Canham, L J W; Manara, A; Fawcett, J; Rolinski, M; Mortimer, A; Inglis, K E A; Cottrell, D A
2018-05-18
We report the case of a patient who died from the rare complication of Listeriosis in the immediate phase following alemtuzumab administration one month after discontinuing dimethyl fumarate (DMF). There is considerable overlap with typical post-infusion symptoms therefore high surveillance and low threshold for empirical or possible prophylactic antibiotic therapy is advocated. Copyright © 2018. Published by Elsevier B.V.
Serebruany, Victor L; Pokov, Alex N; Aradi, Daniel; Can, Mehmet; DiNicolantonio, James; Kipshidze, Nodar; Atar, Dan
2014-01-01
Valsartan is known to inhibit platelet activity in both in vitro and ex vivo clinical setting, whereas aliskiren in vitro modulates antithrombin-III in plasma. The authors tested how aliskiren and valsartan combination versus aliskiren monotherapy will affect hemostatic biomarkers in mild-to-moderate hypertensive diabetics in the frame of the Aliskiren and Valsartan Impact in Diabetics (AVID) trial. A total of 52 patients with type 2 diabetes and mild-to-moderate hypertension were equally randomized to aliskiren (150-300 mg/d) and valsartan (160 mg/d) versus aliskiren (150-300 mg/d) alone for 4 weeks. A total of 25 biomarkers were serially measured, of which 16 are related to platelet function, 6 to coagulation, and 3 to fibrinolysis. Aliskiren monotherapy has no significant impact on any of the assessed biomarkers. In contrast, valsartan on top of aliskiren provided significant inhibition of ADP-induced platelet aggregation (P=0.032), decreased shear-induced activation measured with PFA-100 analyzer (P=0.041), and diminished expression of GP IIb/IIIa activity (P=0.027) measured by PAC-1 antibody, GP Ib (CD42b, P=0.033), vitronectin receptor (CD51/61, P=0.046), P-selectin (CD62p, P=0.026), lysosome-associated membrane protein (CD107a, P=0.042), and CD40-ligand (CD154, P=0.048). In AVID trial, valsartan in combination with aliskiren mildly but significantly inhibited platelets, confirming previous observations. In contrast, aliskiren monotherapy does not enhance antithrombin activity, suggesting that previous data probably represent a laboratory artifact. Importantly, these randomized data were generated on top of low-dose daily aspirin, supporting extra benefit for combination use of angiotensin receptor blockers and renin inhibitors in high-risk diabetic population.
Alemtuzumab (Millennium/ILEX).
Dumont, F J
2001-01-01
Alemtuzumab, a lymphocyte-depleting humanized monoclonal antibody, is being developed by Millennium Pharmaceuticals Inc and ILEX Oncology for the potential treatment of chronic lymphocytic leukemia (CLL) [274580]. The utility of the compound for treating bone marrow (BM) stem cell transplantation-associated graft-versus-host disease (GVHD) [372946] and for ex vivo purging of BM to remove malignant T-cells [244056] is also being investigated. Additional potential therapeutic areas for which clinical trials are planned or ongoing include vasculitis, multiple sclerosis [288762] and organ transplantation [338304]. A Biologics License Application (BLA) was filed with the FDA in December 1999 by ILEX and Millennium [351523], [351524], [373873]. The FDA accepted the application for filing in February 2000 [355775] and returned a complete response letter in June 2000 [372172]. Millennium and ILEX submitted a response to the FDA in August 2000 [379766]. Alemtuzumab has received Fast Track designation [304771] and orphan drug status from the FDA [288762], and the drug was reviewed by the FDA's Oncologic Drugs Advisory Committee on 14 December, 2000 [387228]. The committee voted 14 to 1 to recommend accelerated approval of alemtuzumab for patients with CLL who have been treated with alkylating agents and who have failed fludarabine therapy [393778], [393894]. In March 2000, Millennium and ILEX also submitted a Marketing Authorization Application (MAA) for alemtuzumab to the European Agency for the Evaluation of Medicinal Products (EMEA) [363595]. In October 2000, EMEA accepted the MAA for alemtuzumab under the agency's centralized approval procedure [387228]. Alemtuzumab was originally synthesized by Herman Waldmann and colleagues at Cambridge University and licensed to Burroughs Wellcome (BW) via the British Technology Group (BTG) [162622]. BW conducted phase I and II trials for a broad range of indications, but then discontinued development because of disappointing results
Aliskiren, Enalapril, or Aliskiren and Enalapril in Heart Failure.
McMurray, John J V; Krum, Henry; Abraham, William T; Dickstein, Kenneth; Køber, Lars V; Desai, Akshay S; Solomon, Scott D; Greenlaw, Nicola; Ali, M Atif; Chiang, Yanntong; Shao, Qing; Tarnesby, Georgia; Massie, Barry M
2016-04-21
Among patients with chronic heart failure, angiotensin-converting-enzyme (ACE) inhibitors reduce mortality and hospitalization, but the role of a renin inhibitor in such patients is unknown. We compared the ACE inhibitor enalapril with the renin inhibitor aliskiren (to test superiority or at least noninferiority) and with the combination of the two treatments (to test superiority) in patients with heart failure and a reduced ejection fraction. After a single-blind run-in period, we assigned patients, in a double-blind fashion, to one of three groups: 2336 patients were assigned to receive enalapril at a dose of 5 or 10 mg twice daily, 2340 to receive aliskiren at a dose of 300 mg once daily, and 2340 to receive both treatments (combination therapy). The primary composite outcome was death from cardiovascular causes or hospitalization for heart failure. After a median follow-up of 36.6 months, the primary outcome occurred in 770 patients (32.9%) in the combination-therapy group and in 808 (34.6%) in the enalapril group (hazard ratio, 0.93; 95% confidence interval [CI], 0.85 to 1.03). The primary outcome occurred in 791 patients (33.8%) in the aliskiren group (hazard ratio vs. enalapril, 0.99; 95% CI, 0.90 to 1.10); the prespecified test for noninferiority was not met. There was a higher risk of hypotensive symptoms in the combination-therapy group than in the enalapril group (13.8% vs. 11.0%, P=0.005), as well as higher risks of an elevated serum creatinine level (4.1% vs. 2.7%, P=0.009) and an elevated potassium level (17.1% vs. 12.5%, P<0.001). In patients with chronic heart failure, the addition of aliskiren to enalapril led to more adverse events without an increase in benefit. Noninferiority was not shown for aliskiren as compared with enalapril. (Funded by Novartis; ATMOSPHERE ClinicalTrials.gov number, NCT00853658.).
Reversibility of the Effects of Aliskiren in the Renal Versus Systemic Circulation
Schneider, Markus P.; Janka, Rolf; Ziegler, Thomas; Raff, Ulrike; Ritt, Martin; Ott, Christian; Veelken, Roland; Uder, Michael; Schmieder, Roland E.
2012-01-01
Summary Background and objectives Renal hemodynamic effects of inhibitors of the renin-angiotensin system can increase the risk of acute kidney injury under certain conditions. The BP-lowering effects of the renin inhibitor aliskiren are sustained 3–4 weeks after withdrawal. In this study, the reversibility of the renal hemodynamic effects of aliskiren was tested. Design, setting, participants, & measurements In this open-label study, renal perfusion was measured by 1.5-T magnetic resonance imaging–arterial spin labeling in 34 subjects with arterial hypertension before aliskiren (pre-aliskiren), after 4 weeks of aliskiren treatment (300 mg), and 4–5 days (∼2.5–3.0× plasma half-life) after withdrawal (post-aliskiren). Results Aliskiren reduced systolic BP from 152 ± 14 to 139 ± 16 mmHg (P<0.0001), which was sustained post-aliskiren (136 ± 13 mmHg, P=1.00 versus aliskiren). Aliskiren significantly altered renal perfusion (P=0.005), increasing from 272 ± 25 pre-aliskiren to 287 ± 29 ml/min per 100 g during aliskiren (P=0.03). This increase in renal perfusion was completely reversed post-aliskiren (272 ± 26 ml/min per 100 g, P=0.03 versus aliskiren, P=0.63 versus pre-aliskiren). No changes were noted in urinary angiotensinogen levels. Plasma renin activity was reduced by aliskiren, which was sustained post-aliskiren. Angiotensin II and aldosterone were reduced by aliskiren but recovered post-aliskiren to pre-aliskiren levels. Conclusions After withdrawal of aliskiren, the effects on BP were sustained, whereas increase in renal perfusion was reversed, which was associated with recovery of angiotensin II and aldosterone to pretreatment levels. Renal hemodynamic effects are more readily reversible than systemic effects of aliskiren. PMID:22173856
Havrdova, Eva; Cohen, Jeffrey A; Horakova, Dana; Kovarova, Ivana; Meluzinova, Eva
2017-01-01
The introduction of high-efficacy therapies for relapsing-remitting multiple sclerosis has driven re-evaluation of treatment goals and benefit:risk considerations in treatment choice. In the alemtuzumab Phase II and III clinical trials, patients treated with alemtuzumab 12 mg versus subcutaneous interferon beta-1a demonstrated significantly reduced annualized relapse rates and improved magnetic resonance imaging outcomes, and were significantly more likely to achieve no evidence of disease activity and reduction in brain volume loss. In two of the studies, alemtuzumab-treated patients had a significantly reduced risk of 6-month confirmed disease worsening, compared with subcutaneous interferon beta-1a. Benefits were maintained throughout 5 years, with a majority of patients receiving no alemtuzumab retreatment or other disease-modifying therapy. Trial results support alemtuzumab's manageable, consistent safety profile in relapsing-remitting multiple sclerosis. Infusion-associated reactions, the most frequent adverse events (AEs), can be minimized by corticosteroid pretreatment, monitoring, and symptomatic management. Other AEs include infections and autoimmune events. Oral anti-herpes prophylaxis should be initiated on the first day of each alemtuzumab treatment course and continued according to local guidelines. Overall cancer risk was lower in the alemtuzumab clinical trials than in a reference population; however, continuing surveillance will determine if alemtuzumab may be associated with certain malignancies such as thyroid papillary carcinoma and melanoma, which are currently identified as potential risks. The post-approval risk management strategy includes a safety monitoring program. Autoimmune AEs (thyroid events, immune thrombocytopenia, nephropathies) can be detected in a timely manner with the monitoring program, which includes physician and patient education about the signs and symptoms, monthly renal and hematologic monitoring, and quarterly thyroid
Use of aliskiren in Latin America in a real-world setting: aliskiren in Latin America Study (ALAS).
Volman, Sergio; Benitez, Fernando Nicolas; Cedenio, Harold; Giorgi, Mariano; Jaramillo, Nicolas; Molina, Nelys; Zilberman, Judith
2013-08-01
Hypertension (HTN) is one of the major risk factors for cardiovascular disease in Western countries, and disease control is of major relevance in order to reduce cardiovascular morbidity and mortality. Different approaches have shown efficacy, and one of the proven therapies for HTN control is the blockade of the renin-angiotensin-aldosterone system, which may be accomplished by means of various drugs with different modes of action. Aliskiren is a novel direct renin inhibitor that reduces both angiotensin I and II blood levels. Different randomized clinical trials (phase II and III) have shown its safety and efficacy either alone or in combination with hydrochlorothiazide. However, although aliskiren has been on the market for some years, reports on the post-marketing experience with aliskiren in the real-world setting are lacking. The Aliskiren in Latin America Study (ALAS) was designed with the aim of describing the effectiveness of aliskiren at reducing blood pressure (BP) values by prospectively assessing BP control in outpatient clinics in different countries in Latin America. A total of 435 sites in 5 Latin American countries (Mexico, Ecuador, Colombia, Argentina, and Venezuela) enrolled 4588 patients who had just been initiated on aliskiren (either alone or in combination with hydrochlorothiazide) based on their treating physicians' discretion, and they were followed for a 6-month period. Prior antihypertensive drugs could be continued if their doses were not modified along the study. At the end of the follow-up period, a statistically significant reduction in BP values was observed, with a mean systolic BP reduction of 29.2 mmHg and a mean diastolic BP reduction of 13.78 mmHg from baseline at the 6-month visit. The BP reduction levels and the low adverse event rate demonstrate the adequate efficacy and safety profile of aliskiren (alone or with hydrochlorothiazide).
Aliskiren and losartan trial in non-diabetic chronic kidney disease.
Woo, Keng-Thye; Choong, Hui-Lin; Wong, Kok-Seng; Tan, Han-Kim; Foo, Marjorie; Fook-Chong, Stephanie; Lee, Evan J C; Anantharaman, Vathsala; Lee, Grace S L; Chan, Choong-Meng
2014-12-01
This is a report of a clinical trial on the therapeutic efficacy and safety of combined aliskiren and losartan (an angiotensin II receptor blocker (ARB)) versus aliskiren alone and ARB alone in non-diabetic chronic kidney disease (CKD) over a 3-year period. This was a randomised trial in 155 patients with non-diabetic CKD comparing aliskiren (150 mg/day) (n=52) versus losartan (100 mg/day) (n=52) and the third group aliskiren (150 mg/day) combined with losartan (100 mg/day) (n=51). The trial utilised primary renal end points of eGFR <15 ml/min or end-stage renal failure. All three groups had significant reduction of proteinuria (p<0.001 for all). The changes in eGFR, total urinary protein from baseline to each year were not significantly different between the three therapeutic groups. This study in non-diabetic CKD patients showed that combination therapy with aliskiren and ARB was as efficacious as aliskiren alone and ARB alone. There was one patient who developed a non-fatal stroke in the combined aliskiren and ARB group while the other two groups had none. © The Author(s) 2014.
Aliskiren targets multiple systems to alleviate cancer cachexia.
Wang, Chaoyi; Guo, Dunwei; Wang, Qiang; You, Song; Qiao, Zhongpeng; Liu, Yong; Dai, Hang; Tang, Hua
2016-11-01
To examine the effects of aliskiren, a small-molecule renin inhibitor, on cancer cachexia and to explore the underlying mechanisms. A cancer cachexia model was established by subcutaneously injecting C26 mouse colon carcinoma cells into isogenic BALB/c mice. Aliskiren was administered intragastrically [10 mg/kg body weight (BW)] on day 5 (as a preventive strategy, AP group) or on day 12 (as a therapeutic strategy, AT group) after C26 injection. Mice that received no C26 injection (healthy controls, HC group) or only C26 injection but not aliskiren (cancer, CA group) were used as controls. BW, tumor growth, whole body functions, and survival were monitored daily in half of the mice in each group, whereas serum, tumors, and gastrocnemius muscles were harvested from the other mice after sacrifice on day 20 for further analysis. Aliskiren significantly alleviated multiple cachexia‑associated symptoms, including BW loss, tumor burden, muscle wasting, muscular dysfunction, and shortened survival. On the molecular level, aliskiren antagonized cachexia‑induced activation of the renin‑angiotensin system (RAS), systematic and muscular inflammation, oxidative stress, and autophagy‑lysosome as well as ubiquitin‑proteasome stimulation. In addition, early administration of aliskiren before cachexia development (AP group) resulted in more robust effects in alleviating cachexia or targeting underlying mechanisms than administration after cachexia development (AT group). Aliskiren exhibited potent anti‑cachexia activities. These activities were achieved through the targeting of at least four mechanisms underlying cachexia development: RAS activation, increase in systematic inflammation, upregulation of oxidative stress, and stimulation of autophagy-lysosome pathway (ALP) and ubiquitin-proteasome pathway (UPP).
Alemtuzumab CARE-MS II 5-year follow-up
Cohen, Jeffrey A.; Fox, Edward J.; Giovannoni, Gavin; Hartung, Hans-Peter; Havrdova, Eva; Schippling, Sven; Selmaj, Krzysztof W.; Traboulsee, Anthony; Compston, D. Alastair S.; Margolin, David H.; Thangavelu, Karthinathan; Chirieac, Madalina C.; Jody, Darlene; Xenopoulos, Panos; Hogan, Richard J.; Panzara, Michael A.; Arnold, Douglas L.
2017-01-01
Objective: To evaluate 5-year efficacy and safety of alemtuzumab in patients with active relapsing-remitting multiple sclerosis and inadequate response to prior therapy. Methods: In the 2-year Comparison of Alemtuzumab and Rebif Efficacy in Multiple Sclerosis (CARE-MS) II study (NCT00548405), alemtuzumab-treated patients received 2 courses (baseline and 12 months later). Patients could enter an extension (NCT00930553), with as-needed alemtuzumab retreatment for relapse or MRI activity. Annualized relapse rate (ARR), 6-month confirmed disability worsening (CDW; ≥1-point Expanded Disability Status Scale [EDSS] score increase [≥1.5 if baseline EDSS = 0]), 6-month confirmed disability improvement (CDI; ≥1-point EDSS decrease [baseline score ≥2.0]), no evidence of disease activity (NEDA), brain volume loss (BVL), and adverse events (AEs) were assessed. Results: Most alemtuzumab-treated patients (92.9%) who completed CARE-MS II entered the extension; 59.8% received no alemtuzumab retreatment. ARR was low in each extension year (years 3–5: 0.22, 0.23, 0.18). Through 5 years, 75.1% of patients were free of 6-month CDW; 42.9% achieved 6-month CDI. In years 3, 4, and 5, proportions with NEDA were 52.9%, 54.2%, and 58.2%, respectively. Median yearly BVL remained low in the extension (years 1–5: −0.48%, −0.22%, −0.10%, −0.19%, −0.07%). AE exposure-adjusted incidence rates in the extension were lower than in the core study. Thyroid disorders peaked at year 3, declining thereafter. Conclusions: Alemtuzumab provides durable efficacy through 5 years in patients with an inadequate response to prior therapy in the absence of continuous treatment. Classification of evidence: This study provides Class III evidence that alemtuzumab provides efficacy and slowing of brain atrophy through 5 years. PMID:28835403
Bomback, Andrew S; Rekhtman, Yelena; Klemmer, Philip J; Canetta, Pietro A; Radhakrishnan, Jai; Appel, Gerald B
2012-01-01
Aldosterone levels increase in 30%-40% of patients on angiotensin-converting enzyme inhibitors and/or angiotensin receptor blockers over the long term. This "aldosterone breakthrough" may carry important clinical consequences given aldosterone's nonepithelial, pro-fibrotic actions. The renin inhibitor, aliskiren, by suppressing the renin-angiotensin-aldosterone system (RAAS) proximally, may limit breakthrough compared to conventional RAAS blockade. This open-label study (NCT01129557) randomized subjects to aliskiren 300 mg daily (A), valsartan 320 mg daily (V), or aliskiren 150 mg + valsartan 160 mg daily (A+V) for 9 months. Eligible subjects had proteinuria >300 mg/day, estimated glomerular filtration rate (eGFR) >45 mL/min/1.73 m(2), and systolic blood pressure (BP) >130 or diastolic BP >80 mm Hg. Serum and 24-hour urine aldosterone (indexed to 24-hour urine Na) were checked before initiation of therapy and at 3, 6, and 9 months. Aldosterone breakthrough was defined as a sustained increase from baseline aldosterone by study end. The study was intended to enroll 120 subjects but was terminated early by the sponsor. We present here the results of 33 subjects who completed the protocol, of which 12 were randomized to A, 11 were randomized to V, and 10 were randomized to A+V. Mean baseline eGFR was 75.5 (±23.3) mL/min/1.73 m(2); baseline proteinuria was 3104 (±2943) mg/day; and baseline BP was 134.7 (±10.5)/84.8 (±8.4) mm Hg. Three (27%) subjects on V, three (25%) subjects on A, and three (30%) subjects on A+V had aldosterone breakthrough. Mean proteinuria reduction was 31% from baseline in all subjects: 30% in subjects with breakthrough vs. 32% in subjects without breakthrough. Mean BP reduction was 11.0/8.8 mm Hg in all subjects: 8.4/6.1 mm Hg in subjects with breakthrough vs. 12.0/9.8 mm Hg in subjects without breakthrough. Aliskiren, alone or in combination with valsartan, did not reduce the incidence of aldosterone breakthrough in subjects with hypertension
Stability of alemtuzumab solutions at room temperature.
Goldspiel, Justin T; Goldspiel, Barry R; Grimes, George J; Yuan, Peng; Potti, Gopal
2013-03-01
The 24-hour stability of alemtuzumab solutions prepared at concentrations not included in the product label and stored in glass or polyolefin containers at room temperature was evaluated. Triplicate solutions of alemtuzumab (6.67, 40, and 120 μg/mL) in 0.9% sodium chloride were prepared in either glass bottles or polyolefin containers and stored at room temperature under normal fluorescent lighting conditions. The solutions were analyzed by a validated stability-indicating high-performance liquid chromatography (HPLC) assay at time zero and 8, 14, and 24 hours after preparation; solution pH values were measured and the containers visually inspected at all time points. Stability was defined as the retention of ≥90% of the initial alemtuzumab concentration. HPLC analysis indicated that the percentage of the initial alemtuzumab concentration retained was >90% for all solutions evaluated, with no significant changes over the study period. The most dilute alemtuzumab solution (6.67 μg/mL) showed some degradation (91% of the initial concentration retained at hour 24), whereas the retained concentration was >99% for all other preparations throughout the study period. Solution pH values varied by drug concentration but did not change significantly over 24 hours. No evidence of particle formation was detected in any solution by visual inspection at any time during the study. Solutions of alemtuzumab 6.67 μg/mL stored in glass bottles and solutions of 40 and 120 μg/mL stored in polyolefin containers were stable for at least 24 hours at room temperature.
Alemtuzumab: validation of a sensitive and simple enzyme-linked immunosorbent assay.
Jilani, Iman; Keating, Michael; Giles, Francis J; O'Brien, Susan; Kantarjian, Hagop M; Albitar, Maher
2004-12-01
Alemtuzumab (MabCampath) is a humanized rat monoclonal antibody that targets the CD52 antigen. It has been approved for the treatment of patients with resistant chronic lymphocytic leukaemia (CLL). Measuring plasma/serum levels of alemtuzumab is important for optimizing the dosing and scheduling of therapy; however, current assays in serum or plasma, based on the capture of alemtuzumab using CD52, are complicated and difficult to adapt for high throughput testing. We developed a simple sandwich enzyme-linked immunosorbent assay (ELISA) to measure alemtuzumab that takes advantage of the remaining rat sequence in alemtuzumab. Using specific anti-rat immunoglobulin (Ig) antibodies (absorbed against human Ig), alemtuzumab levels were measured in the serum and plasma of patients treated with alemtuzumab. Levels were similar between plasma and serum samples, in fresh samples and samples stored at 4 degrees C for 24 h, but were significantly lower in samples stored at room temperature for 24h. The assay was successfully used to determine serum alemtuzumab pre- and post-treatment. This assay is simple and adaptable for high throughput testing, with a limit of detection of 0.05 microg/ml and a coefficient of variation of +/-12.5%. No false positivity was observed in >200 samples tested. This validated assay should help optimize the dosing and scheduling of alemtuzumab therapy. The underlying principles are also applicable to the measurement of other humanized antibodies using an appropriate anti-Ig.
Acute effects of alemtuzumab infusion in patients with active relapsing-remitting MS
Thomas, Katja; Eisele, Judith; Rodriguez-Leal, Francisco Alejandro; Hainke, Undine
2016-01-01
Objective: Alemtuzumab exerts its clinical efficacy by its specific pattern of depletion and repopulation of different immune cells. Beyond long-term immunologic and clinical data, little is known about acute changes in immunologic and routine laboratory parameters and their clinical relevance during the initial alemtuzumab infusion. Methods: Fifteen patients with highly active MS were recruited. In addition to parameters including heart rate, blood pressure, body temperature, and monitoring of adverse events, complete blood cell count, liver enzymes, kidney function, acute-phase proteins, serum cytokine profile, complement activation, peripheral immune cell distribution, and their potential of cytokine release were investigated prior to and after methylprednisolone and after alemtuzumab on each day of alemtuzumab infusion. Results: After the first alemtuzumab infusion, both the total leukocyte and granulocyte counts markedly increased, whereas lymphocyte counts dramatically decreased. In addition to lymphocyte depletion, cell subtypes important for innate immunity also decreased within the first week after alemtuzumab infusion. Although patients reported feeling well, C-reactive protein and procalcitonin peaked at serum levels consistent with septic conditions. Increases in liver enzymes were detected, although kidney function remained stable. Proinflammatory serum cytokine levels clearly rose after the first alemtuzumab infusion. Alemtuzumab led to impaired cytokine release ex vivo in nondepleted cells. Normal clinical parameters and mild adverse events were presented. Conclusions: Dramatic immunologic effects were observed. Standardized infusion procedure and pretreatment management attenuated infusion-related reactions. Alemtuzumab-mediated effects led to artificially altered parameters in standard blood testing. We recommend clinical decision-making based on primarily clinical symptoms within the first alemtuzumab treatment week. PMID:27213173
Immediate transient thrombocytopenia at the time of alemtuzumab infusion in multiple sclerosis.
Ranganathan, Usha; Kaunzner, Ulrike; Foster, Stacyann; Vartanian, Timothy; Perumal, Jai S
2018-04-01
Alemtuzumab is a monoclonal antibody approved for relapsing-remitting multiple sclerosis (RRMS). Although Immune thrombocytopenia (ITP) has been reported as a secondary autoimmune phenomenon following alemtuzumab infusion, immediate thrombocytopenia during the infusion has not been reported. We report transient, reversible, self-limiting acute-onset thrombocytopenia during the first course with alemtuzumab. In total, 3 of 22 paitents developed mild self-limited bruising associated with a drop in platelet count from their baseline during the intial 5-day course of alemtuzumab. Upon chart review, all 22 patients who received alemtuzumab developed an immediate mostly asymptomatic drop in platelet count which returned to normal within 2 months post-infusion.
Lin, Yu; Zhang, Tiezheng; Feng, Pinning; Qiu, Miaojuan; Liu, Qiaojuan; Li, Suchun; Zheng, Peili; Kong, Yonglun; Levi, Moshe; Li, Chunling; Wang, Weidong
2017-10-01
The direct renin inhibitor aliskiren has been shown to be retained and persist in medullary collecting ducts even after treatment is discontinued, suggesting a new mechanism of action for this drug. The purpose of the present study was to investigate whether aliskiren regulates renal aquaporin expression in the collecting ducts and improves urinary concentrating defect induced by lithium in mice. The mice were fed with either normal chow or LiCl diet (40 mmol·kg dry food -1 ·day -1 for 4 days and 20 mmol·kg dry food -1 ·day -1 for the last 3 days) for 7 days. Some mice were intraperitoneally injected with aliskiren (50 mg·kg body wt -1 ·day -1 in saline). Aliskiren significantly increased protein abundance of aquaporin-2 (AQP2) in the kidney inner medulla in mice. In inner medulla collecting duct cell suspension, aliskiren markedly increased AQP2 and phosphorylated AQP2 at serine 256 (pS256-AQP2) protein abundance, which was significantly inhibited both by adenylyl cyclase inhibitor MDL-12330A and by PKA inhibitor H89, indicating an involvement of the cAMP-PKA signaling pathway in aliskiren-induced increased AQP2 expression. Aliskiren treatment improved urinary concentrating defect in lithium-treated mice and partially prevented the decrease of AQP2 and pS256-AQP2 protein abundance in the inner medulla of the kidney. In conclusion, the direct renin inhibitor aliskiren upregulates AQP2 protein expression in inner medullary collecting duct principal cells and prevents lithium-induced nephrogenic diabetes insipidus likely via cAMP-PKA pathways. Copyright © 2017 the American Physiological Society.
Aliskiren ameliorates chlorhexidine digluconate-induced peritoneal fibrosis in rats.
Ke, Chun-Yen; Lee, Chia-Chi; Lee, Chung-Jen; Subeq, Yi-Maun; Lee, Ru-Ping; Hsu, Bang-Gee
2010-04-01
Peritoneal fibrosis (PF) is a recognized complication of long-term peritoneal dialysis (PD) and can lead to ultrafiltration failure. The present study was designed to investigate the protective effects of aliskiren on chlorhexidine digluconate-induced PF in rats. The PF was induced in Sprague-Dawley rats by daily administration of 0.5 mL 0.1% chlorhexidine digluconate in normal saline via PD tube for 1 week. Rats received daily intravenous injections of low-dose aliskiren (1 mg kg(-1)) or high-dose aliskiren (10 mg kg(-1)) for 1 week. After 7 days, conventional 4.25% Dianeal (30 mL) was administered via a PD catheter with a dwell time of 4 h and assessed of peritoneal function. At the end of dialysis, rats were sacrificed and the liver peritoneum was harvested for microscopically and immunohistochemistry. There was no significant difference in mean arterial pressure and heart rate between groups. After 4 h of PD, the D(4)/P(4) urea level was reduced, the D(4)/D(0) glucose level, serum and dialysate transforming growth factor-beta1 (TGF-beta1) level was increased, the liver peritoneum was markedly thicker, and the expression of TGF-beta1, alpha-smooth muscle actin (alpha-SMA), fibronectin, collagen, and vascular endothelial growth factor (VEGF) were elevated in the PS group compared with the vehicle group. Aliskiren decreased the serum and dialysate TGF-beta1 level, decreased the thickness of the liver peritoneum, and decreased the expression of TGF-beta1, alpha-SMA, fibronectin, collagen, and VEGF-positive cells in liver peritoneum. Moreover, high-dose aliskiren had better protective effects against PF than low dose in rats. Aliskiren protected against chlorhexidine digluconate-induced PF in rats by decreasing TGF-beta1 production.
Alemtuzumab Use in Clinical Practice: Recommendations from European Multiple Sclerosis Experts.
Berger, Thomas; Elovaara, Irina; Fredrikson, Sten; McGuigan, Chris; Moiola, Lucia; Myhr, Kjell-Morten; Oreja-Guevara, Celia; Stoliarov, Igor; Zettl, Uwe K
2017-01-01
Alemtuzumab (Lemtrada™) is a humanized monoclonal antibody approved in more than 50 countries. Within the European Union, alemtuzumab is indicated for the treatment of adult patients with relapsing-remitting multiple sclerosis (RRMS) with active disease defined by clinical or imaging features; in the USA, the indication states that alemtuzumab should generally be reserved for the treatment of patients with relapsing forms of multiple sclerosis who have had an inadequate response to two or more disease-modifying therapies (DMTs). In clinical trials, alemtuzumab demonstrated efficacy in treatment-naïve patients with active RRMS and those relapsing on prior DMTs, with a consistent and manageable safety and tolerability profile. The European Union indication provides physicians with significant flexibility regarding treatment decisions, affording the opportunity for individualized treatment. Thus, alemtuzumab may be an appropriate treatment choice across a broad range of patients with RRMS, including, for example, treatment-naïve patients with active disease, patients with highly active disease, or for patients relapsing on prior DMTs. There are several practicalities to consider when using alemtuzumab, including the unique dosing regimen, administered via intravenous infusion on 5 consecutive days at baseline and on 3 consecutive days 12 months later, and as-needed retreatment (3 consecutive days at least 12 months after the last course) in cases of disease recurrence. Additionally, routine monthly monitoring is required for up to 48 months after the last infusion to promptly identify potentially serious autoimmune adverse events. Given these considerations, it is beneficial to gain insight into how alemtuzumab is being used in the real-world clinical setting. Here, we report recommendations from European multiple sclerosis experts regarding best practices for alemtuzumab treatment, including management of adverse events and compliance with ongoing safety
Aliskiren: review of efficacy and safety data with focus on past and recent clinical trials.
Sen, Selçuk; Sabırlı, Soner; Ozyiğit, Tolga; Uresin, Yağız
2013-09-01
Aliskiren is the newest antihypertensive drug and the first orally active direct renin inhibitor to become available for clinical use. Clinical data have substantiated that the antihypertensive effectiveness of aliskiren is similar to that of the other major antihypertensive agents. Furthermore, aliskiren has a similar safety profile to placebo. Combination treatment with aliskiren showed significant blood pressure and proteinuria reductions compared with monotherapy. Aliskiren decreases plasma renin activity in contrast to other renin-angiotensin-aldosterone related drugs. The efficacy of aliskiren in treating major cardiovascular events and the prevention of end-organ damage are being investigated in the ASPIRE HIGHER program. Although the first studies of the ASPIRE HIGHER program such as ALOFT, AVOID, AGELESS showed favorable findings, ASPIRE and AVANT-GARDE studies provided contradictory results. Subsequently, the ALTITUDE study was terminated early because of safety issues and lack of beneficial effects. Most recently, the ASTRONAUT trial showed no reduction in cardiovascular death or heart failure rehospitalization with the addition of aliskiren to standard therapy in patients who were hospitalized for heart failure and with reduced left-ventricular ejection fraction. The results of ongoing studies in other patient groups such as the ATMOSPHERE trial are awaited.
Superior MRI outcomes with alemtuzumab compared with subcutaneous interferon β-1a in MS.
Arnold, Douglas L; Fisher, Elizabeth; Brinar, Vesna V; Cohen, Jeffrey A; Coles, Alasdair J; Giovannoni, Gavin; Hartung, Hans-Peter; Havrdova, Eva; Selmaj, Krzysztof W; Stojanovic, Miroslav; Weiner, Howard L; Lake, Stephen L; Margolin, David H; Thomas, David R; Panzara, Michael A; Compston, D Alastair S
2016-10-04
To describe detailed MRI results from 2 head-to-head phase III trials, Comparison of Alemtuzumab and Rebif Efficacy in Multiple Sclerosis Study I (CARE-MS I; NCT00530348) and Study II (CARE-MS II; NCT00548405), of alemtuzumab vs subcutaneous interferon β-1a (SC IFN-β-1a) in patients with active relapsing-remitting multiple sclerosis (RRMS). The impact of alemtuzumab 12 mg vs SC IFN-β-1a 44 μg on MRI measures was evaluated in patients with RRMS who were treatment-naive (CARE-MS I) or who had an inadequate response, defined as at least one relapse, to prior therapy (CARE-MS II). Both treatments prevented T2-hyperintense lesion volume increases from baseline. Alemtuzumab was more effective than SC IFN-β-1a on most lesion-based endpoints in both studies (p < 0.05), including decreased risk of new/enlarging T2 lesions over 2 years and gadolinium-enhancing lesions at year 2. Reduced risk of new T1 lesions (p < 0.0001) and gadolinium-enhancing lesion conversion to T1-hypointense black holes (p = 0.0078) were observed with alemtuzumab vs SC IFN-β-1a in CARE-MS II. Alemtuzumab slowed brain volume loss over 2 years in CARE-MS I (p < 0.0001) and II (p = 0.012) vs SC IFN-β-1a. Alemtuzumab demonstrated greater efficacy than SC IFN-β-1a on MRI endpoints in active RRMS. The superiority of alemtuzumab was more prominent during the second year of both studies. These findings complement the superior clinical efficacy of alemtuzumab over SC IFN-β-1a in RRMS. NCT00530348 and NCT00548405. The results reported here provide Class I evidence that, for patients with active RRMS, alemtuzumab is superior to SC IFN-β-1a on multiple MRI endpoints. © 2016 American Academy of Neurology.
Lanier, Gregg; Sankholkar, Kedar; Aronow, Wilbert S
2014-01-01
Health care providers managing hypertension (HTN) have a large selection of pharmacologic agents to choose from, including several different classes of drugs and many similar drugs within each class. Antagonism of the renin-angiotensin-aldosterone system has been shown to be very effective for HTN, especially in patients with cardiovascular disease, diabetes, and heart failure. Within this group, there have been 2 new agents recently introduced to the US market and approved by the Food and Drug Administration. It is important for the HTN specialist to be familiar with the merits of these 2 drugs: the angiotensin receptor blocker Edarbi (azilsartan) and the renin inhibitor Tekturna (aliskiren). Additionally, there have been several new, fixed-dose combination antihypertensives introduced to the market since 2006 that use a renin-angiotensin-aldosterone antagonist. Seven of these combine 2 drugs together in a single pill: Edarbyclor (azilsartan/chlorthalidone), Exforge (amlodipine/valsartan), Azor (olmesartan/amlodipine), Twynsta (amlodipine/telmisartan), Tekturna HCT [aliskiren/hydrochlorothiazide (HCTZ)], Valturna (aliskiren/valsartan), Tekamlo (aliskiren/amlodipine). Three triple-drug combination medications have also been introduced recently: Exforge HCT (amlodipine/valsartan/HCTZ), Tribenzor (olmesartan/amlodipine/HCTZ), and Amturnide (aliskiren/amlodipine/hydrocholorothiazide). This review will summarize the trial data and important pharmacologic merits of these 2 new renin-angiotensin-aldosterone antagonists and the advantages of initiating treatment with one of the new fixed-dose, combination drugs approved over the last 5 years.
Both cladribine and alemtuzumab may effect MS via B-cell depletion.
Baker, David; Herrod, Samuel S; Alvarez-Gonzalez, Cesar; Zalewski, Lukasz; Albor, Christo; Schmierer, Klaus
2017-07-01
To understand the efficacy of cladribine (CLAD) treatment in MS through analysis of lymphocyte subsets collected, but not reported, in the pivotal phase III trials of cladribine and alemtuzumab induction therapies. The regulatory submissions of the CLAD Tablets Treating Multiple Sclerosis Orally (CLARITY) (NCT00213135) cladribine and Comparison of Alemtuzumab and Rebif Efficacy in Multiple Sclerosis, study one (CARE-MS I) (NCT00530348) alemtuzumab trials were obtained from the European Medicine Agency through Freedom of Information requests. Data were extracted and statistically analyzed. Either dose of cladribine (3.5 mg/kg; 5.25 mg/kg) tested in CLARITY reduced the annualized relapse rate to 0.16-0.18 over 96 weeks, and both doses were similarly effective in reducing the risk of MRI lesions and disability. Surprisingly, however, T-cell depletion was rather modest. Cladribine 3.5 mg/kg depleted CD4 + cells by 40%-45% and CD8 + cells by 15%-30%, whereas alemtuzumab suppressed CD4 + cells by 70%-95% and CD8 + cells by 47%-55%. However, either dose of cladribine induced 70%-90% CD19 + B-cell depletion, similar to alemtuzumab (90%). CD19 + cells slowly repopulated to 15%-25% of baseline before cladribine redosing. However, alemtuzumab induced hyperrepopulation of CD19 + B cells 6-12 months after infusion, which probably forms the substrate for B-cell autoimmunities associated with alemtuzumab. Cladribine induced only modest depletion of T cells, which may not be consistent with a marked influence on MS, based on previous CD4 + T-cell depletion studies. The therapeutic drug-response relationship with cladribine is more consistent with lasting B-cell depletion and, coupled with the success seen with monoclonal CD20 + depletion, suggests that B-cell suppression could be the major direct mechanism of action.
The Role of RAAS Inhibition by Aliskiren on Paracetamol-Induced Hepatotoxicity Model in Rats.
Karcioglu, Saliha Sena; Palabiyik, Saziye Sezin; Bayir, Yasin; Karakus, Emre; Mercantepe, Tolga; Halici, Zekai; Albayrak, Abdulmecit
2016-03-01
Paracetamol is one of the most popular and widely used analgesic and antipyretic agents, but an overdose can cause hepatotoxicity and lead to acute liver failure. Aliskiren directly inhibits renin which downregulates the renin-angiotensin-aldosterone system (RAAS). Recent findings suggest that RAAS system takes part in the pathogenesis of liver fibrosis. We aimed to reveal the relationship between hepatotoxicity and the RAAS by examining paracetamol induced hepatotoxicity. Rats were separated into five groups as follows: control, 100 mg/kg aliskiren (p.o.), 2 g/kg paracetamol (per os (p.o.)), 2 g/kg paracetamol + 50mg/kg aliskiren (p.o.), and 2 g/kg paracetamol + 100 mg/kg aliskiren(p.o.). Samples were analyzed at the biochemical, molecular, and histopathological levels. Paracetamol toxicity increased alanine aminotransferases (ALT), aspartate aminotransferases (AST), renin, and angiotensin II levels in the serum samples. In addition, the SOD activity and glutathione (GSH) levels decreased while Lipid Peroxidation (MDA) levels increased in the livers of the rats treated with paracetamol. Paracetamol toxicity caused a significant increase in TNF-α and TGF-β. Both aliskiren doses showed an improvement in ALT, AST, oxidative parameters, angiotensin II, and inflammatory cytokines. Only renin levels increased in aliskiren treatment groups due to its pharmacological effect. A histopathological examination of the liver showed that aliskiren administration ameliorated the paracetamol-induced liver damage. In immunohistochemical staining, the expression of TNF-α in the cytoplasm of the hepatocytes was increased in the paracetamol group but not in other treatment groups when compared to the control group. In light of these observations, we suggest that the therapeutic administration of aliskiren prevented oxidative stress and cytokine changes and also protected liver tissues during paracetamol toxicity by inhibiting the RAAS. © 2015 Wiley Periodicals
Meunier, Benoit; Rico, Audrey; Seguier, Julie; Boutiere, Clemence; Ebbo, Mikael; Harle, Jean Robert; Schleinitz, Nicolas; Pelletier, Jean
2018-05-01
Alemtuzumab is a humanized monoclonal antibody directed at CD52 approved as a disease-modifying therapy for relapsing forms of multiple sclerosis (MS). To describe a case of a life-threatening autoimmune anemia occurring after a first course of alemtuzumab for relapsing-remitting MS in a 28-year-old male. Case report. A 28-year-old male developed a life-threatening autoimmune anemia occurring 11 months after first alemtuzumab course. We report the third case of autoimmune hemolytic anemia following treatment with alemtuzumab in a young MS patient. Due to the severity of this adverse event, neurologists using this treatment should be alert.
A retrospective Aliskiren and Losartan study in non-diabetic chronic kidney disease.
Woo, Keng-Thye; Choong, Hui-Lin; Wong, Kok-Seng; Tan, Han-Kim; Foo, Marjorie; Stephanie, Fook-Chong; Lee, Evan Jc; Anantharaman, Vathsala; Lee, Grace Sl; Chan, Choong-Meng
2013-11-06
To assess the efficacy of combined Aliskiren and Losartan vs high dose Losartan and Aliskiren alone in chronic kidney disease (CKD). This is a retrospective study of 143 patients with non-diabetic CKD comparing combined Aliskiren (150 mg/d) with Losartan (100 mg/d) therapy vs High dose Angiotensin receptor blockers (ARB) (Losartan 200 mg/d) and the third group Aliskiren (150 mg/d) alone. This study involved only patient medical records. Entry criteria included those patients who had been treated with the above drugs for at least 36 mo within the 5 years period; other criteria included proteinuria of 1 g or more and or CKD Stage 3 at the start of the 36 mo period. The study utilised primary renal end points of estimated Glomerular Filtration Rate (eGFR) < 15 mL/min or end stage renal failure. Patients treated with high dose ARB compared to the other two treatment groups had significantly less proteinuria at the end of 36 mo (P < 0.007). All 3 groups had significant reduction of proteinuria (P < 0.043, P < 0.001). Total urinary protein was significantly different between the 3 groups over the 3-year study period (P = 0.008), but not eGFR. The changes in eGFR from baseline to each year were not significantly different between the 3 therapeutic groups (P < 0.119). There were no significant differences in the systolic and diastolic blood pressure between the 3 drug groups throughout the 3 years. The incidence of hyperkalemia (> 5.5 mmol/L) was 14.2% (7/49) in the Combined Aliskiren and ARB group, 8.7% (4/46) in the Aliskiren alone group and 6.3% (3/48) in the High dose ARB group (P < 0.001). This study in non-diabetic CKD patients showed that Combination therapy with Aliskiren and ARB was effective but was not safe as it was associated with a high prevalence of hyperkalaemia.
Impact of alemtuzumab treatment on the survival and function of human regulatory T cells in vitro
Havari, Evis; Turner, Michael J; Campos-Rivera, Juanita; Shankara, Srinivas; Nguyen, Tri-Hung; Roberts, Bruce; Siders, William; Kaplan, Johanne M
2014-01-01
Alemtuzumab is a humanized monoclonal antibody specific for the CD52 protein present at high levels on the surface of B and T lymphocytes. In clinical trials, alemtuzumab has shown a clinical benefit superior to that of interferon-β in relapsing–remitting multiple sclerosis patients. Treatment with alemtuzumab leads to the depletion of circulating lymphocytes followed by a repopulation process characterized by alterations in the number, proportions and properties of lymphocyte subsets. Of particular interest, an increase in the percentage of T cells with a regulatory phenotype (Treg cells) has been observed in multiple sclerosis patients after alemtuzumab. Since Treg cells play an important role in the control of autoimmune responses, the effect of alemtuzumab on Treg cells was further studied in vitro. Alemtuzumab effectively mediated complement-dependent cytolysis of human T lymphocytes and the remaining population was enriched in T cells with a regulatory phenotype. The alemtuzumab-exposed T cells displayed functional regulatory characteristics including anergy to stimulation with allogeneic dendritic cells and ability to suppress the allogeneic response of autologous T cells. Consistent with the observed increase in Treg cell frequency, the CD25hi T-cell population was necessary for the suppressive activity of alemtuzumab-exposed T cells. The mechanism of this suppression was found to be dependent on both cell–cell contact and interleukin-2 consumption. These findings suggest that an alemtuzumab-mediated increase in the proportion of Treg cells may play a role in promoting the long-term efficacy of alemtuzumab in patients with multiple sclerosis. PMID:24116901
Hawkins, Elizabeth B.; Ling, Hua; Burns, Tammy L.; Mooss, Aryan N.; Hilleman, Daniel E.
2012-01-01
Background To assess the efficacy of aliskiren in patients failing to reach blood pressure (BP) goals with angiotensin converting enzyme inhibitor (ACEI) or angiotensin receptor blocker (ARB). Methods A total of 107 patients who failed to reach BP goals on ACEI or ARB were switched to aliskiren. Changes in BP were determined during maximal ACEI, ARB, or aliskiren therapy. Results Mean reduction in sBP and dBP with ACEI was 8.5 ± 6.3 mmHg and 6.0 ± 4.7 mmHg, respectively. Mean reduction in sBP and dBP with ARB was 8.3 ± 6.7 mmHg and 5.0 ± 5.2 mmHg, respectively. Mean reduction in sBP and dBP with aliskiren 150 mg/d was 6.7 ± 5.4 mmHg and 5.4 ± 4.8 mmHg, respectively. Mean reduction in sBP and dBP with aliskiren 300 mg/d was 8.6 ± 6.3 mmHg and 6.0 ± 4.9 mmHg, respectively. BP reductions between ACEI, ARB, and aliskiren were not significantly different. Conclusions Aliskiren is ineffective in patients failing ACEI or ARB therapy. Given the label changes restricting the use of aliskiren in combination with ACEI and ARB, excess cost compared to ACEI and ARB, and a paucity of outcome data, there is a limited role for aliskiren in practice. PMID:28348679
Wang, Li-Ping; Fan, Su-Jing; Li, Shu-Min; Wang, Xiao-Jun; Sun, Na
2016-10-25
The purpose of the present study is to explore the effect of aliskiren on the proliferation of cardiac fibroblasts (CFs) in AGT-REN double transgenic hypertensive (dTH) mice. The cultured CFs from AGT-REN dTH mice were divided into AGT-REN group (dTH) and aliskiren group (ALIS). Cultured CFs from C57B6 mice were served as control (WT). The effect of different concentration of aliskiren (1 × 10 -6 , 1 × 10 -7 , 1 × 10 -8 , 1 × 10 -9 mol/L) on CFs proliferation was determined by MTT assay. After treatment with 1 × 10 -7 mol/L aliskiren for 24 h, α-SMA, collagen I, III and NADPH oxidase (NOX) protein expression in CFs of AGT-REN dTH mice were detected by Western blot. The collagen synthesis in CFs was assessed by hydroxyproline kit. The expression of ROS was determined by DHE. Results showed that the blood pressure and plasma Ang II levels were significantly increased and CFs proliferation was significantly increased as well in AGT-REN dTH mice compared with WT group. However, aliskiren intervention decreased CFs proliferation, myofibroblast transformation, as well as the collagen I and III synthesis in CFs of AGT-REN dTH mice. Meanwhile, aliskiren inhibited ROS content and NOX2/NOX4 protein expression in CFs of AGT-REN dTH mice. These results suggest that aliskiren decreases the cell proliferation, myofibroblast transformation and collagen production in CFs of AGT-REN dTH mice, which might be through inhibition of oxidative stress response.
Klotz, L; Meuth, S G; Kieseier, B; Wiendl, H
2013-08-01
In November 2012 the results of 2 clinical phase III trials were published which addressed the effects of alemtuzumab in patients with relapsing-remitting multiple sclerosis (MS). In the CARE-MS-I study patients with early untreated MS (EDSS ≤ 3.0, disease duration < 5 years) were included, whereas CARE-MS-II investigated the effects of alemtuzumab in patients with persisting disease activity under standard disease-modifying treatment (EDSS ≤ 5.0, disease duration < 10 years). These groups were compared to patients under treatment with frequently applied interferon β 1a (3 times 44 µg subcutaneous). Both studies clearly demonstrated a superiority of alemtuzumab compared to interferon in terms of reduction of relapse rate as well as the number of new or enlarging T2 lesions and gadolinium-enhancing lesions. Moreover, the CARE-MS-II study showed a significant delay in disease progression by alemtuzumab. The portfolio and the frequency of relevant side effects, such as infusion-related reactions, development of secondary autoimmunity or infections were within the expected range. Taken together these studies confirm the high anti-inflammatory efficacy of alemtuzumab and hence provide the first evidence of superiority of a monotherapy in direct comparison to standard disease-modifying treatment in two phase III trials in relapsing-remitting MS. These data in the context of the mode of action of alemtuzumab provide evidence for the relevance of immune cells, especially T cells, in the pathophysiology of MS. Experience with long-term effects of alemtuzumab, e.g. from the phase II extension trial as well as the side effect profile argue in favor of a sustained reprogramming of the immune system as a consequence of immune cell depletion by alemtuzumab.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoffmann, Peter, E-mail: peterk.hoffmann@novartis.com; Beckman, David; McLean, Lee Anne
Juvenile rat toxicity studies with the direct renin inhibitor aliskiren were initiated to support treatment in the pediatric population. In Study 1, aliskiren was administered orally to juvenile rats at doses of 0, 30, 100 or 300 mg/kg/day with repeated dosing from postpartum day (PPD) 8 to PPD 35/36. In-life, clinical pathology, anatomic pathology, and toxicokinetics evaluations were performed. In Study 2, single oral doses of aliskiren (0, 100 or 300 mg/kg) were given to 14-, 21-, 24-, 28-, 31- or 36-day-old rats; in-life data and toxicokinetics were evaluated. Study 3 was a single dose (3 mg/kg i.v.) pharmacokinetic studymore » in juvenile rats on PPD 8, 14, 21 and 28. In Study 4, naïve rats were used to investigate ontogenic changes of the multidrug-resistant protein 1 (MDR1) and the organic anion transporting polypeptide (OATP) mRNA in several organs. Oral administration of aliskiren at 100 and 300 mg/kg caused unexpected mortality and severe morbidity in 8-day-old rats. Aliskiren plasma and tissue concentrations were increased in rats aged 21 days and younger. Expression of MDR1 and OATP mRNA in the intestine, liver and brain was significantly lower in very young rats. In conclusion, severe toxicity and increased exposure in very young rats after oral administration of aliskiren are considered to be the result of immature drug transporter systems. Immaturity of MDR1 in enterocytes appears to be the most important mechanism responsible for the high exposure. - Highlights: • Aliskiren was orally administered to juvenile rats. • Unexpected severe toxicity and acute mortality occurred in rats aged 8 days. • Toxicity was associated with increased aliskiren plasma and tissue exposure. • Developmental changes of exposure correlated with ontogeny of transporters. • Immaturity of MDR1 in enterocytes causes increased exposure in very young rats.« less
Use of alemtuzumab (Campath-1H) as induction therapy in pediatric kidney transplantation.
Ona, E T; Danguilan, R A; Africa, J; Cabanayan-Casasola, C B; Antonio, Z L; Gutierrez-Marbella, M A; dela Cruz, R; Bumanglag, N; Espedilla, M E
2008-09-01
Alemtuzumab (Campath-1H) is a monoclonal antibody directed against CD52-positive B and T lymphocytes. Initial results of its use as an induction agent in adult renal transplantation have been encouraging. We report a case series of four low-risk pediatric renal transplantation patients who received 20 to 40 mg of alemtuzumab as induction followed by a steroid-free regimen consisting of a calcineurin inhibitor and mycophenolate mofetil. No infusion-related reactions occurred. Patients were aged 9 to 14 years with a mean creatinine of 1.2 mg/dL (range = 0.5-2.3 mg/dL) at a mean follow-up of 10 months (range = 4-16 months). One patient experienced biopsy-proven acute cellular rejections at 4 and 12 months posttransplantation, which were steroid sensitive. Lymphopenia post-alemtuzumab induction started to improve at 3 months posttransplantation. Two patients who received 40 mg of alemtuzumab experienced repeated infections that responded to 7-day courses of antibiotics. There was no cytomegalovirus disease detected. From these preliminary results, alemtuzumab seems to show a promising role to achieve adequate graft function with a steroid-free regimen among low-risk pediatric patients.
Lee, Kuei-Chuan; Chan, Che-Chang; Yang, Ying-Ying; Hsieh, Yun-Cheng; Huang, Yi-Hsiang; Lin, Han-Chieh
2013-01-01
Background & Aims Activation of the renin-angiotensin-system is known to play a role in nonalcoholic steatohepatitis. Renin knockout mice manifest decreased hepatic steatosis. Aliskiren is the first direct renin inhibitor to be approved for clinical use. Our study aims to evaluate the possible therapeutic effects and mechanism of the chronic administration of aliskiren in a dietary steatohepatitis murine model. Methods Male C57BL/6 mice were fed with a methionine and choline-deficient (MCD) diet to induce steatohepatitis. After 8 weeks of feeding, the injured mice were randomly assigned to receive aliskiren (50 mg·kg-1 per day) or vehicle administration for 4 weeks. Normal controls were also administered aliskiren (50 mg·kg-1 per day) or a vehicle for 4 weeks. Results In the MCD mice, aliskiren attenuated hepatic steatosis, inflammation and fibrosis. Aliskiren did not change expression of lipogenic genes but increase turnover of hepatic fat by up-regulating peroxisome proliferator-activated receptor α, carnitine palmitoyltransferase 1a, cytochrome P450-4A14 and phosphorylated AMP-activated protein kinase. Furthermore, aliskiren decreased the hepatic expression of angiotensin II and nuclear factor κB. The levels of oxidative stress, hepatocyte apoptosis, activation of Kupffer cells and hepatic stellate cells, and pro-fibrotic markers were also reduced in the livers of the MCD mice receiving aliskiren. Conclusions Aliskiren attenuates steatohepatitis and fibrosis in mice fed with a MCD diet. Thus, the noted therapeutic effects might come from not only the reduction of angiotensin II but also the up-regulation of fatty acid oxidation-related genes. PMID:24204981
Cardiorenal end points in a trial of aliskiren for type 2 diabetes.
Parving, Hans-Henrik; Brenner, Barry M; McMurray, John J V; de Zeeuw, Dick; Haffner, Steven M; Solomon, Scott D; Chaturvedi, Nish; Persson, Frederik; Desai, Akshay S; Nicolaides, Maria; Richard, Alexia; Xiang, Zhihua; Brunel, Patrick; Pfeffer, Marc A
2012-12-06
This study was undertaken to determine whether use of the direct renin inhibitor aliskiren would reduce cardiovascular and renal events in patients with type 2 diabetes and chronic kidney disease, cardiovascular disease, or both. In a double-blind fashion, we randomly assigned 8561 patients to aliskiren (300 mg daily) or placebo as an adjunct to an angiotensin-converting-enzyme inhibitor or an angiotensin-receptor blocker. The primary end point was a composite of the time to cardiovascular death or a first occurrence of cardiac arrest with resuscitation; nonfatal myocardial infarction; nonfatal stroke; unplanned hospitalization for heart failure; end-stage renal disease, death attributable to kidney failure, or the need for renal-replacement therapy with no dialysis or transplantation available or initiated; or doubling of the baseline serum creatinine level. The trial was stopped prematurely after the second interim efficacy analysis. After a median follow-up of 32.9 months, the primary end point had occurred in 783 patients (18.3%) assigned to aliskiren as compared with 732 (17.1%) assigned to placebo (hazard ratio, 1.08; 95% confidence interval [CI], 0.98 to 1.20; P=0.12). Effects on secondary renal end points were similar. Systolic and diastolic blood pressures were lower with aliskiren (between-group differences, 1.3 and 0.6 mm Hg, respectively) and the mean reduction in the urinary albumin-to-creatinine ratio was greater (between-group difference, 14 percentage points; 95% CI, 11 to 17). The proportion of patients with hyperkalemia (serum potassium level, ≥6 mmol per liter) was significantly higher in the aliskiren group than in the placebo group (11.2% vs. 7.2%), as was the proportion with reported hypotension (12.1% vs. 8.3%) (P<0.001 for both comparisons). The addition of aliskiren to standard therapy with renin-angiotensin system blockade in patients with type 2 diabetes who are at high risk for cardiovascular and renal events is not supported by these
21 CFR 172.350 - Fumaric acid and salts of fumaric acid.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely used...
The evolving role of alemtuzumab (Campath-1H) in renal transplantation
Pham, Phuong-Thu T; Lipshutz, Gerald S; Pham, Phuong-Truc T; Kawahji, Joseph; Singer, Jennifer S; Pham, Phuong-Chi T
2009-01-01
The introduction of new immunosuppressive agents into clinical transplantation in the 1990s has resulted in excellent short-term graft survival. Nonetheless, extended long-term graft outcomes have not been achieved due in part to the nephrotoxic effects of calcineurin inhibitors (CNIs) and the adverse effects of steroid on cardiovascular disease risk factors. Induction therapy with lymphocyte depleting antibodies has originally been introduced into renal transplantation to provide intense immunosuppression in the early post-transplant period to prevent allograft rejection. Over the past half decade, induction therapy with both non-lymphocyte depleting (basiliximab and daclizumab) and lymphocyte-depleting antibodies (antithymocyte antibodies, OKT3, alemtuzumab) has increasingly been utilized in steroid or CNI sparing protocols in the early postoperative period. Alemtuzumab is a humanized monoclonal antibody targeted against CD52 on the surface of circulatory mononuclear cells. The ability of alemtuzumab (Campath-1H) to provide rapid and profound depletion of lymphocytes from the peripheral blood has sparked interest in the use of this agent as induction therapy in steroid and/or CNI minimization or avoidance protocols. This article provides an overview of the literarure on the evolving role of alemtuzumab in renal transplantation. PMID:19920920
Halici, Zekai; Polat, Beyzagul; Cadirci, Elif; Topcu, Atilla; Karakus, Emre; Kose, Duygu; Albayrak, Abdulmecit; Bayir, Yasin
2016-10-25
Previously blocking the renin angiotensin system (RAAS) has been effective in the prevention of gastric damage. Therefore, the aim of this study was to investigate the effects of aliskiren, and thus, direct renin blockage, in indomethacin-induced gastric damage model. Effects of aliskiren were evaluated in indomethacin-induced gastric damage model on Albino Wistar rats. Effects of famotidine has been investigated as standard antiulcer agent. Stereological analyses for ulcer area determination, biochemical analyses for oxidative status determination and molecular analyses for tissue cytokine and cyclooxygenase determination were performed on stomach tissues. In addition, to clarify antiulcer effect mechanism of aliskiren pylorus ligation-induced gastric acid secretion model was applied on rats. Aliskiren was able to inhibit indomethacin-induced ulcer formation. It also inhibited renin, and thus, decreased over-produced Angiotensin-II during ulcer formation. Aliskiren improved the oxidative status and cytokine profile of the stomach, which was most probably impaired by increased Angiotensin II concentration. Aliskiren also increased gastroprotective prostaglandin E2 concentration. Finally, aliskiren did not change the gastric acidity in pylorus ligation model. Aliskiren exerted its protective effects on stomach tissue by decreasing inflammatory cytokines and oxidative stress as a result of inhibiting the RAAS, at a rate-limiting step, as well as its end product, angiotensin II. Aliskiren also significantly increased protective factors such as PGE2, but not affect aggressive factors such as gastric acidity. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Tomillero, A; Moral, M A
2010-05-01
O(6)-Benzylguanine; (-)-Gossypol; Abatacept, AC-2592, Adalimumab, AIDSVAX gp120 B/E, Alemtuzumab, Aliskiren fumarate, ALVAC E120TMG, Ambrisentan, Amlodipine, Anakinra, Aripiprazole, Armodafinil, Atomoxetine hydrochloride, Avotermin; Bevacizumab, BIBW-2992, Bortezomib, Bosentan, Botulinum toxin type B; Canakinumab, CAT-354, Ciclesonide, CMV gB vaccine, Corifollitropin alfa, Daptomycin, Darbepoetin alfa, Dasatinib, Denosumab; EndoTAG-1, Eplerenone, Esomeprazole sodium, Eszopiclone, Etoricoxib, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; F-50040, Fesoterodine fumavate, Fondaparinux sodium, Fulvestrant; Gabapentin enacarbil, Golimumab; Imatinib mesylate, Inhalable human insulin, Insulin glargine, Ivabradine hydrochloride; Lercanidipine hydrochloride/enalapril maleate, Levosimendan, Liposomal vincristine sulfate, Liraglutide; MDV-3100, Mometasone furoate/formoterol fumavate, Multiepitope CTL peptide vaccine, Mycophenolic acid sodium salt, Nabiximols, Natalizumab, Nesiritide; Obeticholic acid, Olmesartan medoxomil, Omalizumab, Omecamtiv mecarbil; Paclitaxel-eluting stent, Paliperidone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, Polymyxin B nonapeptide, PORxin-302, Prasugrel, Pregabalin, Pridopidine; Ranelic acid distrontium salt, Rasagiline mesilate, rDEN4delta30-4995, Recombinant human relaxin H2, rhFSH, Rilonacept, Rolofylline, Rosiglitazone maleate/metformin hydrochloride, Rosuvastatin calcium, Rotigotine; Salcaprozic acid sodium salt, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tapentadol hydrochloride, Temsirolimus, Tenofovir, Tenofovir disoproxil fumarate, Teriparatide, Tiotropium bromide, Tocilizumab, Tolvaptan, Tozasertib, Treprostinil sodium; Ustekinumab; Vardenafil hydrochloride hydrate, Varenicline tartrate, Vatalanib succinate, Voriconazole, Vorinostat; Zotarolimus-eluting stent. Copyright 2010 Prous
Tomillero, A; Moral, M A
2009-06-01
(+)-Dapoxetine hydrochloride; Abatacept, Adalimumab, Agalsidase beta, Alemtuzumab, Alglucosidase alfa, Aliskiren fumarate, Ambrisentan, Amlodipine, Aripiprazole, Atrasentan, Azacitidine, Azelnidipine; Belotecan hydrochloride, Bevacizumab, Bilastine, Biphasic insulin aspart, Bortezomib, Bosentan; Caspofungin acetate, CG-100649, Cinacalcet hydrochloride, Clindamycin phosphate/ benzoyl peroxide; Dasatinib, Denosumab, Duloxetine hydrochloride, Dutasteride, Dutasteride/tamsulosin; Ecogramostim, Eculizumab, Eltrombopag olamine, EndoTAG-1, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe; FAHF-2, Fondaparinux sodium; Gefitinib, Golimumab; HEV-239, HSV-TK; Imatinib mesylate, Indium 111 ((111)In) ibritumomab tiuxetan, Influenza vaccine(surface antigen, inactivated, prepared in cell culture), Insulin glargine; Kisspeptin-54; Lidocaine/prilocaine, Lomitapide; Maraviroc, Mirodenafil hydrochloride, MK-8141, MVA-Ag85A; Nilotinib hydrochloride monohydrate; Olmesartan medoxomil; Paclitaxel-eluting stent, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Pemetrexed disodium, Pitavastatin calcium, Prasugrel; Recombinant human relaxin H2, RHAMM R3 peptide, Rivaroxaban, Rosuvastatin calcium, RRz2; Sagopilone, Salinosporamide A, SB-509, Serlopitant, Sirolimus-eluting stent, Sorafenib, Sunitinib malate; Tadalafil, Temsirolimus, Teriparatide, TG-4010, Tositumomab/iodine (I131) tositumomab; Velusetrag Hydrochloride; Ximelagatran; Yttrium 90 (90Y) ibritumomab tiuxetan. Copyright 2009 Prous Science, S.A.U. or its licensors. All rights reserved.
Kang, Ju Hyung; Baik, Haing Woon; Yoo, Seung-Min; Kim, Joo Heon; Cheong, Hae Il; Park, Chung-Gyu; Kang, Hee Gyung; Ha, Il-Soo
2016-01-01
Renin, in addition to its activation of the renin-angiotensin system, binds to the (pro)renin receptor (PRR) and triggers inflammatory and fibrogenic signaling in tissue. In addition, aliskiren, a direct renin inhibitor, has been shown to affect IgG metabolism by altering PRR and neonatal Fc receptors (FcRns). We investigated the effect of aliskiren on proteinuria, glomerular extracellular matrix, expressions of fibronectin, transforming growth factor β1 (TGF-β1), PRR, FcRn and renal metabolism of IgG in a mice model of anti-glomerular basement membrane glomerulonephritis (anti-GBM GN). IgG deposition and expressions of FcRn and PRR were enhanced at glomeruli and urinary IgG levels increased in anti-GBM GN. Aliskiren attenuated anti-GBM GN with reduction of proteinuria and cortical expressions of fibronectin and TGF-β1. In addition, aliskiren suppressed the renal cortical expressions of FcRn and PRR. Aliskiren also reduced the glomerular IgG depositions and the urinary IgG levels albeit with increased circulating serum IgG levels. These results suggest that suppression of FcRn and PRR and regulation of IgG metabolism may be related to the attenuation of anti-GBM GN by aliskiren. © 2016 S. Karger AG, Basel.
Alemtuzumab improves contrast sensitivity in patients with relapsing–remitting multiple sclerosis
Galetta, Steven L; Palmer, Jeffrey; Margolin, David H; Rizzo, Marco; Bilbruck, John; Balcer, Laura J
2013-01-01
Background: Alemtuzumab is a monoclonal antibody directed against CD52 that depletes T and B lymphocytes. Objective: To evaluate the treatment effect of alemtuzumab on low-contrast vision in relapsing–remitting multiple sclerosis (RRMS) patients. Methods: This was a pre-defined exploratory analysis within a randomized, rater-blinded trial (CAMMS223) that was run at 49 academic medical centers in the US and in Europe. Patients with untreated, early, RRMS (McDonald, n = 334) were randomized 1:1:1 to subcutaneous interferon beta-1a (IFNB-1a), or alemtuzumab 12 mg or 24 mg. Visual contrast sensitivity was measured for each eye at baseline and quarterly, with Pelli-Robson charts. Results: The eyes of patients in the pooled alemtuzumab group (versus IFNB-1a) had a greater than 2-fold higher rate of both 3-month and 6-month sustained visual improvement, of at least 0.3 log units (2 triplets, 6 letters) (At 3 months the hazard ratio (HR) = 2.26; CI = 1.19 to 4.31; P = 0.013; and at 6 months the HR = 2.44; CI =1.16 to 5.15; P = 0.019), and they had a lower risk of 3- and 6-month sustained worsening of at least 0.15 log units (1 triplet, 3 letters) (At 3 months the HR = 0.58; CI = 0.38 to 0.89; P = 0.012; and at 6 months HR = 0.55; CI=0.35 to 0.87; P = 0.010). Over the 36-month study period, the eyes of patients in the pooled alemtuzumab group improved in mean contrast sensitivity to a greater extent than those in the IFNB-1a group (0.080 log units versus 0.038 log units; P = 0.0102). Conclusions: Alemtuzumab was associated with a greater chance of improved contrast sensitivity in patients with RRMS and may delay the worsening of visual function. Contrast sensitivity testing was sensitive to treatment effects, even within an active comparator study design. These results support the validity of low-contrast vision testing as a clinical outcome in MS trials. PMID:23459567
Rasmussen, Thomas A; McMahon, James; Chang, J Judy; Symons, Jori; Roche, Michael; Dantanarayana, Ashanti; Okoye, Afam; Hiener, Bonnie; Palmer, Sarah; Lee, Wen Shi; Kent, Stephen J; Van Der Weyden, Carrie; Prince, H Miles; Cameron, Paul U; Lewin, Sharon R
2017-08-24
To study the effects of alemtuzumab on HIV persistence in an HIV-infected individual on antiretroviral therapy (ART) with Sezary syndrome, a rare malignancy of CD4 T cells. Case report. Blood was collected 30 and 18 months prior to presentation with Sezary syndrome, at the time of presentation and during alemtuzumab. T-cell subsets in malignant (CD7-CD26-TCR-VBeta2+) and nonmalignant cells were quantified by flow cytometry. HIV-DNA in total CD4 T cells, in sorted malignant and nonmalignant CD4 T cells, was quantified by PCR and clonal expansion of HIV-DNA assessed by full-length next-generation sequencing. HIV-hepatitis B virus coinfection was diagnosed and antiretroviral therapy initiated 4 years prior to presentation with Sezary syndrome and primary cutaneous anaplastic large cell lymphoma. The patient received alemtuzumab 10 mg three times per week for 4 weeks but died 6 weeks post alemtuzumab. HIV-DNA was detected in nonmalignant but not in malignant CD4 T cells, consistent with expansion of a noninfected CD4 T-cell clone. Full-length HIV-DNA sequencing demonstrated multiple defective viruses but no identical or expanded sequences. Alemtuzumab extensively depleted T cells, including more than 1 log reduction in total T cells and more than 3 log reduction in CD4 T cells. Finally, alemtuzumab decreased HIV-DNA in CD4 T cells by 57% but HIV-DNA remained detectable at low levels even after depletion of nearly all CD4 T cells. Alemtuzumab extensively depleted multiple T-cell subsets and decreased the frequency of but did not eliminate HIV-infected CD4 T cells. Studying the effects on HIV persistence following immune recovery in HIV-infected individuals who require alemtuzumab for malignancy or in animal studies may provide further insights into novel cure strategies.
Investigation of the mechanism of action of alemtuzumab in a human CD52 transgenic mouse model
Hu, Yanping; Turner, Michael J; Shields, Jacqueline; Gale, Matthew S; Hutto, Elizabeth; Roberts, Bruce L; Siders, William M; Kaplan, Johanne M
2009-01-01
Alemtuzumab is a humanized monoclonal antibody against CD52, an antigen found on the surface of normal and malignant lymphocytes. It is approved for the treatment of B-cell chronic lymphocytic leukaemia and is undergoing Phase III clinical trials for the treatment of multiple sclerosis. The exact mechanism by which alemtuzumab mediates its biological effects in vivo is not clearly defined and mechanism of action studies have been hampered by the lack of cross-reactivity between human and mouse CD52. To address this issue, a transgenic mouse expressing human CD52 (hCD52) was created. Transgenic mice did not display any phenotypic abnormalities and were able to mount normal immune responses. The tissue distribution of hCD52 and the level of expression by various immune cell populations were comparable to those seen in humans. Treatment with alemtuzumab replicated the transient increase in serum cytokines and depletion of peripheral blood lymphocytes observed in humans. Lymphocyte depletion was not as profound in lymphoid organs, providing a possible explanation for the relatively low incidence of infection in alemtuzumab-treated patients. Interestingly, both lymphocyte depletion and cytokine induction by alemtuzumab were largely independent of complement and appeared to be mediated by neutrophils and natural killer cells because removal of these populations with antibodies to Gr-1 or asialo-GM-1, respectively, strongly inhibited the activity of alemtuzumab whereas removal of complement by treatment with cobra venom factor had no impact. The hCD52 transgenic mouse appears to be a useful model and has provided evidence for the previously uncharacterized involvement of neutrophils in the activity of alemtuzumab. PMID:19740383
Accelerated lymphocyte recovery after alemtuzumab does not predict multiple sclerosis activity.
Kousin-Ezewu, Onajite; Azzopardi, Laura; Parker, Richard A; Tuohy, Orla; Compston, Alastair; Coles, Alasdair; Jones, Joanne
2014-06-17
To test the hypothesis that accelerated peripheral blood mononuclear cell recovery after alemtuzumab treatment of multiple sclerosis is associated with recurrent disease activity and to investigate the claim that CD4 counts greater than 388.5 × 10(6) cells/mL at 12 months can be used to identify patients who may benefit from further treatment. A total of 108 patients were followed for a median of 99 months post alemtuzumab. Patients were classified as active or nonactive after each cycle of treatment based on clinical relapse, increasing disability, or new T2/enhancing MRI lesions. These outcomes were correlated with CD4, CD8, CD19, CD56+ NK, and monocyte counts. Of 108 patients, 56 (52%) relapsed at some point during follow-up. Mean annualized relapse rate after alemtuzumab was 0.17 vs 1.67 prior to treatment (equating to a 90% reduction). Of 108 patients, 28 (26%) met the criteria for sustained accumulation of disability. Median time to the lower limit of normal for CD19, CD8, and CD4 was 3, 19.5, and 32 months, respectively. There was no significant difference in the recovery of any cell population between patients with and without disease activity or accumulation of disability after treatment. This study does not support the use of cell counts as biomarkers for identifying patients at greater risk of active disease following treatment with alemtuzumab. © 2014 American Academy of Neurology.
Acute acalculous cholecystitis: A new safety risk for patients with MS treated with alemtuzumab.
Croteau, David; Flowers, Charlene; Kulick, Corrinne G; Brinker, Allen; Kortepeter, Cindy M
2018-05-01
To evaluate acute acalculous cholecystitis (AAC) as a potential safety risk for patients treated with alemtuzumab. The Food and Drug Administration Adverse Event Reporting System and the medical literature were searched for cases of AAC in conjunction with alemtuzumab for all clinical indications. Eight spontaneously reported cases meeting the case definition of AAC in close temporal association with alemtuzumab use were identified. Based on established criteria within the Food and Drug Administration Division of Pharmacovigilance for causality assessment, 4 cases were assessed as probable while 4 were possible. All cases occurred in patients with relapsing-remitting multiple sclerosis. Seven of the 8 cases presented with AAC during or shortly after alemtuzumab treatment, thereby suggesting an acute cytokine release syndrome as a putative pathogenic mechanism. The cases identified in this review differ from the typical AAC cases described in the medical literature based on female preponderance, lack of concurrent critical illnesses, inconsistent presence of other risk factors, and resolution with conservative treatment in the majority of cases. AAC represents a new and potentially life-threatening adverse event associated with alemtuzumab use in relapsing-remitting multiple sclerosis. In cases seen to date, early and conservative treatment resulted in good clinical outcome, although the natural history of AAC in this population without critical illness is not well defined. Awareness of this safety risk by general and specialty neurologists is important for prompt recognition and optimal management. © 2018 American Academy of Neurology.
Maggioni, Aldo P; Greene, Stephen J; Fonarow, Gregg C; Böhm, Michael; Zannad, Faiez; Solomon, Scott D; Lewis, Eldrin F; Baschiera, Fabio; Hua, Tsushung A; Gimpelewicz, Claudio R; Lesogor, Anastasia; Gheorghiade, Mihai
2013-10-01
The objective of the Aliskiren Trial on Acute Heart Failure Outcomes (ASTRONAUT) was to determine whether aliskiren, a direct renin inhibitor, would improve post-discharge outcomes in patients with hospitalization for heart failure (HHF) with reduced ejection fraction. Pre-specified subgroup analyses suggested potential heterogeneity in post-discharge outcomes with aliskiren in patients with and without baseline diabetes mellitus (DM). ASTRONAUT included 953 patients without DM (aliskiren 489; placebo 464) and 662 patients with DM (aliskiren 319; placebo 343) (as reported by study investigators). Study endpoints included the first occurrence of cardiovascular death or HHF within 6 and 12 months, all-cause death within 6 and 12 months, and change from baseline in N-terminal pro-B-type natriuretic peptide (NT-proBNP) at 1, 6, and 12 months. Data regarding risk of hyperkalaemia, renal impairment, and hypotension, and changes in additional serum biomarkers were collected. The effect of aliskiren on cardiovascular death or HHF within 6 months (primary endpoint) did not significantly differ by baseline DM status (P = 0.08 for interaction), but reached statistical significance at 12 months (non-DM: HR: 0.80, 95% CI: 0.64-0.99; DM: HR: 1.16, 95% CI: 0.91-1.47; P = 0.03 for interaction). Risk of 12-month all-cause death with aliskiren significantly differed by the presence of baseline DM (non-DM: HR: 0.69, 95% CI: 0.50-0.94; DM: HR: 1.64, 95% CI: 1.15-2.33; P < 0.01 for interaction). Among non-diabetics, aliskiren significantly reduced NT-proBNP through 6 months and plasma troponin I and aldosterone through 12 months, as compared to placebo. Among diabetic patients, aliskiren reduced plasma troponin I and aldosterone relative to placebo through 1 month only. There was a trend towards differing risk of post-baseline potassium ≥6 mmol/L with aliskiren by underlying DM status (non-DM: HR: 1.17, 95% CI: 0.71-1.93; DM: HR: 2.39, 95% CI: 1.30-4.42; P = 0.07 for interaction
Alemtuzumab induction with tacrolimus monotherapy in de novo renal transplantation.
Villanueva, M E; Muñoz, A S; Casasola, C C; Africa, J B; Danguilan, R A; Ona, E T
2008-09-01
Alemtuzumab is increasingly being used as induction therapy for kidney transplantation, allowing immunosuppression minimization. This study examined the efficacy of alemtuzumab induction followed by low-dose tacrolimus monotherapy in standard risk primary kidney transplant patients. This retrospective cohort of primary standard risk renal transplant recipients were given alemtuzumab induction and low-dose tacrolimus maintenance immunosuppression (target trough 7 to 10 ng/mL for the first 6 months and 5 to 7 ng/mL thereafter). Serum creatinine values, acute rejection episodes, and graft survival were noted at week 1 as well as months 3, 6, 12, and 18. At the time of analysis, 47 patients were at 6 months, 28 at 12 months, and 6 patients at 18 months from transplant. Mean follow-up was 12.53 months (range, 6 to 23). Mean serum creatinine was 1.47 +/- 0.65 mg/dL at 3 months, 1.56 +/- 0.84 at 6 months, 1.45 +/- 0.37 at 12 months, and 1.74 +/- 0.35 at 18 months. The 1-year clinical acute rejection rate was 21% (6/28), occurring at 0 to 3 months in 2 (33%), 4 to 6 months in 1 (17%), and >6 months in 3 patients (50%). Biopsy-proven acute rejection was 14% (4/28). The episodes were classified as borderline in one, Banff 2A in two, and Banff 3 in one patients. One patient had both acute cellular and acute humoral rejection; half responded to steroid pulse therapy. The 1-year patient survival rate was 90%. The 1-year death-censored graft survival rate was 98%. Alemtuzumab induction with tacrolimus monotherapy is an acceptable option in standard risk patients. BPAR was 14%, but renal function remained satisfactory at 18 months posttransplant.
Schroten, Nicolas F; Damman, Kevin; Hemmelder, Marc H; Voors, Adriaan A; Navis, Gerjan; Gaillard, Carlo A J M; van Veldhuisen, Dirk J; Van Gilst, Wiek H; Hillege, Hans L
2015-05-01
We examined the effect of the renin inhibitor, aliskiren, on renal blood flow (RBF) in patients with heart failure with reduced ejection fraction (HFREF) and decreased glomerular filtration rate (GFR). Renal blood flow is the main determinant of GFR in HFREF patients. Both reduced GFR and RBF are associated with increased mortality. Aliskiren can provide additional renin-angiotensin-aldosterone system inhibition and increases RBF in healthy individuals. Patients with left ventricular ejection fraction ≤45% and estimated GFR 30 to 75 mL/min per 1.73 m(2) on optimal medical therapy were randomized 2:1 to receive aliskiren 300 mg once daily or placebo. Renal blood flow and GFR were measured using radioactive-labeled (125)I-iothalamate and (131)I-hippuran at baseline and 26 weeks. After 41 patients were included, the trial was halted based on an interim safety analysis showing futility. Mean age was 68 ± 9 years, 82% male, GFR (49 ± 16 mL/min per 1.73 m(2)), RBF (294 ± 77 mL/min per 1.73 m(2)), and NT-proBNP 999 (435-2040) pg/mL. There was a nonsignificant change in RBF after 26 weeks in the aliskiren group compared with placebo (-7.1 ± 30 vs +14 ± 54 mL/min per 1.73 m(2); P = .16). However, GFR decreased significantly in the aliskiren group compared with placebo (-2.8 ± 6.0 vs +4.4 ± 9.6 mL/min per 1.73 m(2); P = .01) as did filtration fraction (-2.2 ± 3.3 vs +1.1 ± 3.1%; P = .01). There were no significant differences in plasma aldosterone, NT-proBNP, urinary tubular markers, or adverse events. Plasma renin activity was markedly reduced in the aliskiren group versus placebo throughout the treatment phase (P = .007). Adding aliskiren on top of optimal HFREF medical therapy did not improve RBF and was associated with a reduction of GFR and filtration fraction. Copyright © 2015 Mosby, Inc. All rights reserved.
Clark, Rachael A.; Watanabe, Rei; Teague, Jessica E.; Schlapbach, Christoph; Tawa, Marianne C.; Adams, Natalie; Dorosario, Andrew A.; Chaney, Keri S.; Cutler, Corey S.; LeBoeuf, Nicole R.; Carter, Joi B.; Fisher, David C.; Kupper, Thomas S.
2012-01-01
CTCL is a cancer of skin homing T cells with variants that include leukemic CTCL (L-CTCL), a malignancy of central memory T cells (TCM), and mycosis fungoides (MF), a malignancy of skin resident effector memory T cells (TEM). We report that low-dose alemtuzumab (αCD52) effectively treated patients with refractory L-CTCL but not MF. Alemtuzumab depleted all T cells in blood and depleted both benign and malignant TCM from skin, but a diverse population of skin resident TEM remained in skin after therapy. T-cell depletion with alemtuzumab required the presence of neutrophils, a cell type frequent in blood but rare in normal skin. These data suggest that TCM were depleted because they recirculate between the blood and skin whereas skin resident TEM were spared because they are sessile and non-recirculating. After alemtuzumab treatment, skin T cells produced lower amounts of IL-4 and higher amounts of IFNγ. Moreover, there was a marked lack of infections in alemtuzumab-treated L-CTCL patients despite the complete absence of T cells in blood, suggesting that skin resident TEM can protect the skin from pathogens even in the absence of T cell recruitment from the circulation. Together, these data suggest that alemtuzumab may treat refractory L-CTCL without severely compromising the immune response to infection by depleting circulating TCM but sparing the skin resident TEM that provide local immune protection of the skin. PMID:22261031
Limoges, D; Dieterich, H A; Yeh, C-M; Vaidyanathan, S; Howard, D; Dole, W P
2008-05-01
To evaluate the dose-proportionality of the pharmacokinetics of aliskiren, the first in a new class of orally active direct renin inhibitors approved for the treatment of hypertension. This was an open-label, single-center, single-dose, randomized, 4-period crossover study. Following a 21-day screening period, 32 healthy male or female subjects (ages 18 - 45 years) were randomized to 1 of 4 aliskiren dosing sequence groups (8 subjects per group): 75, 150, 300 and 600 mg. Blood samples were obtained for determination of plasma aliskiren concentrations (HPLC/MS/MS) for 96 h post dose. Log-transformed pharmacokinetic parameters AUC and C(max) were analyzed to determine dose-proportionality using the power model, parameter = A*(Dose)(beta), where A = intercept and beta = dose-proportionality coefficient. The predefined dose-proportionality criteria over the dose range 75 â 600 mg were 90% confidence intervals (CI) for beta contained within the range 0.89 - 1.11. AUC and Cmax values increased with increasing doses of aliskiren. Both AUC and C(max) were associated with high variability (coefficient of variation 55 - 64% for AUC and 59 - 117% for C(max)). The estimated proportionality coefficients (beta) for AUC(0-infiniti), AUC(0-t) and C(max) were 1.18 (90% CI 1.10, 1.25), 1.29 (90% CI 1.22, 1.36) and 1.42 (90% CI 1.31, 1.52), respectively. Dose-proportionality was, therefore, not demonstrated across the entire 8-fold dose range. For the clinical dose range of 150 â 300 mg, increases of 2.3- and 2.6-fold were observed for AUC and C(max), respectively. All doses of aliskiren were well tolerated. Exposure to aliskiren was greater than proportional over the dose range of 75 - 600 mg. Over the therapeutic dose range of 150 â 300 mg approved for the treatment of hypertension, AUC and Cmax increased by 2.3- and 2.6-fold, respectively. The pharmacokinetics of aliskiren show relatively high intersubject variability.
