spermine oxidase, while certain amines and the cyanide ion bring about partial inhibition. Thiol reagents and sequestering compounds do not alter the course of the oxidative process. In the presence of low concentrations of mercuric chloride, the sheep serum-spermine system consumes approximately twice as much oxygen as controls containing no mercuric ion. The mechanism by which the mercuric ion stimulates additional oxygen uptake is obscure. PMID:13052805
Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

PubMed Central

Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

2012-01-01

Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974
Preventing impaired driving using alcohol policy.

PubMed

Grube, Joel W; Stewart, Kathryn

2004-09-01

Considerable progress has been made in the reduction of impaired driving crashes during the last two decades. Much of this progress is attributable to strengthening laws against impaired driving along with vigorous enforcement efforts aimed at deterring impaired driving. In addition, many useful strategies can also be applied that focus on the control of alcohol availability, use, and promotion. Alcohol policies include controls on the price of alcohol, the location, density, and opening hours of sales outlets, controls on the social availability of alcohol, and on the promotion and advertising of alcohol. Enforcement of these policies is an important aspect of their effectiveness. These strategies have been shown to be effective or promising in reducing impaired driving as well as other consequences related to alcohol use and misuse.
Alcohol consumption and sport: a cross-sectional study of alcohol management practices associated with at-risk alcohol consumption at community football clubs

PubMed Central

2013-01-01

Background Excessive alcohol consumption is responsible for considerable harm from chronic disease and injury. Within most developed countries, members of sporting clubs participate in at-risk alcohol consumption at levels above that of communities generally. There has been limited research investigating the predictors of at-risk alcohol consumption in sporting settings, particularly at the non-elite level. The purpose of this study was to examine the association between the alcohol management practices and characteristics of community football clubs and at-risk alcohol consumption by club members. Methods A cross sectional survey of community football club management representatives and members was conducted. Logistic regression analysis (adjusting for clustering by club) was used to determine the association between the alcohol management practices (including alcohol management policy, alcohol-related sponsorship, availability of low- and non-alcoholic drinks, and alcohol-related promotions, awards and prizes) and characteristics (football code, size and location) of sporting clubs and at-risk alcohol consumption by club members. Results Members of clubs that served alcohol to intoxicated people [OR: 2.23 (95% CI: 1.26-3.93)], conducted ‘happy hour’ promotions [OR: 2.84 (95% CI: 1.84-4.38)] or provided alcohol-only awards and prizes [OR: 1.80 (95% CI: 1.16-2.80)] were at significantly greater odds of consuming alcohol at risky levels than members of clubs that did not have such alcohol management practices. At-risk alcohol consumption was also more likely among members of clubs with less than 150 players compared with larger clubs [OR:1.45 (95% CI: 1.02-2.05)] and amongst members of particular football codes. Conclusions The findings of this study suggest a need and opportunity for the implementation of alcohol harm reduction strategies targeting specific alcohol management practices at community football clubs. PMID:23947601
Various applications of immobilized glucose oxidase and polyphenol oxidase in a conducting polymer matrix.

PubMed

Cil, M; Böyükbayram, A E; Kiralp, S; Toppare, L; Yağci, Y

2007-06-01

In this study, glucose oxidase and polyphenol oxidase were immobilized in conducting polymer matrices; polypyrrole and poly(N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide-co-pyrrole) via electrochemical method. Fourier transform infrared and scanning electron microscope were employed to characterize the copolymer of (N-(4-(3-thienyl methylene)-oxycarbonyl phenyl) maleimide) with pyrrole. Kinetic parameters, maximum reaction rate and Michealis-Menten constant, were determined. Effects of temperature and pH were examined for immobilized enzymes. Also, storage and operational stabilities of enzyme electrodes were investigated. Glucose and polyphenol oxidase enzyme electrodes were used for determination of the glucose amount in orange juices and human serum and phenolic amount in red wines, respectively.
Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

PubMed

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
27 CFR 6.96 - Consumer promotions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumer...
27 CFR 6.96 - Consumer promotions.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumer...
Coordination chemistry controls the thiol oxidase activity of the B12-trafficking protein CblC

PubMed Central

Li, Zhu; Shanmuganathan, Aranganathan; Ruetz, Markus; Yamada, Kazuhiro; Lesniak, Nicholas A.; Kräutler, Bernhard; Brunold, Thomas C.; Koutmos, Markos; Banerjee, Ruma

2017-01-01

The cobalamin or B12 cofactor supports sulfur and one-carbon metabolism and the catabolism of odd-chain fatty acids, branched-chain amino acids, and cholesterol. CblC is a B12-processing enzyme involved in an early cytoplasmic step in the cofactor-trafficking pathway. It catalyzes the glutathione (GSH)-dependent dealkylation of alkylcobalamins and the reductive decyanation of cyanocobalamin. CblC from Caenorhabditis elegans (ceCblC) also exhibits a robust thiol oxidase activity, converting reduced GSH to oxidized GSSG with concomitant scrubbing of ambient dissolved O2. The mechanism of thiol oxidation catalyzed by ceCblC is not known. In this study, we demonstrate that novel coordination chemistry accessible to ceCblC-bound cobalamin supports its thiol oxidase activity via a glutathionyl-cobalamin intermediate. Deglutathionylation of glutathionyl-cobalamin by a second molecule of GSH yields GSSG. The crystal structure of ceCblC provides insights into how architectural differences at the α- and β-faces of cobalamin promote the thiol oxidase activity of ceCblC but mute it in wild-type human CblC. The R161G and R161Q mutations in human CblC unmask its latent thiol oxidase activity and are correlated with increased cellular oxidative stress disease. In summary, we have uncovered key architectural features in the cobalamin-binding pocket that support unusual cob(II)alamin coordination chemistry and enable the thiol oxidase activity of ceCblC. PMID:28442570
Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
Potentiation of amygdala AMPA receptor activity selectively promotes escalated alcohol self-administration in a CaMKII-dependent manner.

PubMed

Cannady, Reginald; Fisher, Kristen R; Graham, Caitlin; Crayle, Jesse; Besheer, Joyce; Hodge, Clyde W

2017-05-01

Growing evidence indicates that drugs of abuse gain control over the individual by usurping glutamate-linked mechanisms of neuroplasticity in reward-related brain regions. Accordingly, we have shown that glutamate α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) activity in the amygdala is required for the positive reinforcing effects of alcohol, which underlie the initial stages of addiction. It is unknown, however, if enhanced AMPAR activity in the amygdala facilitates alcohol self-administration, which is a kernel premise of glutamate hypotheses of addiction. Here, we show that low-dose alcohol (0.6 g/kg/30 minutes) self-administration increases phosphorylation (activation) of AMPAR subtype GluA1 S831 (pGluA1 S831) in the central amygdala (CeA), basolateral amygdala and nucleus accumbens core (AcbC) of selectively bred alcohol-preferring P-rats as compared with behavior-matched (non-drug) sucrose controls. The functional role of enhanced AMPAR activity was assessed via site-specific infusion of the AMPAR positive modulator, aniracetam, in the CeA and AcbC prior to alcohol self-administration. Intra-CeA aniracetam increased alcohol-reinforced but not sucrose-reinforced responding and was ineffective following intra-AcbC infusion. Because GluA1 S831 is a Ca2+/calmodulin-dependent protein kinase II (CaMKII) substrate, we sought to determine if AMPAR regulation of enhanced alcohol self-administration is dependent on CaMKII activity. Intra-CeA infusion of the cell-permeable CaMKII peptide inhibitor myristolated autocamtide-2-related inhibitory peptide (m-AIP) dose-dependently reduced alcohol self-administration. A subthreshold dose of m-AIP also blocked the aniracetam-induced escalation of alcohol self-administration, demonstrating that AMPAR-mediated potentiation of alcohol reinforcement requires CaMKII activity in the amygdala. Enhanced activity of plasticity-linked AMPAR-CaMKII signaling in the amygdala may promote escalated alcohol use
Potentiation of amygdala AMPA receptor activity selectively promotes escalated alcohol self-administration in a CaMKII-dependent manner

PubMed Central

Cannady, Reginald; Fisher, Kristen R.; Graham, Caitlin; Crayle, Jesse; Besheer, Joyce; Hodge, Clyde W.

2015-01-01

Growing evidence indicates that drugs of abuse gain control over the individual by usurping glutamate-linked mechanisms of neuroplasticity in reward-related brain regions. Accordingly, we have shown that glutamate α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) activity in the amygdala is required for the positive reinforcing effects of alcohol, which underlie the initial stages of addiction. It is unknown, however, if enhanced AMPAR activity in the amygdala facilitates alcohol self-administration, which is a kernel premise of glutamate hypotheses of addiction. Here we show that low-dose alcohol (0.6 g/kg/30-min) self-administration increases phosphorylation (activation) of AMPAR subtype GluA1 S831 (pGluA1 S831) in the central amygdala (CeA), basolateral amygdala, and nucleus accumbens core (AcbC) of selectively bred alcohol-preferring P-rats as compared to behavior-matched (non-drug) sucrose controls. The functional role of enhanced AMPAR activity was assessed via site-specific infusion of the AMPAR positive modulator, aniracetam, in the CeA and AcbC prior to alcohol self-administration. Intra-CeA aniracetam increased alcohol- but not sucrose-reinforced responding, and was ineffective following intra-AcbC infusion. Since GluA1 S831 is a Ca2+/calmodulin-dependent protein kinase II (CaMKII) substrate, we sought to determine if AMPAR regulation of enhanced alcohol self-administration is dependent on CaMKII activity. Intra-CeA infusion of the cell-permeable CaMKII peptide inhibitor m-AIP dose-dependently reduced alcohol self-administration. A sub-threshold dose of m-AIP also blocked the aniracetam-induced escalation of alcohol self-administration, demonstrating that AMPAR-mediated potentiation of alcohol reinforcement requires CaMKII activity in the amygdala. Enhanced activity of plasticity-linked AMPAR-CaMKII signaling in the amygdala may promote escalated alcohol use via increased positive reinforcement during the initial stages of addiction
Spermine oxidase promotes bile canalicular lumen formation through acrolein production.

PubMed

Uemura, Takeshi; Takasaka, Tomokazu; Igarashi, Kazuei; Ikegaya, Hiroshi

2017-11-01

Spermine oxidase (SMOX) catalyzes oxidation of spermine to generate spermidine, hydrogen peroxide (H 2 O 2 ) and 3-aminopropanal, which is spontaneously converted to acrolein. SMOX is induced by a variety of stimuli including bacterial infection, polyamine analogues and acetaldehyde exposure. However, the physiological functions of SMOX are not yet fully understood. We investigated the physiological role of SMOX in liver cells using human hepatocellular carcinoma cell line HepG2. SMOX localized to the bile canalicular lumen, as determined by F-actin staining. Knockdown of SMOX reduced the formation of bile canalicular lumen. We also found that phospho-Akt (phosphorylated protein kinase B) was localized to canalicular lumen. Treatment with Akt inhibitor significantly reduced the formation of bile canalicular lumen. Acrolein scavenger also inhibited the formation of bile canalicular lumen. PTEN, phosphatase and tensin homolog and an inhibitor of Akt, was alkylated in a SMOX-dependent manner. Our results suggest that SMOX plays a central role in the formation of bile canalicular lumen in liver cells by activating Akt pathway through acrolein production.
An Oxidase-Based Electrochemical Fluidic Sensor with High-Sensitivity and Low-Interference by On-Chip Oxygen Manipulation

PubMed Central

Radhakrishnan, Nitin; Park, Jongwon; Kim, Chang-Soo

2012-01-01

Utilizing a simple fluidic structure, we demonstrate the improved performance of oxidase-based enzymatic biosensors. Electrolysis of water is utilized to generate bubbles to manipulate the oxygen microenvironment close to the biosensor in a fluidic channel. For the proper enzyme reactions to occur, a simple mechanical procedure of manipulating bubbles was developed to maximize the oxygen level while minimizing the pH change after electrolysis. The sensors show improved sensitivities based on the oxygen dependency of enzyme reaction. In addition, this oxygen-rich operation minimizes the ratio of electrochemical interference signal by ascorbic acid during sensor operation (i.e., amperometric detection of hydrogen peroxide). Although creatinine sensors have been used as the model system in this study, this method is applicable to many other biosensors that can use oxidase enzymes (e.g., glucose, alcohol, phenol, etc.) to implement a viable component for in-line fluidic sensor systems. PMID:23012527
Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

PubMed Central

Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

2007-01-01

Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895
Alcohol: The Gateway Drug. Alcohol Supplement to the Drug Education Curriculum.

ERIC Educational Resources Information Center

New York State Education Dept., Albany. Bureau of Curriculum Development.

This document presents an alcohol supplement to New York's Drug Education Curriculum. The supplement is designed to address the unique circumstances that distinguish educational strategies about alcohol from those applied to other drugs. Section I, Introduction, describes the strategy suggested by this document as being based on health promotion,…
27 CFR 10.24 - Sales promotion contests.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Sales promotion contests. 10.24 Section 10.24 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion contests...
A Simple Visual Ethanol Biosensor Based on Alcohol Oxidase Immobilized onto Polyaniline Film for Halal Verification of Fermented Beverage Samples

PubMed Central

Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

2014-01-01

A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284
A simple visual ethanol biosensor based on alcohol oxidase immobilized onto polyaniline film for halal verification of fermented beverage samples.

PubMed

Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

2014-01-27

A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification.
Bioconversion of Airborne Methylamine by Immobilized Recombinant Amine Oxidase from the Thermotolerant Yeast Hansenula polymorpha

PubMed Central

Sigawi, Sasi; Nitzan, Yeshayahu

2014-01-01

Aliphatic amines, including methylamine, are air-pollutants, due to their intensive use in industry and the natural degradation of proteins, amino acids, and other nitrogen-containing compounds in biological samples. It is necessary to develop systems for removal of methylamine from the air, since airborne methylamine has a negative effect on human health. The primary amine oxidase (primary amine : oxygen oxidoreductase (deaminating) or amine oxidase, AMO; EC 1.4.3.21), a copper-containing enzyme from the thermotolerant yeast Hansenula polymorpha which was overexpressed in baker's yeast Saccharomyces cerevisiae, was tested for its ability to oxidize airborne methylamine. A continuous fluidized bed bioreactor (CFBR) was designed to enable bioconversion of airborne methylamine by AMO immobilized in calcium alginate (CA) beads. The results demonstrated that the bioreactor with immobilized AMO eliminates nearly 97% of the airborne methylamine. However, the enzymatic activity of AMO causes formation of formaldehyde. A two-step bioconversion process was therefore proposed. In the first step, airborne methylamine was fed into a CFBR which contained immobilized AMO. In the second step, the gas flow was passed through another CFBR, with alcohol oxidase from the yeast H. polymorpha immobilized in CA, in order to decompose the formaldehyde formed in the first step. The proposed system provided almost total elimination of the airborne methylamine and the formaldehyde. PMID:24672387

Alcohol attentional bias is associated with autonomic indices of stress-primed alcohol cue-reactivity in alcohol-dependent patients.

PubMed

Garland, Eric L; Franken, Ingmar H; Sheetz, John J; Howard, Matthew O

2012-06-01

When alcohol-dependent individuals are exposed to drinking-related cues, they exhibit psychophysiological reactivity such as changes in heart rate variability (HRV) and skin temperature. Moreover, such alcohol cue-reactivity may co-occur with attentional bias (AB) toward alcohol cues. In turn, stress may promote appetitive responses by exacerbating these autonomic and attentional factors. Although cue-reactivity paradigms have been used for decades to probe such automatic appetitive processes in persons with alcohol-use disorders, less is known about the attentional correlates of alcohol cue-reactivity. In this study, alcohol-dependent adults (N = 58) recruited from a residential treatment facility completed a spatial cueing task as a measure of alcohol AB and affect-modulated cue-reactivity protocol. Multiple linear regression analyses revealed that alcohol AB was significantly positively associated with parasympathetically mediated HRV and finger temperature slope and inversely associated with sympathetically mediated HRV during stress-primed alcohol cue-exposure, independent of alcohol dependence severity, time in treatment, alcohol craving, and perceived stress. Study findings suggest that alcohol AB is linked with physiological cue-reactivity and that different attentional strategies are associated with distinct profiles of autonomic responses that may ultimately index or confer additional risk for alcohol dependence.
Alcohol Activates the Hedgehog Pathway and Induces Related Pro-carcinogenic Processes in the Alcohol-Preferring Rat Model of Hepatocarcinogenesis

PubMed Central

Chan, Isaac S.; Guy, Cynthia D.; Machado, Mariana V.; Wank, Abigail; Kadiyala, Vishnu; Michelotti, Gregory; Choi, Steve; Swiderska-Syn, Marzena; Karaca, Gamze; Pereira, Thiago A.; Yip-Schneider, Michele T.; Schmidt, C. Max; Diehl, Anna Mae

2014-01-01

Background Alcohol consumption promotes hepatocellular carcinoma (HCC). The responsible mechanisms are not well understood. Hepatocarcinogenesis increases with age and is enhanced by factors that impose a demand for liver regeneration. Because alcohol is hepatotoxic, habitual alcohol ingestion evokes a recurrent demand for hepatic regeneration. The alcohol-preferring (P) rat model mimics the level of alcohol consumption by humans who habitually abuse alcohol. Previously, we showed that habitual heavy alcohol ingestion amplified age-related hepatocarcinogenesis in P-rats, with over 80% of alcohol-consuming P rats developing HCCs after 18 months of alcohol exposure, compared to only 5% of water-drinking controls. Methods Herein, we used quantitative real time PCR and quantitative immunocytochemistry to compare liver tissues from alcohol-consuming P rats and water-fed P rat controls after 6, 12, or 18 months of drinking. We aimed to identify potential mechanisms that might underlie the differences in liver cancer formation, and hypothesized that chronic alcohol ingestion would activate Hedgehog (HH), a regenerative signaling pathway that is over-activated in HCC. Results Chronic alcohol ingestion amplified age-related degenerative changes in hepatocytes, but did not cause appreciable liver inflammation or fibrosis even after 18 months of heavy drinking. HH signaling was also enhanced by alcohol exposure, as evidenced by increased levels of mRNAs encoding HH ligands, HH-regulated transcription factors, and HH-target genes. Immunocytochemistry confirmed increased alcohol-related accumulation of HH ligand-producing cells and HH-responsive target cells. HH-related regenerative responses were also induced in alcohol-exposed rats. Three of these processes (i.e., deregulated progenitor expansion, the reverse-Warburg effect, and epithelial-to-mesenchymal transitions) are known to promote cancer growth in other tissues. Conclusions Alcohol-related changes in Hedgehog signaling
Responsible alcohol service programs evaluation summary report

DOT National Transportation Integrated Search

1991-06-01

TEAM is a responsible alcohol service program developed for public assembly facilities. Its objectives are to promote responsible alcohol service, enhance safety and enjoyment of fans, reduce potential liability, and reduce alcohol-impaired driving. ...
Promoting an Alcohol-Free Childhood: A Novel Home-Based Parenting Program

ERIC Educational Resources Information Center

Dickinson, Denise M.; Hayes, Kim A.; Jackson, Christine; Ennett, Susan T.; Lawson, Caroline

2014-01-01

Few alcohol prevention programs focus on elementary school-aged youth, yet children develop expectancies and norms about alcohol use during the elementary school years, and many elementary school children are allowed to have sips or tastes of alcohol at home. Research on consequences of early alcohol use indicates that it can put children at…
Does alcohol advertising promote adolescent drinking? Results from a longitudinal assessment.

PubMed

Ellickson, Phyllis L; Collins, Rebecca L; Hambarsoomians, Katrin; McCaffrey, Daniel F

2005-02-01

To examine the relationship between exposure to different forms of alcohol advertising and subsequent drinking among US adolescents and assess whether exposure to an alcohol and drug prevention program mitigates any such relationship. Regression models with multiple control variables examined the relationship between exposure to alcohol advertising in grade 8 and grade 9 drinking for two groups of South Dakotan adolescents: (1) seventh-grade non-drinkers (n = 1206) and (2) seventh-grade drinkers (n = 1905). Interactions between the intervention program and the significant advertising predictors were tested. Forty-one middle schools in South Dakota, USA. A total of 3111 seventh-graders followed through grade 9. Advertising variables were constructed for four types of alcohol advertising-television, in-store displays, magazines and concession stands. Other predictors tested included measures tapping social influences, social bonds, problem behavior, alcohol beliefs, television exposure and demographics. For seventh-grade non-drinkers, exposure to in-store beer displays predicted drinking onset by grade 9; for seventh-grade drinkers, exposure to magazines with alcohol advertisements and to beer concession stands at sports or music events predicted frequency of grade 9 drinking. Although exposure to television beer advertising had a significant bivariate relationship with alcohol use for grade 7 non-drinkers, it was not a significant predictor of drinking for either group in multivariate analyses. Participation in the prevention program, ALERT Plus, reduced future drinking for both groups and counteracted the effect of in-store beer displays. Several forms of alcohol advertising predict adolescent drinking; which sources dominate depends on the child's prior experience with alcohol. Alcohol prevention programs and policies should help children counter alcohol advertising from multiple sources and limit exposure to these sources.
A new genetic variant in the Sp1 binding cis-element of cholecystokinin gene promoter region and relationship to alcoholism.

PubMed

Harada, S; Okubo, T; Tsutsumi, M; Takase, S; Muramatsu, T

1998-05-01

Neuropeptide cholecystokinin (CCK) and the CCK receptors in the central nervous system mediate actions on increasing firings, anxiety, and nociceptions. Furthermore, CCK modulates the release of dopamine and dopamine-related behaviors in the mesolimbic pathway. In our study, genetic variation in the promoter and coding regions of the prepro-CCK gene were analyzed among 66 Japanese, 66 American Whites, 54 Chinese, and 41 Colombian natives. Two nucleotide sequence variants were found: a frequent mutation at nucleotide position -45 C to T involved in core sequence of Sp1 binding cis-element of the promoter region, and a C to T substitution at the 1662 position in intron 2. Analysis for the segregation study in 10 families of twins confirmed codominant heredity of two alleles. Distribution of genotypes and gene frequencies of 66 controls and 108 alcoholics in Japan presented that allelic variant T type in alcoholics was found in higher frequencies than that of controls, and distribution of these genotypes was significantly different between the both groups.
Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

PubMed Central

Lermontova, Inna; Grimm, Bernhard

2000-01-01

The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251
Lipid levels are associated with a regulatory polymorphism of the monoamine oxidase-A gene promoter (MAOA-uVNTR).

PubMed

Brummett, Beverly H; Boyle, Stephen H; Siegler, Ilene C; Zuchner, Stephan; Ashley-Koch, Allison; Williams, Redford B

2008-02-01

The monoamine oxidase-A (MAOA) gene plays a vital role in the metabolism of neurotransmitters, e.g, serotonin, norepinephrine, and dopamine. A polymorphism in the promoter region (MAOA-uVNTR) affects transcriptional efficiency. Allelic variation in MAOA-uVNTR has been associated with body mass index (BMI). We extended previous work by examining relations among this polymorphism and serum lipid levels. The sample consisted of 74 males enrolled in a study of caregivers for relatives with dementia. Regression models, adjusted for age, race, group status (caregiver/control), and cholesterol lowering medication (yes/no), were used to examine associations between high verses low MAOA-uVNTR activity alleles and total cholesterol, HDL, LDL, VLDL, LDL/HDL ratio, triglycerides, and BMI. Higher total cholesterol (p<0.03), LDL/HDL ratio (p<0.01), triglycerides (p<0.02), and VLDL (p<0.02) were associated with low activity MAOA-uVNTR alleles. HDL and LDL were modestly related to MAOA-uVNTR activity, however, they did not reach the conventional significance level (p<0.07 and p<0.10, respectively). BMI (p<0.74) was unrelated to MAOA-uVNTR transcription. The present findings suggest that MAOA-uVNTR may influence lipid levels and individuals with less active alleles are at increased health risk.
H2O2 recycling during oxidation of the arylglycerol beta-aryl ether lignin structure by lignin peroxidase and glyoxal oxidase.

PubMed

Hammel, K E; Mozuch, M D; Jensen, K A; Kersten, P J

1994-11-15

Oxidative C alpha-C beta cleavage of the arylglycerol beta-aryl ether lignin model 1-(3,4-dimethoxy-phenyl)-2-phenoxypropane-1,3-diol (I) by Phanerochaete chrysosporium lignin peroxidase in the presence of limiting H2O2 was enhanced 4-5-fold by glyoxal oxidase from the same fungus. Further investigation showed that each C alpha-C beta cleavage reaction released 0.8-0.9 equiv of glycolaldehyde, a glyoxal oxidase substrate. The identification of glycolaldehyde was based on 13C NMR spectrometry of reaction product obtained from beta-, gamma-, and beta,gamma-13C-substituted I, and quantitation was based on an enzymatic NADH-linked assay. The oxidation of glycolaldehyde by glyoxal oxidase yielded 0.9 oxalate and 2.8 H2O2 per reaction, as shown by quantitation of oxalate as 2,3-dihydroxyquinoxaline after derivatization with 1,2-diaminobenzene and by quantitation of H2O2 in coupled spectrophotometric assays with veratryl alcohol and lignin peroxidase. These results suggest that the C alpha-C beta cleavage of I by lignin peroxidase in the presence of glyoxal oxidase should regenerate as many as 3 H2O2. Calculations based on the observed enhancement of LiP-catalyzed C alpha-C beta cleavage by glyoxal oxidase showed that approximately 2 H2O2 were actually regenerated per cleavage of I when both enzymes were present. The cleavage of arylglycerol beta-aryl ether structures by ligninolytic enzymes thus recycles H2O2 to support subsequent cleavage reactions.
A new amperometric enzyme electrode for alcohol determination.

PubMed

Gülce, H; Gülce, A; Kavanoz, M; Coşkun, H; Yildiz, A

2002-06-01

A new enzyme electrode for the determination of alcohols was developed by immobilizing alcohol oxidase in polvinylferrocenium matrix coated on a Pt electrode surface. The amperometric response due to the electrooxidation of enzymatically generated H(2)O(2) was measured at a constant potential of +0.70 V versus SCE. The effects of substrate, buffer and enzyme concentrations, pH and temperature on the response of the electrode were investigated. The optimum pH was found to be pH 8.0 at 30 degrees C. The steady-state current of this enzyme electrode was reproducible within +/-5.0% of the relative error. The sensitivity of the enzyme electrode decreased in the following order: methanol>ethanol>n-butanol>benzyl alcohol. The linear response was observed up to 3.7 mM for methanol, 3.0 mM for ethanol, 6.2 mM for n-butanol, and 5.2 mM for benzyl alcohol. The apparent Michaelis-Menten constant (K(Mapp)) value and the activation energy, E(a), of this immobilized enzyme system were found to be 5.78 mM and 38.07 kJ/mol for methanol, respectively.
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

PubMed

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Calcium mobilization and Rac1 activation are required for VCAM-1 (vascular cell adhesion molecule-1) stimulation of NADPH oxidase activity.

PubMed Central

Cook-Mills, Joan M; Johnson, Jacob D; Deem, Tracy L; Ochi, Atsuo; Wang, Lei; Zheng, Yi

2004-01-01

VCAM-1 (vascular cell adhesion molecule-1) plays an important role in the regulation of inflammation in atherosclerosis, asthma, inflammatory bowel disease and transplantation. VCAM-1 activates endothelial cell NADPH oxidase, and this oxidase activity is required for VCAM-1-dependent lymphocyte migration. We reported previously that a mouse microvascular endothelial cell line promotes lymphocyte migration that is dependent on VCAM-1, but not on other known adhesion molecules. Here we have investigated the signalling mechanisms underlying VCAM-1 function. Lymphocyte binding to VCAM-1 on the endothelial cell surface activated an endothelial cell calcium flux that could be inhibited with anti-alpha4-integrin and mimicked by anti-VCAM-1-coated beads. VCAM-1 stimulation of calcium responses could be blocked by an inhibitor of intracellular calcium mobilization, a calcium channel inhibitor or a calcium chelator, resulting in the inhibition of NADPH oxidase activity. Addition of ionomycin overcame the calcium channel blocker suppression of VCAM-1-stimulated NADPH oxidase activity, but could not reverse the inhibitory effect imposed by intracellular calcium blockage, indicating that both intracellular and extracellular calcium mobilization are required for VCAM-1-mediated activation of NADPH oxidase. Furthermore, VCAM-1 specifically activated the Rho-family GTPase Rac1, and VCAM-1 activation of NADPH oxidase was blocked by a dominant negative Rac1. Thus VCAM-1 stimulates the mobilization of intracellular and extracellular calcium and Rac1 activity that are required for the activation of NADPH oxidase. PMID:14594451
Role of NADPH oxidases and reactive oxygen species in regulation of bone turnover and the skeletal toxicity of alcohol

USDA-ARS?s Scientific Manuscript database

Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...
Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis

PubMed Central

Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

2015-01-01

Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction. PMID:25417822
Influence of gamma irradiation on polymerization of pyrrole and glucose oxidase immobilization onto poly (pyrrole)/poly (vinyl alcohol) matrix

NASA Astrophysics Data System (ADS)

Idris, Sarada; A. Bakar, Ahmad Ashrif; Thevy Ratnam, Chantara; Kamaruddin, Nur Hasiba; Shaari, Sahbudin

2017-04-01

This paper describes the immobilization of glucose oxidase, GOx onto polymer matrix comprising of poly(pyrrole), PPy and poly(vinyl alcohol), PVA using gamma irradiation technique. Py/PVA-GOx film was prepared by spreading PVA:GOx, 1:1 solution onto dried pyrrole film and exposed to gamma irradiation from cobalt 60 source at doses ranging from 0 to 60 kGy. The films were subjected to structural and morphological analyses by using Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), Scanning electron microscope (SEM), Field emission scanning electron microscope (FESEM) and Atomic-force microscopy (AFM) techniques. Similar studies were also made on pristine pyrrole film which served as control. The SEM and FTIR spectra of Py/PVA-GOx film revealed that pyrrole has been successfully polymerized through irradiation-induced reactions. The results on the morphological properties of the samples characterize using FESEM, SEM and AFM further confirmed the occurrence of radiation-induced modification of Py/PVA-GOx film. The FTIR spectra showed the existence of intermolecular interaction between polymer matrix and GOx indicating that GOx had been successfully immobilized onto Ppy/PVA matrix by radiation-induced reactions. Results revealed that radiation induced reactions such as polymerization of pyrrole, crosslinking of PVA, grafting between the adjacent PVA and pyrrole molecules as well as immobilization of GOx onto Ppy/PVA matrix occurred simultaneously upon gamma irradiation. The optimum dose for GOx immobilization in the polymer matrix found to be 40 kGy. Therefore it is clear that this irradiation technique offered a simple single process to produce Py/PVA-GOx film without additional crosslinking and polymerization agents.
[Biological markers of alcoholism].

PubMed

Marcos Martín, M; Pastor Encinas, I; Laso Guzmán, F J

2005-09-01

Diagnosis of alcoholism is very important, given its high prevalence and possibility of influencing the disease course. For this reason, the so-called biological markers of alcoholism are useful. These are analytic parameters that alter in the presence of excessive alcohol consumption. The two most relevant markers are the gamma-glutamyltranspeptidase and carbohydrate deficient transferrin. With this clinical comment, we aim to contribute to the knowledge of these tests and promote its use in the clinical practice.
Correlation Between Monoamine Oxidase Inhibitors and Anticonvulsants

PubMed Central

Dwivedi, Chandradhar; Misra, Radhey S.; Chaudhari, Anshumali; Parmar, Surendra S.

1980-01-01

Monoamine oxidase inhibitory and anticonvulsant properties of 2-substituted styryl-6-bromo-3-(4-ethylbenzoate/4 benzhydrazide)-4-quinazoles are studied. All styryl quinazolone esters except compound number 9 exhibited monoamine oxidase inhibitory properties during oxidative deamination of kynuramine. Corresponding hydrazides were found to have relatively higher activity. All these quinazolones were able to protect against pentylenetetrazol induced seizures. These observations in general do not prove that monoamine oxidase inhibitory properties represent the biochemical basis for the anticonvulsant activity of these compounds. PMID:7420438
Leptin promotes neointima formation and smooth muscle cell proliferation via NADPH oxidase activation and signalling in caveolin-rich microdomains.

PubMed

Schroeter, Marco R; Leifheit-Nestler, Maren; Hubert, Astrid; Schumann, Bettina; Glückermann, Roland; Eschholz, Norman; Krüger, Nenja; Lutz, Susanne; Hasenfuss, Gerd; Konstantinides, Stavros; Schäfer, Katrin

2013-08-01

Apolipoprotein E (apoE) may act as a vasculoprotective factor by promoting plasma lipid clearance and cholesterol efflux. Moreover, apoE accumulates at sites of vascular injury and modulates the effect of growth factors on smooth muscle cells (SMCs). Experimental data suggested that hypothalamic apoE expression is reduced in obesity and associated with leptin resistance. In this study, we examined the role of apoE in mediating the effects of leptin on vascular lesion formation. Leptin was administered to apoE knockout (apoE-/-) mice via osmotic pumps to increase its circulating levels. Morphometric analysis revealed that leptin did not alter neointima formation and failed to increase α-actin- or PCNA-immunopositive SMCs after vascular injury. Similar findings were obtained after analysis of atherosclerotic lesions. Comparison of apoE-/-, wild-type, or LDL receptor-/- mice and functional analyses in aortic SMCs from WT or apoE-/- mice or human arterial SMCs after treatment with small interfering (si)RNA or heparinase revealed that leptin requires the presence of apoE, expressed, secreted and bound to the cell surface, to fully activate leptin receptor signalling and to promote SMC proliferation and neointima formation. Mechanistically, leptin induced the phosphorylation and membrane translocation of caveolin (cav)-1, and apoE down-regulation or caveolae disruption inhibited the leptin-induced p47phox activation, ROS formation and SMC proliferation. Finally, leptin failed to increase neointima formation in mice lacking cav-1. Our findings suggest that apoE mediates the effects of leptin on vascular lesion formation by stabilizing cav-1-enriched cell membrane microdomains in SMCs, thus allowing NADPH oxidase assembly and ROS-mediated mitogenic signalling.
Comparing Alcohol Marketing and Alcohol Warning Message Policies Across Canada.

PubMed

Wettlaufer, Ashley; Cukier, Samantha N; Giesbrecht, Norman

2017-08-24

In order to reduce harms from alcohol, evidence-based policies are to be introduced and sustained. To facilitate the dissemination of policies that reduce alcohol-related harms by documenting, comparing, and sharing information on effective alcohol polices related to restrictions on alcohol marketing and alcohol warning messaging in 10 Canadian provinces. Team members developed measurable indicators to assess policies on (a) restrictions on alcohol marketing, and (b) alcohol warning messaging. Indicators were peer-reviewed by three alcohol policy experts, refined, and data were collected, submitted for validation by provincial experts, and scored independently by two team members. The national average score was 52% for restrictions on marketing policies and 18% for alcohol warning message policies. Most provinces had marketing regulations that went beyond the federal guidelines with penalties for violating marketing regulations. The provincial liquor boards' web pages focused on product promotion, and there were few restrictions on sponsorship activities. No province has implemented alcohol warning labels, and Ontario was the sole province to have legislated warning signs at all points-of-sale. Most provinces provided a variety of warning signs to be displayed voluntarily at points-of-sale; however, the quality of messages varied. Conclusions/Importance: There is extensive alcohol marketing with comparatively few messages focused on the potential harms associated with alcohol. It is recommended that governments collaborate with multiple stakeholders to maximize the preventive impact of restrictions on alcohol marketing and advertising, and a broader implementation of alcohol warning messages.
Hydrogen-bond-driven electrophilic activation for selectivity control: scope and limitations of fluorous alcohol-promoted selective formation of 1,2-disubstituted benzimidazoles and mechanistic insight for rationale of selectivity.

PubMed

Chebolu, Rajesh; Kommi, Damodara N; Kumar, Dinesh; Bollineni, Narendra; Chakraborti, Asit K

2012-11-16

Hydrogen-bond-driven electrophilic activation for selectivity control during competitive formation of 1,2-disubstituted and 2-substituted benzimidazoles from o-phenylenediamine and aldehydes is reported. The fluorous alcohols trifluoroethanol and hexafluoro-2-propanol efficiently promote the cyclocondensation of o-phenylenediamine with aldehydes to afford selectively the 1,2-disubstituted benzimidazoles at rt in short times. A mechanistic insight is invoked by NMR, mass spectrometry, and chemical studies to rationalize the selectivity. The ability of the fluorous alcohols in promoting the reaction and controlling the selectivity can be envisaged from their better hydrogen bond donor (HBD) abilities compared to that of the other organic solvents as well as of water. Due to the better HBD values, the fluorous alcohols efficiently promote the initial bisimine formation by electrophilic activation of the aldehyde carbonyl. Subsequently the hydrogen-bond-mediated activation of the in situ-formed bisimine triggers the rearrangement via 1,3-hydride shift to form the 1,2-disubstituted benzimidazoles.

Health Professionals’ Alcohol-Related Professional Practices and the Relationship between Their Personal Alcohol Attitudes and Behavior and Professional Practices: A Systematic Review

PubMed Central

Bakhshi, Savita; While, Alison E.

2013-01-01

Health professionals’ personal health behaviors have been found to be associated with their practices with patients in areas such as smoking, physical activity and weight management, but little is known in relation to alcohol use. This review has two related strands and aims to: (1) examine health professionals’ alcohol-related health promotion practices; and (2) explore the relationship between health professionals’ personal alcohol attitudes and behaviors, and their professional alcohol-related health promotion practices. A comprehensive literature search of the Cochrane Library, MEDLINE, EMBASE, PsycINFO, CINAHL, British Nursing Index, Web of Science, Scopus and Science Direct (2007–2013) identified 26 studies that met the inclusion criteria for Strand 1, out of which six were analyzed for Strand 2. The findings indicate that health professionals use a range of methods to aid patients who are high-risk alcohol users. Positive associations were reported between health professionals’ alcohol-related health promotion activities and their personal attitudes towards alcohol (n = 2), and their personal alcohol use (n = 2). The findings have some important implications for professional education. Future research should focus on conducting well-designed studies with larger samples to enable us to draw firm conclusions and develop the evidence base. PMID:24366045
Regulation of tyramine oxidase synthesis in Klebsiella aerogenes.

PubMed Central

Okamura, H; Murooka, Y; Harada, T

1976-01-01

Tyramine oxidase in Klebsiella aerogenes is highly specific for tyramine, dopamine, octopamine, and norepinephrine, and its synthesis is induced specifically by these compounds. The enzyme is present in a membrane-bound form. The Km value for tyramine is 9 X 10(-4) M. Tyramine oxidase synthesis was subjected to catabolite repression by glucose in the presence of ammonium salts. Addition of cyclic adenosine 3',5'-monophosphate (cAMP) overcame the catabolite repression. A mutant strain, K711, which can produce a high level of beta-galactosidase in the presence of glucose and ammonium chloride, can also synthesize tyramine oxidase and histidase in the presence of inducer in glucose ammonium medium. Catabolite repression of tyramine oxidase synthesis was relieved when the cells were grown under conditions of nitrogen limitation, whereas beta-galactosidase was strongly repressed under these conditions. A cAMP-requiring mutant, MK54, synthesized tyramine oxidase rapidly when tyramine was used as the sole source of nitrogen in the absence of cAMP. However, a glutamine synthetase-constitutive mutant, MK94, failed to synthesize tyramine oxidase in the presence of glucose and ammonium chloride, although it synthesized histidase rapidly under these conditions. These results suggest that catabolite repression of tyramine oxidase synthesis in K. aerogenes is regulated by the intracellular level of cAMP and an unknown cytoplasmic factor that acts independently of cAMP and is formed under conditions of nitrogen limitation. PMID:179974
Sales promotion strategies and youth drinking in Australia.

PubMed

Pettigrew, Simone; Biagioni, Nicole; Jones, Sandra C; Daube, Mike; Kirby, Gary; Stafford, Julia; Chikritzhs, Tanya

2015-09-01

This study employed an exploratory approach to generate detailed information about how in-store shopping experiences and exposure to sales promotion activities feature in the alcohol choices of Australian 18-21 year old drinkers. The qualitative methods of interviews, focus groups, and emailed narratives were used during 2014 to collect relevant data. The findings suggest that young drinkers' in-store shopping experiences and exposure to sales promotions influence the type, range, and quantity of alcohol purchased. In particular, the role of sales staff can be critical in increasing the amount of alcohol purchased by drawing drinkers' attention to and encouraging their participation in sales promotions. There thus appears to be an important interaction between promotional practices and young drinkers purchasing substantially larger quantities of alcohol than originally intended. Such practices need review in light of the high risk of alcohol-related harm experienced by many members of this age group. Copyright © 2015 Elsevier Ltd. All rights reserved.
“Like Throwing a Bowling Ball at a Battle Ship” Audience Responses to Australian News Stories about Alcohol Pricing and Promotion Policies: A Qualitative Focus Group Study

PubMed Central

Fogarty, Andrea S.; Chapman, Simon

2013-01-01

Introduction Policies affecting alcohol’s price and promotion are effective measures to reduce harms. Yet policies targeting populations are unpopular with the public, whose views can be influenced by news framings of policy narratives. In Australia, alcohol taxation receives high news coverage, while advertising restrictions have not until recently, and narratives are highly contested for each. However, research specifically examining how audiences respond to such news stories is scant. We sought to explore audience understanding of news reports about two alcohol policy proposals. Method From June to August 2012, 46 participants were recruited for 8 focus groups in age-brackets of young people aged 18–25 years, parents of young people, and adults aged 25 or older. Groups were split by education. Participants were asked their prior knowledge of alcohol policies, before watching and discussing four news stories about alcohol taxation and advertising. Results Participants were clear that alcohol poses problems, yet thought policy solutions were ineffective in a drinking culture they viewed as unamenable to change and unaffected by alcohol’s price or promotion. Without knowledge of its actual effect on consumption, they cited the 2008 alcopops tax as a policy failure, blaming cheaper substitution. Participants had low knowledge of advertising restrictions, yet were concerned about underage exposure. They offered conditional support for restrictions, while doubting its effectiveness. There was marked distrust of statistics and news actors in broadcasts, yet discussions matched previous research findings. Conclusions News coverage has resulted in strong audience understanding of alcohol related problems but framed solutions have not always provided clear messages, despite audience support for policies. Future advocacy will need to continue recent moves to address the links between alcohol’s price and promotion with the drinking culture, as well as facilitate
Friends, Family, and Alcohol Abuse: An Examination of General and Alcohol-Specific Social Support

PubMed Central

Groh, David R.; Jason, Leonard A.; Davis, Margaret I.; Olson, Bradley D.; Ferrari, Joseph R.

2010-01-01

Social support may be considered from several different dimensions. While general social support promotes well-being, specific social support is tied to particular functions, such as alcohol use. Not only may the form of social support vary, but also the source (ie, friends vs. family). This study investigated the impact of general and specific support for alcohol use from family versus friends on alcohol use among 897 U.S. residents of abstinent communal-living settings (Oxford Houses). Results indicated that general support from friends and length of stay in Oxford House significantly predicted less alcohol use. Implications for alcohol recovery are discussed. PMID:17364422
Alcohol in the city: wherever and whenever.

PubMed

Sureda, Xisca; Carreño, Víctor; Espelt, Albert; Villalbí, Joan R; Pearce, Jamie; Franco, Manuel

Alcohol urban environment has been associated with individual alcohol behaviors. We are constantly exposed to a wide variety of alcohol products, its marketing and promotion and signs of alcohol consumption that may influence alcohol-drinking behaviors. In this photo-essay, we include photographs that visually explain the exposure to alcohol in the urban streetscape of Madrid. These photographs show the pervasiveness of alcohol products in this city, which can be found everywhere at any time. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.
Reinforcement of smoking and drinking: tobacco marketing strategies linked with alcohol in the United States.

PubMed

Jiang, Nan; Ling, Pamela M

2011-10-01

We investigated tobacco companies' knowledge about concurrent use of tobacco and alcohol, their marketing strategies linking cigarettes with alcohol, and the benefits tobacco companies sought from these marketing activities. We performed systematic searches on previously secret tobacco industry documents, and we summarized the themes and contexts of relevant search results. Tobacco company research confirmed the association between tobacco use and alcohol use. Tobacco companies explored promotional strategies linking cigarettes and alcohol, such as jointly sponsoring special events with alcohol companies to lower the cost of sponsorships, increase consumer appeal, reinforce brand identity, and generate increased cigarette sales. They also pursued promotions that tied cigarette sales to alcohol purchases, and cigarette promotional events frequently featured alcohol discounts or encouraged alcohol use. Tobacco companies' numerous marketing strategies linking cigarettes with alcohol may have reinforced the use of both substances. Because using tobacco and alcohol together makes it harder to quit smoking, policies prohibiting tobacco sales and promotion in establishments where alcohol is served and sold might mitigate this effect. Smoking cessation programs should address the effect that alcohol consumption has on tobacco use.
NADPH oxidases of the brain: distribution, regulation, and function.

PubMed

Infanger, David W; Sharma, Ram V; Davisson, Robin L

2006-01-01

The NADPH oxidase is a multi-subunit enzyme that catalyzes the reduction of molecular oxygen to form superoxide (O(2)(-)). While classically linked to the respiratory burst in neutrophils, recent evidence now shows that O(2)(-) (and associated reactive oxygen species, ROS) generated by NADPH oxidase in nonphagocytic cells serves myriad functions in health and disease. An entire new family of NADPH Oxidase (Nox) homologues has emerged, which vary widely in cell and tissue distribution, as well as in function and regulation. A major concept in redox signaling is that while NADPH oxidase-derived ROS are necessary for normal cellular function, excessive oxidative stress can contribute to pathological disease. This certainly is true in the central nervous system (CNS), where normal NADPH oxidase function appears to be required for processes such as neuronal signaling, memory, and central cardiovascular homeostasis, but overproduction of ROS contributes to neurotoxicity, neurodegeneration, and cardiovascular diseases. Despite implications of NADPH oxidase in normal and pathological CNS processes, still relatively little is known about the mechanisms involved. This paper summarizes the evidence for NADPH oxidase distribution, regulation, and function in the CNS, emphasizing the diversity of Nox isoforms and their new and emerging role in neuro-cardiovascular function. In addition, perspectives for future research and novel therapeutic targets are offered.
Group Work as Facilitation of Spiritual Development for Drug and Alcohol Abusers.

ERIC Educational Resources Information Center

Page, Richard C.; Berkow, Daniel N.

1998-01-01

Describes group work designed to promote spiritual development with drug and alcohol abusers. Provides a definition of spirituality. Discusses research that relates to the spiritual development of members of drug and alcohol groups. Compares the ways that group work and Alcoholics Anonymous promote spiritual development. (Author/MKA)
The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells

DTIC Science & Technology

2007-04-01

and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast
Gravity Responsive NADH Oxidase of the Plasma Membrane

NASA Technical Reports Server (NTRS)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
NADPH Oxidase Plays a Role on Ethanol-Induced Hypertension and Reactive Oxygen Species Generation in the Vasculature.

PubMed

Marchi, Katia Colombo; Ceron, Carla Speroni; Muniz, Jaqueline J; De Martinis, Bruno S; Tanus-Santos, José E; Tirapelli, Carlos Renato

2016-09-01

Investigate the role of NADPH oxidase on ethanol-induced hypertension and vascular oxidative stress. Male Wistar rats were treated with ethanol (20% v/v). Apocynin (10 mg/kg/day, i.p.) prevented ethanol-induced hypertension. The increased contractility of endothelium-intact and endothelium-denuded aortic rings from ethanol-treated rats to phenylephrine was prevented by apocynin. Ethanol consumption increased superoxide anion (O2 (-)) generation and lipid peroxidation and apocynin prevented these responses. The decrease on plasma and vascular nitrate/nitrite (NOx) levels induced by ethanol was not prevented by apocynin. Treatment with ethanol did not affect aortic levels of hydrogen peroxide (H2O2) or reduced glutathione (GSH). Ethanol did not alter the activities of xanthine oxidase (XO), superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx). Ethanol increased the expression of Nox1, PKCδ, nNOS, SAPK/JNK and SOD2 in the rat aorta and apocynin prevented these responses. No difference on aortic expression of Nox2, Nox4, p47phox, Nox organizer 1 (Noxo1), eNOS and iNOS was detected after treatment with ethanol. Ethanol treatment did not alter the phosphorylation of SAPK/JNK, p38MAPK, c-Src, Rac1 or PKCδ. The major new finding of our study is that the increased vascular generation of reactive oxygen species (ROS) induced by ethanol is related to increased vascular Nox1/NADPH oxidase expression. This mechanism is involved in vascular dysfunction and hypertension induced by ethanol. Additionally, we conclude that ethanol consumption induces the expression of different proteins that regulate vascular contraction and growth and that NADPH oxidase-derived ROS play a role in such response. The key findings of our study are that ethanol-induced hypertension is mediated by NADPH oxidase. Moreover, increased vascular Nox1 expression is related to the generation of reactive oxygen species (ROS) by ethanol. Finally, ROS induced by ethanol increase the
Renalase prevents AKI independent of amine oxidase activity.

PubMed

Wang, Ling; Velazquez, Heino; Moeckel, Gilbert; Chang, John; Ham, Ahrom; Lee, H Thomas; Safirstein, Robert; Desir, Gary V

2014-06-01

AKI is characterized by increased catecholamine levels and hypertension. Renalase, a secretory flavoprotein that oxidizes catecholamines, attenuates ischemic injury and the associated increase in catecholamine levels in mice. However, whether the amine oxidase activity of renalase is involved in preventing ischemic injury is debated. In this study, recombinant renalase protected human proximal tubular (HK-2) cells against cisplatin- and hydrogen peroxide-induced necrosis. Similarly, genetic depletion of renalase in mice (renalase knockout) exacerbated kidney injury in animals subjected to cisplatin-induced AKI. Interestingly, compared with the intact renalase protein, a 20-amino acid peptide (RP-220), which is conserved in all known renalase isoforms, but lacks detectable oxidase activity, was equally effective at protecting HK-2 cells against toxic injury and preventing ischemic injury in wild-type mice. Furthermore, in vitro treatment with RP-220 or recombinant renalase rapidly activated Akt, extracellular signal-regulated kinase, and p38 mitogen-activated protein kinases and downregulated c-Jun N-terminal kinase. In summary, renalase promotes cell survival and protects against renal injury in mice through the activation of intracellular signaling cascades, independent of its ability to metabolize catecholamines, and we have identified the region of renalase required for these effects. Renalase and related peptides show potential as therapeutic agents for the prevention and treatment of AKI. Copyright © 2014 by the American Society of Nephrology.
Lysyl Oxidase-like-2 (LOXL2) Is a Major Isoform in Chondrocytes and Is Critically Required for Differentiation*

PubMed Central

Iftikhar, Mussadiq; Hurtado, Paola; Bais, Manish V.; Wigner, Nate; Stephens, Danielle N.; Gerstenfeld, Louis C.; Trackman, Philip C.

2011-01-01

The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1–4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. PMID:21071451
1-Aminocyclopropane-1-carboxylic acid oxidase reaction mechanism and putative post-translational activities of the ACCO protein

PubMed Central

Dilley, David R.; Wang, Zhenyong; Kadirjan-Kalbach, Deena K.; Ververidis, Fillipos; Beaudry, Randolph; Padmanabhan, Kallaithe

2013-01-01

1-Aminocyclopropane-1-carboxylic acid (ACC) oxidase (ACCO) catalyses the final step in ethylene biosynthesis converting ACC to ethylene, cyanide, CO2, dehydroascorbate and water with inputs of Fe(II), ascorbate, bicarbonate (as activators) and oxygen. Cyanide activates ACCO. A ‘nest’ comprising several positively charged amino acid residues from the C-terminal α-helix 11 along with Lys158 and Arg299 are proposed as binding sites for ascorbate and bicarbonate to coordinately activate the ACCO reaction. The binding sites for ACC, bicarbonate and ascorbic acid for Malus domestica ACCO1 include Arg175, Arg244, Ser246, Lys158, Lys292, Arg299 and Phe300. Glutamate 297, Phe300 and Glu301 in α-helix 11 are also important for the ACCO reaction. Our proposed reaction pathway incorporates cyanide as an ACCO/Fe(II) ligand after reaction turnover. The cyanide ligand is likely displaced upon binding of ACC and ascorbate to provide a binding site for oxygen. We propose that ACCO may be involved in the ethylene signal transduction pathway not directly linked to the ACCO reaction. ACC oxidase has significant homology with Lycopersicon esculentum cysteine protease LeCp, which functions as a protease and as a regulator of 1-aminocyclopropane-1-carboxylic acid synthase (Acs2) gene expression. ACC oxidase may play a similar role in signal transduction after post-translational processing. ACC oxidase becomes inactivated by fragmentation and apparently has intrinsic protease and transpeptidase activity. ACC oxidase contains several amino acid sequence motifs for putative protein–protein interactions, phosphokinases and cysteine protease. ACC oxidase is subject to autophosphorylaton in vitro and promotes phosphorylation of some apple fruit proteins in a ripening-dependent manner. PMID:24244837
Endosomal NOX2 oxidase exacerbates virus pathogenicity and is a target for antiviral therapy.

PubMed

To, Eunice E; Vlahos, Ross; Luong, Raymond; Halls, Michelle L; Reading, Patrick C; King, Paul T; Chan, Christopher; Drummond, Grant R; Sobey, Christopher G; Broughton, Brad R S; Starkey, Malcolm R; van der Sluis, Renee; Lewin, Sharon R; Bozinovski, Steven; O'Neill, Luke A J; Quach, Tim; Porter, Christopher J H; Brooks, Doug A; O'Leary, John J; Selemidis, Stavros

2017-07-12

The imminent threat of viral epidemics and pandemics dictates a need for therapeutic approaches that target viral pathology irrespective of the infecting strain. Reactive oxygen species are ancient processes that protect plants, fungi and animals against invading pathogens including bacteria. However, in mammals reactive oxygen species production paradoxically promotes virus pathogenicity by mechanisms not yet defined. Here we identify that the primary enzymatic source of reactive oxygen species, NOX2 oxidase, is activated by single stranded RNA and DNA viruses in endocytic compartments resulting in endosomal hydrogen peroxide generation, which suppresses antiviral and humoral signaling networks via modification of a unique, highly conserved cysteine residue (Cys98) on Toll-like receptor-7. Accordingly, targeted inhibition of endosomal reactive oxygen species production abrogates influenza A virus pathogenicity. We conclude that endosomal reactive oxygen species promote fundamental molecular mechanisms of viral pathogenicity, and the specific targeting of this pathogenic process with endosomal-targeted reactive oxygen species inhibitors has implications for the treatment of viral disease.Production of reactive oxygen species is an ancient antimicrobial mechanism, but its role in antiviral defense in mammals is unclear. Here, To et al. show that virus infection activates endosomal NOX2 oxidase and restricts TLR7 signaling, and that an endosomal NOX2 inhibitor decreases viral pathogenicity.
Marketing messages in food and alcohol magazine advertisements, variations across type and nutritional content of promoted products: a content analysis.

PubMed

Pitts, A; Burke, W; Adams, J

2014-09-01

'Marketing messages' are the themes used in advertisements to promote products. We explored the frequency of different marketing messages used in food and alcohol advertisements in UK women's magazines and associations with the type and nutritional content of products promoted. All advertisements for food and alcohol in 108 issues of popular UK monthly women's magazines were identified and text-based marketing messages classified using a bespoke coding framework. This information was linked to existing data on the type (i.e. food group) and nutritional content of advertised products. A total of 2 687 marketing messages were identified in 726 advertisements. Consumer messages such as 'taste' and 'quality' were most frequently found. Marketing messages used in advertisements for food and alcohol were notably different. The relationship between type and nutritional content of products advertised and marketing messages used was not intuitive from a consumer perspective: advertisements for foods 'high in fat and/or sugar' were less likely to use messages related to health, but more likely to use messages emphasizing reduced amounts of specific nutrients. Almost all advertisements included consumer-related marketing messages. Marketing messages used were not always congruent with the type or nutritional content of advertised products. These findings should be considered when developing policy. © The Author 2013. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
27 CFR 10.24 - Sales promotion contests.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Sales promotion contests..., DEPARTMENT OF THE TREASURY ALCOHOL COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion contests. Sales contests sponsored by an industry member which offer prizes directly or indirectly to trade buyer...
Calcium transport in vesicles energized by cytochrome oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosier, Randy N.

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K + selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K + flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interactionmore » with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.« less
Alcohol Advertising on Social Media: Examining the Content of Popular Alcohol Brands on Instagram.

PubMed

Barry, Adam E; Padon, Alisa A; Whiteman, Shawn D; Hicks, Kristen K; Carreon, Amie K; Crowell, Jarrett R; Willingham, Kristen L; Merianos, Ashley L

2018-06-11

There is considerable evidence that exposure to alcohol marketing increases the likelihood of adolescents initiating and engaging in alcohol consumption. There is a paucity of research, however, specifically examining industry generated alcohol marketing occurring on social media/networking platforms. The purpose of this investigation was to analyze the content of promotional advertisements by alcohol brands on Instagram. For a 30-day period, Instagram profiles of 15 distinct alcohol brands were examined. Pictorial posts/updates from each profile were screen captured and individually documented. Approximately 184 distinct posts constituted our final sample. The Content Appealing to Youth Index was independently employed by two raters to assess each post. For each characteristic, Cohen's Kappa measures, and associated 95% confidence intervals, were calculated. Descriptive statistics were performed. Posts increased throughout the week and peaked on Thursday and Friday. The production value of the posts examined was generally high, frequently featuring color, texture, shine, contrast, faces, and action. Character appeals and use of youth-oriented genres were uncommon. Many of the posts used product appeals and physical benefits to consumption. The posts also emphasized the following rewarding appeal characteristics: positive emotional experiences, achievement, individuality, and camaraderie. The most commonly coded risk-related feature was inappropriate use. Conclusions/Importance: This investigation represents an initial attempt to provide insights into the content alcohol brands are including in their promotional materials on social networking sites.

Proline oxidase promotes tumor cell survival in hypoxic tumor microenvironments

PubMed Central

Liu, Wei; Glunde, Kristine; Bhujwalla, Zaver M.; Raman, Venu; Sharma, Anit; Phang, James M.

2012-01-01

Proline is a readily released stress substrate that can be metabolized by proline oxidase (POX) to generate either reactive oxygen species to induce apoptosis or autophagy or ATP during times of nutrient stress. However, the contribution of proline metabolism to tumorigenesis in hypoxic microenvironments has not been explored. In this study, we investigated the different functions of POX under hypoxia and glucose depletion. We found that hypoxia induced POX expression in cancer cells in vitro and that POX upregulation co-localized with hypoxic tissues in vivo. In addition, the combination of hypoxia and low-glucose showed additive effects on POX expression. Similar to conditions of low glucose, hypoxia-mediated POX induction was dependent on AMP-activated protein kinase (AMPK) activation, but was independent of HIF-1α and HIF-2α. Under low-glucose and combined low-glucose and hypoxic conditions, proline catabolized by POX was used preferentially for ATP production, whereas under hypoxia, POX mediated autophagic signaling for survival by generating ROS. Although the specific mechanism was different for hypoxia and glucose deprivation, POX consistently contributed to tumor cell survival under these conditions. Together, our findings offer new insights into the metabolic reprogramming of tumor cells present within a hostile microenvironment and suggest that proline metabolism is a potential target for cancer therapeutics. PMID:22609800
Prevention Interventions of Alcohol Problems in the Workplace

PubMed Central

Ames, Genevieve M.; Bennett, Joel B.

2011-01-01

The workplace offers advantages as a setting for interventions that result in primary prevention of alcohol abuse. Such programs have the potential to reach broad audiences and populations that would otherwise not receive prevention programs and, thereby, benefit both the employee and employer. Researchers have implemented and evaluated a variety of workplace alcohol problem prevention efforts in recent years, including programs focused on health promotion, social health promotion, brief interventions, and changing the work environment. Although some studies reported significant reductions in alcohol use outcomes, additional research with a stronger and integrated methodological approach is needed. The field of workplace alcohol prevention also might benefit from a guiding framework, such as the one proposed in this article. PMID:22330216
Ten years and 1 master settlement agreement later: the nature and frequency of alcohol and tobacco promotion in televised sports, 2000 through 2002.

PubMed

Zwarun, Lara

2006-08-01

I sought to identify what kinds of promotion for alcohol and tobacco products are found in televised sports programming, as well as how frequently they occur. I compared my findings with data from 5 and 10 years earlier to examine the effects of the Master Settlement Agreement and detect industry trends. Method. A content analysis of more than 83 hours of televised sports programming from 2000 through 2002 was conducted. Composite week sampling was used to ensure results were representative of the overall population of television sports programs. Programs were examined for traditional advertising (commercials) and nontraditional advertising (stadium signs, announcer voiceovers, etc.). Rates of certain types of alcohol advertising have decreased, but what remains is strategically chosen to increase the likelihood of audience exposure. Despite the Master Settlement Agreement, tobacco advertising remains prevalent in many sports. A new trend of placing alcohol and tobacco brand names in commercials for other products is evident. Alcohol and tobacco marketers appear able to cleverly adapt to advertising challenges, such as digital video recorders and legislation. Alcohol and tobacco brands remain visible on sports programming.
Biomimetic enzyme nanocomplexes and their use as antidotes and preventive measures for alcohol intoxication

NASA Astrophysics Data System (ADS)

Liu, Yang; Du, Juanjuan; Yan, Ming; Lau, Mo Yin; Hu, Jay; Han, Hui; Yang, Otto O.; Liang, Sheng; Wei, Wei; Wang, Hui; Li, Jianmin; Zhu, Xinyuan; Shi, Linqi; Chen, Wei; Ji, Cheng; Lu, Yunfeng

2013-03-01

Organisms have sophisticated subcellular compartments containing enzymes that function in tandem. These confined compartments ensure effective chemical transformation and transport of molecules, and the elimination of toxic metabolic wastes. Creating functional enzyme complexes that are confined in a similar way remains challenging. Here we show that two or more enzymes with complementary functions can be assembled and encapsulated within a thin polymer shell to form enzyme nanocomplexes. These nanocomplexes exhibit improved catalytic efficiency and enhanced stability when compared with free enzymes. Furthermore, the co-localized enzymes display complementary functions, whereby toxic intermediates generated by one enzyme can be promptly eliminated by another enzyme. We show that nanocomplexes containing alcohol oxidase and catalase could reduce blood alcohol levels in intoxicated mice, offering an alternative antidote and prophylactic for alcohol intoxication.
Reinforcement of Smoking and Drinking: Tobacco Marketing Strategies Linked With Alcohol in the United States

PubMed Central

Jiang, Nan

2011-01-01

Objectives. We investigated tobacco companies’ knowledge about concurrent use of tobacco and alcohol, their marketing strategies linking cigarettes with alcohol, and the benefits tobacco companies sought from these marketing activities. Methods. We performed systematic searches on previously secret tobacco industry documents, and we summarized the themes and contexts of relevant search results. Results. Tobacco company research confirmed the association between tobacco use and alcohol use. Tobacco companies explored promotional strategies linking cigarettes and alcohol, such as jointly sponsoring special events with alcohol companies to lower the cost of sponsorships, increase consumer appeal, reinforce brand identity, and generate increased cigarette sales. They also pursued promotions that tied cigarette sales to alcohol purchases, and cigarette promotional events frequently featured alcohol discounts or encouraged alcohol use. Conclusions. Tobacco companies’ numerous marketing strategies linking cigarettes with alcohol may have reinforced the use of both substances. Because using tobacco and alcohol together makes it harder to quit smoking, policies prohibiting tobacco sales and promotion in establishments where alcohol is served and sold might mitigate this effect. Smoking cessation programs should address the effect that alcohol consumption has on tobacco use. PMID:21852637
Brief Family Treatment Intervention to Promote Continuing Care Among Alcoholic Patients in Inpatient Detoxification: A Randomized Pilot Study

PubMed Central

O'Farrell, Timothy J.; Murphy, Marie; Alter, Jane; Fals-Stewart, William

2008-01-01

Alcoholic patients in inpatient detoxification were randomized to treatment as usual (TAU) or to a brief family treatment (BFT) intervention to promote continuing care post-detox. BFT consisted of meeting with the patient and an adult family member (in person or over the phone) with whom the patient lived, to review and recommend potential continuing care plans for the patient. Results showed that BFT patients (N=24), were significantly more likely than TAU patients (N=21), to enter a continuing care program after detoxification. This was a medium to large effect size. In the 3 months after detoxification, days using alcohol or drugs (a) trended lower for treatment-exposed BFT patients who had an in-person family meeting than TAU counterparts (medium effect), and (b) were significantly lower for patients who entered continuing care regardless of treatment condition (large effect). PMID:17614242
Health promotion interventions and policies addressing excessive alcohol use: a systematic review of national and global evidence as a guide to health-care reform in China.

PubMed

Li, Qing; Babor, Thomas F; Zeigler, Donald; Xuan, Ziming; Morisky, Donald; Hovell, Melbourne F; Nelson, Toben F; Shen, Weixing; Li, Bing

2015-01-01

Steady increases in alcohol consumption and related problems are likely to accompany China's rapid epidemiological transition and profit-based marketing activities. We reviewed research on health promotion interventions and policies to address excessive drinking and to guide health-care reform. We searched Chinese- and English-language databases and included 21 studies in China published between 1980 and 2013 that covered each policy area from the World Health Organization (WHO) Global Strategy to Reduce the Harmful Use of Alcohol. We evaluated and compared preventive interventions to the global alcohol literature for cross-national applicability. In contrast with hundreds of studies in the global literature, 11 of 12 studies from mainland China were published in Chinese; six of 10 in English were on taxation from Taiwan or Hong Kong. Most studies demonstrated effectiveness in reducing excessive drinking, and some reported the reduction of health problems. Seven were randomized controlled trials. Studies targeted schools, drink-driving, work-places, the health sector and taxation. China is the world's largest alcohol market, yet there has been little growth in alcohol policy research related to health promotion interventions over the past decade. Guided by a public health approach, the WHO Global Strategy and health reform experience in Russia, Australia, Mexico and the United States, China could improve its public health response through better coordination and implementation of surveillance and evidence-based research, and through programmatic and legal responses such as public health law research, screening and early intervention within health systems and the implementation of effective alcohol control strategies. © 2014 Society for the Study of Addiction.
Health promotion interventions and policies addressing excessive alcohol use: A systematic review of national and global evidence as a guide to health-care reform in China

PubMed Central

Li, Qing; Babor, Thomas F.; Zeigler, Donald; Xuan, Ziming; Morisky, Donald; Hovell, Melbourne F.; Nelson, Toben F.; Shen, Weixing; Li, Bing

2014-01-01

Aims Steady increases in alcohol consumption and related problems are likely to accompany China's rapid epidemiologic transition and profit-based marketing activities. We reviewed research on health promotion interventions and policies to address excessive drinking and to guide health-care reform. Methods We searched in Chinese and English language databases and included 21 studies in China published between 1980 and 2013 that covered each policy area from the WHO Global Strategy to Reduce the Harmful Use of Alcohol. We evaluated and compared preventive interventions to the global alcohol literature for cross-national applicability. Results In contrast with hundreds of studies in the global literature, 11 of 12 studies from mainland China were published in Chinese; six of ten in English were on taxation from Taiwan or Hong Kong. Most studies demonstrated effectiveness in reducing excessive drinking, and some reported the reduction of health problems. Seven were randomized controlled trials. Studies targeted schools, drink-driving, workplaces, the health sector, and taxation. Conclusions China is the world's largest alcohol market, yet there has been little growth in alcohol policy research related to health promotion interventions over the past decade. Guided by a public health approach, the WHO Global Strategy, and health reform experience in Russia, Australia, Mexico, and the USA, China could improve its public health response through better coordination and implementation of surveillance and evidence-based research, and through programmatic and legal responses such as public health law research, screening and early intervention within health systems, and the implementation of effective alcohol control strategies. PMID:25533866
Pacific oyster polyamine oxidase: a protein missing link in invertebrate evolution.

PubMed

Cervelli, Manuela; Polticelli, Fabio; Angelucci, Emanuela; Di Muzio, Elena; Stano, Pasquale; Mariottini, Paolo

2015-05-01

Polyamine oxidases catalyse the oxidation of polyamines and acetylpolyamines and are responsible for the polyamine interconversion metabolism in animal cells. Polyamine oxidases from yeast can oxidize spermine, N(1)-acetylspermine, and N(1)-acetylspermidine, while in vertebrates two different enzymes, namely spermine oxidase and acetylpolyamine oxidase, specifically catalyse the oxidation of spermine, and N(1)-acetylspermine/N(1)-acetylspermidine, respectively. In this work we proved that the specialized vertebrate spermine and acetylpolyamine oxidases have arisen from an ancestor invertebrate polyamine oxidase with lower specificity for polyamine substrates, as demonstrated by the enzymatic activity of the mollusc polyamine oxidase characterized here. This is the first report of an invertebrate polyamine oxidase, the Pacific oyster Crassostrea gigas (CgiPAO), overexpressed as a recombinant protein. This enzyme was biochemically characterized and demonstrated to be able to oxidase both N(1)-acetylspermine and spermine, albeit with different efficiency. Circular dichroism analysis gave an estimation of the secondary structure content and modelling of the three-dimensional structure of this protein and docking studies highlighted active site features. The availability of this pluripotent enzyme can have applications in crystallographic studies and pharmaceutical biotechnologies, including anticancer therapy as a source of hydrogen peroxide able to induce cancer cell death.
Evolution of cytochrome oxidase, an enzyme older than atmospheric oxygen.

PubMed

Castresana, J; Lübben, M; Saraste, M; Higgins, D G

1994-06-01

Cytochrome oxidase is a key enzyme in aerobic metabolism. All the recorded eubacterial (domain Bacteria) and archaebacterial (Archaea) sequences of subunits 1 and 2 of this protein complex have been used for a comprehensive evolutionary analysis. The phylogenetic trees reveal several processes of gene duplication. Some of these are ancient, having occurred in the common ancestor of Bacteria and Archaea, whereas others have occurred in specific lines of Bacteria. We show that eubacterial quinol oxidase was derived from cytochrome c oxidase in Gram-positive bacteria and that archaebacterial quinol oxidase has an independent origin. A considerable amount of evidence suggests that Proteobacteria (Purple bacteria) acquired quinol oxidase through a lateral gene transfer from Gram-positive bacteria. The prevalent hypothesis that aerobic metabolism arose several times in evolution after oxygenic photosynthesis, is not sustained by two aspects of the molecular data. First, cytochrome oxidase was present in the common ancestor of Archaea and Bacteria whereas oxygenic photosynthesis appeared in Bacteria. Second, an extant cytochrome oxidase in nitrogen-fixing bacteria shows that aerobic metabolism is possible in an environment with a very low level of oxygen, such as the root nodules of leguminous plants. Therefore, we propose that aerobic metabolism in organisms with cytochrome oxidase has a monophyletic and ancient origin, prior to the appearance of eubacterial oxygenic photosynthetic organisms.
Alcohol-related aggression-social and neurobiological factors.

PubMed

Beck, Anne; Heinz, Andreas

2013-10-01

Alcohol-related aggression and violence are a widespread cause of personal suffering with high socioeconomic costs. In 2011, nearly one in three violent acts in Germany was committed under the influence of alcohol (31.8%). The link between alcohol consumption and aggression is promoted by various interacting factors. In this review, based on a selective search for pertinent literature in PubMed, we analyze and summarize information from original articles, reviews, and book chapters about alcohol and aggression and discuss the neurobiological basis of aggressive behavior. Aggression is promoted both by the cognitive deficits arising in connection with acute or chronic alcohol use and by prior experience of violence in particular situations where alcohol was drunk. Only a minority of persons who drink alcohol become aggressive. On the other hand, alcohol abuse and dependence together constitute the second most commonly diagnosed cause of suicide (15-43%). Current research indicates that the individual tendency toward alcohol-induced aggression depends not just on neurobiological factors, but also on personal expectations of the effects of alcohol, on prior experience of violent conflicts, and on the environmental conditions of early childhood, especially social exclusion and discrimination. Gene-environment interactions affecting the serotonergic and other neurotransmitter systems play an important role. Potential (but not yet adequately validated) therapeutic approaches involve reinforcing cognitive processes or pharmacologically modulating serotonergic neurotransmission (and other target processes). Alcohol-related aggression has manifold social and neurobiological causes. Specific treatments must be tested in controlled trials.
Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

PubMed

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Public attitudes to the regulation of alcohol.

PubMed

McAllister, I

1995-01-01

Public support for the regulation of alcohol is central to government policies aimed at reducing consumption. This study uses a nationally representative population survey conducted in 1993 (n = 3500) to examine public support for 11 separate policies designed to reduce alcohol consumption. The results show that the respondents see these 11 policies in terms of three distinct approaches to alcohol regulation: availability (for example, reducing the number of retail outlets); control (for example, stricter enforcement of laws against serving underage customers); and promotion (for example, restricting alcohol advertising on television). There is strong public support for policies that control alcohol use and, with the exception of restricting alcohol sponsorship of sporting events, for moves to curb the promotion of alcohol. However, public opinion is evenly divided on moves to restrict availability, with the single exception of raising the minimum legal drinking age, which attracts majority support. Women, older people, the less educated, immigrants and abstainers or less frequent drinkers are generally most likely to support more restrictions. By state and territory, Tasmanians are most restrictive in their views, residents of the Northern Territory most liberal. The findings highlight the difficulties that governments will face in restricting the availability of alcohol.
Inhibition of Human Vascular NADPH Oxidase by Apocynin Derived Oligophenols

PubMed Central

Mora-Pale, Mauricio; Weïwer, Michel; Yu, Jingjing; Linhardt, Robert J.; Dordick, Jonathan S.

2009-01-01

Enzymatic oxidation of apocynin, which may mimic in vivo metabolism, affords a large number of oligomers (apocynin oxidation products, AOP) that inhibit vascular NADPH oxidase. In vitro studies of NADPH oxidase activity were performed to identify active inhibitors, resulting in a trimer hydroxylated quinone (IIIHyQ) that inhibited NADPH oxidase with an IC50 = 31 nM. Apocynin itself possessed minimal inhibitory activity. NADPH oxidase is believed to be inhibited through prevention of the interaction between two NADPH oxidase subunits, p47phox and p22phox. To that end, while apocynin was unable to block the interaction of his-tagged p47phox with a surface immobilized biotinalyted p22phox peptide, the IIIHyQ product strongly interfered with this interaction (apparent IC50 = 1.6 μM). These results provide evidence that peroxidase-catalyzed AOP, which consist of oligomeric phenols and quinones, inhibit critical interactions that are involved in the assembly and activation of human vascular NADPH oxidase. PMID:19523836
Current status of NADPH oxidase research in cardiovascular pharmacology.

PubMed

Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Alvarez, Ezequiel

2013-01-01

The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Current status of NADPH oxidase research in cardiovascular pharmacology

PubMed Central

Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

2013-01-01

The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new
Exposure to alcohol advertising and alcohol consumption among Australian adolescents.

PubMed

Jones, Sandra C; Magee, Christopher A

2011-01-01

Underage drinking is a major problem in Australia and may be influenced by exposure to alcohol advertising. The objective of the present study was to collect data on 12-17 year old Australian adolescents' exposure to different types of alcohol advertising and examine the association between exposure to advertising and alcohol consumption. A cross-sectional survey of 1113 adolescents aged 12-17 years recruited with a variety of methods to gain a cross-section of participants across metropolitan, regional and rural New South Wales (including independent schools, mall intercepts and online). Participants answered a series of questions assessing adolescents' exposure to alcohol advertising across eight media (including television, Internet and point-of-sale). Alcohol consumption was assessed using three questions (initiation, recent consumption and frequency of consumption in the previous 12 months). The majority indicated that they had been exposed to alcohol advertisements on television, in newspapers and magazines, on the Internet, on billboards/posters and promotional materials and in bottleshops, bars and pubs; exposure to some of these types of alcohol advertisements was associated with increased alcohol consumption, with differences by age and gender. The results are consistent with studies from other countries and suggest that exposure to alcohol advertisements among Australian adolescents is strongly associated with drinking patterns. Given current high levels of drinking among Australian youth, these findings suggest the need to address the high levels of young people's exposure to alcohol advertising.
Amine oxidase-based biosensors for spermine and spermidine determination.

PubMed

Boffi, Alberto; Favero, Gabriele; Federico, Rodolfo; Macone, Alberto; Antiochia, Riccarda; Tortolini, Cristina; Sanzó, Gabriella; Mazzei, Franco

2015-02-01

The present work describes the development and optimization of electrochemical biosensors for specific determination of the biogenic polyamine spermine (Spm) and spermidine (Spmd) whose assessment represents a novel important analytical tool in food analysis and human diagnostics. These biosensors have been prepared using novel engineered enzymes: polyamine oxidase (PAO) endowed with selectivity towards Spm and Spmd and spermine oxidase (SMO) characterized by strict specificity towards Spm. The current design entails biosensors in which the enzymes were entrapped in poly(vinyl alcohol) bearing styrylpyridinium groups (PVA-SbQ), a photocrosslinkable gel, onto an electrode surface. Screen-printed electrodes (SPEs) were used as electrochemical transducers for enzymatically produced hydrogen peroxide, operating at different potential vs Ag/AgCl according to the material of the working electrode (WE): +700 mV for graphite (GP) or -100 mV for Prussian blue (PB)-modified SPE, respectively. Biosensor performances were evaluated by means of flow injection amperometric (FIA) measurements. The modified electrodes showed good sensitivity, long-term stability and reproducibility. Under optimal conditions, the PAO biosensor showed a linear range 0.003-0.3 mM for Spm and 0.01-0.4 mM for Spmd, while with the SMO biosensor, a linear range of 0.004-0.5 mM for Spm has been obtained. The main kinetic parameters apparent Michaelis constant (K M), turnover number (K cat) and steady-state current (I max) were determined. The proposed device was then applied to the determination of biogenic amines in blood samples. The results obtained were in good agreement with those obtained with the GC-MS reference method.
SIRT1 inhibits NADPH oxidase activation and protects endothelial function in the rat aorta: implications for vascular aging.

PubMed

Zarzuelo, María José; López-Sepúlveda, Rocío; Sánchez, Manuel; Romero, Miguel; Gómez-Guzmán, Manuel; Ungvary, Zoltan; Pérez-Vizcaíno, Francisco; Jiménez, Rosario; Duarte, Juan

2013-05-01

Vascular aging is characterized by up-regulation of NADPH oxidase, oxidative stress and endothelial dysfunction. Previous studies demonstrate that the activity of the evolutionarily conserved NAD(+)-dependent deacetylase SIRT1 declines with age and that pharmacological activators of SIRT1 confer significant anti-aging cardiovascular effects. To determine whether dysregulation of SIRT1 promotes NADPH oxidase-dependent production of reactive oxygen species (ROS) and impairs endothelial function we assessed the effects of three structurally different inhibitors of SIRT1 (nicotinamide, sirtinol, EX527) in aorta segments isolated from young Wistar rats. Inhibition of SIRT1 induced endothelial dysfunction, as shown by the significantly reduced relaxation to the endothelium-dependent vasodilators acetylcholine and the calcium ionophore A23187. Endothelial dysfunction induced by SIRT1 inhibition was prevented by treatment of the vessels with the NADPH oxidase inhibitor apocynin or superoxide dismutase. Inhibition of SIRT1 significantly increased vascular superoxide production, enhanced NADPH oxidase activity, and mRNA expression of its subunits p22(phox) and NOX4, which were prevented by resveratrol. Peroxisome proliferator-activated receptor-α (PPARα) activation mimicked the effects of resveratrol while PPARα inhibition prevented the effects of this SIRT1 activator. SIRT1 co-precipitated with PPARα and nicotinamide increased the acetylation of the PPARα coactivator PGC-1α, which was suppressed by resveratrol. In conclusion, impaired activity of SIRT1 induces endothelial dysfunction and up-regulates NADPH oxidase-derived ROS production in the vascular wall, mimicking the vascular aging phenotype. Moreover, a new mechanism for controlling endothelial function after SIRT1 activation involves a decreased PGC-1α acetylation and the subsequent PPARα activation, resulting in both decreased NADPH oxidase-driven ROS production and NO inactivation. Copyright © 2013
The role of promotion in alcoholism treatment marketing.

PubMed

Jones, M A; Self, D R; Owens, C A; Kline, T A

1988-01-01

This article is an overview of the promotion function as a part of the ATM's marketing mix. It approaches various promotion decision areas from a managerial perspective, focusing upon some key components of promotion planning. Rather than provide specific operational or implementation details (how to write a brochure) it is more conceptual in nature and offers a framework for promotion planners. The article addresses promotion management, promotion objectives, analysis for promotion planning, the promotion mix, and addresses the benefits and limitations of some specific promotion tools available to the ATM manager. It treats ATMs as a service and reveals specific implications for promotion strategy dictated by services. The article also reports promotion tools employed by Alabama ATMs citing data from the Alabama study.

Alcohol advertising and youth: a measured approach.

PubMed

Jernigan, David H; Ostroff, Joshua; Ross, Craig

2005-09-01

Where alcohol industry self-regulation is the primary protection against youth exposure to alcohol advertising, independent, systematic monitoring of youth exposure can promote public awareness of and greater accountability in the industry's practices. Using commercially available databases, the Center on Alcohol Marketing and Youth has combined occurrence and audience data to calculate youth (aged 12-20 years) and adult (above the United States legal drinking age of 21 years) exposure to alcohol advertising on television and radio, in magazines and on the Internet. This research in the United States shows that alcohol companies have placed significant amounts of advertising where youth are more likely per capita to be exposed to it than adults. Further analyses by the Center have demonstrated that much of this excess exposure of youth to alcohol advertising in the United States could be eliminated if alcohol companies would adopt a threshold of 15% (roughly the proportion of 12-20-years-old in the population 12 and above) as the maximum youth audience composition for their advertising. Although adoption of such a threshold would still leave much youth exposure to alcohol marketing in such "unmeasured" activities as sponsorships, on-premise promotions and campus marketing, it would assist alcohol companies in reaching their intended audiences more efficiently while reducing overall youth exposure to their advertising.
Oxygen activation in flavoprotein oxidases: the importance of being positive.

PubMed

Gadda, Giovanni

2012-04-03

The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.
The First Mammalian Aldehyde Oxidase Crystal Structure

PubMed Central

Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

2012-01-01

Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336
Genetics of Lesch's typology of alcoholism.

PubMed

Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

2008-02-15

It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.
CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

PubMed Central

Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

2013-01-01

Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a
The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

ERIC Educational Resources Information Center

Jones, Sandra C.; Smith, Kylie M.

2011-01-01

This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…
Augmenter of Liver Regeneration (alr) Promotes Liver Outgrowth during Zebrafish Hepatogenesis

PubMed Central

Li, Yan; Farooq, Muhammad; Sheng, Donglai; Chandramouli, Chanchal; Lan, Tian; Mahajan, Nilesh K.; Kini, R. Manjunatha; Hong, Yunhan; Lisowsky, Thomas; Ge, Ruowen

2012-01-01

Augmenter of Liver Regeneration (ALR) is a sulfhydryl oxidase carrying out fundamental functions facilitating protein disulfide bond formation. In mammals, it also functions as a hepatotrophic growth factor that specifically stimulates hepatocyte proliferation and promotes liver regeneration after liver damage or partial hepatectomy. Whether ALR also plays a role during vertebrate hepatogenesis is unknown. In this work, we investigated the function of alr in liver organogenesis in zebrafish model. We showed that alr is expressed in liver throughout hepatogenesis. Knockdown of alr through morpholino antisense oligonucleotide (MO) leads to suppression of liver outgrowth while overexpression of alr promotes liver growth. The small-liver phenotype in alr morphants results from a reduction of hepatocyte proliferation without affecting apoptosis. When expressed in cultured cells, zebrafish Alr exists as dimer and is localized in mitochondria as well as cytosol but not in nucleus or secreted outside of the cell. Similar to mammalian ALR, zebrafish Alr is a flavin-linked sulfhydryl oxidase and mutation of the conserved cysteine in the CxxC motif abolishes its enzymatic activity. Interestingly, overexpression of either wild type Alr or enzyme-inactive AlrC131S mutant promoted liver growth and rescued the liver growth defect of alr morphants. Nevertheless, alr C131S is less efficacious in both functions. Meantime, high doses of alr MOs lead to widespread developmental defects and early embryonic death in an alr sequence-dependent manner. These results suggest that alr promotes zebrafish liver outgrowth using mechanisms that are dependent as well as independent of its sulfhydryl oxidase activity. This is the first demonstration of a developmental role of alr in vertebrate. It exemplifies that a low-level sulfhydryl oxidase activity of Alr is essential for embryonic development and cellular survival. The dose-dependent and partial suppression of alr expression through MO
The cytochrome bd-I respiratory oxidase augments survival of multidrug-resistant Escherichia coli during infection.