Cherney, David Z I; Reich, Heather N; Scholey, James W; Daneman, Denis; Mahmud, Farid H; Har, Ronnie L H; Sochett, Etienne B
2013-10-01
Acute clamped hyperglycaemia activates the renin-angiotensin-aldosterone system (RAAS) and increases the urinary excretion of inflammatory cytokines/chemokines in patients with uncomplicated type 1 diabetes mellitus. Our objective was to determine whether blockade of the RAAS would blunt the effect of acute hyperglycaemia on urinary cytokine/chemokine excretion, thereby giving insights into potentially protective effects of these agents prior to the onset of clinical nephropathy. Blood pressure, renal haemodynamic function (inulin and para-aminohippurate clearances) and urinary cytokines/chemokines were measured after 6 h of clamped euglycaemia (4-6 mmol/l) and hyperglycaemia (9-11 mmol/l) on two consecutive days in patients with type 1 diabetes mellitus (n = 27) without overt nephropathy. Measurements were repeated after treatment with aliskiren (300 mg daily) for 30 days. Before aliskiren, clamped hyperglycaemia increased filtration fraction (from 0.188 ± 0.007 to 0.206 ± 0.007, p = 0.003) and urinary fibroblast growth factor-2 (FGF2), IFN-α2 and macrophage-derived chemokine (MDC) (p < 0.005). After aliskiren, the filtration fraction response to hyperglycaemia was abolished, resulting in a lower filtration fraction after aliskiren under clamped hyperglycaemic conditions (p = 0.004), and none of the biomarkers increased in response to hyperglycaemia. Aliskiren therapy also reduced levels of urinary eotaxin, FGF2, IFN-α2, IL-2 and MDC during clamped hyperglycaemia (p < 0.005). The increased urinary excretion of inflammatory cytokines/chemokines in response to acute hyperglycaemia is blunted by RAAS blockade in humans with uncomplicated type 1 diabetes mellitus.
Clark, Rachael A; Watanabe, Rei; Teague, Jessica E; Schlapbach, Christoph; Tawa, Marianne C; Adams, Natalie; Dorosario, Andrew A; Chaney, Keri S; Cutler, Corey S; Leboeuf, Nicole R; Carter, Joi B; Fisher, David C; Kupper, Thomas S
2012-01-18
Cutaneous T cell lymphoma (CTCL) is a cancer of skin-homing T cells with variants that include leukemic CTCL (L-CTCL), a malignancy of central memory T cells (T(CM)), and mycosis fungoides (MF), a malignancy of skin resident effector memory T cells (T(EM)). We report that low-dose alemtuzumab (αCD52) effectively treated patients with refractory L-CTCL but not MF. Alemtuzumab depleted all T cells in blood and depleted both benign and malignant T(CM) from skin, but a diverse population of skin resident T(EM) remained in skin after therapy. T cell depletion with alemtuzumab required the presence of neutrophils, a cell type frequent in blood but rare in normal skin. These data suggest that T(CM) were depleted because they recirculate between the blood and the skin, whereas skin resident T(EM) were spared because they are sessile and non-recirculating. After alemtuzumab treatment, skin T cells produced lower amounts of interleukin-4 and higher amounts of interferon-γ. Moreover, there was a marked lack of infections in alemtuzumab-treated L-CTCL patients despite the complete absence of T cells in the blood, suggesting that skin resident T(EM) can protect the skin from pathogens even in the absence of T cell recruitment from the circulation. Together, these data suggest that alemtuzumab may treat refractory L-CTCL without severely compromising the immune response to infection by depleting circulating T(CM) but sparing the skin resident T(EM) that provide local immune protection of the skin.
Serebruany, V L; Malinin, A; Barsness, G; Vahabi, J; Atar, D
2008-05-01
Aliskiren, an octanamide, is nonpeptide, low molecular weight, orally active renin inhibitor effectively preventing angiotensin and aldosterone release. This drug has been recently approved for the treatment of hypertension. Considering potential links between hypertension, platelets, the coagulation cascade and fibrinolysis we sought to evaluate the effect of aliskiren on human biomarkers of hemostasis. In vitro effects of whole blood preincubation with escalating concentrations of aliskiren (500, 1,000 and 2,000 ng ml(-1)) were assessed in 20 aspirin-naive volunteers with multiple risk factors for vascular disease. A total of 33 biomarkers were measured, of which 18 are related to platelet function, 12 to coagulation and 3 to fibrinolysis. Pretreatment of blood samples with aliskiren 500 ng ml(-1) resulted in a significant increase of antithrombin-III (AT-III) activity (P=0.003). All other tested biomarkers were not significantly affected. Spiking whole blood with the higher aliskiren doses was associated with various trends in biomarker activity, where 1000 ng ml(-1) concentration mostly decreased (7/33), and 2,000 ng ml(-1) mostly increased (6/33) some biomarkers. In the therapeutic concentration of 500 ng ml(-1) aliskiren does not affect hemostatic biomarkers, except for a moderate but highly significant (P=0.003) increase of AT-III activity. Higher aliskiren doses were associated with more profound biomarker changes, but they are likely not to be clinically relevant since they show diverging (that is, both mild antiplatelet and platelet-activating) trends, and considering the 2- to 4-fold safety margin. It is suggested that antithrombotic properties of aliskiren be explored further in an ex vivo clinical setting.
Treatment of Sézary Syndrome With Alemtuzumab: A Series of 5 Cases and a Review of the Literature.
del Alcázar-Viladomiu, E; Tuneu-Valls, A; López-Pestaña, A; Vidal-Manceñido, M J
2015-09-01
Alemtuzumab is a monoclonal antibody that has been used to treat refractory cases of Sézary syndrome (SS) and advanced mycosis fungoides. We present 5 patients with SS who were treated with alemtuzumab between 2008 and 2012, with an overall response rate of 80% (40% partial response and 40% complete response). A regimen of 10mg administered subcutaneously was well tolerated with acceptable toxicity. The median duration of response was 13 months. However, one patient remains in complete remission after 67 months, a remarkable outcome given the low survival rate associated with SS. In conclusion, we believe that alemtuzumab may be useful in cases of SS refractory to other treatments. As there are no curative treatments for SS, alemtuzumab should be considered as a therapeutic option. Copyright © 2014 Elsevier España, S.L.U. y AEDV. All rights reserved.
Aliskiren: a novel renoprotective agent or simply an alternative to ACE inhibitors?
Wiggins, Kathryn J; Kelly, Darren J
2009-07-01
Chronic kidney disease (CKD) is a common condition that is increasing in prevalence in developed nations. The economic and psychosocial costs of CKD are considerable, and are associated with high levels of morbidity and mortality. Specific treatments do not exist for many causes of CKD. Therefore, treatment is reliant on the introduction of therapies that retard progression of structural renal damage and renal impairment. At present, aside from judicious use of antihypertensive agents to lower blood pressure, and possibly low-protein diets and statin therapy, blockade of the renin-angiotensin-aldosterone system (RAAS) with angiotensin-converting enzyme inhibitors (ACEis) and angiotensin II receptor blockers (ARBs) are the only widely available treatments. Although these measures attenuate the inexorable progression to renal failure, they do not halt it. One limiting factor may be feedback effects of ACEis and ARBs, such as increased plasma renin activity. Aliskiren is a newer agent that inhibits renin, the rate-limiting step in the RAAS. There are several theoretical reasons to suggest that aliskiren may have renoprotective actions superior to those of ACEis and ARBs. In this paper the available evidence regarding renoprotective effects of aliskiren is reviewed, with an emphasis on comparison with ACEis and ARBs.
Hwang, Ji-Won; Kim, Eun Kyoung; Jang, Shin Yi; Chung, Tae-Young; Ki, Chang-Seok; Sung, Kiick; Kim, Sung Mok; Ahn, Joonghyun; Carriere, Keumhee; Choe, Yeon Hyeon; Chang, Sung-A; Kim, Duk-Kyung
2017-11-29
The aim of this study was to evaluate the effect of aliskiren on aortic stiffness in patients with Marfan syndrome (MS). Twenty-eight MS patients (mean age ± standard deviation: 32.6 ± 10.6 years) were recruited from November 2009 to October 2014. All patients were receiving atenolol as standard beta-blocker therapy. A prospective randomization process was performed to assign participants to either aliskiren treatment (150-300mg orally per day) or no aliskiren treatment (negative control) in an open-label design. Central aortic distensibility and central pulsed wave velocity (PWV) by magnetic resonance imaging (MRI), peripheral PWV, central aortic blood pressure and augmentation index by peripheral tonometry, and aortic dilatation by echocardiography were examined initially and after 24 weeks. The primary endpoint was central aortic distensibility by MRI. In analyses of differences between baseline and 24 weeks for the aliskiren treatment group vs the negative control group, central distensibility (overall; P = .26) and central PWV (0.2 ± 0.9 vs 0.03 ± 0.7 [m/s]; P = .79) by MRI were not significantly different. Central systolic aortic blood pressure tended to be lower by 14mmHg in patients in the aliskiren treatment group than in the control group (P = .09). A significant decrease in peripheral PWV (brachial-ankle PWV) in the aliskiren treatment group (-1.6 m/s) compared with the control group (+0.28 m/s) was noted (P = .005). Among patients with MS, the addition of aliskiren to beta-blocker treatment did not significantly improve central aortic stiffness during a 24-week period. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
Arroyo González, Rafael; Kita, Mariko; Crayton, Heidi; Havrdova, Eva; Margolin, David H; Lake, Stephen L; Giovannoni, Gavin
2017-09-01
Alemtuzumab was superior on clinical and magnetic resonance imaging (MRI) outcomes versus subcutaneous interferon beta-1a in phase 3 trials in patients with relapsing-remitting multiple sclerosis. To examine quality-of-life (QoL) outcomes in the alemtuzumab phase 3 trials. Patients who were treatment naive (Comparison of Alemtuzumab and Rebif ® Efficacy in Multiple Sclerosis I [CARE-MS I]) or had an inadequate response to prior therapy (CARE-MS II) received annual courses of alemtuzumab 12 mg/day at baseline (5 days) and Month 12 (3 days) or subcutaneous interferon beta-1a 44 µg three times/week. QoL was measured every 6 or 12 months using Functional Assessment of Multiple Sclerosis (FAMS), European Quality of Life-5 Dimensions (EQ-5D) and its visual analog scale (EQ-VAS), and 36-Item Short-Form Survey (SF-36). Statistically significant improvements from baseline with alemtuzumab were observed on all three QoL instruments at the earliest post-baseline assessment and sustained through Year 2. Statistically significant greater QoL improvements over subcutaneous interferon beta-1a were seen at all time points in CARE-MS II with FAMS, EQ-VAS and SF-36 physical component summary, and in CARE-MS I with FAMS. Patients treated with alemtuzumab had improvements in physical, mental, and emotional QoL regardless of treatment history. Improvements were significantly greater with alemtuzumab versus subcutaneous interferon beta-1a on both disease-specific and general measures of QoL.
Kalincik, Tomas; Brown, J William L; Robertson, Neil; Willis, Mark; Scolding, Neil; Rice, Claire M; Wilkins, Alastair; Pearson, Owen; Ziemssen, Tjalf; Hutchinson, Michael; McGuigan, Christopher; Jokubaitis, Vilija; Spelman, Tim; Horakova, Dana; Havrdova, Eva; Trojano, Maria; Izquierdo, Guillermo; Lugaresi, Alessandra; Prat, Alexandre; Girard, Marc; Duquette, Pierre; Grammond, Pierre; Alroughani, Raed; Pucci, Eugenio; Sola, Patrizia; Hupperts, Raymond; Lechner-Scott, Jeannette; Terzi, Murat; Van Pesch, Vincent; Rozsa, Csilla; Grand'Maison, François; Boz, Cavit; Granella, Franco; Slee, Mark; Spitaleri, Daniele; Olascoaga, Javier; Bergamaschi, Roberto; Verheul, Freek; Vucic, Steve; McCombe, Pamela; Hodgkinson, Suzanne; Sanchez-Menoyo, Jose Luis; Ampapa, Radek; Simo, Magdolna; Csepany, Tunde; Ramo, Cristina; Cristiano, Edgardo; Barnett, Michael; Butzkueven, Helmut; Coles, Alasdair
2017-04-01
Alemtuzumab, an anti-CD52 antibody, is proven to be more efficacious than interferon beta-1a in the treatment of relapsing-remitting multiple sclerosis, but its efficacy relative to more potent immunotherapies is unknown. We compared the effectiveness of alemtuzumab with natalizumab, fingolimod, and interferon beta in patients with relapsing-remitting multiple sclerosis treated for up to 5 years. In this international cohort study, we used data from propensity-matched patients with relapsing-remitting multiple sclerosis from the MSBase and six other cohorts. Longitudinal clinical data were obtained from 71 MSBase centres in 21 countries and from six non-MSBase centres in the UK and Germany between Nov 1, 2015, and June 30, 2016. Key inclusion criteria were a diagnosis of definite relapsing-remitting multiple sclerosis, exposure to one of the study therapies (alemtuzumab, interferon beta, fingolimod, or natalizumab), age 65 years or younger, Expanded Disability Status Scale (EDSS) score 6·5 or lower, and no more than 10 years since the first multiple sclerosis symptom. The primary endpoint was annualised relapse rate. The secondary endpoints were cumulative hazards of relapses, disability accumulation, and disability improvement events. We compared relapse rates with negative binomial models, and estimated cumulative hazards with conditional proportional hazards models. Patients were treated between Aug 1, 1994, and June 30, 2016. The cohorts consisted of 189 patients given alemtuzumab, 2155 patients given interferon beta, 828 patients given fingolimod, and 1160 patients given natalizumab. Alemtuzumab was associated with a lower annualised relapse rate than interferon beta (0·19 [95% CI 0·14-0·23] vs 0·53 [0·46-0·61], p<0·0001) and fingolimod (0·15 [0·10-0·20] vs 0·34 [0·26-0·41], p<0·0001), and was associated with a similar annualised relapse rate as natalizumab (0·20 [0·14-0·26] vs 0·19 [0·15-0·23], p=0·78). For the disability outcomes
Zhang, Y; Wang, L; Song, Y; Zhao, X; Wong, M S; Zhang, W
2016-03-01
The skeletal renin-angiotensin system contributes to the development of osteoporosis. The renin inhibitor aliskiren exhibited beneficial effects on trabecular bone of osteoporotic mice, and this action might be mediated through angiotensin and bradykinin receptor pathways. This study implies the potential application of renin inhibitor in the management for postmenopausal osteoporosis. The skeletal renin-angiotensin system plays key role in the pathological process of osteoporosis. The present study is designed to elucidate the effect of renin inhibitor aliskiren on trabecular bone and its potential action mechanism in ovariectomized (OVX) mice. The OVX mice were treated with low dose (5 mg/kg) or high dose (25 mg/kg) of aliskiren or its vehicle for 8 weeks. The bone turnover markers were measured by ELISA. The structural parameters of trabecular bone at lumbar vertebra (LV) and distal femoral metaphysis were measured by micro-CT. The expression of messenger RNA (mRNA) and protein was studied by RT-PCR and immunoblotting, respectively. Aliskiren treatment reduced urinary excretion of calcium and serum level of tartrate-resistant acid phosphatase in OVX mice. The treatment with aliskiren significantly increased bone volume (BV/TV) and connectivity density (Conn.D) of trabecular bone at LV-2 and LV-5 as well as dramatically enhanced BV/TV, Conn.D, bone mineral density (BMD/BV) and decreased bone surface (BS/BV) at the distal femoral end. Aliskiren significantly down-regulated the expression of angiotensinogen, angiotensin II (Ang II), Ang II type 1 receptor, bradykinin receptor (BR)-1, and osteocytic-specific gene sclerostin as well as the osteoclast-specific genes, including carbonic anhydrase II, matrix metalloproteinase-9, and cathepsin K. This study revealed that renin inhibitor aliskiren exhibited the beneficial effects on trabecular bone of ovariectomy-induced osteoporotic mice, and the underlying mechanism for this action might be mediated through Ang II and
Tomillero, A; Moral, M A
2010-01-01
(-)-Epigallocatechin gallate, Abafungin, ACE-031, Adapalene/benzoyl peroxide, AE-37, Aflibercept, AGS-003, Albiglutide, Alemtuzumab, Aliskiren fumarate, ALT-801, AN-2728, Anacetrapib, API, Aprepitant, ARQ-197, Ascorbic acid, Atazanavir sulfate, ATN-224, AVI-4658, Azacitidine, Azelnidipine; Belinostat, Bevacizumab, BI-2536, Biphasic insulin aspart, Bortezomib, Bovine lactoferrin, Bryostatin 1, Budesonide/formoterol fumarate; cAC10, Canfosfamide hydrochloride, Cediranib, Clofarabine, Cocaine conjugate vaccine; Darbepoetin alfa, Dasatinib, Denosumab, Disomotide, Doripenem, Dovitinib Lactate, Dronedarone hydrochloride, Drospirenone/estradiol, Dutasteride; Ecogramostim, Entinostat, Enzastaurin hydrochloride, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fampridine, Fenretinide LXS, FFR-factor VIIa, Fingolimod hydrochloride, Frovatriptan; Gefitinib, Gimatecan, GP-2/GM-CSF; Iloperidone, Imatinib mesylate, Indibulin, Ipilimumab, Ivabradine hydrochloride; Lactobacillus rhamnosus, Lapatinib ditosylate, LC-07, Lenalidomide, Linifanib, Liposomal doxorubicin, Liposomal vincristine, Litenimod, Lutein; M-118, MDX-1401, MEDI-528, Midostaurin, Miglustat, MK-0657; Natalizumab, Nesiritide, NGR-TNF, Niacin/simvastatin; Obatoclax mesylate, Olaparib, Omacetaxine mepesuccinate; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Palonosetron hydrochloride, Pazopanib hydrochloride, Pegfilgrastim, Pemetrexed disodium, PER.C-flu, Perifosine, PF-02341066, Pimecrolimus, Pitrakinra, Plerixafor hydrochloride, Posaconazole; Rasburicase, Recombinant human relaxin H2, ReoT3D, Retaspimycin hydrochloride, Riferminogene pecaplasmid, Rindopepimut, Romiplostim, Ronacaleret hydrochloride, Rosuvastatin calcium, Rotigotine; Sagopilone, sALP-FcD10, SAR-245409, SCH-697243, Selumetinib, Sirolimus-eluting stent, SIR-Spheres, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tandutinib, Tasimelteon, Temsirolimus, Teriparatide
Rao, Sambasiva P.; Sancho, Jose; Campos-Rivera, Juanita; Boutin, Paula M.; Severy, Peter B.; Weeden, Timothy; Shankara, Srinivas; Roberts, Bruce L.; Kaplan, Johanne M.
2012-01-01
Alemtuzumab is a monoclonal antibody that targets cell surface CD52 and is effective in depleting lymphocytes by cytolytic effects in vivo. Although the cytolytic effects of alemtuzumab are dependent on the density of CD52 antigen on cells, there is scant information regarding the expression levels of CD52 on different cell types. In this study, CD52 expression was assessed on phenotypically distinct subsets of lymphoid and myeloid cells in peripheral blood mononuclear cells (PBMCs) from normal donors. Results demonstrate that subsets of PBMCs express differing levels of CD52. Quantitative analysis showed that memory B cells and myeloid dendritic cells (mDCs) display the highest number while natural killer (NK) cells, plasmacytoid dendritic cells (pDCs) and basophils have the lowest number of CD52 molecules per cell amongst lymphoid and myeloid cell populations respectively. Results of complement dependent cytolysis (CDC) studies indicated that alemtuzumab mediated profound cytolytic effects on B and T cells with minimal effect on NK cells, basophils and pDCs, correlating with the density of CD52 on these cells. Interestingly, despite high CD52 levels, mDCs and monocytes were less susceptible to alemtuzumab-mediated CDC indicating that antigen density alone does not define susceptibility. Additional studies indicated that higher expression levels of complement inhibitory proteins (CIPs) on these cells partially contributes to their resistance to alemtuzumab mediated CDC. These results indicate that alemtuzumab is most effective in depleting cells of the adaptive immune system while leaving innate immune cells relatively intact. PMID:22761788
21 CFR 172.350 - Fumaric acid and salts of fumaric acid.
Code of Federal Regulations, 2010 CFR
2010-04-01
... Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) FOOD ADDITIVES PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric...
21 CFR 172.350 - Fumaric acid and salts of fumaric acid.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... special dietary use, when the use is consistent with good nutrition practice. ...
21 CFR 172.350 - Fumaric acid and salts of fumaric acid.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... as a source of iron in foods for special dietary use, when the use is consistent with good nutrition...
21 CFR 172.350 - Fumaric acid and salts of fumaric acid.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Fumaric acid and salts of fumaric acid. 172.350 Section 172.350 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... as a source of iron in foods for special dietary use, when the use is consistent with good nutrition...
Alemtuzumab-induced thyroid dysfunction exhibits distinctive clinical and immunological features.
Pariani, Nadia; Willis, Mark; Muller, Ilaria; Healy, Sarah; Nasser, Taha; McGowan, Anne; Lyons, Greta; Jones, Joanne; Chatterjee, Krishna; Dayan, Colin; Robertson, Neil; Coles, Alasdair; Moran, Carla
2018-06-06
Alemtuzumab, a highly effective treatment for multiple sclerosis (MS), predisposes to Graves' disease (GD) with a reportedly indolent course. To determine the type, frequency and course of thyroid dysfunction (TD) in a cohort of alemtuzumab-treated MS patients in the UK. Case records of alemtuzumab-treated patients who developed TD were reviewed. 41.1% (102/248; 80F, 22M) of patients developed TD, principally GD (71.6%). Median onset was 17 months (range 2-107) following last dose; the majority (89%) within 3 years. Follow-up data (range 6-251 months) was available in 71 cases, of whom 52 (73.2%) developed GD: 10 of these (19.2%) had fluctuating TD. All 52 GD patients commenced anti-thyroid drugs (ATD): 3 required radioiodine (RAI) due to ATD side-effects, drug therapy is ongoing in 2; of those who completed a course, 16 are in remission, 1 developed spontaneous hypothyroidism, and 30 (64%) required definitive or long-term treatment (RAI n=17, thyroidectomy n=5, long-term ATDs n=8). 3 cases of thyroiditis and 16 cases of hypothyroidism were documented; 5 with anti-TPO antibody positivity only, 10 with positive TRAb, 1 hypothyroidism (uncertain aetiology). Bioassay confirmed both stimulating and blocking TRAb in a subset of fluctuating GD cases. Contrary to published literature, we have recorded frequent occurrence of GD that required definitive or prolonged antithyroid drug treatment. Furthermore, fluctuating thyroid status in GD and unexpectedly high frequency of TRAb-positive hypothyroidism suggested changing activity of TRAb in this clinical context; we have documented the existence of both blocking and stimulating TRAb in these patients.
21 CFR 172.826 - Sodium stearyl fumarate.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...
21 CFR 172.826 - Sodium stearyl fumarate.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...
21 CFR 172.826 - Sodium stearyl fumarate.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... Sodium stearyl fumarate. Sodium stearyl fumarate may be safely used in food in accordance with the following conditions: (a) It contains not less than 99 percent sodium stearyl fumarate calculated on the...
21 CFR 172.826 - Sodium stearyl fumarate.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...
Hopfinger, Georg; Busch, Raymonde; Pflug, Natali; Weit, Nicole; Westermann, Anne; Fink, Anna-Maria; Cramer, Paula; Reinart, Nina; Winkler, Dirk; Fingerle-Rowson, Günter; Stilgenbauer, Stephan; Döhner, Hartmut; Kandler, Gabriele; Eichhorst, Barbara; Hallek, Michael; Herling, Marco
2013-06-15
Scarce systematic trial data have prevented uniform therapeutic guidelines for T-cell prolymphocytic leukemia (T-PLL). A central need in this historically refractory tumor is the controlled evaluation of multiagent chemotherapy and its combination with the currently most active single agent, alemtuzumab. This prospective multicenter phase 2 trial assessed response, survival, and toxicity of a novel regimen in previously treated (n = 9) and treatment-naive (n = 16) patients with T-PLL. Induction by fludarabine, mitoxantrone, and cyclophosphamide (FMC), for up to 4 cycles, was followed by alemtuzumab (A) consolidation, up to 12 weeks. Of the 25 patients treated with FMC, 21 subsequently received alemtuzumab. Overall response rate to FMC was 68%, comprising 6 complete remissions (all bone-marrow confirmed) and 11 partial remissions. Alemtuzumab consolidation increased the intent-to-treat overall response rate to 92% (12 complete remissions; 11 partial remissions). Median overall survival after FMC-A was 17.1 months and median progression-free survival was 11.9 months. Progression-free survival tended to be shorter for patients with high-level T-cell leukemia 1 oncoprotein expression. Hematologic toxicities were the most frequent grade 3/4 side effects under FMC-A. Exclusively in the 21 alemtuzumab-consolidated patients, 13 cytomegalovirus reactivations were observed; 9 of these 13 represented a clinically relevant infection. FMC-A is a safe and efficient protocol in T-PLL, which compares favorably to published data. Copyright © 2013 American Cancer Society.
Montgomery, Stephen M; Kusel, Jeanette; Nicholas, Richard; Adlard, Nicholas
2017-09-01
Patients with relapsing-remitting multiple sclerosis (RRMS) treated with disease modifying therapies (DMTs) who continue to experience disease activity may be considered for escalation therapies such as fingolimod, or may be considered for alemtuzumab. Previous economic modeling used Markov models; applying one alternative technique, discrete event simulation (DES) modeling, allows re-treatment and long-term adverse events (AEs) to be included in the analysis. A DES was adapted to model relapse-triggered re-treatment with alemtuzumab and the effect of including ongoing quality-adjusted life year (QALY) decrements for AEs that extend beyond previous 1-year Markov cycles. As the price to the NHS of fingolimod in the UK is unknown, due to a confidential patient access scheme (PAS), a variety of possible discounts were tested. The interaction of re-treatment assumptions for alemtuzumab with the possible discounts for fingolimod was tested to determine which DMT resulted in lower lifetime costs. The lifetime QALY results were derived from modeled treatment effect and short- and long-term AEs. Most permutations of fingolimod PAS discount and alemtuzumab re-treatment rate resulted in fingolimod being less costly than alemtuzumab. As the percentage of patients who are re-treated with alemtuzumab due to experiencing a relapse approaches 100% of those who relapse whilst on treatment, the discount required for fingolimod to be less costly drops below 5%. Consideration of treatment effect alone found alemtuzumab generated 0.2 more QALYs/patient; the inclusion of AEs up to a duration of 1 year reduced this advantage to only 0.14 QALYs/patient. Modeling AEs with a lifetime QALY decrement found that both DMTs generated very similar QALYs with the difference only 0.04 QALYs/patient. When the model captured alemtuzumab re-treatment and long-term AE decrements, it was found that fingolimod is cost-effective compared to alemtuzumab, assuming application of only a modest level of
Solomon, Scott D; Appelbaum, Evan; Manning, Warren J; Verma, Anil; Berglund, Tommy; Lukashevich, Valentina; Cherif Papst, Cheraz; Smith, Beverly A; Dahlöf, Björn
2009-02-03
Left ventricular (LV) hypertrophy, a marker of cardiac end-organ damage, is associated with an increased risk of cardiovascular morbidity and mortality. Inhibitors of the renin-angiotensin-aldosterone system may reduce LV mass to a greater extent than other antihypertensive agents. We compared the effect of aliskiren, the first orally active direct renin inhibitor, the angiotensin-receptor blocker losartan, and their combination on the reduction of LV mass in hypertensive patients. We randomized 465 patients with hypertension, increased ventricular wall thickness, and body mass index >25 kg/m(2) to receive aliskiren 300 mg, losartan 100 mg, or their combination daily for 9 months. Patients were treated to standard blood pressure targets with add-on therapy, excluding other inhibitors of the renin-angiotensin-aldosterone system and beta-blockers. Patients underwent cardiovascular magnetic resonance imaging for assessment of LV mass at baseline and at study completion. The primary objective was to compare change in LV mass index from baseline to follow-up in the combination and losartan arms; the secondary objective was to determine whether aliskiren was noninferior to losartan in reducing LV mass index from baseline to follow-up. Systolic and diastolic blood pressures were reduced similarly in all treatment groups (6.5+/-14.9/3.8+/-10.1 mm Hg in the aliskiren group; 5.5+/-15.6/3.7+/-10.7 mm Hg in the losartan group; 6.6+/-16.6/4.6+/-10.5 mm Hg in the combination arm; P<0.0001 within groups, P=0.81 between groups). LV mass index was reduced significantly from baseline in all treatment groups (4.9-, 4.8-, and 5.8 g/m(2) reductions in the aliskiren, losartan, and combination arms, respectively; P<0.0001 for all treatment groups). The reduction in LV mass index in the combination group was not significantly different from that with losartan alone (P=0.52). Aliskiren was as effective as losartan in reducing LV mass index (P<0.0001 for noninferiority). Safety and
Gheorghiade, Mihai; Böhm, Michael; Greene, Stephen J; Fonarow, Gregg C; Lewis, Eldrin F; Zannad, Faiez; Solomon, Scott D; Baschiera, Fabio; Botha, Jaco; Hua, Tsushung A; Gimpelewicz, Claudio R; Jaumont, Xavier; Lesogor, Anastasia; Maggioni, Aldo P
2013-03-20
Hospitalizations for heart failure (HHF) represent a major health burden, with high rates of early postdischarge rehospitalization and mortality. To investigate whether aliskiren, a direct renin inhibitor, when added to standard therapy, would reduce the rate of cardiovascular (CV) death or HF rehospitalization among HHF patients. International, double-blind, placebo-controlled study that randomized hemodynamically stable HHF patients a median 5 days after admission. Eligible patients were 18 years or older with left ventricular ejection fraction (LVEF) 40% or less, elevated natriuretic peptides (brain natriuretic peptide [BNP] ≥ 400 pg/mL or N -terminal pro-BNP [NT-proBNP] ≥ 1600 pg/mL), and signs and symptoms of fluid overload. Patients were recruited from 316 sites across North and South America, Europe, and Asia between May 2009 and December 2011. The follow-up period ended in July 2012. All patients received 150 mg (increased to 300 mg as tolerated) of aliskiren or placebo daily, in addition to standard therapy. The study drug was continued after discharge for a median 11.3 months. MAIN OUTCOME MEASURES Cardiovascular death or HF rehospitalization at 6 months and 12 months. In total, 1639 patients were randomized, with 1615 patients included in the final efficacy analysis cohort (808 aliskiren, 807 placebo). Mean age was 65 years; mean LVEF, 28%; 41% of patients had diabetes mellitus, mean estimated glomerular filtration rate, 67 mL/min/1.73 m2. At admission and randomization, median NT-proBNP levels were 4239 pg/mL and 2718 pg/mL, respectively. At randomization, patients were receiving diuretics (95.9%), β-blockers (82.5%), angiotensin-converting enzyme inhibitors or angiotensin II receptor blockers (84.2%), and mineralocorticoid receptor antagonists (57.0%). In total, 24.9% of patients receiving aliskiren (77 CV deaths, 153 HF rehospitalizations) and 26.5% of patients receiving placebo (85 CV deaths, 166 HF rehospitalizations) experienced the primary
Outcomes Associated with Steroid Avoidance and Alemtuzumab among Kidney Transplant Recipients.
Serrano, Oscar K; Friedmann, Patricia; Ahsanuddin, Sayeeda; Millan, Carlos; Ben-Yaacov, Almog; Kayler, Liise K
2015-11-06
Alemtuzumab is a humanized anti-CD52 monoclonal antibody used as induction in kidney transplantation (KTX) since 2003. Few studies have evaluated long-term outcomes of this agent or changes in outcomes over time. A retrospective cohort study was performed examining United States registry data from 2003 to 2014 of primary KTX recipients receiving induction with alemtuzumab (AZ; n=5521) or antithymocyte globulin (ATG; n=8504) and maintenance immunosuppression with tacrolimus and mycophenolate mofetil and early withdrawal of steroids. The primary outcome was overall death-censored graft survival (DCGS), and secondary outcomes were overall patient survival and 1-year acute rejection. Multivariate models were fit with donor, recipient, and transplant covariates. Because poorer outcomes with AZ may occur from a learning curve impact with the use of a new medication, transplant year was categorized into three time periods to evaluate outcomes over time (2003-2005, 2006-2008, ≥2009), and an interaction term of induction type with transplant year category was included in all models to test for era impacts. On multivariate analysis of DCGS there was a significant interaction between AZ and era (P<0.001). AZ was significantly associated with inferior DCGS in the earliest 2003-2005 era (adjusted hazard ratio [aHR], 2.21; 95% confidence interval [95% CI], 1.72 to 2.84) but not in the middle 2006-2008 era (aHR, 1.14; 95% CI, 0.96 to 1.36) or the most recent 2009-2014 era (aHR, 1.08; 95% CI, 0.90 to 1.29) compared with ATG. Risk-adjusted patient survival (aHR, 1.32; 95% CI, 1.08 to 1.61; aHR, 1.26; 95% CI, 1.09 to 1.46; and aHR, 1.10; 95% CI, 0.93 to 1.29 by era, respectively) and acute rejection (adjusted odds ratio [aOR], 1.17; 95% CI, 0.96 to 1.42; aOR, 0.94; 95% CI, 0.82 to 1.07; aOR, 0.89; 95% CI, 0.81 to 0.98 by era, respectively) with AZ was comparable with ATG in the most recent era; however, there was no significant interaction with time (P=0.13 and P=0
Furukawa, Masako; Horikoshi, Satoshi; Funabiki, Kazuhiko; Tomino, Yasuhiko
2013-01-01
Objective. Although angiotensin II-mediated inflammation and extracellular matrix accumulation are considered to be associated with the progression of diabetic nephropathy, these processes have not yet been sufficiently clarified. The objective of this study was to determine whether the correction of the abnormal renal expression of MMPs and its inhibitors (MMPs/TIMPs) and cytokines following the administration of aliskiren to KK-A y mice results in a renoprotective effect. Methods. KK-A y mice were divided into two groups, that is, untreated (saline) and treated (aliskiren) groups. Systolic BP, HbA1c levels, and the albumin-creatinine ratio (ACR) were measured. The renal expression of MMPs/TIMPs, fibronectin, type IV collagen, MCP-1, and (pro)renin receptor ((P)RR) was examined using real-time PCR and/or immunohistochemical staining. Renal MAPK and NF-κB activity were also examined by Western blot analyses and ELISA, respectively. Results. Significant decreases in systolic BP and ACR levels were observed in treated KK-A y mice compared with the findings in untreated KK-A y mice. Furthermore, increases in MMPs/TIMPs, fibronectin, type IV collagen, MCP-1, and (P)RR expression, in addition to MAPK and NF-κB activity, were significantly attenuated by aliskiren administration. Conclusions. It appears that aliskiren improves albuminuria and renal fibrosis by regulating inflammation and the alteration of collagen synthesis and degradation. PMID:23819050
Hussain, Saad Abdulrahman; Utba, Rabab Mohammed; Assumaidaee, Ajwad Muhammad
2017-08-01
In addition to its role in regulation of blood pressure, fluid and electrolyte homeostasis, the renin-angiotensin system (RAS) components were expressed in many other tissues suggesting potential roles in their functions. The present study aims to evaluate the protective effect aliskiren, when used alone or in combination with azilsartan against high fat diet-induced liver disease in rats. Thirty-two Wistar male rats, weighing 150-200 gm were allocated evenly into four groups and treated as follow: group I, rats were fed a specially formulated high-fat diet for 8 weeks to induce non-alcoholic liver disease and considered as control group; groups II, III and IV, the rats were administered azilsartan (0.5 mg/kg), aliskiren (25 mg/kg) or their combination orally via gavage tube once daily, and maintained on high fat diet for 8 weeks. The possible treatment outcome was evaluated through measuring serum levels of glucose, insulin, lipid profile, TNF-α, IL-1β and liver enzymes. Additionally, the liver tissue contents of glycogen and lipids and histological changes were also evaluated. The results showed that azilsartan significantly improves the studied markers greater than aliskiren, and their combination o has no additive or synergistic effects on the activity of each one of them. Both azilsartan and aliskiren protects the rats against high-fat diet induced NAFLD with predominant effects for the former, and their combination showed no beneficial synergistic or additive effects.
Hussain, Saad Abdulrahman; Utba, Rabab Mohammed; Assumaidaee, Ajwad Muhammad
2017-01-01
Introduction: In addition to its role in regulation of blood pressure, fluid and electrolyte homeostasis, the renin-angiotensin system (RAS) components were expressed in many other tissues suggesting potential roles in their functions. Aim: The present study aims to evaluate the protective effect aliskiren, when used alone or in combination with azilsartan against high fat diet-induced liver disease in rats. Material and methods: Thirty-two Wistar male rats, weighing 150-200 gm were allocated evenly into four groups and treated as follow: group I, rats were fed a specially formulated high-fat diet for 8 weeks to induce non-alcoholic liver disease and considered as control group; groups II, III and IV, the rats were administered azilsartan (0.5 mg/kg), aliskiren (25 mg/kg) or their combination orally via gavage tube once daily, and maintained on high fat diet for 8 weeks. The possible treatment outcome was evaluated through measuring serum levels of glucose, insulin, lipid profile, TNF-α, IL-1β and liver enzymes. Additionally, the liver tissue contents of glycogen and lipids and histological changes were also evaluated. Result: The results showed that azilsartan significantly improves the studied markers greater than aliskiren, and their combination o has no additive or synergistic effects on the activity of each one of them. Conclusion: Both azilsartan and aliskiren protects the rats against high-fat diet induced NAFLD with predominant effects for the former, and their combination showed no beneficial synergistic or additive effects. PMID:28974844
Martínez, Carmen; Solano, Carlos; Ferrá, Christelle; Sampol, Antonia; Valcárcel, David; Pérez-Simón, José Antonio
2009-05-01
We conducted a phase II trial to investigate the safety and efficacy of alemtuzumab in treating steroid-refractory acute graft-versus-host disease (aGVHD) grade II or higher after stem cell transplantation. Ten adult patients (6 with aGVHD grade III and 4 with aGVHD grade IV) were included in the study. Nine patients had gastrointestinal tract involvement, 7 had skin involvement, and 5 had liver involvement. Five patients responded to treatment, 2 with complete response and 3 with partial response. Eight infectious events (4 of grade 3-4) and 7 cytomegalovirus (CMV) reactivations were observed. Six patients had grade 3-4 cytopenia. All 10 patients died (7 resulting from aGVHD progression, 2 from severe infection, and 1 from to leukemia relapse), at a median of 40 days (range, 4 to 88 days) after alemtuzumab treatment. Overall, our findings suggest that steroid-refractory aGVHD may be improved by treatment with alemtuzumab, but that this treatment does not overcome the dismal prognosis of patients with severe aGVHD, demonstrating the need for alternative therapies to treat this complication.
Fu, Shufang; Wen, Xin; Han, Fei; Long, Yin; Xu, Gaosi
2017-01-01
The efficacy and safety of aliskiren combination therapy with angiotensin converting enzyme inhibitors (ACEIs) or angiotensin receptor blockers (ARBs) in patients with hypertension and cardiovascular disease remains attractive attention. We searched the Cochrane Central Register, the Clinical Trials Registry, EMBASE, MEDLINE and PubMed for relevant literatures up to January 2017. A total of 13 randomized controlled trials (RCTs) with 12222 patients were included in this study, and the combined results indicated that aliskiren in combination therapy with ACEIs or ARBs had remarkable effects in reducing systolic blood pressure (SBP) [weighted mean differences (WMD), -4.20; 95% confidential intervals (CI) -5.44 to -2.97; I2, 29.7%] and diastolic blood pressure (DBP: WMD, -2.09; 95% CI -2.90 to -1.27; I2, 0%) when compared with ACEIs or ARBs monotherapy, but with significantly increased the risk of hyperkalaemia [relative risk (RR), 1.45; 95% CI 1.28 to 1.64; I2,10.6 %] and kidney injury ( RR, 1.92; 95% CI 1.14 to 3.21; I2, 0%). Besides, there was no significant difference in the incidence of major cardiovascular events (RR, 0.95; 95% CI 0.89 to 1.02; I2, 0%) between the combined therapy and ACEIs or ARBs monotherapy. In conclusion, this meta-analysis demonstrated that aliskiren in combination therapy with ACEs/ARBs could control BP effectively, but is associated with increasing risks of hyperkalaemia and kidney injury, and have no benefit in preventing of major cardiovascular events. PMID:29179525
Production of Fumaric Acid in 20-Liter Fermentors
Rhodes, R. A.; Lagoda, A. A.; Misenheimer, T. J.; Smith, M. L.; Anderson, R. F.; Jackson, R. W.
1962-01-01
The conditions necessary for the production of fumaric acid in 20-liter fermentors by fermentation of glucose with Rhizopus arrhizus strain NRRL 2582 were determined. Continuous neutralization of fumaric acid was necessary for optimal yields. Yields of the calcium salt were in excess of 65 g of fumaric acid from 100 g of sugar consumed during fermentation of sugar concentrations of 10 to 16%. Conditions established for calcium fumarate production include a simple mineral salts medium, 0.5 v:v:min aeration rate, 300 rev/min agitation rate in a baffled tank, 33 C incubation temperature, CaCO3 to neutralize the acid formed, and a 4 to 5% (v/v) vegetative inoculum. A suitable procedure and medium for the preparation of a vigorous vegetative inoculum were established. The tendency for calcium fumarate fermentations to foam excessively was controlled with a proper antifoam agent added prior to sterilization of the medium and again at daily intervals during fermentation. The production of soluble sodium or potassium fumarates was inhibited when the concentration of fumarates reached 3.5 to 4.0%. No means of overcoming this inhibition was found. Starches and certain other grain-derived carbohydrates were fermented to form calcium fumarate in flask experiments with approximately the same efficiency as was glucose. PMID:16349614
Outcomes Associated with Steroid Avoidance and Alemtuzumab among Kidney Transplant Recipients
Serrano, Oscar K.; Friedmann, Patricia; Ahsanuddin, Sayeeda; Millan, Carlos; Ben-Yaacov, Almog
2015-01-01
Background and objectives Alemtuzumab is a humanized anti-CD52 monoclonal antibody used as induction in kidney transplantation (KTX) since 2003. Few studies have evaluated long-term outcomes of this agent or changes in outcomes over time. Design, setting, participants, & measurements A retrospective cohort study was performed examining United States registry data from 2003 to 2014 of primary KTX recipients receiving induction with alemtuzumab (AZ; n=5521) or antithymocyte globulin (ATG; n=8504) and maintenance immunosuppression with tacrolimus and mycophenolate mofetil and early withdrawal of steroids. The primary outcome was overall death-censored graft survival (DCGS), and secondary outcomes were overall patient survival and 1-year acute rejection. Multivariate models were fit with donor, recipient, and transplant covariates. Because poorer outcomes with AZ may occur from a learning curve impact with the use of a new medication, transplant year was categorized into three time periods to evaluate outcomes over time (2003–2005, 2006–2008, ≥2009), and an interaction term of induction type with transplant year category was included in all models to test for era impacts. Results On multivariate analysis of DCGS there was a significant interaction between AZ and era (P<0.001). AZ was significantly associated with inferior DCGS in the earliest 2003–2005 era (adjusted hazard ratio [aHR], 2.21; 95% confidence interval [95% CI], 1.72 to 2.84) but not in the middle 2006–2008 era (aHR, 1.14; 95% CI, 0.96 to 1.36) or the most recent 2009–2014 era (aHR, 1.08; 95% CI, 0.90 to 1.29) compared with ATG. Risk-adjusted patient survival (aHR, 1.32; 95% CI, 1.08 to 1.61; aHR, 1.26; 95% CI, 1.09 to 1.46; and aHR, 1.10; 95% CI, 0.93 to 1.29 by era, respectively) and acute rejection (adjusted odds ratio [aOR], 1.17; 95% CI, 0.96 to 1.42; aOR, 0.94; 95% CI, 0.82 to 1.07; aOR, 0.89; 95% CI, 0.81 to 0.98 by era, respectively) with AZ was comparable with ATG in the most recent
[Current immunotherapy of multiple sclerosis].
Paul, F; Ruprecht, K
2015-08-01
Following the introduction of interferon beta 1b as the first immunomodulatory therapy for multiple sclerosis (MS) in 1993, there are currently nine substances or substance classes approved for the treatment of MS (i.e. alemtuzumab, azathioprine, dimethyl fumarate, fingolimod, glatiramer acetate, interferon beta, mitoxantrone, natalizumab and teriflunomide). Major developments during the last 5 years include the approval of orally administered medications (i.e. fingolimod, teriflunomide and dimethyl fumarate), a monoclonal antibody (alemtuzumab), as well as glatiramer acetate with an administration frequency three times a week and a pegylated formulation of interferon beta 1a. The broadened therapeutic options enable a more differentiated and individualized therapy of MS; however, evidence-based data for therapeutic decision-making relevant in clinical practice are not always available. Rare but potentially severe and even life-threatening side effects of immunotherapies for MS require continuous pharmacovigilance and adherence to risk management plans.
Knauf, Wolfgang; Rieger, Kathrin; Blau, Wolfgang; Hegenbart, Ute; Von Gruenhagen, Ulrich; Niederwieser, Dietger; Thiel, Eckhard
2004-12-01
The outcome of allogeneic stem cell transplantation depends upon the disease status before transplantation. Patients with refractory disease are at high risk for relapse. To improve the curative potential of the transplant procedure, we treated 3 chemotherapy-refractory CLL patients with alemtuzumab before allogeneic stem cell transplantation. Prior to therapy, all patients suffered from B-symptoms, and had massive adenopathy, splenomegaly, thrombocytopenia, and anemia; two patients had hepatomegaly. Alemtuzumab greatly reduced tumor mass in blood and bone marrow, B-symptoms resolved, and organomegaly improved. Two patients became blood product independent. All patients proceeded to transplantation after conditioning with TBI 2 Gy (n=1) or Treosulfan (n=2) in combination with Fludarabine either from an HLA-matched sibling (n=2) or from an HLA-matched unrelated donor (n=1). All patients engrafted, and are alive and well. Two patients reached complete remission (CR); one patient attained stable partial remission (PR). These heavily pre-treated refractory patients gained substantial clinical benefit from alemtuzumab, and received successful allografts.
Burckhardt, Bjoern B; Tins, Jutta; Laeer, Stephanie
2014-08-05
Although serum and plasma are the biological fluids of choice for pharmacokinetic determination of drugs in adults, it is desirable to elucidate noninvasive methods which can be used for investigations in vulnerable groups such as children. If the drug properties grant sufficient penetration of the drug from blood into saliva, the latter is a useful matrix for noninvasive investigations. Concerning the known physicochemical properties, the direct renin inhibitor aliskiren is one of the substances of which saliva concentrations could substitute blood concentrations for pharmacokinetic investigations in children. Therefore, a reliable bioanalytical method was successfully developed and validated according to the criteria of current international bioanalytical guidelines to enable the comparison of blood and saliva concentrations of aliskiren. After purification of the fluid by solid-phase extraction the chromatographic separation was conducted by using Xselect™ C18 CSH columns. Applying a mobile phase gradient of acidified methanol and acidified water at a flow rate of 0.4ml/min the column effluent was monitored during a total run time of 7.5min by tandem mass spectrometry with electrospray ionization. Running in positive mode the following transitions were investigated: 552.2-436.2m/z for aliskiren and 425.3-351.2m/z for benazepril (internal standard). Calibration curves were constructed in the range of 0.586-1200ng/ml and were analyzed utilizing 1/x(2) weighted linear regression. Intra-run and inter-run precision were 3.8-8.1% and 3.4-8.9%. The method provides selectivity, linearity and accuracy. The validated method was then applied to determine aliskiren concentrations in saliva and blood of three healthy volunteers after oral administration of 300mg aliskiren. Copyright © 2014 Elsevier B.V. All rights reserved.
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition.
Sciacovelli, Marco; Gonçalves, Emanuel; Johnson, Timothy Isaac; Zecchini, Vincent Roberto; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Drubbel, Alizee Vercauteren; Theobald, Sebastian Julian; Abbo, Sandra Riekje; Tran, Maxine Gia Binh; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Maher, Eamonn Richard; Maxwell, Patrick Henry; Saez-Rodriguez, Julio; Frezza, Christian
2016-08-31
Mutations of the tricarboxylic acid cycle enzyme fumarate hydratase cause hereditary leiomyomatosis and renal cell cancer. Fumarate hydratase-deficient renal cancers are highly aggressive and metastasize even when small, leading to a very poor clinical outcome. Fumarate, a small molecule metabolite that accumulates in fumarate hydratase-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite. Fumarate has been shown to inhibit α-ketoglutarate-dependent dioxygenases that are involved in DNA and histone demethylation. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of fumarate hydratase and the subsequent accumulation of fumarate in mouse and human cells elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster mir-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of fumarate hydratase-proficient cells with cell-permeable fumarate. Loss of fumarate hydratase is associated with suppression of miR-200 and the EMT signature in renal cancer and is associated with poor clinical outcome. These results imply that loss of fumarate hydratase and fumarate accumulation contribute to the aggressive features of fumarate hydratase-deficient tumours.
Hwang, William Y. K.; Dearden, Claire; Loh, Yvonne S. M.; Linn, Yeh C.; Tien, Sim L.; Teoh, Gerrard K. H.; How, Gee F.; Heng, Kee K.; Goh, Yeow T.; Lee, Lai H.
2009-01-01
Background. Intravenous alemtuzumab and fludarabine are effective in combination for the treatment of chronic lymphocytic leukemia (CLL), but require hospital visits for intravenous injection. We performed a pilot study to assess the safety and efficacy of outpatient-based oral fludarabine with subcutaneous alemtuzumab (OFSA) for the treatment of relapsed/refractory CLL. Results. Depending on their response, patients were given two to six 28-day cycles of subcutaneous alemtuzumab 30 mg on days 1,3, and 5 and oral fludarabine 40 mg/m2/day for 5 days. Median patient age was 74. The lymphocyte counts of all five patients fell after the 1st cycle of treatment and reached normal/low levels on completion of 2 to 6 cycles of therapy. Platelet counts and hemoglobin were unaffected. All five patients achieved complete hematological remission, while two attained minimal residual disease negativity on 4-color flow cytometry. Conclusions. Our OFSA regimen was effective in elderly Asian patients with relapsed/refractory CLL, and it should be investigated further. PMID:19960058
... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a condition in which ... day. Take dimethyl fumarate at around the same times every day. Follow the directions on your prescription ...
Phase II study of alemtuzumab in combination with pentostatin in patients with T-cell neoplasms.
Ravandi, Farhad; Aribi, Ahmed; O'Brien, Susan; Faderl, Stefan; Jones, Dan; Ferrajoli, Alessandra; Huang, Xuelin; York, Sergernne; Pierce, Sherry; Wierda, William; Kontoyiannis, Dimitrios; Verstovsek, Srdan; Pro, Barbara; Fayad, Luis; Keating, Michael; Kantarjian, Hagop
2009-11-10
To examine the efficacy and safety of the combination of alemtuzumab and pentostatin in patients with T-cell neoplasms. We treated 24 patients with a variety of T-cell leukemias and lymphomas with a combination of alemtuzumab 30 mg intravenously (IV) three times weekly for up to 3 months and pentostatin 4 mg/m(2) IV weekly for 4 weeks followed by alternate weekly administration for up to 6 months. Prophylactic antibiotics including antiviral, antifungal, and antibacterial agents were administered during the treatment and for 2 months after its completion. The median age of patients was 57 years (range, 21 to 79 years). Eight patients were previously untreated, and 16 had a median of two prior therapies (range, one to six regimens). Thirteen patients responded to treatment (11 complete responses [CRs] and two partial responses), for an overall response rate of 54%. The median response duration was 19.5 months. Monoclonal T-cell receptor chain gene rearrangements were detected by polymerase chain reaction in bone marrow of 20 of 22 evaluable patients and became negative in five of seven evaluable patients in CR. Opportunistic infections caused by pathogens associated with severe T-cell dysfunction were common. The combination of alemtuzumab and pentostatin is feasible and effective in T-cell neoplasms. Although infections, including cytomegalovirus reactivation, are a concern, they may be minimized with adequate prophylactic antibiotic therapy.
Synthesis of Poly(Propylene Fumarate)
Kasper, F. Kurtis; Tanahashi, Kazuhiro; Fisher, John P.; Mikos, Antonios G.
2010-01-01
This protocol describes the synthesis of 500 – 4000 Da poly(propylene fumarate) by a two-step reaction of diethyl fumarate and propylene glycol through a bis(hydroxypropyl) fumarate diester intermediate. Purified PPF can be covalently crosslinked to form degradable polymer networks, which have been widely explored for biomedical applications. The properties of crosslinked PPF networks depend upon the molecular properties of the constituent polymer, such as the molecular weight. The purity of the reactants and the exclusion of water from the reaction system are of utmost importance in the generation of high-molecular-weight PPF products. Additionally, the reaction time and temperature influence the molecular weight of the PPF product. The expected time required to complete this protocol is 3 d. PMID:19325548
Marsh, J C; Pearce, R M; Koh, M B C; Lim, Z; Pagliuca, A; Mufti, G J; Perry, J; Snowden, J A; Vora, A J; Wynn, R T; Russell, N; Gibson, B; Gilleece, M; Milligan, D; Veys, P; Samarasinghe, S; McMullin, M; Kirkland, K; Cook, G
2014-01-01
This retrospective national study compared the use of alemtuzumab-based conditioning regimens for hematopoietic SCT (HSCT) in acquired severe aplastic anemia with antithymocyte globulin (ATG)-based regimens. One hundred patients received alemtuzumab and 55 ATG-based regimens. A matched sibling donor (MSD) was used in 87 (56%), matched unrelated donor (MUD) in 60 (39%) and other related or mismatched unrelated donor (UD) in 8 (5%) patients. Engraftment failure occurred in 9% of the alemtuzumab group and 11% of the ATG group. Five-year OS was 90% for the alemtuzumab and 79% for the ATG groups, P=0.11. For UD HSCT, OS of patients was better when using alemtuzumab (88%) compared with ATG (57%), P=0.026, although smaller numbers of patients received ATG. Similar outcomes for MSD HSCT using alemtuzumab or ATG were seen (91% vs 85%, respectively, P=0.562). A lower risk of chronic GVHD (cGVHD) was observed in the alemtuzumab group (11% vs 26%, P=0.031). On multivariate analysis, use of BM as stem cell source was associated with better OS and EFS, and less acute and cGVHD; young age was associated with better EFS and lower risk of graft failure. This large study confirms successful avoidance of irradiation in the conditioning regimens for MUD HSCT patients.
2005-01-01
Fumapharm AG has developed a second-generation fumarate (fumaric acid) derivative, BG 12 [BG 00012, FAG-201, BG 12/Oral Fumarate], for the oral treatment of psoriasis. Biogen Idec is currently evaluating the product in clinical trials as an oral treatment for multiple sclerosis (phase II) and psoriasis (phase III) trials.BG 12 has an immunomodulatory mechanism of action. It seems that this product has been developed to reduce the adverse effects associated with a first-generation product containing fumaric acid esters (mixed dimethylfumarate and monoethylfumarate salts), Fumaderm. Fumaderm was approved in Germany in August 1994 and is currently the leading oral systemic therapy for moderate-to-severe psoriasis in Germany. One of the problems associated with Fumaderm capsules has been its gastrointestinal adverse effects (including diarrhoea and nausea). In September 2003, Biogen (now Biogen Idec) licensed exclusive worldwide rights (excluding Germany) from Fumapharm to develop and market BG 12. Biogen plans to collaborate with Fumapharm to accelerate phase III development for psoriasis and the registration programme worldwide. Financial terms of the agreement were not disclosed. Development plans for BG 12 include other autoimmune and inflammatory disorders, such as multiple sclerosis. In November 2003, Biogen and IDEC Pharmaceuticals merged to form Biogen Idec. Fumapharm completed phase II trials of this second-generation fumarate derivative for psoriasis prior to licensing of the product to Biogen, also with positive results.
Axthelm, Christoph; Sieder, Christian; Meister, Franziska; Pittrow, David; Kaiser, Edelgard
2013-01-01
Aims Blood pressure (BP) reduction in hypertensive patients is more difficult to achieve in the elderly or in the presence of comorbidities. We aimed to investigate the efficacy of the single-pill combination (SPC) aliskiren/amlodipine in hypertensive elderly patients, patients with high body mass index (BMI), with at least one metabolic risk factor, and/or type 2 diabetes mellitus (DM). Methods In an open-label non-randomized study, patients not adequately controlled by previous treatment with the SPC olmesarten 40/amlodipine 10 (phase 1) were switched to the SPC aliskiren 300/amlodipine 10 (phase 2). The present post-hoc analysis investigated BP reduction in phase 2 in the named subgroups. The EudraCT identifier was 2009-016693-33, ClinicalTrials.gov identifier NCT01113047. Results Of the 187 patients not adequately controlled in phase 1 and thus treated with the SPC aliskiren 300/amlodipine 10 in phase 2, 69 were of advanced age (≥65 years), 74 or 89 were overweight or obese (BMI 25.0–29.9 kg/m2 or ≥30 kg/m2, respectively), 91 had metabolic risk factors (without DM) and 41 had DM. At the beginning of phase 2, depending on the subgroup, baseline SBP was 168–169 mmHg and DBP 103–104 mmHg. After 4 weeks of treatment with aliskiren 300/amlodipine 10, SBP/DBP was lowered by −5.1/−4.8 mmHg in the total cohort, by −5.5/−5.1 mmHg in elderly patients, by −6.7/−5.5 in overweight and by −4.2/−4.5 mmHg in obese patients, by −6.4/−4.7 mmHg in patients with metabolic risk factors without DM, and by −3.3/−5.0 mmHg in DM patients. Limitations include low sample size, limited treatment duration and the fact that the post-hoc defined groups were not mutually exclusive. Conclusions In this study reflecting clinical practice, the aliskiren/amlodipine combination achieved effective BP reduction in elderly patients or with metabolic comorbidities, including DM that might be more difficult to treat. This consistent BP lowering
Lei, Bai; Nakano, Daisuke; Fan, Yu-Yan; Kitada, Kento; Hitomi, Hirofumi; Kobori, Hiroyuki; Mori, Hirohito; Masaki, Tsutomu; Nishiyama, Akira
2012-01-01
We hypothesized that aliskiren provides renoprotection in diabetic animals that did not receive sufficient renoprotection by AT1-receptor antagonist treatment. Type 2 diabetic KKAy mice were treated with group 1: vehicle or group 2: valsartan (15 mg/kg per day) from 12 to 16 weeks of age. The mice were subsequently divided into 4 groups and treated with the following combinations of drugs for another 6 weeks: 1: group 1 kept receiving vehicle, 2: group 2 continuously received 15 mg/kg per day of valsartan (Val-Val15), 3: group 2 received 50 mg/kg per day of valsartan (Val-Val50), 4: group 2 continuously received 15 mg/kg per day of valsartan with 25 mg/kg per day of aliskiren (Val-Val+Ali). Aliskiren exerted significant anti-albuminuric effects, whereas valsartan failed to ameliorate the albuminuria in the first four weeks. Surprisingly, the increasing dosage of valsartan in the Val-Val50 group showed non-significant tendencies to attenuate the albuminuria compared with vehicle infusion. Val-Val+Ali significantly suppressed the development of albuminuria and podocyte injury. Val-Val50 and Val-Val+Ali showed similar suppression of angiotensin II contents in the kidney of KKAy mice. In conclusion, the anti-albuminuric effect that was observed in the type 2 diabetic mice showing no anti-albuminuric effect by valsartan can be attributed to the add-on aliskiren. PMID:22673148
te Riet, Luuk; van den Heuvel, Mieke; Peutz-Kootstra, Carine J; van Esch, Joep H M; van Veghel, Richard; Garrelds, Ingrid M; Musterd-Bhaggoe, Usha; Bouhuizen, Angelique M; Leijten, Frank P J; Danser, A H Jan; Batenburg, Wendy W
2014-05-15
Dual renin-angiotensin system (RAS) blockade in diabetic nephropathy is no longer feasible because of the profit/side effect imbalance. (Pro)renin receptor [(P)RR] blockade with handle region peptide (HRP) has been reported to exert beneficial effects in various diabetic models in a RAS-independent manner. To what degree (P)RR blockade adds benefits on top of RAS blockade is still unknown. In the present study, we treated diabetic TGR(mREN2)27 rats, a well-established nephropathy model with high prorenin levels [allowing continuous (P)RR stimulation in vivo], with HRP on top of renin inhibition with aliskiren. Aliskiren alone lowered blood pressure and exerted renoprotective effects, as evidenced by reduced glomerulosclerosis, diuresis, proteinuria, albuminuria, and urinary aldosterone levels as well as diminished renal (P)RR and ANG II type 1 receptor expression. It also suppressed plasma and tissue RAS activity and suppressed cardiac atrial natriuretic peptide and brain natriuretic peptide expression. HRP, when given on top of aliskiren, did not alter the effects of renin inhibition on blood pressure, RAS activity, or aldosterone. However, it counteracted the beneficial effects of aliskiren in the kidney, induced hyperkalemia, and increased plasma plasminogen activator-inhibitor 1, renal cyclooxygenase-2, and cardiac collagen content. All these effects have been linked to (P)RR stimulation, suggesting that HRP might, in fact, act as a partial agonist. Therefore, the use of HRP on top of RAS blockade in diabetic nephropathy is not advisable. Copyright © 2014 the American Physiological Society.
Dielectric Properties of Iron- and Sodium-Fumarate
NASA Astrophysics Data System (ADS)
Skuban, Sonja J.; Džomić, Tanja; Kapor, Agneš
2007-04-01
The behaviour of dielectric parameters such as relative dielectric constant (ɛ'), relative loss factor (V'') and ac conductivity of well known pharmaceutical materials Fe(II)-fumarate and sodium-fumarate have been studied as a function of temperature (range 303 K to 483 K) and frequency (range 0.1 Hz to 100 kHz).
Fumarate-Mediated Persistence of Escherichia coli against Antibiotics
Kim, Jun-Seob; Cho, Da-Hyeong; Heo, Paul; Jung, Suk-Chae; Park, Myungseo; Oh, Eun-Joong; Sung, Jaeyun; Kim, Pan-Jun; Lee, Suk-Chan; Lee, Dae-Hee; Lee, Sarah; Lee, Choong Hwan; Shin, Dongwoo
2016-01-01
Bacterial persisters are a small fraction of quiescent cells that survive in the presence of lethal concentrations of antibiotics. They can regrow to give rise to a new population that has the same vulnerability to the antibiotics as did the parental population. Although formation of bacterial persisters in the presence of various antibiotics has been documented, the molecular mechanisms by which these persisters tolerate the antibiotics are still controversial. We found that amplification of the fumarate reductase operon (FRD) in Escherichia coli led to a higher frequency of persister formation. The persister frequency of E. coli was increased when the cells contained elevated levels of intracellular fumarate. Genetic perturbations of the electron transport chain (ETC), a metabolite supplementation assay, and even the toxin-antitoxin-related hipA7 mutation indicated that surplus fumarate markedly elevated the E. coli persister frequency. An E. coli strain lacking succinate dehydrogenase (SDH), thereby showing a lower intracellular fumarate concentration, was killed ∼1,000-fold more effectively than the wild-type strain in the stationary phase. It appears that SDH and FRD represent a paired system that gives rise to and maintains E. coli persisters by producing and utilizing fumarate, respectively. PMID:26810657
Gilbert, Cameron; Wald, Ron; Bell, Chaim; Perl, Jeff; Juurlink, David; Beyene, Joseph; Shah, Prakesh S
2012-01-01
Objective To examine the safety of using aliskiren combined with agents used to block the renin-angiotensin system. Design Systematic review and meta-analysis of randomised controlled trials. Data sources Medline, Embase, the Cochrane Library, and two trial registries, published up to 7 May 2011. Study selection Published and unpublished randomised controlled trials that compared combined treatment using aliskiren and angiotensin converting enzyme inhibitors or angiotensin receptor blockers with monotherapy using these agents for at least four weeks and that provided numerical data on the adverse event outcomes of hyperkalaemia and acute kidney injury. A random effects model was used to calculate pooled risk ratios and 95% confidence intervals for these outcomes. Results 10 randomised controlled studies (4814 participants) were included in the analysis. Combination therapy with aliskiren and angiotensin converting enzyme inhibitors or angiotensin receptor blockers significantly increased the risk of hyperkalaemia compared with monotherapy using angiotensin converting enzymes or angiotensin receptor blockers (relative risk 1.58, 95% confidence interval 1.24 to 2.02) or aliskiren alone (1.67, 1.01 to 2.79). The risk of acute kidney injury did not differ significantly between the combined therapy and monotherapy groups (1.14, 0.68 to 1.89). Conclusion Use of aliskerin in combination with angiotensin converting enzyme inhibitors or angiotensin receptor blockers is associated with an increased risk for hyperkalaemia. The combined use of these agents warrants careful monitoring of serum potassium levels. PMID:22232539
Amato, Maria Pia; Portaccio, Emilio
2015-03-01
In recent decades, pregnancy-related issues in multiple sclerosis (MS) have received growing interest. MS is more frequent in women than in men and typically starts during child-bearing age. An increasing number of disease-modifying drugs (DMDs) for the treatment of MS are becoming available. Gathering information on their influences on pregnancy-related issues is of crucial importance for the counselling of MS patients. As for the immunomodulatory drugs (interferons and glatiramer acetate), accumulating evidence points to the relative safety of pregnancy exposure in terms of maternal and foetal outcomes. In case of higher clinical disease activity before pregnancy, these drugs could be continued until conception. As for the 'newer' drugs (fingolimod, natalizumab, teriflunomide, dimethyl fumarate and alemtuzumab), the information is more limited. Whereas fingolimod and teriflunomide are likely associated with an increased risk of foetal malformations, the effects of natalizumab, dimethyl fumarate and alemtuzumab still need to be ascertained. This article provides a review of the available information on the use of DMDs during pregnancy, with a specific focus on fertility, foetal development, delivery and breast-feeding.
Effect of Alemtuzumab (CAMPATH 1-H) in patients with inclusion-body myositis
Rakocevic, Goran; Schmidt, Jens; Salajegheh, Mohammad; McElroy, Beverly; Harris-Love, Michael O.; Shrader, Joseph A.; Levy, Ellen W.; Dambrosia, James; Kampen, Robert L.; Bruno, David A.; Kirk, Allan D.
2009-01-01
Sporadic inclusion-body myositis (sIBM) is the most common disabling, adult-onset, inflammatory myopathy histologically characterized by intense inflammation and vacuolar degeneration. In spite of T cell-mediated cytotoxicity and persistent, clonally expanded and antigen-driven endomysial T cells, the disease is resistant to immunotherapies. Alemtuzumab is a humanized monoclonal antibody that causes an immediate depletion or severe reduction of peripheral blood lymphocytes, lasting at least 6 months. We designed a proof-of-principle study to examine if one series of Alemtuzumab infusions in sIBM patients depletes not only peripheral blood lymphocytes but also endomysial T cells and alters the natural course of the disease. Thirteen sIBM patients with established 12-month natural history data received 0.3 mg/kg/day Alemtuzumab for 4 days. The study was powered to capture ≥10% increase strength 6 months after treatment. The primary end-point was disease stabilization compared to natural history, assessed by bi-monthly Quantitative Muscle Strength Testing and Medical Research Council strength measurements. Lymphocytes and T cell subsets were monitored concurrently in the blood and the repeated muscle biopsies. Alterations in the mRNA expression of inflammatory, stressor and degeneration-associated molecules were examined in the repeated biopsies. During a 12-month observation period, the patients’ total strength had declined by a mean of 14.9% based on Quantitative Muscle Strength Testing. Six months after therapy, the overall decline was only 1.9% (P < 0.002), corresponding to a 13% differential gain. Among those patients, four improved by a mean of 10% and six reported improved performance of daily activities. The benefit was more evident by the Medical Research Council scales, which demonstrated a decline in the total scores by 13.8% during the observation period but an improvement by 11.4% (P < 0.001) after 6 months, reaching the level of strength recorded 12
Vanourková, Z; Kramer, H J; Husková, Z; Cervenka, L; Vanecková, I
2010-01-01
The relationship between angiotensin II (ANG II) and endothelin-1 (ET-1) is known to be complex; both peptides can initiate and potentiate the gene expression of each other. This pilot study investigated the effects of the AT(1) receptor blocker losartan or the direct renin inhibitor aliskiren on mean arterial pressure (MAP) and albuminuria and the renal ANG II and ET-1 levels. 3-month-old male Ren-2 transgenic rats (TGR) were treated either with losartan (5 mg kg(-1) day(-1)) or aliskiren (10 mg kg(-1) day(-1)) for 10 weeks. At the end of the experiment, rats were decapitated and cortical and papillary parts of kidneys were separated. Plasma and tissue ANG II levels were measured by RIA and tissue ET-1 concentrations by ELISA. In all four groups of animals ET-1 levels were lowest in renal cortex and more than 100-fold higher in the papilla. Cortical and papillary ET-1 concentrations in untreated TGR significantly exceeded those of control HanSD rats and were significantly depressed by both drugs. In both strains, papillary ANG II concentrations were moderately but significantly higher than cortical ANG II, TGR exhibited higher ANG II levels both in cortex and papilla as compared to control HanSD rats. Aliskiren and losartan at the doses used depressed similarly the levels of ANG II in cortex and papilla and reduced ET-1 significantly in the renal cortex and papilla below control levels in HanSD rats. Albuminuria, which was more than twice as high in TGR as in HanSD rats, was normalized with aliskiren and reduced by 28% with losartan, although MAP was reduced to a similar degree by both drugs. Despite similar reductions of MAP and renal ET-1 and ANG II levels aliskiren appears to be more effective than losartan, at the doses used, in reducing albuminuria in heterozygous hypertensive Ren-2 rats.
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition
Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian
2016-01-01
Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029
The antihypertensive effectiveness and safety of dual RAAS blockade with aliskiren and valsartan.
Chrysant, Steven G
2010-03-01
The renin-angiotensin-aldosterone system (RAAS) is a major factor for the development and maintenance of hypertension and a major cause for cardiovascular remodeling and cardiovascular complications through its active peptide angiotensin (Ang) II. Blockade of RAAS with ACE inhibitors (ACEIs) results in suppression of Ang II levels, which eventually return to baseline levels after prolonged ACEI administration. This leads to an escape phenomenon through generation of Ang II from enzymes other than ACE and led to the hypothesis that dual blockade of RAAS with an ACEI/Ang receptor blocker (ARB) combination could lead to total blockade of RAAS, since ARBs block the action of Ang II at the AT1 receptor level, irrespective of the mechanism of Ang II generation and will have an additive blood pressure (BP)-lowering effect. However, this hypothesis has not materialized clinically, as the ACEI/ARB combination produces modest BP reductions that are not significantly greater than monotherapy with the component drugs, and is frequently associated with higher incidence of side effects. A new dual RAAS blockade with the direct renin inhibitor aliskiren and the ARB valsartan produces greater BP reductions than monotherapy with the component drugs and is safe and well tolerated. The combination of aliskiren with valsartan, and with other antihypertensive drugs is discussed. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.
21 CFR 520.82a - Aminopropazine fumarate tablets.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Aminopropazine fumarate tablets. (a) Specifications. The drug is in tablet form. Each tablet contains...
Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae
2012-01-01
Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940
Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.
Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R
2017-03-06
Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.
Mauro, Francesca R; Molica, Stefano; Laurenti, Luca; Cortelezzi, Agostino; Carella, Angelo M; Zaja, Francesco; Chiarenza, Annalisa; Angrilli, Francesco; Nobile, Francesco; Marasca, Roberto; Musolino, Caterina; Brugiatelli, Maura; Piciocchi, Alfonso; Vignetti, Marco; Fazi, Paola; Gentile, Giuseppe; De Propris, Maria S; Della Starza, Irene; Marinelli, Marilisa; Chiaretti, Sabina; Del Giudice, Ilaria; Nanni, Mauro; Albano, Francesco; Cuneo, Antonio; Guarini, Anna; Foà, Robin
2014-02-01
In 45, ≤ 60 years old patients with CLL and an adverse biologic profile, a front-line treatment with Fludarabine and Campath (Alemtuzumab(®)) was given. The overall response rate was 75.5%, the complete response rate (CR) 24.4% with the lowest CR rates, 16.7% and 8.3%, in 11q and 17p deleted cases. The 3-year progression-free survival (PFS) and overall survival were 42.5% and 79.9%, respectively. PFS was significantly influenced by CLL duration, beta2-microglobulin, and improved by post-remissional stem cell transplantation. Front-line fludarabine and alemtuzumab showed a manageable safety profile and evidence of a benefit in a small series of CLL patients with adverse biologic features. Copyright © 2013 Elsevier Ltd. All rights reserved.
Smith, A; Couvillion, R; Zhang, R; Killackey, M; Buell, J; Lee, B; Saggi, B H; Paramesh, A S
2014-12-01
The purpose of this study was to determine the incidence and management strategies for post-transplant leukopenia/neutropenia in kidney recipients receiving alemtuzumab induction during the first year following transplantation. We prospectively identified 233 adult patients who underwent kidney transplantation with alemtuzumab induction at a single institution. The incidence and severity of leukopenia (white blood cell count [WBC] ≤2500/mm(3)) and neutropenia (absolute neutrophil count [ANC] ≤500/mm(3)) were evaluated at 1, 3, 6, and 12 months post-transplantation. We determined any association with cytomegalovirus (CMV) infection, graft rejection, and infections requiring hospitalization. We also reviewed interventions performed, including medication adjustments, treatment with granulocyte stimulating factor, and hospitalization. The combined incidence of either leukopenia or neutropenia was 47.5% (n = 114/233) with an average WBC nadir of 1700 ± 50/mm(3) at 131.0 ± 8.5 days and an average ANC nadir of 1500 ± 100/mm(3) at 130.4 ± 9.6 days. No significant difference in graft rejection, CMV infection, or infections requiring hospitalization was found in the leukopenia/neutropenia group vs the normal WBC group (P = .3). The most common intervention performed for leukopenia/neutropenia group was prophylactic medication adjustment. Six patients (5.2%) required a change in >1 medication. The majority of these patients also required granulocyte stimulating factor (61.5%; 32/52), with an average of 2.5 doses given. A total of 25 patients (21.9%) required hospitalization due to leukopenia/neutropenia with an average length of stay of 6 days. Kidney transplant patients receiving alemtuzumab induction required significant interventions due to leukopenia/neutropenia in the first year post-transplantation. These results suggest the need for additional studies aimed at defining the optimum management strategies of leukopenia/neutropenia in this population
Xu, Guoqiang; Chen, Xiulai; Liu, Liming; Jiang, Linghuo
2013-11-01
In this study, the simultaneous use of reductive and oxidative routes to produce fumaric acid was explored. The strain FMME003 (Saccharomyces cerevisiae CEN.PK2-1CΔTHI2) exhibited capability to accumulate pyruvate and was used for fumaric acid production. The fum1 mutant FMME004 could produce fumaric acid via oxidative route, but the introduction of reductive route derived from Rhizopus oryzae NRRL 1526 led to lower fumaric acid production. Analysis of the key factors associated with fumaric acid production revealed that pyruvate carboxylase had a low degree of control over the carbon flow to malic acid. The fumaric acid titer was improved dramatically when the heterologous gene RoPYC was overexpressed and 32 μg/L of biotin was added. Furthermore, under the optimal carbon/nitrogen ratio, the engineered strain FMME004-6 could produce up to 5.64 ± 0.16 g/L of fumaric acid. These results demonstrated that the proposed fermentative method is efficient for fumaric acid production. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kongnakorn, Thitima; Sterchele, James A; Salvador, Christopher G; Getsios, Denis; Mwamburi, Mkaya
2014-01-01
The objective of this analysis was to evaluate the cost-effectiveness of using bendamustine versus alemtuzumab or bendamustine versus chlorambucil as a first-line therapy in patients with Binet stage B or C chronic lymphocytic leukemia (CLL) in the US. A discrete event simulation of the disease course of CLL was developed to evaluate the economic implications of single-agent treatment with bendamustine, alemtuzumab, or chlorambucil, which are indicated for a treatment-naïve patient population with Binet stage B or C CLL. Data from clinical trials were used to create a simulated patient population, risk equations for progression-free survival and survival post disease progression, response rates, and rates of adverse events. Costs from a US health care payer perspective in 2012 US dollars, survival (life years), and quality-adjusted life years (QALYs) were estimated over a patient's lifetime; all were discounted at 3% per year. Compared with alemtuzumab, bendamustine was considered to be a dominant treatment providing greater benefit (6.10 versus 5.37 life years and 4.02 versus 3.45 QALYs) at lower cost ($78,776 versus $121,441). Compared with chlorambucil, bendamustine was associated with higher costs ($78,776 versus $42,337) but with improved health outcomes (6.10 versus 5.21 life years and 4.02 versus 3.30 QALYs), resulting in incremental cost-effectiveness ratios of $40,971 per life year gained and $50,619 per QALY gained. Bendamustine is expected to provide cost savings and greater health benefit than alemtuzumab in treatment-naïve patients with CLL. Furthermore, it can be considered as a cost-effective treatment providing health benefits at an acceptable cost versus chlorambucil in the US.
Nijhoff, M F; Engelse, M A; Dubbeld, J; Braat, A E; Ringers, J; Roelen, D L; van Erkel, A R; Spijker, H S; Bouwsma, H; van der Boog, P J M; de Fijter, J W; Rabelink, T J; de Koning, E J P
2016-01-01
Pancreatic islet transplantation is performed in a select group of patients with type 1 diabetes mellitus. Immunosuppressive regimens play an important role in long-term islet function. We aimed to investigate the efficacy of islet transplantation in patients with type 1 diabetes and a previous kidney transplantation using an alemtuzumab-based induction regimen and triple maintenance immunosuppression. Patients with type 1 diabetes, who had received a kidney transplant previously, were treated with alemtuzumab as induction therapy for their first islet transplantation and basiliximab induction therapy for subsequent islet transplantations. Maintenance immunosuppression consisted of triple immunosuppression (tacrolimus, mycophenolate mofetil, and prednisolone). Thirteen patients (age 50.9 ± 9.2 years, duration of diabetes 35 ± 9 years) received a total of 22 islet transplantations. One- and 2-year insulin independence was 62% and 42%, respectively; graft function was 100% and 92%, respectively. HbA1c dropped from 57.2 ± 13.1 (7.4 ± 1.2%) to 44.5 ± 11.8 mmol/molHb (6.2 ± 0.9%) (p = 0.003) after 2 years. Six of 13 patients suffered from severe hypoglycemia before islet transplantation. After transplantation, severe hypoglycemia was restricted to the only patient who lost graft function. Creatinine clearance was unchanged. Islet-after-kidney transplantation in patients with type 1 diabetes using an alemtuzumab-based induction regimen leads to considerable islet allograft function and improvement in glycemic control. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.
Narala, Arjun; Veerabrahma, Kishan
2013-01-01
Quetiapine fumarate is an antipsychotic drug with poor oral bioavailability (9%) due to first-pass metabolism. Present work is an attempt to improve oral bioavailability of quetiapine fumarate by incorporating in solid lipid nanoparticles (SLN). Six quetiapine fumarate SLN formulations were developed using three different lipids by hot homogenisation followed by ultrasonication. The drug excipient compatibility was studied by differential scanning calorimetry (DSC). Stable quetiapine fumarate SLNs having a mean particle size of 200–250 nm with entrapment efficiency varying in between 80% and 92% were developed. The physical stability of optimized formulation F3 was checked at room temperature for 2 months. Comparative bioavailability studies were conducted in male Wistar rats after oral administration of quetiapine fumarate suspension and SLN formulation. The relative bioavailability of quetiapine fumarate from optimized SLN preparation was increased by 3.71 times when compared with the reference quetiapine fumarate suspension. The obtained results are indicative of SLNs as potential lipid carriers for improving the bioavailability of quetiapine fumarate by minimizing first-pass metabolism. PMID:26555970
Burckhardt, Bjoern B; Tins, Jutta; Laeer, Stephanie
2014-12-01
The benefit-risk ratio of combined blocking by the direct renin inhibitor aliskiren and an angiotensin-converting enzyme inhibitor (e.g. enalapril) on the renin-angiotensin-aldosterone system is discussed. No method was available for simultaneous determination of both drugs in urine. A novel sensitive method for simultaneous quantification in undiluted human urine was developed which enables systematic pharmacokinetic investigations, especially in poorly investigated populations like children. Matrix effects were clearly reduced by applying solid-phase extraction followed by a chromatographic separation on Xselect(TM) C18 CSH columns. Mobile phase consisted of methanol and water, both acidified with formic acid. Under gradient conditions and a flow rate of 0.4 mL/min the column effluent was monitored by tandem mass spectrometry with electrospray ionization. Calibration curves were constructed in the range of 9.4-9600 ng/mL regarding aliskiren, 11.6-12000 ng/mL for enalapril and 8.8-9000 ng/mL for enalaprilat. All curves were analyzed utilizing 1/x(2) -weighted quadratic squared regression. Intra-run and inter-run precision were 3.2-5.8% and 6.1-10.3% for aliskiren, 2.4-6.1% and 3.9-7.9% for enalapril as well as 3.1-9.4% and 4.7-12.7% regarding enalaprilat. Selectivity, accuracy and stability results comply with current international bioanalysis guidelines. The fully validated method was successfully applied to a pharmacokinetic investigation in healthy volunteers. Copyright © 2014 John Wiley & Sons, Ltd.
21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this...
Burckhardt, Bjoern B; Tins, Jutta; Ramusovic, Sergej; Läer, Stephanie
2015-01-01
Drugs that are effectively used to treat hypertension in adults (e.g., enalapril) have not been sufficiently investigated in children. Studies required for pediatric approval require special consideration regarding ethics, study design, and conduct and are also associated with special demands for the bioanalytic method. Pediatric-appropriate assays can overcome these burdens and enable systematic investigations of pharmacokinetics and pharmacodynamic in all pediatric age groups. Tailored assays were developed for pharmacokinetic investigation of a drug in 100 μL of serum, saliva, and urine. All assays were applied in a proof-of-concept study to 22 healthy volunteers who had been given 300 mg aliskiren hemifumarate or 20 mg enalapril maleate and allowed for dense sampling. Changes in humoral parameters of the renin-angiotensin-aldosterone system were also evaluated with 6 parameters in 2.1 mL blood per time point. The pharmacokinetic results of aliskiren and enalapril obtained by low-volume assays in serum and urine were comparable to that noted in the literature. The dense sampling enabled very detailed concentration-time profiles that showed high intersubject variability and biphasic absorption behavior of aliskiren. The replacement of invasive sampling by saliva collection appears inappropriate for both drugs because the correlations of drug concentrations in both fluids were low. A low-volume assay was also used to determine values for in the renin-angiotensin-aldosterone system and to compare those results with the published literature. These results support both the use of low-volume assays in pediatric research and the systematic investigation of their use in neonates and infants. Use of this assay methodology will increase information about drug pharmacokinetics and pharmacodynamics in this vulnerable population and might contribute to safe and effective use of pharmacotherapy.
Tins, Jutta; Ramusovic, Sergej; Läer, Stephanie
2015-01-01
OBJECTIVES: Drugs that are effectively used to treat hypertension in adults (e.g., enalapril) have not been sufficiently investigated in children. Studies required for pediatric approval require special consideration regarding ethics, study design, and conduct and are also associated with special demands for the bioanalytic method. Pediatric-appropriate assays can overcome these burdens and enable systematic investigations of pharmacokinetics and pharmacodynamic in all pediatric age groups. METHODS: Tailored assays were developed for pharmacokinetic investigation of a drug in 100 μL of serum, saliva, and urine. All assays were applied in a proof-of-concept study to 22 healthy volunteers who had been given 300 mg aliskiren hemifumarate or 20 mg enalapril maleate and allowed for dense sampling. Changes in humoral parameters of the renin-angiotensin-aldosterone system were also evaluated with 6 parameters in 2.1 mL blood per time point. RESULTS: The pharmacokinetic results of aliskiren and enalapril obtained by low-volume assays in serum and urine were comparable to that noted in the literature. The dense sampling enabled very detailed concentration-time profiles that showed high intersubject variability and biphasic absorption behavior of aliskiren. The replacement of invasive sampling by saliva collection appears inappropriate for both drugs because the correlations of drug concentrations in both fluids were low. A low-volume assay was also used to determine values for in the renin-angiotensin-aldosterone system and to compare those results with the published literature. CONCLUSION: These results support both the use of low-volume assays in pediatric research and the systematic investigation of their use in neonates and infants. Use of this assay methodology will increase information about drug pharmacokinetics and pharmacodynamics in this vulnerable population and might contribute to safe and effective use of pharmacotherapy. PMID:26766933
21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1 (3...