PubMed

Shepherd, Mark; Achard, Maud E S; Idris, Adi; Totsika, Makrina; Phan, Minh-Duy; Peters, Kate M; Sarkar, Sohinee; Ribeiro, Cláudia A; Holyoake, Louise V; Ladakis, Dimitrios; Ulett, Glen C; Sweet, Matthew J; Poole, Robert K; McEwan, Alastair G; Schembri, Mark A

2016-10-21

Nitric oxide (NO) is a toxic free radical produced by neutrophils and macrophages in response to infection. Uropathogenic Escherichia coli (UPEC) induces a variety of defence mechanisms in response to NO, including direct NO detoxification (Hmp, NorVW, NrfA), iron-sulphur cluster repair (YtfE), and the expression of the NO-tolerant cytochrome bd-I respiratory oxidase (CydAB). The current study quantifies the relative contribution of these systems to UPEC growth and survival during infection. Loss of the flavohemoglobin Hmp and cytochrome bd-I elicit the greatest sensitivity to NO-mediated growth inhibition, whereas all but the periplasmic nitrite reductase NrfA provide protection against neutrophil killing and promote survival within activated macrophages. Intriguingly, the cytochrome bd-I respiratory oxidase was the only system that augmented UPEC survival in a mouse model after 2 days, suggesting that maintaining aerobic respiration under conditions of nitrosative stress is a key factor for host colonisation. These findings suggest that while UPEC have acquired a host of specialized mechanisms to evade nitrosative stresses, the cytochrome bd-I respiratory oxidase is the main contributor to NO tolerance and host colonisation under microaerobic conditions. This respiratory complex is therefore of major importance for the accumulation of high bacterial loads during infection of the urinary tract.
An Internet-Based Intervention to Promote Alcohol-Related Attitudinal and Behavioral Change Among Adolescents: Protocol of a Cluster Randomized Controlled Trial.

PubMed

Ip, Patrick; Chan, Ko-Ling; Chow, Chun-Bong; Lam, Tai-Hing; Ho, Sai-Yin; Wong, Wilfred Hing-Sang; Wong, Margaret Fung-Yee

2016-06-01

Underage drinking is a prevalent risk behavior and common public health problem. Research shows that alcohol abuse not only affects the quality of life of drinkers themselves. The problems resulting from underage drinking pose substantial costs to society as well. The proposed study will address underage drinking with the use of an Internet campaign, which is a cost-effective way of tackling the problem. The aims of this study are to test the effectiveness of an online quiz competition in changing adolescents' alcohol-related attitudes and behavior and to explore the feasibility of using Internet viral marketing to reach a significant number of adolescents. The study will constitute a cluster randomized controlled trial for 20 secondary schools (6720 Grade 7-9 students). Schools will be randomized to intervention or control arm with equal likelihood. Students in intervention schools will be invited to take part in the Internet campaign, whereas those in control schools will receive relevant promotional leaflets. Alcohol-related attitude and behavior will be the primary outcome measures. The results of the proposed study will provide evidence on the efficacy of an Internet intervention in modifying adolescents' attitudes and behavior and guide further investigation into the prevention of and intervention in such risk behaviors as underage drinking. The project was funded July 2015, enrollment started September 2015, and results are expected July 2017. With the Internet increasingly being recognized as a practical and cost-effective platform for health information delivery, the proposed Internet-based intervention is expected to be more effective in altering adolescents' alcohol-related attitudes and behaviors than traditional health promotion. ClinicalTrials.gov NCT02450344; https://clinicaltrials.gov/ct2/show/NCT02450344 (Archived by WebCite at http://www.webcitation.org/6heB2zMBD).
An Internet-Based Intervention to Promote Alcohol-Related Attitudinal and Behavioral Change Among Adolescents: Protocol of a Cluster Randomized Controlled Trial

PubMed Central

Chan, Ko-Ling; Chow, Chun-Bong; Lam, Tai-Hing; Ho, Sai-Yin; Wong, Wilfred Hing-Sang; Wong, Margaret Fung-Yee

2016-01-01

Background Underage drinking is a prevalent risk behavior and common public health problem. Research shows that alcohol abuse not only affects the quality of life of drinkers themselves. The problems resulting from underage drinking pose substantial costs to society as well. The proposed study will address underage drinking with the use of an Internet campaign, which is a cost-effective way of tackling the problem. Objective The aims of this study are to test the effectiveness of an online quiz competition in changing adolescents’ alcohol-related attitudes and behavior and to explore the feasibility of using Internet viral marketing to reach a significant number of adolescents. Methods The study will constitute a cluster randomized controlled trial for 20 secondary schools (6720 Grade 7-9 students). Schools will be randomized to intervention or control arm with equal likelihood. Students in intervention schools will be invited to take part in the Internet campaign, whereas those in control schools will receive relevant promotional leaflets. Results Alcohol-related attitude and behavior will be the primary outcome measures. The results of the proposed study will provide evidence on the efficacy of an Internet intervention in modifying adolescents’ attitudes and behavior and guide further investigation into the prevention of and intervention in such risk behaviors as underage drinking. The project was funded July 2015, enrollment started September 2015, and results are expected July 2017. Conclusions With the Internet increasingly being recognized as a practical and cost-effective platform for health information delivery, the proposed Internet-based intervention is expected to be more effective in altering adolescents’ alcohol-related attitudes and behaviors than traditional health promotion. ClinicalTrial ClinicalTrials.gov NCT02450344; https://clinicaltrials.gov/ct2/show/NCT02450344 (Archived by WebCite at http://www.webcitation.org/6heB2zMBD) PMID:27252072
A promoter polymorphism in the monoamine oxidase A gene is associated with the pineal MAOA activity in Alzheimer's disease patients.

PubMed

Wu, Ying-Hui; Fischer, David F; Swaab, Dick F

2007-09-05

Monoamine oxidase A (MAOA) is involved in the pathogenesis of mood disorders and Alzheimer's disease (AD). MAOA activity and gene expression have been found to be up-regulated in different brain areas of AD patients, including the pineal gland. Increased pineal MAOA activity might contribute to the reduced pineal melatonin production in AD. A promoter polymorphism of a variable number tandem repeats (VNTR) in the MAOA gene shows to affect MAOA transcriptional activity in vitro. Here we examined in 63 aged controls and 44 AD patients the effects of the MAOA-VNTR on MAOA gene expression and activity in the pineal gland as endophenotypes, and on melatonin production. AD patients carrying long MAOA-VNTR genotype (consisting of 3.5- or 4-repeat alleles) showed higher MAOA gene expression and activity than the short-genotyped (i.e., 3-repeat allele) AD patients. Moreover, the AD-related up-regulation of MAOA showed up only among long-genotype bearing subjects. There was no significant effect of the MAOA-VNTR on MAOA activity or gene expression in controls, or on melatonin production in both controls and AD patients. Our data suggest that the MAOA-VNTR affects the activity and gene expression of MAOA in the brain of AD patients, and is involved in the changes of monoamine metabolism.
THE PREPARATION AND PROPERTIES OF HIGHLY PURIFIED ASCORBIC ACID OXIDASE

PubMed Central

Powers, Wendell H.; Lewis, Stanley; Dawson, Charles R.

1944-01-01

1. A method is described for the preparation of a highly purified ascorbic acid oxidase containing 0.24 per cent copper. 2. Using comparable activity measurements, this oxidase is about one and a half times as active on a dry weight basis as the hitherto most highly purified preparation described by Lovett-Janison and Nelson. The latter contained 0.15 per cent copper. 3. The oxidase activity is proportional to the copper content and the proportionality factor is the same as that reported by Lovett-Janison and Nelson. 4. When dialyzed free of salt, the blue concentrated oxidase solutions precipitate a dark green-blue protein which carries the activity. This may be prevented by keeping the concentrated solutions about 0.1 M in Na2HPO4. 5. When highly diluted for activity measurements the oxidase rapidly loses activity (irreversibly) previous to the measurement, unless the dilution is made with a dilute inert protein (gelatin) solution. Therefore activity values obtained using such gelatin-stabilized dilute solutions of the oxidase run considerably higher than values obtained by the Lovett-Janison and Nelson technique. 6. The effect of pH and substrate concentration on the activity of the purified oxidase in the presence and absence of inert protein was studied. PMID:19873382
[Monoamine oxidase activity in rat pineal gland: comparison with brain areas, alteration during aging].

PubMed

Razygraev, A V; Taborskaya, K I; Volovik, K Yu; Bunina, A A; Petrosyan, M A

Using benzylamine as a substrate, the amine oxidase activity was determined in the pineal gland of adult rats and compared with the same activity in brain areas and pituitary. Two groups of rats aged 6-8 and 14-15 months were also compared on the basis of this activity. Benzylamine deaminating activity in the pineal gland was significantly higher than in the area preoptica medialis, the corpus mamillare, the tuberculum olfactorium, and the hypophysis, and lower than in the eminentia mediana. The significant increase of the activity in the pineal gland in animals of age from 6-8 to 14-15-months was revealed. Benzylamine deaminating activity in the pineal gland was totally inhibited by 0,002 mM R deprenyl, indicating the B type monoamine oxidase (MAO B) activity. Age-associated increase of MAO B activity in the pineal gland accompanied by decrease of glutathione peroxidase activity, reported earlier, can promote the oxidative damage in the pineal gland during aging.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

PubMed

Gudkova, O O; Latyshko, N V; Shandrenko, S G

2016-01-01

In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
Lignin and veratryl alcohol are not inducers of the ligninolytic system of Phanerochaete chrysosporium.

PubMed Central

Cancel, A M; Orth, A B; Tien, M

1993-01-01

Phanerochaete chrysosporium is a white rot fungus which secretes a family of lignin-degrading enzymes under nutrient limitation. In this work, we investigated the roles of veratryl alcohol and lignin in the ligninolytic system of P. chrysosporium BKM-F-1767 cultures grown under nitrogen-limited conditions. Cultures supplemented with 0.4 to 2 mM veratryl alcohol showed increased lignin peroxidase activity. Addition of veratryl alcohol had no effect on Mn-dependent peroxidase activity and inhibited glyoxal oxidase activity. Azure-casein analysis of acidic proteases in the extracellular fluid showed that protease activity decreased during the early stages of secondary metabolism while lignin peroxidase activity was at its peak, suggesting that proteolysis was not involved in the regulation of lignin peroxidase activity during early secondary metabolism. In cultures supplemented with lignin or veratryl alcohol, no induction of mRNA coding for lignin peroxidase H2 or H8 was observed. Veratryl alcohol protected lignin peroxidase isozymes H2 and H8 from inactivation by H2O2. We conclude that veratryl alcohol acts as a stabilizer of lignin peroxidase activity and not as an inducer of lignin peroxidase synthesis. Images PMID:8215363
Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.
Heterologous expression and characterization of mouse spermine oxidase.

PubMed

Cervelli, Manuela; Polticelli, Fabio; Federico, Rodolfo; Mariottini, Paolo

2003-02-14

Polyamine oxidases are key enzymes responsible of the polyamine interconversion metabolism in animal cells. Recently, a novel enzyme belonging to this class of enzymes has been characterized for its capability to oxidize preferentially spermine and designated as spermine oxidase. This is a flavin adenine dinucleotide-containing enzyme, and it has been expressed both in vitro and in vivo systems. The primary structure of mouse spermine oxidase (mSMO) was deduced from a cDNA clone (Image Clone 264769) recovered by a data base search utilizing the human counterpart of polyamine oxidases, PAOh1. The open reading frame predicts a 555-amino acid protein with a calculated M(r) of 61,852.30, which shows a 95.1% identity with PAOh1. To understand the biochemical properties of mSMO and its structure/function relationship, the mSMO cDNA has been subcloned and expressed in secreted and secreted-tagged forms into Escherichia coli BL21 DE3 cells. The recombinant enzyme shows an optimal pH value of 8.0 and is able to oxidize rapidly spermine to spermidine and 3-aminopropanal and fails to act upon spermidine and N(1)-acetylpolyamines. The purified recombinant-tagged form enzyme (M(r) approximately 68,000) has K(m) and k(cat) values of 90 microm and 4.5 s(-1), respectively, using spermine as substrate at pH 8.0. Molecular modeling of mSMO protein based on maize polyamine oxidase three-dimensional structure suggests that the general features of maize polyamine oxidase active site are conserved in mSMO.
Ten Years and 1 Master Settlement Agreement Later: The Nature and Frequency of Alcohol and Tobacco Promotion in Televised Sports, 2000 Through 2002

PubMed Central

Zwarun, Lara

2006-01-01

Objectives. I sought to identify what kinds of promotion for alcohol and tobacco products are found in televised sports programming, as well as how frequently they occur. I compared my findings with data from 5 and 10 years earlier to examine the effects of the Master Settlement Agreement and detect industry trends. Method. A content analysis of more than 83 hours of televised sports programming from 2000 through 2002 was conducted. Composite week sampling was used to ensure results were representative of the overall population of television sports programs. Programs were examined for traditional advertising (commercials) and nontraditional advertising (stadium signs, announcer voiceovers, etc.). Results. Rates of certain types of alcohol advertising have decreased, but what remains is strategically chosen to increase the likelihood of audience exposure. Despite the Master Settlement Agreement, tobacco advertising remains prevalent in many sports. A new trend of placing alcohol and tobacco brand names in commercials for other products is evident. Conclusions. Alcohol and tobacco marketers appear able to cleverly adapt to advertising challenges, such as digital video recorders and legislation. Alcohol and tobacco brands remain visible on sports programming. PMID:16809598
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

PubMed

Löw, Hans; Crane, Frederick L; Morré, D James

2012-11-01

The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

PubMed

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

Brief family treatment intervention to promote continuing care among alcohol-dependent patients in inpatient detoxification: a randomized pilot study.

PubMed

O'Farrell, Timothy J; Murphy, Marie; Alter, Jane; Fals-Stewart, William

2008-04-01

Alcohol-dependent patients in inpatient detoxification were randomized to treatment-as-usual (TAU) intervention or brief family treatment (BFT) intervention to promote continuing care postdetoxification. BFT consisted of meeting with the patient and an adult family member (in person or over the phone) with whom the patient lived to review and recommend potential continuing care plans for the patient. Results showed that BFT patients (n = 24) were significantly more likely than TAU patients (n = 21) to enter a continuing care program after detoxification. This was a medium to large effect size. In the 3 months after detoxification, days using alcohol or drugs (a) trended lower for treatment-exposed BFT patients who had an in-person family meeting than for TAU counterparts (medium effect), and (b) were significantly lower for patients who entered continuing care regardless of treatment condition (large effect).
Ginsenoside-free molecules from steam-dried ginseng berry promote ethanol metabolism: an alternative choice for an alcohol hangover.

PubMed

Lee, Do Ik; Kim, Seung Tae; Lee, Dong Hoon; Yu, Jung Min; Jang, Su Kil; Joo, Seong Soo

2014-07-01

Ethanol metabolism produces harmful compounds that contribute to liver damage and cause an alcohol hangover. The intermediate metabolite acetaldehyde is responsible for alcohol hangover and CYP2E1-induced reactive oxygen species damage liver tissues. In this study, we examined whether ginsenoside-free molecules (GFMs) from steam-dried ginseng berries promote ethanol metabolism and scavenge free radicals by stimulating primary enzymes (alcohol dehydrogenase, aldehyde dehydrogenase, CYP2E1, and catalase) and antioxidant effects using in vitro and in vivo models. The results revealed that GFM effectively scavenged 2,2-diphenyl-1-picrylhydrazyl hydrate radicals and hydroxyl radicals. Notably, GFM significantly enhanced the expression of primary enzymes within 2 h in HepG2 cells. GFM clearly removed the consumed ethanol and significantly reduced the level of acetaldehyde as well as enhancement of primary gene expression in BALB/c mice. Moreover, GFM successfully protected HepG2 cells from ethanol attack. Of the major components identified in GFM, it was believed that linoleic acid was the most active ingredient. Based on these findings, we conclude that GFM holds promise for use as a new candidate for ethanol metabolism and as an antihangover agent. © 2014 Institute of Food Technologists®
Assessment of the cerebellar neurotoxic effects of nicotine in prenatal alcohol exposure in rats.

PubMed

Bhattacharya, Dwipayan; Majrashi, Mohammed; Ramesh, Sindhu; Govindarajulu, Manoj; Bloemer, Jenna; Fujihashi, Ayaka; Crump, Bailee-Ryan; Hightower, Harrison; Bhattacharya, Subhrajit; Moore, Timothy; Suppiramaniam, Vishnu; Dhanasekaran, Muralikrishnan

2018-02-01

The adverse effects of prenatal nicotine and alcohol exposure on human reproductive outcomes are a major scientific and public health concern. In the United States, substantial percentage of women (20-25%) of childbearing age currently smoke cigarettes and consume alcohol, and only a small percentage of these individuals quit after learning of their pregnancy. However, there are very few scientific reports on the effect of nicotine in prenatal alcohol exposure on the cerebellum of the offspring. Therefore, this study was conducted to investigate the cerebellar neurotoxic effects of nicotine in a rodent model of Fetal Alcohol Spectrum Disorder (FASD). In this study, we evaluated the behavioral changes, biochemical markers of oxidative stress and apoptosis, mitochondrial functions and the molecular mechanisms associated with nicotine in prenatal alcohol exposure on the cerebellum. Prenatal nicotine and alcohol exposure induced oxidative stress, did not affect the mitochondrial functions, increased the monoamine oxidase activity, increased caspase expression and decreased ILK, PSD-95 and GLUR1 expression without affecting the GSK-3β. Thus, our current study of prenatal alcohol and nicotine exposure on cerebellar neurotoxicity may lead to new scientific perceptions and novel and suitable therapeutic actions in the future. Copyright © 2017. Published by Elsevier Inc.
A novel proteolytic processing of prolysyl oxidase

PubMed Central

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E.; Yamauchi, Mitsuo

2012-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residue Gly162 and Asp163 (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity and mass spectrometry. One form was identified as a well characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX (tLOX) resulting from the cleavage at the carboxy terminus of Arg192. The tLOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX. PMID:21591931
A novel proteolytic processing of prolysyl oxidase.

PubMed

Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Tokutomi, Kentaro; Mocanu, Viorel; Parker, Carol E; Yamauchi, Mitsuo

2011-01-01

Lysyl oxidase (LOX) is an amine oxidase that is critical for the stability of connective tissues. The secreted proLOX is enzymatically quiescent and is activated through proteolytic cleavage between residues Gly(162) and Asp(163) (residue numbers according to the mouse LOX) by bone morphogenetic protein (BMP)-1 gene products. Here we report a novel processing of proLOX identified in vitro and in vivo. Two forms of mature LOX were identified and characterized by their immunoreactivity to specific antibodies, amine oxidase activity, and mass spectrometry. One form was identified as a well-characterized BMP-1 processed LOX protein. Another was found to be a truncated form of LOX resulting from the cleavage at the carboxy terminus of Arg(192). The truncated form of LOX still appeared to retain amine oxidase activity. The results from the proLOX gene deletion and mutation experiments indicated that the processing occurs independent of the cleavage of proLOX by BMP-1 gene products and likely requires the presence of LOX propeptide. These results indicate that proLOX could be processed by two different mechanisms producing two forms of active LOX.
Exploiting algal NADPH oxidase for biophotovoltaic energy

DOE PAGES

Anderson, Alexander; Laohavisit, Anuphon; Blaby, Ian K.; ...

2015-01-29

Photosynthetic microbes exhibit light-dependent electron export across the cell membrane, which can generate electricity in biological photovoltaic (BPV) devices. How electrons are exported remains to be determined; the identification of mechanisms would help selection or generation of photosynthetic microbes capable of enhanced electrical output. We show that plasma membrane NADPH oxidase activity is a significant component of light-dependent generation of electricity by the unicellular green alga Chlamydomonas reinhardtii. NADPH oxidases export electrons across the plasma membrane to form superoxide anion from oxygen. The C. reinhardtii mutant lacking the NADPH oxidase encoded by RBO1 is impaired in both extracellular superoxide anionmore » production and current generation in a BPV device. Complementation with the wild-type gene restores both capacities, demonstrating the role of the enzyme in electron export. Monitoring light-dependent extracellular superoxide production with a colorimetric assay is shown to be an effective way of screening for electrogenic potential of candidate algal strains. Furthermore, the results show that algal NADPH oxidases are important for superoxide anion production and open avenues for optimizing the biological component of these devices.« less
NADPH oxidases: novel therapeutic targets for neurodegenerative diseases.

PubMed

Gao, Hui-Ming; Zhou, Hui; Hong, Jau-Shyong

2012-06-01

Oxidative stress is a key pathologic factor in neurodegenerative diseases such as Alzheimer and Parkinson diseases (AD, PD). The failure of free-radical-scavenging antioxidants in clinical trials pinpoints an urgent need to identify and to block major sources of oxidative stress in neurodegenerative diseases. As a major superoxide-producing enzyme complex in activated phagocytes, phagocyte NADPH oxidase (PHOX) is essential for host defense. However, recent preclinical evidence has underscored a pivotal role of overactivated PHOX in chronic neuroinflammation and progressive neurodegeneration. Deficiency in PHOX subunits mitigates neuronal damage induced by diverse insults/stresses relevant to neurodegenerative diseases. More importantly, suppression of PHOX activity correlates with reduced neuronal impairment in models of neurodegenerative diseases. The discovery of PHOX and non-phagocyte NADPH oxidases in astroglia and neurons further reinforces the crucial role of NADPH oxidases in oxidative stress-mediated chronic neurodegeneration. Thus, proper modulation of NADPH oxidase activity might hold therapeutic potential for currently incurable neurodegenerative diseases. Published by Elsevier Ltd.
Dietary Fisetin Supplementation Protects Against Alcohol-Induced Liver Injury in Mice.

PubMed

Sun, Qian; Zhang, Wenliang; Zhong, Wei; Sun, Xinguo; Zhou, Zhanxiang

2016-10-01

Overproduction of reactive oxygen species is associated with the development of alcoholic liver disease (ALD). Plant polyphenols have been used as dietary interventions for multiple diseases including ALD. The objective of this study was to determine whether dietary supplementation with fisetin, a novel flavonoid, exerts beneficial effect on alcohol-induced liver injury. C57BL/6J mice were pair-fed with the Lieber-DeCarli control or ethanol (EtOH) diet for 4 weeks with or without fisetin supplementation at 10 mg/kg/d. Alcohol feeding induced lipid accumulation in the liver and increased plasma alanine aminotransferase and aspartate aminotransferase activities, which were attenuated by fisetin supplementation. The EtOH concentrations in the plasma and liver were significantly elevated by alcohol exposure but were reduced by fisetin supplementation. Although fisetin did not affect the protein expression of alcohol metabolism enzymes, the aldehyde dehydrogenase activities were significantly increased by fisetin compared to the alcohol alone group. In addition, fisetin supplementation remarkably reduced hepatic NADPH oxidase 4 levels along with decreased plasma hydrogen peroxide and hepatic superoxide and 4-hydroxynonenal levels after alcohol exposure. Alcohol-induced apoptosis and up-regulation of Fas and cleaved caspase-3 in the liver were prevented by fisetin. Moreover, fisetin supplementation attenuated alcohol-induced hepatic steatosis through increasing plasma adiponectin levels and hepatic protein levels of p-AMPK, ACOX1, CYP4A, and MTTP. This study demonstrated that the protective effect of fisetin on ALD is achieved by accelerating EtOH clearance and inhibition of oxidative stress. The data suggest that fisetin has a therapeutical potential for treating ALD. Copyright © 2016 by the Research Society on Alcoholism.
Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of type-2-copper-depleted ascorbate oxidase.

PubMed

O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F

1984-08-15

The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.
Alcohol use by youth and adolescents: a pediatric concern.

PubMed

Kokotailo, Patricia K

2010-05-01

Alcohol use continues to be a major problem from preadolescence through young adulthood in the United States. Results of recent neuroscience research have substantiated the deleterious effects of alcohol on adolescent brain development and added even more evidence to support the call to prevent and reduce underaged drinking. Pediatricians should be knowledgeable about substance abuse to be able to recognize risk factors for alcohol and other substance abuse among youth, screen for use, provide appropriate brief interventions, and refer to treatment. The integration of alcohol use prevention programs in the community and our educational system from elementary school through college should be promoted by pediatricians and the health care community. Promotion of media responsibility to connect alcohol consumption with realistic consequences should be supported by pediatricians. Additional research into the prevention, screening and identification, brief intervention, and management and treatment of alcohol and other substance use by adolescents continues to be needed to improve evidence-based practices.
Role of NADPH Oxidase-4 in Human Endothelial Progenitor Cells

PubMed Central

Hakami, Nora Y.; Ranjan, Amaresh K.; Hardikar, Anandwardhan A.; Dusting, Greg J.; Peshavariya, Hitesh M.

2017-01-01

Introduction: Endothelial progenitor cells (EPCs) display a unique ability to promote angiogenesis and restore endothelial function in injured blood vessels. NADPH oxidase 4 (NOX4)-derived hydrogen peroxide (H2O2) serves as a signaling molecule and promotes endothelial cell proliferation and migration as well as protecting against cell death. However, the role of NOX4 in EPC function is not completely understood. Methods: EPCs were isolated from human saphenous vein and mammary artery discarded during bypass surgery. NOX4 gene and protein expression in EPCs were measured by real time-PCR and Western blot analysis respectively. NOX4 gene expression was inhibited using an adenoviral vector expressing human NOX4 shRNA (Ad-NOX4i). H2O2 production was measured by Amplex red assay. EPC migration was evaluated using a transwell migration assay. EPC proliferation and viability were measured using trypan blue counts. Results: Inhibition of NOX4 using Ad-NOX4i reduced Nox4 gene and protein expression as well as H2O2 formation in EPCs. Inhibition of NOX4-derived H2O2 decreased both proliferation and migration of EPCs. Interestingly, pro-inflammatory cytokine tumor necrosis factor alpha (TNFα) decreased NOX4 expression and reduced survival of EPCs. However, the survival of EPCs was further diminished by TNF-α in NOX4-knockdown cells, suggesting that NOX4 has a protective role in EPCs. Conclusion: These findings suggest that NOX4-type NADPH oxidase is important for proliferation and migration functions of EPCs and protects against pro-inflammatory cytokine induced EPC death. These properties of NOX4 may facilitate the efficient function of EPCs which is vital for successful neovascularization. PMID:28386230
Supramolecular organization of cytochrome c oxidase- and alternative oxidase-dependent respiratory chains in the filamentous fungus Podospora anserina.

PubMed

Krause, Frank; Scheckhuber, Christian Q; Werner, Alexandra; Rexroth, Sascha; Reifschneider, Nicole H; Dencher, Norbert A; Osiewacz, Heinz D

2004-06-18

To elucidate the molecular basis of the link between respiration and longevity, we have studied the organization of the respiratory chain of a wild-type strain and of two long-lived mutants of the filamentous fungus Podospora anserina. This established aging model is able to respire by either the standard or the alternative pathway. In the latter pathway, electrons are directly transferred from ubiquinol to the alternative oxidase and thus bypass complexes III and IV. We show that the cytochrome c oxidase pathway is organized according to the mammalian "respirasome" model (Schägger, H., and Pfeiffer, K. (2000) EMBO J. 19, 1777-1783). In contrast, the alternative pathway is composed of distinct supercomplexes of complexes I and III (i.e. I(2) and I(2)III(2)), which have not been described so far. Enzymatic analysis reveals distinct functional properties of complexes I and III belonging to either cytochrome c oxidase- or alternative oxidase-dependent pathways. By a gentle colorless-native PAGE, almost all of the ATP synthases from mitochondria respiring by either pathway were preserved in the dimeric state. Our data are of significance for the understanding of both respiratory pathways as well as lifespan control and aging.
Environmental Strategies to Prevent Alcohol Problems on College Campuses. Revised

ERIC Educational Resources Information Center

Stewart, Kathryn

2011-01-01

Alcohol problems on campuses cannot be solved with simple solutions, such as an alcohol awareness campaign. Instead, dangerous college drinking can be prevented with an array of protective measures that deal with alcohol availability, enforcement of existing laws and rules, and changes in how alcohol is promoted, sold and served. Many people,…
In vitro study of 6-mercaptopurine oxidation catalysed by aldehyde oxidase and xanthine oxidase.

PubMed

Rashidi, Mohammad-Reza; Beedham, Christine; Smith, John S; Davaran, Soodabeh

2007-08-01

In spite of over 40 years of clinical use of 6-mercaptopurine, many aspects of complex pharmacology and metabolism of this drug remain unclear. It is thought that 6-mercaptopurine is oxidized to 6-thiouric acid through 6-thioxanthine or 8-oxo-6-mercaptopurine by one of two molybdenum hydroxylases, xanthine oxidase (XO), however, the role of other molybdenum hydroxylase, aldehyde oxidase (AO), in the oxidation of 6-mercaptopurine and possible interactions of AO substrates and inhibitors has not been investigated in more details. In the present study, the role of AO and XO in the oxidation of 6- mercaptopurine has been investigated. 6-mercaptopurine was incubated with bovine milk xanthine oxidase or partially purified guinea pig liver molybdenum hydroxylase fractions in the absence and presence of XO and AO inhibitor/substrates, and the reactions were monitored by spectrophotometric and HPLC methods. According to the results obtained from the inhibition studies, it is more likely that 6- mercaptopurine is oxidized to 6-thiouric acid via 6-thioxanthine rather than 8-oxo-6-mercaptopurine. The first step which is the rate limiting step is catalyzed solely by XO, whereas both XO and AO are involved in the oxidation of 6-thioxanthine to 6-thiouric acid.
Viewing alcohol warning advertising reduces urges to drink in young adults: an online experiment.

PubMed

Stautz, Kaidy; Marteau, Theresa M

2016-07-08

Tobacco counter-advertising is effective at promoting smoking cessation. Few studies have evaluated the impact of alcohol warning advertising on alcohol consumption and possible mechanisms of effect. This pilot study aimed to assess whether alcohol warning advertising is effective in reducing urges to drink alcohol, if emotional responses to advertising explain any such effect or perceived effectiveness, and whether effects differ among heavier drinkers. One hundred fifty-two young adult (aged 18-25) alcohol users completed an online experiment in which they were randomly assigned to view one of three sets of six advertisements: (i) alcohol warning; (ii) alcohol promoting; or (iii) advertisements for non-alcohol products. Urges to drink alcohol were self-reported post-exposure. Affective responses (pleasure and arousal) to each advertisement and perceived effectiveness of each advertisement were recorded. Typical level of alcohol consumption was measured as a potential effect modifier. Participants exposed to alcohol warning advertisements reported significantly lower urges to drink alcohol than those who viewed either alcohol promoting or non-alcohol advertisements. This effect was fully mediated by negative affective responses (displeasure) to the alcohol warning advertisements. Perceived effectiveness of alcohol warning advertisements was associated with high arousal responses. Impact of the advertisements was unaffected by typical level of alcohol consumption, although the study was not powered to detect anything other than large effects. In line with findings from the tobacco literature, alcohol warning advertisements that elicit negative affect reduce urges to drink alcohol. Their impact upon actual consumption awaits investigation.
Movie Exposure to Alcohol Cues and Adolescent Alcohol Problems: A Longitudinal Analysis in a National Sample

PubMed Central

Wills, Thomas A.; Sargent, James D.; Gibbons, Frederick X.; Gerrard, Meg; Stoolmiller, Mike

2009-01-01

The authors tested a theoretical model of how exposure to alcohol cues in movies predicts level of alcohol use (ever use plus ever and recent binge drinking) and alcohol-related problems. A national sample of younger adolescents was interviewed by telephone with 4 repeated assessments spaced at 8-month intervals. A structural equation modeling analysis performed for ever-drinkers at Time 3 (N = 961) indicated that, controlling for a number of covariates, movie alcohol exposure at Time 1 was related to increases in peer alcohol use and adolescent alcohol use at Time 2. Movie exposure had indirect effects to alcohol use and problems at Times 3 and 4 through these pathways, with direct effects to problems from Time 1 rebelliousness and Time 2 movie exposure also found. Prospective risk-promoting effects were also found for alcohol expectancies, peer alcohol use, and availability of alcohol in the home; protective effects were found for mother’s responsiveness and for adolescent’s school performance and self-control. Theoretical and practical implications are discussed. PMID:19290687
Movie exposure to alcohol cues and adolescent alcohol problems: a longitudinal analysis in a national sample.

PubMed

Wills, Thomas A; Sargent, James D; Gibbons, Frederick X; Gerrard, Meg; Stoolmiller, Mike

2009-03-01

The authors tested a theoretical model of how exposure to alcohol cues in movies predicts level of alcohol use (ever use plus ever and recent binge drinking) and alcohol-related problems. A national sample of younger adolescents was interviewed by telephone with 4 repeated assessments spaced at 8-month intervals. A structural equation modeling analysis performed for ever-drinkers at Time 3 (N = 961) indicated that, controlling for a number of covariates, movie alcohol exposure at Time 1 was related to increases in peer alcohol use and adolescent alcohol use at Time 2. Movie exposure had indirect effects to alcohol use and problems at Times 3 and 4 through these pathways, with direct effects to problems from Time 1 rebelliousness and Time 2 movie exposure also found. Prospective risk-promoting effects were also found for alcohol expectancies, peer alcohol use, and availability of alcohol in the home; protective effects were found for mother's responsiveness and for adolescent's school performance and self-control. Theoretical and practical implications are discussed. (PsycINFO Database Record (c) 2009 APA, all rights reserved).
Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.

PubMed

Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo

2016-10-01

Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process.
Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

PubMed Central

Molitor, Christian; Mauracher, Stephan Gerhard

2016-01-01

Tyrosinases and catechol oxidases belong to the family of polyphenol oxidases (PPOs). Tyrosinases catalyze the o-hydroxylation and oxidation of phenolic compounds, whereas catechol oxidases were so far defined to lack the hydroxylation activity and catalyze solely the oxidation of o-diphenolic compounds. Aurone synthase from Coreopsis grandiflora (AUS1) is a specialized plant PPO involved in the anabolic pathway of aurones. We present, to our knowledge, the first crystal structures of a latent plant PPO, its mature active and inactive form, caused by a sulfation of a copper binding histidine. Analysis of the latent proenzyme’s interface between the shielding C-terminal domain and the main core provides insights into its activation mechanisms. As AUS1 did not accept common tyrosinase substrates (tyrosine and tyramine), the enzyme is classified as a catechol oxidase. However, AUS1 showed hydroxylase activity toward its natural substrate (isoliquiritigenin), revealing that the hydroxylase activity is not correlated with the acceptance of common tyrosinase substrates. Therefore, we propose that the hydroxylase reaction is a general functionality of PPOs. Molecular dynamics simulations of docked substrate–enzyme complexes were performed, and a key residue was identified that influences the plant PPO’s acceptance or rejection of tyramine. Based on the evidenced hydroxylase activity and the interactions of specific residues with the substrates during the molecular dynamics simulations, a novel catalytic reaction mechanism for plant PPOs is proposed. The presented results strongly suggest that the physiological role of plant catechol oxidases were previously underestimated, as they might hydroxylate their—so far unknown—natural substrates in vivo. PMID:26976571
Simultaneous and accurate real-time monitoring of glucose and ethanol in alcoholic drinks, must, and biomass by a dual-amperometric biosensor.

PubMed

Mentana, Annalisa; Palermo, Carmen; Nardiello, Donatella; Quinto, Maurizio; Centonze, Diego

2013-01-09

In this work the optimization and application of a dual-amperometric biosensor for simultaneous monitoring of glucose and ethanol content, as quality markers in drinks and alcoholic fermentation media, are described. The biosensor is based on glucose oxidase (GOD) and alcohol oxidase (AOD) immobilized by co-cross-linking with bovine serum albumin (BSA) and glutaraldehyde (GLU) both onto a dual gold electrode, modified with a permselective overoxidized polypyrrole film (PPYox). Response, rejection of interferents, and stability of the dual biosensor were optimized in terms of PPYox thickness, BSA, and enzyme loading. The biosensor was integrated in a flow injection system coupled with an at-line microdialysis fiber as a sampling tool. Flow rates inside and outside the fiber were optimized in terms of linear responses (0.01-1 and 0.01-1.5 M) and sensitivities (27.6 ± 0.4 and 31.0 ± 0.6 μA·M(-1)·cm(-2)) for glucose and ethanol. Excellent anti-interference characteristics, the total absence of "cross-talk", and good response stability under operational conditions allowed application of the dual biosensor in accurate real-time monitoring (at least 15 samples/h) of alcoholic drinks, white grape must, and woody biomass.

Sales impact of displaying alcoholic and non-alcoholic beverages in end-of-aisle locations: an observational study.

PubMed

Nakamura, Ryota; Pechey, Rachel; Suhrcke, Marc; Jebb, Susan A; Marteau, Theresa M

2014-05-01

In-store product placement is perceived to be a factor underpinning impulsive food purchasing but empirical evidence is limited. In this study we present the first in-depth estimate of the effect of end-of-aisle display on sales, focussing on alcohol. Data on store layout and product-level sales during 2010-11 were obtained for one UK grocery store, comprising detailed information on shelf space, price, price promotion and weekly sales volume in three alcohol categories (beer, wine, spirits) and three non-alcohol categories (carbonated drinks, coffee, tea). Multiple regression techniques were used to estimate the effect of end-of-aisle display on sales, controlling for price, price promotion, and the number of display locations for each product. End-of-aisle display increased sales volumes in all three alcohol categories: by 23.2% (p = 0.005) for beer, 33.6% (p < 0.001) for wine, and 46.1% (p < 0.001) for spirits, and for three non-alcohol beverage categories: by 51.7% (p < 0.001) for carbonated drinks, 73.5% (p < 0.001) for coffee, and 113.8% (p < 0.001) for tea. The effect size was equivalent to a decrease in price of between 4% and 9% per volume for alcohol categories, and a decrease in price of between 22% and 62% per volume for non-alcohol categories. End-of-aisle displays appear to have a large impact on sales of alcohol and non-alcoholic beverages. Restricting the use of aisle ends for alcohol and other less healthy products might be a promising option to encourage healthier in-store purchases, without affecting availability or cost of products. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sales impact of displaying alcoholic and non-alcoholic beverages in end-of-aisle locations: An observational study

PubMed Central

Nakamura, Ryota; Pechey, Rachel; Suhrcke, Marc; Jebb, Susan A.; Marteau, Theresa M.

2014-01-01

In-store product placement is perceived to be a factor underpinning impulsive food purchasing but empirical evidence is limited. In this study we present the first in-depth estimate of the effect of end-of-aisle display on sales, focussing on alcohol. Data on store layout and product-level sales during 2010–11 were obtained for one UK grocery store, comprising detailed information on shelf space, price, price promotion and weekly sales volume in three alcohol categories (beer, wine, spirits) and three non-alcohol categories (carbonated drinks, coffee, tea). Multiple regression techniques were used to estimate the effect of end-of-aisle display on sales, controlling for price, price promotion, and the number of display locations for each product. End-of-aisle display increased sales volumes in all three alcohol categories: by 23.2% (p = 0.005) for beer, 33.6% (p < 0.001) for wine, and 46.1% (p < 0.001) for spirits, and for three non-alcohol beverage categories: by 51.7% (p < 0.001) for carbonated drinks, 73.5% (p < 0.001) for coffee, and 113.8% (p < 0.001) for tea. The effect size was equivalent to a decrease in price of between 4% and 9% per volume for alcohol categories, and a decrease in price of between 22% and 62% per volume for non-alcohol categories. End-of-aisle displays appear to have a large impact on sales of alcohol and non-alcoholic beverages. Restricting the use of aisle ends for alcohol and other less healthy products might be a promising option to encourage healthier in-store purchases, without affecting availability or cost of products. PMID:24632050
Alcohol and highway safety in a public health perspective.

PubMed Central

Dickman, F B

1988-01-01

The Public Health Service and the National Highway Traffic Safety Administration share the responsibility for problems related to injury prevention and control regarding the alcohol-impaired operation of motor vehicles. NHTSA activities have evolved over several decades within a general framework which emphasizes community-based systems. The National Highway Traffic Safety Administration is promoting program activities that stress community-level involvement in problems of alcohol and highway use. The public health approach to the mortality and morbidity resulting from alcohol use and motor vehicle operation entails examining and promoting those activities that address human factors. Techniques for Effective Alcohol Management (TEAM) is a cooperative effort representing sports, entertainment, insurance, vehicle manufacturer, and other organizations and agencies building community coalitions. The Centers for Disease Control is establishing research and collaborating centers to stimulate studies and exchange information on injury-related research. Alcohol countermeasures programs include training for law enforcement and legal officials, technology development efforts, and changes in laws applied to use of alcohol and other drugs. Outreach and networking activities have encouraged the initiation and coordination of community level groups active in promoting highway safety with regard to the use of alcohol. Statistical method changes are being discussed for surveillance of motor vehicle-related injuries for Health Objectives for the Nation for the Year 2000. NHTSA data systems being discussed are thought to be more timely and more sensitive to crash activity than methods now in use.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3141961
Three-dimensional organization of three-domain copper oxidases: A review

NASA Astrophysics Data System (ADS)

Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

2008-01-01

“Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.
NADPH OXIDASE: STRUCTURE AND ACTIVATION MECHANISMS (REVIEW). NOTE I.

PubMed

Filip-Ciubotaru, Florina; Manciuc, Carmen; Stoleriu, Gabriela; Foia, Liliana

2016-01-01

NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase), with its generically termed NOX isoforms, is the major source of ROS (reactive oxigen species) in biological systems. ROS are small oxygen-derived molecules with an important role in various biological processes (physiological or pathological). If under physiological conditions some processes are beneficial and necessary for life, under pathophysiological conditions they are noxious, harmful. NADPH oxidases are present in phagocytes and in a wide variety of nonphagocytic cells. The enzyme generates superoxide by transferring electrons from NADPH inside the cell across the membrane and coupling them to molecular oxygen to produce superoxide anion, a reactive free-radical. Structurally, NADPH oxidase is a multicomponent enzyme which includes two integral membrane proteins, glycoprotein gp9 1 Phox and adaptor protein p22(phox), which together form the heterodimeric flavocytochrome b558 that constitutes the core of the enzyme. During the resting state, the multidomain regulatory subunits p40P(phox), p47(phox), p67(Phox) are located in the cytosol organized as a complex. The activation of phagocytic NADPH oxidase occurs through a complex series of protein interactions.
Dietary fisetin supplementation protects against alcohol-induced liver injury in mice

PubMed Central

Sun, Qian; Zhang, Wenliang; Zhong, Wei; Sun, Xinguo; Zhou, Zhanxiang

2016-01-01

Background Overproduction of reactive oxygen species (ROS) is associated with the development of alcoholic liver disease (ALD). Plant polyphenols have been used as dietary inverventions for multiple diseases including ALD. The objective of the present study was to determine whether dietary supplementation with fisetin, a novel flavonoid, exerts beneficial effect on alcohol-induced liver injury. Methods C57BL/6J mice were pair-fed with the Lieber-DeCarli control or ethanol diet for four weeks with or without fisetin supplementation at 10 mg/kg/d. Results Alcohol feeding induced lipid accumulation in the liver and increased plasma ALT and AST activities, which were attenuated by fisetin suplementation. The ethanol concentrations in the plasma and liver were significantly elevated by alcohol exposure but were reduced by fisetin suplementation. Although fisetin did not affect the protein expression of alcohol metabolism enzymes, the aldehyde dehydrogenase activities were significantly increased by fisetin compared to the alcohol alone group. In addition, fisetin suplementation remarkably reduced hepatic NADPH oxidase 4 (NOX4) levels along with decreased plasma hydrogen peroxide and hepatic superoxide and 4-hydroxynonenal (4HNE) levels after alcohol exposure. Alcohol-induced apoptosis and upregulation of Fas and cleaved caspase-3 in the liver were prevented by fisetin. Moreover, fisetin suplementation attenuated alcohol-induced hepatic streatosis through increasing plasma adiponectin levels and hepatic protein levels of p-AMPK, ACOX1, CYP4A, and MTTP. Conclusion The present study demonstrated that the protective effect of fisetin on ALD is achieved by accelerating ethanol clearance and inhibition of oxidative stress. The data suggest that fisetin has a therapeutical potential for treating ALD. PMID:27575873
Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

PubMed Central

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Paradoxical roles of dual oxidases in cancer biology.

PubMed

Little, Andrew C; Sulovari, Arvis; Danyal, Karamatullah; Heppner, David E; Seward, David J; van der Vliet, Albert

2017-09-01

Dysregulated oxidative metabolism is a well-recognized aspect of cancer biology, and many therapeutic strategies are based on targeting cancers by altering cellular redox pathways. The NADPH oxidases (NOXes) present an important enzymatic source of biological oxidants, and the expression and activation of several NOX isoforms are frequently dysregulated in many cancers. Cell-based studies have demonstrated a role for several NOX isozymes in controlling cell proliferation and/or cell migration, further supporting a potential contributing role for NOX in promoting cancer. While various NOX isoforms are often upregulated in cancers, paradoxical recent findings indicate that dual oxidases (DUOXes), normally prominently expressed in epithelial lineages, are frequently suppressed in epithelial-derived cancers by epigenetic mechanisms, although the functional relevance of such DUOX silencing has remained unclear. This review will briefly summarize our current understanding regarding the importance of reactive oxygen species (ROS) and NOXes in cancer biology, and focus on recent observations indicating the unique and seemingly opposing roles of DUOX enzymes in cancer biology. We will discuss current knowledge regarding the functional properties of DUOX, and recent studies highlighting mechanistic consequences of DUOX1 loss in lung cancer, and its consequences for tumor invasiveness and current anticancer therapy. Finally, we will also discuss potentially unique roles for the DUOX maturation factors. Overall, a better understanding of mechanisms that regulate DUOX and the functional consequences of DUOX silencing in cancer may offer valuable new diagnostic insights and novel therapeutic opportunities. Copyright © 2017 Elsevier Inc. All rights reserved.
Comparative Activity-Based Flavin-Dependent Oxidase Profiling.

PubMed

Krysiak, Joanna; Breinbauer, Rolf

2017-01-01

Activity-based protein profiling (ABPP) has become a powerful chemoproteomic technology allowing for the dissection of complex ligand-protein interactions in their native cellular environment. One of the biggest challenges for ABPP is the extension of the proteome coverage. In this chapter a new ABPP strategy dedicated to monoamine oxidases (MAO) is presented. These enzymes are representative examples of flavin-dependent oxidases, playing a crucial role in the regulation of nervous system signaling.
Multidomain flavin-dependent sulfhydryl oxidases.

PubMed

Coppock, Donald L; Thorpe, Colin

2006-01-01

Eukaryotic flavin-dependent sulfhydryl oxidases catalyze oxidative protein folding with the generation of disulfides and the reduction of oxygen to hydrogen peroxide. This review deals principally with the Quiescinsulfhydryl oxidases (QSOX) that are found in multiple forms in multicellular organisms and singly in a number of protozoan parasites. QSOX is an ancient fusion of thioredoxin domains and an FAD-binding module, ERV1/ALR. Interdomain disulfide exchanges transmit reducing equivalents from substrates to the flavin cofactor and thence to molecular oxygen. The in vitro substrate specificity of avian QSOX1 and the likely substrates of QSOXs in vivo are discussed. The location of QSOX immunoreactivity and mRNA expression levels in human cells and tissues is reviewed. Generally, there is a marked association of QSOX1 expression with cell types that have a high secretory load of disulfide-containing peptides and proteins. The abundance of sulfhydryl oxidases in the islets of Langerhans suggests that oxidative protein folding may directly contribute to the oxidative stress believed to be a factor in the progression to type II diabetes. Finally, the structure and mechanism of QSOX proteins is compared to their smaller stand-alone cousins: yeast ERV1p and ERV2p, the mammalian augmenter of liver regeneration (ALR), and the viral ALR homologs.
Effect of contraceptive steroids on monoamine oxidase activity

PubMed Central

Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.

1969-01-01

Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3
How the alcohol industry relies on harmful use of alcohol and works to protect its profits.

PubMed

Casswell, Sally; Callinan, Sarah; Chaiyasong, Surasak; Cuong, Pham Viet; Kazantseva, Elena; Bayandorj, Tsogzolmaa; Huckle, Taisia; Parker, Karl; Railton, Renee; Wall, Martin

2016-11-01

The alcohol industry have attempted to position themselves as collaborators in alcohol policy making as a way of influencing policies away from a focus on the drivers of the harmful use of alcohol (marketing, over availability and affordability). Their framings of alcohol consumption and harms allow them to argue for ineffective measures, largely targeting heavier consumers, and against population wide measures as the latter will affect moderate drinkers. The goal of their public relations organisations is to 'promote responsible drinking'. However, analysis of data collected in the International Alcohol Control study and used to estimate how much heavier drinking occasions contribute to the alcohol market in five different countries shows the alcohol industry's reliance on the harmful use of alcohol. In higher income countries heavier drinking occasions make up approximately 50% of sales and in middle income countries it is closer to two-thirds. It is this reliance on the harmful use of alcohol which underpins the conflicting interests between the transnational alcohol corporations and public health and which militates against their involvement in the alcohol policy arena. [Caswell S, Callinan S, Chaiyasong S, Cuong PV, Kazantseva E, Bayandorj T, Huckle T, Parker K, Railton R, Wall M. How the alcohol industry relies on harmful use of alcohol and works to protect its profits. Drug Alcohol Rev 2016;35:661-664]. © 2016 Australasian Professional Society on Alcohol and other Drugs.
Polymorphisms in the promoter region of the human class II alcohol dehydrogenase (ADH4) gene affect both transcriptional activity and ethanol metabolism in Japanese subjects.

PubMed

Kimura, Yukiko; Nishimura, Fusae T; Abe, Shuntaro; Fukunaga, Tatsushige; Tanii, Hideji; Saijoh, Kiyofumi

2009-02-01

Class II alcohol dehydrogenase (pi-ADH), encoded by alcohol dehydrogenase (ADH4), is considered to contribute to ethanol (EtOH) oxidation in the liver at high concentration. Four single nucleotide polymorphisms (SNPs) were found in the promoter region of this gene. Analysis of genotype distribution in 102 unrelated Japanese subjects revealed that four loci were in strong linkage disequilibrium and could be classified into three haplotypes. The effects of these polymorphisms on transcriptional activity were investigated in HepG2 cells. Transcriptional activity was significantly higher in cells with the -136A allele than in those with the -136C allele. To investigate whether this difference in transcriptional activity caused a difference in EtOH elimination, previous data on blood EtOH changes after 0.4 g/kg body weight alcohol ingestion were analyzed. When analyzed based on aldehyde dehydrogenase-2 gene (ALDH2) (487)Glu/Lys genotype, the significantly lower level of EtOH at peak in subjects with -136C/A and -136A/A genotype compared with subjects with -136C/C genotype indicated that -136 bp was a suggestive locus for differences in EtOH oxidation. This effect was observed only in subjects with ALDH2 (487)Glu/Glu. These results suggested that the SNP at -136bp in the ADH4 promoter had an effect on transcriptional regulation, and that the higher activity of the -136A allele compared with the -136C allele caused a lower level of blood EtOH after alcohol ingestion; that is, individuals with the -136A allele may consume more EtOH and might have a higher risk for development of alcohol dependence than those without the -136A allele.
Photobiomodulation on alcohol induced dysfunction

NASA Astrophysics Data System (ADS)

Yang, Zheng-Ping; Liu, Timon C.; Zhang, Yan; Wang, Yan-Fang

2007-05-01

Alcohol, which is ubiquitous today, is a major health concern. Its use was already relatively high among the youngest respondents, peaked among young adults, and declined in older age groups. Alcohol is causally related to more than 60 different medical conditions. Overall, 4% of the global burden of disease is attributable to alcohol, which accounts for about as much death and disability globally as tobacco and hypertension. Alcohol also promotes the generation of reactive oxygen species (ROS) and/or interferes with the body's normal defense mechanisms against these compounds through numerous processes, particularly in the liver. Photobiomodulation (PBM) is a cell-specific effect of low intensity monochromatic light or low intensity laser irradiation (LIL) on biological systems. The cellular effects of both alcohol and LIL are ligand-independent so that PBM might rehabilitate alcohol induced dysfunction. The PBM on alcohol induced human neutrophil dysfunction and rat chronic atrophic gastritis, the laser acupuncture on alcohol addiction, and intravascular PBM on alcoholic coma of patients and rats have been observed. The endonasal PBM (EPBM) mediated by Yangming channel, autonomic nervous systems and blood cells is suggested to treat alcohol induced dysfunction in terms of EPBM phenomena, the mechanism of alcohol induced dysfunction and our biological information model of PBM. In our opinion, the therapeutic effects of PBM might also be achieved on alcoholic myopathy.
Role of the Rho GTPase Rac in the activation of the phagocyte NADPH oxidase

PubMed Central

Pick, Edgar

2014-01-01

The superoxide-generating NADPH oxidase of phagocytes consists of the membrane-associated cytochrome b558 (a heterodimer of Nox2 and p22phox) and 4 cytosolic components: p47phox, p67phox, p40phox, and the small GTPase, Rac, in complex with RhoGDI. Superoxide is produced by the NADPH-driven reduction of molecular oxygen, via a redox gradient located in Nox2. Electron flow in Nox2 is initiated by interaction with cytosolic components, which translocate to the membrane, p67phox playing the central role. The participation of Rac is expressed in the following sequence: (1) Translocation of the RacGDP-RhoGDI complex to the membrane; (2) Dissociation of RacGDP from RhoGDI; (3) GDP to GTP exchange on Rac, mediated by a guanine nucleotide exchange factor; (4) Binding of RacGTP to p67phox; (5) Induction of a conformational change in p67phox, promoting interaction with Nox2. The particular involvement of Rac in NADPH oxidase assembly serves as a paradigm for signaling by Rho GTPases, in general. PMID:24598074
The alcohol industry and trade agreements: a preliminary assessment.

PubMed

Zeigler, Donald W

2009-02-01

To review trade agreements, their relation to alcohol control policy and examine the role of the alcohol industry in supporting and attempting to influence trade policy. Review of peer review, public health advocacy literature (both pro and con on free trade), business, press and government documents on trade agreements, assess current and potential challenges by trade agreements to alcohol control policy and investigate the means and extent of industry influence in trade agreements. 'Free' trade agreements reduce trade barriers, increase competition, lower prices and promote alcohol consumption. However, international treaties, negotiated by free trade experts in close consultation with corporate lobbyists and without significant, if any, public health input, governments and corporations contain significant provisions that will result in increased alcohol consumption and may challenge public health measures of other nations as constraints on trade. Conversely, alcohol control measures seek to reduce access and consumption, raise prices and restrict advertising and product promotion. The prospect is for increased alcohol consumption and concomitant problems throughout the world. Trade agreements challenge effective alcohol control policies. The alcohol industry seeks to influence agreements and can be expected to work through trade agreements to reduce tariffs, increase market access and seek to restrict effective domestic regulations. Further research is needed on the impact of trade agreements and the ongoing role of the industry. Advocates must recognize the inherent conflicts between unbridled free trade and public health, work to exclude alcohol from trade agreements, counter industry influence and protect alcohol control policies.
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

PubMed Central

Legge, M; Duff, G B

1981-01-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information. PMID:6785320
Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

PubMed

Legge, M; Duff, G B

1981-02-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.
Expression of Ascorbic Acid Oxidase in Zucchini Squash (Cucurbita pepo L.).

PubMed

Lin, L S; Varner, J E

1991-05-01

The expression of ascorbic acid oxidase was studied in zucchini squash (Cucurbita pepo L.), one of the most abundant natural sources of the enzyme. In the developing fruit, specific activity of ascorbic acid oxidase was highest between 4 and 6 days after anthesis. Protein and mRNA levels followed the same trend as enzyme activity. Highest growth rate of the fruit occurred before 6 days after anthesis. Within a given fruit, ascorbic acid oxidase activity and mRNA level were highest in the epidermis, and lowest in the central placental region. In leaf tissue, ascorbic acid oxidase activity was higher in young leaves, and very low in old leaves. Within a given leaf, enzyme activity was highest in the fast-growing region (approximately the lower third of the blade), and lowest in the slow-growing region (near leaf apex). High expression of ascorbic acid oxidase at a stage when rapid growth is occurring (in both fruits and leaves), and localization of the enzyme in the fruit epidermis, where cells are under greatest tension during rapid growth in girth, suggest that ascorbic acid oxidase might be involved in reorganization of the cell wall to allow for expansion. Based on the known chemistry of dehydroascorbic acid, the end product of the ascorbic acid oxidase-catalyzed reaction, we have proposed several hypotheses to explain how dehydroascorbic acid might cause cell wall "loosening."
Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

NOX2 amplifies acetaldehyde-mediated cardiomyocyte mitochondrial dysfunction in alcoholic cardiomyopathy

PubMed Central

Brandt, Moritz; Garlapati, Venkata; Oelze, Matthias; Sotiriou, Efthymios; Knorr, Maike; Kröller-Schön, Swenja; Kossmann, Sabine; Schönfelder, Tanja; Morawietz, Henning; Schulz, Eberhard; Schultheiss, Heinz-Peter; Daiber, Andreas; Münzel, Thomas; Wenzel, Philip

2016-01-01

Alcoholic cardiomyopathy (ACM) resulting from excess alcohol consumption is an important cause of heart failure (HF). Although it is assumed that the cardiotoxicity of the ethanol (EtOH)-metabolite acetaldehyde (ACA) is central for its development and progression, the exact mechanisms remain obscure. Murine cardiomyocytes (CMs) exposed to ACA or EtOH showed increased superoxide (O2•−) levels and decreased mitochondrial polarization, both being normalized by NADPH oxidase (NOX) inhibition. C57BL/6 mice and mice deficient for the ACA-degrading enzyme mitochondrial aldehyde dehydrogenase (ALDH-2−/−) were fed a 2% EtOH diet for 5 weeks creating an ACA-overload. 2% EtOH-fed ALDH-2−/− mice exhibited a decreased cardiac function, increased heart-to-body and lung-to-body weight ratios, increased cardiac levels of the lipid peroxidation product malondialdehyde (MDA) as well as increased NOX activity and NOX2/glycoprotein 91phox (NOX2/gp91phox) subunit expression compared to 2% EtOH-fed C57BL/6 mice. Echocardiography revealed that ALDH-2−/−/gp91phox−/− mice were protected from ACA-overload-induced HF after 5 weeks of 2% EtOH-diet, demonstrating that NOX2-derived O2•− contributes to the development of ACM. Translated to human pathophysiology, we found increased gp91phox expression in endomyocardial biopsies of ACM patients. In conclusion, ACM is promoted by ACA-driven mitochondrial dysfunction and can be improved by ablation of NOX2/gp91phox. NOX2/gp91phox therefore might be a potential pharmacological target to treat ACM. PMID:27624556
Characterization of Mouse Models of Early Pancreatic Lesions Induced by Alcohol and Chronic Pancreatitis.

PubMed

Xu, Shiping; Chheda, Chintan; Ouhaddi, Yassine; Benhaddou, Hajar; Bourhim, Mouloud; Grippo, Paul J; Principe, Daniel R; Mascariñas, Emman; DeCant, Brian; Tsukamoto, Hidekazu; Pandol, Stephen J; Edderkaoui, Mouad

2015-08-01

We describe the first mouse model of pancreatic intraepithelial neoplasia (PanIN) lesions induced by alcohol in the presence and absence of chronic pancreatitis. Pdx1-Cre;LSL-K-ras mice were exposed to Lieber-DeCarli alcohol diet for 6 weeks with cerulein injections. The PanIN lesions and markers of fibrosis, inflammation, histone deacetylation, epithelial-to-mesenchymal transition (EMT), and cancer stemness were measured by immunohistochemistry and Western. Exposure of Pdx1-Cre;LSL-K-ras mice to an alcohol diet significantly stimulated fibrosis and slightly but not significantly increased the level of PanIN lesions associated with an increase in tumor-promoting M2 macrophages. Importantly, the alcohol diet did not increase activation of stellate cells. Alcohol diet and cerulein injections resulted in synergistic and additive effects on PanIN lesion and M2 macrophage phenotype induction, respectively. Cerulein pancreatitis caused stellate cell activation, EMT, and cancer stemness in the pancreas. Pancreatitis caused histone deacetylation, which was promoted by the alcohol diet. Pancreatitis increased EMT and cancer stemness markers, which were not further affected by the alcohol diet. The results suggest that alcohol has independent effects on promotion of PDAC associated with fibrosis formed through a stellate cell-independent mechanism and that it further promotes early PDAC and M2 macrophage induction in the context of chronic pancreatitis.
Structure-function relationships in the evolutionary framework of spermine oxidase.

PubMed

Cervelli, Manuela; Salvi, Daniele; Polticelli, Fabio; Amendola, Roberto; Mariottini, Paolo

2013-06-01

Spermine oxidase is a FAD-dependent enzyme that specifically oxidizes spermine, and plays a central role in the highly regulated catabolism of polyamines in vertebrates. The spermine oxidase substrate is specifically spermine, a tetramine that plays mandatory roles in several cell functions, such as DNA synthesis, cellular proliferation, modulation of ion channels function, cellular signalling, nitric oxide synthesis and inhibition of immune responses. The oxidative products of spermine oxidase activity are spermidine, H2O2 and the aldehyde 3-aminopropanal that spontaneously turns into acrolein. In this study the reconstruction of the phylogenetic relationships among spermine oxidase proteins from different vertebrate taxa allowed to infer their molecular evolutionary history, and assisted in elucidating the conservation of structural and functional properties of this enzyme family. The amino acid residues, which have been hypothesized or demonstrated to play a pivotal role in the enzymatic activity, and substrate specificity are here analysed to obtain a comprehensive and updated view of the structure-function relationships in the evolution of spermine oxidase.
Three-dimensional organization of three-domain copper oxidases: A review

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V.

2008-01-15

'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrenamore » maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.« less
Religious Factors Associated with Alcohol Involvement: Results from the Mauritian Joint Child Health Project

PubMed Central

Luczak, Susan E.; Prescott, Carol A.; Dalais, Cyril; Raine, Adrian; Venables, Peter H.; Mednick, Sarnoff A.

2014-01-01

Background The purpose of this study was to examine religious factors associated with alcohol involvement in Mauritius. The three main religions on the island, Hinduism, Catholicism, and Islam, promote different views of the appropriate use of alcohol. Based on reference group theory, we hypothesized that both the content of a religion’s alcohol norms and an individual’s religious commitment would relate to alcohol use behavior. Methods Participants were from the Joint Child Health Project, a longitudinal study that has followed a birth cohort of 1,795 individuals since 1972 when they were 3 years old. All available participants (67%; 55% male) were assessed in mid-adulthood on religious variables, lifetime drinking, and lifetime alcohol use disorders. Results Across religions, individuals who viewed their religion as promoting abstinence were less likely to be drinkers. Religious commitment was associated with reduced probability of drinking only in those who viewed their religion as promoting abstinence. Among drinkers, abstention norms and religious commitment were not associated with lower likelihood of alcohol use disorders. In Catholics who viewed their religion as promoting abstinence and still were drinkers, high religious commitment was associated with increased risk for alcohol use disorders. Conclusions Predictions based on reference group theory were largely supported, with religious norms and commitment differentially related to alcohol use and problems both across religions and among individuals within religions. Findings highlight the importance of examining multiple aspects of religion to better understand the relationship of religion with alcohol behaviors. PMID:24332801
Biochemistry of microbial polyvinyl alcohol degradation.

PubMed

Kawai, Fusako; Hu, Xiaoping

2009-08-01

Effect of minor chemical structures such as 1,2-diol content, ethylene content, tacticity, a degree of polymerization, and a degree of saponification of the main chain on biodegradability of polyvinyl alcohol (PVA) is summarized. Most PVA-degraders are Gram-negative bacteria belonging to the Pseudomonads and Sphingomonads, but Gram-positive bacteria also have PVA-degrading abilities. Several examples show symbiotic degradation of PVA by different mechanisms. Penicillium sp. is the only reported eukaryotic degrader. A vinyl alcohol oligomer-utilizing fungus, Geotrichum fermentans WF9101, has also been reported. Lignolytic fungi have displayed non-specific degradation of PVA. Extensive published studies have established a two-step process for the biodegradation of PVA. Some bacteria excrete extracellular PVA oxidase to yield oxidized PVA, which is partly under spontaneous depolymerization and is further metabolized by the second step enzyme (hydrolase). On the other hand, PVA (whole and depolymerized to some extent) must be taken up into the periplasmic space of some Gram-negative bacteria, where PVA is oxidized by PVA dehydrogenase, coupled to a respiratory chain. The complete pva operon was identified in Sphingopyxis sp. 113P3. Anaerobic biodegradability of PVA has also been suggested.
Polyenylphosphatidylcholine attenuates alcohol-induced fatty liver and hyperlipemia in rats.

PubMed

Navder, K P; Baraona, E; Lieber, C S

1997-09-01

Chronic administration of a soybean-derived polyenylphosphatidylcholine (PPC) extract prevents the development of cirrhosis in alcohol-fed baboons. To assess whether this phospholipid also affects earlier changes induced by alcohol consumption (such as fatty liver and hyperlipemia), 28 male rat littermates were pair-fed liquid diets containing 36% of energy either as ethanol or as additional carbohydrate for 21 d, and killed 90 min after intragastric administration of the corresponding diets. Half of the rats were given PPC (3 g/l), whereas the other half received the same amount of linoleate (as safflower oil) and choline (as bitartrate salt). PPC did not affect diet or alcohol consumption [15.4 +/- 0.5 G/(kg.d)], but the ethanol-induced hepatomegaly and the hepatic accumulation of lipids (principally triglycerides and cholesterol esters) and proteins were about half those in rats not given PPC. The ethanol-induced postprandial hyperlipemia was lower with PPC than without, despite an enhanced fat absorption and no difference in the level of plasma free fatty acids. The attenuation of fatty liver and hyperlipemia was associated with correction of the ethanol-induced inhibition of mitochondrial oxidation of palmitoyl-1-carnitine and the depression of cytochrome oxidase activity, as well as the increases in activity of serum glutamate dehydrogenase and aminotransferases. Thus, PPC attenuates early manifestations of alcohol toxicity, at least in part, by improving mitochondrial injury. These beneficial effects of PPC at the initial stages of alcoholic liver injury may prevent or delay the progression to more advanced forms of alcoholic liver disease.
Catalase deficiency may complicate urate oxidase (rasburicase) therapy.

PubMed

Góth, László; Bigler, N William

2007-09-01

Patients with low (inherited and acquired) catalase activities who are treated with infusion of uric acid oxidase because they are at risk of tumour lysis syndrome may experience very high concentrations of hydrogen peroxide. They may suffer from methemoglobinaemia and haemolytic anaemia which may be attributed either to deficiency of glucose-6-phosphate dehydrogenase or to other unknown circumstances. Data have not been reported from catalase deficient patients who were treated with uric acid oxidase. It may be hypothesized that their decreased blood catalase could lead to the increased concentration of hydrogen peroxide which may cause haemolysis and formation of methemoglobin. Blood catalase activity should be measured for patients at risk of tumour lysis syndrome prior to uric acid oxidase treatment.
Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

PubMed Central

Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.

2014-01-01

Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426
Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis.

PubMed

Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L; Zhau, Haiyen E; Shih, Jean C; Chung, Leland W K

2014-07-01

Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa.
Inhibition of histone acetylation by curcumin reduces alcohol-induced fetal cardiac apoptosis.

PubMed

Yan, Xiaochen; Pan, Bo; Lv, Tiewei; Liu, Lingjuan; Zhu, Jing; Shen, Wen; Huang, Xupei; Tian, Jie

2017-01-05

Prenatal alcohol exposure may cause cardiac development defects, however, the underlying mechanisms are not yet clear. In the present study we have investigated the roles of histone modification by curcumin on alcohol induced fetal cardiac abnormalities during the development. Q-PCR and Western blot results showed that alcohol exposure increased gene and active forms of caspase-3 and caspase-8, while decreased gene and protein of bcl-2. ChIP assay results showed that, alcohol exposure increased the acetylation of histone H3K9 near the promoter region of caspase-3 and caspase-8, and decreased the acetylation of histone H3K9 near the promoter region of bcl-2. TUNEL assay data revealed that alcohol exposure increased the apoptosis levels in the embryonic hearts. In vitro experiments demonstrated that curcumin treatment could reverse the up-regulation of active forms of caspase-3 and caspase-8, and down-regulation of bcl-2 induced by alcohol treatment. In addition, curcumin also corrected the high level of histone H3K9 acetylation induced by alcohol. Moreover, the high apoptosis level induced by alcohol was reversed after curcumin treatment in cardiac cells. These findings indicate that histone modification may play an important role in mediating alcohol induced fetal cardiac apoptosis, possibly through the up-regulation of H3K9 acetylation near the promoter regions of apoptotic genes. Curcumin treatment may correct alcohol-mediated fetal cardiac apoptosis, suggesting that curcumin may play a protective role against alcohol abuse caused cardiac damage during pregnancy.
[Respiratory oxidases: the enzymes which use most of the oxygen which living things breathe].

PubMed

Toledo-Cuevas, E M

1997-01-01

The respiratory oxidases are the last enzymes of the aerobic respiratory chain. They catalize the reduction of molecular oxygen to water, with generation of an electrochemical gradient useful for the energy demanding cellular processes. Most of the oxidases belong to the heme-copper superfamily. They possess a heme-copper center, constituted of a high spin heme and a CuB center, where the reduction of oxygen takes place and probably where the link to proton pumping is located. The superfamily is divided in two classes: the quinol- and the cytochrome c-oxidases. The latter are divided in the aa3 and the cbb3-type cytochrome c oxidases. The main difference between quinol- and the aa3-type cytochrome c-oxidases is the CuA center, which is absent in the quinol oxidases. The cbb3-type cytochrome oxidases have the binuclear center, but lack the CuA center. They also does not have the classical subunits II and III. These differences seem not to affect the oxygen reduction or the proton pumping. Probably the oxidases have evolved from some denitrification enzymes and prior the photosynthetic process. Also is possible that the cbb3-type cytochrome oxidases or others very similar have been the first oxidases to appear.
Identification of the alternative terminal oxidase of higher plant mitochondria

PubMed Central

Elthon, Thomas E.; McIntosh, Lee

1987-01-01

In addition to cytochrome oxidase, plant mitochondria have a second terminal oxidase called the alternative oxidase. The alternative oxidase is of great interest in that energy is not conserved when electrons flow through it. The potential energy of the system is thus lost as heat, and, in plants with high levels of the alternative oxidase, this results in thermogenesis. We have purified the alternative oxidase from mitochondria of the thermogenic spadix of Sauromatum guttatum and have identified its polypeptide constituents by using polyclonal antibodies. A 166-fold purification was achieved through a combination of cation-exchange (carboxymethyl-Sepharose) and hydrophobic-interaction (phenyl-Sepharose) chromatography. Polyclonal antibodies raised to the CM-Sepharose fractions readily immunoprecipitated alternative oxidase activity and immunoprecipitated four of the proteins that copurify with the activity. These proteins have apparent molecular masses of 37, 36, 35.5, and 35 kDa. Polyclonal antibodies raised individually to the 37-, 36-, and 35.5- plus 35-kDa proteins cross-reacted with all of these proteins, indicating the presence of common antigenic sites. The 37-kDa protein appears to be constitutive in Sauromatum, whereas expression of the 36- and 35-kDa proteins was correlated with presence of alternative pathway activity. The 35.5-kDa protein appears with loss of alternative pathway activity during senescence, indicating that this protein may be a degradation product of the 36-kDa protein. Binding of anti-36-kDa protein antibodies to total mitochondrial protein blots of five plant species indicated that similar proteins were always present when alternative pathway activity was observed. Images PMID:16593898
Molecular and Biochemical Characterization of a Cytokinin Oxidase from Maize1

PubMed Central

Bilyeu, Kristin D.; Cole, Jean L.; Laskey, James G.; Riekhof, Wayne R.; Esparza, Thomas J.; Kramer, Michelle D.; Morris, Roy O.

2001-01-01

It is generally accepted that cytokinin oxidases, which oxidatively remove cytokinin side chains to produce adenine and the corresponding isopentenyl aldehyde, play a major role in regulating cytokinin levels in planta. Partially purified fractions of cytokinin oxidase from various species have been studied for many years, but have yet to clearly reveal the properties of the enzyme or to define its biological significance. Details of the genomic organization of the recently isolated maize (Zea mays) cytokinin oxidase gene (ckx1) and some of its Arabidopsis homologs are now presented. Expression of an intronless ckx1 in Pichia pastoris allowed production of large amounts of recombinant cytokinin oxidase and facilitated detailed kinetic and cofactor analysis and comparison with the native enzyme. The enzyme is a flavoprotein containing covalently bound flavin adenine dinucleotide, but no detectable heavy metals. Expression of the oxidase in maize tissues is described. PMID:11154345
Network Commercials Promote Legal Drugs: Outnumber Anti-Drug PSA's 45-to-1.

ERIC Educational Resources Information Center

Fedler, Fred; And Others

1994-01-01

During the week of September 16-20, 1990, commercials promoting drugs and alcohol outnumbered the networks' news stories, documentaries, and public service announcements (PSAs) about illegal drugs by a ratio of almost 39 to 1. Considering the commercials alone, promotion of drugs and alcohol outnumbered the antidrug promotions by a ratio of almost…
21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...
21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...
21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...
21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...
21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420 Section 866.2420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2420 Oxidase...

Identification of a Third Mn(II) Oxidase Enzyme in Pseudomonas putida GB-1

PubMed Central

Smesrud, Logan; Tebo, Bradley M.

2016-01-01

ABSTRACT The oxidation of soluble Mn(II) to insoluble Mn(IV) is a widespread bacterial activity found in a diverse array of microbes. In the Mn(II)-oxidizing bacterium Pseudomonas putida GB-1, two Mn(II) oxidase genes, named mnxG and mcoA, were previously identified; each encodes a multicopper oxidase (MCO)-type enzyme. Expression of these two genes is positively regulated by the response regulator MnxR. Preliminary investigation into putative additional regulatory pathways suggested that the flagellar regulators FleN and FleQ also regulate Mn(II) oxidase activity; however, it also revealed the presence of a third, previously uncharacterized Mn(II) oxidase activity in P. putida GB-1. A strain from which both of the Mn(II) oxidase genes and fleQ were deleted exhibited low levels of Mn(II) oxidase activity. The enzyme responsible was genetically and biochemically identified as an animal heme peroxidase (AHP) with domain and sequence similarity to the previously identified Mn(II) oxidase MopA. In the ΔfleQ strain, P. putida GB-1 MopA is overexpressed and secreted from the cell, where it actively oxidizes Mn. Thus, deletion of fleQ unmasked a third Mn(II) oxidase activity in this strain. These results provide an example of an Mn(II)-oxidizing bacterium utilizing both MCO and AHP enzymes. IMPORTANCE The identity of the Mn(II) oxidase enzyme in Pseudomonas putida GB-1 has been a long-standing question in the field of bacterial Mn(II) oxidation. In the current work, we demonstrate that P. putida GB-1 employs both the multicopper oxidase- and animal heme peroxidase-mediated pathways for the oxidation of Mn(II), rendering this model organism relevant to the study of both types of Mn(II) oxidase enzymes. The presence of three oxidase enzymes in P. putida GB-1 deepens the mystery of why microorganisms oxidize Mn(II) while providing the field with the tools necessary to address this question. The initial identification of MopA as a Mn(II) oxidase in this strain required the
Alcohol imagery on New Zealand television

PubMed Central

McGee, Rob; Ketchel, Juanita; Reeder, Anthony I

2007-01-01

Background To examine the extent and nature of alcohol imagery on New Zealand (NZ) television, a content analysis of 98 hours of prime-time television programs and advertising was carried out over 7 consecutive days' viewing in June/July 2004. The main outcome measures were number of scenes in programs, trailers and advertisements depicting alcohol imagery; the extent of critical versus neutral and promotional imagery; and the mean number of scenes with alcohol per hour, and characteristics of scenes in which alcohol featured. Results There were 648 separate depictions of alcohol imagery across the week, with an average of one scene every nine minutes. Scenes depicting uncritical imagery outnumbered scenes showing possible adverse health consequences of drinking by 12 to 1. Conclusion The evidence points to a large amount of alcohol imagery incidental to storylines in programming on NZ television. Alcohol is also used in many advertisements to market non-alcohol goods and services. More attention needs to be paid to the extent of alcohol imagery on television from the industry, the government and public health practitioners. Health education with young people could raise critical awareness of the way alcohol imagery is presented on television. PMID:17270053
Prenatal alcohol exposure increases the susceptibility to develop aggressive prolactinomas in the pituitary gland.

PubMed

Jabbar, Shaima; Reuhl, Kenneth; Sarkar, Dipak K

2018-05-16

Excess alcohol use is known to promote development of aggressive tumors in various tissues in human patients, but the cause of alcohol promotion of tumor aggressiveness is not clearly understood. We used an animals model of fetal alcohol exposure that is known to promote tumor development and determined if alcohol programs the pituitary to acquire aggressive prolactin-secreting tumors. Our results show that pituitaries of fetal alcohol-exposed rats produced increased levels of intra-pituitary aromatase protein and plasma estrogen, enhanced pituitary tissue growth, and upon estrogen challenge developed prolactin-secreting tumors (prolactinomas) that were hemorrhagic and often penetrated into the surrounding tissue. Pituitary tumors of fetal alcohol-exposed rats produced higher levels of hemorrhage-associated genes and proteins and multipotency genes and proteins. Cells of pituitary tumor of fetal alcohol exposed rat grew into tumor spheres in ultra-low attachment plate, expressed multipotency genes, formed an increased number of colonies, showed enhanced cell migration, and induced solid tumors following inoculation in immunodeficient mice. These data suggest that fetal alcohol exposure programs the pituitary to develop aggressive prolactinoma after estrogen treatment possibly due to increase in stem cell niche within the tumor microenvironment.
The first mammalian aldehyde oxidase crystal structure: insights into substrate specificity.

PubMed

Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T P; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

2012-11-23

Aldehyde oxidases have pharmacological relevance, and AOX3 is the major drug-metabolizing enzyme in rodents. The crystal structure of mouse AOX3 with kinetics and molecular docking studies provides insights into its enzymatic characteristics. Differences in substrate and inhibitor specificities can be rationalized by comparing the AOX3 and xanthine oxidase structures. The first aldehyde oxidase structure represents a major advance for drug design and mechanistic studies. Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity.
A sustained depressive state promotes a guanfacine reversible susceptibility to alcohol seeking in rats.

PubMed

Riga, Danai; Schmitz, Leanne J M; van der Harst, Johanneke E; van Mourik, Yvar; Hoogendijk, Witte J G; Smit, August B; De Vries, Taco J; Spijker, Sabine

2014-04-01

High rates of comorbidity between alcohol use disorder (AUD) and major depressive disorder (MDD) are reported. Preclinical models examining effects of primary depression on secondary AUD are currently absent, preventing adequate testing of drug treatment. Here, we combined social defeat-induced persistent stress (SDPS) and operant alcohol self-administration (SA) paradigms to assess causality between these two neuropsychiatric disorders. We then exploited guanfacine, an FDA-approved adrenergic agent reported to reduce drug craving in humans, against SDPS-induced modulation of operant alcohol SA. Wistar rats were socially defeated and isolated for a period of ≥9 weeks, during which depression-like symptomatology (cognitive and social behavioral symptoms) was assessed. Subsequently, animals were subjected to a 5-month operant alcohol SA paradigm, examining acquisition, motivation, extinction, and cue-induced reinstatement of alcohol seeking. The effects of guanfacine on motivation and relapse were measured at >6 months following defeat. SDPS rats exhibited significant disruption of social and cognitive behavior, including short-term spatial and long-term social memory, several months following defeat. Notably, SDPS increased motivation to obtain alcohol, and cue-induced relapse vulnerability. Guanfacine reversed the SDPS-induced effects on motivation and relapse. Together, our model mimics core symptomatology of a sustained depressive-like state and a subsequent vulnerability to alcohol abuse. We show that SDPS is strongly associated with an enhanced motivation for alcohol intake and relapse. Finally, we show that the clinically employed drug guanfacine has potential as a novel treatment option in comorbid patients, as it effectively reduced the enhanced sensitivity to alcohol and alcohol-associated stimuli.
A Sustained Depressive State Promotes a Guanfacine Reversible Susceptibility to Alcohol Seeking in Rats

PubMed Central

Riga, Danai; Schmitz, Leanne JM; van der Harst, Johanneke E; van Mourik, Yvar; Hoogendijk, Witte JG; Smit, August B; De Vries, Taco J; Spijker, Sabine

2014-01-01

High rates of comorbidity between alcohol use disorder (AUD) and major depressive disorder (MDD) are reported. Preclinical models examining effects of primary depression on secondary AUD are currently absent, preventing adequate testing of drug treatment. Here, we combined social defeat-induced persistent stress (SDPS) and operant alcohol self-administration (SA) paradigms to assess causality between these two neuropsychiatric disorders. We then exploited guanfacine, an FDA-approved adrenergic agent reported to reduce drug craving in humans, against SDPS-induced modulation of operant alcohol SA. Wistar rats were socially defeated and isolated for a period of ⩾9 weeks, during which depression-like symptomatology (cognitive and social behavioral symptoms) was assessed. Subsequently, animals were subjected to a 5-month operant alcohol SA paradigm, examining acquisition, motivation, extinction, and cue-induced reinstatement of alcohol seeking. The effects of guanfacine on motivation and relapse were measured at >6 months following defeat. SDPS rats exhibited significant disruption of social and cognitive behavior, including short-term spatial and long-term social memory, several months following defeat. Notably, SDPS increased motivation to obtain alcohol, and cue-induced relapse vulnerability. Guanfacine reversed the SDPS-induced effects on motivation and relapse. Together, our model mimics core symptomatology of a sustained depressive-like state and a subsequent vulnerability to alcohol abuse. We show that SDPS is strongly associated with an enhanced motivation for alcohol intake and relapse. Finally, we show that the clinically employed drug guanfacine has potential as a novel treatment option in comorbid patients, as it effectively reduced the enhanced sensitivity to alcohol and alcohol-associated stimuli. PMID:24192553
Impacts of international trade, services and investment treaties on alcohol regulation.

PubMed

Grieshaber-Otto, J; Sinclair, S; Schacter, N

2000-12-01

There is an underlying incompatibility between government efforts to minimize the harm associated with alcohol, particularly by regulating its supply, and international commercial treaties that promote the freer flow of goods, services and investment. These treaties have already forced changes to many government measures affecting alcohol availability and control, primarily by constraining the activities of government alcohol monopolies and by altering taxation regimes. The North American Free Trade Agreement and the World Trade Organization agreements open new avenues for challenges against alcohol control measures. Some of these agreements extend beyond trade, border measures and differential taxation and allow challenges that intrude into areas of non-discriminatory domestic regulation affecting market access, intellectual property, investment and services. Effective protection from these agreements for vital public health measures has rarely been obtained, although it is increasingly essential. The WTO "services" agreement, basically unknown to the public, is currently being re-negotiated and poses the gravest new challenge to policies designed to influence patterns of alcohol use and minimize alcohol-related harm. In future, these international agreements will probably affect adversely those alcohol approaches considered to be the most effective or promising. These include: maintaining effective state monopolies, restricting the number and locations of retail outlets, taxing and regulating beverages according to alcohol strength, restricting commercial advertising, and maintaining and enhancing public alcohol education and treatment programs. These effects can, in turn, be expected to increase the availability and access to alcohol, to lower alcohol taxes, and to increase advertising and promotion, resulting in increased alcohol consumption and associated health problems. Until more balanced international rules are developed, the challenge facing alcohol
Aiding and abetting roles of NOX oxidases in cellular transformation

PubMed Central

Block, Karen; Gorin, Yves

2013-01-01

NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415
Further Study on the Affordability of Alcoholic Beverages in the EU: A Focus on Excise Duty Pass-Through, On- and Off-Trade Sales, Price Promotions and Statutory Regulations.

PubMed

Rabinovich, Lila; Hunt, Priscillia; Staetsky, Laura; Goshev, Simo; Nolte, Ellen; Pedersen, Janice S; Tiefensee, Christine

2012-01-01

Policies related to alcohol pricing, promotion and discounts provide opportunities to address harms associated with alcohol misuse. However, there are important gaps in information and knowledge about the regulations in place across parts of Europe and their impacts on consumer prices and locations of purchase. Using market data, we explored the overall scale and trend of price promotions and discounts in the off-premise (e.g. supermarket) and on-premise (e.g. restaurants, pubs) across five EU Member States. To better understand the factors that may influence sales in the on- vs. off-premises, we performed regression analysis for four EU Member States with relevant data. This found that increases in broadband penetration and population density were associated with relatively higher levels of off-premise alcohol purchases and that increases in income were associated with relatively higher levels of on-premise purchases of alcohol. There was no statistically significant relationship for female higher education. We further used time-series methods, drawing on data for Ireland, Latvia, Slovenia and Finland, to estimate the impact of changes in excise duty on price ("pass-through"). This showed that a €1 increase in excise duty increased beer prices by €0.50-€2.50 in the off-premise, and increased spirits prices by €0.70-€1.40 in the off-premise. These findings suggest that, depending on the price sensitivity of consumers and other strategies employed by suppliers (e.g. advertising), changes in excise duty may be an effective instrument to reduce harmful alcohol consumption.
The illusion of righteousness: corporate social responsibility practices of the alcohol industry.