Determination of aliskiren in tablet dosage forms by a validated stability-indicating RP-LC method.
Wrasse-Sangoi, M; Sangoi, M S; Oliveira, P R; Secretti, L T; Rolim, C M B
2011-02-01
A reversed-phase liquid chromatography (RP-LC) method is validated for the determination of aliskiren in tablet dosage form. The LC method is carried out on a Waters XBridge C(18) column (150 × 4.6 mm i.d.), maintained at 25°C. The mobile phase consisted of acetonitrile:water (95:5, v/v)/phosphoric acid (25 mM, pH 3.0) (40:60, v/v), run at a flow rate of 1.0 mL/min, with photodiode array detector set at 229 nm. The chromatographic separation is obtained with aliskiren retention time of 3.68 min, and it is linear in the range of 10-300 μg/mL (r = 0.9999). The limits of detection and quantitation are 2.38 and 7.93 μg/mL, respectively. The specificity and stability-indicating capability of the method are proven through degradation studies, which also showed that there is no interference of the formulation excipients, showing that peak is free from any coeluting peak. The method showed adequate precision, with a relative standard deviation (RSD) values lower than 0.92%. Good values of accuracy were also obtained, with a mean value of 99.55%. Experimental design is used during validation to calculate method robustness. The proposed method is applied for the analysis of the tablet dosage forms, contributing to improve the quality control and to assure the therapeutic efficacy.
Budesonide + formoterol fumarate dihydrate for the treatment of asthma.
Wolthers, Ole D
2016-01-01
One of the most widely used fixed combinations in asthma management is dry powder budesonide+formoterol fumarate dihydrate which is commercially available as Symbicort Turbuhaler(®) (and generic products), Easyhaler Bufomix(®) and DuoRespSpiromax(®) inhaler. The aim of this paper was to review the fixed dry powder combination of inhaled budesonide+formoterol fumarate dihydrate for asthma treatment in adolescents and adults. A literature search using relevant search terms, reference lists for reviews and meta-analyses was performed. In symptomatic adolescent and adult patients with asthma maintenance and reliever therapy with a single-inhaler fixed combination of dry powder budesonide+formoterol fumarate dihydrate is an evidenced option. The combination treatment is convenient to patients. It reduces the number of exacerbations requiring treatment with oral corticosteroids. In some patients the strategy may also reduce the total intake of inhaled corticosteroids over time. Whether important outcome measures of asthma treatment, such as hospital admission and emergency room visit rates, may be reduced is less well documented since the published studies may have been influenced by publication bias. Non-pharmaceutical company-sponsored research evaluating such measures is needed. There is no evidence for the use of single inhaler fixed combinations of inhaled corticosteroids+long-acting β(2)-agonists in children (<12 years of age), and budesonide+formoterol fumarate dihydrate should not be prescribed to the age group.
Mitha, M K; Jayabalan, M
2009-12-01
Biodegradable hydroxyl terminated-poly(castor oil fumarate) (HT-PCF) and poly(propylene fumarate) (HT-PPF) resins were synthesized as an injectable and in situ-cross linkable polyester resins for orthopedic applications. An injectable adhesive formulation containing this resin blend, N-vinyl pyrrolidone (NVP), hydroxy apatite, free radical initiator and accelerator was developed. The Composite adhesives containing the ratio of resin blend and NVP, 2.1:1.5, 2.1:1.2 and 2.1:1.0 set fast with tolerable exothermic temperature as a three dimensionally cross linked toughened material. Crosslink density and mechanical properties of the crosslinked composite increase with increase of NVP. The present crosslinked composite has hydrophilic character and cytocompatibility with L929 fibroblast cells.
Mayer, Lori; Fink, Mary Kay; Sammarco, Carrie; Laing, Lisa
2018-04-01
Delayed-release dimethyl fumarate is an oral disease-modifying therapy that has demonstrated significant efficacy in adults with relapsing-remitting multiple sclerosis. Incidences of flushing and gastrointestinal adverse events are common in the first month after delayed-release dimethyl fumarate initiation. Our objective was to propose mitigation strategies for adverse events related to initiation of delayed-release dimethyl fumarate in the treatment of patients with multiple sclerosis. Studies of individually developed mitigation strategies and chart reviews were evaluated. Those results, as well as mitigation protocols developed at multiple sclerosis care centers, are summarized. Key steps to optimize the effectiveness of delayed-release dimethyl fumarate treatment include education prior to and at the time of delayed-release dimethyl fumarate initiation, initiation dose protocol gradually increasing to maintenance dose, dietary suggestions for co-administration with food, gastrointestinal symptom management with over-the-counter medications, flushing symptom management with aspirin, and temporary dose reduction. Using the available evidence from clinical trials and evaluations of post-marketing studies, these strategies to manage gastrointestinal and flushing symptoms can be effective and helpful to the patient when initiating delayed-release dimethyl fumarate.
Burckhardt, Bjoern B; Ramusovic, Sergej; Tins, Jutta; Laeer, Stephanie
2013-04-01
The orally active direct renin inhibitor aliskiren is approved for the treatment of essential hypertension in adults. Analytical methods utilized in clinical studies on efficacy and safety have not been fully described in the literature but need a large sample volume ranging from 200 to 700 μL, rendering them unsuitable particularly for pediatric applications. In the assay presented only 100 μL of serum is needed for mixed-mode solid-phase extraction. The chromatographic separation was performed on Xselect(TM) C18 CSH columns with mobile phase consisting of methanol-water-formic acid (75:25:0.005, v/v/v) and a flow rate of 0.4 mL/min. Running in positive electrospray ionization and multiple reaction monitoring the mass spectrometer was set to analyze precursor ion 552.2 m/z [M + H](+) to product ion 436.2 m/z during a total run time of 5 min. The method covers a linear calibration range of 0.146-1200 ng/mL. Intra-run and inter-run precisions were 0.4-7.2 and 0.6-12.9%. Mean recovery was at least 89%. Selectivity, accuracy and stability results comply with current European Medicines Agency and Food and Drug Administration guidelines. This successfully validated LC-MS/MS method with a wide linear calibration range requiring small serum amounts is suitable for pharmacokinetic investigations of aliskiren in pediatrics, adults and the elderly. Copyright © 2012 John Wiley & Sons, Ltd.
Panattil, Prabitha; Sreelatha, M
2016-09-01
Proteinuria is always associated with intrinsic kidney disese and is a strong predictor of later development of End Stage Renal Disease (ESRD). As Renin Angiotensin Aldosterone System (RAAS) has a role in mediating proteinuria, inhibitors of this system are renoprotective and patients with refractory proteinuria are put on a combination of these agents. The routinely employed triple blockade of RAAS with Angiotensin Converting Enzyme (ACE) inhibitor, ARB and Aldosterone antagonist has many limitations. Addition of Aliskiren to this combination suppresses the RAAS at the earliest stage and can offset many of these limitations. This study was conducted to assess the safety and efficacy of complete RAAS blockade by the addition of Aliskiren in those patients with refractory proteinuria who were already on triple blockade with ACE inhibitor, ARB and Aldosterone antagonist. This study was conducted in Nephrology Department, Calicut Medical College. A total of 36 patients with refractory proteinuria who were already on ACE inhibitor, ARB and Aldosterone antagonist were divided in to two groups A and B. Group A received Aliskiren in addition to the above combination whereas group B continued the same treatment for 12 weeks. Efficacy of the treatment was assessed by recording 24hr urine protein and safety by S.Creatinine, S.Potassium every 2 weeks of the treatment period. Statistical analysis of the lab values was done using SPSS software. Unpaired t-test, Paired t-test and Chi-square test were done for data analysis. Statistical analysis revealed that addition of Aliskiren to the combination therapy with ACE inhibitor+ ARB+ Aldosterone antagonist offers no advantage. But mean reduction in proteinuria was more with Group A than Group B. There is no statistically significant change in S.Creatinine and S.Potassium at the end of treatment. As proteinuria is a strong risk factor for progression to ESRD, even a mild decrease in proteinuria by treatment is renoprotective. Hence
Design of simulated moving bed for separation of fumaric acid with a little fronting phenomenon.
Choi, Jae-Hwan; Kang, Mun-Seok; Lee, Chung-Gi; Wang, Nien-Hwa Linda; Mun, Sungyong
2017-03-31
The production of fumaric acid through a biotechnological pathway has grown in importance because of its potential value in related industries. This has sparked an interest in developing an economically-efficient process for separation of fumaric acid (product of interest) from acetic acid (by-product). This study aimed to develop a simulated moving bed (SMB) chromatographic process for such separation in a systematic way. As a first step for this work, commercially available adsorbents were screened for their applicability to the considered separation, which revealed that an Amberchrom-CG71C resin had a sufficient potential to become an adsorbent of the targeted SMB. Using this adsorbent, the intrinsic parameters of fumaric and acetic acids were determined and then applied to optimizing the SMB process under consideration. The optimized SMB process was tested experimentally, from which the yield of fumaric-acid product was found to become lower than expected in the design. An investigation about the reason for such problem revealed that it was attributed to a fronting phenomenon occurring in the solute band of fumaric acid. To resolve this issue, the extent of the fronting was evaluated quantitatively using an experimental axial dispersion coefficient for fumaric acid, which was then considered in the design of the SMB of interest. The SMB experimental results showed that the SMB design based on the consideration of the fumaric-acid fronting could guarantee the attainment of both high purity (>99%) and high yield (>99%) for fumaric-acid product under the desorbent consumption of 2.6 and the throughput of 0.36L/L/h. Copyright © 2017 Elsevier B.V. All rights reserved.
DMF, but not other fumarates, inhibits NF-κB activity in vitro in an Nrf2-independent manner.
Gillard, Geoffrey O; Collette, Brian; Anderson, John; Chao, Jianhua; Scannevin, Robert H; Huss, David J; Fontenot, Jason D
2015-06-15
Fumarate-containing pharmaceuticals are potent therapeutic agents that influence multiple cellular pathways. Despite proven clinical efficacy, there is a significant lack of data that directly defines the molecular mechanisms of action of related, yet distinct fumarate compounds. We systematically compared the impact of dimethyl fumarate (DMF), monomethyl fumarate (MMF) and a mixture of monoethyl fumarate salts (Ca(++), Mg(++), Zn(++); MEF) on defined cellular responses. We demonstrate that DMF inhibited NF-κB-driven cytokine production and nuclear translocation of p65 and p52 in an Nrf2-independent manner. Equivalent doses of MMF and MEF did not affect NF-κB signaling. These results highlight a key difference in the biological impact of related, yet distinct fumarate compounds. Copyright © 2015. Published by Elsevier B.V.
Papadaki, Aikaterini; Papapostolou, Harris; Alexandri, Maria; Kopsahelis, Nikolaos; Papanikolaou, Seraphim; de Castro, Aline Machado; Freire, Denise M G; Koutinas, Apostolis A
2018-04-13
The microbial production of fumaric acid by Rhizopus arrhizus NRRL 2582 has been evaluated using soybean cake from biodiesel production processes and very high polarity (VHP) sugar from sugarcane mills. Soybean cake was converted into a nutrient-rich hydrolysate via a two-stage bioprocess involving crude enzyme production via solid state fermentations (SSF) of either Aspergillus oryzae or R. arrhizus cultivated on soybean cake followed by enzymatic hydrolysis of soybean cake. The soybean cake hydrolysate produced using crude enzymes derived via SSF of R. arrhizus was supplemented with VHP sugar and evaluated using different initial free amino nitrogen (FAN) concentrations (100, 200, and 400 mg/L) in fed-batch cultures for fumaric acid production. The highest fumaric acid concentration (27.3 g/L) and yield (0.7 g/g of total consumed sugars) were achieved when the initial FAN concentration was 200 mg/L. The combination of VHP sugar with soybean cake hydrolysate derived from crude enzymes produced by SSF of A. oryzae at 200 mg/L initial FAN concentration led to the production of 40 g/L fumaric acid with a yield of 0.86 g/g of total consumed sugars. The utilization of sugarcane molasses led to low fumaric acid production by R. arrhizus, probably due to the presence of various minerals and phenolic compounds. The promising results achieved through the valorization of VHP sugar and soybean cake suggest that a focused study on molasses pretreatment could lead to enhanced fumaric acid production.
pH-Dependent Uptake of Fumaric Acid in Saccharomyces cerevisiae under Anaerobic Conditions
Jamalzadeh, Elaheh; Verheijen, Peter J. T.; Heijnen, Joseph J.
2012-01-01
Microbial production of C4 dicarboxylic acids from renewable resources has gained renewed interest. The yeast Saccharomyces cerevisiae is known as a robust microorganism and is able to grow at low pH, which makes it a suitable candidate for biological production of organic acids. However, a successful metabolic engineering approach for overproduction of organic acids requires an incorporation of a proper exporter to increase the productivity. Moreover, low-pH fermentations, which are desirable for facilitating the downstream processing, may cause back diffusion of the undissociated acid into the cells with simultaneous active export, thereby creating an ATP-dissipating futile cycle. In this work, we have studied the uptake of fumaric acid in S. cerevisiae in carbon-limited chemostat cultures under anaerobic conditions. The effect of the presence of fumaric acid at different pH values (3 to 5) has been investigated in order to obtain more knowledge about possible uptake mechanisms. The experimental results showed that at a cultivation pH of 5.0 and an external fumaric acid concentration of approximately 0.8 mmol · liter−1, the fumaric acid uptake rate was unexpectedly high and could not be explained by diffusion of the undissociated form across the plasma membrane alone. This could indicate the presence of protein-mediated import. At decreasing pH levels, the fumaric acid uptake rate was found to increase asymptotically to a maximum level. Although this observation is in accordance with protein-mediated import, the presence of a metabolic bottleneck for fumaric acid conversion under anaerobic conditions could not be excluded. PMID:22113915
Mitochondrial fumarate reductase as a target of chemotherapy: from parasites to cancer cells.
Sakai, Chika; Tomitsuka, Eriko; Esumi, Hiroyasu; Harada, Shigeharu; Kita, Kiyoshi
2012-05-01
Recent research on respiratory chain of the parasitic helminth, Ascaris suum has shown that the mitochondrial NADH-fumarate reductase system (fumarate respiration), which is composed of complex I (NADH-rhodoquinone reductase), rhodoquinone and complex II (rhodoquinol-fumarate reductase) plays an important role in the anaerobic energy metabolism of adult parasites inhabiting hosts. The enzymes in these parasite-specific pathways are potential target for chemotherapy. We isolated a novel compound, nafuredin, from Aspergillus niger, which inhibits NADH-fumarate reductase in helminth mitochondria at nM order. It competes for the quinone-binding site in complex I and shows high selective toxicity to the helminth enzyme. Moreover, nafuredin exerts anthelmintic activity against Haemonchus contortus in in vivo trials with sheep indicating that mitochondrial complex I is a promising target for chemotherapy. In addition to complex I, complex II is a good target because its catalytic direction is reverse of succinate-ubiquionone reductase in the host complex II. Furthermore, we found atpenin and flutolanil strongly and specifically inhibit mitochondrial complex II. Interestingly, fumarate respiration was found not only in the parasites but also in some types of human cancer cells. Analysis of the mitochondria from the cancer cells identified an anthelminthic as a specific inhibitor of the fumarate respiration. Role of isoforms of human complex II in the hypoxic condition of cancer cells and fetal tissues is a challenge. This article is part of a Special Issue entitled Biochemistry of Mitochondria, Life and Intervention 2010. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lee, S.; Yeo, I. W.; Yeum, Y.; Kim, Y.
2016-12-01
Previous studies showed that groundwater of rural areas in Korea is often contaminated with nitrate highly exceeding the drinking water standard of 10 mg/L (NO3-N), which poses a major threat in human and livestock health. In-situ bioremediation method has been developed to reduce high nitrate-nitrogen concentration in groundwater using slowly released encapsulated carbon source. Collaborative research of this study revealed that fumarate was found to be a very effective carbon source in terms of cost and nitrate reduction against formate, propionate, and lactate. For reactive transport modeling of the bioremediation of nitrate using fumarate, the BTEX module of RT3D incorporated in GMS, a commercial groundwater modeling software developed by AQUAVEO, was adopted, where BTEX was replaced with fumarate as a carbon source. Column tests were carried out to determine transport and reaction parameters for numerical modeling such as dispersity and first order degradation rate of nitrate by fumarate. The calibration of the numerical model against column tests strongly indicated that nitrate, known to be not reactive in groundwater system, appeared to be retarded due to sorption by fumarate. The calibrated model was tested for field-scale application to the composting facility in Gimje, Korea. The numerical results showed that the model could simulate the nitrate reduction by fumarate in field scale groundwater system. The reactive transport model for nitrate can be used as a tool for optimum design of in-situ nitrate bioremediation system, such as released depth and amount of fumarate and the spacing of wells that encapsulated fumarate is released through.
Ma, Rena; Liu, Fang; Yap, Soe F; Lee, Hoyul; Leong, Rupert W; Riordan, Stephen M; Grimm, Michael C; Zhang, Li
2018-01-01
Inflammatory bowel diseases (IBD) are chronic inflammatory conditions of the gastrointestinal tract with multifactorial etiology. Both dietary factors and the microbe Campylobacter concisus have been found to be associated with the condition. The current study examined the effects of sodium fumarate, a neutralized product of the food additives fumaric acid and monosodium fumarate when in the intestinal environment, on the growth of C. concisus to determine the effects of these food additives on IBD-associated bacterial species. Through culture methods and quantification, it was found that neutralized fumaric acid, neutralized monosodium fumarate, and sodium fumarate increased the growth of C. concisus , with the greatest increase in growth at a concentration of 0.4%. Further examination of 50 C. concisus strains on media with added sodium fumarate showed that greatest growth was also achieved at a concentration of 0.4%. At a concentration of 2% sodium fumarate, all strains examined displayed less growth in comparison with those cultured on media without sodium fumarate. Using mass spectrometry, multiple C. concisus proteins showed significant differential expression when cultured on media with and without 0.4% sodium fumarate. The findings presented suggest that patients with IBD should consider avoiding excessive consumption of foods with fumaric acid or its sodium salts, and that the addition of 0.4% sodium fumarate alone to media may assist in the isolation of C. concisus from clinical samples.
Effect of bicarbonate concentration on aerobic growth of campylobacter in a fumarate-pyruvate medium
USDA-ARS?s Scientific Manuscript database
The purpose of the present study was to examine the effect of sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in a fumarate-pyruvate medium. Fumarate-pyruvate broth medium was supplemented with 0.00 to 0.10% NaHCO3 and inoculated with Campylobacter coli 33559, Campyloba...
Wee, Young-Jung; Yun, Jong-Sun; Kang, Kui-Hyun; Ryu, Hwa-Won
2002-01-01
Enterococcus faecalis RKY1, a fumarate-reducing bacterium, was immobilized in an asymmetric hollow-fiber bioreactor (HFBR) for the continuous production of succinic acid. The cells were inoculated into the shell side of the HFBR, which was operated in transverse mode. Since the pH values in the HFBR declined during continuous operation to about 5.7, it was necessary to change the feed pH from 7.0 to 8.0 after 24 h of operation in order to enhance production of succinic acid. During continuous operation with a medium containing fumarate and glycerol, the productivity of succinate was 3.0-10.9 g/(L x h) with an initial concentration of 30 g/L of fumarate, 4.9-14.9 g/(L x h) with 50 g/L of fumarate, and 7.2-17.1 g/(L x h) with 80 g/L of fumarate for dilution rates between 0.1 and 0.4 h(-1). The maximum productivity of succinate obtained by the HFBR (17.1 g of succinate/[L x h]) was 1.7 times higher than that of the batch bioconversions (9.9 g of succinate/ [L x h]) with 80 g/L of fumarate. Furthermore, the long-term stability of the HFBR was demonstrated with a continuously efficient production of succinate for more than 15 d (360 h).
21 CFR 522.84 - Beta-aminopropionitrile fumarate.
Code of Federal Regulations, 2010 CFR
2010-04-01
... use in breeding animals since the effects on fertility, pregnancy, or fetal health have not been... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Beta-aminopropionitrile fumarate. 522.84 Section 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...
Liu, Huan; Zhao, Shijie; Jin, Yuhan; Yue, Xuemin; Deng, Li; Wang, Fang; Tan, Tianwei
2017-11-01
Fumaric acid is an important building-block chemical. The production of fumaric acid by fermentation is possible. Loofah fiber is a natural, biodegradable, renewable polymer material with highly sophisticated and pore structure. This work investigated a new immobilization method using loofah fiber as carrier to produce fumaric acid in a stirred-tank reactor. Compared with other carriers, loofah fiber was proven to be efficiently and successfully used in the reactor. After the optimization process, 20g addition of loofah fiber and 400rpm agitation speed were chosen as the most suitable process conditions. 30.3g/L fumaric acid in the broth as well as 19.16g fumaric acid in the precipitation of solid was achieved, while the yield from glucose reached 0.211g/g. Three batches of fermentation using the same loofah fiber carrier were conducted successfully, which meant it provided a new method to produce fumaric acid in a stirred-tank reactor. Copyright © 2017. Published by Elsevier Ltd.
Roh, Kyung-Baeg; Jung, Eunsun; Park, Deokhoon; Lee, Jongsung
2013-08-01
Eotaxin-1 is a potent chemoattractant for eosinophils and a critical mediator during the development of eosinophilic inflammation. Fumaric acid is an intermediate product of the citric acid cycle, which is source of intracellular energy. Although fumaric acid ameliorates psoriasis and multiple sclerosis, its involvement in eotaxin-1-mediated effects has not been assessed. In this study, we investigated the effects of fumaric acid on eotaxin-1 expression in a mouse fibroblast cell line. We found that fumaric acid significantly inhibited tumor necrosis factor-α (TNF-α-induced eotaxin-1 expression. This fumaric acid effect was mediated through the inhibition of p38 mitogen-activated protein kinase (MAPK)-dependent nuclear factor (NF)-κB signaling. We also found that fumaric acid operates downstream of MEKK3 during TNF-α-induced NF-κB signaling, which upregulated eotaxin-1 expression. In addition, fumaric acid attenuated expression of CC-chemokine receptor 3 (CCR3), an eotaxin-1 receptor, and adhesion molecules that play important roles in eosinophil binding to induce allergic inflammation. Taken together, these findings indicate that inhibiting TNF-α-induced eotaxin-1 expression by fumaric acid occurs primarily through suppression of NF-κB signaling, which is mediated by inhibiting p38 MAPK and suggest that fumaric acid may be used as a complementary treatment option for eotaxin-1-mediated diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshtrakh, M. I.; Novikov, E. G.; Semionkin, V. A.
2010-07-13
A study of several samples of vitamins and dietary supplements containing ferrous fumarate and ferrous sulfate was carried out using Moessbauer spectroscopy with a high velocity resolution. A presence of ferrous and ferric impurities was revealed. Small variations of Moessbauer hyperfine parameters were found for both ferrous fumarates and ferrous sulfates in the investigated medicines.
Liu, Lei; Cao, Na; Ma, Xingling; Xiong, Kaihe; Sun, Lili; Zou, Qiaogen
2016-04-01
High-performance liquid chromatography analysis of vonoprazan fumarate, a novel proton pump inhibitor drug revealed six impurities. These were identified by liquid chromatography with mass spectrometry. Further, the structures of the impurities were confirmed by synthesis followed by characterization by mass spectrometry, NMR spectroscopy, and infrared spectroscopy. On the basis of these data and knowledge of the synthetic scheme of vonoprazan fumarate, the previously unknown impurity was identified as 1-[5-(2-fluorophenyl)-1-(pyridin-3-ylsulfonyl)-1H-pyrrol-3-yl]-N-methyldimethylamine, which is a new compound. The possible mechanisms by which these impurities were formed were also discussed. A high-performance liquid chromatography method was optimized in order to separate, selectively detect, and quantify all process-related impurities of vonoprazan fumarate. The presented method has been validated in terms of linearity, limits of detection, and quantification, and response factors and, therefore, is highly suitable for routine analysis of vonoprazan fumarate related substances as well as stability studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Role of dimethyl fumarate in oxidative stress of multiple sclerosis: A review.
Suneetha, A; Raja Rajeswari, K
2016-04-15
Multiple sclerosis (MS) is a chronic inflammatory disease of the CNS affecting both white and grey matter. Inflammation and oxidative stress are also thought to promote tissue damage in multiple sclerosis. Recent data point at an important role of anti-oxidative pathways for tissue protection in chronic MS, particularly involving the transcription factor nuclear factor (erythroid-derived 2)-related factor 2 (Nrf2). Thus, novel therapeutics enhancing cellular resistance to free radicals could prove useful for MS treatment. Oxidative stress and anti-oxidative pathways are important players in MS pathophysiology and constitute a promising target for future MS therapy with dimethyl fumarate. The clinical utility of DMF in multiple sclerosis is being explored through phase III trials with BG-12, which is an oral therapeutic agent. Currently a wide research is going on to find out the exact mechanism of DMF, till date it is not clear. Based on strong signals of nephrotoxicity in non-humans and the theoretical risk of renal cell cancer from intracellular accumulation of fumarate, post-marketing study of a large population of patients will be necessary to fully assess the long-term safety of dimethyl fumarate. The current treatment goals are to shorten the duration and severity of relapses, prolong the time between relapses, and delay progression of disability. In this regard, dimethyl fumarate offers a promising alternative to orally administered fingolimod (GILENYA) or teriflunomide (AUBAGIO), which are currently marketed in the United States under FDA-mandated Risk Evaluation and Mitigation Strategy (REMS) programs because of serious safety concerns. More clinical experience with all three agents will be necessary to differentiate the tolerability of long-term therapy for patients diagnosed with multiple sclerosis. This write-up provides the detailed information of dimethyl fumarate in treating the neuro disease, multiple sclerosis and its mechanism involved via
Abdl-Rahman, M A; Sawiress, F A R; Abd El-Aty, A M
2010-01-01
The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH(3)-N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (Y(ATP)). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH(3)-N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency.
Abdl-Rahman, M. A.; Sawiress, F. A. R.; Abd El-Aty, A. M.
2010-01-01
The aim of the current study was to evaluate the effect of sodium lauryl sulfate-fumaric acid coupled addition on in vitro methangenesis and rumen fermentation. Evaluation was carried out using in vitro gas production technique. Ruminal contents were collected from five steers immediately after slaughtering and used for preparation of inoculums of mixed rumen microorganisms. Rumen fluid was then mixed with the basal diet of steers and used to generate four treatments, negative control (no additives), sodium lauryl sulfate (SLS) treated, fumaric acid treated, and SLS-fumaric acid coupled addition treated. The results revealed that, relative to control, efficiency in reduction of methanogenesis was as follows: coupled addition > SLS-addition > fumaric acid addition. Both SLS-addition and SLS-fumaric acid coupled addition demonstrated a decremental effect on ammonia nitrogen (NH3–N), total short chain volatile fatty acids (SCVFAs) concentrations and the amount of substrate degraded, and an increment effect on microbial mass and microbial yield (YATP). Nevertheless, fumaric acid did not alter any of the previously mentioned parameters but induced a decremental effect on NH3–N. Furthermore, both fumaric acid and SLS-fumaric acid coupled addition increased propionate at the expense of acetate and butyrate, while, defaunation increased acetate at the expense of propionate and butyrate. The pH value was decreased by all treatments relative to control, while, cellulase activity did not differ by different treatments. The current study can be promising strategies for suppressing ruminal methane emissions and improving ruminants feed efficiency. PMID:20445794
Aliskiren Prevents the Toxic Effects of Peritoneal Dialysis Fluids during Chronic Dialysis in Rats
Pérez-Martínez, Juan; Pérez-Martínez, Francisco C.; Carrión, Blanca; Masiá, Jesús; Ortega, Agustín; Simarro, Esther; Nam-Cha, Syong H.; Ceña, Valentín
2012-01-01
The benefits of long-term peritoneal dialysis (PD) in patients with end-stage renal failure are short-lived due to structural and functional changes in the peritoneal membrane. In this report, we provide evidence for the in vitro and in vivo participation of the renin-angiotensin-aldosterone system (RAAS) in the signaling pathway leading to peritoneal fibrosis during PD. Exposure to high-glucose PD fluids (PDFs) increases damage and fibrosis markers in both isolated rat peritoneal mesothelial cells and in the peritoneum of rats after chronic dialysis. In both cases, the addition of the RAAS inhibitor aliskiren markedly improved damage and fibrosis markers, and prevented functional modifications in the peritoneal transport, as measured by the peritoneal equilibrium test. These data suggest that inhibition of the RAAS may be a novel way to improve the efficacy of PD by preventing inflammation and fibrosis following peritoneal exposure to high-glucose PDFs. PMID:22558414
Serebryakova, Marina V; Bertsova, Yulia V; Sokolov, Svyatoslav S; Kolesnikov, Alexander A; Baykov, Alexander A; Bogachev, Alexander V
2018-06-01
One of the three domains of kinetoplastid NADH:fumarate oxidoreductase (FRD) is homologous to bacterial flavin transferase that catalyzes transfer of FMN residue from FAD to threonine in flavoproteins. Leptomonas pyrrhocoris FRD produced in yeast cells, which lack flavin transferase gene in their proteome, reduces fumarate in the presence of NADH and contains an FMN residue covalently linked to a Ser9 residue. The conserved flavinylation motif of FRD, D 3 (g/s)x(s/t)(s/g)AS 9 , is similar to the Dxx(s/t)gAT motif recognized by flavin transferase in prokaryotic proteins. Ser9 replacement abolished the flavinylation and fumarate reductase activity of FRD. These findings suggest that the flavinylation is important for the activity of FRD and that this post-translational modification is carried out by the own flavin transferase domain. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
21 CFR 520.82a - Aminopropazine fumarate tablets.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...
21 CFR 520.82a - Aminopropazine fumarate tablets.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...
21 CFR 520.82a - Aminopropazine fumarate tablets.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82a...
[Determination of dimethyl fumarate in bakery food by d-SPE-HPLC-PDA].
Yang, Jie; Luo, Mengtian; Feng, Di; Miao, Hong; Song, Shufeng; Zhao, Yunfeng
2015-05-01
To establish a simple and rapid pretreatment method with dispersive solid phase extraction ( d-SPE) by HPLC for determination of dimethyl fumarate in bakery foods. Dimethyl fumarate in samples was ultrasonically extracted by methanol, and cleaned up with d-SPE. Then, it was separated on C18 chromatographic column (4.6 mm x 25 mm, 5 μm) with a mixture of methanol--0.03 mol/L sodium acetate and 0.008 mol/L tetrabutyl ammonium bromide (40: 60, V/V) as mobile phase. The photodiode array detector was used in the determination under λ = 220 nm. In the linear range of 0.1 -25 μg/ml, the correlation coefficients was r > 0.999, and the average recoveries of the spiked samples were in the range of 82.8% - 107.5% with relative standard deviations (RSD) in the range of 3.30% - 7.30% (n = 6). The limit of detection ( LOD) was 0.4 mg/kg, and the limit of quantification was 1.0 mg/kg. The method is simple, rapid, sensitive and accurate, and suitable for determine dimethyl fumarate in bakery foods.
Dumitriu, Bogdan; Ito, Sawa; Feng, Xingmin; Stephens, Nicole; Yunce, Muharrem; Kajigaya, Sachiko; Melenhorst, Joseph J; Rios, Olga; Scheinberg, Priscila; Chinian, Fariba; Keyvanfar, Keyvan; Battiwalla, Minoo; Wu, Colin O; Maric, Irina; Xi, Liqiang; Raffeld, Mark; Muranski, Pawel; Townsley, Danielle M; Young, Neal S; Barrett, Austin J; Scheinberg, Phillip
2016-01-01
T-cell large granular lymphocytic leukaemia (T-LGL) is a lymphoproliferative disease that presents with immune-mediated cytopenias and is characterised by clonal expansion of cytotoxic CD3+ CD8+ lymphocytes. Use of methotrexate, ciclosporin, or cyclophosphamide as first therapy improves cytopenias in 50% of patients, but long-term use of these can lead to toxicity. We aimed to explore the activity and safety of alemtuzumab, an anti-CD52 monoclonal antibody, in patients with T-LGL. We did this single-arm, phase 2 trial in consecutively enrolled adults with T-LGL referred to the National Institutes of Health in Bethesda, MD, USA. Alemtuzumab was given intravenously at 10 mg per day for 10 days. The primary endpoint was haematological response at 3 months after infusion. A complete response was defined as normalisation of all affected lineages, and a partial response was defined in neutropenic patients as 100% increase in the absolute neutrophil count to more than 5 × 10(8) cells per L, and in those with anaemia, as any increase in haemoglobin of 20 g/L or higher observed in at least two serial measurements 1 week apart and sustained for 1 month or longer without exogenous growth factors support or transfusions. Analysis was by intention to treat. We report results from the first stage of this Simon two-stage design trial; enrolment into the second stage is continuing. This study is registered with ClinicalTrials.gov, number NCT00345345. From Oct 1, 2006, to March 1, 2015, we enrolled 25 patients with T-LGL. 14 patients (56%; 95% CI 35-76) had a haematological response at 3 months. Four patients with associated myelodysplastic syndrome and two who had received haemopoietic stem cell transplantation had either no response or were not evaluable, meaning 14 (74% [49-91]) of the 19 patients with classic T-LGL responded. All patients had an infusion reaction (24 [96%] patients grade 1-2, one [4%] patient grade 3), which improved with symptomatic therapy. All
Footwear contact dermatitis from dimethyl fumarate.
Švecová, Danka; Šimaljakova, Maria; Doležalová, Anna
2013-07-01
Dimethyl fumarate (DMF) is an effective inhibitor of mold growth. In very low concentrations, DMF is a potent sensitizer that can cause severe allergic contact dermatitis (ACD). It has been identified as the agent responsible for furniture contact dermatitis in Europe. The aim of this study was to evaluate patients in Slovakia with footwear ACD associated with DMF, with regard to clinical manifestations, patch test results, and results of chemical analysis of their footwear. Nine patients with suspected footwear contact dermatitis underwent patch testing with the following allergens: samples of their own footwear, commercial DMF, the European baseline, shoe screening, textile and leather dye screening, and industrial biocides series. The results were recorded according to international guidelines. The content of DMF in footwear and anti-mold sachets was analyzed using gas chromatography and mass spectrometry. Acute ACD was observed in nine Caucasian female patients. All patients developed delayed sensitization, as demonstrated by positive patch testing using textile footwear lining. Seven patients were patch tested with 0.1% DMF, and all seven were positive. Chemical analysis of available footwear showed that DMF was present in very high concentrations (25-80 mg/Kg). Dimethyl fumarate is a new footwear allergen and was responsible for severe ACD in our patients. To avoid an increase in the number of cases, the already approved European preventive measures should be accepted and commonly employed. © 2013 The International Society of Dermatology.
Application of acetate, lactate, and fumarate as electron donors in microbial fuel cell
NASA Astrophysics Data System (ADS)
Vasyliv, Oresta M.; Bilyy, Oleksandr I.; Ferensovych, Yaroslav P.; Hnatush, Svitlana O.
2013-09-01
Microbial fuel cells (MFCs) are devices that use bacteria as the catalysts to oxidize organic and inorganic matter and generate current. Up to now, several classes of extracellular electron transfer mechanisms have been elucidated for various microorganisms. Shewanellaceae and Geobacteraceae families include the most of model exoelectrogenic microorganisms. Desulfuromonas acetoxidans bacterium inhabits aquatic sedimental sulfur-containing environments and is philogenetically close to representatives of Geobacteraceae family. Two chamber microbial fuel cell (0.3 l volume) was constructed with application of D. acetoxidans IMV B-7384 as anode biocatalyst. Acetic, lactic and fumaric acids were separately applied as organic electron donors for bacterial growth in constructed MFC. Bacterial cultivation in MFC was held during twenty days. Lactate oxidation caused electric power production with the highest value up to 0.071 mW on 64 hour of D. acetoxidans IMV B-7384 growth. Addition of acetic and fumaric acids into bacterial growth medium caused maximal power production up to 0.075 and 0.074 mW respectively on the 40 hour of their growth. Increasing of incubation time up to twentieth day caused decrease of generated electric power till 0.018 mW, 0.042 mW and 0.047 mW under usage of lactic, acetic and fumaric acids respectively by investigated bacteria. Power generation by D. acetoxidans IMV B-7384 was more stabile and durable under application of acetic and fumaric acids as electron donors in constructed MFC, than under addition of lactic acid in the same concentration into the growth medium.
Park, D. H.; Zeikus, J. G.
1999-01-01
Neutral red (NR) functioned as an electronophore or electron channel enabling either cells or membranes purified from Actinobacillus succinogenes to drive electron transfer and proton translocation by coupling fumarate reduction to succinate production. Electrically reduced NR, unlike methyl or benzyl viologen, bound to cell membranes, was not toxic, and chemically reduced NAD. The cell membrane of A. succinogenes contained high levels of benzyl viologen-linked hydrogenase (12.2 U), fumarate reductase (13.1 U), and diaphorase (109.7 U) activities. Fumarate reductase (24.5 U) displayed the highest activity with NR as the electron carrier, whereas hydrogenase (1.1 U) and diaphorase (0.8 U) did not. Proton translocation by whole cells was dependent on either electrically reduced NR or H2 as the electron donor and on the fumarate concentration. During the growth of Actinobacillus on glucose plus electrically reduced NR in an electrochemical bioreactor system versus on glucose alone, electrically reduced NR enhanced glucose consumption, growth, and succinate production by about 20% while it decreased acetate production by about 50%. The rate of fumarate reduction to succinate by purified membranes was twofold higher with electrically reduced NR than with hydrogen as the electron donor. The addition of 2-(n-heptyl)-4-hydroxyquinoline N-oxide to whole cells or purified membranes inhibited succinate production from H2 plus fumarate but not from electrically reduced NR plus fumarate. Thus, NR appears to replace the function of menaquinone in the fumarate reductase complex, and it enables A. succinogenes to utilize electricity as a significant source of metabolic reducing power. PMID:10198002
21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...
21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...
21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...
21 CFR 520.82 - Aminopropazine fumarate oral dosage forms.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate oral dosage forms. 520.82 Section 520.82 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82...
Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni; Luna-Chávez, César; Davis, Tyler A.; Sarwar, Maruf; Ham, Amy J.; McDonald, W. Hayes; Yankovskaya, Victoria; Stern, Harry A.; Johnston, Jeffrey N.; Maklashina, Elena; Cecchini, Gary; Iverson, Tina M.
2011-01-01
Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of the C2–C3 double bond of activated fumarate parallel to the C(4a)–N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR. PMID:21098488
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni
2012-01-05
Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of themore » C2-C3 double bond of activated fumarate parallel to the C(4a)-N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR.« less
Fogarty, Emer; Schmitz, Susanne; Tubridy, Niall; Walsh, Cathal; Barry, Michael
2016-09-01
Randomised studies have demonstrated efficacy of disease-modifying therapies in relapsing remitting multiple sclerosis (RRMS). However it is unclear how the magnitude of treatment efficacy varies across all currently available therapies. To perform a systematic review and network meta-analysis to evaluate the comparative efficacy of available therapies in reducing relapses and disability progression in RRMS. A systematic review identified 28 randomised, placebo-controlled and direct comparative trials. A network meta-analysis was conducted within a Bayesian framework to estimate comparative annualised relapse rates (ARR) and risks of disability progression (defined by both a 3-month, and 6-month confirmation interval). Potential sources of treatment-effect modification from study-level covariates and baseline risk were evaluated through meta-regression methods. The Surface Under the Cumulative RAnking curve (SUCRA) method was used to provide a ranking of treatments for each outcome. The magnitude of ARR reduction varied between 15-36% for all interferon-beta products, glatiramer acetate and teriflunomide, and from 50 to 69% for alemtuzumab, dimethyl fumarate, fingolimod and natalizumab. The risk of disability progression (3-month) was reduced by 19-28% with interferon-beta products, glatiramer acetate, fingolimod and teriflunomide, by 38-45% for pegylated interferon-beta, dimethyl fumarate and natalizumab and by 68% with alemtuzumab. Broadly similar estimates for the risk of disability progression (6-month), with the exception of interferon-beta-1b 250mcg which was much more efficacious based on this definition. Alemtuzumab and natalizumab had the highest SUCRA scores (97% and 95% respectively) for ARR, while ranking for disability progression varied depending on the definition of the outcome. Interferon-beta-1b 250mcg ranked among the most efficacious treatments for disability progression confirmed after six months (92%) and among the least efficacious when the
USDA-ARS?s Scientific Manuscript database
The naturally occurring compound, fumaric acid, was evaluated as a potential preservative for the long-term storage of cucumbers. Fumaric acid inhibited growth of lactic acid bacteria (LAB) in an acidified cucumber juice medium model system resembling conditions that could allow preservation of cucu...
NASA Astrophysics Data System (ADS)
Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan
2017-05-01
The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91 THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87 THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation.
Zhang, Xinke; Hay, Joel W; Niu, Xiaoli
2015-01-01
The aim of the study was to compare the cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate, and intramuscular (IM) interferon (IFN)-β(1a) as first-line therapies in the treatment of patients with relapsing-remitting multiple sclerosis (RRMS). A Markov model was developed to evaluate the cost effectiveness of disease-modifying drugs (DMDs) from a US societal perspective. The time horizon in the base case was 5 years. The primary outcome was incremental net monetary benefit (INMB), and the secondary outcome was incremental cost-effectiveness ratio (ICER). The base case INMB willingness-to-pay (WTP) threshold was assumed to be US$150,000 per quality-adjusted life year (QALY), and the costs were in 2012 US dollars. One-way sensitivity analyses and probabilistic sensitivity analysis were conducted to test the robustness of the model results. Dimethyl fumarate dominated all other therapies over the range of WTPs, from US$0 to US$180,000. Compared with IM IFN-β(1a), at a WTP of US$150,000, INMBs were estimated at US$36,567, US$49,780, and US$80,611 for fingolimod, teriflunomide, and dimethyl fumarate, respectively. The ICER of fingolimod versus teriflunomide was US$3,201,672. One-way sensitivity analyses demonstrated the model results were sensitive to the acquisition costs of DMDs and the time horizon, but in most scenarios, cost-effectiveness rankings remained stable. Probabilistic sensitivity analysis showed that for more than 90% of the simulations, dimethyl fumarate was the optimal therapy across all WTP values. The three oral therapies were favored in the cost-effectiveness analysis. Of the four DMDs, dimethyl fumarate was a dominant therapy to manage RRMS. Apart from dimethyl fumarate, teriflunomide was the most cost-effective therapy compared with IM IFN-β(1a), with an ICER of US$7,115.
Li, Xin; Zhou, Jin; Ouyang, Shuiping; Ouyang, Jia; Yong, Qiang
2017-02-01
Production of fumaric acid from alkali-pretreated corncob (APC) at high solids loading was investigated using a combination of separated hydrolysis and fermentation (SHF) and fed-batch simultaneous saccharification and fermentation (SSF) by Rhizopus oryzae. Four different fermentation modes were tested to maximize fumaric acid concentration at high solids loading. The highest concentration of 41.32 g/L fumaric acid was obtained from 20 % (w/v) APC at 38 °C in the combined SHF and fed-batch SSF process, compared with 19.13 g/L fumaric acid in batch SSF alone. The results indicated that a combination of SHF and fed-batch SSF significantly improved production of fumaric acid from lignocellulose by R. oryzae than that achieved with batch SSF at high solids loading.
Teo, Koon K; Pfeffer, Marc; Mancia, Giuseppe; O'Donnell, Martin; Dagenais, Gilles; Diaz, Rafael; Dans, Antonio; Liu, Lisheng; Bosch, Jackie; Joseph, Philip; Copland, Ingrid; Jung, Hyejung; Pogue, Janice; Yusuf, Salim
2014-07-01
We studied the unclear question whether blood pressure (BP) lowering reduces cardiovascular disease (CVD) in elderly individuals with systolic BP <160 mm Hg. We initiated a randomized placebo-controlled stratified 2 × 2 factorial clinical trial evaluating the effects of BP lowering in 11 000 elderly individuals with systolic blood pressure (SBP) between 130 and 159 mm Hg, for 5 years. Following 5-week active run-in, participants were randomized to aliskiren (300 mg) or placebo, and to an additional antihypertensive [hydrochlorothiazide (25 mg) or amlodipine (5 mg)], or their respective placeboes. Study was terminated by sponsor after 1759 subjects (age 72.1 ± 5.2 years, 88% receiving at least one antihypertensive) were randomized and followed for 0.6 year. Study drugs were well tolerated with few serious adverse events during run-in and after randomization, with no significant differences between treatment groups. By design, three levels of BP reductions were achieved, adjusted mean BP reductions of 3.5/1.7 mm Hg (P < 0.001) by aliskiren, 6.8/3.3 mm Hg (P < 0.001) by hydrochlorothiazide or amlodipine, and 10.3/5.0 mm Hg (P < 0.001) by double therapy compared with placebo. Twenty-five major CVD events occurred. Non-significant trends towards fewer CVD events with greater BP reductions are evident: hazard ratios (HR) 0.82 [95% confidence interval (CI): 0.37-1.81] for 3.5 mm Hg SBP reduction; HR 0.45 (95% CI: 0.19-1.04) for 6.8 mm Hg; and HR 0.25 (0.05-1.18) for 10.3 mm Hg reduction for primary composite of CV death, MI, stroke, or significant heart failure. Sizeable reductions in BP, with potential for substantial CVD reduction, can be safely achieved using combinations of BP drugs in the elderly with normal high and Stage 1 hypertension. NCT01259297. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.
Hinton, Arthur
2016-09-01
The ability of Campylobacter to grow aerobically in media supplemented with fumarate-pyruvate or with dairy, meat, or soy extracts or peptones was examined. Optical densities (OD) of Campylobacter cultured in basal media, media supplemented with fumarate-pyruvate or with 1.0, 2.5, 5.0, or 7.5% beef extract was measured. Growth was also compared in media supplemented with other extracts or peptones. Finally, cfu/mL of Campylobacter recovered from basal media or media supplemented with fumarate-pyruvate, casamino acids, beef extract, soytone, or beef extract and soytone was determined. Results indicated that OD of cultures grown in media supplemented with fumarate-pyruvate or with 5.0 or 7.5% beef extract were higher than OD of isolates grown in basal media or media supplemented with lower concentrations of beef extract. Highest OD were produced by isolates grown in media supplemented with beef extract, peptone from meat, polypeptone, proteose peptone, or soytone. Also, more cfu/mL were recovered from media with fumarate-pyruvate, beef extract, soytone, or beef extract-soytone than from basal media or media with casamino acids. Findings indicate that media supplemented with organic acids, vitamins, and minerals and media supplemented with extracts or peptones containing these metabolites can support aerobic growth of Campylobacter. Published by Elsevier Ltd.
Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan
2017-05-05
The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.
Fumaric acid: an overlooked form of fixed carbon in Arabidopsis and other plant species
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chia, D.W.; Yoder, T.J.; Reiter, W.D.
2000-10-01
Photoassimilates are used by plants for production of energy, as carbon skeletons and in transport of fixed carbon between different plant organs. Many studies have been devoted to characterizing the factors that. regulate photoassimilate concentrations in different plant species. Most studies examining photoassimilate concentrations in C{sub 3} plants have focused on analyzing starch and soluble sugars. However, work presented here demonstrates that a number of C{sub 3} plants, including the popular model organism Arabidopsis thaliana (L.) Heynh., and agriculturally important plants, such as soybean [Glycine ma (L.) Merr.], contain significant quantities of furnaric acid. In fact, furnaric acid can accumulatemore » to levels of several mg per g fresh weight in A-abidopsis leaves, often exceeding starch and soluble sugar levels. Furnaric acid is a component of the tricarboxylic acid cycle and, like starch and soluble sugars, can be metabolized to yield energy and carbon skeletons for production of other compounds. Fumaric acid concentrations increase with plant age and light intensity in Arabidopsis leaves. Arabidopsis phloem exudates contain significant quantities of fumaric acid, raising the possibility that fumaric acid may function in carbon transport.« less
NASA Astrophysics Data System (ADS)
Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti
2016-03-01
The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.
Pan, Xinrong; Liu, Huanhuan; Liu, Jiao; Wang, Cheng; Wen, Jianping
2016-12-01
In order to relieve the toxicity of furfural on Rhizopus oryzae fermentation, the molecular mechanism of R. oryzae responding to furfural stress for fumaric acid-production was investigated by omics-based approaches. In metabolomics analysis, 29 metabolites including amino acid, sugars, polyols and fatty acids showed significant changes for maintaining the basic cell metabolism at the cost of lowering fumaric acid production. To further uncover the survival mechanism, lipidomics was carried out, revealing that phosphatidylcholine, phosphatidylglycerol, phosphatidylinositol and polyunsaturated acyl chains might be closely correlated with R. oryzae's adapting to furfural stress. Based on the above omics analysis, lecithin, inositol and soybean oil were exogenously supplemented separately with an optimized concentration in the presence of furfural, which increased fumaric acid titer from 5.78g/L to 10.03g/L, 10.05g/L and 12.13g/L (increased by 73.5%, 73.8% and 110%, respectively). These findings provide a methodological guidance for hemicellulose-fumaric acid development. Copyright © 2016 Elsevier Ltd. All rights reserved.
Stress Studies of Tenofovir Disoproxil Fumarate by HPTLC in Bulk Drug and Pharmaceutical Formulation
Havele, Shweta; Dhaneshwar, Sunil R.
2012-01-01
A stability-indicating high-performance thin-layer chromatographic (HPTLC) method for determination of tenofovir disoproxil fumarate in bulk drug and in tablet has been developed and validated. The mobile phase selected was chloroform : methanol (9.0 : 1.0, v/v) with ultraviolet (UV) detection at 260 nm. The retention factor was found to be 0.49 ± 0.03 with correlation coefficients of 0.9994 in the range 300–1500 ng/spot and with an accuracy of 99.25%. Method had the potential to determine tenofovir disoproxil fumarate from tablet without any interference, and it was a stability-indicating one. PMID:22606065
21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...
21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...
21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Aminopropazine fumarate, neomycin sulfate tablets. 520.82b Section 520.82b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.82b...
Ikegami, Yuki
2014-01-01
Although anaerobic glycerol metabolism in Enterococcus faecalis requires exogenous fumarate for NADH oxidation, E. faecalis strain W11 can metabolize glycerol in the absence of oxygen without exogenous fumarate. In this study, metabolic end product analyses and reporter assays probing the expression of enzymes involved in pyruvate metabolism were performed to investigate this fumarate-independent anaerobic metabolism of glycerol in W11. Under aerobic conditions, the metabolic end products of W11 cultured with glycerol were similar to those of W11 cultured with glucose. However, when W11 was cultured anaerobically, most of the glucose was converted to l-lactate, but glycerol was converted to ethanol and formate. During anaerobic culture with glycerol, the expression of the l-lactate dehydrogenase and pyruvate dehydrogenase E1αβ genes in W11 was downregulated, whereas the expression of the pyruvate formate-lyase (Pfl) and aldehyde/alcohol dehydrogenase genes was upregulated. These changes in the expression levels caused the change in the composition of end products. A pflB gene disruptant (Δpfl mutant) of W11 could barely utilize glycerol under anaerobic conditions, but the growth of the Δpfl mutant cultured with either glucose or dihydroxyacetone (DHA) under anaerobic conditions was the same as that of W11. Glucose metabolism and DHA generates one NADH molecule per pyruvate molecule, whereas glycerol metabolism in the dehydrogenation pathway generates two NADH molecules per pyruvate molecule. These findings demonstrate that NADH generated from anaerobic glycerol metabolism in the absence of fumarate is oxidized through the Pfl-ethanol fermentation pathway. Thus, Pfl is essential to avoid the accumulation of excess NADH during fumarate-independent anaerobic glycerol metabolism. PMID:24769696
NASA Astrophysics Data System (ADS)
Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin
2011-11-01
To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.
Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong
2017-11-05
The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8C7N1H27 and the carboxyl group COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong
2017-11-01
The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10 THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8dbnd C7sbnd N1sbnd H27 and the carboxyl group sbnd COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34 THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation.
von Kutzleben, Stephanie; Pryce, Gareth; Giovannoni, Gavin; Baker, David
2017-04-01
The objective was to determine whether CD52 lymphocyte depletion can act to promote immunological tolerance induction by way of intravenous antigen administration such that it could be used to either improve efficiency of multiple sclerosis (MS) inhibition or inhibit secondary autoimmunities that may occur following alemtuzumab use in MS. Relapsing experimental autoimmune encephalomyelitis was induced in ABH mice and immune cell depletion was therapeutically applied using mouse CD52 or CD4 (in conjunction with CD8 or CD20) depleting monoclonal antibodies. Immunological unresponsiveness was then subsequently induced using intravenous central nervous system antigens and responses were assessed clinically. A dose-response of CD4 monoclonal antibody depletion indicated that the 60-70% functional CD4 T-cell depletion achieved in perceived failed trials in MS was perhaps too low to even stop disease in animals. However, more marked (~75-90%) physical depletion of CD4 T cells by CD4 and CD52 depleting antibodies inhibited relapsing disease. Surprisingly, in contrast to CD4 depletion, CD52 depletion blocked robust immunological unresponsiveness through a mechanism involving CD8 T cells. Although efficacy was related to the level of CD4 T-cell depletion, the observations that CD52 depletion of CD19 B cells was less marked in lymphoid organs than in the blood provides a rationale for the rapid B-cell hyper-repopulation that occurs following alemtuzumab administration in MS. That B cells repopulate in the relative absence of T-cell regulatory mechanisms that promote immune tolerance may account for the secondary B-cell autoimmunities, which occur following alemtuzumab treatment of MS. © 2016 The Authors. Immunology Published by John Wiley & Sons Ltd.
Racial Disparity in Renal Transplantation: Alemtuzumab the Great Equalizer?
Smith, Alison A; John, Mira M; Dortonne, Isabelle S; Paramesh, Anil S; Killackey, Mary; Jaffe, Bernard M; Buell, Joseph F
2015-10-01
Racial disparity as a barrier to successful outcomes in renal transplants for African Americans has been well described. Numerous unsuccessful attempts have been made to identify specific immunologic and socioeconomic factors. The objective of our study was to determine whether alemtuzumab (AL) induction abolishes this discrepancy and improves allograft survival in African American recipients. A retrospective chart review of consecutive adult renal transplants was conducted between 2006 and 2014. Kaplan-Meier analysis and hazard ratios were calculated for the African Americans (AA) and white groups. Multiple linear regressions were performed to assess independent variables (race, retransplant, sex, donor type, induction agent) on allograft survival. A significant difference in allograft survival was identified between whites (n = 272) and AA (n = 445), with AA experiencing more graft losses (18.2% vs 12.1%, P = 0.0351). Induction with AL improved outcomes in all transplant recipients. Multiple linear regression identified that the strongest predictor of allograft failure was induction without AL (P < 0.0001). The data for a subset analysis matched for follow-up length demonstrated that whites compared with AA (n = 157, 67 whites and 90 AA) had lower rates of allograft failure in the absence of AL induction (14.9% vs 44.4%, P = 0.0156, hazard ratio = 2.077). In contrast, AL induction (n = 275, 105 whites and 170 AA) eliminated the racial disparity in allograft failure (5.7% vs 9.4%, P = 0.8248, hazard ratio = 1.504). This is the first study to describe the effects of AL induction therapy on AA renal transplant recipients beyond the first posttransplant year. Our early results suggest that AL induction therapy abolishes the disparity in renal allograft failure.
Neal, Sonya E.; Dabir, Deepa V.; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M.
2017-01-01
Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c, but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. PMID:28814504
García-Casal, María N; Leets, Irene
2014-04-01
Due to the high prevalence of iron and vitamin A deficiencies and to the controversy about the role of vitamin A and carotenoids in iron absorption, the objectives of this study were to evaluate the following: (1) the effect of a molar excess of vitamin A as well as the role of tannic acid on iron uptake by Caco-2 cells; (2) iron uptake and ferritin synthesis in presence of carotenoids without pro-vitamin A activity: lycopene, lutein, and zeaxantin; and (3) iron uptake and ferritin synthesis from ferrous fumarate and NaFe-EDTA. Cells were incubated 1 h at 37 °C in PBS pH 5.5, containing (59) Fe and different iron compounds. Vitamin A, ferrous fumarate, β-carotene, lycopene, lutein, zeaxantin, and tannic acid were added to evaluate uptake. Ferritin synthesis was measured 24 h after uptake experiments. Vitamin A had no effect on iron uptake by Caco-2 cells, and was significantly lower from NaFe-EDTA than from ferrous fumarate (15.2 ± 2.5 compared with 52.5 ± 8.3 pmol Fe/mg cell protein, respectively). Carotenoids increase uptake up to 50% from fumarate and up to 300% from NaFe-EDTA, since absorption from this compound is low when administered alone. We conclude the following: (1) There was no effect of vitamin A on iron uptake and ferritin synthesis by Caco-2cells. (2) Carotenoids significantly increased iron uptake from ferrous fumarate and NaFe-EDTA, and were capable of partially overcoming the inhibition produced by tannic acid. (3) Iron uptake by Caco-2 cell from NaFe-EDTA was significantly lower compared to other iron compounds, although carotenoids increased and tannic acid inhibited iron uptake comparably to ferrous fumarate. © 2014 Institute of Food Technologists®
Dashputre, Ankur A; Kamal, Khalid M; Pawar, Gauri
2017-06-01
Multiple sclerosis (MS) is a chronic inflammatory disorder of the central nervous system, affecting 2.5 million people globally and 400,000 people in the United States. While no cure exists for MS, the goal is to manage the disease using disease-modifying therapies (DMTs), which have been shown to slow disease progression and prevent relapses. Relapsing-remitting MS (RRMS) is the most common form of MS at the time of diagnosis. Peginterferon beta-1a (PEG) and alemtuzumab (ALT) were recently approved and have demonstrated good clinical outcomes, including reduced relapse rates in clinical trials. High costs associated with these DMTs necessitates cost-effectiveness analyses to understand their overall value in RRMS management. To assess the cost-effectiveness of (a) Model 1: PEG relative to intramuscular interferon beta-1a (IM IFN), subcutaneous interferon beta-1b (SC IFN), glatiramer acetate 20 mg per mL (GA), fingolimod (FIN), natalizumab (NAT), and dimethyl fumarate (DMF), and (b) Model 2: ALT relative to subcutaneous interferon beta-1a 44 μg (IFN beta-1a 44 μg). Both analyses were conducted from a U.S. third-party payer perspective. Two static decision models were used to compare the cost-effectiveness of PEG and ALT over a 1-year and a 2-year time horizon, respectively. Model inputs were drug acquisition costs (wholesale acquisition cost from RED BOOK); drug administration and monitoring costs (package inserts and Centers for Medicare & Medicaid Services 2015 Physician Fee Schedule); relapse rates and relapse rate reduction (clinical trials); and cost of managing relapses (published literature). All costs were adjusted to 2015 U.S. dollars using the medical care component of the Consumer Price Index. Outcomes measured were total cost of therapy per patient, cost per relapse avoided, and incremental cost-effectiveness ratios (ICERs) calculated as cost per relapse avoided. Sensitivity analysis was conducted to test model robustness given the uncertainty of
Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam
2016-04-01
Several lines of evidence have demonstrated the potential biomedical applications of fumaric acid (FA) and its ester derivatives against many human disease conditions. Fumaric acid esters (FAEs) have been licensed for the systemic treatment of the immune-mediated disease psoriasis. Biogen Idec Inc. announced about the safety and efficacy of the formulation FAE (BG-12) for treating RRMS (relapsing-remitting multiple sclerosis). Another FAE formulation DMF (dimethyl fumarate) was found to be capable of reduction in inflammatory cardiac conditions, such as autoimmune myocarditis and ischemia and reperfusion. DMF has also been reported to be effective as a potential neuroprotectant against the HIV-associated neurocognitive disorders (HAND). Many in vivo studies carried out on rat and mice models indicated inhibitory effects of fumaric acid on carcinogenesis of different origins. Moreover, FAEs has emerged as an important matrix ingredient in the fabrication of biodegradable scaffolds for tissue engineering applications. Drug delivery vehicles composed of FAEs have shown promising results in delivering some leading drug molecules. Apart from these specific applications and findings, many more studies on FAEs have revealed new therapeutic potentials with the scope of clinical applications. However, until now, this scattered vital information has not been written into a collective account and analyzed for minute details. The aim of this paper is to review the advancement made in the biomedical application of FA and FAEs and to focus on the clinical investigation and molecular interpretation of the beneficial effects of FA and FAEs. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
NASA Astrophysics Data System (ADS)
Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi
2016-01-01
As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.
Lu, C; Jia, Y; Chen, L; Ding, Y; Yang, J; Chen, M; Song, Y; Sun, X; Wen, A
2013-04-01
Tenofovir dipivoxil fumarate is a novel ester prodrug of tenofovir, a specific anti-hepatitis B virus (HBV) drug candidate. The pharmacokinetic properties and the effects of food intake on tenofovir dipivoxil have not yet been reported in healthy adults. The aim of this study was to evaluate the pharmacokinetic properties and food interaction of tenofovir dipivoxil in healthy Chinese volunteers. Pharmacokinetic studies included an ascending single dose of 150, 300, 600 mg and multiple doses of 300 mg. Food interaction was evaluated following a single oral dose of tenofovir dipivoxil fumarate 300 mg administered with a high-fat and high-energy standard breakfast or after a 12-h fast. Pharmacokinetic parameters of tenofovir given in each treatment period were calculated using non-compartmental analysis. After a single dose of 150, 300 and 600 mg, the main pharmacokinetic parameters for tenofovir were as follows: Cmax 209·6, 456·7, 989·8 ng/mL; AUClast 1744·9, 2663·5, 6010·2 ng h/mL, respectively. After multiple doses of 300 mg, the main pharmacokinetic parameters for tenofovir were Cmax 523·4 ng/mL, AUClast 4152·4 ng h/mL. After a single dose of 300 mg with a high-fat and high-energy standard breakfast, the main pharmacokinetic parameters for tenofovir were Cmax 448·5 ng/mL, AUClast 3286·8 ng h/mL. The plasma Cmax and AUC of tenofovir showed significance difference between a single dose of 300 mg and the accordingly multiple doses (P < 0·05). A standard high-fat meal enhanced mean AUClast values of tenofovir (relative AUClast = 125·8%; 90% CI 114·5, 136·2); however, food did not show any significant on Cmax (relative Cmax = 103·4%; 90% CI 94·6, 112·6). Oral tenofovir dipivoxil fumarate produced predictable and dose-proportional plasma tenofovir pharmacokinetics. The accumulation ratio was 1·51, suggesting tenofovir dipivoxil fumarate displayed accumulation after repeated administration. The bioavailability of tenofovir
Röhlen, Désirée L; Pilas, Johanna; Schöning, Michael J; Selmer, Thorsten
2017-10-01
Three amperometric biosensors have been developed for the detection of L-malic acid, fumaric acid, and L -aspartic acid, all based on the combination of a malate-specific dehydrogenase (MDH, EC 1.1.1.37) and diaphorase (DIA, EC 1.8.1.4). The stepwise expansion of the malate platform with the enzymes fumarate hydratase (FH, EC 4.2.1.2) and aspartate ammonia-lyase (ASPA, EC 4.3.1.1) resulted in multi-enzyme reaction cascades and, thus, augmentation of the substrate spectrum of the sensors. Electrochemical measurements were carried out in presence of the cofactor β-nicotinamide adenine dinucleotide (NAD + ) and the redox mediator hexacyanoferrate (III) (HCFIII). The amperometric detection is mediated by oxidation of hexacyanoferrate (II) (HCFII) at an applied potential of + 0.3 V vs. Ag/AgCl. For each biosensor, optimum working conditions were defined by adjustment of cofactor concentrations, buffer pH, and immobilization procedure. Under these improved conditions, amperometric responses were linear up to 3.0 mM for L-malate and fumarate, respectively, with a corresponding sensitivity of 0.7 μA mM -1 (L-malate biosensor) and 0.4 μA mM -1 (fumarate biosensor). The L-aspartate detection system displayed a linear range of 1.0-10.0 mM with a sensitivity of 0.09 μA mM -1 . The sensor characteristics suggest that the developed platform provides a promising method for the detection and differentiation of the three substrates.
Li, Xiang Z; Long, Rui J; Yan, Chang G; Lee, Hong G; Kim, Young J; Song, Man K
2011-06-01
Supplementation effect of fish oil and/or fumarate on production of conjugated linoleic acid (CLA) and methane by rumen microbes was examined when incubated with safflower oil. One hundred and twenty milligrams of safflower oil (SO), safflower oil with 24 mg fish oil (SOFO), safflower oil with 24 mmol/L fumarate (SOFA), or safflower oil with 24 mg fish oil and 24 mmol/L fumarate (SOFOFA) were added to the 90 mL culture solution. The culture solution was also made without any supplements (control). The SOFA and SOFOFA increased pH and propionate (C3) compared to other treatments from 3 h incubation time. An accumulated amount of total methane (CH(4) ) for 12 h incubation was decreased by all the supplements compared to control. The concentrations of c9,t11CLA for all the incubation times were increased in the treatments of SOFO, SOFA and SOFOFA compared to SO. The highest concentration of c9,t11CLA was observed from SOFOFA among all the treatments at all incubation times. Overall data indicate that supplementation of combined fumarate and/or fish oil when incubated with safflower oil could depress CH(4) generation and increase production of C(3) and CLA under the condition of current in vitro study. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.
Liu, Huan; Yue, Xuemin; Jin, Yuhan; Wang, Meng; Deng, Li; Wang, Fang; Tan, Tianwei
2017-10-01
Fumaric acid production from lignocellulosic materials is an alternative chemicals production system. This work investigated the suitable conditions for hydrolysis of dried distiller's grains with solubles (DDGS). The hydrolytic liquid was subsequently used for the production of fumaric acid. After optimizing the hydrolysis conditions, the most suitable concentration of H 2 SO 4 (2%), hydrolysis temperature (120 °C), hydrolysis time (100min) and solid/liquid ratio (1:10) were obtained. The yield of monosaccharides reached 258 mg/g DDGS and 15.88 g/L glucose, 7.53 g/L xylose and 2.35 g/L arabinose were obtained in unprocessed hydrolytic liquid. The furfural inhibitor in the hydrolytic liquid was also detected and the yield of it was reducing progressively in the pretreatment process. The ferment ability of the hydrolytic liquid from DDGS was tested through the process of fumaric acid production by Rhizopus arrhizus RH 7-13. The unprocessed hydrolytic liquid was not appropriate for the fermentation process. The yield of fumaric acid from the concentrated processed hydrolytic liquid reached 18.93 g/L, which was close to the yield of fermenting 80 g/L glucose. This result indicated that the commonly used carbon resource glucose could to some extent be replaced by processed hydrolytic liquid. Copyright © 2017 Elsevier Ltd. All rights reserved.
Matavelli, Luis C.; Huang, Jiqian; Siragy, Helmy M.
2011-01-01
SUMMARY We hypothesized that compared to hydrochlorothiazide (HCTZ), the renin inhibitor aliskiren (ALISK) or amlodipine (AMLO) and their combination reduce albuminuria via reduction in renal inflammation, independent of BP changes. We studied normal and streptozotocin induced diabetic (DM) Sprague-Dawley rats treated for 6 weeks with vehicle, ALISK, HCTZ or AMLO individually and combined and evaluated effects of treatments on BP, urine albumin to creatinine ratio (UACR), renal interstitial fluid (RIF) levels of angiotensin II (Ang II), tumor necrosis factor-alpha (TNFα) and interleukin-6 (IL-6), and renal expression of TNFα, IL-6, transforming growth factor-beta1 (TGF-β1) and nuclear factor-kappa B (NF-κB). There were no differences in BP between treatments. Only ALISK and its combinations reduced RIF Ang II. UACR increased in DM rats and decreased with ALISK alone or combined with HCTZ or AMLO. HCTZ or AMLO individually and combined did not influence UACR. RIF TNFα and IL-6, and the renal expression of TNFα, IL-6, TGF-β1 and NF-κB were increased in DM rats. These renal inflammatory markers were reduced only with ALISK or AMLO individually or combined with other treatments. We conclude that ALISK alone and combined with HCTZ or AMLO reduced albuminuria in diabetes via reduction in renal inflammation, independent of BP changes. PMID:22075749
Matavelli, Luis C; Huang, Jiqian; Siragy, Helmy M
2012-03-01
We hypothesized that compared with hydrochlorothiazide (HCTZ), the renin inhibitor aliskiren (ALISK) or amlodipine (AMLO) and their combination reduce albuminuria via reduction in renal inflammation, independent of blood pressure (BP) changes. We studied normal and streptozotocin-induced diabetic (DM) Sprague-Dawley rats treated for 6 weeks with vehicle, ALISK, HCTZ, or AMLO individually and combined and evaluated the effects of treatments on BP, urine albumin to creatinine ratio, renal interstitial fluid levels of angiotensin II, tumor necrosis factor alpha (TNF-α), and interleukin 6 (IL-6) and renal expression of TNF-α, IL-6, transforming growth factor beta 1, and nuclear factor kappa B. There were no differences in BP between treatments. Only ALISK and its combinations reduced renal interstitial fluid angiotensin II. Urine albumin to creatinine ratio increased in DM rats and decreased with ALISK alone or combined with HCTZ or AMLO. HCTZ or AMLO individually and combined did not influence urine albumin to creatinine ratio. Renal interstitial fluid TNF-α and IL-6, and the renal expression of TNF-α, IL-6, transforming growth factor beta 1, and nuclear factor kappa B were increased in DM rats. These renal inflammatory markers were reduced only with ALISK or AMLO individually or combined with other treatments. We conclude that ALISK alone and combined with HCTZ or AMLO reduced albuminuria in diabetes via reduction in renal inflammation, independent of BP changes.
Toth, Courtney R. A.; Gieg, Lisa M.
2018-01-01
Biodegradation of crude oil in subsurface petroleum reservoirs has adversely impacted most of the world's oil, converting this resource to heavier forms that are of lower quality and more challenging to recover. Oil degradation in deep reservoir environments has been attributed to methanogenesis over geological time, yet our understanding of the processes and organisms mediating oil transformation in the absence of electron acceptors remains incomplete. Here, we sought to identify hydrocarbon activation mechanisms and reservoir-associated microorganisms that may have helped shape the formation of biodegraded oil by incubating oilfield produced water in the presence of light (°API = 32) or heavy crude oil (°API = 16). Over the course of 17 months, we conducted routine analytical (GC, GC-MS) and molecular (PCR/qPCR of assA and bssA genes, 16S rRNA gene sequencing) surveys to assess microbial community composition and activity changes over time. Over the incubation period, we detected the formation of transient hydrocarbon metabolites indicative of alkane and alkylbenzene addition to fumarate, corresponding with increases in methane production and fumarate addition gene abundance. Chemical and gene-based evidence of hydrocarbon biodegradation under methanogenic conditions was supported by the enrichment of hydrocarbon fermenters known to catalyze fumarate addition reactions (e.g., Desulfotomaculum, Smithella), along with syntrophic bacteria (Syntrophus), methanogenic archaea, and several candidate phyla (e.g., “Atribacteria”, “Cloacimonetes”). Our results reveal that fumarate addition is a possible mechanism for catalyzing the methanogenic biodegradation of susceptible saturates and aromatic hydrocarbons in crude oil, and we propose the roles of community members and candidate phyla in our cultures that may be involved in hydrocarbon transformation to methane in crude oil systems. PMID:29354103
Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi
2016-01-15
As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques. Copyright © 2015 Elsevier B.V. All rights reserved.
Salem, Y A; Shaldam, M A; El-Sherbiny, D T; El-Wasseef, D R; El-Ashry, S M
2017-11-01
A simple, accurate and valid ion-pairing chromatographic method was developed for the simultaneous determination of formoterol fumarate (FF) and budesonide (BUD) epimers in metered dose inhaler. The separation was performed on C-18 column using mobile phase consisting of acetonitrile:0.05 M sodium acetate buffer (40:60% v/v) containing 0.03% sodium dodecyl sulfate adjusted to pH 3.1 using increasing volumes of either TEA or orthophosphoric acid isocratically eluted at 1.0 mL/min. Quantitation was achieved with UV detection at 214 nm. The retention times were 3.22, 6.41 and 6.91 min for formoterol fumarate, budesonide epimers B and A, respectively. The linearity range was 0.05-5.0 μg/mL for formoterol fumarate and 0.5-50.0 μg/mL for budesonide. The method was validated for, linearity; lower limit of quantification, lower limit of detection accuracy and precision. The proposed method is rapid (7 min), reproducible (RSD < 2.0%) and achieves satisfactory resolution between FF and BUD B (resolution factor = 12.07). The mean recoveries of the analytes in metered dose inhaler (99.97 and 99.83% for FF and BUD, respectively) were satisfactory. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Role of HCA₂ (GPR109A) in nicotinic acid and fumaric acid ester-induced effects on the skin.
Hanson, Julien; Gille, Andreas; Offermanns, Stefan
2012-10-01
Nicotinic acid (NA) and fumaric acid esters (FAE) such as monomethyl fumarate or dimethyl fumarate are drugs that elicit a cutaneous reaction called flushing as a side effect. NA is used to reduce progression of atherosclerosis through its anti-dyslipidemic activity and lipid-independent mechanisms involving immune cells, whereas FAE are used to treat psoriasis via largely unknown mechanisms. Both, NA and FAE, induce flushing by the activation of the G-protein-coupled receptor (GPCR) Hydroxy-carboxylic acid receptor 2 (HCA₂, GPR109A) in cells of the epidermis. While the wanted effects of NA are at least in part also mediated by HCA₂, it is currently not clear whether this receptor is also involved in the anti-psoriatic effects of FAE. The HCA₂-mediated flushing response to these drugs involves the formation of prostaglandins D₂ and E₂ by Langerhans cells and keratinocytes via COX-1 in Langerhans cells and COX-2 in keratinocytes. This review summarizes recent progress in the understanding of the mechanisms underlying HCA₂-mediated flushing, describes strategies to mitigate it and discusses the potential link between flushing, HCA₂ and the anti-psoriatic effects of FAE. Copyright © 2012 Elsevier Inc. All rights reserved.
Giménez-Arnau, Ana; Silvestre, Juan Francisco; Mercader, Pedro; De la Cuadra, Jesus; Ballester, Isabel; Gallardo, Fernando; Pujol, Ramón M; Zimerson, Erik; Bruze, Magnus
2009-11-01
The methyl ester form of fumaric acid named dimethyl fumarate (DMF) is an effective mould-growth inhibitor. Its irritating and sensitizing properties were demonstrated in animal models. Recently, DMF has been identified as responsible for furniture contact dermatitis in Europe. To describe the clinical manifestations, patch test results, shoe chemical analysis, and source of exposure to DMF-induced shoe contact dermatitis. Patients with suspected shoe contact dermatitis were studied in compliance with the Declaration of Helsinki. Patch test results obtained with their own shoe and the European baseline series, acrylates and fumaric acid esters (FAE), were recorded according to international guidelines. The content of DMF in shoes was analysed with gas chromatography and mass spectrometry. Acute, immediate irritant contact dermatitis and non-immunological contact urticaria were observed in eight adults and two children, respectively. All the adult patients studied developed a delayed sensitization demonstrated by a positive patch testing to DMF < or = 0.1% in pet. Cross-reactivity with other FAEs and acrylates was observed. At least 12 different shoe brands were investigated. The chemical analysis from the available shoes showed the presence of DMF. DMF in shoes was responsible for severe contact dermatitis. Global preventive measures for avoiding contact with DMF are necessary.
Kalb, Daniel; Heinekamp, Thorsten; Schieferdecker, Sebastian; Nett, Markus; Brakhage, Axel A; Hoffmeister, Dirk
2016-10-04
S-adenosyl-l-methionine (SAM)-dependent methyltransfer is a common biosynthetic strategy to modify natural products. We investigated the previously uncharacterized Aspergillus fumigatus methyltransferase FtpM, which is encoded next to the bimodular fumaric acid amide synthetase FtpA. Structure elucidation of two new A. fumigatus natural products, the 1,11-dimethyl esters of fumaryl-l-tyrosine and fumaryl-l-phenylalanine, together with ftpM gene disruption suggested that FtpM catalyzes iterative methylation. Final evidence that a single enzyme repeatedly acts on fumaric acid amides came from an in vitro biochemical investigation with recombinantly produced FtpM. Size-exclusion chromatography indicated that this methyltransferase is active as a dimer. As ftpA and ftpM homologues are found clustered in other fungi, we expect our work will help to identify and annotate natural product biosynthesis genes in various species. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Jayabalan, M; Thomas, V; Rajesh, P N
2001-10-01
Polypropylene fumarate/phloroglucinol triglycidyl methacrylate oligomeric blend-based bone cement was studied. Higher the percentage of phloroglucinol triglycidyl methacrylate, lesser the setting time. An optimum setting time could be arrived with 50:50 blend composition of the two oligomers. Composite cement of 50:50 blend prepared with hydroxyapatite granules of particle size 125 microm binds bovine rib bones. The tensile strength of this adhesive bond was found to be 1.11 kPa. The thermal studies suggest the onset of cross-linking reaction in the cured blend if the blend is heated. The absence of softening endotherm in the cured blend shows the thermosetting-like amorphous nature of blend system, which may restrict the changes in creep properties. The in vitro biodegradation studies reveal possible association of calcium ions with negatively charged units of degrading polymer chain resulting in slow down of degradation. Relatively slow degradation was observed in Ringer's solution. The study reveals the potential use of polypropylene fumarate/phloroglucinol triglycidyl methacrylate as partially degradable polymeric cement for orthopaedic applications.
Zouboulis, Christos C; Lippert, Undine; Karagiannidis, Ioannis
2014-01-01
Sarcoidosis is a rare, systemic disease that is characterized by the formation of granulomas in various organs, including the skin. As the etiology remains unknown, the treatment of sarcoidosis is challenging. We present a 47-year-old female patient with progressive, multi-organ sarcoidosis who had a complete clinical improvement of the skin lesions, a moderate reduction in pulmonary opacities on chest X-ray, a marked subjective improvement in general status and pulmonary efficiency and a marked reduction in serum angiotensin-converting enzyme and soluble interleukin-2 receptor after 6 months of therapy with fumaric acid esters. The present case and similar reports in the literature highlight the probable efficacy of fumaric acid esters in the treatment of sarcoidosis and other non-infectious, granulomatous diseases. © 2014 S. Karger AG, Basel.
Neal, Sonya E; Dabir, Deepa V; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M
2017-10-15
Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c , but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. © 2017 Neal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Cao, N.; Du, J.; Gong, C. S.; Tsao, G. T.
1996-01-01
An integrated system of simultaneous fermentation-adsorption for the production and recovery of fumaric acid from glucose by Rhizopus oryzae was investigated. The system was constructed such that growing Rhizopus mycelia were self-immobilized on the plastic discs of a rotary biofilm contactor during the nitrogen-rich growth phase. During the nongrowth, production phase, the biofilm was alternately exposed to liquid medium and air upon rotation of the discs in the horizontal fermentation vessel. The product of fermentation, fumaric acid, was removed simultaneously and continuously by a coupled adsorption column, thereby moderating inhibition, enhancing the fermentation rate, and sustaining cell viability. Another beneficial effect of the removal of fumaric acid is release of hydroxyl ions from a polyvinyl pyridine adsorbent into the circulating fermentation broth. This moderates the decrease in pH that would otherwise occur. Polyvinyl pyridine and IRA-900 gave the highest loading for this type of fermentation. This fermentation system is capable of producing fumaric acid with an average yield of 85 g/liter from 100 g of glucose per liter within 20 h under repetitive fed-batch cycles. On a weight yield basis, 91% of the theoretical maximum was obtained with a productivity of 4.25 g/liter/h. This is in contrast to stirred-tank fermentation supplemented with calcium carbonate, whose average weight yield was 65% after 72 h with a productivity of 0.9 g/liter/h. The immobilized reactor was operated repetitively for 2 weeks without loss of biological activity. PMID:16535381
Hüller, Cornelia; Grunow, Norbert; Nadler, Torsten; Bär, Michael
2011-01-01
We report on an exceedingly rare case of cutaneous and uterine leiomyomatosis in a 58-year-old Caucasian woman associated with ovarian cystadenoma and complete deletion of the fumarate hydratase gene. All patients and their family members with verified mutation have to be regularly screened for associated neoplasms, in particular papillary renal cell carcinoma (HLRCC, hereditary leiomyomatosis and renal cell cancer). PMID:24396716
Xu, Jinku; Li, Xinsong; Sun, Fuqian
2011-02-01
The purpose of this work was to evaluate the usefulness of silicone hydrogel contact lenses loaded with ketotifen fumarate for ocular drug delivery. First, silicone contact lenses were prepared by photopolymerization of bitelechelic methacrylated polydimethylsiloxanes macromonomer, 3-methacryloxypropyltris(trimethylsiloxy)silane, and N,N-dimethylacrylamide using ethylene glycol dimethacrylate as a cross-linker and Darocur 1173 as an initiator followed by surface plasma treatment. Then, the silicone hydrogel matrices of the contact lenses were characterized by equilibrium swelling ratio (ESR), tensile tests, ion permeability, and surface contact angle. Finally, the contact lenses were loaded with ketotifen fumarate by pre-soaking in drug solution to evaluate drug loading capacity, in vitro and in vivo release behavior of the silicone contact lenses. The results showed that ESR and ion permeability increase, and the surface contact angle and tensile strength decreased with the increase of DMA component in the silicone hydrogel. The drug loading and in vitro releases were dependent on the hydrogel composition of hydrophilic/hydrophobic phase of the contact lenses. In rabbit eyes, the pre-soaked contact lenses sustained ketotifen fumarate release for more than 24 h, which leads to a more stable drug concentration and a longer mean retention time in tear fluid than that of eye drops of 0.05%.
USDA-ARS?s Scientific Manuscript database
A study was conducted to examine the ability of Campylobacter spp. to grow aerobically in media supplemented with selected organic acids. Basal broth media composed of tryptose, yeast extract, and a mineral-vitamin solution was supplemented with a-ketoglutaric, lactic, and/or fumaric acids. The fina...
Dimethyl fumarate modulation of immune and antioxidant responses: application to HIV therapy
Gill, Alexander J.; Kolson, Dennis L.
2013-01-01
The persistence of chronic immune activation and oxidative stress in human immunodeficiency virus (HIV)-infected, antiretroviral drug-treated individuals are major obstacles to fully preventing HIV disease progression. The immune modulator and antioxidant dimethyl fumarate (DMF) is effective in treating immune-mediated diseases and it also has potential applications to limiting HIV disease progression. Among the relevant effects of DMF and its active metabolite monomethyl fumarate (MMF) are induction of a Th1 → Th2 lymphocyte shift, inhibition of pro-inflammatory cytokine signaling, inhibition of NF-κB nuclear translocation, inhibition of dendritic cell maturation, suppression of lymphocyte and endothelial cell adhesion molecule expression, and induction of the Nrf2-dependent antioxidant response element (ARE) and effector genes. Associated with these effects are reduced lymphocyte and monocyte infiltration into psoriatic skin lesions in humans and immune-mediated demyelinating brain lesions in rodents, which confirms potent systemic and central nervous system (CNS) effects. In addition, DMF and MMF limit HIV infection in macrophages in vitro, albeit by unknown mechanisms. Finally, DMF and MMF also suppress neurotoxin production from HIV-infected macrophages, which drives CNS neurodegeneration. Thus, DMF might protect against systemic and CNS complications in HIV infection through its effective suppression of immune activation, oxidative stress, HIV replication, and macrophage-associated neuronal injury. PMID:23971529
Nafuredin, a novel inhibitor of NADH-fumarate reductase, produced by Aspergillus niger FT-0554.
Ui, H; Shiomi, K; Yamaguchi, Y; Masuma, R; Nagamitsu, T; Takano, D; Sunazuka, T; Namikoshi, M; Omura, S
2001-03-01
A novel compound, nafuredin, was isolated as an inhibitor of anaerobic electron transport (NADH-fumarate reductase). It was obtained from culture broth of Aspergillus niger FT-0554 isolated from a marine sponge. The structure was elucidated as an epoxy-delta-lactone with an attached methylated olefinic side chain on the basis of spectral analysis.