PubMed

Yoon, Sungwon; Lam, Tai-Hing

2013-07-03

Corporate social responsibility (CSR) has become an integral element of how the alcohol industry promotes itself. The existing analyses of CSR in the alcohol industry point to the misleading nature of these CSR practices. Yet, research has been relatively sparse on how the alcohol industry advances CSR in an attempt to facilitate underlying business interests, and in what ways the ongoing display of industry CSR impacts public health. This paper aims to investigate the alcohol industry's recent CSR engagements and explain how CSR forms part of the industry's wider political and corporate strategies. Our study used qualitative methods to collect and analyse data. We searched for materials pertaining to CSR activities from websites of three transnational alcohol corporations, social media platforms, media reports and other sources. Relevant documents were thematically analysed with an iterative approach. Our analysis identified three CSR tactics employed by the alcohol companies which are closely tied in with the industry's underlying corporate intents. First, the alcohol manufacturers employ CSR as a means to frame issues, define problems and guide policy debates. In doing this, the alcohol companies are able to deflect and shift the blame from those who manufacture and promote alcoholic products to those who consume them. Second, the alcohol corporations promote CSR initiatives on voluntary regulation in order to delay and offset alcohol control legislation. Third, the alcohol corporations undertake philanthropic sponsorships as a means of indirect brand marketing as well as gaining preferential access to emerging alcohol markets. The increasing penetration and involvement of the alcohol industry into CSR highlights the urgent needs for public health counter actions. Implementation of any alcohol control measures should include banning or restricting the publicity efforts of the industry's CSR and informing the public of the alcohol industry's notion of social
The illusion of righteousness: corporate social responsibility practices of the alcohol industry

PubMed Central

2013-01-01

Background Corporate social responsibility (CSR) has become an integral element of how the alcohol industry promotes itself. The existing analyses of CSR in the alcohol industry point to the misleading nature of these CSR practices. Yet, research has been relatively sparse on how the alcohol industry advances CSR in an attempt to facilitate underlying business interests, and in what ways the ongoing display of industry CSR impacts public health. This paper aims to investigate the alcohol industry’s recent CSR engagements and explain how CSR forms part of the industry’s wider political and corporate strategies. Methods Our study used qualitative methods to collect and analyse data. We searched for materials pertaining to CSR activities from websites of three transnational alcohol corporations, social media platforms, media reports and other sources. Relevant documents were thematically analysed with an iterative approach. Results Our analysis identified three CSR tactics employed by the alcohol companies which are closely tied in with the industry’s underlying corporate intents. First, the alcohol manufacturers employ CSR as a means to frame issues, define problems and guide policy debates. In doing this, the alcohol companies are able to deflect and shift the blame from those who manufacture and promote alcoholic products to those who consume them. Second, the alcohol corporations promote CSR initiatives on voluntary regulation in order to delay and offset alcohol control legislation. Third, the alcohol corporations undertake philanthropic sponsorships as a means of indirect brand marketing as well as gaining preferential access to emerging alcohol markets. Conclusions The increasing penetration and involvement of the alcohol industry into CSR highlights the urgent needs for public health counter actions. Implementation of any alcohol control measures should include banning or restricting the publicity efforts of the industry’s CSR and informing the public
Methods for transfer a saliva based alcohol content test to a dermal patch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silks, III, Louis A.

Detection and quantitation of ethanol which is highly sensitive, specific, and efficient has been a commercial target for sometime. Clearly analytical methods are useful such as gas and liquid chromatography, mass spectrometry, and NMR spectroscopy. However, those methods are best used in the laboratory and a less useful for detection and quantitation of ethanol in the field. Enzymes have been employed for the detection and quantitation of EtOH. Enzymes are proteins that perform a particular task in a bio-catalytic way. Most of the chemistry that these enzymes do are frequently exquisitely specific in that only one alcohol reacts and onlymore » one product is produced. One enzyme molecule can catalyze the reaction of numerous substrate molecules which in itself is an amplification of the recognition signal. Alcohol dehydrogenase (ADH) and alcohol oxidase (AO) are two possible enzymatic targets for EtOH sensor development.1 The ADH oxidizes the alcohol using a co-factor nicotinamide adenine dinucleotide. This co-factor needs to be within close proximity of the ADH. AO also oxidizes the ethanol using molecular oxygen giving rise to the production of the aldehyde and hydrogen peroxide.« less
Alcohol, microbiome, life style influence alcohol and non-alcoholic organ damage.

PubMed

Neuman, Manuela G; French, Samuel W; Zakhari, Samir; Malnick, Stephen; Seitz, Helmut K; Cohen, Lawrence B; Salaspuro, Mikko; Voinea-Griffin, Andreea; Barasch, Andrei; Kirpich, Irina A; Thomes, Paul G; Schrum, Laura W; Donohue, Terrence M; Kharbanda, Kusum K; Cruz, Marcus; Opris, Mihai

2017-02-01

. Dysregulation of metabolism, as a result of ethanol exposure, in the intestine leads to colon carcinogenesis. The hepatotoxic effects of ethanol undermine the contribution of malnutrition to the liver injury. Dietary interventions such as micro and macronutrients, as well as changes to the microbiota have been suggested. The clinical aspects of NASH, as part of the metabolic syndrome in the aging population, have been presented. The symposium addressed mechanisms and biomarkers of alcohol induced damage to different organs, as well as the role of the microbiome in this dialog. The microbiota regulates and acts as a key element in harmonizing immune responses at intestinal mucosal surfaces. It is known that microbiota is an inducer of proinflammatory T helper 17 cells and regulatory T cells in the intestine. The signals at the sites of inflammation mediate recruitment and differentiation in order to remove inflammatory inducers and promote tissue homeostasis restoration. The change in the intestinal microbiota also influences the change in obesity and regresses the liver steatosis. Evidence on the positive role of moderate alcohol consumption on heart and metabolic diseases as well on reducing steatosis have been looked up. Moreover nutrition as a therapeutic intervention in alcoholic liver disease has been discussed. In addition to the original data, we searched the literature (2008-2016) for the latest publication on the described subjects. In order to obtain the updated data we used the usual engines (Pub Med and Google Scholar). The intention of the eighth symposia was to advance the international profile of the biological research on alcoholism. We also wish to further our mission of leading the forum to progress the science and practice of translational research in alcoholism. Copyright © 2017 Elsevier Inc. All rights reserved.
Smartphone applications to reduce alcohol consumption and help patients with alcohol use disorder: a state-of-the-art review.

PubMed

Meredith, Steven E; Alessi, Sheila M; Petry, Nancy M

Hazardous drinking and alcohol use disorder (AUD) are substantial contributors to USA and global morbidity and mortality. Patient self-management and continuing care are needed to combat these public health threats. However, services are rarely provided to patients outside of clinic settings or following brief intervention. Smartphone applications ("apps") may help narrow the divide between traditional health care and patient needs. The purpose of this review is to identify and summarize smartphone apps to reduce alcohol consumption or treat AUD that have been evaluated for feasibility, acceptability, and/or efficacy. We searched two research databases for peer-reviewed journal articles published in English that evaluated smartphone apps to decrease alcohol consumption or treat AUD. We identified six apps. Two of these apps (A-CHESS and LBMI-A) promoted self-reported reductions in alcohol use, two (Promillekoll and PartyPlanner) failed to promote self-reported reductions in alcohol use, and two (HealthCall-S and Chimpshop) require further evaluation and testing before any conclusions regarding efficacy can be made. In summary, few evaluations of smartphone apps to reduce alcohol consumption or treat AUD have been reported in the scientific literature. Although advances in smartphone technology hold promise for disseminating interventions among hazardous drinkers and individuals with AUD, more systematic evaluations are necessary to ensure that smartphone apps are clinically useful.
NADPH Oxidase Activation Contributes to Heavy Ion Irradiation–Induced Cell Death

PubMed Central

Wang, Yupei; Liu, Qing; Zhao, Weiping; Zhou, Xin; Miao, Guoying; Sun, Chao

2017-01-01

Increased oxidative stress plays an important role in heavy ion radiation–induced cell death. The mechanism involved in the generation of elevated reactive oxygen species (ROS) is not fully illustrated. Here we show that NADPH oxidase activation is closely related to heavy ion radiation–induced cell death via excessive ROS generation. Cell death and cellular ROS can be greatly reduced in irradiated cancer cells with the preincubation of diphenyleneiodium, an inhibitor of NADPH oxidase. Most of the NADPH oxidase (NOX) family proteins (NOX1, NOX2, NOX3, NOX4, and NOX5) showed increased expression after heavy ion irradiation. Meanwhile, the cytoplasmic subunit p47phox was translocated to the cell membrane and localized with NOX2 to form reactive NADPH oxidase. Our data suggest for the first time that ROS generation, as mediated by NADPH oxidase activation, could be an important contributor to heavy ion irradiation–induced cell death. PMID:28473742
Immobilization of xanthine oxidase on a polyaniline silicone support.

PubMed

Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

1996-03-01

A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.
The promotional effects of cesium promoter on higher alcohol synthesis from syngas over cesium-promoted Cu/ZnO/Al2O3 catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Jie; Cai, Qiuxia; Wan, Yan

In this study, the promotional effects of cesium promoter on higher alcohol (C2+OH) synthesis from syngas over Cs-Cu/ZnO/Al2O3 catalysts were investigated using a combined experimental and theoretical density functional theory (DFT) calculation method. In the presence of cesium, the C2+OH productivity increases from 77.1 g•kgcat-1•h-1 to 157.3 g•kgcat-1•h-1 at 583 K due to the enhancement of the initial C–C bond formation. Detailed analysis of chain growth probabilities (CGPs) confirms that initial C–C bond formation is the rate-determining step in the temperature range of 543-583 K. Addition of cesium promoter significantly increases the productivities of 2-methyl-1-propanol, while the CGPs values (C3*more » to 2-methyl-C3*) is almost unaffected. With the assistance of cesium promoter, the CGPs of the initial C–C bond formation step (C1* to C2*) could be increased from 0.13 to 0.25 at 583 K. DFT calculations indicate that the initial C–C bond formation is mainly contributed by the HCO+HCO coupling reaction over the ZnCu(211) model surface. In the presence of the Cs2O, the stabilities of key reaction intermediates such as HCO and H2CO are enhanced which facilitates both HCO+HCO and HCO+H2CO coupling reaction steps with lower activation barriers over the Cs2O-ZnCu(211) surface. The promotional effects of cesium on the C2+OH productivity are also benefited from the competitive CH+HCO coupling reaction over CH hydrogenation that leads to lower alkane formation. In addition, Bader charge analysis suggests that the presence of cesium ions would facilitate the nucleophilic reaction between HCO and H2CO for initial C–C bond formation. This work was supported by the National Natural Science Foundation of China (No. 91545114 and No. 91545203). We appreciate the joint PhD scholarship support from the China Scholarship Council. The authors would also like to thank the support from Collaborative Innovation Center of Chemistry for Energy Materials (2011-i
Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

PubMed

Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

1996-02-01

It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.
[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

PubMed

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
Simple, high-yield purification of xanthine oxidase from bovine milk.

PubMed

Ozer, N; Müftüoglu, M; Ataman, D; Ercan, A; Ogüs, I H

1999-05-13

Xanthine oxidase, a commercially important enzyme with a wide area of application, was extracted from fresh milk, without added preservatives, using toluene and heat. The short purification procedure, with high yield, consisted of extraction, ammonium sulfate fractionation, and DEAE-Sepharose (fast flow) column chromatography. Xanthine oxidase was eluted as a single activity peak from the column using a buffer gradient. The purification fold, specific activity and yield for the purified xanthine oxidase were 328, 10.161 U/mg and 69%, respectively. The enzyme was concentrated by ultrafiltration, although 31% of the activity was lost during concentration, no change in specific activity was observed. Activity and protein gave coincident staining bands on native polyacrylamide gels. The intensity and the number of bands were dependent on the oxidative state(s) of the enzyme; reduction by 2-mercaptoethanol decreased the intensity of the slow-moving bands and increased the intensity of the fastest-moving band. Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), two major bands (molecular masses of 152 and 131 kDa) were observed, accounting for > or = 95% of xanthine oxidase. Native- and SDS-PAGE showed that the purified xanthine oxidase becomes a heterodimer due to endogenous proteases.

Religious factors associated with alcohol involvement: results from the Mauritian Joint Child Health Project.

PubMed

Luczak, Susan E; Prescott, Carol A; Dalais, Cyril; Raine, Adrian; Venables, Peter H; Mednick, Sarnoff A

2014-02-01

The purpose of this study was to examine religious factors associated with alcohol involvement in Mauritius. The three main religions on the island, Hinduism, Catholicism, and Islam, promote different views of the appropriate use of alcohol. Based on reference group theory, we hypothesized that both the content of a religion's alcohol norms and an individual's religious commitment would relate to alcohol use behavior. Participants were from the Joint Child Health Project, a longitudinal study that has followed a birth cohort of 1.795 individuals since 1972 when they were 3 years old. All available participants (67%; 55% male) were assessed in mid-adulthood on religious variables, lifetime drinking, and lifetime alcohol use disorders. Across religions, individuals who viewed their religion as promoting abstinence were less likely to be drinkers. Religious commitment was associated with reduced probability of drinking only in those who viewed their religion as promoting abstinence. Among drinkers, abstention norms and religious commitment were not associated with lower likelihood of alcohol use disorders. In Catholics who viewed their religion as promoting abstinence and still were drinkers, high religious commitment was associated with increased risk for alcohol use disorders. Predictions based on reference group theory were largely supported, with religious norms and commitment differentially related to alcohol use and problems both across religions and among individuals within religions. Findings highlight the importance of examining multiple aspects of religion to better understand the relationship of religion with alcohol behaviors. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Alkali promoted molybdenum (IV) sulfide based catalysts, development and characterization for alcohol synthesis from carbon monoxide and hydrogen

NASA Astrophysics Data System (ADS)

Molina, Belinda Delilah

For more than a century transition metal sulfides (TMS) have been the anchor of hydro-processing fuels and upgrading bitumen and coal in refineries worldwide. As oil supplies dwindle and environmental laws become more stringent, there is a greater need for cleaner alternative fuels and/or synthetic fuels. The depletion of oil reserves and a rapidly increasing energy demand worldwide, together with the interest to reduce dependence on foreign oil makes alcohol production for fuels and chemicals via the Fischer Tropsch synthesis (FTS) very attractive. The original Fischer-Tropsch (FT) reaction is the heart of all gas-to-liquid technologies; it creates higher alcohols and hydrocarbons from CO/H2 using a metal catalyst. This research focuses on the development of alkali promoted MoS2-based catalysts to investigate an optimal synthesis for their assistance in the production of long chain alcohols (via FTS) for their use as synthetic transportation liquid fuels. Properties of catalytic material are strongly affected by every step of the preparation together with the quality of the raw materials. The choice of a laboratory method for preparing a given catalyst depends on the physical and chemical characteristics desired in the final composition. Characterization methods of K0.3/Cs0.3-MoS2 and K0.3 /Cs0.3-Co0.5MoS2 catalysts have been carried out through Scanning Electron Microscopy (SEM), BET porosity and surface analysis, Transmission Electron Microscopy (TEM) and X-Ray Diffraction (XRD). Various characterization methods have been deployed to correlate FTS products versus crystal and morphological properties of these heterogeneous catalysts. A lab scale gas to liquid system has been developed to evaluate its efficiency in testing FT catalysts for their production of alcohols.
The effects of cumulative risks and promotive factors on urban adolescent alcohol and other drug use: a longitudinal study of resiliency.

PubMed

Ostaszewski, Krzysztof; Zimmerman, Marc A

2006-12-01

Resiliency theory provides a conceptual framework for studying why some youth exposed to risk factors do not develop the negative behaviors they predict. The purpose of this study was to test compensatory and protective models of resiliency in a longitudinal sample of urban adolescents (80% African American). The data were from Years 1 (9th grade) and 4 (12th grade). The study examined effects of cumulative risk and promotive factors on adolescent polydrug use including alcohol, tobacco and marijuana. Cumulative measures of risk/promotive factors represented individual characteristics, peer influence, and parental/familial influences. After controlling for demographics, results of multiple regression of polydrug use support the compensatory model of resiliency both cross-sectionally and longitudinally. Promotive factors were also found to have compensatory effects on change in adolescent polydrug use. The protective model of resiliency evidenced cross-sectionally was not supported in longitudinal analysis. The findings support resiliency theory and the use of cumulative risk/promotive measures in resiliency research. Implications focused on utilizing multiple assets and resources in prevention programming are discussed.
Urate Oxidase Purification by Salting-in Crystallization: Towards an Alternative to Chromatography

PubMed Central

Giffard, Marion; Ferté, Natalie; Ragot, François; El Hajji, Mohamed; Castro, Bertrand; Bonneté, Françoise

2011-01-01

Background Rasburicase (Fasturtec® or Elitek®, Sanofi-Aventis), the recombinant form of urate oxidase from Aspergillus flavus, is a therapeutic enzyme used to prevent or decrease the high levels of uric acid in blood that can occur as a result of chemotherapy. It is produced by Sanofi-Aventis and currently purified via several standard steps of chromatography. This work explores the feasibility of replacing one or more chromatography steps in the downstream process by a crystallization step. It compares the efficacy of two crystallization techniques that have proven successful on pure urate oxidase, testing them on impure urate oxidase solutions. Methodology/Principal Findings Here we investigate the possibility of purifying urate oxidase directly by crystallization from the fermentation broth. Based on attractive interaction potentials which are known to drive urate oxidase crystallization, two crystallization routes are compared: a) by increased polymer concentration, which induces a depletion attraction and b) by decreased salt concentration, which induces attractive interactions via a salting-in effect. We observe that adding polymer, a very efficient way to crystallize pure urate oxidase through the depletion effect, is not an efficient way to grow crystals from impure solution. On the other hand, we show that dialysis, which decreases salt concentration through its strong salting-in effect, makes purification of urate oxidase from the fermentation broth possible. Conclusions The aim of this study is to compare purification efficacy of two crystallization methods. Our findings show that crystallization of urate oxidase from the fermentation broth provides purity comparable to what can be achieved with one chromatography step. This suggests that, in the case of urate oxidase, crystallization could be implemented not only for polishing or concentration during the last steps of purification, but also as an initial capture step, with minimal changes to the
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

PubMed Central

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-01-01

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056
Prevention before profits: a levy on food and alcohol advertising.

PubMed

Harper, Todd A; Mooney, Gavin

2010-04-05

The recent interest in health promotion and disease prevention has drawn attention to the role of the alcohol and junk-food industries. Companies supplying, producing, advertising or selling alcohol or junk food (ie, foods with a high content of fat, sugar or salt) do so to generate profits. Even companies marketing "low-carbohydrate" beers, "mild" cigarettes, or "high-fibre" sugary cereals are not primarily concerned about population health, more so increased sales and profits. In a competitive market, it is assumed that consumers make fully informed choices about costs and benefits before purchasing. However, consumers are not being fully informed of the implications of their junk-food and alcohol choices, as advertising of these products carries little information on the health consequences of consumption. We propose that there should be a levy on advertising expenditure for junk food and alcoholic beverages to provide an incentive for industry to promote healthier products. Proceeds of the levy could be used to provide consumers with more complete and balanced information on the healthy and harmful impacts of food and alcohol choices. Our proposal addresses two of the greatest challenges facing Australia's preventable disease epidemic - the imbalance between the promotion of healthier and unhealthy products, and securing funds to empower consumer choice.
Feasibility and acceptability of shared decision-making to promote alcohol behavior change among women Veterans: Results from focus groups.

PubMed

Abraham, Traci H; Wright, Patricia; White, Penny; Booth, Brenda M; Cucciare, Michael A

2017-01-01

Although rates of unhealthy drinking are high among women Veterans with mental health comorbidities, most women Veterans with mental comorbidities who present to primary care with unhealthy drinking do not receive alcohol-related care. Barriers to alcohol-related treatment could be reduced through patient-centered approaches to care, such as shared decision-making. We assessed the feasibility and acceptability of a telephone-delivered shared decision-making intervention for promoting alcohol behavior change in women Veterans with unhealthy drinking and co-morbid depression and/or probable post-traumatic stress disorder. We used 3, 2-hour focus group discussions with 19 women Veterans to identify barriers and solicit recommendations for using the intervention with women Veterans who present to primary care with unhealthy drinking and mental health comorbidities. Transcripts from the focus groups were qualitatively analyzed using template analysis. Although participants perceived that the intervention was feasible and acceptable for the targeted patient population, they identified the treatment delivery modality, length of telephone sessions, and some of the option grid content as potential barriers. Facilitators included strategies for enhancing the telephone-delivered shared decision-making sessions and diversifying the treatment options contained in the option grids. Focus group feedback resulted in preliminary adaptations to the intervention that are mindful of women Veterans' individual preferences for care and realistic in the everyday context of their busy lives.
Simple exposure to alcohol cues causally increases negative implicit attitudes toward lesbians and gay men.

PubMed

Greitemeyer, Tobias; Nierula, Carina

2016-01-01

Previous research has shown that acute alcohol consumption is associated with negative responses toward outgroup members such as sexual minorities. However, simple alcohol cue exposure without actually consuming alcohol also influences social behavior. Hence, it was reasoned that priming participants with words related to alcohol (relative to neutral words) would promote prejudiced attitudes toward sexual minorities. In fact, an experiment showed that alcohol cue exposure causally led to more negative implicit attitudes toward lesbians and gay men. In contrast, participants' explicit attitudes were relatively unaffected by the priming manipulation. Moreover, participants' typical alcohol use was not related to their attitudes toward lesbians and gay men. In sum, it appears that not only acute alcohol consumption but also the simple exposure of alcohol cues may promote negative views toward lesbians and gay men.
The global alcohol industry: an overview.

PubMed

Jernigan, David H

2009-02-01

To describe the globalized sector of the alcoholic beverage industry, including its size, principal actors and activities. Market research firms and business journalism are the primary sources for information about the global alcohol industry, and are used to profile the size and membership of the three main industry sectors of beer, distilled spirits and wine. Branded alcoholic beverages are approximately 38% of recorded alcohol consumption world-wide. Producers of these beverages tend to be large multi-national corporations reliant on marketing for their survival. Marketing activities include traditional advertising as well as numerous other activities, such as new product development, product placement and the creation and promotion of social responsibility programs, messages and organizations. The global alcohol industry is highly concentrated and innovative. There is relatively little public health research evaluating the impact of its many marketing activities.
5-hydroxytryptamine actions in adipocytes: involvement of monoamine oxidase-dependent oxidation and subsequent PPARγ activation.

PubMed

Grès, Sandra; Gomez-Zorita, Saioa; Gomez-Ruiz, Ana; Carpéné, Christian

2013-06-01

Serotonin (5-HT) is a brain neurotransmitter instrumental for the antidepressant action of selective inhibitors of serotonin reuptake (SSRIs) while it also plays important roles in peripheral organs. Recently, the 5-HT oxidation products, 5-hydroxyindoleacetate and 5-methoxy-indoleacetate, have been shown to bind to peroxisome proliferator-activated receptor γ (PPARγ) and to enhance lipid accumulation in preadipocytes. Since we already reported that adipocytes exhibit elevated monoamine oxidase (MAO) and primary amine oxidase activities, we verified how adipocytes readily oxidize 5-HT, with the objective to determine whether such oxidation promotes PPARγ activation and lipid storage. To this aim, serotonin was tested on cultured 3T3 F442A preadipocytes and on human adipocytes. Results showed that 5-HT was oxidized by MAO in both models. Daily treatment of 3T3 F442A preadipocytes for 8 days with 100-500 μM 5-HT promoted triglyceride accumulation and emergence of adipogenesis markers. At 250 μM, 5-HT alone reproduced half of 50 nM insulin-induced adipogenesis, and exhibited an additive differentiating effect when combined with insulin. Moreover, the 5-HT-induced expression of PPARγ-responsive genes (PEPCK, aP2/FABP4) was blocked by GW 9662, a PPARγ-inhibitor, or by pargyline, a MAO-inhibitor. In human fat cells, 6-h exposure to 100 μM 5-HT increased PEPCK expression as did the PPARγ-agonist rosiglitazone. Since hydrogen peroxide, another amine oxidation product, did not reproduce such enhancement, we propose that serotonin can promote PPARγ activation in fat cells, via the indoleacetate produced during MAO-dependent oxidation. Such pathway could be involved in the adverse effects of several antidepressant SSRIs on body weight gain.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.

PubMed

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Structure of caa(3) cytochrome c oxidase--a nature-made enzyme-substrate complex.

PubMed

Noor, Mohamed Radzi; Soulimane, Tewfik

2013-05-01

Aerobic respiration, the energetically most favorable metabolic reaction, depends on the action of terminal oxidases that include cytochrome c oxidases. The latter forms a part of the heme-copper oxidase superfamily and consists of three different families (A, B, and C types). The crystal structures of all families have now been determined, allowing a detailed structural comparison from evolutionary and functional perspectives. The A2-type oxidase, exemplified by the Thermus thermophilus caa(3) oxidase, contains the substrate cytochrome c covalently bound to the enzyme complex. In this article, we highlight the various features of caa(3) enzyme and provide a discussion of their importance, including the variations in the proton and electron transfer pathways.
The Importance of NADPH Oxidases and Redox Signaling in Angiogenesis

PubMed Central

Prieto-Bermejo, Rodrigo; Hernández-Hernández, Angel

2017-01-01

Eukaryotic cells have to cope with the constant generation of reactive oxygen species (ROS). Although the excessive production of ROS might be deleterious for cell biology, there is a plethora of evidence showing that moderate levels of ROS are important for the control of cell signaling and gene expression. The family of the nicotinamide adenine dinucleotide phosphate oxidases (NADPH oxidases or Nox) has evolved to produce ROS in response to different signals; therefore, they fulfil a central role in the control of redox signaling. The role of NADPH oxidases in vascular physiology has been a field of intense study over the last two decades. In this review we will briefly analyze how ROS can regulate signaling and gene expression. We will address the implication of NADPH oxidases and redox signaling in angiogenesis, and finally, the therapeutic possibilities derived from this knowledge will be discussed. PMID:28505091
Degradation of oxalate in rats implanted with immobilized oxalate oxidase.

PubMed

Raghavan, K G; Tarachand, U

1986-01-20

Accumulation of oxalate leads to hyperoxaluria and calcium oxalate nephrolithiasis in man. Since oxalate is a metabolic end product in mammals, the feasibility of its enzymic degradation has been tested in vivo in rats by administering exogenous oxalate oxidase. Oxalate oxidase, isolated from banana fruit peels, in its native form was found to be non-active at the physiological pH of the recipient animal. However, its functional viability in the recipient animal was ensured by its prior binding with ethylenemaleic anhydride, thus shifting its pH activity curve towards the alkaline range. Rats implanted with dialysis membrane capsules containing such immobilized oxalate oxidase in their peritoneal cavities effectively metabolized intraperitoneally injected [14C]oxalate as well as its precursor [14C]glyoxalate. The implantation of capsules containing coentrapped multienzyme preparations of oxalate oxidase, catalase and peroxidase led to a further degradation of administered [14C]oxalate in rats.
Impact of alcohol advertising and media exposure on adolescent alcohol use: a systematic review of longitudinal studies.

PubMed

Anderson, Peter; de Bruijn, Avalon; Angus, Kathryn; Gordon, Ross; Hastings, Gerard

2009-01-01

To assess the impact of alcohol advertising and media exposure on future adolescent alcohol use. We searched MEDLINE, the Cochrane Library, Sociological Abstracts, and PsycLIT, from 1990 to September 2008, supplemented with searches of Google scholar, hand searches of key journals and reference lists of identified papers and key publications for more recent publications. We selected longitudinal studies that assessed individuals' exposure to commercial communications and media and alcohol drinking behaviour at baseline, and assessed alcohol drinking behaviour at follow-up. Participants were adolescents aged 18 years or younger or below the legal drinking age of the country of origin of the study, whichever was the higher. Thirteen longitudinal studies that followed up a total of over 38,000 young people met inclusion criteria. The studies measured exposure to advertising and promotion in a variety of ways, including estimates of the volume of media and advertising exposure, ownership of branded merchandise, recall and receptivity, and one study on expenditure on advertisements. Follow-up ranged from 8 to 96 months. One study reported outcomes at multiple time-points, 3, 5, and 8 years. Seven studies provided data on initiation of alcohol use amongst non-drinkers, three studies on maintenance and frequency of drinking amongst baseline drinkers, and seven studies on alcohol use of the total sample of non-drinkers and drinkers at baseline. Twelve of the thirteen studies concluded an impact of exposure on subsequent alcohol use, including initiation of drinking and heavier drinking amongst existing drinkers, with a dose response relationship in all studies that reported such exposure and analysis. There was variation in the strength of association, and the degree to which potential confounders were controlled for. The thirteenth study, which tested the impact of outdoor advertising placed near schools failed to detect an impact on alcohol use, but found an impact on
Urate oxidase is imported into peroxisomes recognizing the C-terminal SKL motif of proteins.

PubMed

Miura, S; Oda, T; Funai, T; Ito, M; Okada, Y; Ichiyama, A

1994-07-01

Rat liver urate oxidase synthesized from cDNA through coupled transcription and translation was incubated at 26 degrees C for 60 min with purified peroxisomes from rat liver. Urate oxidase was efficiently imported into the peroxisomes, as determined by resistance to externally added proteinase K. The amount of imported urate oxidase increased with time and the import was temperature dependent. A synthetic peptide composed of the C-terminal 10 amino acid residues of acyl-CoA oxidase (the C-terminal tripeptide is Ser-Lys-Leu) inhibited the import of urate oxidase, whereas other peptides, in which the C-terminal Ser-Lys-Leu (SKL) sequence was deleted or mutated, were not effective. Two mutant urate oxidase proteins in which the C-terminal Ser-Arg-Leu (SRL) sequence was deleted or mutated to Ser-Glu-Leu (SEL) were not imported into peroxisomes. With substitution of a lysine residue for arginine in the SRL tripeptide at the C-terminus the import activity was retained. These results show that urate oxidase is important into peroxisomes via a common pathway with acyl-CoA oxidase, and that the C-terminal SRL sequence functions as a peroxisomal-targeting signal.
The moderating effects of culture on peer deviance and alcohol use among high-risk African-American Adolescents.

PubMed

Nasim, Aashir; Belgrave, Faye Z; Jagers, Robert J; Wilson, Karen D; Owens, Kristal

2007-01-01

African-American adolescents have lower rates of alcohol consumption than White youth. However, African-American youth suffer disproportionately more adverse social, mental, and physical health outcomes related to alcohol use. Affiliating with negative peers is a risk factor for alcohol initiation and consumption. Cultural variables have shown moderating effects against other risk factors for African-American youth and therefore were the focus of this study. Specifically, we tested whether three culturally-relevant variables, Africentric beliefs, religiosity, and ethnic identity were promotive or protective for alcohol initiation and use within the context of negative peer affiliations. The sample consisted of 114 at-risk African-American adolescents whose ages ranged from 13 to 20. Participants were administered a questionnaire with measures of alcohol initiation and use, peer risk behaviors, ethnic identity, Africentric beliefs, religiosity, and demographic items. Peer risk behaviors accounted for significant percentages of the variance in age of alcohol initiation, lifetime use, and current and heavy alcohol use after adjusting for age and gender. Cultural variables showed both promotive and protective effects. Africentric beliefs were promotive of delayed alcohol initiation, whereas both Africentrism and religiosity moderated peer risk behaviors effect on alcohol initiation. Africentric beliefs were also inversely related to lifetime alcohol use revealing a promotive effect. Moreover, there were significant protective effects of ethnic identity and religiosity on heavy alcohol consumption. One implication of these findings is that prevention programs that infuse cultural values and practices such as Africentrism, ethnic identity, and religiosity may delay alcohol initiation and reduce use especially for youth with high risk peers.
Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

PubMed Central

Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

2014-01-01

Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607
Genetic variation and epigenetic modification of the prodynorphin gene in peripheral blood cells in alcoholism.

PubMed

D'Addario, Claudio; Shchetynsky, Klementy; Pucci, Mariangela; Cifani, Carlo; Gunnar, Agneta; Vukojević, Vladana; Padyukov, Leonid; Terenius, Lars

2017-06-02

Dynorphins are critically involved in the development, maintenance and relapse of alcoholism. Alcohol-induced changes in the prodynorphin gene expression may be influenced by both gene polymorphisms and epigenetic modifications. The present study of human alcoholics aims to evaluate DNA methylation patterns in the prodynorphin gene (PDYN) promoter and to identify single nucleotide polymorphisms (SNPs) associated with alcohol dependence and with altered DNA methylation. Genomic DNA was isolated from peripheral blood cells of alcoholics and healthy controls, and DNA methylation was studied in the PDYN promoter by bisulfite pyrosequencing. In alcoholics, DNA methylation increased in three of the seven CpG sites investigated, as well as in the average of the seven CpG sites. Data stratification showed lower increase in DNA methylation levels in individuals reporting craving and with higher levels of alcohol consumption. Association with alcoholism was observed for rs2235751 and the presence of the minor allele G was associated with reduced DNA methylation at PDYN promoter in females and younger subjects. Genetic and epigenetic factors within PDYN are related to risk for alcoholism, providing further evidence of its involvement on ethanol effects. These results might be of relevance for developing new biomarkers to predict disease trajectories and therapeutic outcome. Copyright © 2017 Elsevier Inc. All rights reserved.
Identification in Marinomonas mediterranea of a novel quinoprotein with glycine oxidase activity.

PubMed

Campillo-Brocal, Jonatan Cristian; Lucas-Elio, Patricia; Sanchez-Amat, Antonio

2013-08-01

A novel enzyme with lysine-epsilon oxidase activity was previously described in the marine bacterium Marinomonas mediterranea. This enzyme differs from other l-amino acid oxidases in not being a flavoprotein but containing a quinone cofactor. It is encoded by an operon with two genes lodA and lodB. The first one codes for the oxidase, while the second one encodes a protein required for the expression of the former. Genome sequencing of M. mediterranea has revealed that it contains two additional operons encoding proteins with sequence similarity to LodA. In this study, it is shown that the product of one of such genes, Marme_1655, encodes a protein with glycine oxidase activity. This activity shows important differences in terms of substrate range and sensitivity to inhibitors to other glycine oxidases previously described which are flavoproteins synthesized by Bacillus. The results presented in this study indicate that the products of the genes with different degrees of similarity to lodA detected in bacterial genomes could constitute a reservoir of different oxidases. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

The Implementation Process of Alcohol Policies in Eight Swedish Football Clubs

ERIC Educational Resources Information Center

Geidne, Susanna; Quennerstedt, Mikael; Eriksson, Charli

2013-01-01

Purpose: Alcohol stands in an ambiguous relationship to sports, and there is a common belief that participation in sports prevents alcohol consumption. Although this is not always the case, sports clubs can be important settings for health promoting alcohol policy interventions .The purpose of this paper is to explore the process of implementing…
Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria.

PubMed

Roloff, Gabrielle A; Henry, Michael F

2015-08-15

Three mitochondrial DNA-encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1. © 2015 Roloff and Henry. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Alcohol Industry Sponsorship of University Student Sports Clubs in Brazil.

PubMed

Pinsky, Ilana; Noto, Ana Regina; Botéquio de Moraes, Maria Carolina; Lucas Dos Santos, Elaine; Sparks, Robert; O'Brien, Kerry

2017-03-01

The university sport environment represents an important target for alcohol industry marketing. This study investigated the nature of relationships between the alcohol industry and university student sports clubs (USSCs). Semi-structured interviews were conducted with board members from 60 active USSCs in the city of São Paulo, Brazil. Interviews were transcribed and subjected to content analysis using NVivo10. All invited USSCs participated in the study. Most (n = 53; 88%) reported having signed contracts with the alcohol industry (breweries, in every case) to have their sports events and parties sponsored. The most common sponsorship arrangement involved the supply of discounted beer for sport and student events. T-shirts, beer freezers, and stereo systems were also frequently provided by the alcohol industry to support alcohol-related sports events. In addition, the alcohol industry event promoters helped market the events and products. In return, the USSCs agreed to exclusively sell the sponsors' brand of beer and/or order and sell a quota of beer at their events. Forty-nine interviewees (81%) reported agreements with alcohol companies whereby open bars (free alcohol events) would also be provided. Despite reporting a range of alcohol harms, participants did not perceive there to be a high risk of harm from the alcohol sponsorship arrangements. Most USSCs in São Paulo, Brazil, have formalized contracts with the alcohol industry that promote the marketing, sale, and consumption of alcohol at parties and university games. A critical review of the impacts of these practices and university policies on alcohol industry sponsorship that can take account of the role of such arrangements in student drinking is warranted.
Alcohol dependence as a chronic pain disorder

PubMed Central

Egli, Mark; Koob, George F.; Edwards, Scott

2013-01-01

Dysregulation of pain neurocircuitry and neurochemistry has been increasingly recognized as playing a critical role in a diverse spectrum of diseases including migraine, fibromyalgia, depression, and PTSD. Evidence presented here supports the hypothesis that alcohol dependence is among the pathologies arising from aberrant neurobiological substrates of pain. In this review, we explore the possible influence of alcohol analgesia and hyperalgesia in promoting alcohol misuse and dependence. We examine evidence that neuroanatomical sites involved in the negative emotional states of alcohol dependence also play an important role in pain transmission and may be functionally altered under chronic pain conditions. We also consider possible genetic links between pain transmission and alcohol dependence. We propose an allostatic load model in which episodes of alcohol intoxication and withdrawal, traumatic stressors, and injury are each capable of dysregulating an overlapping set of neural substrates to engender sensory and affective pain states that are integral to alcohol dependence and comorbid conditions such as anxiety, depression, and chronic pain. PMID:22975446
Alcohol advertising and youth.

PubMed

Saffer, Henry

2002-03-01

The question addressed in this review is whether aggregate alcohol advertising increases alcohol consumption among college students. Both the level of alcohol-related problems on college campuses and the level of alcohol advertising are high. Some researchers have concluded that the cultural myths and symbols used in alcohol advertisements have powerful meanings for college students and affect intentions to drink. There is, however, very little empirical evidence that alcohol advertising has any effect on actual alcohol consumption. The methods used in this review include a theoretical framework for evaluating the effects of advertising. This theory suggests that the marginal effect of advertising diminishes at high levels of advertising. Many prior empirical studies measured the effect of advertising at high levels of advertising and found no effect. Those studies that measure advertising at lower, more disaggregated levels have found an effect on consumption. The results of this review suggest that advertising does increase consumption. However, advertising cannot be reduced with limited bans, which are likely to result in substitution to other available media. Comprehensive bans on all forms of advertising and promotion can eliminate options for substitution and be potentially more effective in reducing consumption. In addition, there is an increasing body of literature that suggests that alcohol counteradvertising is effective in reducing the alcohol consumption of teenagers and young adults. These findings indicate that increased counteradvertising, rather than new advertising bans, appears to be the better choice for public policy. It is doubtful that the comprehensive advertising bans required to reduce advertising would ever receive much public support. New limited bans on alcohol advertising might also result in less alcohol counteradvertising. An important topic for future research is to identify the counteradvertising themes that are most effective with
Culture clash: alcohol marketing and public health aspirations.

PubMed

Munro, Geoffrey; de Wever, Johanna

2008-03-01

It is of no coincidence that a number of recent Harm Reduction Digests have addressed the issue of the reduction of alcohol-related harm. Despite the dominant focus on illicit drug use in the popular discourse, alcohol remains Australia's number one drug problem, as it is in many other developed countries. In this Digest Munro and de Wever use the 'four Ps' of marketing: product, price, place and promotion, to critique the two decades industry self-regulation of alcohol marketing. They conclude that if we are going to develop policies which effectively change Australian drinking culture to reduce alcohol-related harm, we need first to accept that the alcohol industry and the health field have separate and conflicting interests.
Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

PubMed

Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

2013-06-01

Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.
Globular adiponectin inhibits ethanol-induced reactive oxygen species production through modulation of NADPH oxidase in macrophages: involvement of liver kinase B1/AMP-activated protein kinase pathway.

PubMed

Kim, Mi Jin; Nagy, Laura E; Park, Pil-Hoon

2014-09-01

Adiponectin, an adipokine predominantly secreted from adipocytes, has been shown to play protective roles against chronic alcohol consumption. Although excessive reactive oxygen species (ROS) production in macrophages is considered one of the critical events for ethanol-induced damage in various target tissues, the effect of adiponectin on ethanol-induced ROS production is not clearly understood. In the present study, we investigated the effect of globular adiponectin (gAcrp) on ethanol-induced ROS production and the potential mechanisms underlying these effects of gAcrp in macrophages. Here we demonstrated that gAcrp prevented ethanol-induced ROS production in both RAW 264.7 macrophages and primary murine peritoneal macrophages. Globular adiponectin also inhibited ethanol-induced activation of NADPH oxidase. In addition, gAcrp suppressed ethanol-induced increase in the expression of NADPH oxidase subunits, including Nox2 and p22(phox), via modulation of nuclear factor-κB pathway. Furthermore, pretreatment with compound C, a selective inhibitor of AMPK, or knockdown of AMPK by small interfering RNA restored suppression of ethanol-induced ROS production and Nox2 expression by gAcrp. Finally, we found that gAcrp treatment induced phosphorylation of liver kinase B1 (LKB1), an upstream signaling molecule mediating AMPK activation. Knockdown of LKB1 restored gAcrp-suppressed Nox2 expression, suggesting that LKB1/AMPK pathway plays a critical role in the suppression of ethanol-induced ROS production and activation of NADPH oxidase by gAcrp. Taken together, these results demonstrate that globular adiponectin prevents ethanol-induced ROS production, at least in part, via modulation of NADPH oxidase in macrophages. Further, LKB1/AMPK axis plays an important role in the suppression of ethanol-induced NADPH oxidase activation by gAcrp in macrophages. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Evidence for proton tunneling and a transient covalent flavin-substrate adduct in choline oxidase S101A.

PubMed

Uluisik, Rizvan; Romero, Elvira; Gadda, Giovanni

2017-11-01

The effect of temperature on the reaction of alcohol oxidation catalyzed by choline oxidase was investigated with the S101A variant of choline oxidase. Anaerobic enzyme reduction in a stopped-flow spectrophotometer was biphasic using either choline or 1,2-[ 2 H 4 ]-choline as a substrate. The limiting rate constants k lim1 and k lim2 at saturating substrate were well separated (k lim1 /k lim2 >9), and were >15-fold slower than for wild-type choline oxidase. Solvent deuterium kinetic isotope effects (KIEs) ~4 established that k lim1 probes the proton transfer from the substrate hydroxyl to a catalytic base. Primary substrate deuterium KIEs ≥7 demonstrated that k lim2 reports on hydride transfer from the choline alkoxide to the flavin. Between 15°C and 39°C the k lim1 and k lim2 values increased with increasing temperature, allowing for the analyses of H + and H - transfers using Eyring and Arrhenius formalisms. Temperature-independent KIE on the k lim1 value ( H2O k lim1 / D2O k lim1 ) suggests that proton transfer occurs within a highly reorganized tunneling-ready-state with a narrow distribution of donor-acceptor distances. Eyring analysis of the k lim2 value gave lines with the slope (choline) >slope (D-choline) , suggesting kinetic complexity. Spectral evidence for the transient occurrence of a covalent flavin-substrate adduct during the first phase of the anaerobic reaction of S101A CHO with choline is presented, supporting the notion that an important role of amino acid residues in the active site of flavin-dependent enzymes is to eliminate alternative reactions of the versatile enzyme-bound flavin for the reaction that needs to be catalyzed. Copyright © 2017 Elsevier B.V. All rights reserved.
Brain pathways to recovery from alcohol dependence.

PubMed

Cui, Changhai; Noronha, Antonio; Warren, Kenneth R; Koob, George F; Sinha, Rajita; Thakkar, Mahesh; Matochik, John; Crews, Fulton T; Chandler, L Judson; Pfefferbaum, Adolf; Becker, Howard C; Lovinger, David; Everitt, Barry J; Egli, Mark; Mandyam, Chitra D; Fein, George; Potenza, Marc N; Harris, R Adron; Grant, Kathleen A; Roberto, Marisa; Meyerhoff, Dieter J; Sullivan, Edith V

2015-08-01

This article highlights the research presentations at the satellite symposium on "Brain Pathways to Recovery from Alcohol Dependence" held at the 2013 Society for Neuroscience Annual Meeting. The purpose of this symposium was to provide an up to date overview of research efforts focusing on understanding brain mechanisms that contribute to recovery from alcohol dependence. A panel of scientists from the alcohol and addiction research field presented their insights and perspectives on brain mechanisms that may underlie both recovery and lack of recovery from alcohol dependence. The four sessions of the symposium encompassed multilevel studies exploring mechanisms underlying relapse and craving associated with sustained alcohol abstinence, cognitive function deficit and recovery, and translational studies on preventing relapse and promoting recovery. Gaps in our knowledge and research opportunities were also discussed. Published by Elsevier Inc.
Brain Pathways to Recovery from Alcohol Dependence

PubMed Central

Cui, Changhai; Noronha, Antonio; Warren, Kenneth; Koob, George F.; Sinha, Rajita; Thakkar, Mahesh; Matochik, John; Crews, Fulton T.; Chandler, L. Judson; Pfefferbaum, Adolf; Becker, Howard C.; Lovinger, David; Everitt, Barry; Egli, Mark; Mandyam, Chitra; Fein, George; Potenza, Marc N.; Harris, R. Adron; Grant, Kathleen A.; Roberto, Marisa; Meyerhoff, Dieter J.; Sullivan, Edith V.

2015-01-01

This article highlights the research presentations at the satellite symposium on “Brain Pathways to Recovery from Alcohol Dependence” held at the 2013 Society for Neuroscience Annual Meeting. The purpose of this symposium was to provide an up to date overview of research efforts focusing on understanding brain mechanisms that contribute to recovery from alcohol dependence. A panel of scientists from the alcohol and addiction research field presented their insights and perspectives on brain mechanisms that may underlie both recovery and lack of recovery from alcohol dependence. The four sessions of the symposium encompassed multilevel studies exploring mechanisms underlying relapse and craving associated with sustained alcohol abstinence, cognitive function deficit and recovery, and translational studies on preventing relapse and promoting recovery. Gaps in our knowledge and research opportunities were also discussed. PMID:26074423
Determination of Monoamine Oxidase A and B Activity in Long-Term Treated Patients With Parkinson Disease.

PubMed

Müller, Thomas; Riederer, Peter; Grünblatt, Edna

Biogenic amines and monoamine oxidase inhibitors influence peripheral monoamine oxidase enzyme activity in chronic levodopa/dopa decarboxylase inhibitor-treated patients with Parkinson disease. Rasagiline is an irreversible inhibitor of monoamine oxidase B. Safinamide blocks this isoenzyme in a reversible fashion. The aim of this study was to determine monoamine oxidase A (plasma) and B (platelets) enzyme activity in long-term levodopa-treated patients without and with additional oral intake of 50- or 100-mg safinamide or 1-mg rasagiline or first-time intake of rasagiline. Monoamine oxidase A enzyme activity did not differ between all groups. Patients on rasagiline or safinamide showed lower monoamine oxidase-B enzyme activity compared with patients without monoamine oxidase B inhibitor intake. No impact of the number of previous oral levodopa intakes was found. Rasagiline and safinamide did not essentially differ in terms of inhibition of monoamine oxidase B despite their different pharmacology regarding reversibility of monoamine oxidase B inhibition. In view of the observed, considerable heterogeneity of enzyme activities, we suggest to determine activities of monoamine oxidase A and B to reduce the risk for tyramine-induced hypertension and the serotonergic syndrome during chronic therapy with rasagiline or safinamide.
Platinum Nanoparticles: Efficient and Stable Catechol Oxidase Mimetics.

PubMed

Liu, Yi; Wu, Haohao; Chong, Yu; Wamer, Wayne G; Xia, Qingsu; Cai, Lining; Nie, Zhihong; Fu, Peter P; Yin, Jun-Jie

2015-09-09

Although enzyme-like nanomaterials have been extensively investigated over the past decade, most research has focused on the peroxidase-like, catalase-like, or SOD-like activity of these nanomaterials. Identifying nanomaterials having oxidase-like activities has received less attention. In this study, we demonstrate that platinum nanoparticles (Pt NPs) exhibit catechol oxidase-like activity, oxidizing polyphenols into the corresponding o-quinones. Four unique approaches are employed to demonstrate the catechol oxidase-like activity exerted by Pt NPs. First, UV-vis spectroscopy is used to monitor the oxidation of polyphenols catalyzed by Pt NPs. Second, the oxidized products of polyphenols are identified by ultrahigh-performance liquid chromatography (UHPLC) separation followed by high-resolution mass spectrometry (HRMS) identification. Third, electron spin resonance (ESR) oximetry techniques are used to confirm the O2 consumption during the oxidation reaction. Fourth, the intermediate products of semiquinone radicals formed during the oxidation of polyphenols are determined by ESR using spin stabilization. These results indicate Pt NPs possess catechol oxidase-like activity. Because polyphenols and related bioactive substances have been explored as potent antioxidants that could be useful for the prevention of cancer and cardiovascular diseases, and Pt NPs have been widely used in the chemical industry and medical science, it is essential to understand the potential effects of Pt NPs for altering or influencing the antioxidant activity of polyphenols.
PROLINE OXIDASES IN HANSENULA SUBPELLICULOSA

PubMed Central

Ling, Chung-Mei; Hedrick, L. R.

1964-01-01

Ling, Chung-Mei (Illinois Institute of Technology, Chicago), and L. R. Hedrick. Proline oxidases in Hansenula subpelliculosa. J. Bacteriol. 87:1462–1470. 1964—Cells of Hansenula subpelliculosa can use l-proline as a carbon and a nitrogen source after a 6- to 8-hr induction period. However, they cannot use l-glutamate as both nitrogen and carbon sources unless the induction period is of several days' duration. Two l-proline oxidases were demonstrated in the mitochondrial preparation of this yeast. One forms the product Δ′-pyrroline-2-carboxylic acid (P2C), which is in equilibrium with α-keto-δ-amino-valeric acid; the other forms the product Δ′-pyrroline-5-carboxylic acid (P5C), which is in equilibrium with glutamic-γ-semialdehyde. The first-mentioned enzyme is induced when l-proline is the carbon source; the second appears to be constitutive, and is probably associated with the use of l-proline as a nitrogen source. The P2C-forming enzyme is specific for the l isomer of proline, and is inactive against l-hydroxyproline. The enzyme activity is at its peak when the mitochondria are prepared from logarithmically grown cells, and is rapidly reduced after cells reach the stationary phase of growth. Kinetic studies with varying concentrations of substrate indicate a Michaelis-Menten constant of 2.45 × 10−2m. Paper chromatographic studies, chemical tests with H2O2, sensitivity to freezing, and spectral measurements indicate that proline oxidase from H. subpelliculosa mitochondria forms a product from l-proline which is like, if not identical to, P2C formed by the action of sheep kidney d-proline oxidase upon dl-proline. The soluble portion of the cell extract contains NAD+ enzymes which use either P2C (α-keto-δ-amino-valeric acid) or P5C (glutamic-γ-semialdehyde) as substrates. No glutamic dehydrogenase activity could be detected when l-glutamic acid and the nicotinamide adenine dinucleotide (NAD+) cofactor were added to the supernatant solution with the
The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.

PubMed

Elmer, Lawrence W; Bertoni, John M

2008-11-01

The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.
The Influence of Alcohol Advertising on Students' Drinking Behaviors.

ERIC Educational Resources Information Center

Pedersen, Peggy J.

2002-01-01

Examines the perceived influence of alcohol advertising in a daily campus newspaper on the drinking behaviors of students. Findings indicated that college students do perceive that their drinking patterns are influenced by alcohol promotions in the campus newspaper and, furthermore, that self-identified binge drinkers were influenced significantly…
Photoaffinity labeling of protoporphyrinogen oxidase, the molecular target of diphenylether-type herbicides.

PubMed

Camadro, J M; Matringe, M; Thome, F; Brouillet, N; Mornet, R; Labbe, P

1995-05-01

Diphenylether-type herbicides are extremely potent inhibitors of protoporphyrinogen oxidase, a membrane-bound enzyme involved in the heme and chlorophyll biosynthesis pathways. Tritiated acifluorfen and a diazoketone derivative of tritiated acifluorfen were specifically bound to a single class of high-affinity binding sites on yeast mitochondrial membranes with apparent dissociation constants of 7 nM and 12.5 nM, respectively. The maximum density of specific binding sites, determined by Scatchard analysis, was 3 pmol.mg-1 protein. Protoporphyrinogen oxidase specific activity was estimated to be 2500 nmol protoporphyrinogen oxidized h-1.mol-1 enzyme. The diazoketone derivative of tritiated acifluorfen was used to specifically photolabel yeast protoporphyrinogen oxidase. The specifically labeled polypeptide in wild-type mitochondrial membranes had an apparent molecular mass of 55 kDa, identical to the molecular mass of the purified enzyme. This photolabeled polypeptide was not detected in a protoporphyrinogen-oxidase-deficient yeast strain, but the membranes contained an equivalent amount of inactive immunoreactive protoporphyrinogen oxidase protein.
'Lead us not into temptation': adolescence and alcohol policy in Europe.

PubMed

Hope, Ann

2014-01-01

Although the World Health Organization and the European Community recognize harm to children and young people due to alcohol-whether their own or someone else's drinking-effective policies to reduce harm are not widely followed. The alcohol beverage industry's drive to use social networking systems blurs the line between user-generated and industry marketing materials, such that young people are more frequently and at a younger age, potentially exposed to the promotion of alcoholic drinks. This contravenes recommendations arising out of the emerging scientific literature that delaying the onset of drinking and reducing the prevalence of heavy session drinking are likely to promote a healthier next generation.
Alcohol industry self-regulation: who is it really protecting?

PubMed

Noel, Jonathan; Lazzarini, Zita; Robaina, Katherine; Vendrame, Alan

2017-01-01

Self-regulation has been promoted by the alcohol industry as a sufficient means of regulating alcohol marketing activities. However, evidence suggests that the guidelines of self-regulated alcohol marketing codes are violated routinely, resulting in excessive alcohol marketing exposure to youth and the use of content that is potentially harmful to youth and other vulnerable populations. If the alcohol industry does not adhere to its own regulations the purpose and design of these codes should be questioned. Indeed, implementation of alcohol marketing self-regulation in Brazil, the United Kingdom and the United States was likely to delay statutory regulation rather than to promote public health. Moreover, current self-regulation codes suffer from vague language that may allow the industry to circumvent the guidelines, loopholes that may obstruct the implementation of the codes, lax exposure guidelines that can allow excessive youth exposure, even if properly followed, and a standard of review that may be inappropriate for protecting vulnerable populations. Greater public health benefits may be realized if legislative restrictions were applied to alcohol marketing, and strict statutory alcohol marketing regulations have been implemented and defended successfully in the European Union, with European courts declaring that restrictions on alcohol marketing are proportional to the benefits to public health. In contrast, attempts to restrict alcohol marketing activities in the United States have occurred through private litigation and have been unsuccessful. None the less, repeated violations of industry codes may provide legislators with sufficient justification to pass new legislation and for such legislation to withstand constitutional review in the United States and elsewhere. © 2016 Society for the Study of Addiction.
Vulnerability to alcohol-related problems: a policy brief with implications for the regulation of alcohol marketing.

PubMed

Babor, Thomas F; Robaina, Katherine; Noel, Jonathan K; Ritson, E Bruce

2017-01-01

The concern that alcohol advertising can have detrimental effects on vulnerable viewers has prompted the development of codes of responsible advertising practices. This paper evaluates critically the concept of vulnerability as it applies to (1) susceptibility to alcohol-related harm and (2) susceptibility to the effects of marketing, and describes its implications for the regulation of alcohol marketing. We describe the findings of key published studies, review papers and expert reports to determine whether these two types of vulnerability apply to population groups defined by (1) age and developmental history; (2) personality characteristics; (3) family history of alcoholism; (4) female sex and pregnancy risk; and (5) history of alcohol dependence and recovery status. Developmental theory and research suggest that groups defined by younger age, incomplete neurocognitive development and a history of alcohol dependence may be particularly vulnerable because of the disproportionate harm they experience from alcohol and their increased susceptibility to alcohol marketing. Children may be more susceptible to media imagery because they do not have the ability to compensate for biases in advertising portrayals and glamorized media imagery. Young people and people with a history of alcohol dependence appear to be especially vulnerable to alcohol marketing, warranting the development of new content and exposure guidelines focused on protecting those groups to improve current self-regulation codes promoted by the alcohol industry. If adequate protections cannot be implemented through this mechanism, statutory regulations should be considered. © 2016 Society for the Study of Addiction.

Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.

PubMed

Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A

2001-07-01

Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).
Purification of the Alpha Glycerophosphate Oxidase from African Trypanosomes

DTIC Science & Technology

1987-02-02

oxidase (GPO). This enzyme has not been purified or characterize in detail. Inhibition of this enzyme coupled with inhibition of the anaerobic...more manageable afterwards and remained in the procedure although it only slightly increased the yield. The stability of the solubilized enzyme was...whether the detergent was added during the assay or in the solubilization procedure. However, the successful assay for the enzyme was ubiquinol oxidase
Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

PubMed

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Direct Identification of a Bacterial Manganese(II) Oxidase, the Multicopper Oxidase MnxG, from Spores of Several Different Marine Bacillus Species▿ †

PubMed Central

Dick, Gregory J.; Torpey, Justin W.; Beveridge, Terry J.; Tebo, Bradley M.

2008-01-01

Microorganisms catalyze the formation of naturally occurring Mn oxides, but little is known about the biochemical mechanisms of this important biogeochemical process. We used tandem mass spectrometry to directly analyze the Mn(II)-oxidizing enzyme from marine Bacillus spores, identified as an Mn oxide band with an in-gel activity assay. Nine distinct peptides recovered from the Mn oxide band of two Bacillus species were unique to the multicopper oxidase MnxG, and one peptide was from the small hydrophobic protein MnxF. No other proteins were detected in the Mn oxide band, indicating that MnxG (or a MnxF/G complex) directly catalyzes biogenic Mn oxide formation. The Mn(II) oxidase was partially purified and found to be resistant to many proteases and active even at high concentrations of sodium dodecyl sulfate. Comparative analysis of the genes involved in Mn(II) oxidation from three diverse Bacillus species revealed a complement of conserved Cu-binding regions not present in well-characterized multicopper oxidases. Our results provide the first direct identification of a bacterial enzyme that catalyzes Mn(II) oxidation and suggest that MnxG catalyzes two sequential one-electron oxidations from Mn(II) to Mn(III) and from Mn(III) to Mn(IV), a novel type of reaction for a multicopper oxidase. PMID:18165363
The voltage dependence of NADPH oxidase reveals why phagocytes need proton channels

NASA Astrophysics Data System (ADS)

DeCoursey, Thomas E.; Morgan, Deri; Cherny, Vladimir V.

2003-04-01

The enzyme NADPH oxidase in phagocytes is important in the body's defence against microbes: it produces superoxide anions (O2-, precursors to bactericidal reactive oxygen species). Electrons move from intracellular NADPH, across a chain comprising FAD (flavin adenine dinucleotide) and two haems, to reduce extracellular O2 to O2-. NADPH oxidase is electrogenic, generating electron current (Ie) that is measurable under voltage-clamp conditions. Here we report the complete current-voltage relationship of NADPH oxidase, the first such measurement of a plasma membrane electron transporter. We find that Ie is voltage-independent from -100mV to >0mV, but is steeply inhibited by further depolarization, and is abolished at about +190mV. It was proposed that H+ efflux mediated by voltage-gated proton channels compensates Ie, because Zn2+ and Cd2+ inhibit both H+ currents and O2- production. Here we show that COS-7 cells transfected with four NADPH oxidase components, but lacking H+ channels, produce O2- in the presence of Zn2+ concentrations that inhibit O2- production in neutrophils and eosinophils. Zn2+ does not inhibit NADPH oxidase directly, but through effects on H+ channels. H+ channels optimize NADPH oxidase function by preventing membrane depolarization to inhibitory voltages.
Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species

PubMed Central

Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.

1970-01-01

The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826
Ultrasound promoted synthesis of 2-imidazolines in water: a greener approach toward monoamine oxidase inhibitors.

PubMed

Sant' Anna, Gabriela da S; Machado, Pablo; Sauzem, Patricia D; Rosa, Fernanda A; Rubin, Maribel A; Ferreira, Juliano; Bonacorso, Helio G; Zanatta, Nilo; Martins, Marcos A P

2009-01-15

A series of sixteen 2-substituted-2-imidazolines (where the substituent R=Ph, Me-4-Ph; MeO-4-Ph; (MeO)(2)-3,4-Ph; (MeO)(3)-3,4,5-Ph; Ph-4-O-C(O)-Ph; Cl-4-Ph; Cl-2-Ph; Cl(2)-2,4-Ph; NO(2)-4-Ph; NO(2)-3-Ph; Naphth-2-yl; Fur-2-yl; Benzofur-2-yl; Pyridin-2-yl; Quinolin-2-yl) has been synthesized from the reaction of the substituted-aldehydes and ethylenediamine by ultrasound irradiation with NBS in an aqueous medium in high yields (80-99%). The 2-imidazoline ability to inhibit the activity of the A and B isoforms of monoamine oxidase (MAO) was investigated and some of them showed potent and selective MAO inhibitory activity especially for the MAO-B isoform and could become promising candidates for future development.
Acute Alcohol Effects on Attentional Bias in Heavy and Moderate Drinkers

PubMed Central

Weafer, Jessica; Fillmore, Mark T.

2012-01-01

Heavy drinkers show an increased attentional bias to alcohol-related stimuli compared to moderate drinkers, and this bias is thought to promote motivation for alcohol consumption (Field & Cox, 2008). Studies have begun to examine acute alcohol effects on attentional bias, however little is known regarding how these effects might differ based on drinker type. Further, the degree to which attentional bias in response to alcohol is associated with excessive alcohol consumption remains unexplored. For the current study, 20 heavy drinkers and 20 moderate drinkers completed a visual probe task in response to placebo and two active doses of alcohol (0.45 g/kg and 0.65 g/kg). Participants’ eye-movements were monitored and attentional bias was calculated as the difference in time spent focused on alcohol compared to neutral images. Participants’ alcohol consumption was assessed by a timeline follow-back calendar and a laboratory ad lib consumption task. Results showed that heavy drinkers displayed significantly greater attentional bias than did moderate drinkers following placebo. However, heavy drinkers displayed a dose-dependent decrease in attentional bias following alcohol, whereas the drug had no effect in moderate drinkers. Individual differences in attentional bias under placebo were strongly associated with both self-reported and laboratory alcohol consumption, yet bias following alcohol administration did not predict either measure of consumption. These findings suggest that attentional bias is strongest before a drinking episode begins. As such, an attentional bias might be most influential in terms of initiation of alcohol consumption, and less of a factor in promoting continued consumption within the drinking episode. PMID:22732051
The association of measures of the serotonin system, personality, alcohol use, and smoking with risk-taking traffic behavior in adolescents in a longitudinal study.

PubMed

Luht, Kadi; Eensoo, Diva; Tooding, Liina-Mai; Harro, Jaanus

2018-01-01

Studies on the neurobiological basis of risk-taking behavior have most often focused on the serotonin system. The promoter region of the gene encoding the serotonin transporter contains a polymorphic site (5-HTTLPR) that is important for the transcriptional activity, and studies have demonstrated its association with brain activity and behavior. Another molecular mechanism that reflects the capacity of the central serotonin system is the activity of the enzyme monoamine oxidase (MAO) as measured in platelets. The purpose of the present study was to examine how measures of the serotonin system (platelet MAO activity and the 5-HTTLPR polymorphism), personality variables, alcohol use and smoking are associated with risk-taking traffic behavior in schoolchildren through late adolescence. The younger cohort of the longitudinal Estonian Children Personality Behaviour and Health Study (originally n = 583) filled in questionnaires about personality traits, smoking status, alcohol use and traffic behavior at age 15 and 18 years. From venous blood samples, platelet MAO activity was measured radioenzymatically and 5-HTTLPR was genotyped. During late adolescence, subjects with lower platelet MAO activity were more likely to belong to the high-risk traffic behavior group. Male 5-HTTLPRs'-allele carriers were more likely to belong to the high-risk traffic behavior group compared to the l'/l' homozygotes. Other variables predicting risk group were alcohol use, smoking and Maladaptive impulsivity.The results suggest that lower capacity of the serotoninergic system is associated with more risky traffic behavior during late adolescence, but possibly by different mechanisms in boys and girls.
Comparative study of different alcohol sensors based on Screen-Printed Carbon Electrodes.

PubMed

Costa Rama, Estefanía; Biscay, Julien; González García, María Begoña; Julio Reviejo, A; Pingarrón Carrazón, José Manuel; Costa García, Agustín

2012-05-30

Different very simple single-use alcohol enzyme sensors were developed using alcohol oxidase (AOX) from three different yeast, Hansenula sp., Pichia pastoris and Candida boidinii, and employing three different commercial mediator-based Screen-Printed Carbon Electrodes as transducers. The mediators tested, Prussian Blue, Ferrocyanide and Co-phthalocyanine were included into the ink of the working electrode. The procedure to obtain these sensors consists of the immobilization of the enzyme on the electrode surface by adsorption. For the immobilization, an AOX solution is deposited on the working electrode and left until dried (1h) at room temperature. The best results were obtained with the biosensor using Screen-Printed Co-phthalocyanine/Carbon Electrode and AOX from Hansenula sp. The reduced cobalt-phthalocyanine form is amperometrically detected at +0.4V (vs. Ag pseudo reference electrode). This sensor shows good sensitivity (1211 nA mM(-1)), high precision (2.1% RSD value for the slope value of the calibration plot) and wide linear response (0.05-1.00 mM) for ethanol determination. The sensor provides also accurate results for ethanol quantification in alcoholic drinks. Copyright © 2012 Elsevier B.V. All rights reserved.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

PubMed

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
A family history of Type 1 alcoholism differentiates alcohol consumption in high cortisol responders to stress.

PubMed

Brkic, Sejla; Söderpalm, Bo; Söderpalm Gordh, Anna

2015-03-01

The differentiation between high and low cortisol responders to stress is of interest in determining the risk factors which may, along with genetic vulnerability, influence alcohol intake. Thirty-two healthy volunteers, family history positive to alcoholism (FHP, n = 16) and family history negative (FHN, n = 16) attended two laboratory sessions during which alcohol or placebo was offered. There were no differences in consumption of alcohol or placebo between FHP and FHN subjects. STUDY 2: Fifty-eight healthy social drinkers, FHP (n = 27) and FHN (n = 31) attended two laboratory sessions. They were administered either alcohol or placebo in both sessions they attended. All subjects underwent either a stress task (the Trier Social Stress Test, TSST) or a stress-free period, at two separate occasions, before being offered beverage. After the salivary cortisol analysis, subjects in each group were divided into high (HCR) or low (LCR) cortisol responders. After stress, subjects who were FHP-HCR consumed more alcohol than FHN-HCR. There were no differences in the placebo intake between FHP and FHN subjects regardless of their cortisol response. This result indicates that stress promotes alcohol consumption only in subjects with a family history of Type 1 alcoholism who show an increase in cortisol response to stress. This behaviour is similar to that previously observed in alcohol dependent individuals after stress and thus could represent an endophenotype posing a risk for future development of alcohol use disorders. Copyright © 2015. Published by Elsevier Inc.
Enhanced labelling on alcoholic drinks: reviewing the evidence to guide alcohol policy.

PubMed

Martin-Moreno, Jose M; Harris, Meggan E; Breda, Joao; Møller, Lars; Alfonso-Sanchez, Jose L; Gorgojo, Lydia

2013-12-01

Consumer and public health organizations have called for better labelling on alcoholic drinks. However, there is a lack of consensus about the best elements to include. This review summarizes alcohol labelling policy worldwide and examines available evidence to support enhanced labelling. A literature review was carried out in June-July 2012 on Scopus using the key word 'alcohol' combined with 'allergens', 'labels', 'nutrition information', 'ingredients', 'consumer information' and/or 'warning'. Articles discussing advertising and promotion of alcohol were excluded. A search through Google and the System for Grey Literature in Europe (SIGLE) identified additional sources on alcohol labelling policies, mainly from governmental and organizational websites. Five elements were identified as potentially useful to consumers: (i) a list of ingredients, (ii) nutritional information, (iii) serving size and servings per container, (iv) a definition of 'moderate' intake and (v) a health warning. Alcohol labelling policy with regard to these aspects is quite rudimentary in most countries, with few requiring a list of ingredients or health warnings, and none requiring basic nutritional information. Only one country (Australia) requires serving size and servings per container to be displayed. Our study suggests that there are both potential advantages and disadvantages to providing consumers with more information about alcohol products. Current evidence seems to support prompt inclusion of a list of ingredients, nutritional information (usually only kcal) and health warnings on labels. Standard drink and serving size is useful only when combined with other health education efforts. A definition of 'moderate intake' and recommended drinking guidelines are best suited to other contexts.
Xanthine Oxidase Induces Foam Cell Formation through LOX-1 and NLRP3 Activation.

PubMed

Dai, Yao; Cao, Yongxiang; Zhang, Zhigao; Vallurupalli, Srikanth; Mehta, Jawahar L

2017-02-01

Xanthine oxidase catalyzes the oxidation of xanthine to uric acid. This process generates excessive reactive oxygen species (ROS) that play an important role in atherogenesis. Recent studies show that LRR and PYD domains-containing protein 3 (NLRP3), a component of the inflammasome, may be involved in the formation of foam cells, a hallmark of atherosclerosis. This study was designed to study the role of various scavenger receptors and NLRP3 inflammasome in xanthine oxidase and uric acid-induced foam cell formation. Human vascular smooth muscle cells (VSMCs) and THP-1 macrophages were treated with xanthine oxidase or uric acid. Xanthine oxidase treatment (of both VSMCs and THP-1 cells) resulted in foam cell formation in concert with generation of ROS and expression of cluster of differentiation 36 (CD36) and oxidized low density lipoprotein (lectin-like) receptor 1 (LOX-1), but not of scavenger receptor A (SRA). Uric acid treatment resulted in foam cell formation, ROS generation and expression of CD36, but not of LOX-1 or SRA. Further, treatment of cells with xanthine oxidase, but not uric acid, activated NLRP3 and its downstream pro-inflammatory signals- caspase-1, interleukin (IL)-1β and IL-18. Blockade of LOX-1 or NLRP3 inflammasome with specific siRNAs reduced xanthine oxidase-induced foam cell formation, ROS generation and activation of NLRP3 and downstream signals. Xanthine oxidase induces foam cell formation in large part through activation of LOX-1 - NLRP3 pathway in both VSMCs and THP-1 cells, but uric acid-induced foam cell formation is exclusively through CD36 pathway. Further, LOX-1 activation is upstream of NLRP3 activation. Graphical Abstract Steps in the formation of foam cells in response to xanthine oxidase and uric acid. Xanthine oxidase stimulates LOX-1 expression on the cell membrane of macrophages and vascular smooth muscle cells (VSMCs) and increases generation of ROS, which activate NLRP3 inflammasome and downstream pro
Parkin regulates mitophagy and mitochondrial function to protect against alcohol-induced liver injury and steatosis in mice

PubMed Central

Williams, Jessica A.; Ni, Hong-Min; Ding, Yifeng

2015-01-01

Alcoholic liver disease claims two million lives per year. We previously reported that autophagy protected against alcohol-induced liver injury and steatosis by removing damaged mitochondria. However, the mechanisms for removal of these mitochondria are unknown. Parkin is an evolutionarily conserved E3 ligase that is recruited to damaged mitochondria to initiate ubiquitination of mitochondrial outer membrane proteins and subsequent mitochondrial degradation by mitophagy. In addition to its role in mitophagy, Parkin has been shown to have other roles in maintaining mitochondrial function. We investigated whether Parkin protected against alcohol-induced liver injury and steatosis using wild-type (WT) and Parkin knockout (KO) mice treated with alcohol by the acute-binge and Gao-binge (chronic plus acute-binge) models. We found that Parkin protected against liver injury in both alcohol models, likely because of Parkin's role in maintaining a population of healthy mitochondria. Alcohol caused greater mitochondrial damage and oxidative stress in Parkin KO livers compared with WT livers. After alcohol treatment, Parkin KO mice had severely swollen and damaged mitochondria that lacked cristae, which were not seen in WT mice. Furthermore, Parkin KO mice had decreased mitophagy, β-oxidation, mitochondrial respiration, and cytochrome c oxidase activity after acute alcohol treatment compared with WT mice. Interestingly, liver mitochondria seemed able to adapt to alcohol treatment, but Parkin KO mouse liver mitochondria had less capacity to adapt to Gao-binge treatment compared with WT mouse liver mitochondria. Overall, our findings indicate that Parkin is an important mediator of protection against alcohol-induced mitochondrial damage, steatosis, and liver injury. PMID:26159696
Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase.

PubMed

Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao

2018-01-01

This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p < 0.05) and total sulfhydryl groups decreased significantly ( p < 0.05). The analysis of Raman spectroscopy shows that the addition of glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.
Altered brain functional connectivity and behaviour in a mouse model of maternal alcohol binge-drinking.

PubMed

Cantacorps, Lídia; González-Pardo, Héctor; Arias, Jorge L; Valverde, Olga; Conejo, Nélida M

2018-06-08

Prenatal and perinatal alcohol exposure caused by maternal alcohol intake during gestation and lactation periods can have long-lasting detrimental effects on the brain development and behaviour of offspring. Children diagnosed with Foetal Alcohol Spectrum Disorders (FASD) display a wide range of cognitive, emotional and motor deficits, together with characteristic morphological abnormalities. Maternal alcohol binge drinking is particularly harmful for foetal and early postnatal brain development, as it involves exposure to high levels of alcohol over short periods of time. However, little is known about the long-term effects of maternal alcohol binge drinking on brain function and behaviour. To address this issue, we used pregnant C57BL/6 female mice with time-limited access to a 20% v/v alcohol solution as a procedure to model alcohol binge drinking during gestation and lactational periods. Male offspring were behaviourally tested during adolescence (30 days) and adulthood (60 days), and baseline neural metabolic capacity of brain regions sensitive to alcohol effects were also evaluated in adult animals from both groups. Our results show that prenatal and postnatal alcohol exposure caused age-dependent changes in spontaneous locomotor activity, increased anxiety-like behaviour and attenuated alcohol-induced conditioned place preference in adults. Also, significant changes in neural metabolic capacity using cytochrome c oxidase (CCO) quantitative histochemistry were found in the hippocampal dentate gyrus, the mammillary bodies, the ventral tegmental area, the lateral habenula and the central lobules of the cerebellum in adult mice with prenatal and postnatal alcohol exposure. In addition, the analysis of interregional CCO activity correlations in alcohol-exposed adult mice showed disrupted functional brain connectivity involving the limbic, brainstem, and cerebellar regions. Finally, increased neurogenesis was found in the dentate gyrus of the hippocampus of
Fetal alcohol exposure increases susceptibility to carcinogenesis and promotes tumor progression in prostate gland.

PubMed

Sarkar, Dipak K

2015-01-01

The idea that exposure to adverse environmental conditions and lifestyle choices during pregnancy can result in fetal programming that underlies disease susceptibility in adulthood is now widely accepted. Fetal alcohol exposed offspring displays many behavioral and physiological abnormalities including neuroendocrine-immune functions, which often carry over into their adult life. Since the neuroendocrine-immune system plays an important role in controlling tumor surveillance, fetal alcohol exposed offspring can be vulnerable to develop cancer. Animal studies have recently showed increased cancer growth and progression in various tissues of fetal alcohol exposed offspring. I will detail in this chapter the recent evidence for increased prostate carcinogenesis in fetal alcohol exposed rats. I will also provide evidence for a role of excessive estrogenization during prostatic development in the increased incidence of prostatic carcinoma in these animals. Furthermore, I will discuss the additional possibility of the involvement of impaired stress regulation and resulting immune incompetence in the increased prostatic neoplasia in the fetal alcohol exposed offspring.
Vitamin C prevents zidovudine-induced NAD(P)H oxidase activation and hypertension in the rat.

PubMed

Papparella, Italia; Ceolotto, Giulio; Berto, Laura; Cavalli, Maurizio; Bova, Sergio; Cargnelli, Gabriella; Ruga, Ezia; Milanesi, Ornella; Franco, Lorenzo; Mazzoni, Martina; Petrelli, Lucia; Nussdorfer, Gastone G; Semplicini, Andrea

2007-01-15

Cardiovascular risk is increased among HIV-infected patients receiving antiretroviral therapy due to the development of hypertension and metabolic abnormalities. In this study, we investigated the effects of long-term treatment with zidovudine (AZT) and vitamin C, alone and in combination, on blood pressure and on the chain of events linking oxidative stress to cardiac damage in the rat. Six adult Wistar Kyoto rats received AZT (1 mg/ml) in the drinking water for 8 months, six vitamin C (10 g/kg of food) and AZT, six vitamin C alone, and six served as controls. AZT increased systolic blood pressure, expression of gp91(phox) and p47(phox) subunits of NAD(P)H oxidase, and protein kinase C (PKC) delta activation and reduced antioxidant power of plasma and cardiac homogenates. AZT also caused morphological alterations in cardiac myocyte mitochondria, indicative of functional damage. All of these effects were prevented by vitamin C. Chronic AZT administration increases blood pressure and promotes cardiovascular damage through a NAD(P)H oxidase-dependent mechanism that involves PKC delta. Vitamin C antagonizes these adverse effects of AZT in the cardiovascular system.
NADPH Oxidase as a Therapeutic Target for Oxalate Induced Injury in Kidneys

PubMed Central

Peck, Ammon B.; Khan, Saeed R.

2013-01-01

A major role of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase family of enzymes is to catalyze the production of superoxides and other reactive oxygen species (ROS). These ROS, in turn, play a key role as messengers in cell signal transduction and cell cycling, but when they are produced in excess they can lead to oxidative stress (OS). Oxidative stress in the kidneys is now considered a major cause of renal injury and inflammation, giving rise to a variety of pathological disorders. In this review, we discuss the putative role of oxalate in producing oxidative stress via the production of reactive oxygen species by isoforms of NADPH oxidases expressed in different cellular locations of the kidneys. Most renal cells produce ROS, and recent data indicate a direct correlation between upregulated gene expressions of NADPH oxidase, ROS, and inflammation. Renal tissue expression of multiple NADPH oxidase isoforms most likely will impact the future use of different antioxidants and NADPH oxidase inhibitors to minimize OS and renal tissue injury in hyperoxaluria-induced kidney stone disease. PMID:23840917

[Experimental rationale for the parameters of a rapid method for oxidase activity determination].

PubMed

Butorina, N N

2010-01-01

Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.
Heterologous production and characterization of two glyoxal oxidases from Pycnoporus cinnabarinus

Treesearch

Marianne Daou; François Piumi; Daniel Cullen; Eric Record; Craig B. Faulds

2016-01-01

The genome of the white rot fungus Pycnoporus cinnabarinus includes a large number of genes encoding enzymes implicated in lignin degradation. Among these, three genes are predicted to encode glyoxal oxidase, an enzyme previously isolated from Phanerochaete chrysosporium. The glyoxal oxidase of P. chrysosporium...
Cloning and Analysis of the Alternative Oxidase Gene of Neurospora Crassa

PubMed Central

Li, Q.; Ritzel, R. G.; McLean, LLT.; McIntosh, L.; Ko, T.; Bertrand, H.; Nargang, F. E.

1996-01-01

Mitochondria of Neurospora crassa contain a cyanide-resistant alternative respiratory pathway in addition to the cytochrome pathway. The alternative oxidase is present only when electron flow through the cytochrome chain is restricted. Both genomic and cDNA copies for the alternative oxidase gene have been isolated and analyzed. The sequence of the predicted protein is homologous to that of other species. The mRNA for the alternative oxidase is scarce in wild-type cultures grown under normal conditions, but it is abundant in cultures grown in the presence of chloramphenicol, an inhibitor of mitochondrial protein synthesis, or in mutants deficient in mitochondrial cytochromes. Thus, induction of alternative oxidase appears to be at the transcriptional level. Restriction fragment length polymorphism mapping of the isolated gene demonstrated that it is located in a position corresponding to the aod-1 locus. Sequence analysis of mutant aod-1 alleles reveals mutations affecting the coding sequence of the alternative oxidase. The level of aod-1 mRNA in an aod-2 mutant strain that had been grown in the presence of chloramphenicol was reduced several fold relative to wild-type, supporting the hypothesis that the product of aod-2 is required for optimal expression of aod-1. PMID:8770590
Public opinion on alcohol policies in the United States: results from a national survey.

PubMed

Wagenaar, A C; Harwood, E M; Toomey, T L; Denk, C E; Zander, K M

2000-01-01

We surveyed the U.S. non-institutionalized population age 18+ on opinions regarding 23 alcohol control policies (N = 7,021). The cooperation rate among contacted households was 70% and the overall response rate was 54%. Results showed high levels of public support for most alcohol control policies. Over 80% support restrictions on alcohol use in public places, such as parks, beaches, concert venues, and on college campuses. Eighty-two percent support increased alcohol taxes, provided the funds are used for treatment or prevention programs. Over 60% support alcohol advertising and promotion restrictions, such as banning billboard advertising, banning promotion at sporting events, or banning liquor and beer advertising on television. Multivariate regression analyses indicated significant relationships between alcohol policy opinions and a variety of sociodemographic, political orientation, and behavioral measures. However, the absolute differences in alcohol policy support across groups is small. There is a strong base of support for alcohol control policies in the U.S., and such support is found among whites and ethnics of color, young and old, rich and poor, and conservatives, moderates, and liberals.
Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A/sub 2/

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gamache, D.A.; Kornberg, L.J.; Bartolf, M.

1986-05-01

Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1-/sup 14/C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A/sub 2/ (PLA/sub 2/) activity (64.3-545.6 nmols/min/mg). The PLA/sub 2/ was maximally active in the neutral-alkaline pH range, was Ca/sup 2 +/-dependent, and was unaffected by the addition of xanthine. PLA/sub 2/ activity was totally inhibited by 1mM EDTA whereas radical production by optimalmore » concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA/sub 2/ activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca/sup 2 +/-dependent PLA/sub 2/ measured in various tissue homogenates (less than or equal to 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA/sub 2/ may have influenced previously published reports, and such studies should be interpreted cautiously.« less
Investigating the Production of Foreign Membrane Proteins in Tobacco Chloroplasts: Expression of an Algal Plastid Terminal Oxidase

PubMed Central

Ahmad, Niaz; Michoux, Franck; Nixon, Peter J.

2012-01-01

Chloroplast transformation provides an inexpensive, easily scalable production platform for expression of recombinant proteins in plants. However, this technology has been largely limited to the production of soluble proteins. Here we have tested the ability of tobacco chloroplasts to express a membrane protein, namely plastid terminal oxidase 1 from the green alga Chlamydomonas reinhardtii (Cr-PTOX1), which is predicted to function as a plastoquinol oxidase. A homoplastomic plant containing a codon-optimised version of the nuclear gene encoding PTOX1, driven by the 16S rRNA promoter and 5′UTR of gene 10 from phage T7, was generated using a particle delivery system. Accumulation of Cr-PTOX1 was shown by immunoblotting and expression in an enzymatically active form was confirmed by using chlorophyll fluorescence to measure changes in the redox state of the plastoquinone pool in leaves. Growth of Cr-PTOX1 expressing plants was, however, more sensitive to high light than WT. Overall our results confirm the feasibility of using plastid transformation as a means of expressing foreign membrane proteins in the chloroplast. PMID:22848578
A Biochemical Approach to Study the Role of the Terminal Oxidases in Aerobic Respiration in Shewanella oneidensis MR-1

PubMed Central

Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

2014-01-01

The genome of the facultative anaerobic γ-proteobacterium Shewanella oneidensis MR-1 encodes for three terminal oxidases: a bd-type quinol oxidase and two heme-copper oxidases, a A-type cytochrome c oxidase and a cbb 3-type oxidase. In this study, we used a biochemical approach and directly measured oxidase activities coupled to mass-spectrometry analysis to investigate the physiological role of the three terminal oxidases under aerobic and microaerobic conditions. Our data revealed that the cbb 3-type oxidase is the major terminal oxidase under aerobic conditions while both cbb 3-type and bd-type oxidases are involved in respiration at low-O2 tensions. On the contrary, the low O2-affinity A-type cytochrome c oxidase was not detected in our experimental conditions even under aerobic conditions and would therefore not be required for aerobic respiration in S. oneidensis MR-1. In addition, the deduced amino acid sequence suggests that the A-type cytochrome c oxidase is a ccaa 3-type oxidase since an uncommon extra-C terminal domain contains two c-type heme binding motifs. The particularity of the aerobic respiratory pathway and the physiological implication of the presence of a ccaa 3-type oxidase in S. oneidensis MR-1 are discussed. PMID:24466040
Phenol oxidase activity in secondary transformed peat-moorsh soils

NASA Astrophysics Data System (ADS)

Styła, K.; Szajdak, L.

2009-04-01

The chemical composition of peat depends on the geobotanical conditions of its formation and on the depth of sampling. The evolution of hydrogenic peat soils is closely related to the genesis of peat and to the changes in water conditions. Due to a number of factors including oscillation of ground water level, different redox potential, changes of aerobic conditions, different plant communities, and root exudes, and products of the degradation of plant remains, peat-moorsh soils may undergo a process of secondary transformation conditions (Sokolowska et al. 2005; Szajdak et al. 2007). Phenol oxidase is one of the few enzymes able to degrade recalcitrant phenolic materials as lignin (Freeman et al. 2004). Phenol oxidase enzymes catalyze polyphenol oxidation in the presence of oxygen (O2) by removing phenolic hydrogen or hydrogenes to from radicals or quinines. These products undergo nucleophilic addition reactions in the presence or absence of free - NH2 group with the eventual production of humic acid-like polymers. The presence of phenol oxidase in soil environments is important in the formation of humic substances a desirable process because the carbon is stored in a stable form (Matocha et al. 2004). The investigations were carried out on the transect of peatland 4.5 km long, located in the Agroecological Landscape Park host D. Chlapowski in Turew (40 km South-West of Poznań, West Polish Lowland). The sites of investigation were located along Wyskoć ditch. The following material was taken from four chosen sites marked as Zbechy, Bridge, Shelterbelt and Hirudo in two layers: cartel (0-50cm) and cattle (50-100cm). The object of this study was to characterize the biochemical properties by the determination of the phenol oxidize activity in two layers of the four different peat-moors soils used as meadow. The phenol oxidase activity was determined spectrophotometrically by measuring quinone formation at λmax=525 nm with catechol as substrate by method of Perucci
Alcohol Marketing on Twitter and Instagram: Evidence of Directly Advertising to Youth/Adolescents.