Osanai, Arihiro; Harada, Shigeharu; Sakamoto, Kimitoshi; Shimizu, Hironari; Inaoka, Daniel Ken; Kita, Kiyoshi
2009-01-01
In adult Ascaris suum (roundworm) mitochondrial membrane-bound complex II acts as a rhodoquinol-fumarate reductase, which is the reverse reaction to that of mammalian complex II (succinate-ubiquinone reductase). The adult A. suum rhodoquinol-fumarate reductase was crystallized in the presence of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a 3:2 weight ratio. The crystals belonged to the orthorhombic space group P212121, with unit-cell parameters a = 123.75, b = 129.08, c = 221.12 Å, and diffracted to 2.8 Å resolution using synchrotron radiation. The presence of two molecules in the asymmetric unit (120 kDa × 2) gives a crystal volume per protein mass (V M) of 3.6 Å3 Da−1. PMID:19724139
ERIC Educational Resources Information Center
Love, Brian E.; Bennett, Lisa J.
2017-01-01
Two experiments are described which lead to the preparation of dimethyl fumarate, a compound currently used in the treatment of multiple sclerosis. Preparation of a compound with "real-world" applications is believed to increase student interest in the experiment. One experiment involves the isomerization of dimethyl maleate to the…
van Bezooijen, Ji Sun; Balak, Deepak M.W.; van Doorn, Martijn B.A.; Looman, Caspar W.N.; Schreurs, Marco W.J.; Koch, Birgit C.P.; van Gelder, Teun; Prens, Errol P.
2016-01-01
Background Biologics are a safe and efficacious therapy for psoriasis. The drug survival of biologics may be disappointing, primarily due to loss of efficacy. Therefore, safe combination treatments are sought to improve their clinical response. Objective To assess the efficacy, safety and tolerability of the combination therapy of etanercept with fumarates versus etanercept monotherapy. Methods Thirty-three patients with psoriasis were randomized 1:1 to receive etanercept combined with fumarates or etanercept monotherapy. The primary outcome measure was the difference in PASI-75 response after 24 weeks; additionally, a longitudinal analysis was performed. An important secondary outcome measure was the proportion of patients with a Physician Global Assessment (PGA) of clear or almost clear. Adverse events were collected throughout the study. Results In the combination therapy group, 78% (14 out of 18 patients) reached PASI-75 at week 24 versus 57% (8 out of 14 patients) in the monotherapy group (p = 0.27). The longitudinal analysis showed a PASI reduction of 5.97% per week for the combination therapy group and of 4.76% for the monotherapy group (p = 0.11). In the combination therapy group, 94% (17 out of 18 patients) of patients had a PGA of clear/almost clear versus 64% (9 out of 14 patients) in the monotherapy group (p = 0.064). The incidence of mild gastrointestinal complaints was higher in the combination group than in the monotherapy group. Conclusion Using the PGA, combination therapy showed a trend towards faster improvement in the first 24 weeks. The difference in the PASI score between the two groups was not statistically significant. Addition of fumarates to etanercept for 48 weeks appeared safe with an acceptable tolerability. PMID:27576483
Xavier, Arun M; Rai, Kavita; Hegde, Amitha M; Shetty, Suchetha
2016-06-01
To compare the efficacy between supplementing ferrous fumarate and ferrous sulfate to carbonated beverages by recording the in vitro mineral loss and surface microhardness (SMH) changes in human enamel. 120 enamel blocks each (from primary and permanent teeth) were uniformly prepared and the initial SMH was recorded. These enamel specimens were equally divided (n = 60) for their respective beverage treatment in Group 1 (2 mmol/L ferrous sulfate) and Group 2 (2 mmol/L ferrous fumarate). Each group was further divided into three subgroups as Coca-Cola, Sprite and mineral water (n= 10). The specimens were subjected to three repetitive cycles of respective treatment for a 5-minute incubation period, equally interspaced by 5-minute storage in artificial saliva. The calcium and phosphate released after each cycle were analyzed spectrophotometrically and the final SMH recorded. The results were tested using student's t-test, one-way ANOVA and Wilcoxon signed rank test (P < 0.05). The spectrophotometric assessment of calcium and phosphate withdrawal found more loss with the supplementation of 2 mmol/L ferrous sulfate than ferrous fumarate (P < 0.005). Similarly, the mean surface microhardness reduction was less with the supplementation of 2 mmol/L ferrous fumarate than with ferrous sulfate (P < 0.005). Statistical comparisons revealed the maximum surface microhardness and mineral loss with primary enamel and the maximum loss produced in all groups by Coca-Cola (P < 0.005).
Ma, Zhen-Gang; Ma, Rui; Xiao, Xiao-Lin; Zhang, Yong-Hui; Zhang, Xin-Zi; Hu, Nan; Gao, Jin-Lai; Zheng, Yu-Feng; Dong, De-Li; Sun, Zhi-Jie
2016-10-15
Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our previous work found that dimethyl fumarate (DMF), the approved drug by the FDA for the treatment of multiple sclerosis, exhibited anti-tumor activity on colon cancer cells. Based on the pharmacological properties of DMF and azo bond in olsalazine chemical structure, we designed azo polymeric micelles for colon-targeted dimethyl fumarate delivery for colon cancer therapy. We synthesized the star-shape amphiphilic polymer with azo bond and fabricated the DMF-loaded azo polymeric micelles. The four-arm polymer star-PCL-azo-mPEG (sPCEG-azo) (constituted by star-shape PCL (polycaprolactone) and mPEG (methoxypolyethylene glycols)-olsalazine) showed self-assembly ability. The average diameter and polydispersity index of the DMF-loaded sPCEG-azo polymeric micelles were 153.6nm and 0.195, respectively. In vitro drug release study showed that the cumulative release of DMF from the DMF-loaded sPCEG-azo polymeric micelles was no more than 20% in rat gastric fluid within 10h, whereas in the rat colonic fluids, the cumulative release of DMF reached 60% in the initial 2h and 100% within 10h, indicating that the DMF-loaded sPCEG-azo polymeric micelles had excellent colon-targeted property. The DMF-loaded sPCEG-azo polymeric micelles had no significant cytotoxicity on colon cancer cells in phosphate buffered solution (PBS) and rat gastric fluid. In rat colonic fluid, the micelles showed significant cytotoxic effect on colon cancer cells. The blank sPCEG-azo polymeric micelles (without DMF) showed no cytotoxic effect on colon cancer cells in rat colonic fluids. In conclusion, the DMF-loaded sPCEG-azo polymeric micelles show colon-targeted DMF release and anti-tumor activity, providing a novel approach potential for colon cancer therapy. Colon-targeted drug delivery and circumventing drug resistance are extremely important for colon cancer chemotherapy. Our
Direct measurement of backflux between oxaloacetate and fumarate following pyruvate carboxylation.
Brekke, Eva; Walls, Anne B; Nørfeldt, Lasse; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-01-01
Pyruvate carboxylation (PC) is thought to be the major anaplerotic reaction for the tricarboxylic acid cycle and is necessary for de novo synthesis of amino acid neurotransmitters. In the brain, the main enzyme involved is pyruvate carboxylase, which is predominantly located in astrocytes. Carboxylation leads to the formation of oxaloacetate, which condenses with acetyl coenzyme A to form citrate. However, oxaloacetate may also be converted to malate and fumarate before being regenerated. This pathway is termed the oxaloacetate-fumarate-flux or backflux. Carbon isotope-based methods for quantification of activity of PC lead to underestimation when backflux is not taken into account and critical errors have been made in the interpretation of results from metabolic studies. This study was conducted to establish the degree of backflux after PC in cerebellar and neocortical astrocytes. Astrocyte cultures from cerebellum or neocortex were incubated with either [3-(13) C] or [2-(13) C]glucose, and extracts were analyzed using mass spectrometry or nuclear magnetic resonance spectroscopy. Substantial PC compared with pyruvate dehydrogenase activity was observed, and extensive backflux was demonstrated in both types of astrocytes. The extent of backflux varied between the metabolites, reaffirming that metabolism is highly compartmentalized. By applying our calculations to published data, we demonstrate the existence of backflux in vivo in cat, rat, mouse, and human brain. Thus, backflux should be taken into account when calculating the magnitude of PC to allow for a more precise evaluation of cerebral metabolism. Copyright © 2011 Wiley Periodicals, Inc.
Survey of dimethyl fumarate in desiccant products during 2009 in Italy.
Stefanelli, Patrizia; Girolimetti, Silvana; Santilio, Angela; Dommarco, Roberto
2011-04-01
Dimethyl fumarate (DMFu) is a substance with remarkable hygroscopicity and fungicidal power, which has recently showed to be a strong sensitizer to humans. The use of DMFu in little desiccant pouches, for e.g. in handbags or footwear boxes, might result in the contamination of leather products, with the subsequent exposure to consumers by contact. In 2009, 153 samples of desiccant material were collected from leather manufactures all over Italy and analyzed for DMFu. Results proved to fall in a wide range (0.14-7145 mg/kg).
The Epi-TAF for Tenofovir Disoproxil Fumarate?
Walensky, Rochelle P; Horn, Tim H; Paltiel, A David
2016-04-01
Approximately 84% of human immunodeficiency virus (HIV)-infected US residents on antiretroviral therapy currently receive some form of tenofovir disoproxil fumarate (TDF) as part of their HIV treatment regimen. The TDF analogue tenofovir alafenamide (TAF) has demonstrated equal efficacy but with decreased renal injury and bone mineral density loss compared with TDF. We examine how much more society ought to be willing to pay for TAF over TDF, in exchange for its improved toxicity profile. Using cost-effectiveness methods, we find that current conditions warrant an annual premium of up to $1000 over the average wholesale price (AWP) of TDF. Once generic coformulations of tenofovir/lamivudine become accessible, however, the appropriate premium for TAF will likely merit a downward adjustment, using generic TDF-based costs as the benchmark. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
NASA Astrophysics Data System (ADS)
Kartal, Zeki; Yavuz, Abdülkerim
2018-03-01
In this study, the clathrates of fumarate-tetracyanonickel-dioxane, given by the formula M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) (M = Co, Ni, Cd and Hg), have been obtained for the first time through chemical methods. These clathrates have been characterized by elemental, thermal, FT-IR, and FT-Raman spectroscopies. The parameters of structures of clathrates have been determined by X-ray powder diffraction. The thermal behaviors of these clathrates have been also investigated by thermo-gravimetric analysis (TGA), differential thermal analysis (DTA), and derivative thermal gravimetric analysis (DTG) in the range of 20-900 °C. X-ray powder diffraction data have been recorded at ambient temperature in the 2θ range 5-50°. The FT-IR and FT-Raman spectra of clathrates have been recorded in the region of 4000-400 cm-1 and 4000-100 cm-1, respectively. The results of the spectral and thermal analyses of the newly synthesized clathrates of fumarate-tetracyanonickel-dioxane suggest that these clathrates are new examples of the Hofmann-type dioxane clathrates. In our study, the Hofmann-type dioxane clathrates, which are formed by bounding electrons of oxygen-donor atoms of fumarate ion ligand molecule to transition metal atoms, consist of the corrugated |M-Ni(CN)4|∞ polymeric layers, which are held in parallel through the chain of (-M-fumarate-M-).
Ziegler, Ekhard E; Fomon, Samuel J; Nelson, Steven E; Jeter, Janice M; Theuer, Richard C
2011-02-01
Precooked, instant (dry) infant cereals in the US are fortified with electrolytic iron, a source of low reactivity and suspected low bioavailability. Iron from ferrous fumarate is presumed to be more available. In this study, we compared a dry infant rice cereal (Cereal L) fortified with electrolytic iron (54.5 mg iron/100 g cereal) to a similar cereal (Cereal M) fortified with ferrous fumarate (52.2 mg Fe/100 g) for efficacy in maintaining iron status and preventing iron deficiency (ID) in breast-fed infants. Ascorbic acid was included in both cereals. In this prospective, randomized double-blind trial, exclusively breast-fed infants were enrolled at 1 mo and iron status was determined periodically. At 4 mo, 3 infants had ID anemia and were excluded. Ninety-five infants were randomized at 4 mo, and 69 (36 Cereal L, 33 Cereal M) completed the intervention at 9 mo. From 4 to 9 mo, they consumed daily one of the study cereals. With each cereal, 2 infants had mild ID, a prevalence of 4.2%, but no infant developed ID anemia. There were no differences in iron status between study groups. Iron intake from the study cereals was (mean ± SD) 1.21 ± 0.31 mg⋅kg(-1)⋅d(-1) from Cereal L and 1.07 ± 0.40 mg⋅kg(-1)⋅d(-1) from Cereal M. Eleven infants had low birth iron endowment (plasma ferritin < 55 μg/L at 2 mo) and 54% of these infants had ID with or without anemia by 4 mo. We conclude that electrolytic iron and ferrous fumarate were equally efficacious as fortificants of this infant cereal.
Nicholas, Jacqueline Ann; Boster, Aaron Lee; Imitola, Jaime; O’Connell, Colleen; Racke, Michael Karl
2014-01-01
Dimethyl fumarate (DMF) is the most recent oral disease-modifying therapy approved by the US Food and Drug Administration and is indicated for the treatment of relapsing forms of multiple sclerosis (MS). Prior to approval for use in MS, DMF and its active metabolite, monomethyl fumarate, had been used for decades as two of the fumaric acid esters in Fumaderm®, a medication used in Europe for the treatment of psoriasis. The unique mechanism of action of DMF remains under evaluation; however, it has been shown to act through multiple pathways leading to shifts away from the Th1 proinflammatory response to the less inflammatory Th2 response. Preliminary data suggest that DMF may induce neuroprotective effects in central nervous system white matter, although further studies are needed to demonstrate these effects on inflammatory demyelination. The DMF Phase III clinical trials demonstrated its efficacy with regard to a reduction in the annualized relapse rate and reductions in new or enlarging T2 lesions and numbers of gadolinium-enhancing lesions on magnetic resonance imaging. DMF has a well-defined safety profile, given the experience with its use in the treatment of psoriasis, and more recently from the DMF clinical trials program and post-marketing era for treatment of MS. The safety profile and oral mode of administration of DMF place it as an attractive first-line therapy option for the treatment of relapsing forms of MS. Long-term observational studies will be needed to determine the effects of DMF on progression of disability in MS. PMID:25045248
Santos, C A; Freedman, B D; Leach, K J; Press, D L; Scarpulla, M; Mathiowitz, E
1999-06-28
The degradation of three poly(fumaric-co-sebacic anhydride) [P(FA:SA)] copolymers is examined in a composition of microspheres made by the hot melt encapsulation process. The emergence of low molecular weight oligomers occurs during degradation of the copolymer microspheres, as evidenced by a variety of characterization methods. Characterization was conducted to determine the extent of degradation of the polyanhydride microspheres using Fourier-transform infrared spectroscopy (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC) and X-ray diffraction. It is demonstrated that degradation of P(FA:SA) is greatly accelerated at basic pH, yet there is little difference between degradation in neutral and acidic buffers. A good correlation exists between the results of each characterization method, which allows a better understanding of the degradation process and the resulting formation of low molecular weight oligomers in poly(fumaric-co-sebacic anhydride).
Fukushima, Arata; Kinugawa, Shintaro; Takada, Shingo; Matsumoto, Junichi; Furihata, Takaaki; Mizushima, Wataru; Tsuda, Masaya; Yokota, Takashi; Matsushima, Shouji; Okita, Koichi; Tsutsui, Hiroyuki
2016-05-15
Insulin resistance can occur as a consequence of heart failure (HF). Activation of the renin-angiotensin system (RAS) may play a crucial role in this phenomenon. We thus investigated the effect of a direct renin inhibitor, aliskiren, on insulin resistance in HF after myocardial infarction (MI). MI and sham operation were performed in male C57BL/6J mice. The mice were divided into 4 groups and treated with sham-operation (Sham, n=10), sham-operation and aliskiren (Sham+Aliskiren; 10mg/kg/day, n=10), MI (n=11), or MI and aliskiren (MI+Aliskiren, n=11). After 4 weeks, MI mice showed left ventricular dilation and dysfunction, which were not affected by aliskiren. The percent decrease of blood glucose after insulin load was significantly smaller in MI than in Sham (14±5% vs. 36±2%), and was ameliorated in MI+Aliskiren (34±5%) mice. Insulin-stimulated serine-phosphorylation of Akt and glucose transporter 4 translocation were decreased in the skeletal muscle of MI compared to Sham by 57% and 69%, and both changes were ameliorated in the MI+Aliskiren group (91% and 94%). Aliskiren administration in MI mice significantly inhibited plasma renin activity and angiotensin II (Ang II) levels. Moreover, (pro)renin receptor expression and local Ang II production were upregulated in skeletal muscle from MI and were attenuated in MI+Aliskiren mice, in tandem with a decrease in superoxide production and NAD(P)H oxidase activities. In conclusion, aliskiren ameliorated insulin resistance in HF by improving insulin signaling in the skeletal muscle, at least partly by inhibiting systemic and (pro)renin receptor-mediated local RAS activation, and subsequent NAD(P)H oxidase-induced oxidative stress. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank
2018-06-01
Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.
Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard
2013-01-01
The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.
Haarmann, Axel; Nehen, Mathias; Deiß, Annika; Buttmann, Mathias
2015-08-13
Dimethyl fumarate (DMF) is approved for disease-modifying treatment of patients with relapsing-remitting multiple sclerosis. Animal experiments suggested that part of its therapeutic effect is due to a reduction of T-cell infiltration of the central nervous system (CNS) by uncertain mechanisms. Here we evaluated whether DMF and its primary metabolite monomethyl fumarate (MMF) modulate pro-inflammatory intracellular signaling and T-cell adhesiveness of nonimmortalized single donor human brain microvascular endothelial cells at low passages. Neither DMF nor MMF at concentrations of 10 or 50 µM blocked the IL-1β-induced nuclear translocation of NF-κB/p65, whereas the higher concentration of DMF inhibited the nuclear entry of p65 in human umbilical vein endothelium cultured in parallel. DMF and MMF also did not alter the IL-1β-stimulated activation of p38 MAPK in brain endothelium. Furthermore, neither DMF nor MMF reduced the basal or IL-1β-inducible expression of ICAM-1. In accordance, both fumaric acid esters did not reduce the adhesion of activated Jurkat T cells to brain endothelium under basal or inflammatory conditions. Therefore, brain endothelial cells probably do not directly mediate a potential blocking effect of fumaric acid esters on the inflammatory infiltration of the CNS by T cells.
Salusjärvi, Laura; Kaunisto, Sanna; Holmström, Sami; Vehkomäki, Maija-Leena; Koivuranta, Kari; Pitkänen, Juha-Pekka; Ruohonen, Laura
2013-12-01
Deviation from optimal levels and ratios of redox cofactors NAD(H) and NADP(H) is common when microbes are metabolically engineered. The resulting redox imbalance often reduces the rate of substrate utilization as well as biomass and product formation. An example is the metabolism of D-xylose by recombinant Saccharomyces cerevisiae strains expressing xylose reductase and xylitol dehydrogenase encoding genes from Scheffersomyces stipitis. This pathway requires both NADPH and NAD(+). The effect of overexpressing the glycosomal NADH-dependent fumarate reductase (FRD) of Trypanosoma brucei in D-xylose-utilizing S. cerevisiae alone and together with an endogenous, cytosol directed NADH-kinase (POS5Δ17) was studied as one possible solution to overcome this imbalance. Expression of FRD and FRD + POS5Δ17 resulted in 60 and 23 % increase in ethanol yield, respectively, on D-xylose under anaerobic conditions. At the same time, xylitol yield decreased in the FRD strain suggesting an improvement in redox balance. We show that fumarate reductase of T. brucei can provide an important source of NAD(+) in yeast under anaerobic conditions, and can be useful for metabolic engineering strategies where the redox cofactors need to be balanced. The effects of FRD and NADH-kinase on aerobic and anaerobic D-xylose and D-glucose metabolism are discussed.
Kappos, Ludwig; Gold, Ralf; Arnold, Douglas L; Bar-Or, Amit; Giovannoni, Gavin; Selmaj, Krzysztof; Sarda, Sujata P; Agarwal, Sonalee; Zhang, Annie; Sheikh, Sarah I; Seidman, Emily; Dawson, Katherine T
2014-02-01
Oral BG-12 (dimethyl fumarate), approved for the treatment of the relapsing forms of MS, has demonstrated clinical efficacy with an acceptable safety profile in the Phase III "Determination of the Efficacy and Safety of Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (RRMS)" (DEFINE) and "Comparator and an Oral Fumarate in RRMS" (CONFIRM) studies. To evaluate the health-related quality of life (HRQoL) impairment that is associated with RRMS and to assess the effects of BG-12 on HRQoL in the DEFINE study. Patients with RRMS were randomized to BG-12 240 mg twice (BID) or three times (TID) daily, or placebo, for 2 years. HRQoL was assessed by the Short Form-36 (SF-36), global assessment of well-being visual analog scale and the EuroQol-5D. In the 1237 patients from DEFINE, HRQoL impairment was greatest in patients who had higher disability scores and in those who had experienced relapse. Change in SF-36 physical component summary scores during 2 years' treatment significantly favored BG-12 over placebo (both doses: p < 0.001). We saw similar benefits in other measures of functioning and general well-being as early as Week 24. These benefits were maintained during the study. Our results add to evidence for a negative impact of RRMS on HRQoL and they demonstrate the benefits of BG-12 on HRQoL measures, which coupled with significant clinical efficacy, further support its use as a new treatment for RRMS.
Tomillero, A; Moral, M A
2009-04-01
(+)-Dapoxetine hydrochloride, [(123)I]-BZA, 9-Aminocamptothecin; Abacavir sulfate/lamivudine, Adalimumab, Adefovir dipivoxil, Alemtuzumab, Alvocidib hydrochloride, Ambrisentan, Amsilarotene, Anacetrapib, Anakinra, Apricitabine, Aripiprazole, Arsenic trioxide, Atazanavir sulfate, Atazanavir/ritonavir, Atrasentan, Azacitidine; Banoxantrone, Bazedoxifene acetate, Bevacizumab, Bexarotene, Biphasic insulin aspart, Bortezomib, Bosentan, Bromfenac; Cachectin, Calcipotriol/betamethasone dipropionate, Canakinumab, Carfilzomib, CAT-354, CCX-282, Certolizumab pegol, Cetuximab, Choline fenofibrate, Clevudine, Clofarabine, CNTO-328, Corifollitropin alfa, Crofelemer; Daptomycin, Darbepoetin alfa, Darunavir, Dasatinib, Decitabine, Deferasirox, Denosumab, Duloxetine hydrochloride, Dutasteride; Emtricitabine, Enfuvirtide, Entecavir, Epoetin zeta, Erlotinib hydrochloride, Escitalopram oxalate, Eslicarbazepine acetate, Eszopiclone, Etravirine, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Farglitazar, Febuxostat, Fosamprenavir calcium, FX-06; Gabapentin enacarbil, Gefitinib; HIVIS DNA; Imatinib mesylate, INCB- 18424, Indacaterol, Inotuzumab ozogamicin, Insulin detemir; JNJ-26854165; Lacosamide, Landiolol, Laromustine, Lenalidomide, Liposomal doxorubicin, L-NAME, Lopinavir, Lopinavir/ritonavir, Lumiracoxib; Maraviroc, Mepolizumab, Methoxy polyethylene glycol- epoetin-beta, Miglustat, MK-0493, MVA-CMDR, Mycophenolic acid sodium salt; Natalizumab, Nepafenac, Neratinib, Neridronic acid, Nesiritide, Nilotinib hydrochloride monohydrate; Olmesartan medoxomil, Omacetaxine mepesuccinate, Omalizumab; Paclitaxel poliglumex, Palifermin, Patupilone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, PHA-848125, Pitavastatin calcium, Posaconazole, Povidone-iodine liposome complex, Prasugrel, Pregabalin, Prucalopride; Raltegravir potassium, Retigabine, Revaprazan hydrochloride, rhFSH, Rilpivirine, Rivaroxaban, Romidepsin
Fumarate decreases edema volume and improves functional outcome after experimental stroke.
Clausen, Bettina Hjelm; Lundberg, Louise; Yli-Karjanmaa, Minna; Martin, Nellie Anne; Svensson, Martina; Alfsen, Maria Zeiler; Flæng, Simon Bertram; Lyngsø, Kristina; Boza-Serrano, Antonio; Nielsen, Helle H; Hansen, Pernille B; Finsen, Bente; Deierborg, Tomas; Illes, Zsolt; Lambertsen, Kate Lykke
2017-09-01
Oxidative stress and inflammation exacerbate tissue damage in the brain after ischemic stroke. Dimethyl-fumarate (DMF) and its metabolite monomethyl-fumarate (MMF) are known to stimulate anti-oxidant pathways and modulate inflammatory responses. Considering these dual effects of fumarates, we examined the effect of MMF treatment after ischemic stroke in mice. Permanent middle cerebral artery occlusion (pMCAO) was performed using adult, male C57BL/6 mice. Thirty minutes after pMCAO, 20mg/kg MMF was administered intravenously. Outcomes were evaluated 6, 24 and 48h after pMCAO. First, we examined whether a bolus of MMF was capable of changing expression of kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1) and nuclear factor erythroid 2-related factor (Nrf)2 in the infarcted brain. Next, we studied the effect of MMF on functional recovery. To explore mechanisms potentially influencing functional changes, we examined infarct volumes, edema formation, the expression of heat shock protein (Hsp)72, hydroxycarboxylic acid receptor 2 (Hcar2), and inducible nitric oxide synthase (iNOS) in the infarcted brain using real-time PCR and Western blotting. Concentrations of a panel of pro- and anti-inflammatory cytokines (IFNγ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p70, TNF) were examined in both the infarcted brain tissue and plasma samples 6, 24 and 48h after pMCAO using multiplex electrochemoluminiscence analysis. Administration of MMF increased the protein level of Nrf2 6h after pMCAO, and improved functional outcome at 24 and 48h after pMCAO. MMF treatment did not influence infarct size, however reduced edema volume at both 24 and 48h after pMCAO. MMF treatment resulted in increased Hsp72 expression in the brain 6h after pMCAO. Hcar2 mRNA levels increased significantly 24h after pMCAO, but were not different between saline- and MMF-treated mice. MMF treatment also increased the level of the anti-inflammatory cytokine IL-10 in the
Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo
2008-11-01
Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle.
Bayés, M; Rabasseda, X; Prous, J R
2006-10-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issues focuses on the following selection of drugs: (-)-Epigallocatechin gallate, (-)-gossypol, 2-deoxyglucose, 3,4-DAP, 7-monohydroxyethylrutoside; Ad5CMV-p53, adalimumab, adefovir dipivoxil, ADH-1, alemtuzumab, aliskiren fumarate, alvocidib hydrochloride, aminolevulinic acid hydrochloride, aminolevulinic acid methyl ester, amrubicin hydrochloride, AN-152, anakinra, anecortave acetate, antiasthma herbal medicine intervention, AP-12009, AP-23573, apaziquone, aprinocarsen sodium, AR-C126532, AR-H065522, aripiprazole, armodafinil, arzoxifene hydrochloride, atazanavir sulfate, atilmotin, atomoxetine hydrochloride, atorvastatin, avanafil, azimilide hydrochloride; Bevacizumab, biphasic insulin aspart, BMS-214662, BN-83495, bortezomib, bosentan, botulinum toxin type B; Caspofungin acetate, cetuximab, chrysin, ciclesonide, clevudine, clofarabine, clopidogrel, CNF-1010, CNTO-328, CP-751871, CX-717, Cypher; Dapoxetine hydrochloride, darifenacin hydrobromide, dasatinib, deferasirox, dextofisopam, dextromethorphan/quinidine sulfate, diclofenac, dronedarone hydrochloride, drotrecogin alfa (activated), duloxetine hydrochloride, dutasteride; Edaravone, efaproxiral sodium, emtricitabine, entecavir, eplerenone, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, etoricoxib, ezetimibe, ezetimibe/simvastatin; Finrozole, fipamezole hydrochloride, fondaparinux sodium, fulvestrant; Gabapentin enacarbil, gaboxadol, gefitinib, gestodene, ghrelin (human); Human insulin, human papillomavirus vaccine; Imatinib mesylate, immunoglobulin intravenous (human), indiplon, insulin detemir, insulin glargine, insulin glulisine, intranasal insulin, istradefylline, i.v. gamma
New biological agents in the treatment of multiple sclerosis.
Buc, M
2018-01-01
Multiple sclerosis (MS) is an inflammatory disease induced by autoimmune processes. Their understanding has resulted in an introduction of biological agents to its treatment. Interferon beta and glatiramer acetate have been in clinical practice for more than 20 years. Nowadays, novel biologics, which target molecules involved in immunopathological processes more specifically have entered the scene. They are represented by monoclonal antibodies binding to molecules VLA4 (natalizumab), CD20 (ocrelizumab), CD52 (alemtuzumab) or alpha subunit of IL-2 receptor (daclizumab) or by small molecules such as those modulating the receptors involved in regulation of lymphocyte migration (fingolimod, ozanimod) or in induction of lymphopenia by apoptosis (dimethyl fumarate, cladribine). In the article, we shortly describe their efficacies, adverse reactions and perspectives of a future development in MS biologics. A treatment of neuromyelitis optica by monoclonal antibodies (rituximab, aquaporumab) is given too (Tab. 1, Fig. 2, Ref. 71).
Multiple Sclerosis: Immunopathology and Treatment Update
Dargahi, Narges; Katsara, Maria; Tselios, Theodore; Androutsou, Maria-Eleni; Matsoukas, John
2017-01-01
The treatment of multiple sclerosis (MS) has changed over the last 20 years. All immunotherapeutic drugs target relapsing remitting MS (RRMS) and it still remains a medical challenge in MS to develop a treatment for progressive forms. The most common injectable disease-modifying therapies in RRMS include β-interferons 1a or 1b and glatiramer acetate. However, one of the major challenges of injectable disease-modifying therapies has been poor treatment adherence with approximately 50% of patients discontinuing the therapy within the first year. Herein, we go back to the basics to understand the immunopathophysiology of MS to gain insights in the development of new improved drug treatments. We present current disease-modifying therapies (interferons, glatiramer acetate, dimethyl fumarate, teriflunomide, fingolimod, mitoxantrone), humanized monoclonal antibodies (natalizumab, ofatumumab, ocrelizumab, alemtuzumab, daclizumab) and emerging immune modulating approaches (stem cells, DNA vaccines, nanoparticles, altered peptide ligands) for the treatment of MS. PMID:28686222
Belal, F; Walash, M; El-Enany, N; Zayed, S
2013-12-01
An alternative method for analysis of aliskiren (ALI) and hydrochlorothiazde (HCT) in combined dosage forms by ion-pair reversed phase high performance liquid chromatography was developed and validated. The pharmaceutical preparations were analyzed using a C18 column (250 mm x 4.6 mm, 3 microm) with a mobile phase consisting of 25% methanol, 50% sodium monobasic phosphate aqueous solution containing 6 mM tetrabutylammonium bromide and 25% water at pH 7.2. Isocratic analysis was performed at a flow rate of 1 mL/min and a column temperature of 30 degrees C under direct UV detection at 210 nm. Paracetamol was used as internal standard. The validation was performed according to the ICH guidelines. The proposed method was linear over the concentration range of 0.250 to 60 and 0.1 to 10 microg/mL for ALI and HCT, respectively. The limits of detection and quantitation (LOD and LOQ) were 0.075 and 0.198 microg/mL, respectively, for ALI and 0.04 and 0.062 microg/mL, respectively, for HCT. The method proved to be specific, sensitive, precise and accurate with mean recovery values of 101.1 +/- 0.32% and 100.9 +/- 0.41% for ALI and HCT, respectively. The method robustness was evaluated by means of an experimental design. The proposed method was applied successfully to spiked human urine samples with mean recoveries of 98.8 +/- 0.36% and 98.1 +/- 0.21% for ALI and HCT, respectively.
Sangoi, Maximiliano S; Wrasse-Sangoi, Micheli; Oliveira, Paulo R; Rolim, Clarice M B; Steppe, Martin
2011-08-01
A stability-indicating MEKC method was developed and validated for the simultaneous determination of aliskiren (ALI) and hydrochlorothiazide (HCTZ) in pharmaceutical formulations using ranitidine as an internal standard (IS). Optimal conditions for the separation of ALI, HCTZ and its major impurity chlorothiazide (CTZ), IS and degradation products were investigated. The method employed 47 mM Tris buffer and 47 mM anionic detergent SDS solution at pH 10.2 as the background electrolyte. MEKC method was performed on a fused-silica capillary (40 cm) at 28°C. Applied voltage was 26 kV (positive polarity) and photodiode array (PDA) detector was set at 217 nm. The method was validated in accordance with the ICH requirements. The method was linear over the concentration range of 5-100 and 60-1200 μg/mL for HCTZ and ALI, respectively (r(2) >0.9997). The stability-indicating capability of the method was established by enforced degradation studies combined with peak purity assessment using the PDA detection. Precision and accuracy evaluated by RSD were lower than 2%. The method proved to be robust by a fractional factorial design evaluation. The proposed MEKC method was successfully applied for the quantitative analysis of ALI and HCTZ both individually and in a combined dosage tablet formulation to support the quality control. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dotsenko, Anna S; Dotsenko, Gleb S; Senko, Olga V; Stepanov, Nikolay A; Lyagin, Ilya V; Efremenko, Elena N; Gusakov, Alexander V; Zorov, Ivan N; Rubtsova, Ekaterina A
2018-02-01
The pretreatment of softwood and hardwood samples (spruce and hornbeam wood) with 1-butyl-3-methylimidazolium chloride ([Bmim]Cl) was undertaken for further simultaneous enzymatic saccharification of renewable non-food lignocellulosic biomass and microbial fermentation of obtained sugars to ethanol and fumaric acid. A multienzyme cocktail based on cellulases and yeast or fungus cells producing ethanol and fumaric acid were the main objects of [Bmim]Cl influence studies. A complex effect of lignocellulosic biomass pretreatment with [Bmim]Cl on various aspects of the process (both action of cellulases and microbial conversion of hydrolysates to target products) was revealed. Positive effects of the pretreatment with [Bmim]Cl included decreasing the lignin content in the biomass, and increasing the effectiveness of enzymatic hydrolysis and microbial transformation of pretreated biomass. Immobilized cells of both yeasts and fungi possessed improved productive characteristics in the biotransformation of biomass pretreated with [Bmim]Cl to ethanol and fumaric acid. Copyright © 2017 Elsevier Ltd. All rights reserved.
Safari, Anahid; Fazeli, Mehdi; Namavar, Mohammad Reza; Tanideh, Nader; Jafari, Peyman; Borhani-Haghighi, Afshin
2017-01-01
Dimethyl fumarate (DMF) has immune-modulatory and neuro-protective characteristics that can be used for treatment of acute ischemic stroke. To investigate the therapeutic effects of DMF on histological and functional recovery of rats after transient middle cerebral artery (MCA) occlusion. 22 Sprague-Dawley male rats weighing 275-300 g were randomized into three groups by block randomization. In the sham group (n = 7), the neck was opened, but neither MCA was occluded, nor any drug was administered.The control group (n = 7) was treated with vehicle (methocel) by gavage for 14 days after MCA occlusion. In the DMF-treated group (n = 8), treatment was performed with 15 mg/kg body weight dimethyl fumarate twice a day for 14 days after MCA occlusion. Transient occlusion of the right MCA was performed by intraluminal thread method in the DMF-treated and the control group. Neurological deficit score (NDS), pole test, and adhesive removal test were performed before the surgery, and on post-operative Days 0, 3, 5, 7, 10, and 14. After the final behaviour test, the animals' brains were perfused and removed. Brains were frozen and sectioned serially and coronally using a cryostat. Infract volume and brain volume were estimated by stereology. The percentage of infarct volume was significantly lower in DMF-treated animals (5.76%) than in the control group (22.39%) (P < 0.0001). Regarding behavioural tests, the DMF-treated group showed better function in NDS on Days 7 (P = 0.041) and 10 (P = 0.046), but not in pole and adhesive removal tests. There was no significant correlation between behavioural tests and histological results. Dimethyl fumarate could be beneficial as a potential neuroprotective agent in the treatment of stroke.
Shakya, Anshul; Soni, Upendra Kumar; Rai, Geeta; Chatterjee, Shyam Sunder; Kumar, Vikas
2016-05-01
Results of the very first experiments conducted to evaluate therapeutic potentials of a fumarate containing Fumaria indica extract and of fairly low daily oral doses of monomethyl fumarate for prevention of chronic unavoidable foot-shock stress-induced gastric ulcers, and possible involvement of diverse neuro-hormonal and oxidative process in their stress response desensitizing effects are reported and discussed in this article. Preventive effects of 21 daily oral 60, 120, and 240 mg/kg doses of a standardized 50 % methanolic F. indica extract (MFI) and 1.25, 2.50, and 5.00 mg/kg/day of pure monomethyl fumarate (MMF) were compared in rats subjected to one hour daily unavoidable foot-shocks. A pharmaceutically well-standardized Withania somnifera (WS) root extract was used as a reference herbal anti-stress agent in all experiments. Effects of the treatments on stress-induced alterations in body weight, adrenal and spleen weights, gastric ulcer and ulcer index, weight of glandular stomach, protective mucosal glycoprotein content, cellular proliferation, oxidative stress on stomach fundus, and brain tissues of male rats were quantified. Other parameters quantified were plasma corticosterone levels, brain monoamine levels, and expressions of the cytokines TNF-α, IL-10, and IL-1β in blood and brain of stressed and treated rats. Most but not every observed stress-induced anomalies were suppressed or completely prevented by both MFI and pure MMF treatments in dose-dependent manner. Qualitatively, the observed activity profiles of both of them were similar to those of WS dose tested. These results reveal that both MFI and MMF are potent gastro-protective agents against chronic unavoidable stress-induced ulcers and strongly suggest that they act as regulators or modulators of monoamine, corticosterone, and cytokine homeostasis.
Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo
2008-01-01
Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle. PMID:18757546
Jayabalan, M.
2009-01-01
The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus. PMID:20126578
Jayabalan, M
2009-01-01
The effect of reinforcement in the cross-linked poly(propylene fumarate-co-caprolactone diol) thermoset composites based on Kevlar fibres and hydroxyapatite was studied. Cross-linked poly(propylene fumarate-co-caprolactone diol) was also studied without any reinforcement for comparison. The reinforcing fibre acts as a barrier for the curing reaction leading to longer setting time and lesser cross-link density. The fibre and HA reinforced composites have almost the same compressive strength. Nonreinforced material undergoes greater degree of swelling. Among the reinforced materials, the hydroxyapatite reinforced composite has a much higher swelling percentage than the fibre reinforced one. The studies on in vitro degradation of the cured materials reveal hydrolytic degradation in Ringer's solution and PBS medium during aging. All the three materials are found to swell initially in Ringer's solution and PBS medium during aging and then undergo gradual degradation. Compression properties of these cross-linked composites increase with aging; HA reinforced composite has the highest compressive strength and compressive modulus, whereas the aged fibre-reinforced composite has the least compressive strength and modulus.
Cevik, Muge; Orkin, Chloe
2018-07-01
In an era when virological efficacy approaches 100%, novel antiretroviral (ARV) therapies must deliver better tolerability, safety, and convenient coformulated regimens. We review the phase II and III clinical data on the fixed dose combination (FDC) darunavir (DRV) 800mg / cobicistat (COBI/C) 150 mg / emtricitabine (F/FTC) 200 mg / tenofovir alafenamide fumarate (TAF) 10mg (D/C/F/TAF) for the treatment of HIV-1 infection. In an exploratory phase II study, D/C/F/TAF FDC demonstrated similar virological efficacy to darunavir/cobicistat FDC + F /tenofovir disoproxil fumarate (TDF) FDC in treatment-naive HIV-1-infected individuals with favorable bone and renal outcomes. These findings led to two subsequent international phase III double-blind randomized controlled trials; AMBER and EMERALD. In the (treatment naïve) AMBER study, D/C/F/TAF FDC was noninferior to component regimen F/TDF + darunavir/cobicistat with favorable bone and renal outcomes at week 48. In the EMERALD study (switch study for virologically suppressed patients), D/C/F/TAF showed noninferior efficacy to F/TDF and boosted protease inhibitor (bPI) regimen at week 48 also with favorable renal and bone outcomes. No virological failure was observed, and no resistance to TDF or darunavir emerged in either study. In clinical trials, D/C/F/TAF FDC demonstrated excellent, noninferior virological efficacy, maintained a high genetic barrier and conferred the additional safety benefits of TAF. As the first one pill, once daily, protease inhibitor-based regimen, D/C/F/TAF FDC offers a new option for the treatment of HIV infection.
Bayés, M; Rabasseda, X; Prous, J R
2002-09-01
Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Studies knowledge area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: Adalimumab, aeroDose insulin inhaler, agomelatine, alendronic acid sodium salt, aliskiren fumarate, alteplase, amlodipine, aspirin, atazanavir; Bacillus Calmette-Guérin, basiliximab, BQ-788, bupropion hydrochloride; Cabergoline, caffeine citrate, carbamazepine, carvedilol, celecoxib, cyclosporine, clopidogrel hydrogensulfate, colestyramine; Dexamethasone, diclofenac sodium, digoxin, dipyridamole, docetaxel, dutasteride; Eletriptan, enfuvirtidie, eplerenone, ergotamine tartrate, esomeprazole magnesium, estramustine phosphate sodium; Finasteride, fluticasone propionate, fosinopril sodium; Ganciclovir, GBE-761-ONC, glatiramer acetate, gliclazide, granulocyte-CSF; Heparin sodium, human isophane insulin (pyr), Hydrochlorothiazide; Ibuprofen, inhaled insulin, interferon alfa, interferon beta-1a; Laminvudine, lansoprazole, lisinopril, lonafarnib, losartan potassium, lumiracoxib; MAb G250, meloxicam methotrexate, methylprednisolone aceponate, mitomycin, mycophenolate mofetil; Naproxen sodium, natalizumab, nelfinavir mesilate, nemifitide ditriflutate, nimesulide; Omalizumab, omapatrilat, omeprazole, oxybutynin chloride; Pantoprazole sodium, paracetamol, paroxetine, pentoxifylline, pergolide mesylate, permixon, phVEGF-A165, pramipexole hydrochloride, prasterone, prednisone, probucol, propiverine hydrochloride; Rabeprazole sodium, resiniferatoxin, risedronate sodium, risperidone, rofecoxib rosiglitazone maleate, ruboxistaurin mesilate hydrate; Selegiline transdermal system, sertraline, sildenafil citrate, streptokinase; Tadalafil, tamsulosin hydrochloride, technosphere/Insulin, tegaserod maleate, tenofovir disoproxil
Bayes, M; Rabasseda, X; Prous, J R
2006-01-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs:(R)-Flurbiprofen, 90Yttrium-DOTA-huJ591; ABT-510, ACP-103, Ad5-FGF4, adalimumab, ademetionine, AG-7352, alemtuzumab, Amb a 1 ISS-DNA, anakinra, apaziquone, aprepitant, aripiprazole, atazanavir sulfate; BAL-8557, bevacizumab, BMS-188797, bortezomib, bosentan, brivudine; Calcipotriol/betamethasone dipropionate, cannabidiol, caspofungin acetate, catumaxomab, CERE-120, cetuximab, ciclesonide, cilomilast, cizolirtine citrate, Cypher, cystemustine; Dalbavancin, darifenacin hydrobromide, dasatinib, deferasirox, denosumab, desmoteplase, dihydrexidine, dimethyl fumarate, dutasteride, DW-166HC; Eculizumab, enfuvirtide, entecavir, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, eszopiclone, etoricoxib, everolimus; Fallypride, febuxostat, fenretinide, fesoterodine, fingolimod hydrochloride; Gabapentin enacarbil, gefitinib; hMaxi-K, human papillomavirus vaccine, HYAL-CT1101; Imatinib mesylate, indiplon, inolimomab, ISAtx-247; J591; Lacosamide, landiolol, lasofoxifene tartrate, lestaurtinib, lidocaine/prilocaine, linezolid, lixivaptan, lonafarnib, lopinavir, lopinavir/ritonavir, lumiracoxib; Natalizumab, nesiritide; OC-108, omalizumab, onercept, OSC; Palifermin, palonosetron hydrochloride, parathyroid hormone (human recombinant), parecoxib sodium, PD-MAGE-3 vaccine, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, pegsunercept, pelitinib, pitavastatin calcium, plerixafor hydrochloride, posaconazole, prasterone sulfate, pregabalin; Ramelteon, ranelic acid distrontium salt, rasburicase, rosuvastatin calcium, rotigotine, RSD-1235, rufinamide, rupatadine fumarate; Sarizotan hydrochloride, SHL-749
Bayés, M; Rabasseda, X; Prous, J R
2005-04-01
Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: ABX-IL-8, Acclaim, adalimumab, AGI-1067, alagebrium chloride, alemtuzumab, Alequel, Androgel, anti-IL-12 MAb, AOD-9604, aripiprazole, atomoxetine hydrochloride; Biphasic insulin aspart, bosentan, botulinum toxin type B, bovine lactoferrin, brivudine; Cantuzumab mertansine, CB-1954, CDB-4124, CEA-TRICOM, choriogonadotropin alfa, cilansetron, CpG-10101, CpG-7909, CTL-102, CTL-102/CB-1954; DAC:GRF, darbepoetin alfa, davanat-1, decitabine, del-1 Genemedicine, dexanabinol, dextofisopam, dnaJP1, dronedarone hydrochloride, dutasteride; Ecogramostim, eletriptan, emtricitabine, EPI-hNE-4, eplerenone, eplivanserin fumarate, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, esomeprazole magnesium, etoricoxib, ezetimibe; Falecalcitriol, fingolimod hydrochloride; Gepirone hydrochloride; HBV-ISS, HSV-2 theracine, human insulin; Imatinib mesylate, Indiplon, insulin glargine, ISAtx-247; L612 HuMAb, levodopa/carbidopa/entacapone, lidocaine/prilocaine, LL-2113AD, lucinactant, LY-156735; Meclinertant, metelimumab, morphine hydrochloride, morphine-6-glucuronide; Natalizumab, nimotuzumab, NX-1207, NYVAC-HIV C; Omalizumab, onercept, osanetant; PABA, palosuran sulfate, parathyroid hormone (human recombinant), parecoxib sodium, PBI-1402, PCK-3145, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, PINC, pregabalin; Ramelteon, rasagiline mesilate, rasburicase, rimonabant hydrochloride, RO-0098557, rofecoxib, rosiglitazone maleate/metformin hydrochloride; Safinamide mesilate, SHL-749, sitaxsentan sodium, sparfosic acid, SprayGel, squalamine, St. John's Wort
Decursin and decursinol angelate selectively inhibit NADH-fumarate reductase of Ascaris suum.
Shiomi, Kazuro; Hatano, Hiroko; Morimoto, Hiromi; Ui, Hideaki; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tomoda, Hiroshi; Lee, Eun Woo; Heo, Tae Ryeon; Kawagishi, Hirokazu; Omura, Satoshi
2007-11-01
NADH-fumarate reductase (NFRD) is a key enzyme in many anaerobic helminths. Decursin and decursinol angelate have been isolated from the roots of ANGELICA GIGAS Nakai (Apiaceae) as NFRD inhibitors. They inhibited ASCARIS SUUM NFRD with IC (50) values of 1.1 and 2.7 microM, respectively. Their target is the electron transport enzyme complex I. Since the inhibitory activities of decursin against bovine heart complexes are weak, it is a selective inhibitor of the nematode complex I. In contrast, decursinol angelate moderately inhibits bovine heart complexes II and III. Decursinol inhibits A. SUUM NFRD to a similar extent, but its target is complex II. It also inhibits bovine heart complexes II and III.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Starbird, C. A.; Maklashina, Elena; Sharma, Pankaj
The Escherichia coli Complex II homolog quinol:fumarate reductase (QFR, FrdABCD) catalyzes the interconversion of fumarate and succinate at a covalently attached FAD within the FrdA subunit. The SdhE assembly factor enhances covalent flavinylation of Complex II homologs, but the mechanisms underlying the covalent attachment of FAD remain to be fully elucidated. Here, we explored the mechanisms of covalent flavinylation of the E. coli QFR FrdA subunit. Using a ΔsdhE E. coli strain, we show that the requirement for the assembly factor depends on the cellular redox environment. We next identified residues important for the covalent attachment and selected the FrdAE245more » residue, which contributes to proton shuttling during fumarate reduction, for detailed biophysical and structural characterization. We found that QFR complexes containing FrdAE245Q have a structure similar to that of the WT flavoprotein, but lack detectable substrate binding and turnover. In the context of the isolated FrdA subunit, the anticipated assembly intermediate during covalent flavinylation, FrdAE245 variants had stability similar to that of WT FrdA, contained noncovalent FAD, and displayed a reduced capacity to interact with SdhE. However, small-angle X-ray scattering (SAXS) analysis of WT FrdA cross-linked to SdhE suggested that the FrdAE245 residue is unlikely to contribute directly to the FrdA-SdhE protein-protein interface. We also found that no auxiliary factor is absolutely required for flavinylation, indicating that the covalent flavinylation is autocatalytic. We propose that multiple factors, including the SdhE assembly factor and bound dicarboxylates, stimulate covalent flavinylation by preorganizing the active site to stabilize the quinone-methide intermediate.« less
Zlotkin, Stanley; Antwi, Kojo Yeboah; Schauer, Claudia; Yeung, George
2003-01-01
OBJECTIVE: To compare the effectiveness of microencapsulated iron(II) fumarate sprinkles (with and without vitamin A), iron(II) sulfate drops, and placebo sprinkles in preventing recurrence of anaemia and to determine the long-term haematological outcomes in children at high risk of recurrence of anaemia 12 months after the end of supplementation. METHODS: A prospective, randomized, placebo-controlled design was used to study 437 Ghanaian children aged 8-20 months who were not anaemic (haemoglobin > or = 100 g/l). Four groups were given microencapsulated iron(II) fumarate sprinkles, microencapsulated iron(II) fumarate sprinkles with vitamin A, iron(II) sulfate drops or placebo sprinkles daily for six months. Primary outcome measures were change in haemoglobin and anaemic status at baseline and study end. Non-anaemic children at the end of the supplementation period were reassessed 12 months after supplementation ended. FINDINGS: Overall, 324 children completed the supplementation period. Among the four groups, no significant changes were seen in mean haemoglobin, ferritin or serum retinol values from baseline to the end of the supplementation period. During the trial, 82.4% (267/324) of children maintained their non-anaemic status. Sprinkles were well accepted without complications. At 12 months post-supplementation, 77.1% (162/210) of children with no intervention remained non-anaemic. This proportion was similar for children among the four groups. CONCLUSION: In most children previously treated for anaemia, further supplementation was not needed to maintain their non-anaemic status. These results may have important implications for community intervention programmes in which initial high-dose treatment is needed because of a high prevalence of anaemia. PMID:12756979
Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J; Corey, Joseph M; Lundy, Steven K; Mao-Draayer, Yang
2015-06-17
Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS).
Gieselbach, Robbert-Jan; Muller-Hansma, Annemarie H; Wijburg, Martijn T; de Bruin-Weller, Marjolein S; van Oosten, Bob W; Nieuwkamp, Dennis J; Coenjaerts, Frank E; Wattjes, Mike P; Murk, Jean-Luc
2017-06-01
Progressive multifocal leukoencephalopathy (PML) is a rare and potentially fatal condition caused by a brain infection with JC polyomavirus (JCV). PML develops almost exclusively in immunocompromised patients and has recently been associated with use of fumaric acid esters (FAEs), or fumarates. We reviewed the literature and the Dutch and European pharmacovigilance databases in order to identify all available FAE-associated PML cases and distinguish possible common features among these patients. A total of 19 PML cases associated with FAE use were identified. Five cases were associated with FAE use for multiple sclerosis and 14 for psoriasis. Ten patients were male and nine were female. The median age at PML diagnosis was 59 years. The median duration of FAE therapy to PML symptom onset or appearance of first PML lesion on brain imaging was 31 months (range 6-110). In all cases a certain degree of lymphocytopenia was reported. The median duration of lymphocytopenia to PML symptom onset was 23 months (range 6-72). The median lymphocyte count at PML diagnosis was 414 cells/µL. CD4 and CD8 counts were reported in ten cases, with median cell count of 137 and 39 cells/µL, respectively. Three patients died (16% mortality). The association between occurrence of PML in patients with low CD4 and CD8 counts is reminiscent of PML cases in the HIV population and suggests that loss of T cells is the most important risk factor.
Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A
2018-06-01
Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.
[Preparation and application on compound excipient of sodium stearyl fumarate and plasdone S-630].
Jiang, Yan-Rong; Zhang, Zhen-Hai; Jia, Xiao-Bin
2013-01-01
The compound excipient containing sodium stearyl fumarate and plasdone S-630 was prepared by applying spray drying method. The basic physical properties of compound excipient were studied by solubility test, scanning electron microscope, differential scanning calorimeter, X-ray diffraction and Fourier transform infra-red spectroscopy. The effect of compound excipient on moisture absorption and ferulic acid in vitro dissolution of spray drying power of angelica were investigated. The results showed that the chemical constituents of compound excipient did not change before and after spray drying. The water soluble compound excipient can improve significantly moisture absorption and has application prospect.
Soni, Hitesh M; Patel, Praful P; Patel, Savan; Rath, Akshyaya C; Acharya, Aviseka; Trivedi, Harshkant D; Jain, Mukul R
2015-01-01
The aim was to investigate the nephroprotective effect of combination of aliskiren (ASK), a direct renin inhibitor and pentoxifylline (PTX), inhibitor of tumor necrotic factor-alpha (TNF-alpha), in rat remnant kidney model of chronic kidney disease (CKD). Nephrectomized (NPX) rats were treated with ASK (10 mg/kg, p.o.), PTX (100 mg/kg, p.o.), and combination of PTX + ASK once daily for 28 days. We have performed analysis of various renal injury parameters after 4 weeks of treatment. Treatment with PTX, ASK and combination showed significant improvement in urea, creatinine and total protein in plasma when compared with vehicle treated group in NPX rats. ASK and combination of PTX + ASK elicited significant reduction in blood pressure but PTX alone did not produce blood pressure reduction. ASK treatment showed significant elevation in TNF-alpha, whereas PTX and ASK + PTX showed significant reduction in TNF-alpha in plasma. Histopathologically, the extent of the kidney injury was similar in NPX + vehicle and NPX + ASK-treated rats. PTX and ASK + PTX-treated group showed lesser extent of kidney injury. There was good correlation of mRNA expression levels of kidney injury molecule-1 and bradykinin B1 receptor data with histopathological findings in kidney samples and elevated TNF-alpha levels in plasma. We conclude that combination of PTX + ASK may be better therapeutic intervention for nephroprotection in CKD patients.
Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J.; Corey, Joseph M.; Lundy, Steven K.; Mao-Draayer, Yang
2015-01-01
Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS). PMID:26090715
He, Xuezhong; Ma, Junyu; Mercado, Angel E; Xu, Weijie; Jabbari, Esmaiel
2008-07-01
Biodegradable core-shell polymeric nanoparticles (NPs), with a hydrophobic core and hydrophilic shell, are developed for surfactant-free encapsulation and delivery of Paclitaxel to tumor cells. Poly (lactide-co-glycolide fumarate) (PLGF) and Poly (lactide-fumarate) (PLAF) were synthesized by condensation polymerization of ultra-low molecular weight poly(L: -lactide-co-glycolide) (ULMW PLGA) with fumaryl chloride (FuCl). Similarly, poly(lactide-co-ethylene oxide fumarate) (PLEOF) macromer was synthesized by reacting ultra-low molecular weight poly(L: -lactide) (ULMW PLA) and PEG with FuCl. The blend PLGF/PLEOF and PLAF/PLEOF macromers were self-assembled into NPs by dialysis. The NPs were characterized with respect to particle size distribution, morphology, and loading efficiency. The physical state and miscibility of Paclitaxel in NPs were characterized by differential scanning calorimetry. Tumor cell uptake and cytotoxicity of Paclitaxel loaded NPs were measured by incubation with HCT116 human colon carcinoma cells. The distribution of NPs in vivo was assessed with Apc(Min/+)mouse using infrared imaging. PLEOF macromer, due to its amphiphilic nature, acted as a surface active agent in the process of self-assembly which produced core-shell NPs with PLGF/PLAF and PLEOF macromers as the core and shell, respectively. The encapsulation efficiency ranged from 70 to 56% and it was independent of the macromer but decreased with increasing concentration of Paclitaxel. Most of the PLGF and PLAF NPs degraded in 15 and 28 days, respectively, which demonstrated that the release was dominated by hydrolytic degradation and erosion of the matrix. As the concentration of Paclitaxel was increased from 0 to 10, and 40 mug/ml, the viability of HCT116 cells incubated with free Paclitaxel decreased from 100 to 65 and 40%, respectively, while those encapsulated in PLGF/PLEOF NPs decreased from 93 to 54 and 28%. Groups with Paclitaxel loaded NPs had higher cytotoxicity compared to
NASA Astrophysics Data System (ADS)
Imaizumi, Ryota; Furuta, Masakazu; Okamura, Haruyuki; Matsumoto, Akikazu
2017-09-01
UV and γ-ray resistance of transparent polymers obtained by radical polymerization of maleic and fumaric acid derivatives, i.e., an alternating copolymer of N-methylmaleimide and isobutene (PMI) and poly(diisopropyl fumarate) (PDiPF), was investigated. Transmittance in UV and visible regions of these polymers were examined after UV irradiation and compared with the results for poly(methyl methacrylate) (PMMA) and polycarbonate (PC) as conventional transparent polymers. The order of stability toward UV irradiation was PMMA≈PDiPF>PMI>>PC, deduced from changes in the transmittance of 380 nm light. Tensile mechanical properties, such as elastic modulus, maximum strength, and elongation values of PMI, PDiPF, and PMMA were also investigated after UV and γ-radiation. UV irradiation induced the side chain scission of PMI and PDiPF via Norrish I type reaction as well as crosslinking by combination between formed polymer radicals, leading to deterioration in their optical and mechanical properties. γ-radiation induced significant changes in molecular weight and mechanical properties of the polymers. In conclusion, PMI exhibited unchanged mechanical properties and PDiPF maintained its high transparency under various irradiation conditions.
USDA-ARS?s Scientific Manuscript database
Without the addition of preservative compounds cucumbers acidified with 150 mM acetic acid with pH adjusted to 3.5 typically undergo fermentation by lactic acid bacteria. Fumaric acid (20 mM) inhibited growth of Lactobacillus plantarum and the lactic acid bacteria present on fresh cucumbers, but sp...
Cherney, David Z I; Scholey, James W; Jiang, Shan; Har, Ronnie; Lai, Vesta; Sochett, Etienne B; Reich, Heather N
2012-11-01
Diabetes is associated with renin-angiotensin system (RAS) activation, leading to renal and systemic vascular dysfunction that contribute to end-organ injury and significant morbidity. RAS blockade with ACE inhibitors reduces, but does not abolish, RAS effects. Accordingly, our aim was to determine if direct renin inhibition alone, and in combination with an ACE inhibitor, corrects early hemodynamic abnormalities associated with type 1 diabetes. Arterial stiffness (augmentation index), flow-mediated vasodilatation (FMD), and renal hemodynamic function (inulin and paraaminohippurate clearance) were measured at baseline under clamped euglycemic and hyperglycemic conditions (n = 21). Measures were repeated after 4 weeks of aliskiren therapy and again after aliskiren plus ramipril. Blood pressure-lowering effects of aliskiren were similar during clamped euglycemia and hyperglycemia. Combination therapy augmented this effect under both glycemic conditions (P = 0.0005). Aliskiren reduced arterial stiffness under clamped euglycemic and hyperglycemic conditions, and the effects were augmented by dual RAS blockade (-3.4 ± 11.2 to -8.0 ± 11.5 to -14.3 ± 8.4%, respectively, during euglycemia, P = 0.0001). During clamped euglycemia, aliskiren increased FMD; dual therapy exaggerated this effect (5.1 ± 3.3 to 7.5 ± 3.0 to 10.8 ± 3.5%, repeated-measures ANOVA, P = 0.0001). Aliskiren monotherapy caused renal vasodilatation during clamped hyperglycemia only. In contrast, dual therapy augmented renal vasodilatory effects during clamped euglycemia and hyperglycemia. In patients with uncomplicated type 1 diabetes, aliskiren-based dual RAS blockade is associated with greater arterial compliance, FMD, and renal vasodilatation.
Subasri, S; Chaudhary, Santosh Kumar; Sekar, K; Kesherwani, Manish; Velmurugan, D
2017-12-01
Fumarase catalyzes the reversible, stereospecific hydration/dehydration of fumarate to L-malate during the Kreb's cycle. In the crystal structure of the tetrameric fumarase, it was found that some of the active site residues S145, T147, N188 G364 and H235 had water-mediated hydrogen bonding interactions with pyromellitic acid and citrate which help to the protonation state for the conversion of fumarate to malate. When His 235 is mutated with Asn (H235N), water-mediated interactions were lost due to the shifting of active site water molecule by 0.7 Å away. Molecular dynamics (MD) simulations were also carried out by NAMD and analyzed using Assisted Model Building with Energy Refinement (AMBER) program to better understand the conformational stability and other aspects during the binding of pyromellitic acid and citrate with native and mutant FH. The role of hydrogen bonds and hydrophobic interactions was also analyzed. The present study confirms that the H235N mutation has a major effect on the catalytic activity of fumarase which is evident from the biochemical studies.
Food-drug interactions precipitated by fruit juices other than grapefruit juice: An update review.
Chen, Meng; Zhou, Shu-Yi; Fabriaga, Erlinda; Zhang, Pian-Hong; Zhou, Quan
2018-04-01
This review addressed drug interactions precipitated by fruit juices other than grapefruit juice based on randomized controlled trials (RCTs). Literature was identified by searching PubMed, Cochrane Library, Scopus and Web of Science till December 30 2017. Among 46 finally included RCTs, six RCTs simply addressed pharmacodynamic interactions and 33 RCTs studied pharmacokinetic interactions, whereas seven RCTs investigated both pharmacokinetic and pharmacodynamic interactions. Twenty-two juice-drug combinations showed potential clinical relevance. The beneficial combinations included orange juice-ferrous fumarate, lemon juice- 99m Tc-tetrofosmin, pomegranate juice-intravenous iron during hemodialysis, cranberry juice-triple therapy medications for H. pylori, blueberry juice-etanercept, lime juice-antimalarials, and wheat grass juice-chemotherapy. The potential adverse interactions included decreased drug bioavailability (apple juice-fexofenadine, atenolol, aliskiren; orange juice-aliskiren, atenolol, celiprolol, montelukast, fluoroquinolones, alendronate; pomelo juice-sildenafil; grape juice-cyclosporine), increased bioavailability (Seville orange juice-felodipine, pomelo juice-cyclosporine, orange-aluminum containing antacids). Unlike furanocoumarin-rich grapefruit juice which could primarily precipitate drug interactions by strong inhibition of cytochrome P450 3A4 isoenzyme and P-glycoprotein and thus cause deadly outcomes due to co-ingestion with some medications, other fruit juices did not precipitate severely detrimental food-drug interaction despite of sporadic case reports. The extent of a juice-drug interaction may be associated with volume of drinking juice, fruit varieties, type of fruit, time between juice drinking and drug intake, genetic polymorphism in the enzymes or transporters and anthropometric variables. Pharmacists and health professionals should properly screen for and educate patients about potential adverse juice-drug interactions and help
REDUCTION OF ALDOSTERONE PRODUCTION IMPROVES RENAL OXIDATIVE STRESS AND FIBROSIS IN DIABETIC RATS
Matavelli, Luis C.; Siragy, Helmy M.
2012-01-01
SUMMARY Aldosterone is increased in diabetes and contributes to the development of diabetic nephropathy. We hypothesized that reduction in aldosterone production in diabetes by amlodipine or aliskiren improves diabetic kidney disease by attenuating renal oxidative stress and fibrosis. Normoglycemic and streptozotocin-induced diabetes Sprague-Dawley rats were given vehicle, amlodipine or aliskiren individually and combined for six weeks. At the end of study, we evaluated BP, 24h urinary sodium (UNaV) and aldosterone excretion rates, renal interstitial fluid (RIF) levels of nitric oxide (NO), cGMP and 8-isoprostane, and renal morphology. BP was not significantly different between any of experimental groups. UNaV increased in diabetic animals and was not affected by different treatments. Urinary aldosterone excretion increased in diabetic rats receiving vehicle and decreased with amlodipine and aliskiren individually or combined. RIF NO and cGMP levels were reduced in vehicle treated diabetic rats and increased with amlodipine or aliskiren given individually and combined. RIF 8-isoprostane levels and renal immunostaining for PAS and fibronectin were increased in vehicle treated diabetic rats and decreased with aliskiren individually or combined with amlodipine. We conclude that inhibition of aldosterone by amlodipine or aliskiren ameliorates diabetes induced renal injury via improvement of NO-cGMP pathway, and reduction in oxidative stress and fibrosis, independent of BP changes. PMID:23011470
Direct renin inhibition modulates insulin resistance in caveolin-1-deficient mice
Chuengsamarn, Somlak; Garza, Amanda E.; Krug, Alexander W.; Romero, Jose R.; Adler, Gail K.; Williams, Gordon H.; Pojoga, Luminita H.
2012-01-01
Objective To test the hypothesis that aliskiren improves the metabolic phenotype in a genetic mouse model of the metabolic syndrome (the caveolin-1 knock out (KO) mouse). Materials/Methods Eleven-week-old cav-1 KO and genetically matched wild-type (WT) mice were randomized to three treatment groups: placebo (n = 8/group), amlodipine (6 mg/kg/day, n = 18/ group), and aliskiren (50 mg/kg/day, n = 18/ group). After three weeks of treatment, all treatment groups were assessed for several measures of insulin resistance (fasting insulin and glucose, HOMA-IR, and the response to an intraperitoneal glucose tolerance test (ipGTT)) as well as for triglyceride levels and the blood pressure response to treatment. Results Treatment with aliskiren did not affect the ipGTT response but significantly lowered the HOMA-IR and insulin levels in cav-1 KO mice. However, treatment with amlodipine significantly degraded the ipGTT response, as well as the HOMA-IR and insulin levels in the cav-1 KO mice. Aliskiren also significantly lowered triglyceride levels in the cav-1 KO but not in the WT mice. Moreover, aliskiren treatment had a significantly greater effect on blood pressure readings in the cav-1 KO vs. WT mice, and marginally more effective than amlodipine. Conclusions Our results support the hypothesis that aliskiren reduces insulin resistance as indicated by improved HOMA-IR in cav-1 KO mice whereas amlodipine treatment resulted in changes consistent with increased insulin resistance. In addition, aliskiren was substantially more effective in lowering blood pressure in the cav-1 KO mouse model than in WT mice and marginally more effective than amlodipine. PMID:22954672
Effects of delayed-release dimethyl fumarate on MRI measures in the phase 3 CONFIRM study.
Miller, David H; Fox, Robert J; Phillips, J Theodore; Hutchinson, Michael; Havrdova, Eva; Kita, Mariko; Wheeler-Kingshott, Claudia A M; Tozer, Daniel J; MacManus, David G; Yousry, Tarek A; Goodsell, Mary; Yang, Minhua; Zhang, Ray; Viglietta, Vissia; Dawson, Katherine T
2015-03-17
To evaluate the effects of oral delayed-release dimethyl fumarate (DMF; also known as gastro-resistant DMF) on MRI lesion activity and load, atrophy, and magnetization transfer ratio (MTR) measures from the Comparator and an Oral Fumarate in Relapsing-Remitting Multiple Sclerosis (CONFIRM) study. CONFIRM was a 2-year, placebo-controlled study of the efficacy and safety of DMF 240 mg twice (BID) or 3 times daily (TID) in 1,417 patients with relapsing-remitting multiple sclerosis (RRMS); subcutaneous glatiramer acetate 20 mg once daily was included as an active reference comparator. The number and volume of T2-hyperintense, T1-hypointense, and gadolinium-enhancing (Gd+) lesions, as well as whole brain volume and MTR, were assessed in 681 patients (MRI cohort). DMF BID and TID produced significant and consistent reductions vs placebo in the number of new or enlarging T2-hyperintense lesions and new nonenhancing T1-hypointense lesions after 1 and 2 years of treatment and in the number of Gd+ lesions at week 24, year 1, and year 2. Lesion volumes were also significantly reduced. Reductions in brain atrophy and MTR changes with DMF relative to placebo did not reach statistical significance. The robust effects on MRI active lesion counts and total lesion volume in patients with RRMS demonstrate the ability of DMF to exert beneficial effects on inflammatory lesion activity in multiple sclerosis, and support DMF therapy as a valuable new treatment option in RRMS. This study provides Class I evidence of reduction in brain lesion number and volume, as assessed by MRI, over 2 years of delayed-release DMF treatment. © 2015 American Academy of Neurology.
Iuchi, S; Lin, E C
1987-01-01
In Escherichia coli the presence of nitrate prevents the utilization of fumarate as an anaerobic electron acceptor. The induction of the narC operon encoding the nitrate reductase is coupled to the repression of the frd operon encoding the fumarate reductase. This coupling is mediated by nitrate as an effector and the narL product as the regulatory protein (S. Iuchi and E. C. C. Lin, Proc. Natl. Acad. Sci. USA 84:3901-3905, 1987). The protein-ligand complex appears to control narC positively but frd negatively. In the present study we found that a molybdenum coeffector acted synergistically with nitrate in the regulation of frd and narC. In chlD mutants believed to be impaired in molybdate transport (or processing), full repression of phi(frd-lac) and full induction of phi(narC-lac) by nitrate did not occur unless the growth medium was directly supplemented with molybdate (1 microM). This requirement was not clearly manifested in wild-type cells, apparently because it was met by the trace quantities of molybdate present as a contaminant in the mineral medium. In chlB mutants, which are known to accumulate the Mo cofactor because of its failure to be inserted as a prosthetic group into proteins such as nitrate reductase, nitrate repression of frd and induction of narC were also intensified by molybdate supplementation. In this case a deficiency of the molybdenum coeffector might have resulted from enhanced feedback inhibition of molybdate transport (or processing) by the elevated level of the unutilized Mo cofactor. In addition, mutations in chlE, which are known to block the synthesis of the organic moiety of the Mo cofactor, lowered the threshold concentration of nitrate (< 1 micromole) necessary for frd repression and narC induction. These changes could be explained simply by the higher intracellular nitrate attainable in cells lacking the ability to destroy the effector. PMID:3301812
Development of Room Temperature Stable Formulation of Formoterol Fumarate/Beclomethasone HFA pMDI
Purohit, D.; Trehan, A.; Arora, V.
2009-01-01
The primary aim of present investigation was to develop and formulate room temperature stable formulation of formoterol fumarate and beclomethasone dipropionate with extra fine part size of hydrofluoroalkane pressurized metered dose inhalers. Particle size distribution of hydrofluoroalkane pressurized metered dose inhalers was evaluated using Twin Stage Glass Impinger and Anderson Cascade Impactor. A tetrafluoroethane and/or heptafluoropropane were evaluated for preparation of hydrofluoroalkane pressurized metered dose inhalers. The fine particle fractions delivered from hydrofluoroalkane propellant suspension pressurized metered dose inhalers can be predicted on the basis of formulation parameters and is dependent of metering chamber of valve and orifice size of actuators. The results presented in investigation showed the importance of formulation excipients with formulation of pressurized metered dose inhalers viz, canister, valve and actuators used in formulations.
Ashrafian, Houman; O'Flaherty, Linda; Adam, Julie; Steeples, Violetta; Chung, Yuen-Li; East, Phil; Vanharanta, Sakari; Lehtonen, Heli; Nye, Emma; Hatipoglu, Emine; Miranda, Melroy; Howarth, Kimberley; Shukla, Deepa; Troy, Helen; Griffiths, John; Spencer-Dene, Bradley; Yusuf, Mohammed; Volpi, Emanuela; Maxwell, Patrick H; Stamp, Gordon; Poulsom, Richard; Pugh, Christopher W; Costa, Barbara; Bardella, Chiara; Di Renzo, Maria Flavia; Kotlikoff, Michael I; Launonen, Virpi; Aaltonen, Lauri; El-Bahrawy, Mona; Tomlinson, Ian; Pollard, Patrick J
2010-11-15
Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is caused by mutations in the Krebs cycle enzyme fumarate hydratase (FH). It has been proposed that "pseudohypoxic" stabilization of hypoxia-inducible factor-α (HIF-α) by fumarate accumulation contributes to tumorigenesis in HLRCC. We hypothesized that an additional direct consequence of FH deficiency is the establishment of a biosynthetic milieu. To investigate this hypothesis, we isolated primary mouse embryonic fibroblast (MEF) lines from Fh1-deficient mice. As predicted, these MEFs upregulated Hif-1α and HIF target genes directly as a result of FH deficiency. In addition, detailed metabolic assessment of these MEFs confirmed their dependence on glycolysis, and an elevated rate of lactate efflux, associated with the upregulation of glycolytic enzymes known to be associated with tumorigenesis. Correspondingly, Fh1-deficient benign murine renal cysts and an advanced human HLRCC-related renal cell carcinoma manifested a prominent and progressive increase in the expression of HIF-α target genes and in genes known to be relevant to tumorigenesis and metastasis. In accord with our hypothesis, in a variety of different FH-deficient tissues, including a novel murine model of Fh1-deficient smooth muscle, we show a striking and progressive upregulation of a tumorigenic metabolic profile, as manifested by increased PKM2 and LDHA protein. Based on the models assessed herein, we infer that that FH deficiency compels cells to adopt an early, reversible, and progressive protumorigenic metabolic milieu that is reminiscent of that driving the Warburg effect. Targets identified in these novel and diverse FH-deficient models represent excellent potential candidates for further mechanistic investigation and therapeutic metabolic manipulation in tumors. Copyright © 2010 AACR.
Dimethyl fumarate contact dermatitis of the foot: an increasingly widespread disease.
D'Erme, Angelo Massimiliano; Bassi, Andrea; Lotti, Torello; Gola, Massimo
2012-01-01
Dimethyl fumarate (DMF) has been recognized as an extremely potent irritant and sensitizer found in sachets inside furniture. The first skin manifestations were correlated to contact with sofas, chairs, and other furniture. In these last years, some papers have reported a development of allergic contact dermatitis on the foot caused by DMF present in high concentration in shoes made in China. We report the case of a 37-year-old woman who presented with severe eczema on the foot shortly after having bought a new pair of shoes. The diagnosis was performed by patch tests with DMF in several dilutions, with pieces of internal and external parts of the shoes, and by chemical analysis of the shoes. In the last three years, goods containing DMF increased diffusely despite the augmentation on global preventive measures by Europe. Therefore, new cases of contact dermatitis could be dependent on DMF, and it is of note that this allergen is not included in most series for patch testing. © 2011 The International Society of Dermatology.
Te Riet, Luuk; van Deel, Elza D; van Thiel, Bibi S; Moltzer, Els; van Vliet, Nicole; Ridwan, Yanto; van Veghel, Richard; van Heijningen, Paula M; Robertus, Jan Lukas; Garrelds, Ingrid M; Vermeij, Marcel; van der Pluijm, Ingrid; Danser, A H Jan; Essers, Jeroen
2016-04-01
Increasing evidence supports a role for the angiotensin II-AT1-receptor axis in aneurysm development. Here, we studied whether counteracting this axis via stimulation of AT2 receptors is beneficial. Such stimulation occurs naturally during AT1-receptor blockade with losartan, but not during renin inhibition with aliskiren. Aneurysmal homozygous fibulin-4 mice, displaying a four-fold reduced fibulin-4 expression, were treated with placebo, losartan, aliskiren, or the β-blocker propranolol from day 35 to 100. Their phenotype includes cystic media degeneration, aortic regurgitation, left ventricular dilation, reduced ejection fraction, and fractional shortening. Although losartan and aliskiren reduced hemodynamic stress and increased renin similarly, only losartan increased survival. Propranolol had no effect. No drug rescued elastic fiber fragmentation in established aneurysms, although losartan did reduce aneurysm size. Losartan also increased ejection fraction, decreased LV diameter, and reduced cardiac pSmad2 signaling. None of these effects were seen with aliskiren or propranolol. Longitudinal micro-CT measurements, a novel method in which each mouse serves as its own control, revealed that losartan reduced LV growth more than aneurysm growth, presumably because the heart profits both from the local (cardiac) effects of losartan and its effects on aortic root remodeling. Losartan, but not aliskiren or propranolol, improved survival in fibulin-4 mice. This most likely relates to its capacity to improve structure and function of both aorta and heart. The absence of this effect during aliskiren treatment, despite a similar degree of blood pressure reduction and renin-angiotensin system blockade, suggests that it might be because of AT2-receptor stimulation.
Gateways to clinical trials. July-August 2008.
Tomillero, A; Moral, M A
2008-01-01
(-)-Epigallocatechin gallate, 501516, 89-12; Abatacept, Adalimumab, Adefovir dipivoxil, AG-701, Agatolimod sodium, Alefacept, Aliskiren fumarate, Apixaban, Atazanavir sulfate, Atrasentan, Axitinib; BI-1744-CL, BIBF-1120, BIBW-2992, Bortezomib; Carboxyamidotriazole, Caspofungin acetate, CBP-501, Cediranib, Ceftobiprole, Certolizumab pegol, Cetuximab, Cholesteryl hydrophobized polysaccharide-Her2 protein complex, CHP-NY-ESO-1, Cypher; Dalbavancin, Dalcetrapib, Daptomycin, Darapladib, Deferasirox, Deforolimus, Denosumab, DNA-HIV-C, Dovitinib, DR-5001, Dronedarone hydrochloride, DT388IL3; E75, EC-17/EC-90, Ecogramostim, Efungumab, Entecavir, EP HIV-1090, EP-2101, Everolimus, Ezetimibe, Ezetimibe/simvastatin; Faropenem daloxate, Fluticasone furoate, Fondaparinux sodium, Fospropofol disodium, Fulvestrant; Golimumab, GSK-089, GW-590735; HO/03/03, hTERT572, hTERT572Y; Iloperidone; Immunoglobulin intravenous (human), Ispinesib mesylate, Istradefylline, Ixabepilone; JR-031, JX-594; KLH; Laropiprant, Lecozotan hydrochloride, Lenalidomide, Lestaurtinib, Linezolid; MGCD-0103, MK-0646, MVA-BN Measles; NI-0401, Niacin/laropiprant, NSC-719239, NYVAC-C; Ospemifene; Paliperidone palmitate, PAN-811, PCV7, Pegfilgrastim, Peginterferon alfa-2a, PEGirinotecan, Perifosine, Pertuzumab, PF-00299804, Picoplatin, Pimavanserin tartrate, Pitavastatin calcium, Pomalidomide, Prasterone, Pratosartan, Prucalopride, PSMA27/pDOM, Pyridoxal phosphate; QS-21, Quercetin; Rebimastat, Rimonabant, Rolofylline, Romidepsin, Rosuvastatin calcium, RTS,S/SBAS2; SCH-530348, SN-29244, Soblidotin, Sodium dichloroacetate, Solifenacin succinate, Sorafenib, Spheramine, SU-6668, Succinobucol; Taranabant, Taxus, Telaprevir, Telavancin hydrochloride, Telbivudine, Tenofovir disoproxil fumarate, Tigecycline, Tiotropium bromide, Tocilizumab, Triphendiol; UC-781, Udenafil, UNIL-025; V-5 Immunitor, Valsartan/amlodipine besylate, Varenicline tartrate, Velafermin, Vernakalant hydrochloride, Vinflunine, Vitespen, Vorinostat
A Role for Cytosolic Fumarate Hydratase in Urea Cycle Metabolism and Renal Neoplasia
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O’Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A.; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J.; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J.
2013-01-01
Summary The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. PMID:23643539
New FDA-Approved Disease-Modifying Therapies for Multiple Sclerosis.
English, Clayton; Aloi, Joseph J
2015-04-01
Interferon injectables and glatiramer acetate have served as the primary disease-modifying treatments for multiple sclerosis (MS) since their introduction in the 1990s and are first-line treatments for relapsing-remitting forms of MS (RRMS). Many new drug therapies were launched since early 2010, expanding the drug treatment options considerably in a disease state that once had a limited treatment portfolio. The purpose of this review is to critically evaluate the safety profile and efficacy data of disease-modifying agents for MS approved by the US Food and Drug Administration (FDA) from 2010 to the present and provide cost and available pharmacoeconomic data about each new treatment. Peer-reviewed clinical trials, pharmacoeconomic studies, and relevant pharmacokinetic/pharmacologic studies were identified from MEDLINE (January 2000-December 2014) by using the search terms multiple sclerosis, fingolimod, teriflunomide, alemtuzumab, dimethyl fumarate, pegylated interferon, peginterferon beta-1a, glatiramer 3 times weekly, and pharmacoeconomics. Citations from available articles were also reviewed for additional references. The databases publically available at www.clinicaltrials.gov and www.fda.gov were searched for unpublished studies or studies currently in progress. A total of 5 new agents and 1 new dosage formulation were approved by the FDA for the treatment of RRMS since 2010. Peginterferon beta-1a and high-dose glatiramer acetate represent 2 new effective injectable options for MS that reduce burden of administration seen with traditional interferon and low-dose glatiramer acetate. Fingolimod, teriflunomide, and dimethyl fumarate represent new oral agents available for MS, and their efficacy in reducing annualized relapse rates is 48% to 55%, 22% to 36.3%, and 44% to 53%, respectively, compared with placebo. Alemtuzumab is a biologic given over a 2-year span that reduced annualized relapse rates by 55% in treatment-naive patients and by 49% in patients
USDA-ARS?s Scientific Manuscript database
Background: Tenofovir disoproxil fumarate (TDF) decreases bone mineral density (BMD). We hypothesized vitamin D3 (VITD3) would increase BMD in adolescents/young adults receiving TDF. Methods: Randomized double-blind placebo-controlled trial of directly observed VITD3 50,000 IU vs. placebo every 4 ...
A role for cytosolic fumarate hydratase in urea cycle metabolism and renal neoplasia.
Adam, Julie; Yang, Ming; Bauerschmidt, Christina; Kitagawa, Mitsuhiro; O'Flaherty, Linda; Maheswaran, Pratheesh; Özkan, Gizem; Sahgal, Natasha; Baban, Dilair; Kato, Keiko; Saito, Kaori; Iino, Keiko; Igarashi, Kaori; Stratford, Michael; Pugh, Christopher; Tennant, Daniel A; Ludwig, Christian; Davies, Benjamin; Ratcliffe, Peter J; El-Bahrawy, Mona; Ashrafian, Houman; Soga, Tomoyoshi; Pollard, Patrick J
2013-05-30
The identification of mutated metabolic enzymes in hereditary cancer syndromes has established a direct link between metabolic dysregulation and cancer. Mutations in the Krebs cycle enzyme, fumarate hydratase (FH), predispose affected individuals to leiomyomas, renal cysts, and cancers, though the respective pathogenic roles of mitochondrial and cytosolic FH isoforms remain undefined. On the basis of comprehensive metabolomic analyses, we demonstrate that FH1-deficient cells and tissues exhibit defects in the urea cycle/arginine metabolism. Remarkably, transgenic re-expression of cytosolic FH ameliorated both renal cyst development and urea cycle defects associated with renal-specific FH1 deletion in mice. Furthermore, acute arginine depletion significantly reduced the viability of FH1-deficient cells in comparison to controls. Our findings highlight the importance of extramitochondrial metabolic pathways in FH-associated oncogenesis and the urea cycle/arginine metabolism as a potential therapeutic target. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Wong, Keith S; Bhandari, Vaibhav; Janga, Sarath Chandra; Houry, Walid A
2017-01-20
Regulatory ATPase variant A (RavA) is a MoxR AAA+ protein that functions together with a partner protein that we termed VWA interacting with AAA+ ATPase (ViaA) containing a von Willebrand Factor A domain. However, the functional role of RavA-ViaA in the cell is not yet well established. Here, we show that RavA-ViaA are functionally associated with anaerobic respiration in Escherichia coli through interactions with the fumarate reductase (Frd) electron transport complex. Expression analysis of ravA and viaA genes showed that both proteins are co-expressed with multiple anaerobic respiratory genes, many of which are regulated by the anaerobic transcriptional regulator Fnr. Consistently, the expression of both ravA and viaA was found to be dependent on Fnr in cells grown under oxygen-limiting condition. ViaA was found to physically interact with FrdA, the flavin-containing subunit of the Frd complex. Both RavA and the Fe-S-containing subunit of the Frd complex, FrdB, regulate this interaction. Importantly, Frd activity was observed to increase in the absence of RavA and ViaA. This indicates that RavA and ViaA modulate the activity of the Frd complex, signifying a potential regulatory chaperone-like function for RavA-ViaA during bacterial anaerobic respiration with fumarate as the terminal electron acceptor. Copyright © 2016 Elsevier Ltd. All rights reserved.
Blood pressure lowering efficacy of renin inhibitors for primary hypertension.
Musini, Vijaya M; Lawrence, Kendra Ak; Fortin, Patricia M; Bassett, Ken; Wright, James M
2017-04-05
CSRs are not available.Two review authors independently assessed study eligibility and extracted data. In all cases where there was a difference between the CSR and the published report, data from the CSR was used. Dichotomous outcomes were reported as risk ratio (RR) with 95% confidence intervals (CIs) and continuous outcomes as mean difference (MD) with 95% CIs. 12 studies (mean duration of eight weeks) in 7439 mostly Caucasian patients (mean age 54 years) with mild-to-moderate uncomplicated hypertension were eligible for inclusion in the review. Aliskiren was the only renin inhibitor evaluated. All included studies were assessed to have high likelihood of attrition, reporting and funding bias.Aliskiren has a dose-related systolic/diastolic blood pressure (SBP/DBP) lowering effect as compared with placebo MD with 95% CI: aliskiren 75 mg (MD -2.97, 95% CI -4.76 to -1.18)/(MD -2.05, 95% CI -3.13 to -0.96) mm Hg (moderate-quality evidence), aliskiren 150 mg (MD -5.95, 95% CI -6.85 to -5.06)/ (MD -3.16, 95% CI -3.74 to -2.58) mm Hg (moderate-quality evidence), aliskiren 300 mg (MD -7.88, 95% CI -8.94 to -6.82)/ (MD -4.49, 95% CI -5.17 to -3.82) mm Hg (moderate-quality evidence), aliskiren 600 mg (MD -11.35, 95% CI -14.43 to -8.27)/ (MD -5.86, 95% CI -7.73 to -3.99) mm Hg (low-quality evidence). There was a dose-dependent decrease in blood pressure for aliskiren 75 mg, 150 mg and 300 mg. The blood pressure lowering effect of aliskiren 600 mg was not different from 300 mg (MD -0.61, 95% CI -2.78 to 1.56)/(MD -0.68, 95% CI -2.03 to 0.67). Aliskiren had no effect on blood pressure variability. Due to very limited information available regarding change in heart rate and pulse pressure, it was not possible to meta-analyze these outcomes.Mortality and non-fatal serious adverse events were not increased. This review found that in studies of eight week duration aliskiren may not increase withdrawal due to adverse events (low-quality evidence). Diarrhoea was increased in a dose
Nestorov, Ivan; Zhao, Guolin; Meka, Venkata; Leahy, Mark; Kam, Jeanelle; Sheikh, Sarah I.
2017-01-01
Abstract Delayed‐release dimethyl fumarate (DMF) is an oral therapy for relapsing multiple sclerosis with anti‐inflammatory and neuroprotective properties. This 2‐period crossover study was conducted to evaluate the potential for drug–drug interaction between DMF (240 mg twice daily) and a combined oral contraceptive (OC; norgestimate 250 μg, ethinyl estradiol 35 μg). Forty‐six healthy women were enrolled; 32 completed the study. After the lead‐in period (OC alone), 41 eligible participants were randomized 1:1 to sequence 1 (OC and DMF coadministration in period 1; OC alone in period 2) or sequence 2 (regimens reversed). Mean concentration profiles of plasma norelgestromin (primary metabolite of norgestimate) and ethinyl estradiol were superimposable following OC alone and OC coadministered with DMF, with 90% confidence intervals of geometric mean ratios for area under the plasma concentration–time curve over the dosing interval and peak plasma concentration contained within the 0.8–1.25 range. Low serum progesterone levels during combined treatment confirmed suppression of ovulation. The pharmacokinetics of DMF (measured via its primary active metabolite, monomethyl fumarate) were consistent with historical data when DMF was administered alone. No new safety concerns were identified. These results suggest that norgestimate/ethinyl estradiol–based OCs may be used with DMF without dose modification. PMID:28783872
Fox, Julie; Brady, Michael; Alexander, Hannah; Davies, Olubanke; Robinson, Nicola; Pace, Mathew; Else, Laura; Cason, John; Khoo, Saye; Back, David; Fidler, Sarah; Frater, John
2016-03-01
The use of antiretrovirals as pre-exposure prophylaxis (PrEP) is highly efficacious in HIV prevention. The World Health Organization recently recommended Truvada(®) (Gilead Sciences, Inc.) or tenofovir disoproxil fumarate (TDF) for high-risk individuals, with limited data for single-agent TDF PrEP in men who have sex with men (MSM). We report two cases of TDF PrEP failure in MSM who had received long-term TDF for hepatitis B infection and had therapeutic levels of drug immediately after HIV acquisition. Rapid antiretroviral intensification at diagnosis of acute HIV infection failed to limit immune dysfunction or prevent the establishment of a viral reservoir.
... and other problems. In addition to taking medication, making lifestyle changes will also help to control your ... This branded product is no longer on the market. Generic alternatives may be available.
Zecca, C; Antozzi, C G; Torri Clerici, V; Ferrazzini, M; Mantegazza, R E; Rossi, S; Gobbi, C
2018-06-01
Delayed-release dimethyl fumarate (DMF) treatment can be associated with reduced lymphocyte and leucocyte counts, which might persist after DMF discontinuation. We report the case of a patient with severe disease reactivation despite prolonged lymphopenia after DMF discontinuation. We describe the frequency and impact of prolonged lymphopenia after DMF discontinuation at two tertiary MS centres. A 36-year-old female patient with multiple sclerosis was switched to DMF after 14 years of treatment with interferon beta-1a. DMF was suspended after 4 months because of persistent lymphopenia for 3 months. Six months later, the patient had a severe relapse with multiple enhancing brain lesions at MRI although lymphopenia was still persistent. Haematological assessment excluded other causes of lymphopenia, which was evaluated as a probable iatrogenic complication of DMF. The patient was treated with i.v. methylprednisolone 1 gr daily for 3 days with clinical recovery. Prolonged lymphopenia after DMT discontinuation does not protect against disease reactivation. Starting a new immune therapy should be balanced against the option of a "wait and see." A different immunotherapeutic strategy such as an anti-B therapeutic approach could be considered. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Frag, Eman Y Z; Mohamed, Gehad G; Khalil, Mohamed M; Hwehy, Mohammad M A
2011-01-01
This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10(-7) to 10(-2) mol L(-1). The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade(-1) for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0-6.0 and 2.0-7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method.
Frag, Eman Y. Z.; Mohamed, Gehad G.; Khalil, Mohamed M.; Hwehy, Mohammad M. A.
2011-01-01
This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10−7 to 10−2 mol L−1. The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade−1 for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0–6.0 and 2.0–7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method. PMID:22013443
Lee, Kee-Won; Wang, Shanfeng; Yaszemski, Michael J.; Lu, Lichun
2008-01-01
A series of crosslinkable nanocomposites has been developed using hydroxyapatite (HA) nanoparticles and poly(propylene fumarate) (PPF). PPF/HA nanocomposites with four different weight fractions of HA nanoparticles have been characterized in terms of thermal and mechanical properties. To assess surface chemistry of crosslinked PPF/HA nanocomposites, their hydrophilicity and capability of adsorbing proteins have been determined using static contact angle measurement and MicroBCA protein assay kit after incubation with 10% fetal bovine serum (FBS), respectively. In vitro cell studies have been performed using MC3T3-E1 mouse pre-osteoblast cells to investigate the ability of PPF/HA nanocomposites to support cell attachment, spreading, and proliferation after 1, 4, and 7 days. By adding HA nanoparticles to PPF, the mechanical properties of crosslinked PPF/HA nanocomposites have not been increased due to the initially high modulus of crosslinked PPF. However, hydrophilicity and serum protein adsorption on the surface of nanocomposites have been significantly increased, resulting in enhanced cell attachment, spreading, and proliferation after 4 days of cell seeding. These results indicate that crosslinkable PPF/HA nanocomposites are useful for hard tissue replacement because of excellent mechanical strength and osteoconductivity. PMID:18403013
Comes, Justin E; Beelman, Robert B
2002-03-01
A study was conducted to develop a preservative treatment capable of the Food and Drug Administration-mandated 5-log reduction of Escherichia coli O157:H7 populations in apple cider. Unpreserved apple cider was treated with generally recognized as safe acidulants and preservatives before inoculation with E. coli O157:H7 in test tubes and subjected to mild heat treatments (25, 35, and 45 degrees C) followed by refrigerated storage (4 degrees C). Fumaric acid had significant (P < 0.05) bactericidal effect when added to cider at 0.10% (wt/vol) and adjusted to pH 3.3, but citric and malic acid had no effect. Strong linear correlation (R2 = 0.96) between increasing undissociated fumaric acid concentrations and increasing log reductions of E. coli O157:H7 in apple cider indicated the undissociated acid to be the bactericidal form. The treatment that achieved the 5-log reduction in three commercial ciders was the addition of fumaric acid (0.15%, wt/vol) and sodium benzoate (0.05%, wt/vol) followed by holding at 25 degrees C for 6 h before 24 h of refrigeration at 4 degrees C. Subsequent experiments revealed that the same preservatives added to cider in flasks resulted in a more than 5-log reduction in less than 5 and 2 h when held at 25 and 35 degrees C, respectively. The treatment also significantly (P < 0.05) reduced total aerobic counts in commercial ciders to populations less than those of pasteurized and raw ciders from the same source (after 5 and 21 days of refrigerated storage at 4 degrees C, respectively). Sensory evaluation of the same ciders revealed that consumers found the preservative-treated cider to be acceptable.
Hill, Andrew; Hughes, Sophie L; Gotham, Dzintars; Pozniak, Anton L
2018-04-01
Higher plasma tenofovir concentrations are associated with higher risks of renal and bone adverse events. The pharmacokinetic boosters ritonavir (RTV) and cobicistat (COBI) significantly increase plasma area under the curve (AUC) concentrations of tenofovir disoproxil fumarate (TDF), by 25-37%. When combined with RTV or COBI, the dose of tenofovir alafenamide (TAF) is lowered from 25 mg to 10 mg daily, but the TDF dose is maintained at 300 mg daily. To assess the differences in safety and efficacy between tenofovir alafenamide (TAF) and tenofovir disoproxil fumarate (TDF) in regimens with and without the pharmacokinetic boosters RTV and COBI. A PubMed/Embase search inclusive of dates up to 17 July 2017 identified 11 randomised head-to-head trials (8111 patients) of TDF versus TAF. The Mantel-Haenszel method was used to calculate pooled risk differences and 95% confidence intervals using random-effects models. A pre-defined sub-group analysis compared TAF with TDF, either when boosted with RTV or COBI, or when unboosted. Nine clinical trials compared TAF and TDF for treatment of HIV-1 and two were for hepatitis B treatment. The eleven clinical trials documented 4574 patients with boosting RTV or COBI in both arms, covering 7198 patient-years of follow-up. Some 3537 patients received unboosted regimens, totalling 3595 patient-years of follow-up. Boosted TDF-treated patients showed borderline lower HIV RNA suppression <50 copies/mL ( P =0.05), more bone fractures ( P =0.04), larger decreases in bone mineral density ( P <0.001), and more discontinuations for bone ( P =0.03) or renal ( P =0.002) adverse events. By contrast, there were no significant differences in HIV RNA suppression rates or clinical safety endpoints between unboosted TAF and unboosted TDF. TDF boosted with RTV or COBI was associated with higher risks of bone and renal adverse events, and lower HIV RNA suppression rates, compared with TAF. By contrast, when ritonavir and cobicistat were not used
Rationale and efficacy of CD52 targeting in HTLV-1-associated myositis.
Cochereau, Delphine; Georgin-Lavialle, Sophie; Maisonobe, Thierry; Dubourg, Odile; Melboucy-Belkhir, Sara; Hermine, Olivier; Aouba, Achille
2014-07-01
We retrospectively analysed two selected patients, referred to our Haematology Department for refractory HTLV-1 associated myositis with circulating pathologic T-cell population with ATL phenotype. They respectively presented also HTLV-1 associated Crohn-like disease and myelopathy. Muscle biopsy of both patients was analysed to determine the pathologic infiltrate. Alemtuzumab was proposed as salvage therapy. Targeting CD52 with alemtuzumab showed good efficacy on myopathy of both patients for respectively 11 and 10 months. Interestingly, this treatment showed also efficacy on circulating pathologic T-cell population and on concomitant digestive and neurological diseases. The double infected cells ablation and immunosuppressive propriety of alemtuzumab probably explains its interest in this infectious and dysimmunitary disorder. Even though alemtuzumab probably remains a suspensive treatment, its place should be assessed in controlled trial in this difficult to treat rare disease. Copyright © 2014 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.
Bénit, Paule; Letouzé, Eric; Rak, Malgorzata; Aubry, Laetitia; Burnichon, Nelly; Favier, Judith; Gimenez-Roqueplo, Anne-Paule; Rustin, Pierre
2014-08-01
Seventy years from the formalization of the Krebs cycle as the central metabolic turntable sustaining the cell respiratory process, key functions of several of its intermediates, especially succinate and fumarate, have been recently uncovered. The presumably immutable organization of the cycle has been challenged by a number of observations, and the variable subcellular location of a number of its constitutive protein components is now well recognized, although yet unexplained. Nonetheless, the most striking observations have been made in the recent period while investigating human diseases, especially a set of specific cancers, revealing the crucial role of Krebs cycle intermediates as factors affecting genes methylation and thus cell remodeling. We review here the recent advances and persisting incognita about the role of Krebs cycle acids in diverse aspects of cellular life and human pathology. Copyright © 2014 Elsevier B.V. All rights reserved.
Wagner, Eric R; Bravo, Dalibel; Dadsetan, Mahrokh; Riester, Scott M; Chase, Steven; Westendorf, Jennifer J; Dietz, Allan B; van Wijnen, Andre J; Yaszemski, Michael J; Kakar, Sanjeev
2015-11-01
Surgical reconstruction of intra-articular ligament injuries is hampered by the poor regenerative potential of the tissue. We hypothesized that a novel composite polymer "neoligament" seeded with progenitor cells and growth factors would be effective in regenerating native ligamentous tissue. We synthesized a fumarate-derivative of polycaprolactone fumarate (PCLF) to create macro-porous scaffolds to allow cell-cell communication and nutrient flow. Clinical grade human adipose tissue-derived human mesenchymal stem cells (AMSCs) were cultured in 5% human platelet lysate (PL) and seeded on scaffolds using a dynamic bioreactor. Cell growth, viability, and differentiation were examined using metabolic assays and immunostaining for ligament-related markers (e.g., glycosaminoglycans [GAGs], alkaline phosphatase [ALP], collagens, and tenascin-C). AMSCs seeded on three-dimensional (3D) PCLF scaffolds remain viable for at least 2 weeks with proliferating cells filling the pores. AMSC proliferation rates increased in PL compared to fetal bovine serum (FBS) (p < 0.05). Cells had a low baseline expression of ALP and GAG, but increased expression of total collagen when induced by the ligament and tenogenic growth factor fibroblast growth factor 2 (FGF-2), especially when cultured in the presence of PL (p < 0.01) instead of FBS (p < 0.05). FGF-2 and PL also significantly increased immunostaining of tenascin-C and collagen at 2 and 4 weeks compared with human fibroblasts. Our results demonstrate that AMSCs proliferate and eventually produce a collagen-rich extracellular matrix on porous PCLF scaffolds. This novel scaffold has potential in stem cell engineering and ligament regeneration.
Wagner, Eric R.; Bravo, Dalibel; Dadsetan, Mahrokh; Riester, Scott M.; Chase, Steven; Westendorf, Jennifer J.; Dietz, Allan B.; van Wijnen, Andre J.; Yaszemski, Michael J.
2015-01-01
Purpose: Surgical reconstruction of intra-articular ligament injuries is hampered by the poor regenerative potential of the tissue. We hypothesized that a novel composite polymer “neoligament” seeded with progenitor cells and growth factors would be effective in regenerating native ligamentous tissue. Methods: We synthesized a fumarate-derivative of polycaprolactone fumarate (PCLF) to create macro-porous scaffolds to allow cell–cell communication and nutrient flow. Clinical grade human adipose tissue-derived human mesenchymal stem cells (AMSCs) were cultured in 5% human platelet lysate (PL) and seeded on scaffolds using a dynamic bioreactor. Cell growth, viability, and differentiation were examined using metabolic assays and immunostaining for ligament-related markers (e.g., glycosaminoglycans [GAGs], alkaline phosphatase [ALP], collagens, and tenascin-C). Results: AMSCs seeded on three-dimensional (3D) PCLF scaffolds remain viable for at least 2 weeks with proliferating cells filling the pores. AMSC proliferation rates increased in PL compared to fetal bovine serum (FBS) (p < 0.05). Cells had a low baseline expression of ALP and GAG, but increased expression of total collagen when induced by the ligament and tenogenic growth factor fibroblast growth factor 2 (FGF-2), especially when cultured in the presence of PL (p < 0.01) instead of FBS (p < 0.05). FGF-2 and PL also significantly increased immunostaining of tenascin-C and collagen at 2 and 4 weeks compared with human fibroblasts. Summary: Our results demonstrate that AMSCs proliferate and eventually produce a collagen-rich extracellular matrix on porous PCLF scaffolds. This novel scaffold has potential in stem cell engineering and ligament regeneration. PMID:26413793
Bin-Dayel, Anfal Fahad; Abdel Baky, Nayira A; Fadda, L M; Mohammad, Raeesa A; Al-Mohanna, Futwan
2016-02-01
The critical role of CaMKIIδ isoforms in cardiac hypertrophy is well documented. This study was aimed to investigate the possible inhibitory effects of aliskiren (ALS) and/or carvedilol (CAV) on CaMKIIδ isoforms expression in experimental cardiac hypertrophy. Male Wistar albino rats were subcutaneously injected with isoproterenol (ISO) (5 mg/kg/day) for 4 weeks to induce cardiac hypertrophy. Hypertrophied rats were daily treated with either ALS (10 mg/kg) and/or CAV (10 mg/kg). At the end of the treatment, rats were killed; blood and hearts were collected for assessing different biochemical parameters. ISO treatment significantly increased heart weight to body weight (HW/BW) ratio, serum creatine kinase MB (CK-MB) and troponin T (Tn-T) levels, and plasma renin activity (PRA) as compared to control rats. Additionally, ISO treatment produced a significant increase in the expression of myocardial CaMKIIδ2 and CaMKIIδ3 that were associated with significant elevation in myocardial caspase-3 protein expression. Histopathological examination of rats exposed to ISO treatment showed severe myocardial cell degeneration. ALS and/or CAV treatment significantly reduced the altered HW/BW ratio, serum CK-MB and Tn-T levels, PRA, and caspase-3 protein expression in hypertrophied rats, with maximal improvement in the combination group. These biochemical findings were supported by the histopathological examination of the heart tissue. Additionally, treatment with ALS and CAV significantly inhibited ISO-induced increase in CaMKIIδ2 and CaMKIIδ3 expression levels. The present study indicated that ALS and CAV treatment ameliorated ISO-induced hypertrophy via inhibiting the expression and the activity of CaMKIIδ isoforms and the associated myocardial apoptosis.
Established and novel disease-modifying treatments in multiple sclerosis.
Cross, A H; Naismith, R T
2014-04-01
Multiple sclerosis (MS) is a presumed autoimmune disorder of the central nervous system, resulting in inflammatory demyelination and axonal and neuronal injury. New diagnostic criteria that incorporate magnetic resonance imaging have resulted in earlier and more accurate diagnosis of MS. Several immunomodulatory and immunosuppressive therapeutic agents are available for relapsing forms of MS, which allow individualized treatment based upon the benefits and risks. Disease-modifying therapies introduced in the 1990s, the beta-interferons and glatiramer acetate, have an established track record of efficacy and safety, although they require administration via injection. More recently, monoclonal antibodies have been engineered to act through specific mechanisms such as blocking alpha-4 integrin interactions (natalizumab) or lysing cells bearing specific markers, for example CD52 (alemtuzumab) or CD20 (ocrelizumab and ofatumumab). These agents can be highly efficacious, but sometimes have serious potential complications (natalizumab is associated with progressive multifocal leukoencephalopathy; alemtuzumab is associated with the development of new autoimmune disorders). Three new oral therapies (fingolimod, teriflunomide and dimethyl fumarate, approved for MS treatment from 2010 onwards) provide efficacy, tolerability and convenience; however, as yet, there are no long-term postmarketing efficacy and safety data in a general MS population. Because of this lack of long-term data, in some cases, therapy is currently initiated with the older, safer injectable medications, but patients are monitored closely with the plan to switch therapies if there is any indication of a suboptimal response or intolerance or lack of adherence to the initial therapy. For patients with MS who present with highly inflammatory and potentially aggressive disease, the benefit-to-risk ratio may support initiating therapy using a drug with greater potential efficacy despite greater risks (e
Biowaiver monograph for immediate-release solid oral dosage forms: bisoprolol fumarate.
Charoo, Naseem A; Shamsher, Areeg A A; Lian, Lai Y; Abrahamsson, Bertil; Cristofoletti, Rodrigo; Groot, D W; Kopp, Sabine; Langguth, Peter; Polli, James; Shah, Vinod P; Dressman, Jennifer
2014-02-01
Literature data relevant to the decision to allow a waiver of in vivo bioequivalence (BE) testing for the approval of immediate-release (IR) solid oral dosage forms containing bisoprolol as the sole active pharmaceutical ingredient (API) are reviewed. Bisoprolol is classified as a Class I API according to the current Biopharmaceutics Classification System (BCS). In addition to the BCS class, its therapeutic index, pharmacokinetic properties, data related to the possibility of excipient interactions, and reported BE/bioavailability problems are taken into consideration. Qualitative compositions of IR tablet dosage forms of bisoprolol with a marketing authorization (MA) in ICH (International Conference on Harmonisation) countries are tabulated. It was inferred that these tablets had been demonstrated to be bioequivalent to the innovator product. No reports of failure to meet BE standards have been made in the open literature. On the basis of all these pieces of evidence, a biowaiver can currently be recommended for bisoprolol fumarate IR dosage forms if (1) the test product contains only excipients that are well known, and used in normal amounts, for example, those tabulated for products with MA in ICH countries and (2) both the test and comparator dosage form are very rapidly dissolving, or, rapidly dissolving with similarity of the dissolution profiles demonstrated at pH 1.2, 4.5, and 6.8. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.
Safety of oral tenofovir disoproxil fumarate-based pre-exposure prophylaxis for HIV prevention.
Mugwanya, Kenneth K; Baeten, Jared M
2016-01-01
Tenofovir disoproxil fumarate (TDF)-based pre-exposure prophylaxis is a novel HIV prevention strategy for individuals at increased sexual risk for HIV infection. For any biomedical prevention intervention, the bar for tolerating adverse effects in healthy persons is high compared to therapeutic interventions. We provide a concise summary of the clinical safety of TDF-based pre-exposure prophylaxis with focus on TDF-related effects on tolerability, kidney function, bone density, HIV resistance, sexual and reproductive health. The evidence base for this review is derived from a literature search of both randomized and observational studies evaluating efficacy and safety of TDF-based PrEP, TDF alone or in combination with emtricitabine, identified from PUBMED and EMBASE electronic databases, clinicaltrials.gov and major HIV conferences. TDF-based pre-exposure prophylaxis is a potent intervention against HIV acquisition when taken which is generally safe and well tolerated. The risk of the small, non-progressive, and reversible decline in glomerular filtration rate and bone mineral density as well as the potential selection for drug resistance associated with PrEP are outweighed, at the population level and broadly for individuals, by PrEP's substantial reduction in the risk of HIV infection.
Zhu, Bing; Nestorov, Ivan; Zhao, Guolin; Meka, Venkata; Leahy, Mark; Kam, Jeanelle; Sheikh, Sarah I
2017-11-01
Delayed-release dimethyl fumarate (DMF) is an oral therapy for relapsing multiple sclerosis with anti-inflammatory and neuroprotective properties. This 2-period crossover study was conducted to evaluate the potential for drug-drug interaction between DMF (240 mg twice daily) and a combined oral contraceptive (OC; norgestimate 250 μg, ethinyl estradiol 35 μg). Forty-six healthy women were enrolled; 32 completed the study. After the lead-in period (OC alone), 41 eligible participants were randomized 1:1 to sequence 1 (OC and DMF coadministration in period 1; OC alone in period 2) or sequence 2 (regimens reversed). Mean concentration profiles of plasma norelgestromin (primary metabolite of norgestimate) and ethinyl estradiol were superimposable following OC alone and OC coadministered with DMF, with 90% confidence intervals of geometric mean ratios for area under the plasma concentration-time curve over the dosing interval and peak plasma concentration contained within the 0.8-1.25 range. Low serum progesterone levels during combined treatment confirmed suppression of ovulation. The pharmacokinetics of DMF (measured via its primary active metabolite, monomethyl fumarate) were consistent with historical data when DMF was administered alone. No new safety concerns were identified. These results suggest that norgestimate/ethinyl estradiol-based OCs may be used with DMF without dose modification. © 2017, The Authors. Clinical Pharmacology in Drug Development Published by Wiley Periodicals, Inc. on behalf of The American College of Clinical Pharmacology.
Vavougios, George; Zarogiannis, Sotirios G; Doskas, Triantafylos
2018-04-01
Recent research has outlined that Dimethyl Fumarate (DMF) functions as a gene regulator via multiple pathways, critical among which is the NRF2 cytoprotective cascade. PARK7/DJ-1 is a multifunctional protein that acts as a redox sensor and effector of multiple cytoprotective pathways, including NRF2. Specifically, it prevents the association of NRF2 with its inhibitor KEAP1, allowing NRF2 to enter the nucleus and mediate cytoprotective and antioxidant cascades. It is our hypothesis that while the NRF2-KEAP1 inhibitory complex is reported the main pharmacological target for DMF's NRF dependent functions, no study to date has explored the effects of DMF on DJ-1's expression, and vice-versa, the possibility of a regulatory inadequacy in the upstream, oxidant-responsive DJ-1 activator of the NRF2 cascade. Copyright © 2018 Elsevier B.V. All rights reserved.
H2 S Sensors: Fumarate-Based fcu-MOF Thin Film Grown on a Capacitive Interdigitated Electrode.
Yassine, Omar; Shekhah, Osama; Assen, Ayalew H; Belmabkhout, Youssef; Salama, Khaled N; Eddaoudi, Mohamed
2016-12-19
Herein we report the fabrication of an advanced sensor for the detection of hydrogen sulfide (H 2 S) at room temperature, using thin films of rare-earth metal (RE)-based metal-organic framework (MOF) with underlying fcu topology. This unique MOF-based sensor is made via the in situ growth of fumarate-based fcu-MOF (fum-fcu-MOF) thin film on a capacitive interdigitated electrode. The sensor showed a remarkable detection sensitivity for H 2 S at concentrations down to 100 ppb, with the lower detection limit around 5 ppb. The fum-fcu-MOF sensor exhibits a highly desirable detection selectivity towards H 2 S vs. CH 4 , NO 2 , H 2 , and C 7 H 8 as well as an outstanding H 2 S sensing stability as compared to other reported MOFs. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shalumon, K T; Jayabalan, M
2009-12-01
Biodegradation of crosslinked-hydroxy terminated-poly(proplyene fumarate) (X-HTPPF) has been studied in simulated physiological media to assess the formation of porous scaffold structure for bone growth and remodeling in load bearing orthopedic applications. Variation in crosslink density and surface hydrophilicity of X-HTPPF are observed due to non-stoichiometric mass of reacting partners. These variations influence absorption of the medium and biodegradation during aging. Though the initial absorption of medium is relatively higher with the crosslinked polymer (PNVP1) having 63.6% HT-PPF and 36.4% comonomer n-vinyl pyrrolidone (NVP) during the initial period of aging, the weight loss due to subsequent degradation with time is relatively lesser. PNVP1 undergo slow degradation with formation of fibril structure on the surface. The present crosslinked material PNVP1 is a candidate for the load bearing orthopedic applications.
Kastrati, Irida; Siklos, Marton I; Calderon-Gierszal, Esther L; El-Shennawy, Lamiaa; Georgieva, Gergana; Thayer, Emily N; Thatcher, Gregory R J; Frasor, Jonna
2016-02-12
In breast tumors, activation of the nuclear factor κB (NFκB) pathway promotes survival, migration, invasion, angiogenesis, stem cell-like properties, and resistance to therapy--all phenotypes of aggressive disease where therapy options remain limited. Adding an anti-inflammatory/anti-NFκB agent to breast cancer treatment would be beneficial, but no such drug is approved as either a monotherapy or adjuvant therapy. To address this need, we examined whether dimethyl fumarate (DMF), an anti-inflammatory drug already in clinical use for multiple sclerosis, can inhibit the NFκB pathway. We found that DMF effectively blocks NFκB activity in multiple breast cancer cell lines and abrogates NFκB-dependent mammosphere formation, indicating that DMF has anti-cancer stem cell properties. In addition, DMF inhibits cell proliferation and significantly impairs xenograft tumor growth. Mechanistically, DMF prevents p65 nuclear translocation and attenuates its DNA binding activity but has no effect on upstream proteins in the NFκB pathway. Dimethyl succinate, the inactive analog of DMF that lacks the electrophilic double bond of fumarate, is unable to inhibit NFκB activity. Also, the cell-permeable thiol N-acetyl l-cysteine, reverses DMF inhibition of the NFκB pathway, supporting the notion that the electrophile, DMF, acts via covalent modification. To determine whether DMF interacts directly with p65, we synthesized and used a novel chemical probe of DMF by incorporating an alkyne functionality and found that DMF covalently modifies p65, with cysteine 38 being essential for the activity of DMF. These results establish DMF as an NFκB inhibitor with anti-tumor activity that may add therapeutic value in the treatment of aggressive breast cancers. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
McNeil, Matthew B; Hampton, Hannah G; Hards, Kiel J; Watson, Bridget N J; Cook, Gregory M; Fineran, Peter C
2014-01-31
The activity of the respiratory enzyme fumarate reductase (FRD) is dependent on the covalent attachment of the redox cofactor flavin adenine dinucleotide (FAD). We demonstrate that the FAD assembly factor SdhE, which flavinylates and activates the respiratory enzyme succinate dehydrogenase (SDH), is also required for the complete activation and flavinylation of FRD. SdhE interacted with, and flavinylated, the flavoprotein subunit FrdA, whilst mutations in a conserved RGxxE motif impaired the complete flavinylation and activation of FRD. These results are of widespread relevance because SDH and FRD play an important role in cellular energetics and are required for virulence in many important bacterial pathogens. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Injectable, in situ forming poly(propylene fumarate)-based ocular drug delivery systems.
Ueda, H; Hacker, M C; Haesslein, A; Jo, S; Ammon, D M; Borazjani, R N; Kunzler, J F; Salamone, J C; Mikos, A G
2007-12-01
This study sought to develop an injectable formulation for long-term ocular delivery of fluocinolone acetonide (FA) by dissolving the anti-inflammatory drug and the biodegradable polymer poly(propylene fumarate) (PPF) in the biocompatible, water-miscible, organic solvent N-methyl-2-pyrrolidone (NMP). Upon injection of the solution into an aqueous environment, a FA-loaded PPF matrix is precipitated in situ through the diffusion/extraction of NMP into surrounding aqueous fluids. Fabrication of the matrices and in vitro release studies were performed in phosphate buffered saline at 37 degrees C. Drug loadings up to 5% were achieved. High performance liquid chromatography was employed to determine the released amount of FA. The effects of drug loading, PPF content of the injectable formulation, and additional photo-crosslinking of the matrix surface were investigated. Overall, FA release was sustained in vitro over up to 400 days. After an initial burst release of 22 to 68% of initial FA loading, controlled drug release driven by diffusion and bulk erosion was observed. Drug release rates in a therapeutic range were demonstrated. Release kinetics were found to be dependent on drug loading, formulation PPF content, and extent of surface crosslinking. The results suggest that injectable, in situ formed PPF matrices are promising candidates for the formulation of long-term, controlled delivery devices for intraocular drug delivery. Copyright 2007 Wiley Periodicals, Inc.
USDA-ARS?s Scientific Manuscript database
Background. We aimed to define the relative importance of renal and endocrine changes in tenofovir disoproxil fumarate (TDF)-related bone toxicity. Methods. In a study of daily TDF/emtricitabine (FTC) pre-exposure prophylaxis (PrEP) in HIV uninfected young men who have sex with men, we measured ch...
Safety of Oral Tenofovir Disoproxil Fumarate-Based Pre-Exposure Prophylaxis for HIV Prevention
Mugwanya, Kenneth K.; Baeten, Jared M.
2016-01-01
Introduction Tenofovir disoproxil fumarate (TDF)-based pre-exposure prophylaxis is a novel HIV prevention strategy for individuals at increased sexual risk for HIV infection. For any biomedical prevention intervention, the bar for tolerating adverse effects in healthy persons is high compared to therapeutic interventions. Areas covered We provide a concise summary of the clinical safety of TDF-based pre-exposure prophylaxis with focus on TDF-related effects on tolerability and side effects, kidney function, bone density, HIV resistance, sexual and reproductive health. The evidence base for this review is derived from a literature search of both randomized and observational studies evaluating efficacy and safety of TDF-based PrEP, TDF alone or in combination with emtricitabine, identified from PUBMED and EMBASE electronic databases, clinicaltrials.gov and major HIV conferences. Expert opinion TDF-based pre-exposure prophylaxis is a potent intervention against HIV acquisition when taken which is generally safe and well tolerated. The risk of the small, non-progressive, and reversible decline in glomerular filtration rate and bone mineral density as well as the potential selection for drug resistance associated with PrEP are outweighed, at the population level and broadly for individuals, by PrEP’s substantial reduction in the risk of HIV infection. PMID:26634852
Effect of Prevascularization on In Vivo Vascularization of Poly(Propylene fumarate)/Fibrin Scaffolds
Mishra, Ruchi; Roux, Brianna M.; Posukonis, Megan; Bodamer, Emily; Brey, Eric M.; Fisher, John P.; Dean, David
2016-01-01
The importance of vascularization in the field of bone tissue engineering has been established by previous studies. The present work proposes a novel poly(propylene fumarate) (PPF)/fibrin composite scaffold for the development of vascularized neobone tissue. The effect of prevascularization (i.e., in vitro pre-culture prior to implantation) with human mesenchymal stem cells (hMSCs) and human umbilical vein endothelial cells (HUVECs) on in vivo vascularization of scaffolds was determined. Five conditions were studied: no pre-culture (NP), 1 week preculture (1P), 2 week pre-culture (2P), 3 week pre-culture (3P), and scaffolds without cells (control, C). Scaffolds were implanted subcutaneously in a severe combined immunodeficiency (SCID) mice model for 9 days. During in vitro studies, CD31 staining showed a significant increase in vascular network area over 3 weeks of culture. Vascular density was significantly higher in vivo when comparing NP to 3P groups. Immunohistochemical staining of human CD-31 expression indicated spreading of vascular networks with increasing pre-culture time. These vascular networks were perfused with mouse blood indicated by perfused lectin staining in human CD-31 positive vessels. Our results demonstrate that in vitro prevascularization supports in vivo vascularization in PPF/fibrin scaffolds. PMID:26606451
Multiple sclerosis therapeutic pipeline: opportunities and challenges.
Krieger, Stephen
2011-01-01
The year 2010 marked the beginning of the era of oral medications for the treatment of multiple sclerosis, with the approval of dalfampridine to improve walking and fingolimod as the first oral disease-modifying agent. This review provides an overview of these and other emerging therapies, with an emphasis on the opportunities for new treatment paradigms they have the potential to offer, followed by a discussion of the challenges they will pose in the new era of multiple sclerosis management. Therapeutics in late-stage development for MS include non-selective immunosupressants, targeted immune-modulators, and monoclonal antibodies. Oral agents including cladribine, teriflunomide, laquinimod, and dimethyl fumarate, as well as monoclonal antibodies alemtuzumab, daclizumab, and rituximab are considered. Potential side effects and adverse event monitoring, including opportunistic infections, emergent malignancies, and other systemic consequences of immunosuppression are discussed in a unified section. Challenges of optimally staging, sequencing, and combining treatments in the expanding multiple sclerosis armamentarium are discussed. This review emphasizes the multifactorial decision making that these new therapeutics will warrant in terms of patient selection and personalization/individualization of therapy, and the increasingly interdisciplinary approach that will be necessitated by the new generation of agents. © 2011 Mount Sinai School of Medicine.
Anil Kumar, K V; Nagwar, Shrasti; Thyloor, Rama; Satyanarayana, Sreemantula
2015-12-01
Various stress hormones are responsible for bringing out stress-related changes and are implicated in learning and memory processes. The extensive clinical experience of angiotensin receptor blockers (ARBs) and direct renin inhibitor as antihypertensive agents provides anecdotal evidence of improvements in cognition. The neurochemical basis underlying the anti-stress and nootropic effects are unclear. This study was aimed to determine the effects of aliskiren, valsartan and their combination on the neuromediators of the central nervous system (CNS) and periphery as well as on cognitive function. Groups of rats were subjected to a forced swim stress for one hour after daily treatment with aliskiren, valsartan and their combination. The 24 h urinary excretion of vanillylmandellic acid (VMA), 5-hydroxyindoleacetic acid (5-HIAA), 6-β-hydroxycortisol (6-β-OH) cortisol and homovanillic acid (HVA) was determined in all groups under normal and stressed conditions. Nootropic activity was studied using cook's pole climbing apparatus and acetylcholinesterase (AChE) inhibitory activity by Ellman's method. Administration of aliskiren (10 mg/kg), valsartan (20 mg/kg) and their combination at a dose of 5 and 10 mg/kg respectively reduced the urinary metabolite levels. Further, all drugs showed significant improvement in scopolamine-impaired performance and produced inhibition of the AChE enzyme. The present study provides scientific support for the anti-stress and nootropic activities of aliskiren, valsartan and their combination. © The Author(s) 2014.
Tenofovir alafenamide (TAF) as the successor of tenofovir disoproxil fumarate (TDF).
De Clercq, Erik
2016-11-01
Tenofovir alafenamide (TAF) can be considered a new prodrug of tenofovir (TFV), as successor of tenofovir disoproxil fumarate (TDF). It is in vivo as potent against human immunodeficiency virus (HIV) at a 30-fold lower dose (10mg) than TDF (300mg). TAF has been approved in November 2015 (in the US and EU), as a single-tablet regimen (STR) containing 150mg elvitegravir (E), 150mg cobicistat (C), 200mg emtricitabine [(-)FTC] (F) and 10mg TAF, marketed as Genvoya®, on 01 March 2016 in the US as an STR containing 25mg rilpivirine (R), 200mg F and 25mg TAF, marketed as Odefsey®, and on 4 April 2016 in the US, as an STR containing 200mg F and 25mg TAF, marketed as Descovy®, for the treatment of HIV infections. STR combinations containing TAF and emtricitabine could be paired with a range of third agents, for example, darunavir and cobicistat. TAF has a much lower risk of kidney toxicity or bone density changes than TDF, and also offers long-term potential in the pre-exposure prophylaxis (PrEP) of HIV infections. TAF is specifically accumulated in lymphatic tissue, and in the liver, and hence also holds great potential for the treatment of hepatitis B virus (HBV) infections. Akin to TDF, TAF is converted intracellularly to TFV. Its active diphosphate metabolite (TFVpp) is targeted at the RNA-dependent DNA polymerase (reverse transcriptase) of either HIV or HBV. Copyright © 2016 Elsevier Inc. All rights reserved.
... poultry that has been allowed to defrost at room temperature on a counter; and meat, poultry, fish, or eggs that have not been cooked thoroughly.If you develop anemia (low red blood cell count) during your treatment, your doctor ...
Santos, Daniel Ditzel; Hatjiharissi, Evdoxia; Tournilhac, Olivier; Chemaly, Mariana Z A; Leleu, Xavier; Xu, Lian; Patterson, Christopher; Branagan, Andrew R; Manning, Robert J; Ho, Allen W; Hunter, Zachary R; Dimmock, Elizabeth A; Kutok, Jeffery L; Churchill, Winthrop H; Castells, Mariana C; Tai, Yu-Tzu; Anderson, Kenneth C; Treon, Steven P
2006-05-01
Alemtuzumab is a monoclonal antibody used in the treatment of CD52-expressing B-cell malignancies, including Waldenstrom's macroglobulinemia (WM). Recent studies demonstrate high levels of alemtuzumab activity in relapsed/refractory disease. One potential target of alemtuzumab is bone marrow mast cells (BMMCs), which provide growth and survival signaling for WM lymphoplasmacytic cells. We therefore examined BMMCs (FceRI+, CD117+) from WM and other mast cell (MC) disorders for expression of CD52. We identified cell surface antigen expression by multicolor flow cytometric analysis and found CD52 expressed on human mast-derived cell line-1 (HMC-1) and LAD2 MC lines, on BMMC from 13 of 15 patients with WM, and on BMMCs from 4 of 4 patients with systemic mastocytosis (SM). None of 4 healthy donors expressed CD52. Reverse-transcriptase polymerase chain reaction analysis confirmed CD52 expression in the HMC-1 and LAD2 MC lines, in BMMCs from 14 of 15 patients with WM, and 3 of 3 patients with SM. CD52 transcripts were also detected in BMMCs from 6 of 6 healthy donors, despite the absence of CD52 cell surface expression. Importantly, we observed high levels of alemtuzumab-mediated, antibody-dependent, cell-mediated cytotoxicity against LAD2 MCs and BMMCs from patients with WM and SM. These studies demonstrate that CD52 is widely expressed on human MCs and WM bone marrow lymphoplasmacytic cells and provide the preclinical rationale for the use of alemtuzumab in the treatment of WM and possibly other MC-related disorders.
Díez-Pascual, Ana M; Díez-Vicente, Angel L
2016-07-20
Poly(propylene fumarate) (PPF)-based nanocomposites incorporating different amounts of polyethylene glycol-functionalized graphene oxide (PEG-GO) have been prepared via sonication and thermal curing, and their surface morphology, structure, thermal stability, hydrophilicity, water absorption, biodegradation, cytotoxicity, mechanical, viscoelastic and antibacterial properties have been investigated. SEM and TEM images corroborated that the noncovalent functionalization with PEG caused the exfoliation of GO into thinner flakes. IR spectra suggested the presence of strong hydrogen-bonding interactions between the nanocomposite components. A gradual rise in the level of hydrophilicity, water uptake, biodegradation rate, surface roughness, protein absorption capability and thermal stability was found upon increasing GO concentration in the composites. Tensile tests revealed improved stiffness, strength and toughness for the composites compared to unfilled PPF, ascribed to a homogeneous GO dispersion within the matrix along with a strong PPF/PEG-GO interfacial adhesion via polar and hydrogen bonding interactions. Further, the nanocomposites retained enough stiffness and strength under a biological state to provide effective support for bone tissue formation. The antibacterial activity was investigated against Gram-positive Staphylococcus aureus and Staphylococcus epidermidis as well as Gram-negative Pseudomonas aeruginosa and Escherichia coli microorganisms, and it rose sharply upon increasing GO concentration; systematically, the biocide effect was stronger versus Gram-positive bacteria. Cell viability data demonstrated that PPF/PEG-GO composites do not induce toxicity over human dermal fibroblasts. These novel materials show great potential to be applied in the bone tissue engineering field.
Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients
Trachtenberg, Jordan E.; Placone, Jesse K.; Smith, Brandon T.; Fisher, John P.; Mikos, Antonios G.
2017-01-01
The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (µCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications. PMID:28125380
Extrusion-based 3D printing of poly(propylene fumarate) scaffolds with hydroxyapatite gradients.
Trachtenberg, Jordan E; Placone, Jesse K; Smith, Brandon T; Fisher, John P; Mikos, Antonios G
2017-04-01
The primary focus of this work is to present the current challenges of printing scaffolds with concentration gradients of nanoparticles with an aim to improve the processing of these scaffolds. Furthermore, we address how print fidelity is related to material composition and emphasize the importance of considering this relationship when developing complex scaffolds for bone implants. The ability to create complex tissues is becoming increasingly relevant in the tissue engineering community. For bone tissue engineering applications, this work demonstrates the ability to use extrusion-based printing techniques to control the spatial deposition of hydroxyapatite (HA) nanoparticles in a 3D composite scaffold. In doing so, we combined the benefits of synthetic, degradable polymers, such as poly(propylene fumarate) (PPF), with osteoconductive HA nanoparticles that provide robust compressive mechanical properties. Furthermore, the final 3D printed scaffolds consisted of well-defined layers with interconnected pores, two critical features for a successful bone implant. To demonstrate a controlled gradient of HA, thermogravimetric analysis was carried out to quantify HA on a per-layer basis. Moreover, we non-destructively evaluated the tendency of HA particles to aggregate within PPF using micro-computed tomography (μCT). This work provides insight for proper fabrication and characterization of composite scaffolds containing particle gradients and has broad applicability for future efforts in fabricating complex scaffolds for tissue engineering applications.
Agarwal, Kosh; Brunetto, Maurizia; Seto, Wai Kay; Lim, Young-Suk; Fung, Scott; Marcellin, Patrick; Ahn, Sang Hoon; Izumi, Namiki; Chuang, Wan-Long; Bae, Ho; Sharma, Manoj; Janssen, Harry L A; Pan, Calvin Q; Çelen, Mustafa Kemal; Furusyo, Norihiro; Shalimar, Dr; Yoon, Ki Tae; Trinh, Huy; Flaherty, John F; Gaggar, Anuj; Lau, Audrey H; Cathcart, Andrea L; Lin, Lanjia; Bhardwaj, Neeru; Suri, Vithika; Mani Subramanian, G; Gane, Edward J; Buti, Maria; Chan, Henry L Y
2018-04-01
Tenofovir alafenamide (TAF) is a new prodrug of tenofovir developed to treat patients with chronic hepatitis B virus (HBV) infection at a lower dose than tenofovir disoproxil fumarate (TDF) through more efficient delivery of tenofovir to hepatocytes. In 48-week results from two ongoing, double-blind, randomized phase III trials, TAF was non-inferior to TDF in efficacy with improved renal and bone safety. We report 96-week outcomes for both trials. In two international trials, patients with chronic HBV infection were randomized 2:1 to receive 25 mg TAF or 300 mg TDF in a double-blinded fashion. One study enrolled HBeAg-positive patients and the other HBeAg-negative patients. We assessed efficacy in each study, and safety in the pooled population. At week 96, the differences in the rates of viral suppression were similar in HBeAg-positive patients receiving TAF and TDF (73% vs. 75%, respectively, adjusted difference -2.2% (95% CI -8.3 to 3.9%; p = 0.47), and in HBeAg-negative patients receiving TAF and TDF (90% vs. 91%, respectively, adjusted difference -0.6% (95% CI -7.0 to 5.8%; p = 0.84). In both studies the proportions of patients with alanine aminotransferase above the upper limit of normal at baseline, who had normal alanine aminotransferase at week 96 of treatment, were significantly higher in patients receiving TAF than in those receiving TDF. In the pooled safety population, patients receiving TAF had significantly smaller decreases in bone mineral density than those receiving TDF in the hip (mean % change -0.33% vs. -2.51%; p <0.001) and lumbar spine (mean % change -0.75% vs. -2.57%; p <0.001), as well as a significantly smaller median change in estimated glomerular filtration rate by Cockcroft-Gault method (-1.2 vs. -4.8 mg/dl; p <0.001). In patients with HBV infection, TAF remained as effective as TDF, with continued improved renal and bone safety, two years after the initiation of treatment. Clinicaltrials.gov number: NCT01940471 and
Wu, Qi; Wang, Qin; Mao, Guangmei; Dowling, Catherine A; Lundy, Steven K; Mao-Draayer, Yang
2017-04-15
Dimethyl fumarate (DMF; trade name Tecfidera) is an oral formulation of the fumaric acid ester that is Food and Drug Administration approved for treatment of relapsing-remitting multiple sclerosis. To better understand the therapeutic effects of Tecfidera and its rare side effect of progressive multifocal leukoencephalopathy, we conducted cross-sectional and longitudinal studies by immunophenotyping cells from peripheral blood (particularly T lymphocytes) derived from untreated and 4-6 and 18-26 mo Tecfidera-treated stable relapsing-remitting multiple sclerosis patients using multiparametric flow cytometry. The absolute numbers of CD4 and CD8 T cells were significantly decreased and the CD4/CD8 ratio was increased with DMF treatment. The proportions of both effector memory T cells and central memory T cells were reduced, whereas naive T cells increased in treated patients. T cell activation was reduced with DMF treatment, especially among effector memory T cells and effector memory RA T cells. Th subsets Th1 (CXCR3 + ), Th17 (CCR6 + ), and particularly those expressing both CXCR3 and CD161 were reduced most significantly, whereas the anti-inflammatory Th2 subset (CCR3 + ) was increased after DMF treatment. A corresponding increase in IL-4 and decrease in IFN-γ and IL-17-expressing CD4 + T cells were observed in DMF-treated patients. DMF in vitro treatment also led to increased T cell apoptosis and decreased activation, proliferation, reactive oxygen species, and CCR7 expression. Our results suggest that DMF acts on specific memory and effector T cell subsets by limiting their survival, proliferation, activation, and cytokine production. Monitoring these subsets could help to evaluate the efficacy and safety of DMF treatment. Copyright © 2017 by The American Association of Immunologists, Inc.
Inhibition of fumarate reductase in Leishmania major and L. donovani by chalcones.
Chen, M; Zhai, L; Christensen, S B; Theander, T G; Kharazmi, A
2001-07-01
Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major promastigote and in the parasite mitochondria, and it also inhibited solubilized FRD and a purified FRD from L. donovani. Two other chalcones, 2,4-dimethoxy-4'-allyloxychalcone (24m4ac) and 2,4-dimethoxy-4'-butoxychalcone (24mbc), also exhibited inhibitory effects on the activity of solubilized FRD in L. major promastigotes. Although licochalcone A inhibited the activities of succinate dehydrogenase (SDH), NADH dehydrogenase (NDH), and succinate- and NADH-cytochrome c reductases in the parasite mitochondria, the 50% inhibitory concentrations (IC(50)) of licochalcone A for these enzymes were at least 20 times higher than that for FRD. The IC(50) of licochalcone A for SDH and NDH in human peripheral blood mononuclear cells were at least 70 times higher than that for FRD. These findings indicate that FRD, one of the enzymes of the parasite respiratory chain, might be the specific target for the chalcones tested. Since FRD exists in the Leishmania parasite and does not exist in mammalian cells, it could be an excellent target for antiprotozoal drugs.
Inhibition of Fumarate Reductase in Leishmania major and L. donovani by Chalcones
Chen, Ming; Zhai, Lin; Christensen, Søren Brøgger; Theander, Thor G.; Kharazmi, Arsalan
2001-01-01
Our previous studies have shown that chalcones exhibit potent antileishmanial and antimalarial activities in vitro and in vivo. Preliminary studies showed that these compounds destroyed the ultrastructure of Leishmania parasite mitochondria and inhibited the respiration and the activity of mitochondrial dehydrogenases of Leishmania parasites. The present study was designed to further investigate the mechanism of action of chalcones, focusing on the parasite respiratory chain. The data show that licochalcone A inhibited the activity of fumarate reductase (FRD) in the permeabilized Leishmania major promastigote and in the parasite mitochondria, and it also inhibited solubilized FRD and a purified FRD from L. donovani. Two other chalcones, 2,4-dimethoxy-4′-allyloxychalcone (24m4ac) and 2,4-dimethoxy-4′-butoxychalcone (24mbc), also exhibited inhibitory effects on the activity of solubilized FRD in L. major promastigotes. Although licochalcone A inhibited the activities of succinate dehydrogenase (SDH), NADH dehydrogenase (NDH), and succinate- and NADH-cytochrome c reductases in the parasite mitochondria, the 50% inhibitory concentrations (IC50) of licochalcone A for these enzymes were at least 20 times higher than that for FRD. The IC50 of licochalcone A for SDH and NDH in human peripheral blood mononuclear cells were at least 70 times higher than that for FRD. These findings indicate that FRD, one of the enzymes of the parasite respiratory chain, might be the specific target for the chalcones tested. Since FRD exists in the Leishmania parasite and does not exist in mammalian cells, it could be an excellent target for antiprotozoal drugs. PMID:11408218
Bayes, M; Rabasseda, X; Prous, J R
2006-03-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 131I-labetuzumab; Abacavir sulfate, abatacept, adalimumab, ademetionine, adjuvanted influenza vaccine, alefacept, alemtuzumab, amlodipine, amphotericin B, anakinra, aripiprazole, aspirin, axitinib; Betamethasone dipropionate, bevacizumab, biphasic insulin aspart, bortezomib, bosentan, botulinum toxin type B, BQ-123; Calcium folinate, canertinib dihydrochloride, carboplatin, carmustine, cetirizine hydrochloride, cetuximab, cholecalciferol, ciclesonide, ciclosporin, cinacalcet hydrochloride, cisplatin, clarithromycin, clofazimine, cold-adapted influenza vaccine trivalent, CpG-7909; Darbepoetin alfa, darifenacin hydrobromide, DB-289, desloratadine, Dexamet, dicycloverine hydrochloride, dimethyl fumarate, docetaxel, dolastatin 10, drospirenone, drospirenone/estradiol, duloxetine hydrochloride; Ecogramostim, edotecarin, efaproxiral sodium, enalapril maleate, epoetin beta, epoprostenol sodium, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, estradiol, etanercept; Fluconazole, fludarabine phosphate, fluorouracil; Gefitinib, gemcitabine, Ghrelin (human), glibenclamide, glimepiride, GTI-2040; Haloperidol, human insulin, hydrocortisone probutate; Imatinib mesylate, indisulam, influenza vaccine, inhaled insulin, insulin aspart, insulin glulisine, insulin lispro, irinotecan, ispronicline; Lamivudine, lamivudine/zidovudine/abacavir sulfate, lapatinib, letrozole, levocetirizine, lomustine, lonafarnib, lumiracoxib;Magnesium sulfate, MD-1100, melphalan, metformin hydrochloride, methotrexate, metoclopramide hydrochloride, mitiglinide calcium hydrate, monophosphoryl lipid A, montelukast sodium, motexafin gadolinium
Kumar, Pramod; Sharma, Gajanand; Gupta, Varun; Kaur, Ramanpreet; Thakur, Kanika; Malik, Ruchi; Kumar, Anil; Kaushal, Naveen; Raza, Kaisar
2018-05-16
Multiple sclerosis (MS) is a neurodegenerative disease in which myelin sheath damage occurs due to internal and external factors. MS especially affects the young population. Dimethyl fumarate (DMF) is a promising agent for MS treatment, although it is associated with concerns such as poor brain permeation, multiple dosing, and gastrointestinal flushing. The present study attempts to evaluate the preclinical performance of specially designed DMF-based lipoidal nanoparticles in a cuprizone-induced demyelination model in rodents. The studies proved the efficacy of lipid-based nanoparticles containing DMF in a once-a-day dosage regimen over that of thrice-a-day plain DMF administration on crucial parameters like motor coordination, grip strength, mortality, body weight, and locomotor activity. However, neither blank lipid nor blank neuroprotective (vitamins A, D, and E) loaded nanoparticles were able to elicit any desirable behavioral response. Histopathological studies showed that the designed once-a-day DMF nanomedicines were well tolerated and rejuvenated the myelin sheath vis-à-vis the plain DMF thrice-a-day regimen. These findings provide proof of concept for a biocompatible nanomedicine for MS with tremendous promise for effective brain delivery and patient compliance on the grounds of a reduction in the dosage frequency.
Nishijima, Takeshi; Kurosawa, Takuma; Tanaka, Noriko; Kawasaki, Yohei; Kikuchi, Yoshimi; Oka, Shinichi; Gatanaga, Hiroyuki
2016-06-19
In nephrotoxicity induced by tenofovir disoproxil fumarate (TDF), tubular dysfunction precedes the decline in GFR, suggesting that tubular markers are more sensitive than estimated glomerular filtration rate (eGFR). The hypothesis that urinary β2 microglobulin (β2 M), a tubular function marker, can predict TDF-renal dysfunction in HIV-1-infected patients was tested. A single-center observational study. The inclusion criteria were: HIV-1-infected patients who started TDF-containing antiretroviral therapy from 2004 to 2013, urinary β2 M after and closest to the day of TDF initiation within 180 days (termed 'β2 M after TDF') was measured. The associations between 'β2 M after TDF' and four renal end points (>10 ml/min per 1.73 m decrement in eGFR relative to baseline, >20 decrement, >25% decrement, and eGFR < 60) were estimated with logistic regression model. The association between 'β2 M after TDF' and longitudinal changes in eGFR after initiation of TDF was estimated with a mixed-model. A total 655 study patients were analyzed (96% men, median age 38, median CD4 238 cells/μl, 63% treatment naïve). The median baseline eGFR was 117 ml/min per 1.73 m (IQR 110-125), and the median duration of TDF use was 3.32 years (IQR 2.02-5.31). 'β2 M after TDF' was significantly associated with more than 20 decrement in eGFR (P = 0.024) and more than 25% decrement (P = 0.014), and was marginally associated with eGFR less than 60 (P = 0.076). It was also significantly associated with the longitudinal eGFR after initiation of TDF (P < 0.0001). 'β2 M after TDF' of 1700 μg/l was identified as the optimal cutoff value for the prediction of longitudinal eGFR. Urinary β2 M measured within 180 days after initiation of TDF predicts renal dysfunction related to long-term TDF use.
Tomitsuka, Eriko; Kita, Kiyoshi; Esumi, Hiroyasu
2009-01-01
Complex II (succinate-ubiquinone reductase; SQR) is a mitochondrial respiratory chain enzyme that is directly involved in the TCA cycle. Complex II exerts a reverse reaction, fumarate reductase (FRD) activity, in various species such as bacteria, parasitic helminths and shellfish, but the existence of FRD activity in humans has not been previously reported. Here, we describe the detection of FRD activity in human cancer cells. The activity level was low, but distinct, and it increased significantly when the cells were cultured under hypoxic and glucose-deprived conditions. Treatment with phosphatase caused the dephosphorylation of flavoprotein subunit (Fp) with a concomitant increase in SQR activity, whereas FRD activity decreased. On the other hand, treatment with protein kinase caused an increase in FRD activity and a decrease in SQR activity. These data suggest that modification of the Fp subunit regulates both the SQR and FRD activities of complex II and that the phosphorylation of Fp might be important for maintaining mitochondrial energy metabolism within the tumor microenvironment.
Feliciano, Patricia R; Drennan, Catherine L; Nonato, M Cristina
2016-08-30
Fumarate hydratases (FHs) are essential metabolic enzymes grouped into two classes. Here, we present the crystal structure of a class I FH, the cytosolic FH from Leishmania major, which reveals a previously undiscovered protein fold that coordinates a catalytically essential [4Fe-4S] cluster. Our 2.05 Å resolution data further reveal a dimeric architecture for this FH that resembles a heart, with each lobe comprised of two domains that are arranged around the active site. Besides the active site, where the substrate S-malate is bound bidentate to the unique iron of the [4Fe-4S] cluster, other binding pockets are found near the dimeric enzyme interface, some of which are occupied by malonate, shown here to be a weak inhibitor of this enzyme. Taken together, these data provide a framework both for investigations of the class I FH catalytic mechanism and for drug design aimed at fighting neglected tropical diseases.
Vanduyfhuys, Louis; Alvarez, Elsa; Rodriguez, Julien; Itié, Jean-Paul; Fabry, Paul; Guillou, Nathalie; Devic, Thomas; Beurroies, Isabelle; Llewellyn, Philip L.; Van Speybroeck, Veronique; Serre, Christian; Maurin, Guillaume
2016-01-01
The aluminum fumarate MOF A520 or MIL-53–FA is revealed to be a promising material for mechanical energy-related applications with performances in terms of work and heat energies which surpass those of any porous solids reported so far. Complementary experimental and computational tools are deployed to finely characterize and understand the pressure-induced structural transition at the origin of these unprecedented levels of performance. PMID:29861993
Schneidewind, Laila; Neumann, Thomas; Knoll, Florian; Zimmermann, Kathrin; Smola, Sigrun; Schmidt, Christian Andreas; Krüger, William
2017-01-01
The association of polyomaviruses BK and JC with other opportunistic infections and graft-versus-host disease (GvHD) in allogeneic stem cell transplantation is controversially discussed. We conducted a retrospective study of 64 adult patients who received their first allogeneic stem cell transplantation between March 2010 and December 2014; the follow-up time was 2 years. Acute leukemia was the most frequent underlying disease (45.3%), and conditioning included myeloablative (67.2%) and nonmyeloablative protocols (32.8%). All patients received 10 mg of alemtuzumab on day -2 (20 mg in case of mismatch) as GvHD prophylaxis. Twenty-seven patients (41.5%) developed cytomegalovirus (CMV) reactivation. BKPyV-associated hemorrhagic cystitis was diagnosed in 10 patients (15.6%). Other opportunistic infections caused by viruses or protozoa occurred rarely (<10%). There was no association of BKPyV or JCPyV with CMV reactivation, Epstein-Barr virus reactivation, human herpes virus 6, or parvovirus B19 infection requiring treatment. There was a significant correlation of BKPyV-associated hemorrhagic cystitis with toxoplasmosis (p = 0.013). Additionally, there was a significant link of simultaneous BKPyV and JCPyV viruria with toxoplasmosis (p = 0.047). BKPyV and JCPyV were not associated with GvHD, relapse, or death. We found no association of BKPyV or JCPyV with viral infections or GvHD. Only the correlation of both polyomaviruses with toxoplasmosis was significant. This is a novel and interesting finding. © 2017 S. Karger AG, Basel.
Krishna, Lekshmi; Jayabalan, Muthu
2009-12-01
Biodegradable poly (caprolactone diol-co-propylene fumarate-co-ethylene glycol) amphiphilic polymer with poly (ethylene glycol) and poly (caprolactone diol) chain ends (PCL-PPF-PEG) was prepared. PCL-PPF-PEG undergoes fast setting with acrylamide (aqueous solution) by free radical polymerization and produces a crosslinked hydrogel. The cross linked and freeze-dried amphiphilic material has porous and interconnected network. It undergoes higher degree of swelling and water absorption to form hydrogel with hydrophilic and hydrophobic domains at the surface and appreciable tensile strength. The present hydrogel is compatible with L929 fibroblast cells. PCL-PPF-PEG/acrylamide hydrogel is a candidate scaffold material for tissue engineering applications.
Dimethyl fumarate reduces the risk of mycotoxins via improving intestinal barrier and microbiota
Ma, Ning; Wu, Yi; Xie, Fei; Du, Kexin; Wang, Yuan; Shi, Linxin; Ji, Linbao; Liu, Tianyi; Ma, Xi
2017-01-01
The effects of dimethyl fumarate (DMF) on mycotoxins and animal growth performance are well documented. However, its mechanism of anti-mildew effects is still unknown. The current study investigated how DMF detoxified the mycotoxin and improved the growth performance using BALB/c mice model, especially its effects on intestinal barrier function and gut micro-ecology. Our study also compared with the ultraviolet radiation (UR) treatment, a traditional anti-mildew control (TC). The results indicated that the DMF treatment had a lower contents of mycotoxin, better growth performance and improved mucosal morphology (P < 0.05), accompanied with the decreased intestinal permeability and the tighter gut barrier. Moreover, the efficiency of DMF was better than TC (P < 0.05). 16S rRNA gene sequence analysis revealed that the richness and diversity of bacteria was increased in DMF treatment. The most abundant OTUs belonged to Firmicutes and Bacteroidetes, and their changes in DMF were more moderate than the TC group, suggesting a more stable micro-ecology and the positive impact of DMF on the biodiversity of intestine. Specifically, the increased abundance of bacteria producing short-chain fatty acids (SCFAs), such as Gemella, Roseburia, Bacillus and Bacteroides in DMF group and prebiotics such as Lactobacillus in TC group, suggested a more healthier microbial composition and distribution. These findings supported that DMF had significant effects on animal's growth performance and intestinal barrier function by modulating the pathway of nutrient absorption and increasing the diversity and balance of gut microbes, which also illuminate that DMF is more efficient than traditional anti-mildew method. PMID:28574825
Raffi, François; Orkin, Chloe; Clarke, Amanda; Slama, Laurence; Gallant, Joel; Daar, Eric; Henry, Keith; Santana-Bagur, Jorge; Stein, David K.; Bellos, Nicholaos; Scarsella, Anthony; Yan, Mingjin; Abram, Michael E.; Cheng, Andrew
2017-01-01
Abstract: In a double-blind, phase 3 trial, 663 HIV-infected, virologically suppressed adults were randomized to switch to tenofovir alafenamide (TAF; n = 333) vs. remain on tenofovir disoproxil fumarate (TDF; n = 330), each coformulated with emtricitabine (FTC), while continuing their third agent (boosted protease inhibitor or unboosted third agent). At week 96, 88.6% on FTC/TAF and 89.1% on FTC/TDF had HIV-1 RNA <50 copies per milliliter [adjusted difference −0.5% (95% confidence interval: −5.3 to 4.4%)]. Proteinuria, albuminuria, proximal renal tubular function, and bone mineral density improved after switching to TAF- from TDF-containing regimens. These longer-term data support FTC/TAF as a safe, well-tolerated, and durable nucleotide reverse transcriptase inhibitor backbone. PMID:28272164
Inaoka, Daniel Ken; Shiba, Tomoo; Sato, Dan; Balogun, Emmanuel Oluwadare; Sasaki, Tsuyoshi; Nagahama, Madoka; Oda, Masatsugu; Matsuoka, Shigeru; Ohmori, Junko; Honma, Teruki; Inoue, Masayuki; Kita, Kiyoshi; Harada, Shigeharu
2015-07-07
Recent studies on the respiratory chain of Ascaris suum showed that the mitochondrial NADH-fumarate reductase system composed of complex I, rhodoquinone and complex II plays an important role in the anaerobic energy metabolism of adult A. suum. The system is the major pathway of energy metabolism for adaptation to a hypoxic environment not only in parasitic organisms, but also in some types of human cancer cells. Thus, enzymes of the pathway are potential targets for chemotherapy. We found that flutolanil is an excellent inhibitor for A. suum complex II (IC50 = 0.058 μM) but less effectively inhibits homologous porcine complex II (IC50 = 45.9 μM). In order to account for the specificity of flutolanil to A. suum complex II from the standpoint of structural biology, we determined the crystal structures of A. suum and porcine complex IIs binding flutolanil and its derivative compounds. The structures clearly demonstrated key interactions responsible for its high specificity to A. suum complex II and enabled us to find analogue compounds, which surpass flutolanil in both potency and specificity to A. suum complex II. Structures of complex IIs binding these compounds will be helpful to accelerate structure-based drug design targeted for complex IIs.
Inaoka, Daniel Ken; Shiba, Tomoo; Sato, Dan; Balogun, Emmanuel Oluwadare; Sasaki, Tsuyoshi; Nagahama, Madoka; Oda, Masatsugu; Matsuoka, Shigeru; Ohmori, Junko; Honma, Teruki; Inoue, Masayuki; Kita, Kiyoshi; Harada, Shigeharu
2015-01-01
Recent studies on the respiratory chain of Ascaris suum showed that the mitochondrial NADH-fumarate reductase system composed of complex I, rhodoquinone and complex II plays an important role in the anaerobic energy metabolism of adult A. suum. The system is the major pathway of energy metabolism for adaptation to a hypoxic environment not only in parasitic organisms, but also in some types of human cancer cells. Thus, enzymes of the pathway are potential targets for chemotherapy. We found that flutolanil is an excellent inhibitor for A. suum complex II (IC50 = 0.058 μM) but less effectively inhibits homologous porcine complex II (IC50 = 45.9 μM). In order to account for the specificity of flutolanil to A. suum complex II from the standpoint of structural biology, we determined the crystal structures of A. suum and porcine complex IIs binding flutolanil and its derivative compounds. The structures clearly demonstrated key interactions responsible for its high specificity to A. suum complex II and enabled us to find analogue compounds, which surpass flutolanil in both potency and specificity to A. suum complex II. Structures of complex IIs binding these compounds will be helpful to accelerate structure-based drug design targeted for complex IIs. PMID:26198225
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis
Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.
2011-01-01
Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate
Yang, Dan-Hong; Xie, Yuan-Jun; Zhao, Nian-Feng; Pan, Hong-Ying; Li, Ming-Wei; Huang, Hai-Jun
2015-03-07
To assess the efficacy of tenofovir disoproxil fumarate (TDF) in lamivudine (LAM)-resistant patients with a suboptimal response to LAM plus adefovir (ADV). We retrospectively analyzed the efficacy of switching to tenofovir disoproxil fumarate in suboptimal responders to lamivudine plus adefovir. Charts were reviewed for LAM-resistant chronic hepatitis B (CHB) patients who visited the Zhejiang Province People's Hospital and The First Affiliated Hospital, College of Medicine, Zhejiang University, from June 2009 to May 2013. Patients whose serum hepatitis B virus (HBV) DNA remained detectable despite at least 6 mo of LAM plus ADV combination therapy were included. Patients with a suboptimal response to LAM plus ADV were randomized to switch to TDF monotherapy (300 mg/d orally; TDF group) or to continuation with LAM (100 mg/d orally) plus ADV (10 mg/d orally; LAM plus ADV group) and were followed for 48 wk. Serum HBV DNA was determined at baseline and weeks 4, 12, 24, 36, and 48. HBV serological markers and biochemistry were assessed at baseline and weeks 12, 24, and 48. Resistance surveillance and side effects were monitored during therapy. Fifty-nine patient were randomized to switch to TDF (n = 28) or continuation with LAM plus ADV (n = 31). No significant differences were found between the groups at baseline. Prior to TDF therapy, all patients had been exposed to LAM plus ADV for a median of 11 mo (range: 6-24 mo). No difference was seen in baseline serum HBV DNA between the two groups [5.13 ± 1.08 log10 copies/mL (TDF) vs 5.04 ± 31.16 log10 copies/mL (LAM + ADV), P = 0.639]. There was no significant difference in the rates of achieving complete virological response (CVR) at week 4 between the TDF and LAM + ADV groups (17.86% vs 6.45%, P = 0.24). The rate of achieving CVR in the TDF and LAM plus ADV groups was 75% vs 16.13% at week 12, 82.14% vs 22.58% at week 24, 89.29% vs 25.81% at week 36, and 96.43% vs 29.03% at week 48, respectively (P < 0.001). The rate of
Vourvahis, Manoli; Davis, John; Langdon, Grant; Layton, Gary; Fang, Juanzhi; Choo, Heng Wee; Hansson, Arne G; Tawadrous, Margaret
2013-01-01
To investigate pharmacokinetic interactions associated with coadministration of lersivirine with zidovudine, tenofovir disoproxil fumarate (DF)/emtricitabine (Truvada(®)) or abacavir/lamivudine (Epzicom(®)/Kivexa(®)). Three Phase I, open, crossover studies with two (studies 1 and 3) or three (study 2) treatment periods were conducted in healthy individuals. In study 1, individuals received zidovudine and placebo or zidovudine and lersivirine on days 1-14. In study 2, individuals received lersivirine and tenofovir DF/emtricitabine, lersivirine and placebo or tenofovir DF/emtricitabine and placebo on days 1-10. In study 3, individuals received abacavir/lamivudine only in period 1 (5 days) and abacavir/lamivudine and lersivirine in period 2 (10 days). Blood samples were taken on days 1-14 (study 1) or day of final dose (studies 2 and 3) and analysed using high performance liquid chromatography/dual mass spectrometry. Pharmacokinetic parameters were calculated by standard non-compartmental methods. When coadministered with lersivirine, zidovudine exposure increased by 35%, and exposure of its metabolite zidovudine-glucuronide decreased by 19%. Following coadministration of lersivirine and tenofovir DF/emtricitabine, tenofovir exposure increased by 30%, and lersivirine exposure decreased by 12%. Coadministration of lersivirine and abacavir/lamivudine increased abacavir exposure by 27% and decreased lamivudine exposure by 8%. Adverse events were predominantly mild in these Phase I studies. Coadministration of lersivirine with zidovudine, tenofovir DF/emtricitabine or abacavir/lamivudine influenced the systemic exposure of all nucleoside reverse transcriptase inhibitor agents investigated (except for lamivudine; emtricitabine pharmacokinetics were not assessed). Changes were not considered clinically meaningful for zidovudine and abacavir. The clinical relevance of the effect on tenofovir pharmacokinetics is currently unknown.
Characterization of lymphopenia in patients with MS treated with dimethyl fumarate and fingolimod.
Nakhaei-Nejad, Maryam; Barilla, David; Lee, Chieh-Hsin; Blevins, Gregg; Giuliani, Fabrizio
2018-03-01
Lymphopenia is a common occurrence of disease-modifying therapies (DMTs) for relapsing-remitting MS (RRMS). The aim of this study was to dissect the prevalence of various lymphocyte subsets in patients with RRMS treated with 2 DMTs commonly associated with lymphopenia, dimethyl fumarate (DMF), and fingolimod (FTY). Multicolor flow cytometry and multiplex assays were used to identify up to 50 lymphocyte subpopulations and to examine the expression of multiple cytokines in selected patients. We compared patients untreated (NT) or treated with FTY or DMF who did (DMF-L) or did not (DMF-N) develop lymphopenia. All FTY patients developed lymphopenia in both T-cell and B-cell compartments. CD41 T cells were more affected by this treatment than CD81 cells. In the B-cell compartment, the CD271IgD2 subpopulation was reduced. T cells but not B cells were significantly reduced in DMF-L. However, within the B cells, CD271 cells were significantly lower. Both CD41 and CD81 subpopulations were reduced in DMF-L. Within the remaining CD41 and CD81 compartments, there was an expansion of the naive subpopulation and a reduction of the effector memory subpopulation. Unactivated lymphocyte from DMF-L patients had significantly higher levels of interferon-γ, interleukin (IL)-12, IL-2, IL-4, IL-6, and IL-1β compared with DMF-N. In plasma, TNFβ was significantly higher in DMF-N and DMF-L compared with NT, whereas CCL17 was significantly higher in DMF-L compared with NT and DMF-N. This study shows that different treatments can target different lymphocyte compartments and suggests that lymphopenia can induce compensatory mechanisms to maintain immune homeostasis.
Digital micromirror device (DMD)-based 3D printing of poly(propylene fumarate) scaffolds.
Mott, Eric J; Busso, Mallory; Luo, Xinyi; Dolder, Courtney; Wang, Martha O; Fisher, John P; Dean, David
2016-04-01
Our recent investigations into the 3D printing of poly(propylene fumarate) (PPF), a linear polyester, using a DMD-based system brought us to a resin that used titanium dioxide (TiO2) as an ultraviolet (UV) filter for controlling cure depth. However, this material hindered the 3D printing process due to undesirable lateral or "dark" curing (i.e., in areas not exposed to light from the DMD chip). Well known from its use in sunscreen, another UV filter, oxybenzone, has previously been used in conjunction with TiO2. In this study we hypothesize that combining these two UV filters will result in a synergistic effect that controls cure depth and avoids dark cure. A resin mixture (i.e., polymer, initiator, UV filters) was identified that worked well. The resin was then further characterized through mechanical testing, cure testing, and cytotoxicity testing to investigate its use as a material for bone tissue engineering scaffolds. Results show that the final resin eliminated dark cure as shown through image analysis. Mechanically the new scaffolds proved to be far weaker than those printed from previous resins, with compressive strengths of 7.8 ± 0.5 MPa vs. 36.5 ± 1.6 MPa, respectively. The new scaffolds showed a 90% reduction in elastic modulus and a 74% increase in max strain. These properties may be useful in tissue engineering applications where resorption is required. Initial cytotoxicity evaluation was negative. As hypothesized, the use of TiO2 and oxybenzone showed synergistic effects in the 3D printing of PPF tissue engineering scaffolds. Copyright © 2015 Elsevier B.V. All rights reserved.
Walker, Jason M; Bodamer, Emily; Krebs, Olivia; Luo, Yuanyuan; Kleinfehn, Alex; Becker, Matthew L; Dean, David
2017-04-10
Two distinct molecular masses of poly(propylene fumarate) (PPF) are combined with an additive manufacturing process to fabricate highly complex scaffolds possessing controlled chemical properties and porous architecture. Scaffolds were manufactured with two polymer molecular masses and two architecture styles. Degradation was assessed in an accelerated in vitro environment. The purpose of the degradation study is not to model or mimic in vivo degradation, but to efficiently compare the effect of modulating scaffold properties. This is the first study addressing degradation of chain-growth synthesized PPF, a process that allows for considerably more control over molecular mass distribution. It demonstrates that, with greater process control, not only is scaffold fabrication reproducible, but the mechanical properties and degradation kinetics can be tailored by altering the physical properties of the scaffold. This is a clear step forward in using PPF to address unmet medical needs while meeting regulatory demands and ultimately obtaining clinical relevancy.
Runge, M. Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J.
2011-01-01
Polycaprolactone fumarate (PCLF) is a cross-linkable derivate of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of the previously studied PCLF (PCLFDEG) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLFPPD) or glycerol (PCLFGLY). PCLFPPD is linear and resembles the previously studied PCLFDEG, while PCLFGLY is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLFPPD has material properties similar to the previously studied PCLFDEG. The branched PCLFGLY exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate FDA approvable sterilization method is addressed. This study shows that autoclave sterilization on PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. PMID:21911087
Shabbir, Maryam; Ali, Sajid; Raza, Moosa; Sharif, Ali; Akhtar, Furoan Muhammad; Manan, Abdul; Fazli, Ali Raza; Younas, Neelofar; Manzoor, Iqra
2017-01-01
A matrix transdermal patch of bisoprolol fumarate was formulated with different concentrations of Eudragit RS 100 and Methocel E5 with PEG 400 as plasticizer by solvent evaporation technique. Tween 80 was added to the optimized patch to evaluate the effect of permeation enhancer at different concentration through the excised rabbit's skin. The patches were analyzed for weight variation, drug content, swelling index, erosion studies, moisture content, moisture uptake, water vapor transmission rate (WVTR) and water vapor permeability (WVP). In vitro dissolution test was carried out in USP dissolution apparatus V to select the optimized formulation. In vitr skin permeation studies were done in Franz diffusion cell using rabbit skin as a model membrane. The cumulative drug release and flux were determined to compare the result of test patches with a control patch. The greatest enhancement ratio (ER) was obtained in F03-PE with 30% Tween 80. F03-PE seemed to follow zero order kinetics with super case II mechanism of drug release. Statistical ANOVA suggested that there was a significant difference in formulations, steady flux and cumulative permeation rate at different Tween 80 concentrations.
Balak, Deepak M W; Bouwes Bavinck, Jan Nico; de Vries, Aiko P J; Hartman, Jenny; Neumann, Hendrik A Martino; Zietse, Robert; Thio, Hok Bing
2016-02-01
Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37-46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28-111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome.
Díez-Pascual, Ana M; Díez-Vicente, Angel L
2017-09-01
Antibacterial and biocompatible SnO 2 nanorods have been easily synthesized through a hydrothermal process with the aid of a cationic surfactant, and incorporated as nanoreinforcements in poly(propylene fumarate-co-ethylene glycol) (P(PF-co-EG)) copolymer crosslinked with N-vinyl-pyrrolidone (NVP) by sonication and thermal curing. The nanorods were randomly and individually dispersed inside the P(PF-co-EG) network, and noticeably increased the thermal stability, hydrophilicity, degree of crystallinity, protein absorption capability as well as stiffness and strength of the matrix, whilst decreased its level of porosity and biodegradation rate. More importantly, the resulting nanocomposites retained adequate rigidity and strength after immersion in a simulated body fluid (SBF) at 37°C. They also exhibited biocide action against Gram-positive and Gram-negative bacteria; their antibacterial effect was strong under UV-light illumination whilst in dark conditions was only moderate. Further, they did not cause toxicity on human dermal fibroblasts. The friction coefficient and wear rate strongly decreased with increasing nanorod loading under both dry and SBF conditions; the greatest drops in SBF were about 18-fold and 13-fold, respectively, compared to those of the copolymer network. These novel biomaterials are good candidates to be applied in the field of soft-tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.
Evaluation of "Guia para Dejar de Fumar," a self-help guide in Spanish to quit smoking.
Pérez-Stable, E J; Sabogal, F; Marín, G; Marín, B V; Otero-Sabogal, R
1991-01-01
Because of the absence of culturally appropriate self-help smoking cessation materials for Latinos, a new Spanish language cessation guide, "Guia para Dejar de Fumar," was developed and evaluated. It was distributed as part of a community-wide intervention to decrease the prevalence of smoking. The "Guia" is an attractive full-color booklet written in universal Spanish that uses simple text and numerous photographs. Motivation to quit smoking is emphasized, and graphic demonstrations of the adverse health effects of smoking are included. A menu of quitting and maintenance techniques is presented. A total of 431 smokers were identified for evaluation at approximately 3, 6, and 12 months after receiving the "Guia." Self-reported quit rates declined from 21.1 percent at 2.5 months to 13.7 percent at 14 months; 8.4 percent of the sample had a validated quit status by saliva cotinine test at 1 year. Persons older than 44 years were more likely to remain nonsmokers, but sex, education, acculturation score, and cigarettes smoked per day did not predict smoking cessation. The components of the "Guia" most mentioned by those who were surveyed were the graphic photographs, the health emphasis, and the overall format. The authors concluded that the "Guia" is an appropriate self-help smoking cessation booklet for Spanish-speaking Latinos in the United States. PMID:1910191
Schneider, Sebastian; Strumpf, Annette; Schetelig, Johannes; Wunderlich, Gerd; Ehninger, Gerhard; Kotzerke, Jörg; Bornhäuser, Martin
2015-10-01
The combination of reduced-intensity conditioning, (188)rhenium anti-CD66 radioimmunotherapy, and in vivo T cell depletion was successfully applied in elderly patients with acute myeloid leukemia or myelodysplastic syndrome. Within a prospective phase II protocol, we investigated whether a dose reduction of alemtuzumab (from 75 mg to 50 mg MabCampath) would improve leukemia-free survival by reducing the incidence of relapse. Fifty-eight patients (median age, 67 years; range, 54 to 76) received radioimmunotherapy followed by fludarabine 150 mg/m(2) and busulfan 8 mg/kg combined with either 75 mg (n = 26) or 50 mg (n = 32) alemtuzumab. Although we observed a trend towards a shorter duration of neutropenia in the 50 mg group (median, 19 versus 21 days; P = .07), the time from transplantation to neutrophil and platelet engraftment as well as the overall incidence of engraftment did not differ. The incidence of severe acute graft-versus-host disease tended to be higher after the lower alemtuzumab dose (17% versus 4%; P = .15). No significant differences in the cumulative incidences of relapse (38% versus 35%; P = .81) or nonrelapse mortality (46% versus 27%; P = .31) were observed. Accordingly, disease-free and overall survival were not significantly different between groups. Although the feasibility of radioimmunotherapy plus reduced-intensity conditioning could be demonstrated in elderly patients, the dose reduction of alemtuzumab had no positive impact on overall outcome. Copyright © 2015 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
De Deyn, Peter Paul; Eriksson, Hans; Svensson, Hanna
2012-03-01
The objective of this study was to assess the safety and tolerability of extended-release quetiapine fumarate (quetiapine XR) compared with quetiapine immediate-release (quetiapine IR) in older patients with Alzheimer's disease with symptoms of psychosis and/or agitation. This was a 6-week, double-blind, double-dummy, randomised study. Of the 109 patients screened, 100 were randomised to receive quetiapine XR (n = 68) or quetiapine IR (n = 32), at doses of 50 and 25 mg/day, respectively. Treatment was escalated to 100 mg/day by Day 4. At Day 8, a flexible-dose (50-300 mg/day) period began when dose adjustment was made at the investigator's discretion. The primary variable was incidence and type of adverse events (AEs). Secondary variables included efficacy and other safety assessments. Mean daily doses were 143.6 and 142.0 mg in the quetiapine XR and quetiapine IR groups, respectively. Ninety patients completed the study; only one withdrew (in the quetiapine XR group) because of an AE. Laboratory evaluations identified severe neutropaenia (one patient), mild neutropaenia (three patients) and eosinophilia (five patients); however, these were not reported, as AEs and confounding factors, such as patient age, concomitant illness and medication, made it difficult to determine any relationship to quetiapine treatment. Numerical improvements from baseline were seen across both treatment groups in Neuropsychiatric Inventory frequency × severity total, Neuropsychiatric Inventory-Nursing Home version, Cohen-Mansfield Agitation Inventory, Clinical Global Impression-Severity of Illness and Clinical Global Impression-Improvement scores. Quetiapine XR dosed up to 300 mg/day was generally well tolerated, with a similar profile to that of quetiapine IR. Copyright © 2011 John Wiley & Sons, Ltd.