PubMed

Barry, Adam E; Bates, Austin M; Olusanya, Olufunto; Vinal, Cystal E; Martin, Emily; Peoples, Janiene E; Jackson, Zachary A; Billinger, Shanaisa A; Yusuf, Aishatu; Cauley, Daunte A; Montano, Javier R

2016-07-01

Assess whether alcohol companies restrict youth/adolescent access, interaction, and exposure to their marketing on Twitter and Instagram. Employed five fictitious male and female Twitter (n = 10) and Instagram (n = 10) user profiles aged 13, 15, 17, 19 and/or 21. Using cellular smartphones, we determined whether profiles could (a) interact with advertising content-e.g. retweet, view video or picture content, comment, share URL; and/or (b) follow and directly receive advertising material updates from the official Instagram and Twitter pages of 22 alcohol brands for 30 days. All user profiles could fully access, view, and interact with alcohol industry content posted on Instagram and Twitter. Twitter's age-gate, which restricts access for those under 21, successfully prevented underage profiles from following and subsequently receiving promotional material/updates. The two 21+ profiles collectively received 1836 alcohol-related tweets within 30 days. All Instagram profiles, however, were able to follow all alcohol brand pages and received an average of 362 advertisements within 30 days. The quantity of promotional updates increased throughout the week, reaching their peak on Thursday and Friday. Representatives/controllers of alcohol brand Instagram pages would respond directly to our underage user's comments. The alcohol industry is in violation of their proposed self-regulation guidelines for digital marketing communications on Instagram. While Twitter's age-gate effectively blocked direct to phone updates, unhindered access to post was possible. Everyday our fictitious profiles, even those as young as 13, were bombarded with alcohol industry messages and promotional material directly to their smartphones. © The Author 2015. Medical Council on Alcohol and Oxford University Press. All rights reserved.
A comparison between brand-specific and traditional alcohol surveillance methods to assess underage drinkers' reported alcohol use.

PubMed

Roberts, Sarah P; Siegel, Michael B; DeJong, William; Jernigan, David H

2014-11-01

Adolescent alcohol consumption remains common and is associated with many negative health outcomes. Unfortunately, common alcohol surveillance methods often underestimate consumption. Improved alcohol use measures are needed to characterize the landscape of youth drinking. We aimed to compare a standard quantity-frequency measure of youth alcohol consumption to a novel brand-specific measure. We recruited a sample of 1031 respondents across the United States to complete an online survey. Analyses included 833 male and female underage drinkers ages 13-20. Respondents reported on how many of the past 30 days they consumed alcohol, and the number of drinks consumed on an average drinking day. Using our brand-specific measure, respondents identified which brands they consumed, how many days they consumed each brand, and how many drinks per brand they usually had. Youth reported consuming significantly more alcohol (on average, 11 drinks more per month) when responding to the brand-specific versus the standard measure (p < 0.001). The two major predictors of the difference between the two measures were being a heavy episodic drinker (p < 0.001, 95% CI = 4.1-12.0) and the total number of brands consumed (p < 0.001, 95% CI = 2.0-2.8). This study contributes to the field of alcohol and adolescent research first by investigating a potentially more accurate alcohol surveillance method, and secondly by promoting the assessment of alcohol use among adolescents vulnerable to risky alcohol use. Finally, our survey addresses the potential impact of alcohol marketing on youth and their subsequent alcohol brand preferences and consumption.
Is alcohol and community sport a good mix? Alcohol management, consumption and social capital in community sports clubs.

PubMed

Rowland, Bosco C; Wolfenden, Luke; Gillham, Karen; Kingsland, Melanie; Richardson, Ben; Wiggers, John

2015-06-01

Community sports clubs provide an important contribution to the health and wellbeing of individuals and the community; however, they have also been associated with risky alcohol consumption. This study assessed whether a club's alcohol management strategies were related to risky alcohol consumption by members and levels of social capital, as measured in terms of participation in and perceived safety of the club. A total of 723 sports club members from 33 community football clubs in New South Wales, Australia, completed a computer assisted telephone interview (CATI) and a management representative from each club also completed a CATI. The club representative reported on the club's implementation of 11 alcohol management practices, while club members reported their alcohol consumption and perceived levels of safety at the club and participation in the club. A structural equation model identified having the bar open for more than four hours; having alcohol promotions; and serving intoxicated patrons were associated with increased risky alcohol consumption while at the club; which in turn was associated with lower levels of perceived club safety and member participation. The positive contribution of community sports clubs to the community may be diminished by specific inadequate alcohol management practices. Changing alcohol management practices can reduce alcohol consumption, and possibly increase perceived aspects of social capital, such as safety and participation. © 2014 Public Health Association of Australia.
Reliability of a store observation tool in measuring availability of alcohol and selected foods.

PubMed

Cohen, Deborah A; Schoeff, Diane; Farley, Thomas A; Bluthenthal, Ricky; Scribner, Richard; Overton, Adrian

2007-11-01

Alcohol and food items can compromise or contribute to health, depending on the quantity and frequency with which they are consumed. How much people consume may be influenced by product availability and promotion in local retail stores. We developed and tested an observational tool to objectively measure in-store availability and promotion of alcoholic beverages and selected food items that have an impact on health. Trained observers visited 51 alcohol outlets in Los Angeles and southeastern Louisiana. Using a standardized instrument, two independent observations were conducted documenting the type of outlet, the availability and shelf space for alcoholic beverages and selected food items, the purchase price of standard brands, the placement of beer and malt liquor, and the amount of in-store alcohol advertising. Reliability of the instrument was excellent for measures of item availability, shelf space, and placement of malt liquor. Reliability was lower for alcohol advertising, beer placement, and items that measured the "least price" of apples and oranges. The average kappa was 0.87 for categorical items and the average intraclass correlation coefficient was 0.83 for continuous items. Overall, systematic observation of the availability and promotion of alcoholic beverages and food items was feasible, acceptable, and reliable. Measurement tools such as the one we evaluated should be useful in studies of the impact of availability of food and beverages on consumption and on health outcomes.
Design, synthesis and molecular modeling of aloe-emodin derivatives as potent xanthine oxidase inhibitors.

PubMed

Shi, Da-Hua; Huang, Wei; Li, Chao; Liu, Yu-Wei; Wang, Shi-Fan

2014-03-21

A series of aloe-emodin derivatives were synthesized and evaluated as xanthine oxidase inhibitors. Among them, four aloe-emodin derivatives showed significant inhibitory activities against xanthine oxidase. The compound 4,5-dihydroxy-9,10-dioxo-9,10-dihydroanthracene-2-carbaldehyde (A1) possessed the best xanthine oxidase inhibitory activity with IC50 of 2.79 μM. Lineweaver-Burk plot analysis revealed that A1 acted as a mixed-type inhibitor for xanthine oxidase. The docking study revealed that the molecule A1 had strong interactions with the active site of xanthine oxidase and this result was in agreement with kinetic study. Consequently, compound A1 is a new-type candidate for further development for the treatment of gout. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Superoxide from NADPH oxidase upregulates type 5 phosphodiesterase in human vascular smooth muscle cells: inhibition with iloprost and NONOate.

PubMed

Muzaffar, S; Shukla, N; Bond, M; Sala-Newby, G B; Newby, A C; Angelini, G D; Jeremy, J Y

2008-11-01

To determine whether there is an association between vascular NADPH oxidase (NOX), superoxide, the small GTPase Rac(1) and PDE type 5 (PDE5) in human vascular smooth muscle cell (hVSMCs). hVSMCs were incubated with xanthine-xanthine oxidase (X-XO; a superoxide generating system) or the thromboxane A(2) analogue, U46619 (+/-superoxide dismutase (SOD) or apocynin) for 16 h. The expression of PDE5 and NOX-1 was assessed using Western blotting and superoxide measured. The role of Rac(1) in superoxide generation was assessed by overexpressing either the dominant-negative or constitutively active Rac isoforms. The effects of iloprost, DETA-NONOate and the Rho-kinase inhibitor, Y27632, on PDE5 and NOX-1 expression were also studied. Following 16 h incubation, U46619 and X-XO promoted the expression of PDE5 and NOX-1, an effect blocked by SOD or apocynin when co-incubated over the same time course. X-XO and U46619 both promoted the formation of superoxide. Overexpression of dominant-negative Rac(1) or addition of iloprost, DETA-NONOate or Y27632 completely blocked both superoxide release and PDE5 protein expression and activity. These data demonstrate that superoxide derived from NOX upregulates the expression of PDE5 in human VSMCs. As PDE5 hydrolyses cyclic GMP, this effect may blunt the vasculoprotective actions of NO.
Mechanisms of influence: Alcohol industry submissions to the inquiry into fetal alcohol spectrum disorders.

PubMed

Avery, Michelle Rose; Droste, Nicolas; Giorgi, Caterina; Ferguson, Amy; Martino, Florentine; Coomber, Kerri; Miller, Peter

2016-11-01

Industry groups with vested interests in policy regularly work to protect their profits via the endorsement of ineffective voluntary regulation and interventions, extensive lobbying activity and minimising the health impact of consumption behaviours. This study aims to examine all alcohol industry submissions to the Australian House of Representatives Standing Committee on Social Policy and Legal Affairs into Fetal Alcohol Spectrum Disorders (FASD), to assist in understanding how those with vested interests contribute to policy development. The analysis aims to document the strategies and arguments used by alcohol industry bodies in their submissions and to compare these with known strategies of vested-interest groups. All 92 submissions to the Inquiry were screened to include only those submitted by alcohol industry bodies (five submissions). Content domains were derived based on the major themes emerging from the industry submissions and on common vested-interest behaviours identified in previous literature. The following content categories were identified: Concerns about FASD; Current industry activities and FASD prevention; Value of mandatory warning labels; and Credibility of independent public health researchers and organisations. Alcohol industry submissions sought to undermine community concern, debate the evidence, promote ineffective measure which are no threat to the profit margins and attack independent health professionals and researchers. In doing so, their behaviour is entirely consistent with their responses to other issues, such as violence and chronic health, and copies the tactics employed by the tobacco industry. [Avery MR, Droste N, Giorgi C, Ferguson A, Martino F, Coomber K, Miller P. Mechanisms of influence: Alcohol industry submissions to the inquiry into fetal alcohol spectrum disorders. Drug Alcohol Rev 2016;35:665-672]. © 2016 Australasian Professional Society on Alcohol and other Drugs.
The effects of the therapeutic workplace and heavy alcohol use on homelessness among homeless alcohol-dependent adults.

PubMed

Carlson, Emily; Holtyn, August F; Fingerhood, Michael; Friedman-Wheeler, Dara; Leoutsakos, Jeannie-Marie S; Silverman, Kenneth

2016-11-01

A clinical trial demonstrated that a therapeutic workplace could promote alcohol abstinence in homeless, alcohol-dependent adults. This secondary-data analysis examined rates of homelessness and their relation to the therapeutic workplace intervention and alcohol use during the trial. In the trial, homeless, alcohol-dependent adults could work in a therapeutic workplace for 6 months and were randomly assigned to Unpaid Training, Paid Training, or Contingent Paid Training groups. Unpaid Training participants were not paid for working. Paid Training participants were paid for working. Contingent Paid Training participants were paid for working if they provided alcohol-negative breath samples. Rates of homelessness during the study were calculated for each participant and the three groups were compared. Mixed-effects regression models were conducted to examine the relation between alcohol use (i.e., heavy drinking, drinks per drinking day, and days of alcohol abstinence) and homelessness. Unpaid Training, Paid Training, and Contingent Paid Training participants did not differ in the percentage of study days spent homeless (31%, 28%, 17%; respectively; F(2,94)=1.732, p=0.183). However, participants with more heavy drinking days (b=0.350, p<0.001), more drinks per drinking day (b=0.267, p<0.001), and fewer days of alcohol abstinence (b=-0.285, p<0.001) spent more time homeless. Reducing heavy drinking and alcohol use may help homeless, alcohol-dependent adults transition out of homelessness. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Supplementary biochemical tests useful for the differentiation of oxidase positive staphylococci.

PubMed

Stepanović, Srdjan; Dakić, Ivana; Hauschild, Tomasz; Vuković, Dragana; Morrison, Donald; Jezek, Petr; Cirković, Ivana; Petrás, Petr

2007-06-01

Differentiation of the oxidase positive staphylococci, Staphylococcus sciuri, Staphylococcus lentus, Staphylococcus vitulinus and Staphylococcus fleurettii, based on tributyrin, urease, caseinase, gelatinase and DNase activity is described. These tests may be used for preliminary identification of oxidase positive isolates of staphylococci resulting in more accurate identification of these species.
Congruence between PM H+-ATPase and NADPH oxidase during root growth: a necessary probability.

PubMed

Majumdar, Arkajo; Kar, Rup Kumar

2018-07-01

Plasma membrane (PM) H + -ATPase and NADPH oxidase (NOX) are two key enzymes responsible for cell wall relaxation during elongation growth through apoplastic acidification and production of ˙OH radical via O 2 ˙ - , respectively. Our experiments revealed a putative feed-forward loop between these enzymes in growing roots of Vigna radiata (L.) Wilczek seedlings. Thus, NOX activity was found to be dependent on proton gradient generated across PM by H + -ATPase as evident from pharmacological experiments using carbonyl cyanide m-chlorophenylhydrazone (CCCP; protonophore) and sodium ortho-vanadate (PM H + -ATPase inhibitor). Conversely, H + -ATPase activity retarded in response to different ROS scavengers [CuCl 2 , N, N' -dimethylthiourea (DMTU) and catalase] and NOX inhibitors [ZnCl 2 and diphenyleneiodonium (DPI)], while H 2 O 2 promoted PM H + -ATPase activity at lower concentrations. Repressing effects of Ca +2 antagonists (La +3 and EGTA) on the activity of both the enzymes indicate its possible mediation. Since, unlike animal NOX, the plant versions do not possess proton channel activity, harmonized functioning of PM H + -ATPase and NOX appears to be justified. Plasma membrane NADPH oxidase and H + -ATPase are functionally synchronized and they work cooperatively to maintain the membrane electrical balance while mediating plant cell growth through wall relaxation.
NADPH oxidases: new kids on the block.

PubMed

Geiszt, Miklós

2006-07-15

Reactive oxygen species (ROS) play a pivotal role in many physiological processes including host defense, hormone biosynthesis, fertilization and cellular signaling. Altered production of ROS has been implicated in the development of immunodeficiency, hypothyroidism and cardiovascular pathologies. In the last few years, several enzymes were identified at the molecular level, which are now thought to be responsible for ROS production observed in diverse tissues. These enzymes show a high degree of homology to the phagocytic NADPH oxidase and are now designated the Nox family of NADPH oxidases. This review updates our knowledge on six new members of the Nox family: Nox1, Nox3, Nox4, Nox5, Duox1 and Duox2.
Monocyte and macrophage-targeted NADPH oxidase mediates antifungal host defense and regulation of acute inflammation in mice

PubMed Central

Grimm, Melissa J.; Vethanayagam, R. Robert; Almyroudis, Nikolaos G.; Dennis, Carly G.; Khan, A. Nazmul H.; D’Auria, Anthony; Singel, Kelly L.; Davidson, Bruce A.; Knight, Paul R.; Blackwell, Timothy S.; Hohl, Tobias M.; Mansour, Michael K.; Vyas, Jatin M.; Röhm, Marc; Urban, Constantin F.; Kelkka, Tiina; Holmdahl, Rikard; Segal, Brahm H.

2013-01-01

Chronic granulomatous disease, an inherited disorder of the NADPH oxidase in which phagocytes are defective in the generation of superoxide anion and downstream reactive oxidant species, is characterized by severe bacterial and fungal infections and excessive inflammation. Although NADPH oxidase isoforms exist in several lineages, reactive oxidant generation is greatest in neutrophils, where NADPH oxidase has been deemed vital for pathogen killing. In contrast, the function and importance of NADPH oxidase in macrophages are less clear. Therefore, we evaluated susceptibility to pulmonary aspergillosis in globally NADPH oxidase-deficient mice versus transgenic mice with monocyte/macrophage-targeted NADPH oxidase activity. We found that the lethal inoculum was more than 100-fold greater in transgenic versus globally NADPH oxidase-deficient mice. Consistent with these in vivo results, NADPH oxidase in mouse alveolar macrophages limited germination of phagocytosed Aspergillus fumigatus spores. Finally, globally NADPH oxidase-deficient mice developed exuberant neutrophilic lung inflammation and pro-inflammatory cytokine responses to zymosan, a fungal cell wall-derived product composed principally of particulate beta-glucans, whereas inflammation in transgenic and wildtype mice was mild and transient. Together, our studies identify a central role for monocyte/macrophage NADPH oxidase in controlling fungal infection and in limiting acute lung inflammation. PMID:23509361

Pavlovian-to-instrumental transfer effects in the nucleus accumbens relate to relapse in alcohol dependence.

PubMed

Garbusow, Maria; Schad, Daniel J; Sebold, Miriam; Friedel, Eva; Bernhardt, Nadine; Koch, Stefan P; Steinacher, Bruno; Kathmann, Norbert; Geurts, Dirk E M; Sommer, Christian; Müller, Dirk K; Nebe, Stephan; Paul, Sören; Wittchen, Hans-Ulrich; Zimmermann, Ulrich S; Walter, Henrik; Smolka, Michael N; Sterzer, Philipp; Rapp, Michael A; Huys, Quentin J M; Schlagenhauf, Florian; Heinz, Andreas

2016-05-01

In detoxified alcohol-dependent patients, alcohol-related stimuli can promote relapse. However, to date, the mechanisms by which contextual stimuli promote relapse have not been elucidated in detail. One hypothesis is that such contextual stimuli directly stimulate the motivation to drink via associated brain regions like the ventral striatum and thus promote alcohol seeking, intake and relapse. Pavlovian-to-Instrumental-Transfer (PIT) may be one of those behavioral phenomena contributing to relapse, capturing how Pavlovian conditioned (contextual) cues determine instrumental behavior (e.g. alcohol seeking and intake). We used a PIT paradigm during functional magnetic resonance imaging to examine the effects of classically conditioned Pavlovian stimuli on instrumental choices in n = 31 detoxified patients diagnosed with alcohol dependence and n = 24 healthy controls matched for age and gender. Patients were followed up over a period of 3 months. We observed that (1) there was a significant behavioral PIT effect for all participants, which was significantly more pronounced in alcohol-dependent patients; (2) PIT was significantly associated with blood oxygen level-dependent (BOLD) signals in the nucleus accumbens (NAcc) in subsequent relapsers only; and (3) PIT-related NAcc activation was associated with, and predictive of, critical outcomes (amount of alcohol intake and relapse during a 3 months follow-up period) in alcohol-dependent patients. These observations show for the first time that PIT-related BOLD signals, as a measure of the influence of Pavlovian cues on instrumental behavior, predict alcohol intake and relapse in alcohol dependence. © 2015 Society for the Study of Addiction.
Targeted intervention: Computational approaches to elucidate and predict relapse in alcoholism.

PubMed

Heinz, Andreas; Deserno, Lorenz; Zimmermann, Ulrich S; Smolka, Michael N; Beck, Anne; Schlagenhauf, Florian

2017-05-01

Alcohol use disorder (AUD) and addiction in general is characterized by failures of choice resulting in repeated drug intake despite severe negative consequences. Behavioral change is hard to accomplish and relapse after detoxification is common and can be promoted by consumption of small amounts of alcohol as well as exposure to alcohol-associated cues or stress. While those environmental factors contributing to relapse have long been identified, the underlying psychological and neurobiological mechanism on which those factors act are to date incompletely understood. Based on the reinforcing effects of drugs of abuse, animal experiments showed that drug, cue and stress exposure affect Pavlovian and instrumental learning processes, which can increase salience of drug cues and promote habitual drug intake. In humans, computational approaches can help to quantify changes in key learning mechanisms during the development and maintenance of alcohol dependence, e.g. by using sequential decision making in combination with computational modeling to elucidate individual differences in model-free versus more complex, model-based learning strategies and their neurobiological correlates such as prediction error signaling in fronto-striatal circuits. Computational models can also help to explain how alcohol-associated cues trigger relapse: mechanisms such as Pavlovian-to-Instrumental Transfer can quantify to which degree Pavlovian conditioned stimuli can facilitate approach behavior including alcohol seeking and intake. By using generative models of behavioral and neural data, computational approaches can help to quantify individual differences in psychophysiological mechanisms that underlie the development and maintenance of AUD and thus promote targeted intervention. Copyright © 2016 Elsevier Inc. All rights reserved.
Orexin-1 receptor blockade suppresses compulsive-like alcohol drinking in mice

PubMed Central

Lei, Kelly; Wegner, Scott A.; Yu, Ji-Hwan; Hopf, F. Woodward

2016-01-01

Addiction is promoted by pathological motivation for addictive substances, and, despite extensive efforts, alcohol use disorders (AUDs) continue to extract a very high social, physical, and economic toll. Compulsive drinking of alcohol, where consumption persists even when alcohol is paired with negative consequences, is considered a particular obstacle for treating AUDs. Aversion-resistant alcohol intake in rodents, e.g. where rodents drink even when alcohol is paired with the bitter tastant quinine, has been considered to model some compulsive aspects of human alcohol consumption. However, the critical mechanisms that drive compulsive-like drinking are only beginning to be identified. The neuropeptide orexin has been linked to high motivation for cocaine, preferred foods, and alcohol. Thus, we investigated the role of orexin receptors in compulsive-like alcohol drinking, where C57BL/6 mice had 2-hr daily access to 15% alcohol with or without quinine (100 µM). We found that systemic administration of the widely used selective orexin-1 receptor (OX1R) blocker, SB-334867 (SB), significantly reduced compulsive-like consumption at doses lower than those reported to reduce quinine-free alcohol intake. The dose of 3-mg/kg SB, in particular, suppressed only compulsive-like drinking. Furthermore, SB did not reduce concurrent water intake during the alcohol drinking sessions, and did not alter saccharin+quinine consumption. In addition, the OX2R antagonist TCS-OX2-29 (3 or 10 mg/kg) did not alter intake of alcohol with or without quinine. Together, our results suggest that OX1R signaling is particularly important for promoting compulsive-like alcohol drinking, and that OX1Rs might represent a novel therapy to counteract compulsive aspects of human AUDs. PMID:27523303
Effect of mitoguazone on polyamine oxidase activity in rat liver.

PubMed

Ferioli, Maria Elena; Berselli, Debora; Caimi, Samuela

2004-12-01

Mitoguazone is a known inhibitor of polyamine biosynthesis through competitive inhibition of S-adenosylmethionine decarboxylase. A recent renewed interest in mitoguazone as an antineoplastic agent prompted us to investigate the effect of the drug on polyamine catabolism in rat liver, since the organ plays an important role in detoxification mechanisms. Thus, the purpose of this work was to evaluate the effect of in vivo mitoguazone administration on polyamine catabolic enzymes. In particular, our interest was directed to the changes in polyamine oxidase activity, since this enzyme has been recently confirmed to exert important functions that until now were underestimated. Mitoguazone administration induced hepatic polyamine oxidase activity starting at 4 h after administration, and the enzyme returned to basal levels 96 h after treatment. The changes in enzyme activity were accompanied by changes in putrescine concentrations, which increased starting at 4 h until 72 h after treatment. We also evaluated the activity of the newly identified spermine oxidase, which was not significantly changed by mitoguazone treatment. Therefore, we hypothesized that the enzyme involved in mitoguazone response of the liver is the polyamine oxidase, which acts on acetylated polyamines as substrate.
Social competence promotion with inner-city and suburban young adolescents: effects on social adjustment and alcohol use.

PubMed

Caplan, M; Weissberg, R P; Grober, J S; Sivo, P J; Grady, K; Jacoby, C

1992-02-01

This study assessed the impact of school-based social competence training on skills, social adjustment, and self-reported substance use of 282 sixth and seventh graders. Training emphasized broad-based competence promotion in conjunction with domain-specific application to substance abuse prevention. The 20-session program comprised six units: stress management, self-esteem, problem solving, substances and health information, assertiveness, and social networks. Findings indicated positive training effects on Ss' skills in handling interpersonal problems and coping with anxiety. Teacher ratings revealed improvements in Ss' constructive conflict resolution with peers, impulse control, and popularity. Self-report ratings indicated gains in problem-solving efficacy. Results suggest some preventive impact on self-reported substance use intentions and excessive alcohol use. In general, the program was found to be beneficial for both inner-city and suburban students.
Oxidase-functionalized Fe(3)O(4) nanoparticles for fluorescence sensing of specific substrate.

PubMed

Liu, Cheng-Hao; Tseng, Wei-Lung

2011-10-03

This study reports the development of a reusable, single-step system for the detection of specific substrates using oxidase-functionalized Fe(3)O(4) nanoparticles (NPs) as a bienzyme system and using amplex ultrared (AU) as a fluorogenic substrate. In the presence of H(2)O(2), the reaction pH between Fe(3)O(4) NPs and AU was similar to the reaction of oxidase and the substrate. The catalytic activity of Fe(3)O(4) NPs with AU was nearly unchanged following modification with poly(diallyldimethylammonium chloride) (PDDA). Based on these features, we prepared a composite of PDDA-modified Fe(3)O(4) NPs and oxidase for the quantification of specific substrates through the H(2)O(2)-mediated oxidation of AU. By monitoring fluorescence intensity at 587 nm of oxidized AU, the minimum detectable concentrations of glucose, galactose, and choline were found to be 3, 2, and 20 μM using glucose oxidase-Fe(3)O(4), galactose oxidase-Fe(3)O(4), and choline oxidase-Fe(3)O(4) composites, respectively. The identification of glucose in blood was selected as the model to validate the applicability of this proposed method. Copyright © 2011 Elsevier B.V. All rights reserved.
A Mycobacterium tuberculosis Cytochrome bd Oxidase Mutant Is Hypersensitive to Bedaquiline

PubMed Central

Hartman, Travis E.

2014-01-01

ABSTRACT The new medicinal compound bedaquiline (BDQ) kills Mycobacterium tuberculosis by inhibiting F1Fo-ATP synthase. BDQ is bacteriostatic for 4 to 7 days and kills relatively slowly compared to other frontline tuberculosis (TB) drugs. Here we show that killing with BDQ can be improved significantly by inhibiting cytochrome bd oxidase, a non-proton-pumping terminal oxidase. BDQ was instantly bactericidal against a cytochrome bd oxidase null mutant of M. tuberculosis, and the rate of killing was increased by more than 50%. We propose that this exclusively bacterial enzyme should be a high-priority target for new drug discovery. PMID:25028424
Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

PubMed

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
NADPH oxidase activation in neutrophils: Role of the Phosphorylation of its subunits.

PubMed

Belambri, Sahra A; Rolas, Loïc; Raad, Houssam; Hurtado-Nedelec, Margarita; Dang, Pham My-Chan; El-Benna, Jamel

2018-05-14

Neutrophils are key cells of innate immunity and during inflammation. Upon activation, they produce large amounts of superoxide anion (O 2 -. ) and ensuing reactive oxygen species (ROS) to kill phagocytized microbes. The enzyme responsible for O 2 -. production is called the phagocyte NADPH oxidase. This is a multicomponent enzyme system that becomes active after assembly of four cytosolic proteins (p47 phox , p67 phox , p40 phox and Rac2) with the transmembrane proteins (p22 phox and gp91 phox , which form the cytochrome b 558 ). gp91 phox represents the catalytic subunit of the NADPH oxidase and is also called NOX2. NADPH oxidase-derived ROS are essential for microbial killing and innate immunity; however, excessive ROS production induces tissue injury and prolonged inflammatory reactions that contribute to inflammatory diseases. Thus, NADPH oxidase activation must be tightly regulated in time and space in order to limit ROS production. NADPH oxidase activation is regulated by several processes such as phosphorylation of its components, exchange of GDP/GTP on Rac2 and binding of p47 phox and p40 phox to phospholipids. This review aims to provide new insights into the role of the phosphorylation of the NADPH oxidase components, i.e., gp91 phox , p22 phox , p47 phox , p67 phox and p40 phox , in the activation of this enzyme. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
The alcoholic brain: neural bases of impaired reward-based decision-making in alcohol use disorders.

PubMed

Galandra, Caterina; Basso, Gianpaolo; Cappa, Stefano; Canessa, Nicola

2018-03-01

Neuroeconomics is providing insights into the neural bases of decision-making in normal and pathological conditions. In the neuropsychiatric domain, this discipline investigates how abnormal functioning of neural systems associated with reward processing and cognitive control promotes different disorders, and whether such evidence may inform treatments. This endeavor is crucial when studying different types of addiction, which share a core promoting mechanism in the imbalance between impulsive subcortical neural signals associated with immediate pleasurable outcomes and inhibitory signals mediated by a prefrontal reflective system. The resulting impairment in behavioral control represents a hallmark of alcohol use disorders (AUDs), a chronic relapsing disorder characterized by excessive alcohol consumption despite devastating consequences. This review aims to summarize available magnetic resonance imaging (MRI) evidence on reward-related decision-making alterations in AUDs, and to envision possible future research directions. We review functional MRI (fMRI) studies using tasks involving monetary rewards, as well as MRI studies relating decision-making parameters to neurostructural gray- or white-matter metrics. The available data suggest that excessive alcohol exposure affects neural signaling within brain networks underlying adaptive behavioral learning via the implementation of prediction errors. Namely, weaker ventromedial prefrontal cortex activity and altered connectivity between ventral striatum and dorsolateral prefrontal cortex likely underpin a shift from goal-directed to habitual actions which, in turn, might underpin compulsive alcohol consumption and relapsing episodes despite adverse consequences. Overall, these data highlight abnormal fronto-striatal connectivity as a candidate neurobiological marker of impaired choice in AUDs. Further studies are needed, however, to unveil its implications in the multiple facets of decision-making.
Development and evaluation of the OHCITIES instrument: assessing alcohol urban environments in the Heart Healthy Hoods project

PubMed Central

Sureda, Xisca; Espelt, Albert; Villalbí, Joan R; Cebrecos, Alba; Baranda, Lucía; Pearce, Jamie; Franco, Manuel

2017-01-01

Objectives To describe the development and test–retest reliability of OHCITIES, an instrument characterising alcohol urban environment in terms of availability, promotion and signs of consumption. Design This study involved: (1) developing the conceptual framework for alcohol urban environment by means of literature reviewing and previous alcohol environment research experience; (2) pilot testing and redesigning the instrument; (3) instrument digitalisation; (4) instrument evaluation using test–retest reliability. Setting Data for testing the reliability of the instrument were collected in seven census sections in Madrid in 2016 by two observers. Primary and secondary outcome measures We computed per cent agreement and Cohen’s kappa coefficients to estimate inter-rater and test–retest reliability for alcohol outlet environment measures. We calculated interclass coefficients and their 95% CIs to provide a measure of inter-rater reliability for signs of alcohol consumption measures. Results We collected information on 92 on-premise and 24 off-premise alcohol outlets identified in the studied areas about availability, accessibility and promotion of alcohol. Most per cent-agreement values for alcohol measures in on-premise and off-premise alcohol outlets were greater than 80%, and inter-rater and test–retest reliability values were generally above 0.80. Observers identified 26 streets and 3 public squares with signs of alcohol consumption. Intraclass correlation coefficient between observers for any type of signs of alcohol consumption was 0.50 (95% CI −0.09 to 0.77). Few items promoting alcohol unrelated to alcohol outlets were found on public spaces. Conclusions The OHCITIES instrument is a reliable instrument to characterise alcohol urban environment. This instrument might be used to understand how alcohol environment associates with alcohol behaviours and its related health outcomes, and can help in the design and evaluation of policies to reduce the
Spermine oxidase is up-regulated and promotes tumor growth in hepatocellular carcinoma.

PubMed

Hu, Tingting; Sun, Dalong; Zhang, Jie; Xue, Ruyi; Janssen, Harry L A; Tang, Wenqing; Dong, Ling

2018-06-20

The polyamine catabolic enzyme, spermine oxidase (SMOX) is up-regulated in chronic inflammatory conditions and linked to increased reactive oxygen species (ROS) and DNA damage in various forms of cancers. The present study aims to explore the expression pattern and biological function of SMOX in hepatocellular carcinoma (HCC). We used qRT-PCR, Western blotting and immunohistochemistry to examine SMOX expression in four HCC cell lines and 120 cases of HCC clinical samples, and the clinical significance of SMOX was analyzed. The biological function of SMOX on HCC cells were detected both in vitro and in vivo. It showed that SMOX was overexpressed in HCC cell lines and clinical HCC tissues. Moreover, SMOX expression levels were gradually increased in normal liver, chronic hepatitis and HCC tissues. Increased SMOX expression was correlated with poor clinical features of HCC. Patients with positive SMOX expression in tumor tissues indicated worse overall survival (P = 0.008) and shorter relapse-free survival (P = 0.002). Knockdown of SMOX inhibited HCC cell proliferation, arrested cell cycle at S phase and resulted in an increase of apoptosis. The in vivo study showed that inhibition of SMOX in HCC cells significantly repressed tumor growth in nude mice. Furthermore, we demonstrated that SMOX may exert its function by regulating PI3K/Akt signaling pathway. Our data indicated that SMOX upregulation may be a critical oncogene in HCC and might serve as a valuable prognostic marker and potential therapeutic target for HCC. This article is protected by copyright. All rights reserved.
Substitutions of S101 decrease proton and hydride transfers in the oxidation of betaine aldehyde by choline oxidase.

PubMed

Gadda, Giovanni; Yuan, Hongling

2017-11-15

Choline oxidase oxidizes choline to glycine betaine, with two flavin-mediated reactions to convert the alcohol substrate to the carbon acid product. Proton abstraction from choline or hydrated betaine aldehyde in the wild-type enzyme occurs in the mixing time of the stopped-flow spectrophotometer, thereby precluding a mechanistic investigation. Mutagenesis of S101 rendered the proton transfer reaction amenable to study. Here, we have investigated the aldehyde oxidation reaction catalyzed by the mutant enzymes using steady-state and rapid kinetics with betaine aldehyde. Stopped-flow traces for the reductive half-reaction of the S101T/V/C variants were biphasic, corresponding to the reactions of proton abstraction and hydride transfer. In contrast, the S101A enzyme yielded monophasic traces like wild-type choline oxidase. The rate constants for proton transfer in the S101T/C/V variants decreased logarithmically with increasing hydrophobicity of residue 101, indicating a behavior different from that seen previously with choline for which no correlation was determined. The rate constants for hydride transfer also showed a logarithmic decrease with increasing hydrophobicity at position 101, which was similar to previous results with choline as a substrate for the enzyme. Thus, the hydrophilic character of S101 is necessary not only for efficient hydride transfer but also for the proton abstraction reaction. Copyright © 2017. Published by Elsevier Inc.
Safety assessment of bacterial choline oxidase protein introduced in transgenic crops for tolerance against abiotic stress.

PubMed

Singh, Abinav K; Singh, Bhanu P; Prasad, G B K S; Gaur, Shailendra N; Arora, Naveen

2008-12-24

Genetically modified crops have resistance to abiotic stress by introduction of choline oxidase protein. In the present study, the safety of choline oxidase protein derived from Arthrobacter globiformis was assessed for toxicity and allergenicity. The protein was stable at 90 degrees C for 1 h. Toxicity studies of choline oxidase in mice showed no significant difference (p > 0.05) from control in terms of growth, body weight, food consumption, and blood biochemical indices. Histology of gut tissue of mice fed protein showed normal gastric mucosal lining and villi in jejunum and ileum sections. Specific IgE in serum and IL-4 release in splenic culture supernatant were low in choline oxidase treated mice, comparable to control. Intravenous challenge with choline oxidase did not induce any adverse reaction, unlike ovalbumin group mice. Histology of lung tissues from choline oxidase sensitized mice showed normal airways, whereas ovalbumin-sensitized mice showed inflamed airways with eosinophilic infiltration and bronchoconstriction. ELISA carried out with food allergic patients' sera revealed no significant IgE affinity with choline oxidase. Also, choline oxidase did not show any symptoms of toxicity and allergenicity in mice.
Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

PubMed

Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

1997-03-25

1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.
Industry Actors, Think Tanks, and Alcohol Policy in the United Kingdom

PubMed Central

McCambridge, Jim

2014-01-01

Corporate actors seek to influence alcohol policies through various means, including attempts to shape the evidential content of policy debates. In this case study, we examined how SABMiller engaged the think tank Demos to produce reports on binge drinking, which were heavily promoted among policymakers at crucial stages in the development of the UK government’s 2012 alcohol strategy. One key report coincided with other SABMiller-funded publications, advocating measures to enhance parenting as an alternative to minimum unit pricing. In this instance, the perceived independence of an influential think tank was used to promote industry interests in tactics similar to those of transnational tobacco corporations. This approach is in keeping with other alcohol industry efforts to marginalize the peer-reviewed literature. PMID:24922137
Industry actors, think tanks, and alcohol policy in the United kingdom.

PubMed

Hawkins, Benjamin; McCambridge, Jim

2014-08-01

Corporate actors seek to influence alcohol policies through various means, including attempts to shape the evidential content of policy debates. In this case study, we examined how SABMiller engaged the think tank Demos to produce reports on binge drinking, which were heavily promoted among policymakers at crucial stages in the development of the UK government's 2012 alcohol strategy. One key report coincided with other SABMiller-funded publications, advocating measures to enhance parenting as an alternative to minimum unit pricing. In this instance, the perceived independence of an influential think tank was used to promote industry interests in tactics similar to those of transnational tobacco corporations. This approach is in keeping with other alcohol industry efforts to marginalize the peer-reviewed literature.
Red flags on pinkwashed drinks: contradictions and dangers in marketing alcohol to prevent cancer.

PubMed

Mart, Sarah; Giesbrecht, Norman

2015-10-01

To document alcohol products and promotions that use the pink ribbon symbol and related marketing materials that associate alcohol brands with breast cancer charities, awareness and survivors. We conducted a basic Boolean public internet search for alcohol products with pink ribbon/breast cancer awareness marketing campaigns. There is strong and growing evidence of alcohol as a contributing cause of several types of cancer, including breast cancer. There is no U-shaped curve for cancer, and threshold of elevated relative risk is as low as one drink a day for certain cancers. We found 17 examples of alcohol product campaigns with websites, press releases and social media posts, along with news articles and blog posts from industry and non-profit organizations regarding alcohol products associated with breast cancer causes and charities. Various cancer charities have entered into alliances with sectors of the alcohol industry that raise funds for breast cancer research, treatment or prevention by promoting the purchase of certain alcoholic beverages. Some alcohol corporations use pink ribbons and other breast cancer-related images, messages and user-generated media to market a product that contributes to cancer disease and death. Therefore, cancer charities should adopt policies to separate them from alliances with the alcohol industry. © 2015 Society for the Study of Addiction.
Alcohol management practices in community football clubs: Association with risky drinking at the club and overall hazardous alcohol consumption.

PubMed

Rowland, Bosco; Tindall, Jenny; Wolfenden, Luke; Gillham, Karen; Ramsden, Robyn; Wiggers, John

2015-07-01

Across the world, it has been estimated that approximately 270 million people participate in community football clubs. However, the community sports club setting is associated with high levels of risky alcohol consumption. The study examined if sporting club alcohol management practices are associated with risky consumption of alcohol by club members while at the club, and also whether such consumption is directly and indirectly associated with club member overall hazardous alcohol consumption. Telephone surveys were conducted with a representative from 72 community football clubs in New South Wales, Australia, and 1428 club members. A path and mediation analysis was undertaken to determine the association between 11 club alcohol management practices and member alcohol consumption, at the club and overall hazardous consumption. Three alcohol management practices were associated with an increased probability of risky drinking while at the club: having alcohol promotions; serving intoxicated patrons; and having bar open longer than 4 h. A mediation analyses identified that risky drinking at the club as a result of these three practices was also linked to increase risk in being an overall hazardous drinker. Modifying alcohol management practices in community football clubs has the potential to reduce both risky alcohol consumption by members in this setting and the prevalence of overall hazardous alcohol consumption. Coordinated, multi-strategic interventions are required to support community football clubs to modify their alcohol management practices and hence contribute to reducing the burden of alcohol-related harm in the community. © 2014 Australasian Professional Society on Alcohol and other Drugs.
Parkin regulates mitophagy and mitochondrial function to protect against alcohol-induced liver injury and steatosis in mice.

PubMed

Williams, Jessica A; Ni, Hong-Min; Ding, Yifeng; Ding, Wen-Xing

2015-09-01

Alcoholic liver disease claims two million lives per year. We previously reported that autophagy protected against alcohol-induced liver injury and steatosis by removing damaged mitochondria. However, the mechanisms for removal of these mitochondria are unknown. Parkin is an evolutionarily conserved E3 ligase that is recruited to damaged mitochondria to initiate ubiquitination of mitochondrial outer membrane proteins and subsequent mitochondrial degradation by mitophagy. In addition to its role in mitophagy, Parkin has been shown to have other roles in maintaining mitochondrial function. We investigated whether Parkin protected against alcohol-induced liver injury and steatosis using wild-type (WT) and Parkin knockout (KO) mice treated with alcohol by the acute-binge and Gao-binge (chronic plus acute-binge) models. We found that Parkin protected against liver injury in both alcohol models, likely because of Parkin's role in maintaining a population of healthy mitochondria. Alcohol caused greater mitochondrial damage and oxidative stress in Parkin KO livers compared with WT livers. After alcohol treatment, Parkin KO mice had severely swollen and damaged mitochondria that lacked cristae, which were not seen in WT mice. Furthermore, Parkin KO mice had decreased mitophagy, β-oxidation, mitochondrial respiration, and cytochrome c oxidase activity after acute alcohol treatment compared with WT mice. Interestingly, liver mitochondria seemed able to adapt to alcohol treatment, but Parkin KO mouse liver mitochondria had less capacity to adapt to Gao-binge treatment compared with WT mouse liver mitochondria. Overall, our findings indicate that Parkin is an important mediator of protection against alcohol-induced mitochondrial damage, steatosis, and liver injury. Copyright © 2015 the American Physiological Society.