McGuire, Victoria A; Ruiz-Zorrilla Diez, Tamara; Emmerich, Christoph H; Strickson, Sam; Ritorto, Maria Stella; Sutavani, Ruhcha V; Weiβ, Anne; Houslay, Kirsty F; Knebel, Axel; Meakin, Paul J; Phair, Iain R; Ashford, Michael L J; Trost, Matthias; Arthur, J Simon C
2016-08-08
Dimethyl fumarate (DMF) possesses anti-inflammatory properties and is approved for the treatment of psoriasis and multiple sclerosis. While clinically effective, its molecular target has remained elusive - although it is known to activate anti-oxidant pathways. We find that DMF inhibits pro-inflammatory cytokine production in response to TLR agonists independently of the Nrf2-Keap1 anti-oxidant pathway. Instead we show that DMF can inhibit the E2 conjugating enzymes involved in K63 and M1 polyubiquitin chain formation both in vitro and in cells. The formation of K63 and M1 chains is required to link TLR activation to downstream signaling, and consistent with the block in K63 and/or M1 chain formation, DMF inhibits NFκB and ERK1/2 activation, resulting in a loss of pro-inflammatory cytokine production. Together these results reveal a new molecular target for DMF and show that a clinically approved drug inhibits M1 and K63 chain formation in TLR induced signaling complexes. Selective targeting of E2s may therefore be a viable strategy for autoimmunity.
Kim, Yu Kyong; Choi, Mun Ju; Oh, Tae Young; Yu, Kyung-Sang; Lee, SeungHwan
2017-01-01
A novel orotic acid salt form of tenofovir disoproxil (DA-2802) was developed and is expected to replace the fumaric acid salt form. The pharmacokinetic (PK) characteristics and tolerability profiles of DA-2802 were compared to those of tenofovir disoproxil fumarate (TDF, Viread®) in healthy subjects. A randomized, open-label, single-dose study was conducted in 36 healthy subjects using a two-treatment, two-period, and two-sequence crossover design. Subjects received a single oral dose of 319 mg DA-2802 or 300 mg TDF, during each period, with a 7-day washout. Serial blood samples were collected pre-dosing and up to 72 hours post-dosing in each period, for determination of serum tenofovir concentration, which was measured by ultra-performance liquid chromatography-tandem mass spectrometry. A non-compartmental method was used to obtain PK parameters of tenofovir. For comparison between the two tenofovir disoproxil salts, the 90% confidence intervals (90% CIs) of geometric mean ratios of DA-2802 to TDF for the maximum concentration (Cmax) and the area under the concentration–time curve to the last quantifiable concentration (AUC0–t) were determined. The tolerability profiles of tenofovir were assessed by evaluation of adverse events and vital signs, physical examination, ECG, and clinical laboratory tests. The serum tenofovir concentration–time profiles of DA-2802 or TDF were comparable in 32 subjects who completed the study. In both profiles, a two-compartmental elimination with first-order elimination kinetics in the terminal phase was reported in a few subjects, showing a secondary peak in the initial phase of elimination. The geometric mean ratio (90% CI) of DA-2802 to TDF was 0.898 (0.815–0.990) for Cmax and 0.904 (0.836–0.978) for AUC0–t. There were no clinically significant findings in the tolerability assessments. DA-2802 showed comparable PK characteristics and tolerability profiles to TDF. PMID:29158663
Tenofovir disoproxil fumarate safety for women and their infants during pregnancy and breastfeeding.
Mofenson, Lynne M; Baggaley, Rachel C; Mameletzis, Ioannis
2017-01-14
Pregnant/lactating women in some sub-Saharan Africa settings are at substantial risk of HIV acquisition and could benefit from preexposure prophylaxis (PrEP) with tenofovir disoproxil fumarate (TDF), but safety data in pregnancy/lactation are limited. Systematic data review through August 2016. We reviewed research reports/conference abstracts with maternal/child adverse outcome data in HIV-infected and HIV-uninfected pregnant/lactating women receiving TDF alone or in combination with other drugs compared with non-TDF regimens. In total, 26 articles in HIV-infected and seven in HIV-uninfected women were identified. No statistically significant differences were observed between TDF and comparison non-TDF regimens in pregnancy incidence, stillbirth/pregnancy loss, preterm delivery less than 37 weeks, low birth weight <2500/<1500 g, small for gestational age, birth defects, or infant (>14 days) or maternal mortality. One study reported significantly higher very preterm delivery (<34 weeks) and neonatal mortality with TDF versus non-TDF antiretroviral therapy (ART), but no significant difference between TDF ART and zidovudine/single-dose nevirapine. Most studies report normal infant linear growth; one study showed slightly lower, and one higher 1-year length-for-age z-score in TDF ART-exposed infants. No significant differences were reported in abnormal laboratory values or bone markers between TDF and non-TDF-exposed infants in four studies. Lower maternal bone mineral density was observed at 74 weeks postpartum in breastfeeding women on TDF ART compared with no ART in one study. Given available safety data, there does not appear to be a safety-related rationale for prohibiting PrEP during pregnancy/lactation or for discontinuing PrEP in HIV-uninfected women receiving PrEP who become pregnant and are at continuing risk of HIV acquisition.
Characterization of lymphopenia in patients with MS treated with dimethyl fumarate and fingolimod
Nakhaei-Nejad, Maryam; Barilla, David; Lee, Chieh-Hsin; Blevins, Gregg
2017-01-01
Objective: Lymphopenia is a common occurrence of disease-modifying therapies (DMTs) for relapsing-remitting MS (RRMS). The aim of this study was to dissect the prevalence of various lymphocyte subsets in patients with RRMS treated with 2 DMTs commonly associated with lymphopenia, dimethyl fumarate (DMF), and fingolimod (FTY). Methods: Multicolor flow cytometry and multiplex assays were used to identify up to 50 lymphocyte subpopulations and to examine the expression of multiple cytokines in selected patients. We compared patients untreated (NT) or treated with FTY or DMF who did (DMF-L) or did not (DMF-N) develop lymphopenia. Results: All FTY patients developed lymphopenia in both T-cell and B-cell compartments. CD41 T cells were more affected by this treatment than CD81 cells. In the B-cell compartment, the CD271IgD2 subpopulation was reduced. T cells but not B cells were significantly reduced in DMF-L. However, within the B cells, CD271 cells were significantly lower. Both CD41 and CD81 subpopulations were reduced in DMF-L. Within the remaining CD41 and CD81 compartments, there was an expansion of the naive subpopulation and a reduction of the effector memory subpopulation. Unactivated lymphocyte from DMF-L patients had significantly higher levels of interferon-γ, interleukin (IL)-12, IL-2, IL-4, IL-6, and IL-1β compared with DMF-N. In plasma, TNFβ was significantly higher in DMF-N and DMF-L compared with NT, whereas CCL17 was significantly higher in DMF-L compared with NT and DMF-N. Conclusions: This study shows that different treatments can target different lymphocyte compartments and suggests that lymphopenia can induce compensatory mechanisms to maintain immune homeostasis. PMID:29296636
Bayés, M; Rabasseda, X; Prous, J R
2005-12-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: 131I-chTNT; Abatacept, adalimumab, alemtuzumab, APC-8015, aprepitant, atazanavir sulfate, atomoxetine hydrochloride, azimilide hydrochloride; Bevacizumab, bortezomib, bosentan, buserelin; Caspofungin acetate, CC-4047, ChAGCD3, ciclesonide, clopidogrel, curcumin, Cypher; Dabigatran etexilate, dapoxetine hydrochloride, darbepoetin alfa, darusentan, denosumab, DMXB-Anabaseine, drospirenone, drospirenone/estradiol, duloxetine hydrochloride, dutasteride; Edodekin alfa, efaproxiral sodium, elaidic acid-cytarabine, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, eszopiclone, etonogestrel/testosterone decanoate, exenatide; Fulvestrant; Gefitinib, glycine, GVS-111; Homoharringtonine; ICC-1132, imatinib mesylate, iodine (I131) tositumomab, i.v. gamma-globulin; Levetiracetam, levocetirizine, lintuzumab, liposomal nystatin, lumiracoxib, lurtotecan; Manitimus, mapatumumab, melatonin, micafungin sodium, mycophenolic acid sodium salt; Oblimersen sodium, OGX-011, olmesartan medoxomil, omalizumab, omapatrilat, oral insulin; Parathyroid hormone (human recombinant), pasireotide, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, phVEGF-A165, pimecrolimus, pitavastatin calcium, plerixafor hydrochloride, posaconazole, pramlintide acetate, prasterone, pregabalin, PT-141; Quercetin; Ranolazine, rosuvastatin calcium, rubitecan, rupatadine fumarate; Sardomozide, sunitinib malate; Tadalafil, talactoferrin alfa, tegaserod maleate, telithromycin, testosterone transdermal patch, TH-9507, tigecycline, tiotropium bromide, tipifarnib, tocilizumab, treprostinil sodium; Valdecoxib, vandetanib
Henke, Matthias; Baumer, Julia; Blunk, Torsten; Tessmar, Joerg
2014-03-01
Radically cross-linked hydrogels are frequently used as cell carriers due to their excellent biocompatibility and their tissue-like mechanical properties. Through frequent investigation, PEG-based polymers such as oligo(poly(ethylene glycol)fumarate [OPF] have proven to be especially suitable as cell carriers by encapsulating cells during hydrogel formation. In some cases, NaCl or biodegradable gelatin microparticles were added prior to cross-linking in order to provide space for the proliferating cells, which would otherwise stay embedded in the hydrogel matrix. However, all of these immediate cross-linking procedures involve time consuming sample preparation and sterilization directly before cell culture and often show notable swelling after their preparation. In this study, ready to use OPF-hydrogel scaffolds were prepared by gas foaming, freeze drying, individual packing into bags and subsequent γ-sterilization. The scaffolds could be stored and used "off-the-shelf" without any need for further processing prior to cell culture. Thus the handling was simplified and the sterility of the cell carrier was assured. Further improvement of the gel system was achieved using a two component injectable system, which may be used for homogenous injection molding in order to create individually shaped three dimensional scaffolds. In order to evaluate the suitability of the scaffolds for tissue engineering, constructs were seeded with juvenile bovine chondrocytes and cultured for 28 days. Cross-sections of the respective constructs showed an intense and homogenous red staining of GAG with safranin O, indicating a homogenous cell distribution within the scaffolds and the production of substantial amounts of GAG-rich matrix. Copyright © 2012 John Wiley & Sons, Ltd.
Lastres-Becker, Isabel; García-Yagüe, Angel J; Scannevin, Robert H; Casarejos, María J; Kügler, Sebastian; Rábano, Alberto; Cuadrado, Antonio
2016-07-10
This preclinical study was aimed at determining whether pharmacological targeting of transcription factor NRF2, a master controller of many homeostatic genes, might provide a disease-modifying therapy in the animal model of Parkinson's disease (PD) that best reproduces the main hallmark of this pathology, that is, α-synucleinopathy, and associated events, including nigral dopaminergic cell death, oxidative stress, and neuroinflammation. Pharmacological activation of NRF2 was achieved at the basal ganglia by repurposing dimethyl fumarate (DMF), a drug already in use for the treatment of multiple sclerosis. Daily oral gavage of DMF protected nigral dopaminergic neurons against α-SYN toxicity and decreased astrocytosis and microgliosis after 1, 3, and 8 weeks from stereotaxic delivery to the ventral midbrain of recombinant adeno-associated viral vector expressing human α-synuclein. This protective effect was not observed in Nrf2-knockout mice. In vitro studies indicated that this neuroprotective effect was correlated with altered regulation of autophagy markers SQTSM1/p62 and LC3 in MN9D, BV2, and IMA 2.1 and with a shift in microglial dynamics toward a less pro-inflammatory and a more wound-healing phenotype. In postmortem samples of PD patients, the cytoprotective proteins associated with NRF2 expression, NQO1 and p62, were partly sequestered in Lewy bodies, suggesting impaired neuroprotective capacity of the NRF2 signature. These experiments provide a compelling rationale for targeting NRF2 with DMF as a therapeutic strategy to reinforce endogenous brain defense mechanisms against PD-associated synucleinopathy. DMF is ready for clinical validation in PD. Antioxid. Redox Signal. 25, 61-77.
Polyclonal and monoclonal antibodies for induction therapy in kidney transplant recipients.
Hill, Penny; Cross, Nicholas B; Barnett, A Nicholas R; Palmer, Suetonia C; Webster, Angela C
2017-01-11
(CNI) treatment. ATG (with CNI therapy) had uncertain effects on death (3 to 6 months, 3 studies: RR 0.41, 0.13 to 1.22; 1 to 2 years, 5 studies: RR 0.75, 0.27 to 2.06; 5 years, 2 studies: RR 0.94, 0.11 to 7.81) and graft loss (3 to 6 months, 4 studies: RR 0.60, 0.34 to 1.05; 1 to 2 years, 3 studies: RR 0.65, 0.36 to 1.19). The effect of ATG on death-censored graft loss was uncertain at 1 to 2 years and 5 years. In non-CNI studies, ATG had uncertain effects on death but reduced death-censored graft loss (6 studies: RR 0.55, 0.38 to 0.78). When CNI and older non-CNI studies were combined, a benefit was seen with ATG at 1 to 2 years for both all-cause graft loss (7 studies: RR 0.71, 0.53 to 0.95) and death-censored graft loss (8 studies: RR 0.55, 0.39 to 0.77) but not sustained longer term. ATG increased cytomegalovirus (CMV) infection (6 studies: RR 1.55, 1.24 to 1.95), leucopenia (4 studies: RR 3.86, 2.79 to 5.34) and thrombocytopenia (4 studies: RR 2.41, 1.61 to 3.61) but had uncertain effects on delayed graft function, malignancy, post-transplant lymphoproliferative disorder (PTLD), and new onset diabetes after transplantation (NODAT).Alemtuzumab was compared to ATG in six studies (446 patients) with early steroid withdrawal (ESW) or steroid minimisation. Alemtuzumab plus steroid minimisation reduced acute rejection compared to ATG at one year (4 studies: RR 0.57, 0.35 to 0.93). In the two studies with ESW only in the alemtuzumab arm, the effect of alemtuzumab on acute rejection at 1 year was uncertain compared to ATG (RR 1.27, 0.50 to 3.19). Alemtuzumab had uncertain effects on death (1 year, 2 studies: RR 0.39, 0.06 to 2.42; 2 to 3 years, 3 studies: RR 0.67, 95% CI 0.15 to 2.95), graft loss (1 year, 2 studies: RR 0.39, 0.13 to 1.30; 2 to 3 years, 3 studies: RR 0.98, 95% CI 0.47 to 2.06), and death-censored graft loss (1 year, 2 studies: RR 0.38, 0.08 to 1.81; 2 to 3 years, 3 studies: RR 2.45, 95% CI 0.67 to 8.97) compared to ATG. Creatinine clearance was lower with
Balak, Deepak M.W.; Bouwes Bavinck, Jan Nico; de Vries, Aiko P.J.; Hartman, Jenny; Neumann, Hendrik A. Martino; Zietse, Robert; Thio, Hok Bing
2016-01-01
Background Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Methods Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. Results All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37–46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28–111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. Conclusions FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome. PMID:26798466
Mesquita, Pedro M M; Rastogi, Rachna; Segarra, Theodore J; Teller, Ryan S; Torres, N Merna; Huber, Ashley M; Kiser, Patrick F; Herold, Betsy C
2012-07-01
A safe and effective topical prevention strategy will likely require sustained delivery of potent antiviral drugs and a delivery system that simultaneously maximizes drug distribution and overcomes the behavioural challenges related to adherence. Activity against HIV and herpes simplex virus (HSV) would be advantageous, given the epidemiological link between the two pathogens. We hypothesize that tenofovir disoproxil fumarate (tenofovir DF), a prodrug of tenofovir, may be more potent than tenofovir and ideal for sustained intravaginal ring (IVR) delivery. The anti-HIV and anti-HSV activity of tenofovir and tenofovir DF were assessed in cell and explant models. Cumulative tenofovir DF release and stability from polyether urethane (PEU), ethylene-co-vinyl acetate (EVA) and silicone IVRs were compared, and the activity and safety of drug released were evaluated in cervical explants and in a polarized dual-chamber model. Tenofovir DF inhibited HIV and HSV at ≈ 100-fold lower concentrations than tenofovir and retained activity in the presence of semen. PEU rings delivered >1 mg/day of tenofovir DF for 30 days. Pre-treatment of cervical explants with 10 μg/mL tenofovir DF or eluants from PEU minirings resulted in >90% inhibition of HIV and reduced HSV-2 yields by 2.5 log. Tenofovir DF and eluants did not prevent cell growth or polarization, or have any deleterious effects on an epithelial barrier. The findings support the development of a PEU tenofovir DF ring, which may provide potent and sustained protection against HIV and HSV.
Hazra, Rohan; Balis, Frank M; Tullio, Antonella N; DeCarlo, Ellen; Worrell, Carol J; Steinberg, Seth M; Flaherty, John F; Yale, Kitty; Poblenz, Marianne; Kearney, Brian P; Zhong, Lijie; Coakley, Dion F; Blanche, Stephane; Bresson, Jean Louis; Zuckerman, Judith A; Zeichner, Steven L
2004-01-01
Tenofovir disoproxil fumarate (DF) is a potent nucleotide analog reverse transcriptase inhibitor approved for the treatment of human immunodeficiency virus (HIV)-infected adults. The single-dose and steady-state pharmacokinetics of tenofovir were evaluated following administration of tenofovir DF in treatment-experienced HIV-infected children requiring a change in antiretroviral therapy. Using increments of tenofovir DF 75-mg tablets, the target dose was 175 mg/m(2); the median administered dose was 208 mg/m(2). Single-dose pharmacokinetics were evaluated in 18 subjects, and the geometric mean area under the concentration-time curve from 0 h to infinity (AUC(0- infinity )) was 2,150 ng. h/ml and the geometric mean maximum concentration (C(max)) was 266 ng/ml. Subsequently, other antiretrovirals were added to each patient's regimen based upon treatment history and baseline viral resistance results. Steady-state pharmacokinetics were evaluated in 16 subjects at week 4. The steady-state, geometric mean AUC for the 24-h dosing interval was 2,920 ng. h/ml and was significantly higher than the AUC(0- infinity ) after the first dose (P = 0.0004). The geometric mean C(max) at steady state was 302 ng/ml. Tenofovir DF was generally very well tolerated. Steady-state tenofovir exposures in children receiving tenofovir DF-containing combination antiretroviral therapy approached values seen in HIV-infected adults (AUC, approximately 3,000 ng. h/ml; C(max), approximately 300 ng/ml) treated with tenofovir DF at 300 mg.
Sethi, Sanjay; Fogarty, Charles; Hanania, Nicola A; Martinez, Fernando J; Rennard, Stephen; Fries, Michael; Orevillo, Chad; Darken, Patrick; St Rose, Earl; Strom, Shannon; Fischer, Tracy; Golden, Michael; Dwivedi, Sarvajna; Reisner, Colin
2016-11-17
Background: Co-Suspension™ Delivery Technology offers a novel pharmaceutical platform for inhaled drug therapy. This randomized, double-blind, placebo-controlled, single-dose study (NCT01349868) evaluated the efficacy of a range of doses for formoterol fumarate (FF) delivered using Co-Suspension delivery technology via a pressurized metered dose inhaler (MDI) versus placebo in patients with moderate-to-severe chronic obstructive pulmonary disease (COPD). Secondary objectives included determination of non-inferior efficacy and systemic exposure compared with open-label Foradil ® 12 μg (Foradil ® Aerolizer ® ; formoterol fumarate dry powder inhaler). Methods: Patients received each of the 6 study treatments (FF MDI [7.2, 9.6 and 19.2μg], placebo MDI and open-label Foradil ® [12 and 24µg]), separated by 3-10 days. Spirometry was performed 60 and 30 minutes prior to and at regular intervals up to 12 hours post-administration of study drug. The primary outcome measure was the change in forced expiratory volume in 1 second (FEV 1 ) area under the curve between 0 and 12 hours (AUC 0-12 ) relative to test day baseline. Results: A total of 50 patients were randomized to study treatment sequences. All doses of FF MDI demonstrated superiority to placebo ( p <0.0001) and non-inferiority to Foradil ® 12μg, on bronchodilator outcome measures. No serious adverse events were reported during the study. Conclusions: This study demonstrates non-inferiority of bronchodilator response and bioequivalent exposure of FF MDI 9.6μg to Foradil ® 12μg, with both agents exhibiting a similar safety profile in patients with moderate-to-severe COPD. This study supports the selection of FF MDI 9.6µg for further evaluation in Phase III trials.
Lu, Zheng; Imlay, James A
2017-01-03
The impact of oxidative stress upon organismal fitness is most apparent in the phenomenon of obligate anaerobiosis. The root cause may be multifaceted, but the intracellular generation of reactive oxygen species (ROS) likely plays a key role. ROS are formed when redox enzymes accidentally transfer electrons to oxygen rather than to their physiological substrates. In this study, we confirm that the predominant intestinal anaerobe Bacteroides thetaiotaomicron generates intracellular ROS at a very high rate when it is aerated. Fumarate reductase (Frd) is a prominent enzyme in the anaerobic metabolism of many bacteria, including B. thetaiotaomicron, and prior studies of Escherichia coli Frd showed that the enzyme is unusually prone to ROS generation. Surprisingly, in this study biochemical analysis demonstrated that the B. thetaiotaomicron Frd does not react with oxygen at all: neither superoxide nor hydrogen peroxide is formed. Subunit-swapping experiments indicated that this difference does not derive from the flavoprotein subunit at which ROS normally arise. Experiments with the related enzyme succinate dehydrogenase discouraged the hypothesis that heme moieties are responsible. Thus, resistance to oxidation may reflect a shift of electron density away from the flavin moiety toward the iron-sulfur clusters. This study shows that the autoxidizability of a redox enzyme can be suppressed by subtle modifications that do not compromise its physiological function. One implication is that selective pressures might enhance the oxygen tolerance of an organism by manipulating the electronic properties of its redox enzymes so they do not generate ROS. Whether in sediments or pathogenic biofilms, the structures of microbial communities are configured around the sensitivities of their members to oxygen. Oxygen triggers the intracellular formation of reactive oxygen species (ROS), and the sensitivity of a microbe to oxygen likely depends upon the rates at which ROS are formed
Todd, Catherine S; Deese, Jennifer; Wang, Meng; Hubacher, David; Steiner, Markus J; Otunga, Sheila; Van Damme, Lut
2015-03-01
The objective was to assess associations between tenofovir disoproxil fumarate-emtricitabine (TDF-FTC) exposure and levonorgestrel (LNG) concentrations among Kenyan HIV prevention trial participants using Sino-implant (II) LNG implants for contraception. Women were offered implants among other contraceptive methods, were randomized to daily TDF-FTC or placebo, and followed monthly up to 56weeks. Associations between TDF-FTC exposure and mean LNG values were analyzed with linear mixed models. Of 739 women, 29 (3.9%) received implants with no incident pregnancies and one discontinuation. Mean LNG concentrations over 56weeks among 28 women contributing data ranged between 214.0 and 659.8pg/mL with no significant difference between TDF-FTC and placebo arms or between variable levels of TDF-FTC adherence. Concomitant TDF-FTC use was not associated with a significant change in plasma LNG concentrations among women using Sino-implant (II) in the first year of use. Copyright © 2015 Elsevier Inc. All rights reserved.
Bayés, M; Rabasseda, X; Prous, J R
2007-12-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Intergrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 249553, 2-Methoxyestradiol; Abatacept, Adalimumab, Adefovir dipivoxil, Agalsidase beta, Albinterferon alfa-2b, Aliskiren fumarate, Alovudine, Amdoxovir, Amlodipine besylate/atorvastatin calcium, Amrubicin hydrochloride, Anakinra, AQ-13, Aripiprazole, AS-1404, Asoprisnil, Atacicept, Atrasentan; Belimumab, Bevacizumab, Bortezomib, Bosentan, Botulinum toxin type B, Brivaracetam; Catumaxomab, Cediranib, Cetuximab, cG250, Ciclesonide, Cinacalcet hydrochloride, Curcumin, Cypher; Darbepoetin alfa, Denosumab, Dihydrexidine; Eicosapentaenoic acid/docosahexaenoic acid, Entecavir, Erlotinib hydrochloride, Escitalopram oxalate, Etoricoxib, Everolimus, Ezetimibe; Febuxostat, Fenspiride hydrochloride, Fondaparinux sodium; Gefitinib, Ghrelin (human), GSK-1562902A; HSV-tk/GCV; Iclaprim, Imatinib mesylate, Imexon, Indacaterol, Insulinotropin, ISIS-112989; L-Alanosine, Lapatinib ditosylate, Laropiprant; Methoxy polyethylene glycol-epoetin-beta, Mipomersen sodium, Motexafin gadolinium; Natalizumab, Nimotuzumab; OSC, Ozarelix; PACAP-38, Paclitaxel nanoparticles, Parathyroid Hormone-Related Protein-(1-36), Pasireotide, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Pemetrexed disodium, Pertuzumab, Picoplatin, Pimecrolimus, Pitavastatin calcium, Plitidepsin; Ranelic acid distrontium salt, Ranolazine, Recombinant human relaxin H2, Regadenoson, RFB4(dsFv)-PE38, RO-3300074, Rosuvastatin calcium; SIR-Spheres, Solifenacin succinate, Sorafenib, Sunitinib malate; Tadalafil, Talabostat, Taribavirin hydrochloride, Taxus, Temsirolimus, Teriparatide, Tiotropium bromide, Tipifarnib, Tirapazamine, Tocilizumab; UCN-01, Ularitide
Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen
2011-01-01
Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.
Majkutewicz, Irena; Kurowska, Ewelina; Podlacha, Magdalena; Myślińska, Dorota; Grembecka, Beata; Ruciński, Jan; Plucińska, Karolina; Jerzemowska, Grażyna; Wrona, Danuta
2016-07-15
Intracerebroventricular (ICV) injection of streptozotocin (STZ) is a widely-accepted animal model of sporadic Alzheimer's disease (sAD). The present study evaluated the ability of dimethyl fumarate (DMF), an agent with antioxidant and anti-inflammatory properties, to prevent spatial memory impairments and hippocampal neurodegeneration mediated by ICV injection of STZ in 4-month-old rats. Rodent chow containing DMF (0.4%) or standard rodent chow was made available on day 0. Rat body weight and food intake were measured daily for whole the experiment (21days). STZ or vehicle (SHAM) ICV injections were performed on days 2 and 4. Spatial reference and working memory were evaluated using the Morris water maze on days 14-21. Cells containing Fluoro-Jade B (neurodegeneration marker), IL-6, IL-10 were quantified in the hippocampus and choline acetyltransferase (ChAT) in the basal forebrain. The disruption of spatial memory and a high density of hippocampal CA1-3 cells labeled with Fluoro-Jade B or containing IL-6 or IL-10 were observed in the STZ group but not in the STZ+DMF group, as compared to the SHAM or SHAM+DMF groups. STZ vs. STZ+DMF differences were found: worse reference memory acquisition, fewer ChAT-positive neurons in the medial septum (Ch1), more Fluoro-Jade-positive CA1 hippocampal cells in STZ rats. DMF therapy in a rodent model of sAD prevented the disruption of spatial reference and working memory, loss of Ch1 cholinergic cells and hippocampal neurodegeneration as well as the induction of IL-6 and IL-10 in CA1. These beneficial cognitive and molecular effects validate the anti-inflammatory and neuroprotective properties of DMF in the hippocampus. Copyright © 2016 Elsevier B.V. All rights reserved.
Fingolimod vs dimethyl fumarate in multiple sclerosis: A real-world propensity score-matched study.
Prosperini, Luca; Lucchini, Matteo; Haggiag, Shalom; Bellantonio, Paolo; Bianco, Assunta; Buscarinu, Maria Chiara; Buttari, Fabio; Centonze, Diego; Cortese, Antonio; De Giglio, Laura; Fantozzi, Roberta; Ferraro, Elisabetta; Fornasiero, Arianna; Francia, Ada; Galgani, Simonetta; Gasperini, Claudio; Marfia, Girolama Alessandra; Millefiorini, Enrico; Nociti, Viviana; Pontecorvo, Simona; Pozzilli, Carlo; Ruggieri, Serena; Salvetti, Marco; Sgarlata, Eleonora; Mirabella, Massimiliano
2018-06-06
To directly compare fingolimod (FNG) and dimethyl fumarate (DMF) on no evident disease activity (NEDA) status in patients with relapsing-remitting multiple sclerosis (RRMS) from 7 multiple sclerosis outpatient clinics in Central Italy. We analyzed data of patients with RRMS who started an oral agent, namely DMF or FNG, either as first treatment (naives) or after switching from self-injectable drugs (switchers). We performed a propensity score (PS)-based nearest-neighbor matching within a caliper of 0.05 to select patients with homogeneous baseline characteristics. Pairwise censoring was adopted to adjust for difference in length of follow-up between the 2 treatment groups. Comparisons were then conducted in matched samples with Cox models (stratified by center) with NEDA-3 as the main outcome. NEDA-3 was defined as no relapses, no disability worsening, and no MRI activity. Overall, 483 and 456 patients eligible for analysis started on FNG and DMF, respectively. The PS-matching procedure retained a total of 550 patients (275 per group). After a median on-study follow-up of 18 months, the proportions of patients with NEDA-3 were similar (FNG 73%, DMF 70%; hazard ratio [HR] 0.74, p = 0.078). Subgroup analyses showed a comparable effectiveness of the 2 drugs in naives (n = 170, HR 1.15, p = 0.689), whereas FNG was superior to DMF in the achievement of NEDA-3 status among switchers (n = 380, HR 0.57, p = 0.007). We found no significant difference between FNG and DMF on NEDA-3 status, while subgroup analyses suggest the superiority of FNG over DMF in patients switching from self-injectable drugs. This study provides Class IV evidence that for patients with RRMS, DMF and FNG have comparable efficacy in treatment-naive patients and that FNG is superior to DMF in patients switching from self-injectable drugs. © 2018 American Academy of Neurology.
NASA Astrophysics Data System (ADS)
Peer Mohamed, M.; Jayaprakash, P.; Nageshwari, M.; Rathika Thaya Kumari, C.; Sangeetha, P.; Sudha, S.; Mani, G.; Lydia Caroline, M.
2017-08-01
A new organic active nonlinear optical crystal L-tryptophan fumaric acid water (1/1/1), (C15H17N2 O7. H2O)(LTFAW), consisting of zwitterion tryptophan molecule in conjunction with a fumaric acid molecule and a water molecule was grown by slow solvent evaporation technique from aqueous solution. The organic chromophore crystallizes from water in its zwitterions exhibiting tabular habit in monoclinic system with acentric space group C2 (Z = 4). The sharp peaks observed in Powder X-ray diffractogram depicts the crystalline nature. The presence of functional groups in the grown crystal was analyzed using FT-IR spectrum. The carbon and hydrogen environment in molecular structure was investigated using FT-NMR technique using deuterated DMSO solution. Ultraviolet-visible spectral analysis reveal that the crystal possess lower cut-off wavelength down to 275 nm, is a key factor to exhibit Second Harmonic Generation (SHG) signal. The direct optical band gap is evaluated to be 5.28 eV from the UV absorption profile. The evaluation of optical constants by employing UV-visible absorbance data such as, extinction coefficient, reflectance, refractive index, optical conductivity are supportive towards good performance as NLO devices. Temperature of decomposition was investigated using thermogravimetric analysis/differential thermal analysis techniques (TG/DTA). The luminescence profile exhibited two peaks (362 nm, 683 nm) due to the donation of protons from carboxylic group to amino group. The nonlinear optical behavior from the noncentrosymmetric crystal was observed by the generation of frequency doubled (2ω) optical radiation when subjected to pulsed Nd:YAG laser (1064 nm, 10 ns, 10 Hz) using Kurtz-Perry method. The variation of dielectric constant (εʹ) and dielectric loss (εʹʹ) vs. Log f for the title compound was analysed at a few selected temperatures and frequencies.
NASA Astrophysics Data System (ADS)
Takahashi, Hirona; Hagiwara, Kenta; Kawai, Akio
2016-11-01
Addition reaction of photo-generated radicals to double bonds of diethyl fumarate (deF) and diethyl maleate (deM), which are geometrical isomers, was studied by means of time-resolved- (TR-) and pulsed-electron paramagnetic resonance (EPR). Analysis of TR-EPR spectra indicates that adduct radicals from deF and deM should have the same structure. The double bonds of these monomers are converted to single ones by addition reaction, which allows hindered internal rotation to give the same structure of adduct radical. The rate constants for addition reaction of photo-generated radicals were determined by Stern-Volmer analysis of the decay time of electron spin-echo intensity of these radicals measured by the pulsed EPR method. Rate constants for deF were found to be larger than those for deM. This relation is in good consistent with efficiency of polymerisation of deF and deM. Experimentally determined rate constants were evaluated by introducing the addition reaction model on the basis of two important factors enthalpy and polar effects.
Jose, Sophie; Hamzah, Lisa; Campbell, Lucy J; Hill, Teresa; Fisher, Martin; Leen, Clifford; Gilson, Richard; Walsh, John; Nelson, Mark; Hay, Phillip; Johnson, Margaret; Chadwick, David; Nitsch, Dorothea; Jones, Rachael; Sabin, Caroline A; Post, Frank A
2014-08-01
Tenofovir disoproxil fumarate (TDF) has been linked to renal impairment, but the extent to which this impairment is reversible is unclear. We aimed to investigate the reversibility of renal decline during TDF therapy. Cox proportional hazards models assessed factors associated with discontinuing TDF in those with an exposure duration of >6 months. In those who discontinued TDF therapy, linear piecewise regression models estimated glomerular filtration rate (eGFR) slopes before initiation of, during, and after discontinuation of TDF therapy. Factors associated with not achieving eGFR recovery 6 months after discontinuing TDF were assessed using multivariable logistic regression. We observed declines in the eGFR during TDF exposure (mean slopes, -15.7 mL/minute/1.73 m(2)/year [95% confidence interval {CI}, -20.5 to -10.9] during the first 3 months and -3.1 mL/minute/1.73 m(2)/year [95% CI, -4.6 to -1.7] thereafter) and evidence of eGFR increases following discontinuation of TDF therapy (mean slopes, 12.5 mL/minute/1.73 m(2)/year [95% CI, 8.9-16.1] during the first 3 months and 0.8 mL/minute/1.73 m(2)/year [95% CI, .1-1.5] thereafter). Following TDF discontinuation, 38.6% of patients with a decline in the eGFR did not experience recovery. A higher eGFR at baseline, a lower eGFR after discontinuation of TDF therapy, and more-prolonged exposure to TDF were associated with an increased risk of incomplete recovery 6 months after discontinuation of TDF therapy. This study shows that a decline in the eGFR during TDF therapy was not fully reversible in one third of patients and suggests that prolonged TDF exposure at a low eGFR should be avoided. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.
Jose, Sophie; Hamzah, Lisa; Campbell, Lucy J.; Hill, Teresa; Fisher, Martin; Leen, Clifford; Gilson, Richard; Walsh, John; Nelson, Mark; Hay, Phillip; Johnson, Margaret; Chadwick, David; Nitsch, Dorothea; Jones, Rachael; Sabin, Caroline A.; Post, Frank A.; Ainsworth, Jonathan; Anderson, Jane; Babiker, Abdel; Chadwick, David; Delpech, Valerie; Dunn, David; Fisher, Martin; Gazzard, Brian; Gilson, Richard; Gompels, Mark; Hay, Phillip; Hill, Teresa; Johnson, Margaret; Kegg, Stephen; Leen, Clifford; Nelson, Mark; Orkin, Chloe; Palfreeman, Adrian; Phillips, Andrew; Pillay, Deenan; Post, Frank; Sabin, Caroline; Sachikonye, Memory; Schwenk, Achim; Walsh, John; Hill, Teresa; Huntington, Susie; Josie, Sophie; Phillips, Andrew; Sabin, Caroline; Thornton, Alicia; Dunn, David; Glabay, Adam; Orkin, C.; Garrett, N.; Lynch, J.; Hand, J.; de Souza, C.; Fisher, M.; Perry, N.; Tilbury, S.; Churchill, D.; Gazzard, B.; Nelson, M.; Waxman, M.; Asboe, D.; Mandalia, S.; Delpech, V.; Anderson, J.; Munshi, S.; Korat, H.; Poulton, M.; Taylor, C.; Gleisner, Z.; Campbell, L.; Babiker, Abdel; Dunn, David; Glabay, Adam; Gilson, R.; Brima, N.; Williams, I.; Schwenk, A.; Ainsworth, J.; Wood, C.; Miller, S.; Johnson, M.; Youle, M.; Lampe, F.; Smith, C.; Grabowska, H.; Chaloner, C.; Puradiredja, D.; Walsh, J.; Weber, J.; Ramzan, F.; Mackie, N.; Winston, A.; Leen, C.; Wilson, A.; Gompels, M.; Allan, S.; Palfreeman, A.; Moore, A.; Chadwick, D.; Wakeman, K.; Kegg, Stephen; Main, Paul; Mitchell; Hunter; Sachikonye, Memory; Hay, Phillip; Dhillon, Mandip
2014-01-01
Background. Tenofovir disoproxil fumarate (TDF) has been linked to renal impairment, but the extent to which this impairment is reversible is unclear. We aimed to investigate the reversibility of renal decline during TDF therapy. Methods. Cox proportional hazards models assessed factors associated with discontinuing TDF in those with an exposure duration of >6 months. In those who discontinued TDF therapy, linear piecewise regression models estimated glomerular filtration rate (eGFR) slopes before initiation of, during, and after discontinuation of TDF therapy. Factors associated with not achieving eGFR recovery 6 months after discontinuing TDF were assessed using multivariable logistic regression. Results. We observed declines in the eGFR during TDF exposure (mean slopes, −15.7 mL/minute/1.73 m2/year [95% confidence interval {CI}, −20.5 to −10.9] during the first 3 months and −3.1 mL/minute/1.73 m2/year [95% CI, −4.6 to −1.7] thereafter) and evidence of eGFR increases following discontinuation of TDF therapy (mean slopes, 12.5 mL/minute/1.73 m2/year [95% CI, 8.9–16.1] during the first 3 months and 0.8 mL/minute/1.73 m2/year [95% CI, .1–1.5] thereafter). Following TDF discontinuation, 38.6% of patients with a decline in the eGFR did not experience recovery. A higher eGFR at baseline, a lower eGFR after discontinuation of TDF therapy, and more-prolonged exposure to TDF were associated with an increased risk of incomplete recovery 6 months after discontinuation of TDF therapy. Conclusions. This study shows that a decline in the eGFR during TDF therapy was not fully reversible in one third of patients and suggests that prolonged TDF exposure at a low eGFR should be avoided. PMID:24585896
Paricalcitol modulates ACE2 shedding and renal ADAM17 in NOD mice beyond proteinuria.
Riera, Marta; Anguiano, Lidia; Clotet, Sergi; Roca-Ho, Heleia; Rebull, Marta; Pascual, Julio; Soler, Maria Jose
2016-03-15
Circulating and renal activity of angiotensin-converting enzyme 2 (ACE2) is increased in non-obese diabetic (NOD) mice. Because paricalcitol has been reported to protect against diabetic nephropathy, we investigated the role of paricalcitol in modulating ACE2 in these mice. In addition, renal ADAM17, a metalloprotease implied in ACE2 shedding, was assessed. NOD female and non-diabetic control mice were studied for 21 days after diabetes onset and divided into various treatment groups. Diabetic animals received either vehicle; 0.4 or 0.8 μg/kg paricalcitol, aliskiren, or a combination of paricalcitol and aliskiren. We then studied the effect of paricalcitol on ACE2 expression in proximal tubular epithelial cells. Paricalcitol alone or in combination with aliskiren resulted in significantly reduced circulating ACE2 activity in NOD mice but there were no changes in urinary albumin excretion. Serum renin activity was significantly decreased in mice that received aliskiren but no effect was found when paricalcitol was used alone. Renal content of ADAM17 was significantly decreased in animals that received a high dose of paricalcitol. Renal and circulating oxidative stress (quantified by plasma H2O2 levels and immunolocalization of nitrotyrosine) were reduced in high-dose paricalcitol-treated mice compared with non-treated diabetic mice. In culture, paricalcitol incubation resulted in a significant increase in ACE2 expression compared with nontreated cells. In NOD mice with type 1 diabetes, paricalcitol modulates ACE2 activity, ADAM17, and oxidative stress renal content independently from the glycemic profile and urinary albumin excretion. In tubular cells, paricalcitol may modulate ACE2 by blocking its shedding. In the early stage of diabetic nephropathy, paricalcitol treatment counterbalances the effect of diabetes on circulating ACE2 activity. Our results suggest that additional use of paricalcitol may be beneficial in treating patients with diabetes under standard
Design of sustained release pellets of ferrous fumarate using cow ghee as hot-melt coating agent.
Sakarkar, Dinesh M; Dorle, Avinash K; Mahajan, Nilesh Manoharrao; Sudke, Suresh Gendappa
2013-07-01
The objective of the present study was to design ferrous fumarate (FF) sustained release (SR) pellets using of cow ghee (CG) as an important hot-melt coating (HMC) agent. The pellets were coated by HMC technique using CG and ethyl cellulose composition by conventional coating pan without the use of spray system. FF formulated as pellets and characterized with regard to the drug content and physico-chemical properties. Stability studies were carried out on the optimized formulation for a period of 6 months at 40 ± 2°C and 75 ± 5% relative humidity. Pellets with good surface morphology and smooth texture confirmed by stereo micrographs. HMC is easy, efficient, rapid and simple method since virtually no agglomeration seen during coating. In-vitro release from pellets at a given level of coating and for present pellet size was dependent upon the physico-chemical property of the drug and mostly aqueous solubility of the drug. The selection of optimized FF formulation was confirmed by comparing percent cumulative drug release with theoretical release profile. Formulation F2 had difference factor (f 1) and similarity factor (f 2) values was found to be 5 and 66 respectively. F2 showed SR of drug for 8 h with cumulative per cent release of 98.03 ± 4.49%. Release kinetics indicates approximately zero order release pattern. HMC pellets were stable during the course of stability study. By means of HMC using CG and ethyl cellulose, SR pellets containing FF were successfully prepared.
Upadhyay, Pratik; Trivedi, Jatin; Pundarikakshudu, Kilambi; Sheth, Navin
2016-05-01
Nasal route of drug administration is preferred more and more for the targeted delivery to the brain in current drug development scenario due to its ease of use, reliability, quick action, and lesser side effects. Those CNS drugs which have limited oral bioavailability due to pharmacokinetic consequences and brain barrier repulsion are getting onto this direction. Quetiapine fumarate, an analogous to above and an antischizophrenic agent, is tested for its diffusion property with and without lipophilic carrier through sheep nasal membrane. Being a BCS class II' and high permeable candidate, it tends to crossover easily, so made up in a simple dispersion. To improve its diffusion rate, it was embedded into liposomal dispersion, which has proven that it has advanced efficiency for diffusion. For this, both the formulations were checked and compared for their diffusion profile, as it is an essential property for bioavailability through nasal route. Comparison was made on the basis of % drug diffusion within 6 h, rate, mechanism, profile, and coefficient. Liposomal dispersion has been proved superior with greater percentage diffusion of 32.61 ± 1.70 and very high permeability with a coefficient value of 4.1334 ± 0.7321 (× 10 (-) (5 )cm/s). Diffusion profile comparison bearing dissimilarity of 18 and similarity of 74 indicated that the diffusion profiles of liposomal dispersions and simple dispersion were similar but not identical. Liposomal diffusion supremacy was further sustained by in vivo, ciliotoxicity, and gamma scintigraphy studies.
Tajber, L; Corrigan, O I; Healy, A M
2009-02-09
The aim of this study was to investigate the effect of changing spray drying parameters on the production of a budesonide/formoterol fumarate 100:6 (w/w) composite. The systems were spray dried as solutions from 95% ethanol/5% water (v/v) using a Büchi 191-Mini Spray Dryer. A 2(5-1) factorial design study was undertaken to assess the consequence of altering spray drying processing variables on particle characteristics. The processing parameters that were studied were inlet temperature, spray drier airflow rate, pump rate, aspirator setting and feed concentration. Each batch of the resulting powder was characterised in terms of thermal and micromeritic properties as well as an in vitro deposition by twin impinger analysis. Overall, the parameter that had the greatest influence on each response investigated was production yield - airflow (higher airflow giving greater yields), median particle size - airflow (higher airflow giving smaller particle sizes) and Carr's compressibility index - feed concentration (lower feed concentration giving smaller Carr's indices). A six- to seven-fold difference in respirable fraction can be observed by changing the spray drying process parameters. The co-spray dried composite system which displayed best in vitro deposition characteristics, showed a 2.6-fold increase in respirable fraction in the twin impinger experiments and better dose uniformity compared with the physical mix of micronised powders.
Runge, M Brett; Wang, Huan; Spinner, Robert J; Windebank, Anthony J; Yaszemski, Michael J
2012-01-01
Polycaprolactone fumarate (PCLF) is a cross-linkable derivative of polycaprolactone diol that has been shown to be an effective nerve conduit material that supports regeneration across segmental nerve defects and has warranted future clinical trials. Degradation of PCLF (PCLF(DEG)) releases toxic small molecules of diethylene glycol used as the initiator for the synthesis of polycaprolactone diol. In an effort to eliminate this toxic degradation product we present a strategy for the synthesis of PCLF from either propylene glycol (PCLF(PPD)) or glycerol (PCLF(GLY)). PCLF(PPD) is linear and resembles the previously studied PCLF(DEG), while PCLF(GLY) is branched and exhibits dramatically different material properties. The synthesis and characterization of their thermal, rheological, and mechanical properties are reported. The results show that the linear PCLF(PPD) has material properties similar to the previously studied PCLF(DEG). The branched PCLF(GLY) exhibits dramatically lower crystalline properties resulting in lower rheological and mechanical moduli, and is therefore a more compliant material. In addition, the question of an appropriate Food and Drug Administration approvable sterilization method is addressed. This study shows that autoclave sterilization of PCLF materials is an acceptable sterilization method for cross-linked PCLF and has minimal effect on the PCLF thermal and mechanical properties. Copyright © 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Mugwanya, Kenneth K; John-Stewart, Grace; Baeten, Jared
2017-07-01
In settings where HIV is prevalent in heterosexual populations, pregnancy and postpartum breastfeeding periods can be associated with substantial HIV acquisition risk. Pre-exposure prophylaxis (PrEP) with daily oral tenofovir disoproxil fumarate (TDF)/emtricitabine is an attractive HIV prevention option for women who are lactating but data are limited on its safety during the lactation period. Areas covered: We provide a concise synthesis and summary of current evidence on the safety of TDF-based PrEP during breastfeeding. We conducted a review, searching Pubmed database and major PrEP conferences for primary studies with TDF-based PrEP exposure during postpartum breastfeeding. Expert opinion: TDF-based oral PrEP is an effective female-controlled HIV prevention option. There is evidence supporting the safety of TDF use for infant outcomes during breastfeeding in antiretroviral treatment regimens for HIV and hepatitis B virus, and more limited, but consistently safe, data from use of TDF as PrEP. The potential for risk is arguably outweighed for at-risk individuals by HIV prevention benefits, including indirect protection to the infant as a result of preventing HIV in the breastfeeding mother. As PrEP delivery is scaled up in heterosexual populations in high HIV prevalence settings and for at-risk persons in other settings, implementation science studies can provide a framework to increase the accrual of safety, acceptability, and use data related to PrEP during lactation.
Targeting renin-angiotensin system in malignant hypertension in atypical hemolytic uremic syndrome
Raghunathan, V.; Sethi, S. K.; Dragon-Durey, M. A.; Dhaliwal, M.; Raina, R.; Jha, P.; Bansal, S. B.; Kher, V.
2017-01-01
Hypertension is common in hemolytic uremic syndrome (HUS) and often difficult to control. Local renin-angiotensin activation is believed to be an important part of thrombotic microangiopathy, leading to a vicious cycle of progressive renal injury and intractable hypertension. This has been demonstrated in vitro via enhanced tissue factor expression on glomerular endothelial cells which is enhanced by angiotensin II. We report two pediatric cases of atypical HUS with severe refractory malignant hypertension, in which we targeted the renin-angiotensin system by using intravenous (IV) enalaprilat, oral aliskiren, and oral enalapril with quick and dramatic response of blood pressure. Both drugs, aliskiren and IV enalaprilat, were effective in controlling hypertension refractory to multiple antihypertensive medications. These appear to be promising alternatives in the treatment of severe atypical HUS-induced hypertension and hypertensive emergency. PMID:28356668
Axthelm, Christoph; Sieder, Christian; Meister, Franziska; Kaiser, Edelgard
2012-01-01
We aimed to investigate whether the single pill combination (SPC) of aliskiren 300 mg and amlodipine 10 mg (ALIS 300/AMLO 10) improves blood pressure (BP) reduction in hypertensive patients not adequately controlled by the SPC olmesartan 40 mg and amlodipine 10 mg (OLM 40/AMLO 10). Open-label, non-randomized single-arm study. Patients with stage 2 hypertension were titrated to the SPC OLM 40/AMLO 10 (4-week Phase 1). If hypertension was not controlled they were switched to the SPC ALIS 300/AMLO 10 (4-week Phase 2). In the optional 4-week study extension hydrochlorothiazide (HCT) 12.5 mg was added. EudraCT 2009-016693-33. In the 342 patients treated, OLM 40/AMLO 10 reduced systolic BP (SBP)/diastolic BP (DBP) by 24.5/14.5 mmHg by end of Phase 1. Those 187 patients with uncontrolled hypertension at the end of Phase 1 switched to ALIS 300/AMLO 10 experienced a further SBP reduction of 5.1 mmHg (95% confidence interval [CI] 3.7 to 6.5, p < 0.0001) and a DBP reduction of 4.8 mmHg (95% CI 3.8 to 5.8; p < 0.0001) in Phase 2. DBP or SBP responder rates were achieved by 51.3% or 44.4%, respectively, SBP and DBP normalization by 36.4%. In 65 patients whose BP was not controlled in Phase 2, SPC ALIS 300/AMLO 10/HCT 12.5 mg decreased SBP/DBP by further 8.1/6.7 mmHg (p < 0.0001 each). No deaths or serious adverse events were noted. Significant adverse events leading to study discontinuation were reported in 2.6% (Phase 1), 2.7% (Phase 2), and 0% (extension). Limitations included the open-label, single-arm non-randomized design, and the relatively short duration. In this switch study reflecting clinical practice, patients with moderate hypertension not controlled by the SPC OLM 40/AMLO 10 achieved a clinically and statistically significant reduction of blood pressure from the SPC ALIS 300/AMLO 10 and the optional addition of HCT. All drug combinations were well tolerated.
Tomillero, A; Moral, M A
2009-03-01
ABT-869, Acadesine, Acetylsalicylic acid/omeprazole, Adefovir, Adefovir dipivoxil, AEG-35156, Agatolimod sodium, Albiglutide, Alemtuzumab, Alipogene tiparvovec, Alogliptin benzoate, AMG-386, Amrubicin hydrochloride, Apremilast, Aripiprazole, Asoprisnil, Atorvastatin/fenofibrate, AVN-944, Axitinib; Belinostat, Bevacizumab, BHT-3021, BI-2536, Biapenem, Bilastine, Biphasic insulin aspart, Blinatumomab, Bortezomib, Bosentan; Catumaxomab, CD-NP, Cediranib, Certolizumab pegol, Cetuximab, Choline fenofibrate, Ciclesonide, CK-1827452,Clevudine, Clofarabine, CSL-360, CYT-997; Dapagliflozin, Darinaparsin, Denosumab, Densiron 68, Desloratadine, Dulanermin; Edoxaban tosilate, Emtricitabine, Entecavir, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fidaxomicintiacumiv, Fulvestrant; G-207, GCR-8015, Gefitinib, Ghrelin (human), Glufosfamide; HPV16L1E7CVLP; Ibutamoren mesilate, Imatinib mesylate, Insulin detemir, Insulin glargine, Iodine (I131) tositumomab, Istaroxime, ITMN-191, Ixabepilone; JZP-4, Lenalidomide; Levetiracetam, Linaclotide acetate, Liposomal cytarabine/daunorubicin, Liposomal doxorubicin, Liraglutide, LY-518674; Milatuzumab, MMR-V, Motesanib diphosphate, Mycophenolic acid sodium salt; Niacin/simvastatin; Obatoclax mesylate, Odanacatib; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Pazufloxacin, PBT-2, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ribavirin, Pemetrexed disodium, Perampanel, PfCP2.9, Pitavastatin calcium, Poly I:CLC, Pomalidomide, Pralatrexate, Pramlintide acetate, Prucalopride; rhGAD65, Roflumilast; RTS,S/AS02D; SCH-530348, Semagacestat, Sirolimus-eluting coronary stent, Sirolimus-Eluting Stent, SIR-Spheres, Sivelestat sodium hydrate, Sorafenib, Sunitinib malate; Tadalafil, Tafluprost, Tanespimycin, Teduglutide, Telaprevir, Telbivudine, Tenofovir disoproxil fumarate, Tiotropium bromide, TMC-435350, Tositumomab/iodine (I131) tositumomab, Travoprost/timolol, Triciribine
Zhovtis Ryerson, Lana; Green, Rivka; Confident, Gladyne; Pandey, Krupa; Richter, Benjamin; Bacon, Tamar; Sammarco, Carrie; Laing, Lisa; Kalina, Jennifer; Kister, Ilya
2016-11-01
Dimethyl fumarate (DMF) was approved by the US Food and Drug Administration (FDA) for treatment of relapsing-remitting multiple sclerosis (RRMS) based on two phase III randomized clinical trials (RCTs). There were not enough non-White patients enrolled in these RCTs to allow for subgroup analysis based on race. Efficacy and tolerability of DMF therapy across various racial groups is unknown. Retrospective chart review was performed on all patients with RRMS who were started on DMF in two tertiary multiple sclerosis (MS) clinics. Efficacy and tolerability of DMF was compared across three self-identified racial groups: White-American (WA), African-American (AA) and Hispanic-American (HA). A total of 390 RRMS patients were included in the study: 261 (66.9%) WA, 69 (17.7%) AA and 52 (13.3%) HA. When comparing 'pre-DMF' (1 year) and 'on DMF' (mean follow up of 14 months) periods, statistically significant reduction in rates of annualized relapses (WA from 0.44 to 0.19, AA from 0.39 to 0.15, and HA from 0.39 to 0.14; no differences between groups), new T2 lesions (WA from 45% to 23%, AA from 39% to 23%, HA from 52% to 26%; no difference between groups), and Gd+ lesions (WA from 25% to 13%, AA from 24% to 7%, HA from 23% to 12%; no difference between groups) were seen. DMF was relatively well tolerated across all groups, with an overall discontinuation rate of 20% (no difference between the three groups). Efficacy of DMF in our clinic population did not differ across three major ethnic groups, WA, AA and HA, and was comparable with results observed in the pivotal studies. These 'real-life' data suggest that race is not a factor that needs to be taken into account when initiating DMF.
Dimethyl fumarate is highly cytotoxic in KRAS mutated cancer cells but spares non-tumorigenic cells.
Bennett Saidu, Nathaniel Edward; Bretagne, Marie; Mansuet, Audrey Lupo; Just, Pierre-Alexandre; Leroy, Karen; Cerles, Olivier; Chouzenoux, Sandrine; Nicco, Carole; Damotte, Diane; Alifano, Marco; Borghese, Bruno; Goldwasser, François; Batteux, Frédéric; Alexandre, Jérôme
2018-02-06
KRAS mutation, one of the most common molecular alterations observed in adult carcinomas, was reported to activate the anti-oxidant program driven by the transcription factor NRF2 (Nuclear factor-erythroid 2-related factor 2). We previously observed that the antitumoral effect of Dimethyl fumarate (DMF) is dependent of NRF2 pathway inhibition. We used in vitro methods to examine the effect of DMF on cell death and the activation of the NRF2/DJ-1 antioxidant pathway. We report here that DMF is preferentially cytotoxic against KRAS mutated cancer cells. This effect was observed in patient-derived cancer cell lines harbouring a G12V KRAS mutation, compared with cell lines without such a mutation. In addition, KRAS*G12V over-expression in the human Caco-2 colon cancer cell line significantly promoted DMF-induced cell death, as well as DMF-induced- reactive oxygen species (ROS) formation and -glutathione (GSH) depletion. Moreover, in contrast to malignant cells, our data confirms that the same concentration of DMF has no significant cytotoxic effects on non-tumorigenic human ARPE-19 retinal epithelial, murine 3T3 fibroblasts and primary mice bone marrow cells; but is rather associated with NRF2 activation, decreased ROS and increased GSH levels. Furthermore, DJ-1 down-regulation experiments showed that this protein does not play a protective role against NRF2 in non-tumorigenic cells, as it does in malignant ones. This, interestingly, could be at the root of the differential effect of DMF observed between malignant and non-tumorigenic cells. Our results suggest for the first time that the dependence on NRF2 observed in mutated KRAS malignant cells makes them more sensitive to the cytotoxic effect of DMF, which thus opens up new prospects for the therapeutic applications of DMF.
Sato, Atsuhisa; Fukuda, Seiichi
2013-10-01
We have reported observing aldosterone breakthrough in the course of relatively long-term treatment with renin-angiotensin (RA) system inhibitors, where the plasma aldosterone concentration (PAC) increased following an initial decrease. Aldosterone breakthrough has the potential to eliminate the organ-protective effects of RA system inhibitors. We therefore conducted a study in essential hypertensive patients to determine whether aldosterone breakthrough occurred during treatment with the direct renin inhibitor (DRI) aliskiren and to ascertain its clinical significance. The study included 40 essential hypertensive patients (18 men and 22 women) who had been treated for 12 months with aliskiren. Aliskiren significantly decreased blood pressure and plasma renin activity (PRA). The PAC was also decreased significantly at 3 and 6 months; however, the significant difference disappeared after 12 months. Aldosterone breakthrough was observed in 22 of the subjects (55%). Urinary albumin excretion differed depending on whether breakthrough occurred. For the subjects in whom aldosterone breakthrough was observed, eplerenone was added. A significant decrease in urinary albumin excretion was observed after 1 month, independent of changes in blood pressure. In conclusion, this study demonstrated that aldosterone breakthrough occurs in some patients undergoing DRI therapy. Aldosterone breakthrough affects the drug's ability to improve urinary albumin excretion, and combining a mineralocorticoid receptor antagonist with the DRI may be useful for decreasing urinary albumin excretion. When the objective is organ protection in hypertensive patients, a two-pronged approach using combination therapy to inhibit both the RA system and aldosterone may be highly effective.
Chen, Jin-Shuen
2017-01-01
Renin–angiotensin system in visceral fat plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. However, the effects of renin inhibition on visceral adiposity in metabolic syndrome are not fully investigated. We investigated the effects of renin inhibition on visceral adiposity in fructose-fed rats. Male Wistar–Kyoto rats were divided into 4 groups for 8-week experiments: Group Con (standard chow diet), Group Fru (high-fructose diet; 60% fructose), Group FruA (high-fructose diet and concurrent aliskiren treatment; 100 mg/kg body weight [BW] per day), and Group FruB (high-fructose diet and subsequent, i.e. 4 weeks after initiating high-fructose feeding, aliskiren treatment; 100 mg/kg BW per day). The high-fructose diet induced metabolic syndrome, increased visceral fat weights and adipocyte sizes, and augmented angiotensin II (Ang II), NADPH oxidase (NOX) isoforms expressions, oxidative stress, and dysregulated production of adipocytokines from visceral adipose tissues. Concurrent and subsequent aliskiren administration ameliorated metabolic syndrome, dysregulated adipocytokines, and visceral adiposity in high fructose-fed hypertensive rats, and was associated with reducing Ang II levels, NOX isoforms expressions and oxidative stress in visceral fat tissues. Therefore, this study demonstrates renin inhibition could improve metabolic syndrome, and reduce Ang II levels and oxidative stress in visceral fat tissue in fructose-fed rats, and suggests that visceral adipose Ang II plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. PMID:28700686
Chou, Chu-Lin; Lin, Heng; Chen, Jin-Shuen; Fang, Te-Chao
2017-01-01
Renin-angiotensin system in visceral fat plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats. However, the effects of renin inhibition on visceral adiposity in metabolic syndrome are not fully investigated. We investigated the effects of renin inhibition on visceral adiposity in fructose-fed rats. Male Wistar-Kyoto rats were divided into 4 groups for 8-week experiments: Group Con (standard chow diet), Group Fru (high-fructose diet; 60% fructose), Group FruA (high-fructose diet and concurrent aliskiren treatment; 100 mg/kg body weight [BW] per day), and Group FruB (high-fructose diet and subsequent, i.e. 4 weeks after initiating high-fructose feeding, aliskiren treatment; 100 mg/kg BW per day). The high-fructose diet induced metabolic syndrome, increased visceral fat weights and adipocyte sizes, and augmented angiotensin II (Ang II), NADPH oxidase (NOX) isoforms expressions, oxidative stress, and dysregulated production of adipocytokines from visceral adipose tissues. Concurrent and subsequent aliskiren administration ameliorated metabolic syndrome, dysregulated adipocytokines, and visceral adiposity in high fructose-fed hypertensive rats, and was associated with reducing Ang II levels, NOX isoforms expressions and oxidative stress in visceral fat tissues. Therefore, this study demonstrates renin inhibition could improve metabolic syndrome, and reduce Ang II levels and oxidative stress in visceral fat tissue in fructose-fed rats, and suggests that visceral adipose Ang II plays a crucial role in the pathogenesis of metabolic syndrome in fructose-fed rats.
Tomillero, A; Moral, M A
2010-06-01
[¹¹C]RAC; (18)F-Fluoromisonidazole; 89-12; 9-[¹⁸F]Fluoropropyl-(+)-dihydrotetrabenazine; Adalimumab, Adecatumumab, ADMVA, ADXS-11-001, Aflibercept, Agatolimod sodium, AGS-004, Alglucosidase alfa, Aliskiren fumarate, Alvocidib hydrochloride, AMG-108, AMG-853, Apixaban, Aripiprazole, Armodafinil, Atazanavir sulfate, Atomoxetine hydrochloride; Bevacizumab, BioMatrix Flex drug eluting stent, Biphasic insulin aspart, Bortezomib, Bosentan; Caspofungin acetate, Cediranib, Cetuximab, ChimeriVax-Dengue, Choriogonadotropin alfa, Cinacalcet hydrochloride, Cizolirtine citrate, Clofarabine, Cocaine conjugate vaccine, CX-717; Darbepoetin alfa, Dasatinib, Decitabine, Denosumab, Desvenlafaxine succinate, Dexamethasone sodium phosphate, Dienogest, Diphencyprone, Doripenem, DTaP-HepB-IPV, Dutasteride; E-7010, Ecallantide, Ecstasy, Eicosapentaenoic acid/docosahexaenoic acid, Emtricitabine, Enfuvirtide, Erlotinib hydrochloride, Eszopiclone, Etonogestrel/ethinyl estradiol, Etoricoxib, Everolimus, Everolimus-eluting coronary stent EVT-201, Ezetimibe, Ezetimibe/simvastatin; Ferumoxytol, Fesoterodine fumavate, Figitumumab, Filgrastim, Fingolimod hydrochloride, Fluticasone furoate, Fluval P, Fluzone, Fondaparinux sodium, Fulvestrant, Fungichromin; Gamma-hydroxybutyrate sodium, Gefitinib, GHB-01L1, GLY-230, GSK-1349572; Hib-MenCY-TT, Hib-TT, HPV-6/11/16/18, Hydrocodone bitartrate; IC-51, Icatibant acetate, Imatinib mesylate, Immunoglobulin intravenous (human), Indetanib, Influenza A (H1N1) 2009 Monovalent Vaccine, Inhalable human insulin, Insulin glargine, Insulin glulisine, Interferon-beta, Ispinesib mesylate, Ixabepilone; Laromustine, Latanoprost/timolol maleate, L-Citrulline, Lenalidomide, Lexatumumab, Linezolid, Lopinavir/ritonavir, Lutropin alfa; Mapatumumab, MDX-066, MDX-1388, Mepolizumab, Methoxy polyethylene glycol-epoetin-beta, Metreleptin, Micafungin sodium, Mometasone furoate/oxymetazoline hydrochloride, Mx-dnG1, Mycophenolic acid sodium salt; Nabiximols, Natalizumab
Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam
2015-12-01
The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Schmieder, Astrid; Poppe, Manuel; Hametner, Christian; Meyer-Schraml, Hanna; Schaarschmidt, Marthe-Lisa; Findeisen, Peter; Benoit, Sandrine; Bauer, Boris; Schmid, Sybille; Goebeler, Matthias; Goerdt, Sergij; Ludwig-Peitsch, Wiebke K
2015-07-01
Patients with psoriasis have an increased risk of cardiovascular disease that is partly attributable to chronic systemic inflammation. The aim of our prospective pilot study was to investigate the impact of fumaric acid esters (FAE), a first-line systemic antipsoriatic treatment in Germany, on cardiovascular risk parameters. Participants with moderate-to-severe psoriasis from the University Medical Center Mannheim and the University Hospital Würzburg were treated with FAE for 16 weeks according to standard dosage recommendations. Disease severity, life quality and depression scores as well as biomarkers of inflammation, lipid and glucose metabolism were assessed prior to initiation of FAE and after 16 weeks. Out of 39 participants recruited, 27 completed the study. 44% of all participants and 63% of those completing the 16-week treatment achieved PASI 50 response and 27 or 37% PASI 75 response. Clinical improvement was paralleled by significant improvement in quality of life, high treatment satisfaction and significant reduction of depressive symptoms. Adverse events, most frequently mild gastrointestinal complaints, flush and lymphocytopenia occurred in 89%. FAE did not modify glucose metabolism or inflammatory parameters substantially. However, a highly significant increase in serum levels of the atheroprotective cytokine adiponectin was noted after 16 weeks (median 4.7 vs. 8.9 µg/ml; p = 0.0002). Our study demonstrates a significant beneficial impact of FAE on adiponectin, indicating a potential cardioprotective effect. It will be interesting to verify this finding in larger cohorts and to assess the long-term influence of FAE on cardiovascular risk and disease.
Keller, Marla J; Mesquita, Pedro M; Marzinke, Mark A; Teller, Ryan; Espinoza, Lilia; Atrio, Jessica M; Lo, Yungtai; Frank, Bruce; Srinivasan, Sujatha; Fredricks, David N; Rabe, Lorna; Anderson, Peter L; Hendrix, Craig W; Kiser, Patrick F; Herold, Betsy C
2016-03-13
Tenofovir disoproxil fumarate (TDF), a prodrug of tenofovir (TFV), may be ideal for topical HIV preexposure prophylaxis because it has higher tissue and cell permeability than TFV; is not adversely impacted by seminal proteins; and its active metabolite, TFV-diphosphate (TFV-DP), has a long intracellular half-life. We engineered a TDF eluting polyurethane reservoir intravaginal ring (IVR) to provide near constant mucosal antiretroviral concentrations. A first-in-human randomized placebo-controlled trial was conducted to assess the safety and pharmacokinetics of the TDF IVR in healthy, sexually abstinent women (15 TDF and 15 placebo). Drug concentrations were measured in cervicovaginal fluid (CVF) obtained by swab, cervical tissue, plasma, and dried blood spots (DBS) over 14 days of continuous ring use. There were 43 total, 23 reproductive tract, and eight product-related grade 1 adverse events. Steady-state CVF TFV concentrations were achieved proximal (vagina, ectocervix) and distal (introitus) to the TDF IVR 1 day after ring insertion. Median tissue TFV-DP concentrations 14 days after TDF IVR placement were 120 fmol/mg (interquartile range 90, 550). CVF collected from the cervix 1 week and 2 weeks after TDF IVR insertion provided significant protection against ex-vivo HIV challenge. Eleven of 14 (78%) participants had detectable TFV-DP DBS concentrations 14 days after TDF IVR placement, suggesting that DBS may provide a surrogate marker of adherence in future clinical trials. A TDF IVR is safe, well tolerated, and results in mucosal TFV concentrations that exceed those associated with HIV protection. The findings support further clinical evaluation of this TDF IVR.
Influence of Nutritional Conditions on Production of l-Glutamine by Flavobacterium rigense
Nabe, Koichi; Ujimaru, Toshihiko; Yamada, Shigeki; Chibata, Ichiro
1981-01-01
The nutritional conditions for the production of l-glutamine by Flavobacterium rigense strain 703 were investigated. The optimum concentration of ammonia for achieving the highest yield of l-glutamine (25 mg/ml of broth) was relatively broad, from 0.9 to 1.6%, whereas fumaric acid had a narrow optimum range, near 5.5%. High concentration of inorganic ions such as chloride or sulfate ion clearly inhibited cell growth. Therefore, ammonium salts other than (NH4)2-fumarate were unsuitable for the highest production. The optimum concentration of (NH4)2-fumarate was 7%. To reduce the concentration of fumaric acid in the medium, many substances were evaluated as substitutes. The fumaric acid concentration required for highest l-glutamine yield could not be replaced by any one of the compounds tested. However, part of fumaric acid could be replaced with succinic acid and cupric ion; 4% (NH4)2-fumarate plus 2.5% succinic acid or 5% (NH4)2-fumarate plus 1 mM cupric ion produced results similar to 7% (NH4)2-fumarate in the fermentation medium. PMID:16345682
Baeten, Jared M; Donnell, Deborah; Mugo, Nelly R; Ndase, Patrick; Thomas, Katherine K; Campbell, James D; Wangisi, Jonathan; Tappero, Jordan W; Bukusi, Elizabeth A; Cohen, Craig R; Katabira, Elly; Ronald, Allan; Tumwesigye, Elioda; Were, Edwin; Fife, Kenneth H; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Kidoguchi, Lara; Coombs, Robert W; Hendrix, Craig; Marzinke, Mark A; Frenkel, Lisa; Haberer, Jessica E; Bangsberg, David; Celum, Connie
2014-11-01
Antiretroviral pre-exposure prophylaxis (PrEP), with daily oral tenofovir disoproxil fumarate or tenofovir disoproxil fumarate in combination with emtricitabine, has been shown to be efficacious for HIV-1 prevention. Although the use of more than one antiretroviral agent is essential for effective HIV-1 treatment, more than one agent might not be required for effective prophylaxis. We assessed the efficacy of single-agent tenofovir disoproxil fumarate relative to combination emtricitabine plus tenofovir disoproxil fumarate as PrEP. We did a randomised, double-blind, placebo-controlled three-group phase 3 trial of daily oral tenofovir disoproxil fumarate and emtricitabine plus tenofovir disoproxil fumarate PrEP in HIV-1 uninfected individuals in heterosexual HIV-1 serodiscordant couples from Kenya and Uganda. After an interim review, the trial's placebo group was discontinued and thereafter the active groups were continued, and participants initially randomly assigned to placebo were offered rerandomisation in a 1:1 ratio to tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate as PrEP. The primary endpoints were HIV-1 seroconversion and safety. This trial is registered with ClinicalTrials.gov, number NCT00557245. 4410 (99·6%) of 4427 couples received tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate and were followed up for HIV-1 acquisition. Of 52 incident HIV-1 infections, 31 occurred in individuals assigned tenofovir disoproxil fumarate (incidence 0·71 cases per 100 person-years) and 21 were in those assigned emtricitabine plus tenofovir disoproxil fumarate (0·48 cases per 100 person-years); HIV-1 incidence in the placebo group until discontinuation was two cases per 100 person-years. HIV-1 prevention efficacy with emtricitabine plus tenofovir disoproxil fumarate was not significantly different from that of tenofovir disoproxil fumarate alone (hazard ratio [HR] 0·67, 95% CI 0·39-1·17; p=0·16
Rogers, Jeffrey; Farney, Alan C.; Al-Geizawi, Samer; Iskandar, Samy S.; Doares, William; Gautreaux, Michael D.; Hart, Lois; Kaczmorski, Scott; Reeves-Daniel, Amber; Winfrey, Stephanie; Ghanta, Mythili; Adams, Patricia L.; Stratta, Robert J.
2011-01-01
This article reviews the outcome of pancreas transplantations in diabetic recipients according to risk factors, surgical techniques, and immunosuppression management that evolved over the course of a decade at Wake Forest Baptist Medical Center. A randomized trial of alemtuzumab versus rabbit anti-thymocyte globulin (rATG) induction in simultaneous kidney-pancreas transplantation (SKPT) at our institution demonstrated lower rates of acute rejection and infection in the alemtuzumab group. Consequently, alemtuzumab induction has been used exclusively in all pancreas transplantations since February 2009. Early steroid elimination has been feasible in the majority of patients. Extensive experience with surveillance pancreas biopsies in solitary pancreas transplantation (SPT) is described. Surveillance pancreas biopsy-directed immunosuppression has contributed to equivalent long-term pancreas graft survival rates in SKPT and SPT recipients at our center, in contrast to recent registry reports of persistently higher rates of immunologic pancreas graft loss in SPT. Furthermore, the impact of donor and recipient selection on outcomes is explored. Excellent results have been achieved with older (extended) donors and recipients, in recipients of organs from donation after cardiac death donors managed with extracorporeal support, and in African-American patients. Type 2 diabetics with detectable C-peptide levels have been transplanted successfully with outcomes comparable to those of insulinopenic diabetics. Our experiences are discussed in the light of findings reported in the literature. PMID:21720669
Rogers, Jeffrey; Farney, Alan C; Al-Geizawi, Samer; Iskandar, Samy S; Doares, William; Gautreaux, Michael D; Hart, Lois; Kaczmorski, Scott; Reeves-Daniel, Amber; Winfrey, Stephanie; Ghanta, Mythili; Adams, Patricia L; Stratta, Robert J
2011-01-01
This article reviews the outcome of pancreas transplantations in diabetic recipients according to risk factors, surgical techniques, and immunosuppression management that evolved over the course of a decade at Wake Forest Baptist Medical Center. A randomized trial of alemtuzumab versus rabbit anti-thymocyte globulin (rATG) induction in simultaneous kidney-pancreas transplantation (SKPT) at our institution demonstrated lower rates of acute rejection and infection in the alemtuzumab group. Consequently, alemtuzumab induction has been used exclusively in all pancreas transplantations since February 2009. Early steroid elimination has been feasible in the majority of patients. Extensive experience with surveillance pancreas biopsies in solitary pancreas transplantation (SPT) is described. Surveillance pancreas biopsy-directed immunosuppression has contributed to equivalent long-term pancreas graft survival rates in SKPT and SPT recipients at our center, in contrast to recent registry reports of persistently higher rates of immunologic pancreas graft loss in SPT. Furthermore, the impact of donor and recipient selection on outcomes is explored. Excellent results have been achieved with older (extended) donors and recipients, in recipients of organs from donation after cardiac death donors managed with extracorporeal support, and in African-American patients. Type 2 diabetics with detectable C-peptide levels have been transplanted successfully with outcomes comparable to those of insulinopenic diabetics. Our experiences are discussed in the light of findings reported in the literature.
Jotwani, Vasantha; Scherzer, Rebecca; Glidden, David V; Mehrotra, Megha; Defechereux, Patricia; Liu, Albert; Gandhi, Monica; Bennett, Michael; Coca, Steven G; Parikh, Chirag R; Grant, Robert M; Shlipak, Michael G
2018-06-01
Pre-exposure prophylaxis (PrEP) with tenofovir disoproxil fumarate (TDF) and emtricitabine (FTC) is becoming increasingly adopted for HIV prevention. Tenofovir can cause proximal tubular damage and chronic kidney disease in HIV-infected persons, but little is known regarding its nephrotoxic potential among HIV-uninfected persons. In this study, we evaluated the effects of PrEP on urine levels of the following: α1-microglobulin (α1m), a marker of impaired tubular reabsorption; albuminuria, a measure of glomerular injury; and total proteinuria. The Iniciativa Profilaxis Pre-Exposicion (iPrEx) study randomized HIV-seronegative men and transgender women who have sex with men to oral TDF/FTC or placebo. The iPrEx open-label extension (iPrEx-OLE) study enrolled former PrEP trial participants to receive open-label TDF/FTC. A cross-sectional analysis compared urine biomarker levels by study arm in iPrEx (N = 100 treatment arm, N = 100 placebo arm). Then, urine biomarker levels were compared before and after PrEP initiation in 109 participants of iPrEx-OLE. In iPrEx, there were no significant differences in urine α1m, albuminuria, or proteinuria by treatment arm. In iPrEx-OLE, after 24 weeks on PrEP, urine α1m and proteinuria increased by 21% [95% confidence interval (CI): 10 to 33] and 18% (95% CI: 8 to 28), respectively. The prevalence of detectable α1m increased from 44% to 65% (P < 0.001) and estimated glomerular filtration rate declined by 4 mL/min/1.73 m (P < 0.001). There was no significant change in albuminuria (6%; 95% CI: -7% to 20%). PrEP with TDF/FTC was associated with a statistically significant rise in urine α1m and proteinuria after 6 months, suggesting that PrEP may result in subclinical tubule dysfunction.
Pontrelli, Giuseppe; Cotugno, Nicola; Amodio, Donato; Zangari, Paola; Tchidjou, Hyppolite K; Baldassari, Stefania; Palma, Paolo; Bernardi, Stefania
2012-01-23
Kidney disease is an important complication in HIV infected people, and this may be related to infection or antiretroviral therapy (ART). Our aim is to assess renal function in HIV infected paediatric patients, who may be particularly affected and are likely to take ART for longer than adults, and investigate the long term role of Tenofovir Disoproxil Fumarate (TDF) alone or co-administered with Ritonavir-boosted Protease Inhibitors (PI). Serum creatinine, phosphate and potassium levels, with estimated Glomerular Filtration Rate (eGFR), had been prospectively evaluated for 2 years in a cohort of HIV infected children and adolescents (age 9-18) on ART, and data analyzed according to the exposure to TDF or simultaneous TDF and PI. Forty-nine patients were studied (57% female, mean age 14). Sixty-three percent were treated with ART containing TDF (Group A), and 37% without TDF (Group B); 47% with concomitant use of TDF and PI (Group C) and 53% without this combination (Group D). The groups didn't differ for age, gender or ethnicity. The median creatinine increased in the entire cohort and in all the groups analyzed; eGFR decreased from 143.6 mL/min/1.73 m2 at baseline to 128.9 after 2 years (p = 0.006) in the entire cohort. Three patients presented a mild eGFR reduction, all were on TDF+PI. Phosphatemia decreased significantly in the entire cohort (p = 0.0003) and in TDF+PI group (p = 0.0128) after 2 years. Five patients (10%) developed hypophosphatemia (Division of Acquired Immune Deficiency AE grade 1 or 2), and four of them were on TDF+PI. Renal function decrease and hypophosphatemia occur over time in HIV infected children and adolescents on ART. The association with co-administration of TDF and PI appears weak, and further studies are warranted.
Weisenseel, Peter; Reich, Kristian; Griemberg, Wiebke; Merten, Katharina; Gröschel, Christine; Gomez, Natalie Nunez; Taipale, Kirsi; Bräu, Beate; Zschocke, Ina
2017-02-01
Die Behandlung von Psoriasis-Patienten mit einer Kombination aus Fumarsäureestern (FSE, Fumaderm ® ) und Phototherapie (UV) ist verbreitet, wurde aber im Rahmen von Studien wenig untersucht. Bisher liegen lediglich Daten aus einer kleinen Pilotstudie vor. Intention dieser Studie war, eine FSE/UV-Kombinationsbehandlung an einem größeren Patientenkollektiv mit mittelschwerer bis schwerer Psoriasis zu untersuchen. In dieser prospektiven, multizentrischen, nichtinterventionellen Studie wurden Daten von Patienten mit FSE/UV-Kombinationstherapie hinsichtlich der Wirksamkeit (PGA' PASI, DLQI, EQ-5D), Sicherheit und Dosierung über einen Zeitraum von zwölf Monaten erfasst und mit Daten einer retrospektiven Studie mit FSE-Monotherapie verglichen. Es wurden Daten von 363 Patienten ausgewertet. Unter der Kombinationstherapie verbesserten sich alle Wirksamkeitsparameter deutlich. Im Vergleich zur Monotherapie mit FSE konnte durch die Kombination mit UV ein schnellerer Wirkeintritt erzielt werden, wobei nach zwölf Monaten kein Unterschied in der Wirksamkeit bestand. Die Dauer und Art der Phototherapie zeigte keinen Einfluss auf die Wirksamkeitsparameter. Allgemein wurde die Kombinationstherapie gut vertragen. Unerwünschte Ereignisse wurden bei 7 % der Patienten berichtet. Die FSE/UV Kombinationstherapie zeigt eine gute Wirksamkeit und Verträglichkeit und kann zu einem schnelleren Wirkeintritt führen. Eine Kombinationstherapie erscheint vor allem in den ersten drei Monaten der FSE Behandlung sinnvoll. © 2017 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
Li, Jian-Chun; Zhang, Wen-Jing; Zhu, Jin-Xiu; Zhu, Na; Zhang, Hong-Min; Wang, Xiu; Zhang, Jin; Wang, Qing-Qing
2015-01-01
To investigate the brain delivery in rat by nasal Quetiapine fumarate (QF) loaded with solid lipid nanoparticles in situ gel (QF-SLN-gel). QF-SLN-gel was prepared through micro-emulsion technique. The rat model of schizophrenia was established by intraperitoneal injection of (+)-MK-801, evaluated by stereotypic behavior, Mori’s Water Maze (MWM) test and hematoxylin and eosin (HE) staining of hippocampus. The animals were administrated with QF via oral, nasal or tail vein approach and the concentration of QF in blood and brain was determined using high performance liquid chromatography (HPLC). The QF-SLN-gel was even and transparent, having size of 117.8±2.67 d.nm, potential of 57.2±0.24 mV and EF of 97.6±0.58%. After administration of QF-SLN-gel, the concentration of QF in blood and brain of rats in nasal QF-SLN-gel group was similar with that of rats in tail vein QF group, but significantly higher than that of rats in oral QF group. The hippocampal morphology changes induced by (+)-MK-801 were ameliorated by QF, with advantage of nasal QF-SLN-gel over tail vein QF. The nasal QF-SLN-gel had stable and good brain delivery and could ameliorate the damages in rat model of schizophrenia induced by (+)-MK-801. PMID:26770349
Medeiros, David B; Barros, Kallyne A; Barros, Jessica Aline S; Omena-Garcia, Rebeca P; Arrivault, Stéphanie; Sanglard, Lílian M V P; Detmann, Kelly C; Silva, Willian Batista; Daloso, Danilo M; DaMatta, Fábio M; Nunes-Nesi, Adriano; Fernie, Alisdair R; Araújo, Wagner L
2017-11-01
Malate is a central metabolite involved in a multiplicity of plant metabolic pathways, being associated with mitochondrial metabolism and playing significant roles in stomatal movements. Vacuolar malate transport has been characterized at the molecular level and is performed by at least one carrier protein and two channels in Arabidopsis ( Arabidopsis thaliana ) vacuoles. The absence of the Arabidopsis tonoplast Dicarboxylate Transporter (tDT) in the tdt knockout mutant was associated previously with an impaired accumulation of malate and fumarate in leaves. Here, we investigated the consequences of this lower accumulation on stomatal behavior and photosynthetic capacity as well as its putative metabolic impacts. Neither the stomatal conductance nor the kinetic responses to dark, light, or high CO 2 were highly affected in tdt plants. In addition, we did not observe any impact on stomatal aperture following incubation with abscisic acid, malate, or citrate. Furthermore, an effect on photosynthetic capacity was not observed in the mutant lines. However, leaf mitochondrial metabolism was affected in the tdt plants. Levels of the intermediates of the tricarboxylic acid cycle were altered, and increases in both light and dark respiration were observed. We conclude that manipulation of the tonoplastic organic acid transporter impacted mitochondrial metabolism, while the overall stomatal and photosynthetic capacity were unaffected. © 2017 American Society of Plant Biologists. All Rights Reserved.
Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang
2015-08-01
Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. Copyright © 2015 Elsevier Inc. All rights reserved.
Coustou, Virginie; Besteiro, Sébastien; Rivière, Loïc; Biran, Marc; Biteau, Nicolas; Franconi, Jean-Michel; Boshart, Michael; Baltz, Théo; Bringaud, Frédéric
2005-04-29
Trypanosoma brucei is a parasitic protist responsible for sleeping sickness in humans. The procyclic stage of T. brucei expresses a soluble NADH-dependent fumarate reductase (FRDg) in the peroxisome-like organelles called glycosomes. This enzyme is responsible for the production of about 70% of the excreted succinate, the major end product of glucose metabolism in this form of the parasite. Here we functionally characterize a new gene encoding FRD (FRDm1) expressed in the procyclic stage. FRDm1 is a mitochondrial protein, as evidenced by immunolocalization, fractionation of digitonin-permeabilized cells, and expression of EGFP-tagged FRDm1 in the parasite. RNA interference was used to deplete FRDm1, FRDg, or both together. The analysis of the resulting mutant cell lines showed that FRDm1 is responsible for 30% of the cellular NADH-FRD activity, which solves a long standing debate regarding the existence of a mitochondrial FRD in trypanosomatids. FRDg and FRDm1 together account for the total NADH-FRD activity in procyclics, because no activity was measured in the double mutant lacking expression of both proteins. Analysis of the end products of 13C-enriched glucose excreted by these mutant cell lines showed that FRDm1 contributes to the production of between 14 and 44% of the succinate excreted by the wild type cells. In addition, depletion of one or both FRD enzymes results in up to 2-fold reduction of the rate of glucose consumption. We propose that FRDm1 is involved in the maintenance of the redox balance in the mitochondrion, as proposed for the ancestral soluble FRD presumably present in primitive anaerobic cells.
Goss, P E; Oza, A; Goel, R; Nabholtz, J M; De Coster, R; Bruynseels, J; Reid, C; Wadden, N; Crump, M; Tye, L M
2000-01-01
This phase II study of liarozole fumarate (R85246, liarozole), a novel imidazole with retinomimetic and aromatase inhibitory effects, was designed to determine the efficacy and tolerability in postmenopausal women with advanced breast cancer in progression, to correlate these effects with hormonal levels, and to evaluate quality of life. Twenty-nine women with ER-positive or unknown metastatic disease who received > or = 2 prior hormonal therapies were treated with 150-300 mg liarozole twice daily until disease progression. All patients were evaluable for toxicity and 25 for response. Four patients (16.0%, 95% CI 5.3-37.4%) had partial remission (PR) of their disease for a median of 7.4 months (range 1.2-12.9) and 7 (28%) had disease stabilization for a median of 4.8 months (1.6-16.0). Estradiol decreased from pre-treatment levels of 9.2-52 pM (mean 17.1) to below detection (9.2 pM, p = 0.0005) after 1 month. Similarly estrone levels fell from 14-307 pM (mean 92.7) to below detection (9.2 pM, p = 0.0001). The most common toxicity was dermatological (96.6%) with features compatible with hypervitaminosis A syndrome such as rash, pruritus, dry skin, and brittle nails. The majority of these were mild to moderate in severity. No significant improvement in quality of life scores (FLI-C) were noted. Liarozole is an active new treatment for breast cancer in patients heavily pre-treated with hormone therapies. Further studies are needed to confirm its relative efficacy in both receptor positive and negative postmenopausal breast cancer.
Soltani, Saieede; Zakeri-Milani, Parvin; Barzegar-Jalali, Mohammad; Jelvehgari, Mitra
2016-01-01
Objective(s): Ketotifen fumarate (KF) is a selective and noncompetitive histamine antagonist (H1-receptor) that is used topically in the treatment of allergic conditions of rhinitis and conjunctivitis. The aim of this study was to formulate and improve an ophthalmic delivery system of KF. Ocular nanoparticles were prepared with the objective of reducing the frequency of administration and obtaining controlled release to improve the anti-inflammatory drug delivery. Materials and Methods: In the present study, ocular KF loaded Eudragit RL 100 nanoparticles were prepared using O/W solvent diffusion method. The nanoparticles were evaluated for particle size, entrapment efficiency, surface morphology, X-ray diffraction (XRD), Fourier transform spectroscopy (FTIR), and differential scanning calorimetry (DSC). In vitro release and permeation studies were also carried out on nanoparticles. Results: An average size range of 182 to 314.30 nm in diameter was obtained and encapsulation efficiency up to 95.0% was observed for all the formulations. Drug release for all formulations after 24 hr was between 65.51% and 88.82% indicating effective controlled release property of KF. The mechanism of drug release for best formulation was found to be fickian diffusion mechanism. KF nanoparticles containing high polymer concentration (1:15) presented a faster drug release and a higher drug penetration; on the contrary, nanoparticles containing low polymer concentration (1:7.5) were able to give a more sustained release of the drug and thus a slower KF permeation through the cornea. Conclusion: The study revealed that KF NPs were capable of releasing the drug for a prolonged period of time and increasing the ocular bioavailability. PMID:27403262
Khan, Arshad Bashir; Thakur, Ram Sharnagat
2018-03-01
To design and evaluate novel, feasible, safe, mucoadhesive intravaginal tablets of tenofovir disoproxil fumarate (TDF). It may provide pre-exposure prophylaxis for women against HIV. TDF intravaginal tablets were formulated employing poylvinylpyrrolidone (PVP) as the matrix forming polymer and various mucoadhesive polymers such as carbopol 934, 940, chitosan, and sodium carboxymethylcellulose (SCMC). Wet granulation was used. The evaluation involved testing drug-excipient compatibility, precompression parameters such as percentage yield, bulk density and tapped density of the granules, Carr's index, Hausner ratio, angle of repose, post compression parameters such as color, shape, physical dimensions, weight variation, hardness, friability, swelling index, assay, in vitro dissolution study and ex vivo mucoadhesion studies. Based on in vitro evaluation, C1 was selected as the best formulation and evaluated further for release kinetics, curve fitting analysis, absorption studies using liquid chromatography-mass spectrometry (LC-MS) technique and histopathological assessment in female Sprague-Dawley rats. C1 followed Higuchi model kinetics. Accelerated stability study was as per ICH guidelines by keeping C1 at 40 ± 2 °C and 75 ± 5% RH for six months. C1 was selected as the best formulation due to better swelling index (65.93% at 24 h), prolonged release of 100.62% cumulative drug release (CDR) at 24 h, superior mucoadhesion force (35.93 × 10 2 dynes/cm 2 ) and retention time (16 h). The study revealed that C1 remained stable for six months. C1 showed nil systemic absorption which is desirable and according to histopathological study, C1, exhibited minimal damage on the rat vaginal epithelium indicating safety.
Solomon, Marc M; Lama, Javier R; Glidden, David V; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y; Guanira, Juan Vicente; Veloso, Valdilea G; Mayer, Kenneth H; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N; Grant, Robert M
2014-03-27
Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft-Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: -2.4 vs. -1.1 ml/min; P=0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P=0.02), and resolved after stopping pre-exposure prophylaxis (mean change: -0.1 vs. 0.0 ml/min; P=0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring.
Reich, Kristian; Hartl, Christoph; Gambichler, Thilo; Zschocke, Ina
2016-01-01
Given that there is no standard systemic treatment for children and adolescents with plaque psoriasis, this non-interventional, multicenter, retrospective study collected data on the efficacy and safety of long-term treatment with fumaric acid esters (FAEs) in this particular patient group. In patients younger than 18 years of age at the start of FAE treatment, data on efficacy and safety was retrospectively collected for at least 36 months. Data from 127 patients (aged 6-17 years) was collected for treatment durations of up to 60 months. Physician's Global Assessment, Psoriasis Area and Severity Index, and Body Surface Area showed marked improvement in the first six months. After 36 months, these parameters had, on average, improved by up to two-thirds of baseline values. Thirty-seven patients experienced at least one adverse event (AE), which was FAE-related in 36 individuals. Three AEs (proteinuria (one case), flushing (two cases)) persisted during the observation period while on treatment. Fifteen AEs led to the discontinuation of therapy; nearly all of these cases were related to gastrointestinal disorders. The KIDS FUTURE study - for the first time - included a larger population of children and adolescents with psoriasis who were treated with FAEs. The data obtained suggests that long-term FAE therapy in this patient group may be effective and safe. The results are currently being verified in an ongoing clinical study. © 2015 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.
von Netzer, Frederick; Pilloni, Giovanni; Kleindienst, Sara; Krüger, Martin; Knittel, Katrin; Gründger, Friederike
2013-01-01
The detection of anaerobic hydrocarbon degrader populations via catabolic gene markers is important for the understanding of processes at contaminated sites. Fumarate-adding enzymes (FAEs; i.e., benzylsuccinate and alkylsuccinate synthases) have already been established as specific functional marker genes for anaerobic hydrocarbon degraders. Several recent studies based on pure cultures and laboratory enrichments have shown the existence of new and deeply branching FAE gene lineages, such as clostridial benzylsuccinate synthases and homologues, as well as naphthylmethylsuccinate synthases. However, established FAE gene detection assays were not designed to target these novel lineages, and consequently, their detectability in different environments remains obscure. Here, we present a new suite of parallel primer sets for detecting the comprehensive range of FAE markers known to date, including clostridial benzylsuccinate, naphthylmethylsuccinate, and alkylsuccinate synthases. It was not possible to develop one single assay spanning the complete diversity of FAE genes alone. The enhanced assays were tested with a range of hydrocarbon-degrading pure cultures, enrichments, and environmental samples of marine and terrestrial origin. They revealed the presence of several, partially unexpected FAE gene lineages not detected in these environments before: distinct deltaproteobacterial and also clostridial bssA homologues as well as environmental nmsA homologues. These findings were backed up by dual-digest terminal restriction fragment length polymorphism diagnostics to identify FAE gene populations independently of sequencing. This allows rapid insights into intrinsic degrader populations and degradation potentials established in aromatic and aliphatic hydrocarbon-impacted environmental systems. PMID:23124238
NASA Astrophysics Data System (ADS)
Moradi, Golshan; Zinadini, Sirus; Rajabi, Laleh; Dadari, Soheil
2018-01-01
The nanofibrous Polyacrylonitrile (PAN) membranes embedded with fumarate-alumoxane (Fum-A) nanoparticles were prepared via electrospinning technique as high flux and antifouling membranes for membrane bioreactor (MBR) applications. The effect of Fum-A nanoparticles on membrane morphology, surface hydrophilicity, pure water flux, effluent turbidity and the antifouling property was investigated. Fum-A is a carboxylate-alumoxane nanoparticle covered by extra hydroxyl and carboxylate groups on its surface. By embedding Fum-A nanoparticles into the spinning solution, the surface hydrophilicity and pure water flux of the resulted membranes were improved. The smooth surface of fibers at the low amount of nanoparticles and the agglomeration of nanoparticles at their high concentration were shown in SEM images of the membranes surface. The energy dispersive spectroscopy (EDS) and Fourier transform infrared spectroscopy (FTIR) analysis of the prepared Fum-A/PAN membrane confirmed the presence of carboxylate and hydroxyl functional groups of Fum-A nanoparticles on the surface of the Fum-A nanoparticles containing membrane. The results obtained from the filtration of activated sludge suspension revealed that by addition of a low amount of Fum-A nanoparticles, the irreversible fouling was significantly decreased due to the higher hydrophilicity. The Fum-A/PAN membranes showed superior permeate flux and antifouling properties compared to bare electrospun PAN membrane. Finally, 2 wt.% Fum-A/PAN membrane exhibited the highest FRR of 96% and the lowest irreversible fouling of 4% with excellent durability of antifouling property during twenty repeated activated sludge filtrations.
Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina
2016-01-01
Objective. Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). Methods. A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Results. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52–3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10–14.0; P > .99). Conclusions. Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. PMID:27029778
Ke, Weixia; Zhang, Chi; Liu, Li; Gao, Yanhui; Yao, Zhenjiang; Ye, Xiaohua; Zhou, Shudong; Yang, Yi
2016-11-01
Tenofovir disoproxil fumarate (TDF) is newly available for treatment of chronic hepatitis B patients in China. To date, no study has been conducted to examine the cost-effectiveness of this treatment. The aim of this study was to estimate the cost-effectiveness of TDF versus four oral nucleos(t)ide analogs [lamivudine (LAM), adefovir (ADV), telbivudine (LdT), and entecavir (ETV)] and from a pharmacoeconomic perspective to assess current drug pricing for TDF. Based on Chinese healthcare perspectives, a Markov model was applied to simulate the lifetime (40-year time span) costs and quality-adjusted life-years (QALYs) for five different monotherapy strategies. Two kinds of rescue combination strategies (base-case: LAM + ADV then ETV + ADV; alternative: directly using ETV + ADV) were separately considered for treatment of patients refractory to monotherapy. Model parameters (including disease transition, cost, and utility) were obtained from previous Chinese population studies. Both branded and generic drugs were separately analyzed. Study model uncertainties were assessed by one-way and probabilistic sensitivity analyses. Two-way sensitivity analysis was used to explore uncertainties between efficacy and price of TDF. In the base-case analysis, the lowest lifetime cost and the best cost-effectiveness ratio were obtained by ETV, which was considered the reference treatment. LAM, ADV, and LdT treatments had significantly greater costs and lower efficacies. Compared to ETV, TDF was more effective but also more expensive. The incremental cost-effectiveness ratios of TDF versus ETV were much higher than the willing-to-pay threshold of $20,466 US dollars (USD) per QALY gained (3 × gross domestic product per capita of China, 2014). TDF would be the most cost-effective strategy if the annual cost did not exceed $2260 USD and $1600 USD for branded and generic drugs, respectively. For Chinese chronic hepatitis B patients, ETV is still the most cost
Predictors of Response to Multiple Sclerosis Therapeutics in Individual Patients.
Hegen, Harald; Auer, Michael; Deisenhammer, Florian
2016-10-01
Multiple sclerosis (MS) is a chronic inflammatory disorder of the central nervous system. Several disease-modifying therapies have been shown to ameliorate the disease course; however, the individual treatment response and the occurrence of adverse events remain highly unpredictable. In the last 2 decades, a multitude of studies have aimed to identify biomarkers that enable treatment allocation in the individual patient or subgroup of patients with regard to treatment efficacy and safety profile. Following a PubMed database search, we provide an overview on what is presently known about body fluid markers for the prediction of response to the currently approved MS therapeutics. We also discuss the potential use of biomarkers with regard to drug-induced adverse events. To date, only a few molecules have been introduced in clinical routine: anti-drug antibodies against interferon (IFN)-β and natalizumab that are associated with abolished drug levels and treatment failure; anti-JC virus (JCV) antibody index that allows risk stratification for the development of progressive multifocal leukoencephalopathy (PML), a rare but severe adverse event during natalizumab treatment; and serostatus of varicella zoster virus as screening examination prior to fingolimod therapy to prevent the infection. A few candidate biomarkers still need closer examination, such as type I IFN signature and T-helper cell (Th)-17 reactivity for prediction of IFN-β treatment response, L-selectin expression for prediction of natalizumab-associated PML, interleukin (IL)-21 levels for prediction of secondary autoimmunity after exposure to alemtuzumab, lymphocyte count with regard to PML risk while receiving dimethyl fumarate or N-terminal-pro-B-type natriuretic peptide (NT-proBNP) for monitoring of cardiac side effects during mitoxantrone therapy.
Chen, Xi; Zhao, Yannan; Li, Xing; Xiao, Zhifeng; Yao, Yuanjiang; Chu, Yun; Farkas, Balázs; Romano, Ilaria; Brandi, Fernando; Dai, Jianwu
2018-06-19
Many factors contribute to the poor axonal regrowth and ineffective functional recovery after spinal cord injury (SCI). Biomaterials have been used for SCI repair by promoting bridge formation and reconnecting the neural tissue at the lesion site. The mechanical properties of biomaterials are critical for successful design to ensure the stable support as soon as possible when compressed by the surrounding spine and musculature. Poly(propylene fumarate) (PPF) scaffolds with high mechanical strength have been shown to provide firm spatial maintenance and to promote repair of tissue defects. A multichannel PPF scaffold is combined with collagen biomaterial to build a novel biocompatible delivery system coated with neurotrophin-3 containing an engineered collagen-binding domain (CBD-NT3). The parallel-aligned multichannel structure of PPF scaffolds guide the direction of neural tissue regeneration across the lesion site and promote reestablishment of bridge connectivity. The combinatorial treatment consisting of PPF and collagen loaded with CBD-NT3 improves the inhibitory microenvironment, facilitates axonal and neuronal regeneration, survival of various types of functional neurons and remyelination and synapse formation of regenerated axons following SCI. This novel treatment strategy for SCI repair effectively promotes neural tissue regeneration after transected spinal injury by providing a regrowth-supportive microenvironment and eventually induces functional improvement. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cheng, Chien-Yu; Chang, Shu-Yin; Lin, Mei-Hui; Ku, Shin-Yen; Sun, Na-Lee; Cheng, Shu-Hsing
2016-11-01
Tenofovir disoproxil fumarate (TDF) -containing regimens have been associated with nephrotoxicity and hypophosphatemia in HIV-infected patients. The objective of this study was to assess the possible risk factors for hypophosphatemia and evaluate the relationship between fractional excretion of filtered phosphate (FePi) and hypophosphatemia in TDF users. Patients were enrolled in a prospective cohort study between January 2011 and December 2014. We classified experienced HIV-infected patients (individuals maintained on antiretroviral therapy (ART) for 6 months or more) and naïve patients into 3 treatment groups: TDF-containing ART (group 1), non-TDF-containing ART (never received TDF or had not received TDF in the past 6 months; group 2) and naive to antiretroviral therapy (group 3). Specimens from each individual were assessed for serum phosphate, serum creatinine, urine phosphate, and urine creatinine. Multivariable logistic regression was performed to control for the following variables measured at baseline: eGFR, age, sex, sexual orientation, injection drug use (IDUs), HIV-RNA viral load, and CD4 cell count. The frequency of hypophosphatemia in groups 1, 2, and 3 was 20.2%, 7.2%, and 14.6%, respectively (P = 0.002). FePi above 10% also was significantly associated with hypophosphatemia (P = 0.003; adjusted odds ratio = 2.54). Patients with elevated CD4 cell counts (>500 cells/μL) exhibited a lower risk of hypophosphatemia (P = 0.002; adjusted odds ratio = 0.35). Hypophosphatemia is a multifactorial etiology; FePi was confirmed as a suggested method to predict the risk of hypophosphatemia in TDF users. Clinical Trial Number: TYGH103011. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Shah, Brijesh; Khunt, Dignesh; Misra, Manju; Padh, Harish
2016-08-25
Systemic drug delivery in schizophrenia is a major challenge due to presence of obstacles like, blood-brain barrier and P-glycoprotein, which prohibit entry of drugs into the brain. Quetiapine fumarate (QF), a substrate to P-glycoprotein under goes extensive first pass metabolism leading to limited absorption thus necessitating frequent oral administration. The aim of this study was to develop QF based microemulsion (ME) with and without chitosan (CH) to investigate its potential use in improving the bioavailability and brain targeting efficiency following non-invasive intranasal administration. QF loaded ME and mucoadhesive ME (MME) showed globule size, pH and viscosity in the range of 29-47nm, 5.5-6.5 and 17-40cP respectively. CH-ME with spherical globules having mean size of 35.31±1.71nm, pH value of 5.61±0.16 showed highest ex-vivo nasal diffusion (78.26±3.29%) in 8h with no sign of structural damage upon histopathological examination. Circular plume with an ovality ratio closer to 1.3 for CH-ME depicted ideal spray pattern. Significantly higher brain/blood ratio of CH-ME in comparison to QF-ME and drug solution following intranasal administration revealed prolonged retention of QF at site of action suggesting superiority of CH as permeability enhancer. Following intranasal administration, 2.7 and 3.8 folds higher nasal bioavailability in brain with CH-ME compared to QF-ME and drug solution respectively is indicative of preferential nose to brain transport (80.51±6.46%) bypassing blood-brain barrier. Overall, the above finding shows promising results in the area of developing non-invasive intranasal route as an alternative to oral route for brain delivery. Copyright © 2016 Elsevier B.V. All rights reserved.
Solomon, Marc M.; Lama, Javier R.; Glidden, David V.; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y.; Guanira, Juan Vicente; Veloso, Valdilea G.; Mayer, Kenneth H.; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N.; Grant, Robert M.
2014-01-01
Objective: Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. Design and methods: The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft–Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. Results: There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: −2.4 vs. −1.1 ml/min; P = 0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P = 0.02), and resolved after stopping pre-exposure prophylaxis (mean change: −0.1 vs. 0.0 ml/min; P = 0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. Conclusions: In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring. PMID:24499951
Möller, Hans-Jürgen; Johnson, Sunny; Mateva, Temenuzhka; Brecher, Martin; Svensson, Ola; Miller, Frank; Meulien, Didier
2008-03-01
This double-blind, double-dummy study (D1444C00146) evaluated the efficacy and safety of switching patients with clinically stable schizophrenia from quetiapine immediate release (IR) to the same dose of once-daily extended release quetiapine fumarate (quetiapine XR). Patients received quetiapine IR 400-800 mg/day twice daily for 4 weeks, and were then randomized (2 : 1) to a once-daily equivalent dose of quetiapine XR or maintained on IR for 6 weeks. The primary variable was the proportion of patients who discontinued treatment owing to lack of efficacy or whose Positive and Negative Syndrome Scale scores increased by at least 20% from randomization to any visit. In total, 497 patients were randomized to quetiapine XR (n=331) or IR (n=166). Noninferiority (6% margin; one-sided test, 2.5% significance level) was narrowly missed for the primary efficacy variable for the modified intention-to-treat population (9.1%, quetiapine XR; 7.2%, quetiapine IR; difference 1.86%; 95% confidence interval: -3.78, 6.57; P=0.0431), but was shown for the per-protocol population (5.3%, quetiapine XR; 6.2%, quetiapine IR; difference: -0.83%; 95% confidence interval: -6.75, 3.71; P=0.0017). Serious adverse event incidence was low for quetiapine XR and IR; there were no unexpected adverse events. In conclusion, efficacy was maintained without compromising safety/tolerability when switching patients with stable schizophrenia from twice-daily quetiapine IR to once-daily quetiapine XR (400-800 mg/day).
Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina
2016-10-01
Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52-3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10-14.0; P > .99). Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Cattaneo, Dario; Minisci, Davide; Baldelli, Sara; Mazzali, Cristina; Giacomelli, Andrea; Milazzo, Laura; Meraviglia, Paola; Resnati, Chiara; Rizzardini, Giuliano; Clementi, Emilio; Galli, Massimo; Gervasoni, Cristina
2018-01-01
The dose of tenofovir alafenamide is reduced from 25 to 10 mg daily when given with boosting agents. However, such dose reduction has never been adopted for tenofovir disoproxil fumarate (TDF). In this study, we aim to quantify the effect of cobicistat (COBI) both on tenofovir concentrations and TDF durability in real life setting. HIV-positive patients receiving TDF-containing antiretroviral therapies with at least 1 assessment of tenofovir plasma trough concentrations were included in the study. Univariate and multivariate regression analyses were performed considering tenofovir concentration as the dependent variable and clinical characteristics as independent covariates. Subsequently, survival and Cox analyses were performed considering as the primary outcome TDF discontinuation for any reasons. Patients were given TDF with protease inhibitors/ritonavir (n = 212), non-nucleoside reverse transcriptase inhibitors (n = 176), integrase inhibitors (dolutegravir or raltegravir, n = 46), or with elvitegravir/COBI (ELV/COBI) (n = 76). By multivariate analysis, concomitant antiretroviral therapies resulted significantly associated with tenofovir levels, with the highest drug concentrations measured in patients given ELV/COBI. By survival analysis, we found that patients given TDF with ELV/COBI had the lowest rate of drug durability. Overall, these patients had a 2.3-fold increased risk to experience TDF discontinuation. Coadministration with COBI resulted in significantly higher tenofovir concentrations and higher TDF discontinuation compared with other antiretroviral regimens. Accordingly, the possibility that the lack of proper dose adjustment for TDF when given with COBI might have biased the safety comparisons with tenofovir alafenamide during registrative trials cannot be ruled out.
Singh, Dave; Vezzoli, Stefano; Petruzzelli, Stefano; Papi, Alberto
2017-01-01
The GOLD 2017 strategy document recommends that the pharmacological management of COPD patients be based on the risk of future exacerbations and the severity of symptoms. A threshold of two moderate exacerbations or one hospitalization is used to define high-risk patients. The FORWARD study was a randomized, double-blind, parallel-group trial that compared 48 weeks’ treatment with extrafine beclomethasone dipropionate plus formoterol fumarate (BDP-FF) versus FF in severe COPD patients with a history of one or more exacerbations in the previous year. The new GOLD 2017 recommendations mean that many patients in the FORWARD study are now reclassified as GOLD B. We conducted a post hoc analysis of the FORWARD study, in order to investigate the effects of extrafine BDP/FF in patients with one exacerbation in the previous year, focusing on those categorized as group B using the GOLD 2017 definition. The analysis showed a 35% reduction in exacerbation rate with an inhaled corticosteroid (ICS) + long-acting β-agonist (LABA) versus LABA. We propose that ICS-LABA treatment is a therapeutic option for COPD patients with one exacerbation in the previous year. PMID:29138555
Runja, Chinnalalaiah; Ravi Kumar, Pigili; Avanapu, Srinivasa Rao
2016-01-01
A new simple, rapid stability indicating assay method has been developed and validated for the determination of emtricitabine, tenofovir disoproxil fumarate, elvitegravir and cobicistat using reverse-phase high-performance liquid chromatography in their pharmaceutical dosage form. The chromatographic separation was performed on an ODS column (250 × 4.6 mm, 5 µm) using mobile phase A (potassium dihydrogen orthophosphate, pH adjusted to 2.5) and mobile phase B (acetonitrile) in the ratio of 55:45% v/v at a flow rate of 1 mL/min. The analytes were detected at 250 nm. The method was found to be linear in the concentration range of 2–12 µg/mL for EMT, 3–18 µg/mL for TNDF, 1.5–9 µg/mL for ELV and COB, with the coefficient value (R2) of >0.9990. The accuracy was measured via recovery studies and found to be acceptable, and the percentage recoveries were found in the range of 99.93–100.08 ± 0.5%. Forced degradation studies were also conducted, and the drugs were subjected to various stress conditions such as acid hydrolysis, base hydrolysis, oxidative, photolytic and thermal degradation. The proposed method was successfully validated and applied for the quantitative estimation of these drugs in both bulk and tablet dosage forms. PMID:26865655
Shah, Brijesh; Khunt, Dignesh; Misra, Manju; Padh, Harish
2016-08-01
The objective of the present investigation was to optimize and develop quetiapine fumarate (QF) loaded chitosan nanoparticles (QF-NP) by ionic gelation method using Box-Behnken design. Three independent variables viz., X1-Concentration of chitosan, X2-Concentration of sodium tripolyphosphate and X3-Volume of sodium tripolyphosphate were taken to investigate their effect on dependent variables (Y1-Size, Y2-PDI and Y3-%EE). Optimized formula of QF-NP was selected from the design space which was further evaluated for physicochemical, morphological, solid state characterization, nasal diffusion and in-vivo distribution for brain targeting following non-invasive intranasal administration. The average particle size, PDI, %EE and nasal diffusion were found to be 131.08±7.45nm, 0.252±0.064, 89.93±3.85% and 65.24±5.26% respectively. Neither toxicity nor structural damage on nasal mucosa was observed upon histopathological examination. Significantly higher brain/blood ratio and 2 folds higher nasal bioavailability in brain with QF-NP in comparison to drug solution following intranasal administration revealed preferential nose to brain transport bypassing blood-brain barrier and prolonged retention of QF at site of action suggesting superiority of chitosan as permeability enhancer. Overall, the above finding shows promising results in the area of developing non-invasive intranasal route as an alternative to oral route for brain delivery. Copyright © 2016 Elsevier B.V. All rights reserved.
Methods for the synthesis of olefins and derivatives
Burk, Mark J; Pharkya, Priti; Van Dien, Stephen J; Burgard, Anthony P; Schilling, Christophe H
2013-06-04
The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.
Methods for the synthesis of olefins and derivatives
Burk, Mark J [San Diego, CA; Pharkya, Priti [San Diego, CA; Van Dien, Stephen J [Encinitas, CA; Burgard, Anthony P [Bellefonte, PA; Schilling, Christophe H [San Diego, CA
2011-09-27
The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.
Methods for synthesis of olefins and derivatives
Burk, Mark J.; Pharkya, Priti; Van Dien, Stephen J.; Burgard, Anthony P.; Schilling, Christophe H.
2016-06-14
The invention provides a method of producing acrylic acid. The method includes contacting fumaric acid with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylic acid per mole of fumaric acid. Also provided is an acrylate ester. The method includes contacting fumarate diester with a sufficient amount of ethylene in the presence of a cross-metathesis transformation catalyst to produce about two moles of acrylate ester per mole of fumarate diester. An integrated process for process for producing acrylic acid or acrylate ester is provided which couples bioproduction of fumaric acid with metathesis transformation. An acrylic acid and an acrylate ester production also is provided.
Vojdeman, Fie Juhl; Van't Veer, Mars B; Tjønnfjord, Geir E; Itälä-Remes, Maija; Kimby, Eva; Polliack, Aaron; Wu, Ka L; Doorduijn, Jeanette K; Alemayehu, Wendimagegn G; Wittebol, Shulamiet; Kozak, Tomas; Walewski, Jan; Abrahamse-Testroote, Martine C J; van Oers, Marinus H J; Geisler, Christian Hartmann
2017-03-01
In the HOVON68 CLL trial, patients 65 to 75 years of age had no survival benefit from the addition of low-dose alemtuzumab to fludarabine and cyclophosphamide (FC) in contrast to younger patients. The reasons are explored in this 5-year trial update using both survival analysis and competing risk analysis on non-CLL-related mortality. Elderly FCA patients died more frequently from causes not related to CLL, and more often related to comorbidity (mostly cardiovascular) than to infection. In a Cox multivariate analysis, del(17p), performance status >0, and comorbidity were associated with a higher non-CLL-related mortality in the elderly independent of the treatment modality. Thus, while the 'fit' elderly with no comorbidity or performance status of 0 might potentially benefit from chemo-immunotherapy with FC, caution is warranted, when considering alemtuzumab treatment in elderly patients with cardiovascular comorbidity.
Fragoso, Yara Dadalti
2015-01-01
Natalizumab and alemtuzumab are monoclonal antibodies approved for the treatment of relapsing-remitting multiple sclerosis (RRMS). A third monoclonal antibody, daclizumab, should soon become another alternative for RRMS therapy. A group of 26 doctors working at specific MS Units in seven different Latin American countries participated in the present study. All 26 neurologists had experience with natalizumab for the treatment of MS and were willing to discuss strategies for improving this treatment. Most neurologists had no confidence in starting a patient on natalizumab and alemtuzumab, which are new and efficient drugs approved by North American, European and most Latin American health agencies. The Latin American specialists felt they were not properly informed on daclizumab. Specific pharmacovigilance programs for each of these monoclonal antibodies were considered very important by the neurologists, who were also willing to discuss these therapeutic options with peers from other countries.
Ladomenou, Fani; Carpenter, Ben; Chandra, Sharat; Sedlacek, Petr; Formankova, Renata; Grandage, Vicky; Friswell, Mark; Cant, Andrew J.; Nademi, Zohreh; Slatter, Mary A.; Gennery, Andrew R.; Hambleton, Sophie; Flood, Terence J.; Lucchini, Giovanna; Chiesa, Robert; Rao, Kanchan; Amrolia, Persis J.; Brogan, Paul; Wedderburn, Lucy R.; Glanville, Julie M.; Hough, Rachael; Marsh, Rebecca; Abinun, Mario; Veys, Paul
2018-01-01
Patients with juvenile idiopathic arthritis (JIA) can experience a severe disease course, with progressive destructive polyarthritis refractory to conventional therapy with disease-modifying antirheumatic drugs including biologics, as well as life-threatening complications including macrophage activation syndrome (MAS). Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a potentially curative immunomodulatory strategy for patients with such refractory disease. We treated 16 patients in 5 transplant centers between 2007 and 2016: 11 children with systemic JIA and 5 with rheumatoid factor–negative polyarticular JIA; all were either refractory to standard therapy, had developed secondary hemophagocytic lymphohistiocytosis/MAS poorly responsive to treatment, or had failed autologous HSCT. All children received reduced toxicity fludarabine-based conditioning regimens and serotherapy with alemtuzumab. Fourteen of 16 patients are alive with a median follow-up of 29 months (range, 2.8-96 months). All patients had hematological recovery. Three patients had grade II-IV acute graft-versus-host disease. The incidence of viral infections after HSCT was high, likely due to the use of alemtuzumab in already heavily immunosuppressed patients. All patients had significant improvement of arthritis, resolution of MAS, and improved quality of life early following allo-HSCT; most importantly, 11 children achieved complete drug-free remission at the last follow-up. Allo-HSCT using alemtuzumab and reduced toxicity conditioning is a promising therapeutic option for patients with JIA refractory to conventional therapy and/or complicated by MAS. Long-term follow-up is required to ascertain whether disease control following HSCT continues indefinitely. PMID:29618462
Code of Federal Regulations, 2011 CFR
2011-04-01
...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...
Code of Federal Regulations, 2014 CFR
2014-04-01
...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...
Code of Federal Regulations, 2012 CFR
2012-04-01
...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...
Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu
2018-05-01
Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Hoyle, M; Crathorne, L; Garside, R; Hyde, C
2011-05-01
This paper presents a summary of the evidence review group (ERG) report into the clinical effectiveness and cost-effectiveness of ofatumumab for the treatment of refractory chronic lymphocytic leukaemia (CLL), based upon the manufacturer's submission (MS) to the National Institute for Health and Clinical Excellence (NICE) as part of the single technology appraisal process. The submitted clinical evidence included one study: a non-randomised, single-arm study. Two other studies were identified but both were non-comparative and provided evidence for therapies other than ofatumumab. For this reason these studies were not discussed in full in the main body of the submission. In the Hx-CD20-406 study, the overall response rate was 58% (99% confidence interval 40% to 74%, p < 0.001). Complete resolution of constitutional symptoms and improved performance status occurred in 57% of patients. Median progression-free survival (PFS) and overall survival (OS) times were 5.7 and 13.7 months, respectively. The most common adverse events during treatment were infusion reactions and infections, which were primarily grade 1 or 2 events. The MS concluded that ofatumumab provides a new, effective and well-tolerated therapy for patients with CLL who are refractory to both fludarabine and alemtuzumab [double refractory (DR)]. The ERG undertook a critical appraisal of the submission. The ERG had a number of concerns regarding the manufacturer's estimates of effectiveness based on evidence from a single-arm, non-randomised study. An 'area-under-the-curve' or 'partitioned-survival' model was used to project expected clinical and economic outcomes for patients with DR CLL who were assumed to receive ofatumumab or best supportive care (BSC). The model had a three-state structure: 'alive pre-progression', 'alive post progression' and 'dead'. Overall, the modelling approach is reasonable given the limited evidence available for the drug in the patient population under review. However, a
Arribas, José R; Thompson, Melanie; Sax, Paul E; Haas, Bernhard; McDonald, Cheryl; Wohl, David A; DeJesus, Edwin; Clarke, Amanda E; Guo, Susan; Wang, Hui; Callebaut, Christian; Plummer, Andrew; Cheng, Andrew; Das, Moupali; McCallister, Scott
2017-06-01
In 2 double-blind phase 3 trials, 1733 antiretroviral-naive adults were randomized to tenofovir alafenamide (TAF) or tenofovir disoproxil fumarate (TDF), each coformulated with elvitegravir/cobicistat/emtricitabine (E/C/F). At 144 weeks, TAF was superior to TDF in virologic efficacy, with 84.2% vs 80.0% having HIV-1 RNA <50 copies/mL (difference 4.2%; 95% confidence interval: 0.6% to 7.8%). TAF had less impact than TDF on bone mineral density and renal biomarkers. No participants on TAF had renal-related discontinuations vs 12 on TDF (P < 0.001), with no cases of proximal tubulopathy for TAF vs 4 for TDF. There were greater increases in lipids with TAF vs TDF, with no difference in the total cholesterol to high-density lipoprotein ratio. For initial HIV therapy, E/C/F/TAF is superior to E/C/F/TDF in efficacy and bone and renal safety.
Koenig, H C; Mounzer, K; Daughtridge, G W; Sloan, C E; Lalley-Chareczko, L; Moorthy, G S; Conyngham, S C; Zuppa, A F; Montaner, L J; Tebas, P
2017-07-01
Tenofovir disoproxil fumarate/emtricitabine (TDF/FTC) is approved for pre-exposure prophylaxis (PrEP) against HIV infection. Adherence is critical for the success of PrEP, but current adherence measurements are inadequate for real-time adherence monitoring. We developed and validated a urine assay to measure tenofovir (TFV) to objectively monitor adherence to PrEP. We developed a urine assay using high-performance liquid chromatography coupled to tandem mass spectrometry with high sensitivity/specificity for TFV that allowed us to determine TFV concentrations in log 10 categories between 0 and 10 000 ng/mL. We validated the assay in three cohorts: (1) HIV-positive subjects with undetectable viral loads on a TDF/FTC-based regimen, (2) healthy HIV-negative subjects who received a single dose of TDF/FTC, and (3) HIV-negative subjects receiving daily TDF/FTC as PrEP for 24 weeks. The urine assay detected TFV with greater sensitivity than plasma-based measures and with a window of measurements within 7 days of the last TDF/FTC dose. Based on the urine log-linear clearance after the last dose and its concordance with all detectable plasma levels, a urine TFV concentration > 1000 ng/mL was identified as highly predictive of the presence of TFV in plasma at > 10 ng/mL. The urine assay was able to distinguish high and low adherence patterns within the last 48 h (> 1000 ng/mL versus 10-1000 ng/mL), as well as nonadherence (< 10 ng/mL) extended over at least 1 week prior to measurement. We provide proof of concept that a semiquantitative urine assay measuring levels of TFV could be further developed into a point-of-care test and be a useful tool to monitor adherence to PrEP. © 2017 British HIV Association.
Lee, Kee-Won; Wang, Shanfeng; Lu, Lichun; Jabbari, Esmaiel; Currier, Bradford L; Yaszemski, Michael J
2006-10-01
Poly(propylene fumarate) (PPF) is an injectable, biodegradable polymer that has been used for fabricating preformed scaffolds in tissue engineering applications because of in situ crosslinking characteristics. Aiming for understanding the effects of pore structure parameters on bone tissue ingrowth, 3-dimensional (3D) PPF scaffolds with controlled pore architecture have been produced in this study from computer-aided design (CAD) models. We have created original scaffold models with 3 pore sizes (300, 600, and 900 microm) and randomly closed 0%, 10%, 20%, or 30% of total pores from the original models in 3 planes. PPF scaffolds were fabricated by a series steps involving 3D printing of support/build constructs, dissolving build materials, injecting PPF, and dissolving support materials. To investigate the effects of controlled pore size and interconnectivity on scaffolds, we compared the porosities between the models and PPF scaffolds fabricated thereby, examined pore morphologies in surface and cross-section using scanning electron microscopy, and measured permeability using the falling head conductivity test. The thermal properties of the resulting scaffolds as well as uncrosslinked PPF were determined by differential scanning calorimetry and thermogravimetric analysis. Average pore sizes and pore shapes of PPF scaffolds with 600- and 900-microm pores were similar to those of CAD models, but they depended on directions in those with 300-microm pores. Porosity and permeability of PPF scaffolds decreased as the number of closed pores in original models increased, particularly when the pore size was 300 microm as the result of low porosity and pore occlusion. These results show that 3D printing and injection molding technique can be applied to crosslinkable polymers to fabricate 3D porous scaffolds with controlled pore structures, porosity, and permeability using their CAD models.
Kim, Tae Heon; Lee, Sang Eun; Lee, Hahn-Ey; Lee, Kyu-Sung
2016-08-01
The aim of this study was to evaluate the safety and efficacy of fesoterodine fumarate (fesoterodine; Toviaz ) in Korean patients with overactive bladder (OAB) in routine clinical practice. This was an open-label, non-interventional, prospective, post-marketing surveillance study submitted to the Korean Ministry of Food and Drug Safety. A total of 3109 patients aged ≥18 years with OAB symptoms were prescribed flexible doses of fesoterodine at the investigator's discretion. Safety was assessed based upon the reporting of adverse events (AEs). Efficacy was evaluated on the basis of patient self-assessment using a bladder diary as well as on the basis of investigator assessment in terms of overall clinical efficacy. A final analysis was performed on 3107 (99.9%) and 2978 (95.8%) patients for safety and efficacy analysis, respectively. The mean treatment duration of fesoterodine was 83.2 days. The incidence of AEs was 8.5% (265/3107). Common AEs that accounted for more than 1.0% of the total AE incidence included dry mouth (5.4%, 168/3107), constipation (1.5%, 48/3107) and micturition disorder (1.1%, 35/3107). Mean episodes of urinary frequency, urgency, and urgency urinary incontinence (UUI) per 24 hours decreased by 4.0, 2.4, and 0.8, respectively (all p < 0.001). At the final follow-up visit, the investigators found improvement in clinical efficacy for the majority of patients (90.1%, 2684/2978). Limitations of this study include the observational study design and the relatively short treatment duration. These results suggest that fesoterodine is a well tolerated and effective treatment for Korean patients with OAB in routine clinical practice.
Ohe, Chisato; Smith, Steven C; Sirohi, Deepika; Divatia, Mukul; de Peralta-Venturina, Mariza; Paner, Gladell P; Agaimy, Abbas; Amin, Mitual B; Argani, Pedram; Chen, Ying-Bei; Cheng, Liang; Colecchia, Maurizio; Compérat, Eva; Werneck da Cunha, Isabela; Epstein, Jonathan I; Gill, Anthony J; Hes, Ondřej; Hirsch, Michelle S; Jochum, Wolfram; Kunju, Lakshmi P; Maclean, Fiona; Magi-Galluzzi, Cristina; McKenney, Jesse K; Mehra, Rohit; Nesi, Gabriella; Osunkoya, Adeboye O; Picken, Maria M; Rao, Priya; Reuter, Victor E; de Oliveira Salles, Paulo Guilherme; Schultz, Luciana; Tickoo, Satish K; Tomlins, Scott A; Trpkov, Kiril; Amin, Mahul B
2018-03-01
Renal medullary carcinomas (RMCs) and collecting duct carcinomas (CDCs) are rare subsets of lethal high-stage, high-grade distal nephron-related adenocarcinomas with a predilection for the renal medullary region. Recent findings have established an emerging group of fumarate hydratase (FH)-deficient tumors related to hereditary leiomyomatosis and renal cell carcinoma (HLRCC-RCCs) syndrome within this morphologic spectrum. Recently developed, reliable ancillary testing has enabled consistent separation between these tumor types. Here, we present the clinicopathologic features and differences in the morphologic patterns between RMC, CDC, and FH-deficient RCC in consequence of these recent developments. This study included a total of 100 cases classified using contemporary criteria and ancillary tests. Thirty-three RMCs (SMARCB1/INI1-deficient, hemoglobinopathy), 38 CDCs (SMARCB1/INI1-retained), and 29 RCCs defined by the FH-deficient phenotype (FH/2SC or FH/2SC with FH mutation, regardless of HLRCC syndromic stigmata/history) were selected. The spectrum of morphologic patterns was critically evaluated, and the differences between the morphologic patterns present in the 3 groups were analyzed statistically. Twenty-five percent of cases initially diagnosed as CDC were reclassified as FH-deficient RCC on the basis of our contemporary diagnostic approach. Among the different overlapping morphologic patterns, sieve-like/cribriform and reticular/yolk sac tumor-like patterns favored RMCs, whereas intracystic papillary and tubulocystic patterns favored FH-deficient RCC. The tubulopapillary pattern favored both CDCs and FH-deficient RCCs, and the multinodular infiltrating papillary pattern favored CDCs. Infiltrating glandular and solid sheets/cords/nested patterns were not statistically different among the 3 groups. Viral inclusion-like macronucleoli, considered as a hallmark of HLRCC-RCCs, were observed significantly more frequently in FH-deficient RCCs. Despite the
Dorman, Emily; Kansal, Anuraag R; Sarda, Sujata
2015-01-01
Multiple sclerosis (MS) causes significant disability globally and is especially prevalent in Canada. Delayed-release dimethyl fumarate (DMF; also known as gastro-resistant DMF) is an orally administered disease-modifying treatment (DMT) for patients with relapsing-remitting MS (RRMS) that is currently on the market in the US, Australia, Canada, and Europe. A budget impact model (BIM) was developed to assess the financial consequences of introducing DMF for treatment of RRMS in Canada. A BIM calculated the financial consequences of introducing DMF in Canada over 3 years based on RRMS prevalence, treatment market share, and clinical effects. RRMS prevalence in Canada was derived from published literature and natural relapse rates, and disease state distribution from clinical trial data. It was conservatively assumed that 100% of RRMS patients were treated with a DMT. DMF was assumed to absorb market share proportionally from the following current treatments: interferon beta-1a-IM, interferon beta-1a-SC, interferon beta-1b, and glatiramer acetate. Treatment efficacy, in terms of relapse rate reductions and treatment discontinuation rates, was determined from mixed treatment comparison. Treatment costs (including costs of acquisition, monitoring, and administration) and cost of relapse were considered. Deterministic one-way sensitivity analyses were conducted to assess the most sensitive input parameters. Over 3 years, the introduction of DMF resulted in an average annual increase of CAD417 per treated patient per year, with reductions in costs associated with relapses (CAD192/patient/year) partially offsetting increased drug acquisition costs (CAD602/patient/year). On a population level, the average annual cost increase was CAD24,654,237, a CAD 0.68 increase per population covered by the Canadian healthcare system. The main drivers of budget impact were drop-out rates, proportion of RRMS patients treated, and market share assumptions. The acquisition costs of DMF for
Lu, Zheng
2017-01-01
ABSTRACT The impact of oxidative stress upon organismal fitness is most apparent in the phenomenon of obligate anaerobiosis. The root cause may be multifaceted, but the intracellular generation of reactive oxygen species (ROS) likely plays a key role. ROS are formed when redox enzymes accidentally transfer electrons to oxygen rather than to their physiological substrates. In this study, we confirm that the predominant intestinal anaerobe Bacteroides thetaiotaomicron generates intracellular ROS at a very high rate when it is aerated. Fumarate reductase (Frd) is a prominent enzyme in the anaerobic metabolism of many bacteria, including B. thetaiotaomicron, and prior studies of Escherichia coli Frd showed that the enzyme is unusually prone to ROS generation. Surprisingly, in this study biochemical analysis demonstrated that the B. thetaiotaomicron Frd does not react with oxygen at all: neither superoxide nor hydrogen peroxide is formed. Subunit-swapping experiments indicated that this difference does not derive from the flavoprotein subunit at which ROS normally arise. Experiments with the related enzyme succinate dehydrogenase discouraged the hypothesis that heme moieties are responsible. Thus, resistance to oxidation may reflect a shift of electron density away from the flavin moiety toward the iron-sulfur clusters. This study shows that the autoxidizability of a redox enzyme can be suppressed by subtle modifications that do not compromise its physiological function. One implication is that selective pressures might enhance the oxygen tolerance of an organism by manipulating the electronic properties of its redox enzymes so they do not generate ROS. PMID:28049145
Sędzielewska, Kinga A; Vetter, Katja; Bode, Rüdiger; Baronian, Keith; Watzke, Roland; Kunze, Gotthard
2012-04-01
Fumarate reductase is a protein involved in the maintenance of redox balance during oxygen deficiency. This enzyme irreversibly catalyzes the reduction of fumarate to succinate and requires flavin cofactors as electron donors. Two examples are the soluble mitochondrial and the cytosolic fumarate reductases of Saccharomyces cerevisiae encoded by the OSM1 and FRDS1 genes, respectively. This work reports the identification and characterization of the gene encoding cytosolic fumarate reductase enzyme in the arbuscular mycorrhizal fungus, Glomus intraradices and the establishment of its physiological role. Using a yeast expression system, we demonstrate that G. intraradices GiFRD encodes a protein that has fumarate reductase activity which can functionally substitute for the S. cerevisiae fumarate reductases. Additionally, we showed that GiFRD transformants are not affected by presence of salt in medium, indicating that the presence of this gene has no effect on yeast behavior under osmotic stress. The fact that GiFRD expression and enzymatic activity was present only in asymbiotic stage confirmed existence of at least one anaerobic metabolic pathway in this phase of fungus life cycle. This suggests that the AMF behave as facultative anaerobes in the asymbiotic stage. Copyright © 2012 Elsevier Inc. All rights reserved.
Lee, Andrew; Pike, James; Edwards, Michael R; Petrillo, Jennifer; Waller, John; Jones, Eddie
2017-06-01
Dimethyl fumarate (DMF) is a novel oral therapy used for the treatment of relapse-remitting multiple sclerosis (RRMS). In two 2-year pivotal Phase 3 trials in patients with RRMS, DMF significantly reduced disease activity based on both clinical and magnetic resonance imaging (MRI) findings and demonstrated an acceptable safety profile. However, there is currently a lack of comparative data which explore the relationship between work productivity and health-related quality of life (HRQoL) outcomes in RRMS and how these differ among RRMS therapies, including DMF. We explored this relationship through patient-reported data from the EuroQol Five-Dimensions (EQ-5D) tool, Work Productivity and Activity Impairment Questionnaire (WPAI), and the Hamburg Quality of Life Questionnaire in Multiple Sclerosis (HAQUAMS) using the Adelphi MS DSP® dataset. Our data demonstrated that patients receiving DMF experienced better outcomes, relative to patients receiving beta (β)interferons or glatiramer acetate, in all WPAI subscales [overall; average treatment effect (ATE) -13.92, 95% confidence interval (CI) -18.87 to -7.08; p < 0.001], EQ-5D (ATE +0.075, 95% Cl 0.014-0.136; p = 0.016) and HAQUAMS [ATE -0.45, 95% Cl -0.61 to -0.29; p < 0.001]. The EQ-5D and HAQUAMS were used with WPAI to determine the relationship between HRQoL outcomes and work productivity. Multiple linear regression analyses were performed, adjusting for age, sex, body mass index, ethnicity and number of comorbid conditions. These data demonstrate that therapy with DMF was associated with increased work productivity and HRQoL for patients with RRMS and that these outcomes were consistently improved compared to outcomes with interferon and glatiramer acetate therapies.
Huang, Li-Shar; Shen, John T; Wang, Andy C; Berry, Edward A
2006-01-01
Mitochondrial Complex II (succinate:ubiquinone oxidoreductase) is purified in a partially inactivated state, which can be activated by removal of tightly bound oxaloacetate (E.B. Kearney, et al., Biochem. Biophys. Res. Commun. 49 1115-1121). We crystallized Complex II in the presence of oxaloacetate or with the endogenous inhibitor bound. The structure showed a ligand essentially identical to the "malate-like intermediate" found in Shewanella Flavocytochrome c crystallized with fumarate (P. Taylor, et al., Nat. Struct. Biol. 6 1108-1112) Crystallization of Complex II in the presence of excess fumarate also gave the malate-like intermediate or a mixture of that and fumarate at the active site. In order to more conveniently monitor the occupation state of the dicarboxylate site, we are developing a library of UV/Vis spectral effects induced by binding different ligands to the site. Treatment with fumarate results in rapid development of the fumarate difference spectrum and then a very slow conversion into a species spectrally similar to the OAA-liganded complex. Complex II is known to be capable of oxidizing malate to the enol form of oxaloacetate (Y.O. Belikova, et al., Biochim. Biophys. Acta 936 1-9). The observations above suggest it may also be capable of interconverting fumarate and malate. It may be useful for understanding the mechanism and regulation of the enzyme to identify the malate-like intermediate and its pathway of formation from oxaloacetate or fumarate.
Analysis of mechanisms for memory enhancement using novel and potent 5-HT1A receptor ligands.
Pittalà, Valeria; Siracusa, Maria A; Salerno, Loredana; Romeo, Giuseppe; Modica, Maria N; Madjid, Nather; Ogren, Sven Ove
2015-08-01
In light of the involvement of serotonergic 5-HT1A receptors in the mediation of the memory of aversive events, the potent and selective 5-HT1A receptor antagonists, MC18 fumarate and VP08/34 fumarate, were tested in the passive avoidance task (PA), a rodent model of instrumental conditioning. Either alone or in combination with the prototypical agonist 8-OH-DPAT, MC18 fumarate at doses (0.1, 0.3 and 1mg/kg given 15min prior to training) exerted a dose-dependent facilitation of PA memory retention. When administered 15min prior to 8-OH-DPAT (0.3 and 1mg/kg), MC18 fumarate at a dose of 0.3mg/kg, enhanced significantly the impairment of PA retention caused by 8-OH-DPAT (1mg/kg). However, VP08/34 fumarate given at the same doses exerted no statistically effect on PA retention memory. Furthermore, VP08/34 fumarate given 15min prior to 8-OH-DPAT (0.3 and 1mg/kg) only slightly enhanced the PA impairment induced by 8-OH-DPAT. In conclusion, the profile of MC18 fumarate is intriguing since it behaves in a manner which differs from both full receptor antagonists such as NAD-299 or partial receptor agonists. The results also illustrate the importance of subtle receptor interaction and probably ligand efficacy in determining the actions of two almost identical 5-HT1A receptor ligands in cognitive function such as instrumental learning. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.
Costantini, Andrea; Tontini, Chiara; Rocchi, Monia; Martini, Matteo; Butini, Luca
2018-06-01
Reduced dose schedules may be feasible options to simplify antiretroviral therapy (ART) in selected HIV-1-infected individuals. Efficacy and safety of a Day-on, Day-off (DODO) schedule of tenofovir disoproxil fumarate, emtricitabine and efavirenz (FTC/TDF/EFV) single tablet regimen (STR) was assessed. Twenty-seven patients were prescribed the DODO schedule and were monitored for 48 weeks. Switching criteria were: no previous ART failure, no AIDS-defining illnesses, T CD4 cell nadir >200/mmc, and HIV-RNA below detection limit (40 copies/mL) for at least six months. Clinical and laboratory data, including plasma HIV-RNA levels, T CD4 and CD8 counts, liver and kidney function, lipid levels and ultrasensitive C-reactive protein (us-CRP) were assessed at baseline, week 4, 12, 24, and 48. Statistical analysis was performed by paired Student's T-test for comparison between baseline and each time point and Chi square test for CD4/CD8 ratio comparison. In all, 26 out of 27 patients maintained plasma HIV-RNA levels below the detection limit through the entire follow-up. One patient experienced low level plasma HIV-RNA rebound at week 36 (47 copies/ml) and immediately reverted to the conventional dose schedule of FTC/TDF/EFV; plasma HIV-RNA was undetectable after four weeks. No major changes on liver and kidney function tests, lipid levels and us-CRP were observed. Although no profound modifications of T CD4 count were observed during follow-up, the CD4/CD8 ratio increased significantly at week 48 compared to the baseline (p<0.05). In conclusion, 48-week DODO administration of the fixed dose FTC/TDF/EFV STR combination was safe and effective in maintaining HIV viral replication below the detection limit in a selected group of HIV-1-infected individuals.
Buchacz, K; Brooks, J T; Tong, T; Moorman, A C; Baker, R K; Holmberg, S D; Greenberg, A
2006-10-01
Cases of hypophosphataemia (often coincident with renal dysfunction) have been reported in HIV-infected patients taking tenofovir disoproxil fumarate (TDF), but randomized placebo-controlled trials of HIV-infected persons with normal baseline renal function have found a comparable incidence of hypophosphataemia in the TDF and placebo groups. We assessed the incidence of grade 2 and higher hypophosphataemia in the HIV Outpatient Study (HOPS). We analysed a prospective cohort of patients who initiated either a TDF-containing highly active antiretroviral therapy (HAART) regimen [TDF-exposed (TDF+) group; n = 165] or a TDF-sparing HAART regimen [TDF-unexposed (TDF-) group; n = 90], and who had normal baseline phosphate and creatinine values. The TDF+ and TDF- groups had comparable median follow-up times (10.9 vs 8.8 months, respectively; P = 0.18) and number of phosphate measurements (median = 3 for both) and were similar on most clinical and demographic factors. During follow up, 12.7% of TDF+vs 6.7% of TDF-patients developed grade 2 hypophosphataemia (2.0-2.4 mg/dL), and 2.4% of TDF+ patients vs 0% of TDF-patients developed grade 3 hypophosphataemia (1.0-1.9 mg/dL); none developed grade 4 hypophosphataemia (<1.0 mg/dL). The incidence of grade 2 or higher hypophosphataemia was 16.7 per 100 person-years among TDF+ patients vs 8.0 per 100 person-years among TDF-patients (P = 0.11). The incidence of hypophosphataemia was somewhat elevated in HOPS patients who took TDF-containing HAART compared with those who took TDF-sparing HAART during the first 1 to 2 years of observation, but the difference was not statistically significant. Longer follow-up of a larger population is needed to determine if this trend towards an association achieves statistical significance and to evaluate the clinical consequences of hypophosphataemia.
Suttels, Veronique; Florence, Eric; Leys, John; Vekemans, Marc; Van den Ende, Jef; Vlieghe, Erika; Kenyon, Chris
2015-09-08
We present what we believe to be the first case in the literature of rhabdomyolysis-induced renal failure caused by a probable drug interaction between elvitegravir/cobicistat/emtricitabine/tenofovir disoproxil fumarate (EVG/COBI/FTC/TDF) and pravastatin/fenofibrate. A 68-year old Caucasian man presented with progressive pain in both legs two weeks after commencing treatment with EVG/COBI/FTC/TDF. He was found to have biochemical evidence of rhabdomyolysis and acute renal failure. We emphasize the need for post marketing surveillance of adverse effects of new products. Pharmacokinetic studies are necessary to investigate the levels of pravastatin in patients taking COBI and fenofibrate with and without other comorbidities. Meanwhile, we suggest that creatine kinase levels should be monitored and patients advised to report myalgias when using concomitant EVG/COBI/FTC/TDF and pravastatin/fenofibrate. This case serves as an important reminder to use estimated glomerular filtration rates rather than serum creatinine levels when choosing new medications. If potentially nephrotoxic combinations are started in patients with borderline estimated glomerular filtration rates, it may be prudent to check these filtration rates more frequently than usual. In patients with reduced estimated glomerular filtration rates, potentially nephrotoxic combinations should be avoided wherever possible.
Chang, Alice Y W; Li, Faith C H; Huang, Chi-Wei; Wu, Julie C C; Dai, Kuang-Yu; Chen, Chang-Han; Li, Shau-Hsuan; Su, Chia-Hao; Wu, Re-Wen
2014-11-01
Pressor response after stroke commonly leads to early death or susceptibility to stroke recurrence, and detailed mechanisms are still lacking. We assessed the hypothesis that the renin-angiotensin system contributes to pressor response after stroke by differential modulation of the pro-inflammatory chemokine monocyte chemoattractant protein-1 (MCP-1) in the rostral ventrolateral medulla (RVLM), a key brain stem site that maintains blood pressure. We also investigated the beneficial effects of a novel renin inhibitor, aliskiren, against stroke-elicited pressor response. Experiments were performed in male adult Sprague-Dawley rats. Stroke induced by middle cerebral artery occlusion elicited significant pressor response, accompanied by activation of angiotensin II (Ang II)/type I receptor (AT1R) and AT2R signaling, depression of Ang-(1-7)/MasR and Ang IV/AT4R cascade, alongside augmentation of MCP-1/C-C chemokine receptor 2 (CCR2) signaling and neuroinflammation in the RVLM. Stroke-elicited pressor response was significantly blunted by antagonism of AT1R, AT2R or MCP-1/CCR2 signaling, and eliminated by applying Ang-(1-7) or Ang IV into the RVLM. Furthermore, stroke-activated MCP-1/CCR2 signaling was enhanced by AT1R and AT2R activation, and depressed by Ang-(1-7)/MasR and Ang IV/AT4R cascade. Aliskiren inhibited stroke-elicited pressor response via downregulating MCP-1/CCR2 activity and reduced neuroinflammation in the RVLM; these effects were potentiated by Ang-(1-7) or Ang IV. We conclude that whereas Ang II/AT1R or Ang II/AT2R signaling in the brain stem enhances, Ang-(1-7)/MasR or Ang IV/AT4R antagonizes pressor response after stroke by differential modulations of MCP-1 in the RVLM. Furthermore, combined administration of aliskiren and Ang-(1-7) or Ang IV into the brain stem provides more effective amelioration of stroked-induced pressor response. Copyright © 2014 Elsevier Inc. All rights reserved.
Okada, Yoshiyuki; Jarvis, Sara S; Best, Stuart A; Bivens, Tiffany B; Adams-Huet, Beverley; Levine, Benjamin D; Fu, Qi
2013-01-01
Cardiovascular risk remains high in patients with hypertension even with adequate blood pressure (BP) control. One possible mechanism may be sympathetic activation via the baroreflex. We tested the hypothesis that chronic inhibition of renin reduces BP without sympathetic activation, but diuresis augments sympathetic activity in elderly hypertensives. Fourteen patients with stage-I hypertension (66 ± 5 (SD) years) were treated with a direct renin inhibitor, aliskiren (n= 7), or a diuretic, hydrochlorothiazide (n= 7), for 6 months. Muscle sympathetic nerve activity (MSNA), BP, direct renin and aldosterone were measured during supine and a graded head-up tilt (HUT; 5 min 30° and 20 min 60°), before and after treatment. Sympathetic baroreflex sensitivity (BRS) was assessed. Both groups had similar BP reductions after treatment (all P < 0.01), while MSNA responses were different between hydrochlorothiazide and aliskiren (P= 0.006 pre/post × drug). Both supine and upright MSNA became greater after hydrochlorothiazide treatment (supine, 72 ± 18 post vs. 64 ± 15 bursts (100 beats)−1 pre; 60° HUT, 83 ± 10 vs. 78 ± 13 bursts (100 beats)−1; P= 0.002). After aliskiren treatment, supine MSNA remained unchanged (69 ± 13 vs. 64 ± 8 bursts (100 beats)−1), but upright MSNA was lower (74 ± 15 vs. 85 ± 10 bursts (100 beats)−1; P= 0.012 for pre/post × posture). Direct renin was greater after both treatments (both P < 0.05), while upright aldosterone was greater after hydrochlorothiazide only (P= 0.002). The change in upright MSNA by the treatment was correlated with the change of aldosterone (r= 0.74, P= 0.002). Upright sympathetic BRS remained unchanged after either treatment. Thus, chronic renin inhibition may reduce upright MSNA through suppressed renin activity, while diuresis may evoke sympathetic activation via the upregulated renin–angiotensin–aldosterone system, without changing intrinsic sympathetic baroreflex function in elderly hypertensive
Rhie, Mi Na; Yoon, Hyo Eun; Oh, Hye Yun; Zedler, Sandra; Unden, Gottfried; Kim, Ok Bin
2014-07-01
Actinobacillus succinogenes, which is known to produce large amounts of succinate during fermentation of hexoses, was able to grow on C4-dicarboxylates such as fumarate under aerobic and anaerobic conditions. Anaerobic growth on fumarate was stimulated by glycerol and the major product was succinate, indicating the involvement of fumarate respiration similar to succinate production from glucose. The aerobic growth on C4-dicarboxylates and the transport proteins involved were studied. Fumarate was oxidized to acetate. The genome of A. succinogenes encodes six proteins with similarity to secondary C4-dicarboxylate transporters, including transporters of the Dcu (C4-dicarboxylate uptake), DcuC (C4-dicarboxylate uptake C), DASS (divalent anion : sodium symporter) and TDT (tellurite resistance dicarboxylate transporter) family. From the cloned genes, Asuc_0304 of the DASS family protein was able to restore aerobic growth on C4-dicarboxylates in a C4-dicarboxylate-transport-negative Escherichia coli strain. The strain regained succinate or fumarate uptake, which was dependent on the electrochemical proton potential and the presence of Na(+). The transport had an optimum pH ~7, indicating transport of the dianionic C4-dicarboxylates. Transport competition experiments suggested substrate specificity for fumarate and succinate. The transport characteristics for C4-dicarboxylate uptake by cells of aerobically grown A. succinogenes were similar to those of Asuc_0304 expressed in E. coli, suggesting that Asuc_0304 has an important role in aerobic fumarate uptake in A. succinogenes. Asuc_0304 has sequence similarity to bacterial Na(+)-dicarboxylate cotransporters and contains the carboxylate-binding signature. Asuc_0304 was named SdcA (sodium-coupled C4-dicarboxylate transporter from A. succinogenes). © 2014 The Authors.
Kulinowski, Piotr; Woyna-Orlewicz, Krzysztof; Rappen, Gerd-Martin; Haznar-Garbacz, Dorota; Węglarz, Władysław P; Dorożyński, Przemysław P
2015-04-30
Motivation for the study was the lack of dedicated and effective research and development (R&D) in vitro methods for oral, generic, modified release formulations. The purpose of the research was to assess multimodal in vitro methodology for further bioequivalence study risk minimization. Principal results of the study are as follows: (i) Pharmaceutically equivalent quetiapine fumarate extended release dosage form of Seroquel XR was developed using a quality by design/design of experiment (QbD/DoE) paradigm. (ii) The developed formulation was then compared with originator using X-ray microtomography, magnetic resonance imaging and texture analysis. Despite similarity in terms of compendial dissolution test, developed and original dosage forms differed in micro/meso structure and consequently in mechanical properties. (iii) These differences were found to be the key factors of failure of biorelevant dissolution test using the stress dissolution apparatus. Major conclusions are as follows: (i) Imaging methods allow to assess internal features of the hydrating extended release matrix and together with the stress dissolution test allow to rationalize the design of generic formulations at the in vitro level. (ii) Technological impact on formulation properties e.g., on pore formation in hydrating matrices cannot be overlooked when designing modified release dosage forms. Copyright © 2015 Elsevier B.V. All rights reserved.
Hamed, Rania; AlJanabi, Reem; Sunoqrot, Suhair; Abbas, Aiman
2017-08-01
The objective of this study was to investigate the effect of the different physiological parameters of the gastrointestinal (GI) fluid (pH, buffer capacity, and ionic strength) on the in vitro release of the weakly basic BCS class II drug quetiapine fumarate (QF) from two once-a-day matrix tablet formulations (F1 and F2) developed as potential generic equivalents to Seroquel ® XR. F1 tablets were prepared using blends of high and low viscosity grades of hydroxypropyl methylcellulose (HPMC K4M and K100LV, respectively), while F2 tablets were prepared from HPMC K4M and PEGylated glyceryl behenate (Compritol ® HD5 ATO). The two formulations attained release profiles of QF over 24 h similar to that of Seroquel ® XR using the dissolution medium published by the Food and Drug Administration (FDA). A series of solubility and in vitro dissolution studies was then carried out using media that simulate the gastric and intestinal fluids and cover the physiological pH, buffer capacity and ionic strength range of the GIT. Solubility studies revealed that QF exhibits a typical weak base pH-dependent solubility profile and that the solubility of QF increases with increasing the buffer capacity and ionic strength of the media. The release profiles of QF from F1, F2 and Seroquel ® XR tablets were found to be influenced by the pH, buffer capacity and ionic strength of the dissolution media to varying degrees. Results highlight the importance of studying the physiological variables along the GIT in designing controlled release formulations for more predictive in vitro-in vivo correlations.
Seto, Wai-Kay; Asahina, Yasuhiro; Brown, Todd T; Peng, Cheng-Yuan; Stanciu, Carol; Abdurakhmanov, Dzhamal; Tabak, Fehmi; Nguyen, Tuan T; Chuang, Wan-Long; Inokuma, Tetsuro; Ikeda, Fusao; Santantonio, Teresa Antonia; Habersetzer, François; Ramji, Alnoor; Lau, Audrey H; Suri, Vithika; Flaherty, John F; Wang, Hongyuan; Gaggar, Anuj; Subramanian, G Mani; Mukewar, Shrikant; Brunetto, Maurizia R; Fung, Scott; Chan, Henry Lik-Yuen
2018-06-19
Long-term use of tenofovir disoproxil fumarate (TDF) reduces bone mineral density (BMD). Tenofovir alafenamide (TAF), a new prodrug of tenofovir, has shown non-inferior efficacy to TDF in patients with chronic hepatitis B virus (HBV) infection, with improved bone effects at 48 weeks. We performed a randomized trial to evaluate the bone safety of TAF compared with TDF over 2 years, assessing baseline risk factors for bone loss, were evaluated after 2 years of treatment. In a double-blind study, hepatitis B e antigen (HBeAg)-positive patients (n=873) and HBeAg-negative patients (n=425) were randomly assigned (2:1) to groups given TAF (25 mg, n=866) or TDF (300 mg, n=432) once daily. We assessed bone safety, including hip and spine BMD, using dual-energy X-ray absorptiometry and measured changes in serum markers of bone turnover over 96 weeks. At baseline, treatment groups were well matched. At week 96, patients receiving TAF had significantly smaller decreases in hip BMD (mean reduction of 0.33%) than patients receiving TDF (mean reduction of 2.51%) (P<.001) and spine BMD (reduction of 0.75% in patients receiving patients receiving TAF vs reduction of 2.57% in patients receiving TDF) (P<.001). For hip BMD, the magnitude of difference in bone loss between the TAF and TDF groups increased at week 96 compared to week 48 (P<.001). The TAF group had minimal changes in markers of bone turnover by 12 weeks of treatment, but the TDF group had significant changes, compared to baseline. Risk factors for bone loss had fewer effects in patients receiving TAF than TDF at week 96. In double-blind randomized trials, we found that after 2 years of treatment, patients receiving TAF had continued improvements in bone safety compared with patients receiving TDF. Clinicaltrial.gov no: NCT01940471 and NCT01940341. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.
Agaimy, Abbas; Amin, Mahul B; Gill, Anthony J; Popp, Bernt; Reis, André; Berney, Daniel M; Magi-Galluzzi, Cristina; Sibony, Mathilde; Smith, Steven C; Suster, Saul; Trpkov, Kiril; Hes, Ondřej; Hartmann, Arndt
2018-04-21
Fumarate hydratase-deficient renal cell carcinoma (FH-RCC) is a rare, aggressive RCC type, originally described in the setting of hereditary leiomyomatosis and renal cell carcinoma (HLRCC) syndrome which is defined by germline FH gene inactivation. Inactivation of components of the SWI/SNF chromatin remodelling complex is involved in renal medullary carcinoma (SMARCB1/INI1 loss), clear cell RCC (PBRM1 loss) and in subsets of dedifferentiated RCC of clear cell, chromophobe and papillary types (loss of different SWI/SNF components). FH-RCC and SWI/SNF-deficient RCC share anaplastic nuclear features and highly aggressive course. We analysed 32 FH-RCCs from 28 patients using seven commercially available SWI/SNF antibodies (SMARCB1/INI1, SMARCA2, SMARCA4, SMARCC1, SMARCC2, PBRM1 and ARID1A). Variable loss of SMARCB1, ARID1A and SMARCC1 was observed in 1/31, 2/31 and 1/29 evaluable cases, respectively; three of these four SWI/SNF-deficient tumors had confirmed FH mutations. No correlation of SWI/SNF loss with solid or sarcomatoid features was observed. Two tumors with SMARCB1 and ARID1A deficiency had available SWI/SNF molecular data; both lacked SMARCB1 and ARID1A mutations. The remaining five SWI/SNF components were intact in all cases. Especially PBRM1 seems not to be involved in the pathogenesis or progression of FH-deficient RCC. Our data showed that, a subset of FH-RCC (12%) have a variable loss of SWI/SNF complex subunits, likely as secondary genetic events. This should not be confused with SWI/SNF-deficient RCC of other types. Evaluation of FH and SWI/SNF together with comprehensive molecular-genetic profiling is needed to explore possible prognostic implications of FH/SWI-SNF double deficiency and to better understand the somatic mutation landscape in high-grade RCC. Copyright © 2018. Published by Elsevier Inc.
Fung, Scott; Gordon, Stuart C; Krastev, Zahary; Horban, Andrzej; Petersen, Jörg; Sperl, Jan; Gane, Edward; Jacobson, Ira M; Yee, Leland J; Dinh, Phillip; Martins, Eduardo B; Flaherty, John F; Kitrinos, Kathryn M; Dusheiko, Geoffrey; Trinh, Huy; Flisiak, Robert; Rustgi, Vinod K; Buti, Maria; Marcellin, Patrick
2015-02-01
We evaluated the antiviral response of Asian or Pacific Islander (API) patients with chronic hepatitis B (CHB) who had baseline high viral load (HVL), defined as pre-treatment hepatitis B virus (HBV) DNA ≥9 log10 copies/ml, following up to 288 weeks of tenofovir disoproxil fumarate (TDF) treatment. A total of 205 HBeAg-negative and HBeAg-positive self-described API patients received 48 weeks of TDF 300 mg (HVL n = 18) or adefovir dipivoxil 10 mg (HVL n = 15) in a blinded fashion, followed by open-label TDF for an additional 240 weeks. The proportions of HVL vs. non-HVL patients with HBV DNA <400 copies/ml were compared. Mean declines in HBV DNA were evaluated in API vs. non-API patients. Throughout the first 72 weeks of treatment, a smaller proportion of HVL API patients reached HBV DNA <400 copies/ml than non-HVL API patients. However, after this timepoint similar proportions of HVL and non-HVL API patients achieved HBV DNA <400 copies/ml (100% vs. 97%, respectively), which was maintained through week 288, where 92% of HVL patients and 99% of non-HVL API patients on treatment had HBV DNA <400 copies/ml. During the 288 weeks of treatment, API patients had similar mean HBV DNA declines as non-API patients, regardless of whether patients were HVL or non-HVL. No API HVL patient had persistent viremia at week 288. No resistance was detected among HVL or non-HVL patients. API patients with HVL CHB achieve HBV DNA <400 copies/ml with long-term TDF treatment; however, achieving viral suppression may take longer for HVL patients relative to non-HVL API patients. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Llamas-Velasco, Mar; Requena, Luis; Adam, Julie; Frizzell, Norma; Hartmann, Arndt; Mentzel, Thomas
2016-12-01
Hereditary leiomyomatosis and renal cell cancer (HLRCC) syndrome is an autosomal dominant disorder caused by heterozygotic germline mutations in fumarate hydratase (FH) with incomplete penetrance, and clinically challenging to diagnose. Immunohistochemical stainings may favor an earlier diagnosis. The authors have tested 31 smooth muscle neoplasms. Ten of the 13 lesions from patients with HLRCC syndrome showed negative FH staining. Most sporadic piloleiomyomas presented strongly positive FH staining although 5 cases were negative. Sensitivity of FH staining in our series is 83.3% but specificity is 75%. Anti-S-(2-succino)-cysteine (2SC) showed the opposite intensity staining pattern and showed great correlation with anti-FH (rho spearman = -0.797). Anti-2SC staining increased the diagnostic accuracy in 19% of the cases. The main limitation of this study is the lack additional clinical data to further classify the cases as the case inclusion was histopathological. Negative FH staining could indicate a high risk of HLRCC but it could also suggest the presence of a syndrome in up to 25% of sporadic cases. Thus, when there is a doubtful case, anti-2SC may be added to exclude the syndrome if a negative staining is found.
Cagnoni, Francesca; Njwe, Christian Achiri Ngu; Zaninelli, Augusto; Ricci, Alessandra Rossi; Daffra, Diletta; D'Ospina, Antonio; Preti, Paola; Destro, Maurizio
2010-08-09
The renin-angiotensin-aldosterone system (RAAS), an important regulator of blood pressure and mediator of hypertension-related complications, is a prime target for cardiovascular drug therapy. Angiotensin-converting enzyme inhibitors (ACEIs) were the first drugs to be used to block the RAAS. Angiotensin II receptor blockers (ARBs) have also been shown to be equally effective for treatment. Although these drugs are highly effective and are widely used in the management of hypertension, current treatment regimens with ACEIs and ARBs are unable to completely suppress the RAAS. Combinations of ACEIs and ARBs have been shown to be superior than to either agent alone for some, but certainly not all, composite cardiovascular and kidney outcomes, but dual RAAS blockade with the combination of an ACEI and an ARB is sometimes associated with an increase in the risk for adverse events, primarily hyperkalemia and worsening renal function. The recent introduction of the direct renin inhibitor, aliskiren, has made available new combination strategies to obtain a more complete blockade of the RAAS with fewer adverse events. Renin system blockade with aliskiren and another RAAS agent has been, and still is, the subject of many large-scale clinical trials and furthermore, is already available in some countries as a fixed combination.
Stepan, George; Tian, Yang; Miller, Michael D.
2015-01-01
Tenofovir alafenamide (TAF) is an investigational oral prodrug of the HIV-1 nucleotide reverse transcriptase inhibitor tenofovir (TFV). Tenofovir disoproxil fumarate (TDF) is another TFV prodrug, widely used for the treatment of HIV-1 infection. TAF is converted mostly intracellularly to TFV and, in comparison to TDF, achieves higher tenofovir diphosphate (TFV-DP) levels in peripheral blood mononuclear cells. As a result, TAF has demonstrated potent anti-HIV-1 activity at lower doses than TDF in monotherapy studies. Here, the in vitro virology profile of TAF was evaluated and compared to that of TDF. TAF displayed potent antiviral activity against all HIV-1 groups/subtypes, as well as HIV-2. TAF exhibited minimal changes in the drug concentration needed to inhibit 50% of viral spread (EC50) upon removal of the prodrug, similar to TDF, demonstrating intracellular antiviral persistence. While TAF and TDF exhibited comparable potencies in the absence of serum pretreatment, TAF maintained activity in the presence of human serum, whereas TDF activity was significantly reduced. This result demonstrates TAF's improved plasma stability over TDF, which is driven by the different metabolic pathways of the two prodrugs and is key to TAF's improved in vivo antiviral activity. The activity of TAF is specific for HIV, as TAF lacked activity against a large panel of human viruses, with the exception of herpes simplex virus 2, where weak TAF antiviral activity was observed, as previously observed with TFV. Finally, in vitro combination studies with antiretroviral drugs from different classes showed additive to synergistic interactions with TAF, consistent with ongoing clinical studies with TAF in fixed-dose combinations with multiple other antiretroviral drugs for the treatment of HIV. PMID:26149992
Burt, Richard K; Han, Xiaoqiang; Gozdziak, Paula; Yaung, Kim; Morgan, Amy; Clendenan, Allison M; Henry, Jacquelyn; Calvario, Michelle A; Datta, Syamal K; Helenowski, Irene; Schroeder, James
2018-05-31
Some patients with systemic lupus erythematosus (SLE) are refractory to traditional therapies, dependent on chronic corticosteroids, have organ damage, and are at high risk of mortality. In this group of patients, we report outcome at a median of five years after autologous hematopoietic stem cell transplant (HSCT) using two different non-myeloablative regimens. Four patients received a conditioning regimen of cyclophosphamide (200 mg/kg) and alemtuzumab (60 mg), while 26 patients underwent conditioning with cyclophosphamide (200 mg/kg), rATG (Thymoglobulin) (5.5 mg/kg), and rituximab 1000 mg. Unselected peripheral blood stem cells were infused on day 0. There were no treatment related deaths. Of the four patients treated with cyclophosphamide and alemtuzumab, none entered remission. For the 26 patients treated with cyclophosphamide, rATG, and rituximab, disease remission defined as no immune suppressive drugs except hydroxychloroquine and/or 10 mg or less of prednisone a day was 92% at 6 months, 92% at one year, 81% at 2 years, 71% at 3 years, and 62% at 4 and 5 years post-HSCT. Autologous HSCT outcome is dependent on the conditioning regimen but prior organ damage may cause lingering symptoms.
Lee, Kyoung Hwa; Lee, Ji Un; Ku, Nam Su; Jeong, Su Jin; Han, Sang Hoon; Choi, Jun Yong; Song, Young Goo; Kim, June Myung
2017-07-01
Tenofovir disoproxil fumarate (TDF) is commonly prescribed as a fixed-dose, co-formulated antiretroviral drug for HIV-1 infection. The major concern of long-term TDF use is renal dysfunction. However, little is known about the long-term patterns of changes in renal function in HIV-infected Koreans receiving TDF. We prospectively followed 50 HIV-infected Koreans, performing laboratory tests every 3 months during the first year and every 6 months for the next 2 years. Urine N-acetyl-β-D-glucosaminidase (NAG) and plasma cystatin-C were measured using samples collected in the first year. Data on renal function were retrospectively collected on HIV-infected patients receiving first-line TDF (n=40) and in antiretroviral therapy (ART)-naïve patients (n=24) for 3 years. Renal function was evaluated as estimated glomerular filtration rate (eGFR) from serum creatinine [Modification of Diet in Renal Disease (MDRD)] and cystatin-C. The eGFR (cystatin-C) showed significant changes from 0 to 48 wks (p=0.002), with the lowest levels at 24 wks (84.3±18.8 mL/min vs. 90.3±22.5 mL/min, p=0.021 by post hoc test). Urine NAG levels did not differ at 0, 12, 24, and 48 wks, although eGFR (MDRD) significantly decreased from 0 (98.7±18.9 mL/min/1.73 m²) to 144 wks (89.0±14.7 mL/min/1.73 m²) (p=0.010). The first-line TDF group had significantly lower eGFR (MDRD) than the ART-naïve group at 144 wks (89.7 mL/min/1.73 m² vs. 98.4 mL/min/1.73 m², p=0.036). Thirteen (26%) participants experienced a decrease in renal impairment of 10 mL/min/1.73 m² in eGFR (MDRD) at 144 wks. These data suggest that clinically meaningful renal injury can develop in HIV-infected Koreans receiving long-term TDF. © Copyright: Yonsei University College of Medicine 2017
Robert, Benoît; Perrin, Marc-Antoine; Barrio, Maria; Tamarit, Josep-Lluis; Coquerel, Gérard; Ceolin, René; Rietveld, Ivo B
2016-01-01
Two polymorphs of the 1:1 fumarate salt of 1,4-diazabicyclo[3.2.2]nonane-4-carboxylic acid 4-bromophenyl ester, developed for the treatment of cognitive symptoms of schizophrenia and Alzheimer disease, have been characterized. The 2 crystal structures have been solved, and their phase relationships have been established. The space group of form I is P2₁/c with a unit-cell volume of 1811.6 (5) Å(3) with Z = 4. The crystals of form I were 2-component nonmerohedral twins. The space group of form II is P2₁/n with a unit-cell volume of 1818.6 (3) Å(3) with Z = 4. Relative stabilities have been inferred from experimental and topological P-T diagrams exhibiting an overall enantiotropic relationship between forms I and II although the solid-solid transition has never been observed. The slope of the I-II equilibrium in the P-T diagram is negative, form II is the stable phase below the solid-solid transition temperature of 371 K, and form I exhibits a stable melting equilibrium. The I-II transition temperature has been obtained from the intersection of the sublimation curves of the 2 solid forms. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Wörner, Sebastian; Strecker, Alexander; Monzel, Christian; Zeltner, Matthias; Witan, Julian; Ebert-Jung, Andrea; Unden, Gottfried
2016-12-01
The sensor kinase DcuS of Escherichia coli co-operates under aerobic conditions with the C 4 -dicarboxylate transporter DctA to form the DctA/DcuS sensor complex. Under anaerobic conditions C 4 -dicarboxylate transport in fumarate respiration is catalyzed by C 4 -dicarboxylate/fumarate antiporter DcuB. (i) DcuB interacted with DcuS as demonstrated by a bacterial two-hybrid system (BACTH) and by co-chromatography of the solubilized membrane-proteins (mHPINE assay). (ii) In the DcuB/DcuS complex only DcuS served as the sensor since mutations in the substrate site of DcuS changed substrate specificity of sensing, and substrates maleate or 3-nitropropionate induced DcuS response without affecting the fumarate site of DcuB. (iii) The half-maximal concentration for induction of DcuS by fumarate (1 to 2 mM) and the corresponding K m for transport (50 µM) differ by a factor of 20 to 40. Therefore, the fumarate sites are different in transport and sensing. (iv) Increasing levels of DcuB converted DcuS from the permanent ON (DcuB deficient) state to the fumarate responsive form. Overall, the data show that DcuS and DcuB form a DcuB/DcuS complex representing the C 4 -dicarboxylate responsive form, and that the sensory site of the complex is located in DcuS whereas DcuB is required for converting DcuS to the sensory competent state. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Bayes, M; Rabasseda, X; Prous, J R
2005-10-01
Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: (-)-Epigallocatechin gallate, (Z)-4-hydroxytamoxifen; Ad.muIFN-beta AD-237, adalimumab, adefovir dipivoxil, agalsidase alfa, alemtuzumab, almotriptan, ALVAC vCP1452, alvimopan hydrate, ambrisentan, anakinra, anti-IFN-gamma MAb; Bimatoprost, BMS-188797, BMS-214662, bortezomib, bosentan, bovine lactoferrin; Caffeine, canertinib dihydrochloride, canfosfamide hydrochloride, cannabidiol, caspofungin acetate, cetuximab, cH36, ChimeriVax-JE, ciclesonide, cilansetron, cinacalcet hydrochloride, clopidogrel, CpG-7909, Cypher; Daptomycin, darbepoetin alfa, darifenacin hydrobromide, decitabine, denufosol tetrasodium, Dexamet, diindolemethane, drotrecogin alfa (activated), duloxetine hydrochloride, DX-9065a; E-7010, edaravone, efalizumab, eicosapentaenoic acid/docosahexaenoic acid, elacridar, eletriptan, emtricitabine, epratuzumab, erlotinib hydrochloride, ertapenem sodium, eszopiclone, everolimus, ezetimibe; Fludarabine, fondaparinux sodium; gamma-Hydroxybutyrate sodium, gavestinel sodium, gefitinib, granisetron-Biochronomer; Human Albumin, human insulin; Imatinib mesylate, indiplon, interleukin-2 XL, isatoribine, ISS-1018, i.v. gamma-globulin, ivabradine hydrochloride, ixabepilone; Lanthanum carbonate, L-arginine hydrochloride, liposomal doxorubicin, LY-450139; Magnesium sulfate, melatonin, motexafin gadolinium, mycophenolic acid sodium salt; Natalizumab, nesiritide, niacin/lovastatin; OGX-011, olmesartan medoxomil, omalizumab, ospemifene; PACAP38, panitumumab, parathyroid hormone (human recombinant), parecoxib sodium, patupilone, pegfilgrastim, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b
Chaucheyras-Durand, Frédérique; Masséglia, Sébastien; Fonty, Gérard; Forano, Evelyne
2010-12-01
We investigated the influence of the composition of the fibrolytic microbial community on the development and activities of hydrogen-utilizing microorganisms in the rumens of gnotobiotically reared lambs. Two groups of lambs were reared. The first group was inoculated with Fibrobacter succinogenes, a non-H(2)-producing species, as the main cellulolytic organism, and the second group was inoculated with Ruminococcus albus, Ruminococcus flavefaciens, and anaerobic fungi that produce hydrogen. The development of hydrogenotrophic bacterial communities, i.e., acetogens, fumarate and sulfate reducers, was monitored in the absence of methanogens and after inoculation of methanogens. Hydrogen production and utilization and methane production were measured in rumen content samples incubated in vitro in the presence of exogenous hydrogen (supplemented with fumarate or not supplemented with fumarate) or in the presence of ground alfalfa hay as a degradable substrate. Our results show that methane production was clearly reduced when the dominant fibrolytic species was a non-H(2)-producing species, such as Fibrobacter succinogenes, without significantly impairing fiber degradation and fermentations in the rumen. The addition of fumarate to the rumen contents stimulated H(2) utilization only by the ruminal microbiota inoculated with F. succinogenes, suggesting that these communities could play an important role in fumarate reduction in vivo.