A comparison between brand-specific and traditional alcohol surveillance methods to assess underage drinkers’ reported alcohol use

PubMed Central

Roberts, Sarah P.; Siegel, Michael B.; DeJong, William; Jernigan, David H.

2014-01-01

Background Adolescent alcohol consumption remains common and is associated with many negative health outcomes. Unfortunately, common alcohol surveillance methods often underestimate consumption. Improved alcohol use measures are needed to characterize the landscape of youth drinking. Objectives We aimed to compare a standard quantity-frequency measure of youth alcohol consumption to a novel brand-specific measure. Methods We recruited a sample of 1,031 respondents across the United States to complete an online survey. Analyses included 833 male and female underage drinkers ages 13–20. Respondents reported on how many of the past 30 days they consumed alcohol, and the number of drinks consumed on an average drinking day. Using our brand-specific measure, respondents identified which brands they consumed, how many days they consumed each brand, and how many drinks per brand they usually had. Results Youth reported consuming significantly more alcohol (on average, 11 drinks more per month) when responding to the brand-specific versus the standard measure (p<.001). The two major predictors of the difference between the two measures were being a heavy episodic drinker (p<.001, 95% CI = 4.1 to 12.0) and the total number of brands consumed (p<.001, 95% CI = 2.0 to 2.8). Conclusion This study contributes to the field of alcohol and adolescent research first by investigating a potentially more accurate alcohol surveillance method, and secondly by promoting the assessment of alcohol use among adolescents vulnerable to risky alcohol use. Finally, our survey addresses the potential impact of alcohol marketing on youth and their subsequent alcohol brand preferences and consumption. PMID:25062357
European longitudinal study on the relationship between adolescents' alcohol marketing exposure and alcohol use.

PubMed

de Bruijn, Avalon; Tanghe, Jacqueline; de Leeuw, Rebecca; Engels, Rutger; Anderson, Peter; Beccaria, Franca; Bujalski, Michał; Celata, Corrado; Gosselt, Jordy; Schreckenberg, Dirk; Słodownik, Luiza; Wothge, Jördis; van Dalen, Wim

2016-10-01

This is the first study to examine the effect of alcohol marketing exposure on adolescents' drinking in a cross-national context. The aim was to examine reciprocal processes between exposure to a wide range of alcohol marketing types and adolescent drinking, controlled for non-alcohol branded media exposure. Prospective observational study (11-12- and 14-17-month intervals), using a three-wave autoregressive cross-lagged model. School-based sample in 181 state-funded schools in Germany, Italy, Netherlands, Poland. A total of 9075 eligible respondents participated in the survey (mean age 14 years, 49.5% male. Adolescents reported their frequency of past-month drinking and binge drinking. Alcohol marketing exposure was measured by a latent variable with 13 items measuring exposure to online alcohol marketing, televised alcohol advertising, alcohol sport sponsorship, music event/festival sponsorship, ownership alcohol-branded promotional items, reception of free samples and exposure to price offers. Confounders were age, gender, education, country, internet use, exposure to non-alcohol sponsored football championships and television programmes without alcohol commercials. The analyses showed one-directional long-term effects of alcohol marketing exposure on drinking (exposure T1 on drinking T2: β = 0.420 (0.058), P < 0.001, 95% confidence interval (CI) = 0.324-0.515; exposure T2 on drinking T3: β = 0.200 (0.044), P < 0.001, 95% CI = 0.127-0.272; drinking T1 and drinking T2 on exposure: P > 0.05). Similar results were found in the binge drinking model (exposure T1 on binge T2: β = 0.409 (0.054), P < 0.001, 95% CI = 0.320-0.499; exposure T2 on binge T3: β = 0.168 (0.050), P = 0.001, 95% CI = 0.086-0.250; binge T1 and binge T2 on exposure: P > 0.05). There appears to be a one-way effect of alcohol marketing exposure on adolescents' alcohol use over time, which cannot be explained by either previous drinking or
Activation of monoamine oxidase isotypes by prolonged intake of aluminum in rat brain.

PubMed

Huh, Jae-Wan; Choi, Myung-Min; Lee, Jang Han; Yang, Seung-Ju; Kim, Mi Jung; Choi, Jene; Lee, Kwan Ho; Lee, Jong Eun; Cho, Sung-Woo

2005-10-01

Rats were fed 100 microM aluminum maltolate for one year in their drinking water. Brain aluminum contents have increased 4.2-fold in the aluminum-treated group, whereas no significant changes in the body weight, brain weight, and brain protein content were observed. Long-term aluminum feeding induced apoptosis as assessed by the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling method and showed activatory effects on the catalytic efficiency (kcat/KM) of monoamine oxidase-A and monoamine oxidase-B up to 1.9- and 3.8-fold, respectively. The expression level of monoamine oxidase isotypes on the Western blot remained unchanged between the two groups, suggesting a change in post-translational regulation of the activities of monoamine oxidase isotypes by long-term aluminum feeding.
Exogenous estrogen protects mice from the consequences of obesity and alcohol.

PubMed

Holcomb, Valerie B; Hong, Jina; Núñez, Nomelí P

2012-06-01

Breast cancer is the second leading cause of cancer death among American women. Risk factors for breast cancer include obesity, alcohol consumption, and estrogen therapy. In the present studies, we determine the simultaneous effects of these three risk factors on wingless int (Wnt)-1 mammary tumor growth. Ovariectomized female mice were fed diets to induce different body weights (calorie restricted, low fat, high fat), provided water or 20% alcohol, implanted with placebo or estrogen pellets and injected with Wnt-1 mouse mammary cancer cells. Our results show that obesity promoted the growth of Wnt-1 tumors and induced fatty liver. Tumors tended to be larger in alcohol-consuming mice and alcohol exacerbated fatty liver in obese mice. Estrogen treatment promoted weight loss in obese mice, which was associated with the suppression of tumor growth and fatty liver. In summary, we show that estrogen protects against obesity, which is associated with the inhibition of fatty liver and tumor growth.
[Consumption of alcoholic beverages: cultural revolution is necessary].

PubMed

Testino, Gianni

2015-11-01

Significant investment in advertising has been made to promote the consumption of alcoholic beverages, but only 0.5% of the GDP is allocated for preventing alcohol use. Although available evidence clearly demonstrates a causal relationship between ethanol and cancer, the perception of risk in the general population remains extremely low. This is partly due to the fact that alcohol consumption is considered as a "normal" habit in our society, mostly as a consequence of the lack of appropriate information. It should also be emphasized the lack of a common language within the healthcare community, in that too often alcohol is identified as a food or a preservative. The fourth edition of the RDA represents a true cultural revolution as it identifies alcohol consumption as a risk, regardless of the amount consumed. Recommended dosages are defined as low-risk dosages. It would be appropriate to correctly apply the Law 125/2001, which provides for inclusion of alcoholism in university education programs.
Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

USDA-ARS?s Scientific Manuscript database

Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...
Towards rational therapy with monoamine oxidase inhibitors.

PubMed

Tyrer, P

1976-04-01

A rational approach to the use of monoamine oxidase inhibitors (MAOIs) is outlined. Patients suitable for treatment cannot be classified adequately using conventional diagnostic labels. They include those with primary symptoms of hypochondriasis, agoraphobia and social phobias, irritability, somatic anxiety and anergia; those with primary depressed mood, guilt, ideas of reference and personality disorders seldom respond. There is great variation in the interval between the first administration of these drugs and clinical response, and this may account for the inconsistencies in published trials. The type of drug and its dose may affect rate of response, as may biochemical factors, including acetylator and monoamine oxidase status. To obtain maximum benefit, a course of therapy with MAOIs should last for several months.
In vivo low-level light therapy increases cytochrome oxidase in skeletal muscle.

PubMed

Hayworth, Christopher R; Rojas, Julio C; Padilla, Eimeira; Holmes, Genevieve M; Sheridan, Eva C; Gonzalez-Lima, F

2010-01-01

Low-level light therapy (LLLT) increases survival of cultured cells, improves behavioral recovery from neurodegeneration and speeds wound healing. These beneficial effects are thought to be mediated by upregulation of mitochondrial proteins, especially the respiratory enzyme cytochrome oxidase. However, the effects of in vivo LLLT on cytochrome oxidase in intact skeletal muscle have not been previously investigated. We used a sensitive method for enzyme histochemistry of cytochrome oxidase to examine the rat temporalis muscle 24 h after in vivo LLLT. The findings showed for the first time that in vivo LLLT induced a dose- and fiber type-dependent increase in cytochrome oxidase in muscle fibers. LLLT was particularly effective at enhancing the aerobic capacity of intermediate and red fibers. The findings suggest that LLLT may enhance the oxidative energy metabolic capacity of different types of muscle fibers, and that LLLT may be used to enhance the aerobic potential of skeletal muscle.
Mammalian monoamine-oxidizing enzymes, with special reference to benzylamine oxidase in human tissues.

PubMed

Lewinsohn, R

1984-01-01

A review is presented of the monoamine-oxidizing enzymes with special reference to the activity of benzylamine oxidase (BzAO) in human tissues. Methods of study of amine oxidases, properties (chiefly of BzAO) and some problems concerning substrate and inhibitor specificity and multiple forms of monoamine oxidase (MAO) are surveyed. The substrate specificity of human plasma BzAO is compared with that of amine-oxidizing enzymes in plasma or serum of other species. Correlations of plasma BzAO and platelet MAO activity with clinical findings are discussed. The distribution of amine oxidase activities in solid human tissues is reviewed, in particular BzAO in blood vessels and richly-vascularized tissues, as well as kinetic constants and altered patterns of activity of BzAO in human atherosclerosis. Activities of the amine oxidases in non-vascular smooth muscle, in cultured cells, and in various tissues related to human gestation, are discussed. The present knowledge of BzAO is discussed in terms of its possible clinical relevance to several human disease states, and the importance of the enzyme in the human body.
Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.

PubMed

Brattsten, L B; Wilkinson, C F; Eisner, T

1977-06-17

The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.
Television viewing and alcohol advertising with alcohol expectancies among school-aged children in Taiwan.

PubMed

Chen, Ying-Ying; Chiu, Yu-Chan; Ting, Te-Tien; Liao, Hsin-Yao; Chen, Wei J; Chen, Chuan-Yu

2016-05-01

This study is aimed to examine the strength of association between television watching and potential exposure to alcohol advertising with multidimensional alcohol expectancies in school-aged children. A total of 779 4th (age 10) and 768 6th (age 12) grade students were recruited from 17 public elementary schools in northern Taiwan in 2006, with two waves of follow-up at 6 months apart. Self-administered questionnaires were used to collect information concerning individual characteristics, parental attributes, past-week screen time, drinking behaviors, and alcohol expectancies. Data of aired alcohol advertisements at baseline were obtained from the Nielsen Media Research Advertising Information Services; parenting styles were ascertained from the 1st follow-up. Alcohol Expectancies Questionnaire-Children version was used to measure alcohol expectancies (AEs) at baseline and the 2nd follow-up. Nearly 27% of students reported watching television for more than two hours per day and 58% watching television after 9 p.m. Dimension-related heterogeneity exists in the relationship between TV viewing and alcohol advertising with AEs. With statistical adjustment for covariates, spending more than two hours watching TV per day was associated with increased levels of positive AEs "Promoting Relaxation or Tension Reduction [PRTR]" (β=1.52, 95% CI=0.92, 2.12; p<0.001); the exposure to alcohol advertising was associated with decline in negative AEs "Deteriorated Cognitive and Behavioral Function" (e.g., >8.0 ads: β=-1.06, 95% CI=-1.66, -0.47, p<0.01). Greater screen time is associated with elevated positive expectancies of PRTR and alcohol advertising exposure is linked with lowered negative expectancies in late childhood. School-based anti-underage drinking programs may consider integrating the media literacy curriculum. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Snake Venom L-Amino Acid Oxidases: Trends in Pharmacology and Biochemistry

PubMed Central

Izidoro, Luiz Fernando M.; Sobrinho, Juliana C.; Mendes, Mirian M.; Costa, Tássia R.; Grabner, Amy N.; Rodrigues, Veridiana M.; da Silva, Saulo L.; Zanchi, Fernando B.; Zuliani, Juliana P.; Fernandes, Carla F. C.; Calderon, Leonardo A.; Stábeli, Rodrigo G.; Soares, Andreimar M.

2014-01-01

L-amino acid oxidases are enzymes found in several organisms, including venoms of snakes, where they contribute to the toxicity of ophidian envenomation. Their toxicity is primarily due to enzymatic activity, but other mechanisms have been proposed recently which require further investigation. L-amino acid oxidases exert biological and pharmacological effects, including actions on platelet aggregation and the induction of apoptosis, hemorrhage, and cytotoxicity. These proteins present a high biotechnological potential for the development of antimicrobial, antitumor, and antiprotozoan agents. This review provides an overview of the biochemical properties and pharmacological effects of snake venom L-amino acid oxidases, their structure/activity relationship, and supposed mechanisms of action described so far. PMID:24738050
Cellular and molecular mechanisms of alcohol-induced osteopenia.

PubMed

Luo, Zhenhua; Liu, Yao; Liu, Yitong; Chen, Hui; Shi, Songtao; Liu, Yi

2017-12-01

Alcoholic beverages are widely consumed, resulting in a staggering economic cost in different social and cultural settings. Types of alcohol consumption vary from light occasional to heavy, binge drinking, and chronic alcohol abuse at all ages. In general, heavy alcohol consumption is widely recognized as a major epidemiological risk factor for chronic diseases and is detrimental to many organs and tissues, including bones. Indeed, recent findings demonstrate that alcohol has a dose-dependent toxic effect in promoting imbalanced bone remodeling. This imbalance eventually results in osteopenia, an established risk factor for osteoporosis. Decreased bone mass and strength are major hallmarks of osteopenia, which is predominantly attributed not only to inhibition of bone synthesis but also to increased bone resorption through direct and indirect pathways. In this review, we present knowledge to elucidate the epidemiology, potential pathogenesis, and major molecular mechanisms and cellular effects that underlie alcoholism-induced bone loss in osteopenia. Novel therapeutic targets for correcting alcohol-induced osteopenia are also reviewed, such as modulation of proinflammatory cytokines and Wnt and mTOR signaling and the application of new drugs.
Does early exposure to caffeine promote smoking and alcohol use behavior? A prospective analysis of middle school students.

PubMed

Kristjansson, Alfgeir L; Kogan, Steven M; Mann, Michael J; Smith, Megan L; Juliano, Laura M; Lilly, Christa L; James, Jack E

2018-04-30

Despite the negative consequences associated with caffeine use among children and youth, its use is increasingly widespread among middle school students. Cross-sectional studies reveal links between caffeine and other substance use. The potential for caffeine use to confer increased vulnerability to substance use, however, has not been investigated using prospective designs. We hypothesized that caffeine use at baseline would be positively associated with increased alcohol use, drunkenness, smoking, and e-cigarette use. Prospective cohort study with 12 months separating baseline from follow-up. West Virginia, USA. Middle school students (6 th and 7 th grades; N = 3,932) in three West Virginia (WV) counties provided data at baseline and follow-up 12 months later. Youth self-reported their use of caffeine from multiple sources (e.g., soda, energy drinks, coffee and tea), cigarette smoking, electronic cigarette use, alcohol use, and drunkenness. Cross-lagged path models for individual substance use categories provided good fit to the data. Controlling for demographic variables and other substance use at baseline, caffeine at T1 was positively associated with T2 cigarette smoking (β = .27, p = .001), e-cigarette use (β = .21, p = .001), alcohol use (β = .17, p = .001), and drunkenness (β = .15, p = .001). Conversely, non-significant relations emerged between three of four substances at T1 and caffeine at T2. Positive relations were found between e-cigarette use at T1 and caffeine use at T2 (β = .07, p = .006). These findings were supported by an omnibus model with all substances included. Specifically, significant relations were observed between caffeine at T1 and all substance use outcomes at T2, whereas no significant relations were observed between substance use and caffeine over time. Caffeine may promote early use of other types of substances among middle school-aged adolescents. This article is protected by copyright. All rights reserved.
Lipid diffusion in alcoholic environment.

PubMed

Rifici, Simona; Corsaro, Carmelo; Crupi, Cristina; Nibali, Valeria Conti; Branca, Caterina; D'Angelo, Giovanna; Wanderlingh, Ulderico

2014-08-07

We have studied the effects of a high concentration of butanol and octanol on the phase behavior and on the lateral mobility of 1,2-palmitoyl-sn-glycero-3-phosphocholine (DPPC) by means of differential scanning calorimetry and pulsed-gradient stimulated-echo (PGSTE) NMR spectroscopy. A lowering of the lipid transition from the gel to the liquid-crystalline state for the membrane-alcohol systems has been observed. NMR measurements reveal three distinct diffusions in the DPPC-alcohol systems, characterized by a high, intermediate, and slow diffusivity, ascribed to the water, the alcohol, and the lipid, respectively. The lipid diffusion process is promoted in the liquid phase while it is hindered in the interdigitated phase due to the presence of alcohols. Furthermore, in the interdigitated phase, lipid lateral diffusion coefficients show a slight temperature dependence. To the best of our knowledge, this is the first time that lateral diffusion coefficients on alcohol with so a long chain, and at low temperatures, are reported. By the Arrhenius plots of the temperature dependence of the diffusion coefficients, we have evaluated the apparent activation energy in both the liquid and in the interdigitated phase. The presence of alcohol increases this value in both phases. An explanation in terms of a free volume model that takes into account also for energy factors is proposed.
Self-Reported Youth and Adult Exposure to Alcohol Marketing in Traditional and Digital Media: Results of a Pilot Survey.

PubMed

Jernigan, David H; Padon, Alisa; Ross, Craig; Borzekowski, Dina

2017-03-01

Alcohol marketing is known to be a significant risk factor for underage drinking. However, little is known about youth and adult exposure to alcohol advertising in digital and social media. This study piloted a comparative assessment of youth and adult recall of exposure to online marketing of alcohol. From September to October 2013, a pilot survey of past 30-day exposure to alcohol advertising and promotional content in traditional and digital media was administered to a national sample of 1,192 youth (ages 13 to 20) and 1,124 adults (ages ≥21) using a prerecruited Internet panel maintained by GfK Custom Research. The weighted proportions of youth and adults who reported this exposure were compared by media type and by advertising and promotional content. Youth were more likely than adults to recall exposure to alcohol advertising on television (69.2% vs. 61.9%), radio (24.8% vs. 16.7%), billboards (54.8% vs. 35.4%), and the Internet (29.7% vs. 16.8%), but less likely to recall seeing advertising in magazines (35.7% vs. 36.4%). Youth were also more likely to recall seeing advertisements and pictures on the Internet of celebrities using alcohol (36.1% vs. 20.8%) or wearing clothing promoting alcohol (27.7% vs. 15.9%), and actively respond (i.e., like, share, or post) to alcohol-related content online. Youth report greater exposure to alcohol advertising and promotional content than adults in most media, including on the Internet. These findings emphasize the need to assure compliance with voluntary industry standards on the placement of alcohol advertising and the importance of developing better tools for monitoring youth exposure to alcohol marketing, particularly on the Internet. Copyright © 2017 by the Research Society on Alcoholism.
A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of
Ingesting alcohol prior to food can alter the activity of the hypothalamic-pituitary-adrenal axis.

PubMed

Kokavec, Anna; Lindner, Amy J; Ryan, Jaymee E; Crowe, Simon F

2009-08-01

There is an increasing evidence that long-term alcohol intake can promote damage to most of the body's major organs. However, regular consumption of a small-moderate amount of alcohol is often recommended as being beneficial to health and of concern is that the effect of ingesting commercially available alcohol products on steroid hormone synthesis under variable nutritional conditions has not been thoroughly investigated. Many individuals consume alcohol alone prior to a meal and the aim of the present study was to assess the effect of consuming a small-moderate amount of commercially available alcohol on the level of salivary cortisol and salivary dehydroepiandrosterone sulfate (DHEAS) before and after a meal. A total of 24 males aged 19-22 years participated in the current investigation. The experimental procedure required participants to fast for 6 h before being asked to ingest either 40 g alcohol in the form of red wine (n=8), low alcohol and high beer (n=8), white wine (n=8) or the equivalent amount of placebo over a 135-min period before consuming food for 45-min. The level of blood alcohol, salivary cortisol and salivary DHEAS was assessed upon arrival and then at regular 45-min intervals during the 180-min experimental period. The results showed that the consumption of alcohol and placebo can significantly lower the level of salivary cortisol. However, the effect of consuming a small-moderate amount of commercially available alcohol on the level of salivary DHEAS was dependent on the nutritional content of the beverage with red wine promoting no change, white wine promoting a significant decrease, and beer having a variable effect on salivary DHEAS concentration when compared to placebo. It was concluded that the effect of commercially available alcohol on the HPA axis is not the same for all alcohol products and both the nutritional status of participants and the nutritional content of the alcoholic beverage being administered should be taken into
Proposed structural basis of interaction of piperine and related compounds with monoamine oxidases.

PubMed

Rahman, Taufiq; Rahmatullah, Mohammed

2010-01-15

Several studies have revealed piperine and a few related compounds as potent inhibitors of monoamine oxidases without delineating the underlying mechanism. Using in silico modelling, we propose a structural basis of such activity by showing that these compounds can successfully dock into the inhibitor binding pockets of human monoamine oxidase isoforms with predicted affinities comparable to some known inhibitors. The results therefore suggest that piperine can be a promising lead for developing novel monoamine oxidase inhibitors. Copyright 2009 Elsevier Ltd. All rights reserved.
Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.

PubMed

Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L

2012-08-01

Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (P<0.05) protein expression of NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) , 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P<0.05) the abnormalities in protein expressions of p47(phox) , gp91(phox) (but not p67(phox) ) and 4-HNE, but only slightly (P>0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in

Targeting NADPH Oxidase Decreases Oxidative Stress in the Transgenic Sickle Cell Mouse Penis

PubMed Central

Musicki, Biljana; Liu, Tongyun; Sezen, Sena F.; Burnett, Arthur L.

2012-01-01

Introduction Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. Aims We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. Methods SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67phox, p47phox, and gp91phox), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Main Outcome Measures Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Results Relative to hemi mice, SCD increased (P < 0.05) protein expression of NADPH oxidase subunits p67phox, p47phox, and gp91phox, 4-HNE-modified proteins, induced eNOS uncoupling, and reduced Gpx1 expression in the penis. Apocynin treatment of sickle mice reversed (P < 0.05) the abnormalities in protein expressions of p47phox, gp91phox (but not p67phox) and 4-HNE, but only slightly (P > 0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. Conclusion NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a
Direct conversion of alcohols to α-chloro aldehydes and α-chloro ketones.

PubMed

Jing, Yuanyuan; Daniliuc, Constantin G; Studer, Armido

2014-09-19

Direct conversion of primary and secondary alcohols into the corresponding α-chloro aldehydes and α-chloro ketones using trichloroisocyanuric acid, serving both as stoichiometric oxidant and α-halogenating reagent, is reported. For primary alcohols, TEMPO has to be added as an oxidation catalyst, and for the transformation of secondary alcohols (TEMPO-free protocol), MeOH as an additive is essential to promote chlorination of the intermediary ketones.
Electron spin resonance characterization of vascular xanthine and NAD(P)H oxidase activity in patients with coronary artery disease: relation to endothelium-dependent vasodilation.

PubMed

Spiekermann, Stephan; Landmesser, Ulf; Dikalov, Sergey; Bredt, Martin; Gamez, Graciela; Tatge, Helma; Reepschläger, Nina; Hornig, Burkhard; Drexler, Helmut; Harrison, David G

2003-03-18

Increased inactivation of nitric oxide by superoxide (O2*-) contributes to endothelial dysfunction in patients with coronary disease (CAD). We therefore characterized the vascular activities of xanthine oxidase and NAD(P)H oxidase, 2 major O2*--producing enzyme systems, and their relationship with flow-dependent, endothelium-mediated vasodilation (FDD) in patients with CAD. Xanthine- and NAD(P)H-mediated O*.- formation was determined in coronary arteries from 10 patients with CAD and 10 controls by using electron spin resonance spectroscopy. Furthermore, activity of endothelium-bound xanthine oxidase in vivo and FDD of the radial artery were determined in 21 patients with CAD and 10 controls. FDD was measured before and after infusion of the antioxidant vitamin C (25 mg/min i.a.) to determine the portion of FDD inhibited by radicals. In coronary arteries from patients with CAD, xanthine- and NAD(P)H-mediated O2*- formation was increased compared with controls (xanthine: 12+/-2 versus 7+/-1 nmol O2*-/ microg protein; NADH: 11+/-1 versus 7+/-1 nmol O2*-/ microg protein; and NADPH: 12+/-2 versus 9+/-1 nmol O2*-/ microg protein; each P<0.05). Endothelium-bound xanthine oxidase activity was increased by >200% in patients with CAD (25+/-4 versus 9+/-1 nmol O2*-/ microL plasma per min; P<0.05) and correlated inversely with FDD (r=-0.55; P<0.05) and positively with the effect of vitamin C on FDD (r=0.54; P<0.05). The present study represents the first electron spin resonance measurements of xanthine and NAD(P)H oxidase activity in human coronary arteries and supports the concept that increased activities of both enzymes contribute to increased vascular oxidant stress in patients with CAD. Furthermore, the present study suggests that increased xanthine oxidase activity contributes to endothelial dysfunction in patients with CAD and may thereby promote the atherosclerotic process.
Epigenetic mechanisms of alcoholism and stress-related disorders.

PubMed

Palmisano, Martina; Pandey, Subhash C

2017-05-01

Stress-related disorders, such as anxiety, early life stress, and posttraumatic stress disorder appear to be important factors in promoting alcoholism, as alcohol consumption can temporarily attenuate the negative affective symptoms of these disorders. Several molecules involved in signaling pathways may contribute to the neuroadaptation induced during alcohol dependence and stress disorders, and among these, brain-derived neurotrophic factor (BDNF), corticotropin releasing factor (CRF), neuropeptide Y (NPY) and opioid peptides (i.e., nociceptin and dynorphin) are involved in the interaction of stress and alcohol. In fact, alterations in the expression and function of these molecules have been associated with the pathophysiology of stress-related disorders and alcoholism. In recent years, various studies have focused on the epigenetic mechanisms that regulate chromatin architecture, thereby modifying gene expression. Interestingly, epigenetic modifications in specific brain regions have been shown to be associated with the neurobiology of psychiatric disorders, including alcoholism and stress. In particular, the enzymes responsible for chromatin remodeling (i.e., histone deacetylases and methyltransferases, DNA methyltransferases) have been identified as common molecular mechanisms for the interaction of stress and alcohol and have become promising therapeutic targets to treat or prevent alcoholism and associated emotional disorders. Published by Elsevier Inc.
EPIGENETIC MECHANISMS OF ALCOHOLISM AND STRESS-RELATED DISORDERS

PubMed Central

Palmisano, Martina; Pandey, Subhash C.

2017-01-01

Stress-related disorders, such as anxiety, early life stress and posttraumatic stress disorder appear to be important factors in promoting alcoholism, as alcohol consumption can temporarily attenuate the negative affective symptoms of these disorders. Several molecules involved in signaling pathways may contribute to the neuroadaptation induced during alcohol dependence and stress disorders, and among these, brain-derived neurotrophic factor (BDNF), corticotropin releasing factor (CRF), neuropeptide Y (NPY) and opioid peptides (i.e. nociceptin and dynorphin) are involved in the interaction of stress and alcohol. In fact, alterations in the expression and function of these molecules have been associated with the pathophysiology of stress-related disorders and alcoholism. In recent years, various studies have focused on the epigenetic mechanisms that regulate chromatin architecture thereby modifying gene expression. Interestingly, epigenetic modifications in specific brain regions have been shown to be associated with the neurobiology of psychiatric disorders, including alcoholism and stress. In particular, the enzymes responsible for chromatin remodeling (i.e. histone deacetylases and methyltransferases, DNA methyltransferases) have been identified as common molecular mechanisms for the interaction of stress and alcohol and have become promising therapeutic targets to treat or prevent alcoholism and associated emotional disorders. PMID:28477725
Multi-Copper Oxidases and Human Iron Metabolism

PubMed Central

Vashchenko, Ganna; MacGillivray, Ross T. A.

2013-01-01

Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651
The hemibiotrophic cacao pathogen Moniliophthora perniciosa depends on a mitochondrial alternative oxidase for biotrophic development

PubMed Central

Thomazella, Daniela P T; Teixeira, Paulo José P L; Oliveira, Halley C; Saviani, Elzira E; Rincones, Johana; Toni, Isabella M; Reis, Osvaldo; Garcia, Odalys; Meinhardt, Lyndel W; Salgado, Ione; Pereira, Gonçalo A G

2012-01-01

The tropical pathogen Moniliophthora perniciosa causes witches’ broom disease in cacao. As a hemibiotrophic fungus, it initially colonizes the living host tissues (biotrophic phase), and later grows over the dead plant (necrotrophic phase). Little is known about the mechanisms that promote these distinct fungal phases or mediate the transition between them. An alternative oxidase gene (Mp-aox) was identified in the M. perniciosa genome and its expression was analyzed througout the fungal life cycle. In addition, the effects of inhibitors of the cytochrome-dependent respiratory chain (CRC) and alternative oxidase (AOX) were evaluated on the in vitro development of M. perniciosa. Larger numbers of Mp-aox transcripts were observed in the biotrophic hyphae, which accordingly showed elevated sensitivity to AOX inhibitors. More importantly, the inhibition of CRC prevented the transition from the biotrophic to the necrotrophic phase, and the combined use of a CRC and AOX inhibitor completely halted fungal growth. On the basis of these results, a novel mechanism is presented in which AOX plays a role in the biotrophic development of M. perniciosa and regulates the transition to its necrotrophic stage. Strikingly, this model correlates well with the infection strategy of animal pathogens, particularly Trypanosoma brucei, which uses AOX as a strategy for pathogenicity. PMID:22443281
Alcohol and Airways Function in Health and Disease

PubMed Central

Sisson, Joseph H.

2007-01-01

The volatility of alcohol promotes the movement of alcohol from the bronchial circulation across the airway epithelium and into the conducting airways of the lung. The exposure of the airways through this route likely accounts for many of the biologic effects of alcohol on lung airway functions. The impact of alcohol on lung airway functions is dependent on the concentration, duration and route of exposure. Brief exposure to mild concentrations of alcohol may enhance mucociliary clearance, stimulates bronchodilation and probably attenuates the airway inflammation and injury observed in asthma and COPD. Prolonged and heavy exposure to alcohol impairs mucociliary clearance, may complicate asthma management and likely worsens outcomes including lung function and mortality in COPD patients. Non-alcohol congeners and alcohol metabolites act as triggers for airway disease exacerbations especially in atopic asthmatics and in Asian populations who have a reduced capacity to metabolize alcohol. Research focused on the mechanisms of alcohol-mediated changes in airway functions has identified specific mechanisms that mediate alcohol effects within the lung airways. These include prominent roles for the second messengers calcium and nitric oxide, regulatory kinases including PKG and PKA, alcohol and acetaldehyde-metabolizing enzymes such as aldehyde dehydrogenase type 2 (ALDH2). The role alcohol may play in the pathobiology of airway mucus, bronchial blood flow, airway smooth muscle regulation and the interaction with other airway exposure agents, such as cigarette smoke, represent opportunities for future investigation. PMID:17764883
Peer, social media, and alcohol marketing influences on college student drinking.

PubMed

Roberson, Angela A; McKinney, Cliff; Walker, Courtney; Coleman, Ashley

2018-07-01

To investigate how alcohol marketing and peers may promote college students' alcohol use through social media. College students (N = 682) aged 18 to 22 years from a large Southern university completed paper surveys in April 2014. Structural equation modeling was used to investigate relationships among variables as well as moderation by gender and race. Drinking behavior was directly related to perceived norms and attitudes toward alcohol that develop, in part, from direct and indirect interactions with their online and offline peers, as well as engagement with alcohol-related content on social media. Gender and ethnicity moderated some effects. College student drinking is influenced by friends' alcohol-related content posted on social networking sites and by greater engagement with traditional and online alcohol marketing. College campus alcohol misuse interventions should include components to counter peer influences and alcohol marketing on social media.
Living under the influence: normalisation of alcohol consumption in our cities.

PubMed

Sureda, Xisca; Villalbí, Joan R; Espelt, Albert; Franco, Manuel

Harmful use of alcohol is one of the world's leading health risks. A positive association between certain characteristics of the urban environment and individual alcohol consumption has been documented in previous research. When developing a tool characterising the urban environment of alcohol in the cities of Barcelona and Madrid we observed that alcohol is ever present in our cities. Urban residents are constantly exposed to a wide variety of alcohol products, marketing and promotion and signs of alcohol consumption. In this field note, we reflect the normalisation of alcohol in urban environments. We highlight the need for further research to better understand attitudes and practices in relation to alcohol consumption. This type of urban studies is necessary to support policy interventions to prevent and control harmful alcohol use. Copyright © 2016 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.
Function of the Pyruvate Oxidase-Lactate Oxidase Cascade in Interspecies Competition between Streptococcus oligofermentans and Streptococcus mutans

PubMed Central

Liu, Lei

2012-01-01

Complex interspecies interactions occur constantly between oral commensals and the opportunistic pathogen Streptococcus mutans in dental plaque. Previously, we showed that oral commensal Streptococcus oligofermentans possesses multiple enzymes for H2O2 production, especially lactate oxidase (Lox), allowing it to out-compete S. mutans. In this study, through extensive biochemical and genetic studies, we identified a pyruvate oxidase (pox) gene in S. oligofermentans. A pox deletion mutant completely lost Pox activity, while ectopically expressed pox restored activity. Pox was determined to produce most of the H2O2 in the earlier growth phase and log phase, while Lox mainly contributed to H2O2 production in stationary phase. Both pox and lox were expressed throughout the growth phase, while expression of the lox gene increased by about 2.5-fold when cells entered stationary phase. Since lactate accumulation occurred to a large degree in stationary phase, the differential Pox- and Lox-generated H2O2 can be attributed to differential gene expression and substrate availability. Interestingly, inactivation of pox causes a dramatic reduction in H2O2 production from lactate, suggesting a synergistic action of the two oxidases in converting lactate into H2O2. In an in vitro two-species biofilm experiment, the pox mutant of S. oligofermentans failed to inhibit S. mutans even though lox was active. In summary, S. oligofermentans develops a Pox-Lox synergy strategy to maximize its H2O2 formation so as to win the interspecies competition. PMID:22287002
Peer, Social Media, and Alcohol Marketing Influences on College Student Drinking

ERIC Educational Resources Information Center

Roberson, Angela A.; McKinney, Cliff; Walker, Courtney; Coleman, Ashley

2018-01-01

Objective: To investigate how alcohol marketing and peers may promote college students' alcohol use through social media. Participants: College students (N = 682) aged 18 to 22 years from a large Southern university completed paper surveys in April 2014. Methods: Structural equation modeling was used to investigate relationships among variables as…
Alcoholism and Alcohol Abuse

MedlinePlus

... their drinking causes distress and harm. It includes alcoholism and alcohol abuse. Alcoholism, or alcohol dependence, is a disease that causes ... the liver, brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the ...
Alcohol Enhances HIV Infection of Cord Blood Monocyte-Derived Macrophages

PubMed Central

Mastrogiannis, Dimitrios S.; Wang, Xu; Dai, Min; Li, Jieliang; Wang, Yizhong; Zhou, Yu; Sakarcan, Selin; Peña, Juliet Crystal; Ho, Wenzhe

2014-01-01

Alcohol consumption or alcohol abuse is common among pregnant HIV+ women and has been identified as a potential behavioral risk factor for the transmission of HIV. In this study, we examined the impact of alcohol on HIV infection of cord blood monocyte-derived macrophages (CBMDM). We demonstrated that alcohol treatment of CBMDM significantly enhanced HIV infection of CBMDM. Investigation of the mechanisms of alcohol action on HIV demonstrated that alcohol inhibited the expression of several HIV restriction factors, including anti-HIV microRNAs, APOBEC3G and APOBEC3H. Additionally, alcohol also suppressed the expression of IFN regulatory factor 7 (IRF-7) and retinoic acid-inducible gene I (RIG-I), an intracellular sensor of viral infection. The suppression of these IFN regulatory factors was associated with reduced expression of type I IFN. These experimental findings suggest that maternal alcohol consumption may facilitate HIV infection, promoting vertical transmission of HIV. PMID:25053361
Nature of events and alcohol-related content in marketing materials at a university freshers' fair: a summative content analysis.

PubMed

Fuller, A; Fleming, K M; Szatkowski, L; Bains, M

2017-12-15

The transition to university is a potentially influential time upon students' drinking behaviour. This study explored the nature of activities and alcohol-related content in marketing materials from student-led societies and local businesses provided to students, at a university freshers' fair in the UK. All marketing materials handed out at the fair were collected across the 5-day event in September 2015. Written and visual content was analysed using a summative qualitative content analysis. Most student-led societies promoted social events they were hosting (n = 530), most of which took place in a drinking venue or referred to drinking (n = 335). Only four explicitly alcohol-free events were promoted. Student-led societies also promoted activities relating to their interest, e.g. sports training (n = 519), a small proportion of which had references to drinking and drinking venues (n = 54). Three societies provided promotional handouts from local bars or nightclubs. Local bars, pubs and nightclubs promoted events they hosted (n = 81) as well as alcoholic drink promotions (n = 79) and alcohol branded advertising (n = 22), albeit infrequently for the latter. In the first week of university, students are exposed to alcohol-related events, promotions and advertising, which may act as an incentive to participate in drinking. © The Author(s) 2017. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Size-selective QD@MOF core-shell nanocomposites for the highly sensitive monitoring of oxidase activities.

PubMed

Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan

2017-01-15

In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright Â© 2016 Elsevier B.V. All rights reserved.
Behavior change techniques in popular alcohol reduction apps: content analysis.

PubMed

Crane, David; Garnett, Claire; Brown, James; West, Robert; Michie, Susan

2015-05-14

.4% of apps, and theory was not mentioned by any app. Multivariable regression showed that apps including advice on environmental restructuring were associated with lower user ratings (Β=-46.61, P=.04, 95% CI -91.77 to -1.45) and that both the techniques of "advise on/facilitate the use of social support" (Β=2549.21, P=.04, 95% CI 96.75-5001.67) and the mention of evidence (Β=1376.74, P=.02, 95%, CI 208.62-2544.86) were associated with the popularity of the app. Only a minority of alcohol-related apps promoted health while the majority implicitly or explicitly promoted the use of alcohol. Alcohol-related apps that promoted health contained few BCTs and none referred to theory. The mention of evidence was associated with more popular apps, but popularity and user ratings were only weakly associated with the BCT content.
Identifying Risk and Promoting Resilience in Infants and Toddlers with Fetal Alcohol Spectrum Disorders

ERIC Educational Resources Information Center

Shah, Prachi; Milgrom, Tedi; Munzer, Tiffany; Hoyme, H. Eugene

2015-01-01

Fetal alcohol spectrum disorders (FASDs) is an umbrella term that describes a variety of conditions characterized by a pattern of atypical facial features, growth restriction, structural physical abnormalities, and brain dysfunction resulting from prenatal alcohol exposure. Studies suggest that the prevalence of FASDs ranges between 2-5% (of the…
Development and evaluation of the OHCITIES instrument: assessing alcohol urban environments in the Heart Healthy Hoods project.

PubMed

Sureda, Xisca; Espelt, Albert; Villalbí, Joan R; Cebrecos, Alba; Baranda, Lucía; Pearce, Jamie; Franco, Manuel

2017-10-05

To describe the development and test-retest reliability of OHCITIES, an instrument characterising alcohol urban environment in terms of availability, promotion and signs of consumption. This study involved: (1) developing the conceptual framework for alcohol urban environment by means of literature reviewing and previous alcohol environment research experience; (2) pilot testing and redesigning the instrument; (3) instrument digitalisation; (4) instrument evaluation using test-retest reliability. Data for testing the reliability of the instrument were collected in seven census sections in Madrid in 2016 by two observers. We computed per cent agreement and Cohen's kappa coefficients to estimate inter-rater and test-retest reliability for alcohol outlet environment measures. We calculated interclass coefficients and their 95% CIs to provide a measure of inter-rater reliability for signs of alcohol consumption measures. We collected information on 92 on-premise and 24 off-premise alcohol outlets identified in the studied areas about availability, accessibility and promotion of alcohol. Most per cent-agreement values for alcohol measures in on-premise and off-premise alcohol outlets were greater than 80%, and inter-rater and test-retest reliability values were generally above 0.80. Observers identified 26 streets and 3 public squares with signs of alcohol consumption. Intraclass correlation coefficient between observers for any type of signs of alcohol consumption was 0.50 (95% CI -0.09 to 0.77). Few items promoting alcohol unrelated to alcohol outlets were found on public spaces. The OHCITIES instrument is a reliable instrument to characterise alcohol urban environment. This instrument might be used to understand how alcohol environment associates with alcohol behaviours and its related health outcomes, and can help in the design and evaluation of policies to reduce the harm caused by alcohol. © Article author(s) (or their employer(s) unless otherwise stated in the
Superoxide from NADPH oxidase upregulates type 5 phosphodiesterase in human vascular smooth muscle cells: inhibition with iloprost and NONOate

PubMed Central

Muzaffar, S; Shukla, N; Bond, M; Sala-Newby, G B; Newby, A C; Angelini, G D; Jeremy, J Y

2008-01-01

Background and purpose: To determine whether there is an association between vascular NADPH oxidase (NOX), superoxide, the small GTPase Rac1 and PDE type 5 (PDE5) in human vascular smooth muscle cell (hVSMCs). Experimental approach: hVSMCs were incubated with xanthine–xanthine oxidase (X-XO; a superoxide generating system) or the thromboxane A2 analogue, U46619 (±superoxide dismutase (SOD) or apocynin) for 16 h. The expression of PDE5 and NOX-1 was assessed using Western blotting and superoxide measured. The role of Rac1 in superoxide generation was assessed by overexpressing either the dominant-negative or constitutively active Rac isoforms. The effects of iloprost, DETA-NONOate and the Rho-kinase inhibitor, Y27632, on PDE5 and NOX-1 expression were also studied. Key results: Following 16 h incubation, U46619 and X-XO promoted the expression of PDE5 and NOX-1, an effect blocked by SOD or apocynin when co-incubated over the same time course. X-XO and U46619 both promoted the formation of superoxide. Overexpression of dominant-negative Rac1 or addition of iloprost, DETA-NONOate or Y27632 completely blocked both superoxide release and PDE5 protein expression and activity. Conclusions and implications: These data demonstrate that superoxide derived from NOX upregulates the expression of PDE5 in human VSMCs. As PDE5 hydrolyses cyclic GMP, this effect may blunt the vasculoprotective actions of NO. PMID:18660830

Some links on this page may take you to non-federal websites. Their policies may differ from this site.