Smith, Steven C; Trpkov, Kiril; Chen, Ying-Bei; Mehra, Rohit; Sirohi, Deepika; Ohe, Chisato; Cani, Andi K; Hovelson, Daniel H; Omata, Kei; McHugh, Jonathan B; Jochum, Wolfram; Colecchia, Maurizio; Amin, Mitual; Divatia, Mukul K; Hes, Ondřej; Menon, Santosh; da Cunha, Isabela Werneck; Tripodi, Sergio; Brimo, Fadi; Gill, Anthony J; Osunkoya, Adeboye O; Magi-Galluzzi, Cristina; Sibony, Mathilde; Williamson, Sean R; Nesi, Gabriella; Picken, Maria M; Maclean, Fiona; Agaimy, Abbas; Cheng, Liang; Epstein, Jonathan I; Reuter, Victor E; Tickoo, Satish K; Tomlins, Scott A; Amin, Mahul B
2017-01-01
An emerging group of high grade renal cell carcinomas (RCCs), particularly carcinomas arising in the hereditary leiomyomatosis renal cell carcinoma syndrome (HLRCC), show fumarate hydratase (FH) gene mutation and loss of function. Based on similar cytomorphology and clinicopathologic features between these tumors and cases described as tubulocystic carcinomas with poorly differentiated foci of infiltrative adenocarcinoma (TC-PD), we hypothesized a relationship between these entities. First, 29 RCCs with morphology of TC-PD were identified retrospectively and assessed for FH expression and aberrant succination (2SC) by immunohistochemistry (IHC), with targeted next generation sequencing (NGS) of 409 genes—including FH—performed on a subset. The 29 TC-PD RCCs included 21 males and 8 females, aged 16-86 years (median 46), with tumors measuring 3-21 cm (median 9) arising in the right (n=16) and left (n=13) kidneys. Family history or stigmata of HLRCC were identified in only 3 (12%). These tumors were aggressive, with 79% showing perinephric extension, nodal involvement in 41%, and metastasis in 86%. Of these, 16 (55%) demonstrated loss of FH by IHC (14/14 with positive 2SC). In contrast, 5 (17%) showed a wild type immunoprofile of FH+/2SC-. An intriguing group of 8 (28%) showed variable FH± positivity, but with strong/diffuse 2SC+. NGS revealed 8 cases with FH mutations, including 5 FH-/2SC+ and 3 FH±/2SC+ cases, but none in FH+/2SC- cases. Secondly, we retrospectively reviewed the morphology of two well-characterized cohorts of RCCs with FH-deficiency determined by IHC or sequencing (n=23 and n=9), unselected for TC-PD pattern, identifying the TC-PD morphology in 10 (31%). We conclude that RCCs with TC-PD morphology are enriched for FH deficiency, and we recommend additional work up, including referral to genetic counseling, for prospective cases. Additionally, based on these and other observations, we propose the term “FH-deficient RCC” as a provisional
Iwata, Fumiko; Shinjyo, Noriko; Amino, Hisako; Sakamoto, Kimitoshi; Islam, M Khyrul; Tsuji, Naotoshi; Kita, Kiyoshi
2008-03-01
The mitochondrial metabolic pathway of the parasitic nematode Ascaris suum changes dramatically during its life cycle, to adapt to changes in the environmental oxygen concentration. We previously showed that A. suum mitochondria express stage-specific isoforms of complex II (succinate-ubiquinone reductase: SQR/quinol-fumarate reductase: QFR). The flavoprotein (Fp) and small subunit of cytochrome b (CybS) in adult complex II differ from those of infective third stage larval (L3) complex II. However, there is no difference in the iron-sulfur cluster (Ip) or the large subunit of cytochrome b (CybL) between adult and L3 isoforms of complex II. In the present study, to clarify the changes that occur in the respiratory chain of A. suum larvae during their migration in the host, we examined enzymatic activity, quinone content and complex II subunit composition in mitochondria of lung stage L3 (LL3) A. suum larvae. LL3 mitochondria showed higher QFR activity ( approximately 160 nmol/min/mg) than mitochondria of A. suum at other stages (L3: approximately 80 nmol/min/mg; adult: approximately 70 nmol/min/mg). Ubiquinone content in LL3 mitochondria was more abundant than rhodoquinone ( approximately 1.8 nmol/mg versus approximately 0.9 nmol/mg). Interestingly, the results of two-dimensional bule-native/sodium dodecyl sulfate polyacrylamide gel electrophoresis analyses showed that LL3 mitochondria contained larval Fp (Fp(L)) and adult Fp (Fp(A)) at a ratio of 1:0.56, and that most LL3 CybS subunits were of the adult form (CybS(A)). This clearly indicates that the rearrangement of complex II begins with a change in the isoform of the anchor CybS subunit, followed by a similar change in the Fp subunit.
Cranston, Ross D.; Kashuba, Angela; Hendrix, Craig W.; Bumpus, Namandjé N.; Richardson-Harman, Nicola; Elliott, Julie; Janocko, Laura; Khanukhova, Elena; Dennis, Robert; Cumberland, William G.; Ju, Chuan; Carballo-Diéguez, Alex; Mauck, Christine; McGowan, Ian
2012-01-01
Abstract This study was designed to assess the safety, acceptability, pharmacokinetic (PK), and pharmacodynamic (PD) responses to rectal administration of tenofovir (TFV) 1% vaginally formulated gel and oral tenofovir disoproxil fumarate (TDF). This study was designed as a phase 1, randomized, two-site (United States), double-blind, placebo-controlled study of sexually abstinent men and women. Eighteen participants received a single 300-mg exposure of oral TDF and were then randomized 2:1 to receive a single and then seven daily exposures of rectal TFV or hydroxyethyl cellulose (HEC) placebo gel. Safety endpoints included clinical adverse events (AEs) and mucosal safety parameters. Blood and colonic biopsies were collected for PK analyses and ex vivo HIV-1 challenge. No serious AEs were reported. However, AEs were significantly increased with 7-day TFV gel use, most prominently with gastrointestinal AEs (p=0.002). Only 25% of participants liked the TFV gel. Likelihood of use “if somewhat protective” was ∼75% in both groups. Indices of mucosal damage showed minimal changes. Tissue TFV diphosphate (TFV-DP) Cmax 30 min after single rectal exposure was 6–10 times greater than single oral exposure; tissue TFV-DP was 5.7 times greater following 7-day versus single rectal exposure. In vivo exposure correlated with significant ex vivo tissue infectibility suppression [single-rectal: p=0.12, analysis of covariance (ANCOVA) p=0.006; 7-day rectal: p=0.02, ANCOVA p=0.005]. Tissue PK–PD was significantly correlated (p=0.002). We conclude that rectal dosing with TFV 1% gel resulted in greater TFV-DP tissue detection than oral dosing with reduced ex vivo biopsy infectibility, enabling PK–PD correlations. On the basis of increased gastrointestinal AEs, rectally applied, vaginally formulated TFV was not entirely safe or acceptable, suggesting the need for alternative rectal-specific formulations. PMID:22943559
Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark
2013-08-21
The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.
Dakin, Helen; Sherman, Morris; Fung, Scott; Fidler, Carrie; Bentley, Anthony
2011-12-01
Previous research has demonstrated that tenofovir disoproxil fumarate (DF) is the most cost-effective nucleos(t)ide treatment for chronic hepatitis B (CHB) in the UK, Spain, Italy and France. However, to our knowledge, no published studies have yet evaluated the cost effectiveness of any treatments for CHB in a Canadian setting, where relative prices and management of CHB differ from those in Europe. Our objective was to determine the cost effectiveness of tenofovir DF compared with other nucleos(t)ide therapies licensed for CHB in Canada from the perspective of publicly funded healthcare payers. A Markov model was used to calculate the costs and benefits of nucleos(t)ide therapy in three groups of patients with hepatitis B e antigen (HBeAg)-positive and -negative CHB: nucleos(t)ide-naive patients without cirrhosis; nucleos(t)ide-naive patients with compensated cirrhosis; and lamivudine-resistant patients. Disease progression was modelled as annual transitions between 18 disease states. Transition probabilities, quality of life and costs were based on published studies. Health benefits were measured in QALYs. The reference year for costs was 2007 and costs and outcomes were discounted at 5% per annum. First-line tenofovir DF was the most effective nucleos(t)ide strategy for managing CHB, generating 6.85-9.39 QALYs per patient. First-line tenofovir DF was also the most cost-effective strategy in all patient subgroups investigated, costing between $Can43,758 and $Can48,015 per QALY gained compared with lamivudine then tenofovir. First-line tenofovir DF strongly dominated first-line entecavir. Giving tenofovir DF monotherapy immediately after lamivudine resistance developed was less costly and more effective than any other active treatment strategy investigated for lamivudine-resistant CHB, including second-line use of adefovir or adefovir + lamivudine. Probabilistic sensitivity analysis demonstrated 50% confidence that first-line tenofovir DF is the most cost
Renin-angiotensin system blockers regulate the metabolism of isolated fat cells in vitro
Caminhotto, R de O.; Sertié, R.A.L.; Andreotti, S.; Campaãa, A.B.; Lima, F.B.
2016-01-01
Due to the presence of the renin-angiotensin system (RAS) in tissues and its specific influence on white adipose tissue, fat cells are possible targets of pharmacological RAS blockers commonly used as anti-hypertensive drugs. In the present study, we investigated the effects of different RAS blockers on fat cell metabolism, more specifically on lipolysis, lipogenesis and oxidation of energy substrates. Isolated primary adipocytes were incubated with different RAS blockers (aliskiren, captopril and losartan) in vitro for 24 h and lipolysis, lipogenesis and glucose oxidation capacities were determined in dose-response assays to a β-adrenergic agonist and to insulin. Although no change was found in lipolytic capacity, the RAS blockers modulated lipogenesis and glucose oxidation in a different way. While captopril decreased insulin-stimulated lipogenesis (−19% of maximal response and −60% of insulin responsiveness) due to reduced glucose derived glycerol synthesis (−19% of maximal response and 64% of insulin responsiveness), aliskiren increased insulin-stimulated glucose oxidation (+49% of maximal response and +292% of insulin responsiveness) in fat cells. Our experiments demonstrate that RAS blockers can differentially induce metabolic alterations in adipocyte metabolism, characterized by a reduction in lipogenic responsiveness or an increase in glucose oxidation. The impact of RAS blockers on adipocyte metabolism may have beneficial implications on metabolic disorders during their therapeutic use in hypertensive patients. PMID:27487419
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Li-Shar; Shen, John T.; Wang, Andy C.
2006-07-01
Mitochondrial Complex II (succinate:ubiquinoneoxidoreductase) is purified in a partially innactivated state, which canbe activated by removal of tightly bound oxaloacetate (Kearney, E.B. etal. Biochem Biophys Res Commun 49, 1115-1121). We crystallized Complex IIin the presence of oxaloacetate or with the endogenous inhibitor bound.The structure showed a ligand essentially identical to the "malate-likeintermediate" found in Shewanella Flavocytochrome c crystallized withfumarate (Taylor, P., et al. Nat Struct Biol 6, 1108-1112.)Crystallization of Complex II in the presence of excess fumarate alsogave the malate-like intermediate or a mixture of that and fumarate atthe active site. In order to more conveniently monitor the occupationstate ofmore » the dicarboxylate site, we are developing a library of UV/Visspectral effects induced by binding different ligands to the site.Treatment with fumarate results in rapid development of the fumaratedifference spectrum and then a very slow conversion into a speciesspectrally similar to the OAA liganded complex. Complex II is known to becapable of oxidizing malate to the enol form of oxaloacetate (Belikova,Y.O., et al. Biochim Biophys Acta 936, 1-9). The observations abovesuggest it may also be capable of interconverting fumarate and malate. Itmay be useful for understanding the mechanism and regulation of theenzyme to identify the malate-like intermediate and its pathway offormation from oxaloacetate or fumarate.« less
Porter, Danielle P; Toma, Jonathan; Tan, Yuping; Solberg, Owen; Cai, Suqin; Kulkarni, Rima; Andreatta, Kristen; Lie, Yolanda; Chuck, Susan K; Palella, Frank; Miller, Michael D; White, Kirsten L
2016-02-01
Antiretroviral regimen switching may be considered for HIV-1-infected, virologically-suppressed patients to enable treatment simplification or improve tolerability, but should be guided by knowledge of pre-existing drug resistance. The current study examined the impact of pre-existing drug resistance mutations on virologic outcomes among virologically-suppressed patients switching to Rilpivirine (RPV)/emtricitabine (FTC)/tenofovir disoproxil fumarate (TDF). SPIRIT was a phase 3b study evaluating the safety and efficacy of switching to RPV/FTC/TDF in virologically-suppressed HIV-1-infected patients. Pre-existing drug resistance at baseline was determined by proviral DNA genotyping for 51 RPV/FTC/TDF-treated patients with known mutations by historical RNA genotype and matched controls and compared with clinical outcome at Week 48. Drug resistance mutations in protease or reverse transcriptase were detected in 62.7% of patients by historical RNA genotype and in 68.6% by proviral DNA genotyping at baseline. Proviral DNA sequencing detected 89% of occurrences of NRTI and NNRTI resistance-associated mutations reported by historical genotype. Mutations potentially affecting RPV activity, including E138A/G/K/Q, Y181C, and H221Y, were detected in isolates from 11 patients by one or both assays. None of the patients with single mutants had virologic failure through Week 48. One patient with pre-existing Y181Y/C and M184I by proviral DNA genotyping experienced virologic failure. Nineteen patients with K103N present by historical genotype were confirmed by proviral DNA sequencing and 18/19 remained virologically-suppressed. Virologic success rates were high among virologically-suppressed patients with pre-existing NRTI and NNRTI resistance-associated mutations who switched to RPV/FTC/TDF in the SPIRIT study. While plasma RNA genotyping remains preferred, proviral DNA genotyping may provide additional value in virologically-suppressed patients for whom historical resistance
Cladribine treatment of multiple sclerosis is associated with depletion of memory B cells.
Ceronie, Bryan; Jacobs, Benjamin M; Baker, David; Dubuisson, Nicolas; Mao, Zhifeng; Ammoscato, Francesca; Lock, Helen; Longhurst, Hilary J; Giovannoni, Gavin; Schmierer, Klaus
2018-05-01
The mechanism of action of oral cladribine, recently licensed for relapsing multiple sclerosis, is unknown. To determine whether cladribine depletes memory B cells consistent with our recent hypothesis that effective, disease-modifying treatments act by physical/functional depletion of memory B cells. A cross-sectional study examined 40 people with multiple sclerosis at the end of the first cycle of alemtuzumab or injectable cladribine. The relative proportions and absolute numbers of peripheral blood B lymphocyte subsets were measured using flow cytometry. Cell-subtype expression of genes involved in cladribine metabolism was examined from data in public repositories. Cladribine markedly depleted class-switched and unswitched memory B cells to levels comparable with alemtuzumab, but without the associated initial lymphopenia. CD3 + T cell depletion was modest. The mRNA expression of metabolism genes varied between lymphocyte subsets. A high ratio of deoxycytidine kinase to group I cytosolic 5' nucleotidase expression was present in B cells and was particularly high in mature, memory and notably germinal centre B cells, but not plasma cells. Selective B cell cytotoxicity coupled with slow repopulation kinetics results in long-term, memory B cell depletion by cladribine. These may offer a new target, possibly with potential biomarker activity, for future drug development.
Hypothalamic demyelination causing panhypopituitarism.
Dixon-Douglas, Julia; Burgess, John; Dreyer, Michael
2018-05-01
Hypothalamic involvement in multiple sclerosis (MS) and neuromyelitis optica spectrum disorder (NMOSD) is rare and endocrinopathies involving the hypothalamic-pituitary axis in patients with demyelinating conditions have rarely been reported. We present two cases of MS/NMOSD with associated hypothalamic-pituitary involvement and subsequent hypopituitarism, including the first report of a patient with hypothalamic demyelination causing panhypopituitarism. Differential diagnoses, including alemtuzumab-related and primary pituitary pathology are discussed. © 2018 Royal Australasian College of Physicians.
Kowalec, Kaarina; Kingwell, Elaine; Carruthers, Robert; Marrie, Ruth Ann; Bernatsky, Sasha; Traboulsee, Anthony; Ross, Colin J D; Carleton, Bruce; Tremlett, Helen
2017-06-02
Adverse drug reactions (ADRs) are a global public health issue. The potential for pharmacogenomic biomarkers has been demonstrated in several therapeutical areas, including HIV infection and oncology. Dimethyl fumarate (DMF) is a licensed disease-modifying therapy for the treatment of multiple sclerosis (MS). The use of DMF in MS has been associated with a severe reduction in lymphocyte counts and reports of progressive multifocal leukoencephalopathy. Here, we outline the protocol for a case-control study designed to discover genomic variants associated with DMF-induced lymphopenia. The ultimate goal is to replicate these findings and create an efficient and adaptable approach towards the identification of genomic markers that could assist in mitigating adverse drug reactions in MS. The population sample will comprise DMF-exposed patients with MS, with cases representing those who developed lymphopenia and controls who did not. DNA genotyping will take place using a high-throughput genome-wide array. Fine mapping and imputation will be performed to focus in on the potentially causal variants associated with lymphopenia. Multivariable logistic regression will be used to compare genotype and allele frequencies between the cases and the controls, with consideration of potential confounders. The association threshold will be set at p<1.0×10 -5 for the discovery of genomic association analyses to select variants for replication. Ethics approval has been obtained from the respective research ethics board, which includes written informed consent. Findings will be disseminated widely, including at scientific conferences, via podcasts (targeted at both healthcare professionals as well as patients and the wider community), through patient engagement and other outreach community events, written lay summaries for all participants and formal publication in peer-reviewed scientific journals. © Article author(s) (or their employer(s) unless otherwise stated in the text of the
DeJesus, Edwin; Haas, Bernard; Segal-Maurer, Sorana; Ramgopal, Moti N; Mills, Anthony; Margot, Nicolas; Liu, Ya-Pei; Makadzange, Tariro; McCallister, Scott
2018-04-01
We previously demonstrated superior efficacy and safety advantages in HIV-infected, virologically suppressed adults switched to a regimen containing tenofovir alafenamide (TAF) as compared with those remaining on a tenofovir disoproxil fumarate (TDF) regimen through week 48. We now report long-term data through week 96. In this randomized, active-controlled, multicenter, open-label, noninferiority trial (ClinicalTrials.gov No. NCT01815736), we randomized virologically suppressed (HIV-1 RNA <50 copies/ml) adults (2:1) to receive a once-daily, single-tablet regimen containing elvitegravir (EVG), cobicistat (COBI), emtricitabine (FTC), and TAF group or to continue one of four TDF-containing regimens (TDF group) for 96 weeks. We evaluated efficacy (HIV-1 RNA <50 copies/ml using the FDA snapshot algorithm) and prespecified bone and renal endpoints at week 96. We randomized and treated 1,436 participants in this study (TAF n = 959, TDF n = 477). At week 96, TAF was superior to TDF in virologic efficacy, with 93% on TAF and 89% on TDF having HIV-1 RNA <50 copies/ml (difference 3.7%, 95% confidence interval: 0.4%-7.0%). Improvements in hip and spine bone mineral density for those assigned to TAF versus TDF continued through week 96 (p < .001). Significant improvements in urine protein or albumin to creatinine ratios were also seen among those in the TAF group versus TDF through week 96 (p < .001). There were no cases of investigator-reported proximal renal tubulopathy in the TAF group as compared with one case in the TDF group. Switching to EVG/COBI/FTC/TAF (E/C/F/TAF) was associated with statistically significant efficacy and safety advantages over remaining on a standard-of-care TDF-based regimen.
Myers, C R; Nealson, K H
1990-01-01
An oxidant pulse technique, with lactate as the electron donor, was used to study respiration-linked proton translocation in the manganese- and iron-reducing bacterium Shewanella putrefaciens MR-1. Cells grown anaerobically with fumarate or nitrate as the electron acceptor translocated protons in response to manganese (IV), fumarate, or oxygen. Cells grown anaerobically with fumarate also translocated protons in response to iron(III) and thiosulfate, whereas those grown with nitrate did not. Aerobically grown cells translocated protons only in response to oxygen. Proton translocation with all electron acceptors was abolished in the presence of the protonophore carbonyl cyanide m-chlorophenylhydrazone (20 microM) and was partially to completely inhibited by the electron transport inhibitor 2-n-heptyl-4-hydroxyquinoline N-oxide (50 microM). PMID:2172208
Nkhoma, Ella T; Rosenblatt, Lisa; Myers, Joel; Villasis-Keever, Angelina; Coumbis, John
2016-01-01
Tenofovir disoproxil fumarate (TDF)-containing antiretroviral regimens have been associated with an increased incidence of renal and bone adverse outcomes. Here, we estimated the real-world incidence of renal and bone adverse outcomes among patients with HIV infection receiving different TDF-containing single-tablet regimens (STRs). This cohort study used US health insurance data spanning the years 2008-2014. We identified HIV-infected patients aged ≥18 years (all HIV patients) and those with ≥6 months of continuous enrollment prior to initiating efavirenz/emtricitabine/TDF (EFV/FTC/TDF), rilpivirine/FTC/TDF (RPV/FTC/TDF) or elvitegravir/cobicistat/FTC/TDF (EVG/COBI/FTC/TDF). Renal adverse outcomes were identified using renal International Classification of Diseases, Ninth Revision, Clinical Modification (ICD-9-CM) diagnosis codes. Bone adverse outcomes were identified using ICD-9-CM diagnosis codes for fracture. Incidence rates (IRs) and associated 95% confidence intervals (CIs) were estimated assuming a Poisson distribution, and outcomes between STRs were compared using IR ratios (IRRs) and IR differences (IRDs). We identified 9876 and 10,383 eligible patients for the renal and fracture analyses, respectively. Observed IRs for renal adverse outcomes were 9.7, 10.5, 13.6, and 18.0 per 1000 person-years among those receiving EFV/FTC/TDF, RPV/FTC/TDF, or EVG/COBI/FTC/TDF, or all HIV patients, respectively. Corresponding values for IRs of fracture were 3.4, 3.6, 7.2, and 4.4 per 1000 person-years, respectively. Renal adverse outcomes with EFV/FTC/TDF were significantly less frequent than with EVG/COBI/FTC/TDF (IRD -3.96; 95% CI: -7.31, -1.06). No IRR differences were identified for the renal analysis. Fractures with EFV/FTC/TDF were significantly less frequent than with EVG/COBI/FTC/TDF (IRR 0.47; 95% CI: 0.27, 0.81 and IRD -3.85; 95% CI: -5.02, -2.78). In this large real-world database, observed IRs for renal adverse outcomes with TDF-containing STRs were lower
Gold, Ralf; Schlegel, Eugen; Elias-Hamp, Birte; Albert, Christian; Schmidt, Stephan; Tackenberg, Björn; Xiao, James; Schaak, Tom; Salmen, Hans Christian
2018-01-01
Gastrointestinal (GI) events are common adverse events (AEs) associated with delayed-release dimethyl fumarate (DMF), an approved treatment for relapsing-remitting multiple sclerosis (RRMS). The objective of the TOLERATE study was to evaluate GI tolerability and GI mitigation via symptomatic therapies in patients initiating DMF in a real-world clinical setting in Germany. TOLERATE was a multicentre, open-label, single-arm study performed at 25 German sites. Endpoints were frequency, severity, duration (all primary) and mitigation of GI-related events (secondary). Patients were instructed to take DMF according to the prescribing information for up to 12 weeks and to document GI events and intake of GI-symptomatic therapy on numerical rating scales, using eDiaries. A total of 211 patients were included in the safety population (71% female; mean age 40 ± 11 years). Of these, 185 patients (87.7%) reported GI-related events, out of which nearly half received GI-symptomatic therapy (84/185; 45.4%). The most frequently reported GI events were upper abdominal pain, flatulence and nausea. GI-related events peaked during the first 3 weeks of therapy and rapidly decreased thereafter. The severity of GI events over 12 weeks according to the Modified Overall Gastrointestinal Symptom Scale were mild to moderate in the majority of patients reporting GI-related events and taking symptomatic GI medication (53.6%). Only 10% of all patients discontinued study treatment due to AEs in general, while 6.6% discontinued due to GI-related events. The severity of GI-related events decreased over time in patients who received symptomatic treatment with one or more medications (e.g. acid secretion blockers, antidiarrhoeals or antiemetics). Gastrointestinal events associated with delayed-release DMF were mainly mild to moderate in severity. Prevalence of GI events peaked during the first 3 weeks of therapy and rapidly faded thereafter. Although 44.9% of patients experiencing GI events used
Menezes, C N; Crowther, N J; Duarte, R; Van Amsterdam, D; Evans, D; Dickens, C; Dix-Peek, T; Rassool, M; Prinsloo, A; Raal, F; Sanne, I
2014-01-01
Low-dose stavudine therapy may have a lower toxicity profile compared with standard dose. A randomized controlled trial comparing these two doses of stavudine with tenofovir disoproxil fumarate (tenofovir DF) was performed to assess the effects on anthropometry, markers of inflammation, and lipid and glucose metabolism in Black South African patients. Sixty patients were randomized 1:1:1 to either standard-dose (30-40 mg) or low-dose (20-30 mg) stavudine or tenofovir DF (300 mg), each combined with lamivudine and efavirenz, for 48 weeks. Anthropometry, markers of inflammation, and lipid and glucose metabolism were assessed using standard techniques. In all three treatment arms, there was a significant increase in lipid levels over the study period. At 48 weeks, fasting glucose level (P < 0.005) and homeostasis model assessment (HOMA) score (P < 0.05) increased significantly in the standard-dose stavudine arm, as did insulin and C-peptide levels in both the standard- and low-dose stavudine arms. At week 48, a significant decrease (P < 0.05) in adiponectin was noted in the standard-dose stavudine arm, but there was an increase (P < 0.005) in the tenofovir DF arm. In both the stavudine arms, significant increases in anthropometric measures occurred at 24 weeks but these decreased by week 48. Mitochondrial toxicities occurred in both the stavudine arms. Immunological and virological outcomes were similar for all three arms. This study highlights the occurrence of metabolic abnormalities with both stavudine and tenofovir DF treatment. Awareness of the potential increased cardiovascular risk should be of concern with the use of both these therapies. © 2013 British HIV Association.
Kim, Nan-Sun; Yu, Hwa-Young; Chung, Nguyen-Duc; Kwon, Tae-Ho; Yang, Moon-Sik
2014-09-01
Productivity of recombinant bovine trypsin using a rice amylase 3D promoter has been studied in transgenic rice suspension culture. Alternative carbon sources were added to rice cell suspension cultures in order to improve the production of recombinant bovine trypsin. It was demonstrated that addition of alternative carbon sources such as succinic acid, fumaric acid and malic acid in the culture medium could increase the productivity of recombinant bovine trypsin 3.8-4.3-fold compared to those in the control medium without carbon sources. The highest accumulated trypsin reached 68.2 mg/L on day 5 in the culture medium with 40 mM fumaric acid. The feasibility of repeated use of the cells for recombinant trypsin production was tested in transgenic rice cell suspension culture with the culture medium containing the combination of variable sucrose concentration and 40 mM fumaric acid. Among the used combinations, the combination of 1% sucrose and 40 mM fumaric acid resulted in a yield of up to 53 mg/L five days after incubation. It also increased 31% (W/W) of dry cell weight and improved 43% of cell viability compared to that in control medium without sucrose. Based on these data, recycling of the trypsin production process with repeated 1% sucrose and 40 mM fumaric acid supplying-harvesting cycles was developed in flask scale culture. Recombinant bovine trypsin could be stably produced with a yield of up to 53-39 mg/L per cycle during five recycling cycles. Copyright © 2014 Elsevier Inc. All rights reserved.
Identification of Protein Succination as a Novel Modification of Tubulin
Piroli, Gerardo G.; Manuel, Allison M.; Walla, Michael D.; Jepson, Matthew J.; Brock, Jonathan W.C.; Rajesh, Mathur P.; Tanis, Ross M.; Cotham, William E.; Frizzell, Norma
2015-01-01
Protein succination is a stable post-translational modification that occurs when fumarate reacts with cysteine residues to generate S-(2-succino)cysteine (2SC). We demonstrate that both alpha (α) and beta (β) tubulin are increasingly modified by succination in 3T3-L1 adipocytes and in the adipose tissue of db/db mice. Incubation of purified tubulin from porcine brain with fumarate (50 mM) or the pharmacological compound dimethylfumarate (DMF, 500 μM) inhibited polymerization up to 35% and 59%, respectively. Using mass spectrometry we identified Cys347α, Cys376α, Cys12β and Cys303β as sites of succination in porcine brain tubulin and the relative abundance of succination at these cysteines increased in association with fumarate concentration. The increase in succination after incubation with fumarate altered tubulin recognition by an anti-α-tubulin antibody. Succinated tubulin in adipocytes cultured in high glucose vs. normal glucose also had reduced reactivity with the anti-αtubulin antibody; suggesting that succination may interfere with tubulin:protein interactions. DMF reacted rapidly with 11 of the 20 cysteines in the αβ tubulin dimer, decreased the number of free sulfhydryls and inhibited the proliferation of 3T3-L1 fibroblasts. Our data suggests that inhibition of tubulin polymerization is an important, undocumented mechanism of action of DMF. Taken together, our results demonstrate that succination is a novel post-translational modification of tubulin and suggest that extensive modification by fumarate, either physiologically or pharmacologically, may alter microtubule dynamics. PMID:24909641
Kanorskiĭ, S G
2013-01-01
According to results of large clinical studies angiotensin II receptor blockers (ARB) and aliskiren do not lower risk of cardiovascular complications and mortality in wide spectrum of clinical conditions and are able to worsen renal outcomes. It is expedient to prefer inhibitors of angiotensin converting enzyme in particular perindopril over ARB in the treatment of patients with arterial hypertension taking into consideration differences in effect on mortality. Fixed perindopril/indapamide combination provides achievement of target arterial pressure in many patients with uncontrolled hypertension, has good tolerability, is metabolically neutral, and possesses high organoprotective properties.
Havrdova, E; Giovannoni, G; Gold, R; Fox, R J; Kappos, L; Phillips, J Theodore; Okwuokenye, M; Marantz, J L
2017-05-01
Significant effects on clinical/neuroradiological disease activity have been reported in patients with relapsing-remitting multiple sclerosis treated with delayed-release dimethyl fumarate (DMF) in phase III DEFINE/CONFIRM trials. We conducted a post hoc analysis of integrated data from DEFINE/CONFIRM to evaluate the effect of DMF on achieving no evidence of disease activity (NEDA) in patients with relapsing-remitting multiple sclerosis. The analysis included patients randomized to DMF 240 mg twice daily, placebo or glatiramer acetate (CONFIRM only) for ≤2 years. A time-to-event method was used to estimate the percentage of patients achieving NEDA. Clinical NEDA (no relapses/no 12-week confirmed disability progression) was analysed in the intention-to-treat (ITT) population. Neuroradiological (no new/newly enlarging T2 hyperintense lesions/no gadolinium-enhancing lesions) and overall NEDA (clinical and neuroradiological NEDA) were analysed in the magnetic resonance imaging (MRI) cohort. The ITT and MRI populations comprised 1540 and 692 patients, respectively. The percentage of patients with clinical NEDA (ITT population) and neuroradiological NEDA (MRI cohort) was higher with DMF versus placebo over 2 years [clinical NEDA: 38.9% relative reduction; hazard ratio (HR), 0.61; 95% confidence interval (CI), 0.52-0.72; P < 0.0001; neuroradiological NEDA: 40.0% relative reduction; HR, 0.60; 95% CI, 0.49-0.73; P < 0.0001]. The percentage of patients achieving overall NEDA (MRI cohort) was also higher with DMF (26%) versus placebo (12%) over 2 years, with a relative risk reduction of 42.7% (HR, 0.57; 95% CI, 0.48-0.69; P < 0.0001). A significantly higher percentage of patients treated with DMF achieved NEDA status over 2 years compared with placebo. © 2017 Biogen. European Journal of Neurology published by John Wiley & Sons Ltd on behalf of European Academy of Neurology.
Michal, Jessica L; Rab, Saira; Patel, Manish; Kyle, Alison W; Miller, Lesley S; Easley, Kirk A; Kalapila, Aley G
2018-06-19
Ledipasvir/sofosbuvir (LDV/SOF), an antiviral treatment for hepatitis C virus (HCV), and tenofovir disoproxil fumarate (TDF), an antiretroviral for treating human immunodeficiency virus (HIV), may be coadministered in patients coinfected with these viruses. A drug interaction between LDV and TDF could increase TDF-associated nephrotoxicity rates; however, there is minimal clinical evidence describing acute kidney injury (AKI) rates in this population. This study was conducted at a Ryan White-funded facility in Atlanta, Georgia, that cares for over 5,000 patients with AIDS. This retrospective cohort used chart review to assess occurrence of and risk factors for AKI in HIV/HCV-coinfected patients receiving LDV/SOF and antiretroviral therapy (ART). AKI rates were compared between TDF-containing and non-TDF-containing ART groups according to Kidney Disease Improving Global Outcomes (KDIGO) criteria. Additional evaluated risk factors for AKI included chronic kidney disease and use of boosted protease inhibitor-based ART. In the 117 included patients, the overall incidence of AKI was 27.3%. AKI occurred more frequently in the non-TDF group (13/86, 15.1% vs. 19/31, 61.3%, p < .001). All AKI was KDIGO stage 1. From multivariable logistic regression, the only independent predictor of AKI was treatment with non-TDF relative to TDF (adjusted odds ratio 6.51, 95% confidence interval 2.34-18.10, p < .001). In this real-world cohort of HIV/HCV-coinfected patients, KDIGO-defined AKI was common, but occurred less frequently in patients receiving TDF-based ART. Our study suggests that patients with normal baseline renal function can be safely treated with TDF and LDV/SOF without significant nephrotoxicity if renal function is closely monitored.
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
Stimulation of Erwinia sp. fumarase and aspartase synthesis by changing medium components.
Bagdasaryan, Z N; Aleksanyan, G A; Mirzoyan, A M; Roseiro, J C; Bagdasaryan, S N
2005-05-01
The optimal concentrations of nutrient medium components, aeration conditions, and pH providing for maximum biomass yields, as well as fumarase and L-aspartase activities, during submerged cultivation of Erwinia sp. were determined. The data showed that different concentrations of carbon source (molasses) and pH of the nutrient medium were required to reach the maximum fumarase and L-aspartase activities. Calculations performed by application of the additive lattice model suggested that the combination of these optimized factors would result in 3.2-, 3.4-, and 3.8-fold increases as compared to the experimental means in Erwinia sp. biomass, and L-aspartase and fumarase activities, respectively. The conditions of the fumaric acid biotransformations into L-malic and L-aspartic acids were optimized on the basis of intact Erwinia sp. cells, a fumarase and L-aspartase producer. In the cases of fumarate transformation into L-malic acid and of fumarate transformation into L-aspartic acids, fumarase and L-aspartase activities increased 1.5- and 1.7-fold, respectively. The experimental data were consistent with these estimates to 80% accuracy. In comparison with the additive lattice model, the application of polynomial nonlinear model allowed the between-factor relations to be considered and analyzed, which resulted in 1.1-, 1.27-, and 1.1-fold increases in Erwinia sp. biomass and fumarase and L-aspartase activities for the case of cultivation. In the case of fumarate transformation into L-malic acid, this model demonstrated a 1.7-fold increase in fumarase activity, whereas during fumarate transformation into L-aspartic acid no significant change in aspartase activity was observed.
The effect of change in pH on the solubility of iron bis-glycinate chelate and other iron compounds.
García-Casal, M N; Layrisse, M
2001-03-01
The effect of a pH change from 2 to 6 was tested on the solubility of ferrous sulfate, ferrous fumarate, iron bis-glycine chelate (Ferrochel) and sodium-iron ethylenediaminetetraacetic acid (NaFeEDTA). It was found that at pH 2 ferrous sulfate, Ferrochel and NaFeEDTA were completely soluble and only 75% of iron from ferrous fumarate was soluble. When pH was raised to 6, iron from amino acid chelate and NaFeEDTA remained completely soluble while solubility from ferrous sulfate and ferrous fumarate decreased 64 and 74%, respectively compared to the amount of iron initially soluble at pH 2. These results suggest that iron solubility from iron bis-glycine chelate and NaFeEDTA is not affected by pH changes within the ranges tested, probably because iron remained associated to the respective compounds.
Wang, Gang; McIntyre, Alexander; Earley, Willie R; Raines, Shane R; Eriksson, Hans
2014-01-01
Objectives To evaluate the efficacy and tolerability of once-daily extended release quetiapine fumarate (quetiapine XR) monotherapy in patients with major depressive disorder (MDD). Patients and methods This was a 10-week (8-week active treatment/2-week post-treatment) randomized, double-blind, placebo- and active-controlled study (D1448C00004). Patients received quetiapine XR 150 mg/day, escitalopram 10 mg/day, or placebo; patients with an inadequate response (<20% improvement in Montgomery–Åsberg Depression Rating Scale [MADRS] total score) at week two received double-dose treatment. The primary end point was week eight change from randomization in MADRS total score. Secondary end points included MADRS response (≥50% improvement) and remission (score ≤8); Hamilton Rating Scale for Depression total and item 1; Hamilton Rating Scale for Anxiety total, psychic, and somatic; Clinical Global Impressions – Severity of Illness total; Pittsburgh Sleep Quality Index (PSQI) global; and Quality of Life Enjoyment and Satisfaction Questionnaire – Short Form percentage maximum total scores. Tolerability was assessed throughout. Results A total of 471 patients was randomized. No significant improvements in MADRS total score were observed at week eight (last observation carried forward) with either active treatment (quetiapine XR, −17.21 [P=0.174]; escitalopram, −16.73 [P=0.346]) versus placebo (−15.61). There were no significant differences in secondary end points versus placebo, with the exception of week-eight change in PSQI global score (quetiapine XR, −4.96 [P<0.01] versus placebo, −3.37). Mixed-model repeated-measures analysis of observed-case data suggested that the primary analysis may not be robust. Most commonly reported adverse events included dry mouth, somnolence, and dizziness for quetiapine XR, and headache and nausea for escitalopram. Conclusion In this study, neither quetiapine XR (150/300 mg/day) nor escitalopram (10/20 mg/day) showed
Ferrario, Carlos M
2010-02-27
This article reviews the importance of the renin-angiotensin-aldosterone system (RAAS) in the cardiometabolic continuum; presents the pros and cons of dual RAAS blockade with angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin receptor blockers (ARBs); and examines the theoretical and practical benefits supporting the use of direct renin inhibitors (DRIs) in combination with ACEIs or ARBs. The author reviewed the literature for key publications related to the biochemical physiology of the RAAS and the pharmacodynamic effects of ACEIs, ARBs, and DRIs, with a particular focus on dual RAAS blockade with these drug classes. Although ACEI/ARB combination therapy produces modest improvement in BP, it has not resulted in the major improvements predicted given the importance of the RAAS across the cardiorenal disease continuum. This may reflect the fact that RAAS blockade with ACEIs and/or ARBs leads to exacerbated renin release through loss of negative-feedback inhibition, as well as ACE/aldosterone escape through RAAS and non-RAAS-mediated mechanisms. Plasma renin activity (PRA) is an independent predictor of morbidity and mortality, even for patients receiving ACEIs and ARBs. When used alone or in combination with ACEIs and ARBs, the DRI aliskiren effectively reduces PRA. Reductions in BP are greater with these combinations, relative to the individual components alone. It is possible that aliskiren plus either an ACEI or ARB may provide greater RAAS blockade than monotherapy with ACEIs or ARBs, and lead to additive improvement in BP and clinically important outcomes. Copyright 2009 Elsevier Inc. All rights reserved.
Giovannoni, Gavin; Gold, Ralf; Fox, Robert J; Kappos, Ludwig; Kita, Mariko; Yang, Minhua; Sarda, Sujata P; Zhang, Ray; Viglietta, Vissia; Havrdova, Eva
2015-11-01
The purpose was to report the effects of delayed-release dimethyl fumarate (DMF; also known as gastro-resistant DMF) on the number of relapses requiring intravenous (IV) steroids and multiple sclerosis (MS)-related hospitalizations using integrated data from the Phase III DEFINE and CONFIRM studies. DEFINE and CONFIRM were randomized, double-blind, placebo-controlled, multicenter studies that evaluated the efficacy and safety of DMF over a 2-year period in patients with relapsing-remitting MS (RRMS). Patients were randomized (1:1:1) to receive oral DMF 240 mg BID or TID, placebo, or glatiramer acetate (CONFIRM only). Eligible subjects (aged 18-55 years) had an EDSS score of 0-5.0 and experienced either ≥1 relapse in the 12 months or had ≥1 gadolinium-enhanced lesion on brain MRI in the 6 weeks, before randomization. Data DEFINE and CONFIRM were pooled and analyzed using a negative binomial regression model (adjusted for study and region). Data obtained after subjects switched to an alternative MS therapy were not included in the analysis. Only relapses confirmed by the Independent Neurology Evaluation Committee were included in the analysis of relapses requiring IV steroids. The study population (intention-to-treat) comprised 2301 patients who received either placebo (n = 771), DMF BID (n = 769), or DMF TID (n = 761). Baseline demographic and disease characteristics were generally well balanced among treatment groups. Throughout the 2-year studies, the total number of relapses treated with methylprednisolone was 402, 221, and 209 in the placebo, DMF BID, and DMF TID groups, respectively. A smaller proportion of patients in the DMF BID (168 of 769 [21.8%]) and DMF TID (151 of 761 [19.8%]) groups experienced ≥1 relapse requiring IV steroids compared with the placebo group (284 of 771 [36.8%]). The total number of MS-related hospitalizations over 2 years was 136, 94, and 74 in the placebo, DMF BID, and DMF TID groups. A smaller proportion of patients in the DMF
Chevalier, Julie; Chamoux, Catherine; Hammès, Florence; Chicoye, Annie
2016-01-01
The paper aimed to estimate the incremental cost-effectiveness ratio (ICER) at the public published price for delayed-release dimethyl fumarate versus relevant Multiple Sclerosis disease-modifying therapies available in France in June 2015. The economic model was adapted to the French setting in accordance with the Haute Autorité de Santé guidelines using a model previously developed for NICE. A cohort of Relapsing Remitting Multiple Sclerosis patients was simulated over a 30-year time horizon. Twenty one health states were taken into account: Kurtzke Expanded Disability Status Scale (EDSS) 0-9 for Relapsing Remitting Multiple Sclerosis patients, EDSS 0-9 for Secondary Progressive Multiple Sclerosis patients, and death. Estimates of relative treatment efficacy were determined using a mixed-treatment comparison. Probabilities of events were derived from the dimethyl fumarate pivotal clinical trials and the London Ontario Dataset. Costs and utilities were extracted from the published literature from both the payer and societal perspectives. Univariate and probabilistic sensitivity analyses were performed to assess the robustness of the model results. From both perspectives, dimethyl fumarate and interferon beta-1a (IFN beta-1a) 44 mcg were the two optimal treatments, as the other treatments (IFN beta-1a 30 mcg, IFN beta-1b 250 mcg, teriflunomide, glatiramer acetate, fingolimod) were dominated on the efficiency frontier. From the societal perspective, dimethyl fumarate versus IFN beta-1a 44 mcg incurred an incremental cost of €3,684 and an incremental quality-adjusted life year (QALY) of 0.281, corresponding to an ICER of €13,110/QALY. Despite no reference threshold for France, dimethyl fumarate can be considered as a cost-effective option as it is on the efficiency frontier.
Anaerobic respiration of Escherichia coli in the mouse intestine.
Jones, Shari A; Gibson, Terri; Maltby, Rosalie C; Chowdhury, Fatema Z; Stewart, Valley; Cohen, Paul S; Conway, Tyrrell
2011-10-01
The intestine is inhabited by a large microbial community consisting primarily of anaerobes and, to a lesser extent, facultative anaerobes, such as Escherichia coli, which we have shown requires aerobic respiration to compete successfully in the mouse intestine (S. A. Jones et al., Infect. Immun. 75:4891-4899, 2007). If facultative anaerobes efficiently lower oxygen availability in the intestine, then their sustained growth must also depend on anaerobic metabolism. In support of this idea, mutants lacking nitrate reductase or fumarate reductase have extreme colonization defects. Here, we further explore the role of anaerobic respiration in colonization using the streptomycin-treated mouse model. We found that respiratory electron flow is primarily via the naphthoquinones, which pass electrons to cytochrome bd oxidase and the anaerobic terminal reductases. We found that E. coli uses nitrate and fumarate in the intestine, but not nitrite, dimethyl sulfoxide, or trimethylamine N-oxide. Competitive colonizations revealed that cytochrome bd oxidase is more advantageous than nitrate reductase or fumarate reductase. Strains lacking nitrate reductase outcompeted fumarate reductase mutants once the nitrate concentration in cecal mucus reached submillimolar levels, indicating that fumarate is the more important anaerobic electron acceptor in the intestine because nitrate is limiting. Since nitrate is highest in the absence of E. coli, we conclude that E. coli is the only bacterium in the streptomycin-treated mouse large intestine that respires nitrate. Lastly, we demonstrated that a mutant lacking the NarXL regulator (activator of the NarG system), but not a mutant lacking the NarP-NarQ regulator, has a colonization defect, consistent with the advantage provided by NarG. The emerging picture is one in which gene regulation is tuned to balance expression of the terminal reductases that E. coli uses to maximize its competitiveness and achieve the highest possible population in
Morales, J; Vargas, F; Cassís, L; Sánchez, E; Villalpando, S
2008-01-01
As part of the efforts to reduce iron deficiency anemia (IDA), the Mexican Federal program PROGRESA distributes complementary foods to toddlers and pregnant women living in extreme poverty. Complementary foods were originally fortified with hydrogen-reduced iron, which proved a limited efficacy. The supplement was reformulated to provide higher iron bioavailability. This investigation aims to assess the sensory changes and the acceptance of new versions of the complementary foods fortified with either reduced iron, ferrous fumarate, or ferrous sulfate, stored at room temperature for 2, 4, and 6 mo. Complementary foods were presented without flavor (plain) or flavored with either chocolate or vanilla. The complementary foods were evaluated in toddlers and their mothers using a hedonic scale. The percentage of overall acceptance for the baby foods was higher in toddlers (80% to 88%) than in their mothers (63% to 68%). The complementary foods with a better acceptance were those fortified with reduced iron (63% to 68%) and ferrous fumarate (61% to 80%) independently of the flavoring added. The acceptance of the beverage intended for women was better for those fortified with reduced iron (52% to 63%) or ferrous fumarate (44% to 63%) in their vanilla-flavored version. For women, the most accepted sources of iron were reduced iron (50% to 60%) and ferrous fumarate (50% to 58%).
Song, Ivy; Borland, Julie; Arya, Niki; Wynne, Brian; Piscitelli, Stephen
2015-01-01
All commercially available integrase inhibitors are 2-metal binders and may be affected by co-administration with metal cations. The purpose of this study was to evaluate the effect of calcium and iron supplements on dolutegravir pharmacokinetics and strategies (dose separation and food) to attenuate the effects if significant reductions in dolutegravir exposure were observed. This was an open-label, crossover study that randomized 24 healthy subjects into 1 of 2 cohorts to receive 4 treatments: (1) dolutegravir alone, fasting; (2) dolutegravir with calcium carbonate or ferrous fumarate, fasting; (3) dolutegravir with calcium carbonate or ferrous fumarate with a moderate-fat meal; (4) dolutegravir administered 2 hours before calcium carbonate or ferrous fumarate, fasting. Plasma dolutegravir AUC(0–∞), Cmax, and C24 were reduced by 39%, 37%, and 39%, respectively, when co-administered with calcium carbonate while fasting and were reduced by 54%, 57%, and 56%, respectively, when co-administered with ferrous fumarate while fasting. Dolutegravir administration 2 hours before calcium or iron supplement administration (fasted), as well as administration with a meal, counteracted the effect. Dolutegravir and calcium or iron supplements can be co-administered if taken with a meal. Under fasted conditions, dolutegravir should be administered 2 hours before or 6 hours after calcium or iron supplements. PMID:25449994
Brifkani, Zaid; Brennan, Daniel C; Lentine, Krista L; Horwedel, Timothy A; Malone, Andrew F; Delos Santos, Rowena; Maw, Thin Thin; Alhamad, Tarek
2017-03-01
White recipients of 2-haplotype HLA-matched living kidney transplants are perceived to be of low immunologic risk. Little is known about the safety of induction avoidance and calcineurin inhibitor withdrawal in these patients. We reviewed our experience at a single center and compared it to Organ Procurement and Transplantation Network (OPTN) registry data and only included 2-haplotype HLA-matched white living kidney transplants recipients between 2000 and 2013. There were 56 recipients in a single center (where no induction was given) and 2976 recipients in the OPTN. Among the OPTN recipients, 1285 received no induction, 903 basiliximab, 608 thymoglobulin, and 180 alemtuzumab. First-year acute rejection rates were similar after induction-free transplantation among the center and induced groups nationally. Compared with induction-free transplantation in the national data, there was no decrease in graft failure risk over 13 years with use of basiliximab (adjusted hazard ratio [aHR], 0.86; confidence interval [CI], 0.68-1.08), Thymoglobulin (aHR, 0.92; CI, 0.7-1.21) or alemtuzumab (aHR, 1.18; CI, 0.72-1.93). Among induction-free recipients at the center, calcineurin inhibitor withdrawal at 1 year (n = 27) did not significantly impact graft failure risk (HR,1.62; CI, 0.38-6.89). This study may serve as a foundation for further studies to provide personalized, tailored, immunosuppression for this very low-risk population of kidney transplant patients.
Efficient aspartic acid production by a psychrophile-based simple biocatalyst.
Tajima, Takahisa; Hamada, Mai; Nakashimada, Yutaka; Kato, Junichi
2015-10-01
We previously constructed a Psychrophile-based Simple bioCatalyst (PSCat) reaction system, in which psychrophilic metabolic enzymes are inactivated by heat treatment, and used it here to study the conversion of aspartic acid from fumaric acid mediated by the activity of aspartate ammonia-lyase (aspartase). In Escherichia coli, the biosynthesis of aspartic acid competes with that of L-malic acid produced from fumaric acid by fumarase. In this study, E. coli aspartase was expressed in psychrophilic Shewanella livingstonensis Ac10 heat treated at 50 °C for 15 min. The resultant PSCat could convert fumaric acid to aspartic acid without the formation of L-malic acid because of heat inactivation of psychrophilic fumarase activity. Furthermore, alginate-immobilized PSCat produced high yields of aspartic acid and could be re-used nine times. The results of our study suggest that PSCat can be applied in biotechnological production as a new approach to increase the yield of target compounds.
Fusee, Murray C.; Swann, Wayne E.; Calton, Gary J.
1981-01-01
Whole cells of Escherichia coli containing aspartase activity were immobilized by mixing a cell suspension with a liquid isocyanate-capped polyurethane prepolymer (Hypol). The immobilized cell preparation was used to convert ammonium fumarate to l-aspartic acid. Properties of the immobilized E. coli cells containing aspartase were investigated with a batch reactor. A 1.67-fold increase in the l-aspartic acid production rate was observed at 37°C as compared to 25°C operating temperature. The pH optimum was broad, ranging from 8.5 to 9.2. Increasing the concentration of ammonium fumarate to 1.5 M from 1.0 M negatively affected the reaction rate. l-Aspartic acid was produced at an average rate of 2.18 × 10−4 mol/min per g (wet weight) of immobilized E. coli cells with a 37°C substrate solution consisting of 1.0 M ammonium fumarate with 1 mM Mg2+ (pH 9.0). PMID:16345865
Production of Plant Phthalate and its Hydrogenated Derivative from Bio-Based Platform Chemicals.
Lu, Rui; Lu, Fang; Si, Xiaoqin; Jiang, Huifang; Huang, Qianqian; Yu, Weiqiang; Kong, Xiangtao; Xu, Jie
2018-04-06
Direct transformation of bio-based platform chemicals into aromatic dicarboxylic acids and their derivatives, which are widely used for the manufacture of polymers, is of significant importance for the sustainable development of the plastics industry. However, limited successful chemical processes have been reported. This study concerns a sustainable route for the production of phthalate and its hydrogenated derivative from bio-based malic acid and erythritol. The key Diels-Alder reaction is applied to build a substituted cyclohexene structure. The dehydration reaction of malic acid affords fumaric acid with 96.6 % yield, which could be used as the dienophile, and 1,3-butadiene generated in situ through erythritol deoxydehydration serves as the diene. Starting from erythritol and dibutyl fumarate, a 74.3 % yield of dibutyl trans-4-cyclohexene-1,2-dicarboxylate is obtained. The palladium-catalyzed dehydrogenation of the cycloadduct gives a 77.8 % yield of dibutyl phthalate. Dibutyl trans-cyclohexane-1,2-dicarboxylate could be formed in nearly 100 % yield under mild conditions by hydrogenation of the cycloadduct. Furthermore, fumaric acid and fumarate, with trans configurations, were found to be better dienophiles for this Diels-Alder reaction than maleic acid and maleate, with cis configuration, based on the experimental and computational results. This new route will pave the way for the production of environmental friendly plastic materials from plants. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Taskin, Eylem; Tuncer, Kadir Ali; Guven, Celal; Kaya, Salih Tunc; Dursun, Nurcan
2016-01-01
Background Myocardial ischemia and reperfusion lead to impairment of electrolyte balance and, eventually, lethal arrhythmias. The aim of this study was to investigate the effects of pharmacological inhibition of angiotensin-II (Ang-II) production on heart tissue with ischemia-reperfusion damage, arrhythmia, and oxidative stress. Material/Methods Rats were divided into 4 groups: only ischemia/reperfusion (MI/R), captopril (CAP), aliskiren (AL), and CAP+AL. The drugs were given by gavage 30 min before anesthesia. Blood pressure and electrocardiography (ECG) were recorded during MI/R procedures. The heart tissue and plasma was kept so as to evaluate the total oxidant (TOS), antioxidant status (TAS), and creatine kinase-MB (CK-MB). Results Creatine kinase-MB was not different among the groups. Although TAS was not affected by inhibition of Ang-II production, TOS was significantly lower in the CAP and/or AL groups than in the MI/R group. Furthermore, oxidative stress index was significantly attenuated in the CAP and/or AL groups. Captopril significantly increased the duration of VT during ischemia; however, it did not have any effect on the incidence of arrhythmias. During reperfusion periods, aliskiren and its combinations with captopril significantly reduced the incidence of other types of arrhythmias. Captopril alone had no effect on the incidence of arrhythmias, but significantly increased arrhythmias score and durations of arrhythmias during reperfusion. MAP and heart rate did not show changes in any groups during ischemic and reperfusion periods. Conclusions Angiotensin-II production appears to be associated with elevated levels of reactive oxygen species, but Ang-II inhibitions increases arrhythmia, mainly by initiating ventricular ectopic beats. PMID:27889788
Vyas, D; Beauchemin, K A; Koenig, K M
2015-08-01
The objective of this study was to determine whether supplementing organic acids can prevent incidences of subacute ruminal acidosis (SARA) in beef heifers fed a diet consisting of 8% barley silage and 92% barley grain-based concentrate (DM basis). Ten ruminally cannulated Hereford crossbred heifers (484 ± 25 kg BW) were used in a replicated 5 × 5 Latin square design with 14-d periods including 10 d for dietary adaptation and 4 d for measurements. Dietary treatments included no supplementation (Control), low fumaric acid (61 g/d), high fumaric acid (125 g/d), low malic acid (59 g/d), and high malic acid (134 g/d). Organic acid supplementation had no effect on DMI ( = 0.77). Similarly, no effects were observed on mean ( = 0.74), minimum ( = 0.64), and maximum ( = 0.27) ruminal pH measured continuously for 48 h. Moreover, area under the curve for pH thresholds 6.2 ( = 0.97), 5.8 ( = 0.66), 5.5 ( = 0.55), and 5.2 ( = 0.93) was similar for all treatments. However, malic acid supplementation lowered the amount of time that ruminal pH was <6.2 compared with the Control ( = 0.02) and fumaric acid treatments ( < 0.01). No effects were observed on total VFA concentrations with organic acid supplementation ( = 0.98) compared with the Control, but greater total VFA concentrations were observed with fumaric acid compared with the malic acid treatments ( = 0.02). The population of total culturable bacteria 3 h after feeding was reduced with supplemental malic acid compared with the Control ( = 0.03) and fumaric acid treatments ( = 0.03). However, no effects were observed with organic acid supplementation on lactic acid-utilizing bacteria ( = 0.59). In conclusion, under the conditions of the present study, organic acid supplementation did not have any significant effects on ruminal fermentation parameters compared with the Control and were not effective in preventing SARA in beef cattle fed high-grain diets.
Ernst, Frank R; Barr, Peri; Elmor, Riad; Wong, Schiffon L
2017-12-01
To estimate real-world treatment patterns, safety, and relapse outcomes of subcutaneous (sc) interferon (IFN) β-1a (Rebif) vs dimethyl fumarate (DMF; Tecfidera), to treat relapsing-remitting multiple sclerosis (RRMS). A US retrospective chart review of 450 randomly selected adults newly diagnosed with RRMS who received sc IFN β-1a (n = 143) or DMF (n = 307) was conducted. Patients were either (a) treatment-naïve, initiating first-line treatment with sc IFN β-1a or DMF, or (b) previously treated, switching to sc IFN β-1a or DMF. Two years' follow-up data were captured. Patient characteristics, persistence, and adverse events between treatment groups were compared using t-tests or Chi-square tests. Kaplan-Meier curves with log-rank tests and Cox proportional hazards models were used to compare time to, and risk of non-persistence. Annualized Relapse Rates (ARR) were calculated using a robust variance Poisson model adjusting for covariates. Propensity scores were used to address possible selection bias. One hundred and twelve patients became non-persistent, most commonly due to an adverse event (n = 37). No difference was observed in time to overall non-persistence between sc IFN β-1a and DMF patients. Among treatment-naïve patients, those receiving DMF had 2.4-times the risk (HR = 2.439, 95% CI = 1.007-5.917, p = .0483) of experiencing a discontinuation than patients receiving sc IFN β-1a. Non-persistent patients receiving DMF had 2.3-times the risk (HR = 2.311, 95% CI = 1.350-3.958, p = .0023) of experiencing an adverse event at a given time point than patients prescribed sc IFN β-1a. No differences in relapse risk or ARR between sc IFN β-1a- and DMF-treated patients were observed. sc IFN β-1a-treated patients had comparable persistence and relapse outcomes, and better safety outcomes vs DMF-treated patients across 2 years.
Water Adsorption on Various Metal Organic Framework
NASA Astrophysics Data System (ADS)
Teo, H. W. B.; Chakraborty, A.
2017-12-01
In this paper, Metal Organic Framework (MOF) undergoes N2 and water adsorption experiment to observe how the material properties affects the water sorption performance. The achieved N2 isotherms is used to estimate the BET surface area, pore volume and, most importantly, the pore size distribution of the adsorbent material. It is noted that Aluminium Fumarate and CAU-10 has pore distribution of about 6Å while MIL-101(Cr) has 16 Å. The water adsorption isotherms at 25°C shows MIL-101(Cr) has a long hydrophobic length from relative pressure of 0 ≤ P/Ps ≤ 0.4 with a maximum water uptake of 1kg/kg sorbent. Alkali metal ions doped MIL-101(Cr) reduced the hydrophobic length and maximum water uptake of original MIL-101(Cr). Aluminium Fumarate and CAU-10 has lower water uptake, but the hydrophobic length of both materials is within relative pressure of P/Ps ≤ 0.2. The kinetic behaviour of doped MIL-101(Cr), Aluminium Fumarate and CAU-10 are faster than MIL-101(Cr).
Hou, Entai; Li, Xian; Liu, Zerong; Zhang, Fuchang; Tian, Zhongmin
2018-04-01
Fumarase catalyzes the interconversion of fumarate and l-malate in the tricarboxylic acid cycle. Fumarase insufficiencies were associated with increased levels of fumarate, decreased levels of malate and exacerbated salt-induced hypertension. To gain insights into the metabolism profiles induced by fumarase insufficiency and identify key regulatory metabolites, we applied a GC-MS based metabolomics platform coupled with a network approach to analyze fumarase insufficient human umbilical vein endothelial cells (HUVEC) and negative controls. A total of 24 altered metabolites involved in seven metabolic pathways were identified as significantly altered, and enriched for the biological module of amino acids metabolism. In addition, Pearson correlation network analysis revealed that fumaric acid, l-malic acid, l-aspartic acid, glycine and l-glutamic acid were hub metabolites according to Pagerank based on their three centrality indices. Alanine aminotransferase and glutamate dehydrogenase activities increased significantly in fumarase deficiency HUVEC. These results confirmed that fumarase insufficiency altered amino acid metabolism. The combination of metabolomics and network methods would provide another perspective on expounding the molecular mechanism at metabolomics level. Copyright © 2017 John Wiley & Sons, Ltd.
Marozava, Sviatlana; Vargas-López, Raquel; Tian, Ye; Merl-Pham, Juliane; Braster, Martin; Meckenstock, Rainer U; Smidt, Hauke; Röling, Wilfred F M; Westerhoff, Hans V
2018-06-19
Desulfitobacterium hafniense Y51 has been widely used in investigations of perchloroethylene (PCE) biodegradation, but limited information exists on its other physiological capabilities. We investigated how D. hafniense Y51 confronts the debilitating limitations of not having enough electron donor (lactate), or electron acceptor (fumarate) during cultivation in chemostats. The residual concentrations of the substrates supplied in excess were much lower than expected. Transcriptomics, proteomics, and fluxomics were integrated to investigate how this phenomenon was regulated. Through diverse regulation at both transcriptional and translational levels, strain Y51 turned to fermenting the excess lactate and disproportionating the excess fumarate under fumarate- and lactate-limiting conditions, respectively. Genes and proteins related to the utilization of a variety of alternative electron donors and acceptors absent from the medium were induced, apparently involving the Wood-Ljungdahl pathway. Through this metabolic flexibility, D. hafniense Y51 may be able to switch between different metabolic capabilities under limiting conditions. This article is protected by copyright. All rights reserved. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.
Iron bioavailability in corn-masa tortillas is improved by the addition of disodium EDTA.
Walter, Tomás; Pizarro, Fernando; Olivares, Manuel
2003-10-01
Corn-masa flour flat bread tortillas are the main staple of Mexican and Central American populations. Due to high concentrations of inhibitors of iron absorption, the bioavailability from this matrix is unknown. We wanted to determine the most suitable fortificant that would efficaciously improve iron bioavailability. In tortillas prepared with commercial precooked, lime-treated, corn-masa flour, we examined the in vitro solubility of the following forms of iron: native iron with and without Na2EDTA, elemental reduced iron plus Na2EDTA, ferrous fumarate with and without Na2EDTA, bisglycine iron, ferrous sulfate and NaFeEDTA. We also examined the in vivo bioavailability in humans with double radioiron erythrocyte incorporation of ferrous fumarate with and without Na2EDTA, bisglycine iron, NaFeEDTA and native iron plus Na2EDTA, beans and rice. In vitro, solubility ranged from 1% in iron forms without Na2EDTA to 19.4% for NaFeEDTA. Forms of iron with Na2EDTA had intermediate values. In vivo radioiron studies showed that iron forms without Na2EDTA also had low bioavailability (< or =1%). NaFeEDTA had the highest bioavailability (5.3%). The bioavailability of all iron forms improved significantly when tested with Na2EDTA (<0.05). Adding Na2EDTA to ferrous fumarate increased bioavailability from 0.87% to 2.9% (P < 0.001). We conclude that NaFeEDTA is the form of iron best absorbed, but alternatively, ferrous fumarate plus Na2EDTA comprises a feasible option as a fortificant.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bau, R.; Brewer, I.; Chiang, M.Y.
Neutron diffraction has been used to monitor the absolute stereochemistry of an enzymatic reaction. (-)(2S)malic-3-d acid was prepared by the action of fumarase on fumaric acid in D/sub 2/O. After a large number of cations were screened, it was found that (+)(R)..cap alpha..-phenylethylamine forms the large crystals necessary for a neutron diffraction analysis. The subsequent structure determination showed that (+)(R)..cap alpha..-phenylethylammonium (-)(2S)malate-3-d has an absolute configuration of R at the CHD site. This result confirms the absolute stereochemistry of fumarate-to-malate transformation as catalyzed by the enzyme fumarase.
Toh, Sengwee; Reichman, Marsha E; Houstoun, Monika; Ding, Xiao; Fireman, Bruce H; Gravel, Eric; Levenson, Mark; Li, Lingling; Moyneur, Erick; Shoaibi, Azadeh; Zornberg, Gwen; Hennessy, Sean
2013-11-01
It is increasingly necessary to analyze data from multiple sources when conducting public health safety surveillance or comparative effectiveness research. However, security, privacy, proprietary, and legal concerns often reduce data holders' willingness to share highly granular information. We describe and compare two approaches that do not require sharing of patient-level information to adjust for confounding in multi-site studies. We estimated the risks of angioedema associated with angiotensin-converting enzyme inhibitors (ACEIs), angiotensin receptor blockers (ARBs), and aliskiren in comparison with beta-blockers within Mini-Sentinel, which has created a distributed data system of 18 health plans. To obtain the adjusted hazard ratios (HRs) and 95% confidence intervals (CIs), we performed (i) a propensity score-stratified case-centered logistic regression analysis, a method identical to a stratified Cox regression analysis but needing only aggregated risk set data, and (ii) an inverse variance-weighted meta-analysis, which requires only the site-specific HR and variance. We also performed simulations to further compare the two methods. Compared with beta-blockers, the adjusted HR was 3.04 (95% CI: 2.81, 3.27) for ACEIs, 1.16 (1.00, 1.34) for ARBs, and 2.85 (1.34, 6.04) for aliskiren in the case-centered analysis. The corresponding HRs were 2.98 (2.76, 3.21), 1.15 (1.00, 1.33), and 2.86 (1.35, 6.04) in the meta-analysis. Simulations suggested that the two methods may produce different results under certain analytic scenarios. The case-centered analysis and the meta-analysis produced similar results without the need to share patient-level data across sites in our empirical study, but may provide different results in other study settings. Copyright © 2013 John Wiley & Sons, Ltd.
Bovine ovarian cells have (pro)renin receptors and prorenin induces resumption of meiosis in vitro.
Dau, Andressa Minussi Pereira; da Silva, Eduardo Pradebon; da Rosa, Paulo Roberto Antunes; Bastiani, Felipe Tusi; Gutierrez, Karina; Ilha, Gustavo Freitas; Comim, Fabio Vasconcellos; Gonçalves, Paulo Bayard Dias
2016-07-01
The discovery of a receptor that binds prorenin and renin in human endothelial and mesangial cells highlights the possible effect of renin-independent prorenin in the resumption of meiosis in oocytes that was postulated in the 1980s.This study aimed to identify the (pro)renin receptor in the ovary and to assess the effect of prorenin on meiotic resumption. The (pro)renin receptor protein was detected in bovine cumulus-oocyte complexes, theca cells, granulosa cells, and in the corpus luteum. Abundant (pro)renin receptor messenger ribonucleic acid (mRNA) was detected in the oocytes and cumulus cells, while prorenin mRNA was identified in the cumulus cells only. Prorenin at concentrations of 10(-10), 10(-9), and 10(-8)M incubated with oocytes co-cultured with follicular hemisections for 15h caused the resumption of oocyte meiosis. Aliskiren, which inhibits free renin and receptor-bound renin/prorenin, at concentrations of 10(-7), 10(-5), and 10(-3)M blocked this effect (P<0.05). To determine the involvement of angiotensin II in prorenin-induced meiosis resumption, cumulus-oocyte complexes and follicular hemisections were treated with prorenin and with angiotensin II or saralasin (angiotensin II antagonist). Prorenin induced the resumption of meiosis independently of angiotensin II. Furthermore, cumulus-oocyte complexes cultured with forskolin (200μM) and treated with prorenin and aliskiren did not exhibit a prorenin-induced resumption of meiosis (P<0.05). Only the oocytes' cyclic adenosine monophosphate levels seemed to be regulated by prorenin and/or forskolin treatment after incubation for 6h. To the best of our knowledge, this is the first study to identify the (pro)renin receptor in ovarian cells and to demonstrate the independent role of prorenin in the resumption of oocyte meiosis in cattle. Copyright © 2016 Elsevier Inc. All rights reserved.
Bayes, M; Rabasseda, X; Prous, J R
2005-01-01
Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: (-)-Epigallocatechin gallate; ACP-103, Ad.Egr.TNF.11 D, adalimumab, AF-IL 12, AIDSVAX gp120 B/B, alefacept, alemtuzumab, a-Galactosylceramide, ALVAC vCP 1452, alvimopan hydrate, alvocidib hydrochloride, aminolevulinic acid hydrochloride, aminolevulinic acid methyl ester, anakinra, anidulafungin, antarelix, aprepitant, aripiprazole, arsenic sulfide, asoprisnil, atazanavir sulfate, atomoxetine hydrochloride; Bevacizumab, bimatoprost, BMS-184476, bortezomib, bosentan, botulinum toxin type B, BrachySil, brivudine; Caffeine, calcipotriol/betamethasone dipropionate, cannabidiol, capsaicin for injection, caspofungin acetate, CC-4047, cetuximab, CGP-36742, clofazimine, CpG-7909, Cypher; Darbepoetin alfa, dextromethorphan/quinidine sulfate, dimethylfumarate, dronabinol/cannabidiol, drotrecogin alfa (activated), duloxetine hydrochloride, dutasteride; Ecogramostim, efalizumab, eletriptan, emtricitabine, enfuvirtide, eplerenone, esomeprazole magnesium, estradiol acetate, eszopiclone, etoricoxib, exenatide, ezetimibe, ezetimibe/simvastatin; Fampridine, fondaparinux sodium, fosamprenavir calcium; Gefitinib, GPI-0100; hA 20, HTU-PA, human insulin, HuOKT 3 gamma 1(Ala 234-Ala 235), hyaluronic acid; Icatibant, imatinib mesylate, Indiplon, INKP-100, INKP-102, iodine (I131) tositumomab, istradefylline, IV gamma-globulin, ivabradine hydrochloride, ixabepilone; Lacosamide, landiolol, lanthanum carbonate, lasofoxifene tartrate, LB-80380, lenalidomide, lidocaine/tetracaine, linezolid, liposomal doxorubicin, liposomal vincristine sulfate, lopinavir, lopinavir/ritonavir, lumiracoxib, lurtotecan; Maribavir, morphine glucuronide, MVA-5 T
Ivanovski, Ivan; Ješić, Miloš; Ivanovski, Ana; Garavelli, Livia; Ivanovski, Petar
2017-11-28
The underlying pathophysiology of liver dysfunction in urea cycle disorders (UCDs) is still largely elusive. There is some evidence that the accumulation of urea cycle (UC) intermediates are toxic for hepatocyte mitochondria. It is possible that liver injury is directly caused by the toxicity of ammonia. The rarity of UCDs, the lack of checking of iron level in these patients, superficial knowledge of UC and an underestimation of the metabolic role of fumaric acid, are the main reasons that are responsible for the incomprehension of the mechanism of liver injury in patients suffering from UCDs. Owing to our routine clinical practice to screen for iron overload in severely ill neonates, with the focus on the newborns suffering from acute liver failure, we report a case of citrullinemia with neonatal liver failure and high blood parameters of iron overload. We hypothesize that the key is in the decreased-deficient fumaric acid production in the course of UC in UCDs that causes several sequentially intertwined metabolic disturbances with final result of liver iron overload. The presented hypothesis could be easily tested by examining the patients suffering from UCDs, for liver iron overload. This could be easily performed in countries with a high population and comprehensive national register for inborn errors of metabolism. Providing the hypothesis is correct, neonatal liver damage in patients having UCD can be prevented by the supplementation of pregnant women with fumaric or succinic acid, prepared in the form of iron supplementation pills. After birth, liver damage in patients having UCDs can be prevented by supplementation of these patients with zinc fumarate or zinc succinylate, as well.
Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.
Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg
2010-10-01
Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.
Kiser, Jennifer J.; Stephensen, Charles B.; Hazra, Rohan; Flynn, Patricia M.; Wilson, Craig M.; Rutledge, Brandy; Bethel, James; Pan, Cynthia G.; Woodhouse, Leslie R.; Van Loan, Marta D.; Liu, Nancy; Lujan-Zilbermann, Jorge; Baker, Alyne; Kapogiannis, Bill G.; Gordon, Catherine M.
2013-01-01
Tenofovir disoproxil fumarate (TDF) causes bone, endocrine, and renal changes by an unknown mechanism(s). Data are limited on tenofovir pharmacokinetics and these effects. Using baseline data from a multicenter study of HIV-infected youth on stable treatment with regimens containing TDF (n = 118) or lacking TDF (n = 85), we measured cross-sectional associations of TDF use with markers of renal function, vitamin D-calcium-parathyroid hormone balance, phosphate metabolism (tubular reabsorption of phosphate and fibroblast growth factor 23 [FGF23]), and bone turnover. Pharmacokinetic-pharmacodynamic associations with plasma tenofovir and intracellular tenofovir diphosphate concentrations were explored among those receiving TDF. The mean age was 20.9 (standard deviation [SD], 2.0) years; 63% were male; and 52% were African American. Compared to the no-TDF group, the TDF group showed lower mean estimated glomerular filtration rates and tubular reabsorption of phosphate, as well as higher parathyroid hormone and 1,25-dihydroxy vitamin D [1,25-OH(2)D] levels. The highest quintile of plasma tenofovir concentrations was associated with higher vitamin D binding protein, lower free 1,25-OH(2)D, higher 25-OH vitamin D, and higher serum calcium. The highest quintile of intracellular tenofovir diphosphate concentration was associated with lower FGF23. Higher plasma tenofovir concentrations were associated with higher vitamin D binding protein and lower free 1,25-OH(2)D, suggesting a functional vitamin D deficiency explaining TDF-associated increased parathyroid hormone. The finding of lower FGF23 accompanying higher intracellular tenofovir diphosphate suggests that different mechanisms mediate TDF-associated changes in phosphate handling. Separate pharmacokinetic properties may be associated with distinct TDF toxicities: tenofovir with parathyroid hormone and altered calcium balance and tenofovir diphosphate with hypophosphatemia and FGF23 regulation. (The clinical trial
Dyson, Beth C.; Miller, Matthew A.E.; Feil, Regina; Rattray, Nicholas; Bowsher, Caroline G.
2016-01-01
Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the cold-tolerant model species Arabidopsis (Arabidopsis thaliana). A nontargeted metabolomic approach, using gas chromatography-mass spectrometry, identifies fumarate as a key component of the cold response in this species. Plants of T-DNA insertion mutants, lacking FUM2, show marked differences in their response to cold, with contrasting responses both in terms of metabolite concentrations and gene expression. The fum2 plants accumulated higher concentrations of phosphorylated sugar intermediates and of starch and malate. Transcripts for proteins involved in photosynthesis were markedly down-regulated in fum2.2 but not in wild-type Columbia-0. Plants of fum2 show a complete loss of the ability to acclimate photosynthesis to low temperature. We conclude that fumarate accumulation plays an essential role in low temperature sensing in Arabidopsis, either indirectly modulating metabolic or redox signals or possibly being itself directly involved in cold sensing. PMID:27440755
Watanabe, Rei; Gehad, Ahmed; Yang, Chao; Scott, Laura L; Teague, Jessica E; Schlapbach, Christoph; Elco, Christopher P; Huang, Victor; Matos, Tiago R; Kupper, Thomas S; Clark, Rachael A
2015-03-18
The skin of an adult human contains about 20 billion memory T cells. Epithelial barrier tissues are infiltrated by a combination of resident and recirculating T cells in mice, but the relative proportions and functional activities of resident versus recirculating T cells have not been evaluated in human skin. We discriminated resident from recirculating T cells in human-engrafted mice and lymphoma patients using alemtuzumab, a medication that depletes recirculating T cells from skin, and then analyzed these T cell populations in healthy human skin. All nonrecirculating resident memory T cells (TRM) expressed CD69, but most were CD4(+), CD103(-), and located in the dermis, in contrast to studies in mice. Both CD4(+) and CD8(+) CD103(+) TRM were enriched in the epidermis, had potent effector functions, and had a limited proliferative capacity compared to CD103(-) TRM. TRM of both types had more potent effector functions than recirculating T cells. We observed two distinct populations of recirculating T cells, CCR7(+)/L-selectin(+) central memory T cells (TCM) and CCR7(+)/L-selectin(-) T cells, which we term migratory memory T cells (TMM). Circulating skin-tropic TMM were intermediate in cytokine production between TCM and effector memory T cells. In patients with cutaneous T cell lymphoma, malignant TCM and TMM induced distinct inflammatory skin lesions, and TMM were depleted more slowly from skin after alemtuzumab, suggesting that TMM may recirculate more slowly. In summary, human skin is protected by four functionally distinct populations of T cells, two resident and two recirculating, with differing territories of migration and distinct functional activities. Copyright © 2015, American Association for the Advancement of Science.
Schmidt-Hieber, Martin; Schwender, Julie; Heinz, Werner J.; Zabelina, Tatjana; Kühl, Jörn S.; Mousset, Sabine; Schüttrumpf, Silke; Junghanss, Christian; Silling, Gerda; Basara, Nadezda; Neuburger, Stefan; Thiel, Eckhard; Blau, Igor W.
2011-01-01
Background Limited data are available on characteristics of viral encephalitis in patients after allogeneic stem cell transplantation. Design and Methods We analyzed 2,628 patients after allogeneic stem cell transplantation to identify risk factors and characteristics of viral encephalitis. Results Viral encephalitis occurred in 32 patients (1.2%, 95% confidence interval 0.8%–1.6%) and was associated with the use of OKT-3 or alemtuzumab for T-cell depletion (P<0.001) and an increased mortality (P=0.011) in comparison to patients without viral encephalitis. Detected viruses included human herpesvirus-6 (28%), Epstein-Barr virus (19%), herpes simplex virus (13%), JC virus (9%), varicella zoster virus (6%), cytomegalovirus (6%) and adenovirus (3%). More than one virus was identified in 16% of the patients. The median onset time was 106 days after allogeneic stem cell transplantation for the total group of 32 patients, but onset times were shortest in those with human herpesvirus-6 encephalitis and longest in those with JC virus-associated progressive multifocal leukoencephalopathy. The probability of a sustained response to treatment was 63% (95% confidence interval 44%–82%) with a median survival of 94 (95% confidence interval 36–152) days after onset, but significant variation was found when considering different causative viruses. Patients with herpes simplex virus encephalitis had the most favorable outcome with no encephalitis-related deaths. Conclusions The use of OKT-3 or alemtuzumab for in vivo T-cell depletion is associated with an increased risk of viral encephalitis after allogeneic stem cell transplantation. Different viruses are frequently associated with distinct characteristics such as onset time, response to treatment and outcome. PMID:20851868
Tenofovir-induced kidney injury.
Gitman, Michael D; Hirschwerk, David; Baskin, Cindy H; Singhal, Pravin C
2007-03-01
Tenofovir disoproxil fumarate is a nucleotide reverse transcriptase inhibitor with activity against both HIV and the hepatitis B virus. It has had minimal nephrotoxic effects in early clinical trials, but as clinical use has widened, case reports describing tenofovir-induced renal tubular damage, Fanconi's syndrome and diabetes insipidus have been described. The authors review the pharmacokinetics, mechanism of action and clinical uses of tenofovir disoproxil fumarate. The large clinical trials, as well as the case reports of tenofovir-induced kidney injury, are also reviewed. The potential mechanism of renal damage is discussed and recommendations for evaluation and treatment of tenofovir-induced kidney injury are given.
Gupta, Samir K; McComsey, Grace A; Lombaard, John; Echevarría, Juan; Orrell, Catherine; Avihingsanon, Anchalee; Osiyemi, Olayemi; Santoscoy, Mario; Ray, Neelanjana; Stock, David A; Joshi, Samit R; Hanna, George J; Lataillade, Max
2016-01-01
BMS-986001 is a thymidine analogue nucleoside reverse transcriptase inhibitor (NRTI) designed to maintain in-vitro antiviral activity while minimising off-target effects. We assessed the efficacy and safety of BMS-986001 versus tenofovir disoproxil fumarate in treatment-naive patients with HIV-1. In this phase 2b, randomised, active-controlled trial (AI467003), we recruited treatment-naive (no current or previous exposure to an antiretroviral drug for >1 week) adults (aged at least 18 years) with HIV-1 from 47 sites across Asia, Australia, Europe, North America, South Africa, and South America. Patients with plasma HIV-1 RNA greater than 5000 copies per mL and CD4 counts greater than 200 cells per μL were randomly assigned (2:2:2:3) to receive BMS-986001 100 mg, 200 mg, or 400 mg once a day or to receive tenofovir disoproxil fumarate 300 mg once a day; each allocation was given with efavirenz 600 mg once a day and lamivudine 300 mg once a day. Both patients and investigators were masked to BMS-986001 dose (achieved with similar looking placebo tablets), but not allocation up to and including week 48. The primary endpoints were the proportion of patients with plasma HIV-1 RNA less than 50 copies per mL and safety events (serious adverse events and adverse events leading to discontinuation) through week 24; the main analysis was with a modified intention-to-treat population. Resistance analysis was a secondary endpoint, and additional safety parameters were exploratory endpoints. This trial is registered with ClinicalTrials.gov, number NCT01489046, and the European Clinical Trials Database, number EudraCT 2011-003329-89. Patients were recruited between Jan 25, 2012, and Oct 3, 2012; 757 patients were assessed for eligibility and 301 were randomly assigned to receive either BMS-986001 once a day (67 patients to 100 mg, 67 to 200 mg, and 66 to 400 mg) or tenofovir disoproxil fumarate (n=101). 297 patients received at least one dose of study drug. At week 24, 57 (88