Grossi, Vincent; Cravo-Laureau, Cristiana; Méou, Alain; Raphel, Danielle; Garzino, Frédéric; Hirschler-Réa, Agnès
2007-12-01
The alkane- and alkene-degrading, marine sulfate-reducing bacterium Desulfatibacillum aliphaticivorans strain CV2803(T), known to oxidize n-alkanes anaerobically by fumarate addition at C-2, was investigated for its 1-alkene metabolism. The total cellular fatty acids of this strain were predominantly C-(even number) (C-even) when it was grown on C-even 1-alkenes and predominantly C-(odd number) (C-odd) when it was grown on C-odd 1-alkenes. Detailed analyses of those fatty acids by gas chromatography-mass spectrometry after 6- to 10-week incubations allowed the identification of saturated 2- and 4-ethyl-, 2- and 4-methyl-, and monounsaturated 4-methyl-branched fatty acids with chain lengths that correlated with those of the 1-alkene. The growth of D. aliphaticivorans on (per)deuterated 1-alkenes provided direct evidence of the anaerobic transformation of these alkenes into the corresponding 1-alcohols and into linear as well as 10- and 4-methyl-branched fatty acids. Experiments performed with [(13)C]bicarbonate indicated that the initial activation of 1-alkene by the addition of inorganic carbon does not occur. These results demonstrate that D. aliphaticivorans metabolizes 1-alkene by the oxidation of the double bond at C-1 and by the subterminal addition of organic carbon at both ends of the molecule [C-2 and C-(omega-1)]. The detection of ethyl-branched fatty acids from unlabeled 1-alkenes further suggests that carbon addition also occurs at C-3. Alkylsuccinates were not observed as potential initial intermediates in alkene metabolism. Based on our observations, the first pathways for anaerobic 1-alkene metabolism in an anaerobic bacterium are proposed. Those pathways indicate that diverse initial reactions of 1-alkene activation can occur simultaneously in the same strain of sulfate-reducing bacterium.
Grossi, Vincent; Cravo-Laureau, Cristiana; Méou, Alain; Raphel, Danielle; Garzino, Frédéric; Hirschler-Réa, Agnès
2007-01-01
The alkane- and alkene-degrading, marine sulfate-reducing bacterium Desulfatibacillum aliphaticivorans strain CV2803T, known to oxidize n-alkanes anaerobically by fumarate addition at C-2, was investigated for its 1-alkene metabolism. The total cellular fatty acids of this strain were predominantly C-(even number) (C-even) when it was grown on C-even 1-alkenes and predominantly C-(odd number) (C-odd) when it was grown on C-odd 1-alkenes. Detailed analyses of those fatty acids by gas chromatography-mass spectrometry after 6- to 10-week incubations allowed the identification of saturated 2- and 4-ethyl-, 2- and 4-methyl-, and monounsaturated 4-methyl-branched fatty acids with chain lengths that correlated with those of the 1-alkene. The growth of D. aliphaticivorans on (per)deuterated 1-alkenes provided direct evidence of the anaerobic transformation of these alkenes into the corresponding 1-alcohols and into linear as well as 10- and 4-methyl-branched fatty acids. Experiments performed with [13C]bicarbonate indicated that the initial activation of 1-alkene by the addition of inorganic carbon does not occur. These results demonstrate that D. aliphaticivorans metabolizes 1-alkene by the oxidation of the double bond at C-1 and by the subterminal addition of organic carbon at both ends of the molecule [C-2 and C-(ω-1)]. The detection of ethyl-branched fatty acids from unlabeled 1-alkenes further suggests that carbon addition also occurs at C-3. Alkylsuccinates were not observed as potential initial intermediates in alkene metabolism. Based on our observations, the first pathways for anaerobic 1-alkene metabolism in an anaerobic bacterium are proposed. Those pathways indicate that diverse initial reactions of 1-alkene activation can occur simultaneously in the same strain of sulfate-reducing bacterium. PMID:17965214
48 CFR 2803.101-3 - Agency regulations.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Agency regulations. 2803.101-3 Section 2803.101-3 Federal Acquisition Regulations System DEPARTMENT OF JUSTICE GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.101-3 Agency regulations. The DOJ...
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Remedies. 2803.906 Section 2803.906 Federal Acquisition Regulations System DEPARTMENT OF JUSTICE GENERAL IMPROPER BUSINESS... Remedies. (a) Upon determination that a contractor has subjected one of its employees to a reprisal for...
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Remedies. 2803.906 Section 2803.906 Federal Acquisition Regulations System DEPARTMENT OF JUSTICE General IMPROPER BUSINESS... Remedies. (a) Upon determination that a contractor has subjected one of its employees to a reprisal for...
10 CFR 2.803 - Determination of petition.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Determination of petition. 2.803 Section 2.803 Energy... Rulemaking § 2.803 Determination of petition. No hearing will be held on the petition unless the Commission... of proposed rulemaking. In any other case, it will deny the petition and will notify the petitioner...
Mollex, Damien; Vinçon-Laugier, Arnauld; Hakil, Florence; Pacton, Muriel; Cravo-Laureau, Cristiana
2015-01-01
Bacterial glycerol ether lipids (alkylglycerols) have received increasing attention during the last decades, notably due to their potential role in cell resistance or adaptation to adverse environmental conditions. Major uncertainties remain, however, regarding the origin, biosynthesis, and modes of formation of these uncommon bacterial lipids. We report here the preponderance of monoalkyl- and dialkylglycerols (1-O-alkyl-, 2-O-alkyl-, and 1,2-O-dialkylglycerols) among the hydrolyzed lipids of the marine mesophilic sulfate-reducing proteobacterium Desulfatibacillum alkenivorans PF2803T grown on n-alkenes (pentadec-1-ene or hexadec-1-ene) as the sole carbon and energy source. Alkylglycerols account for one-third to two-thirds of the total cellular lipids (alkylglycerols plus acylglycerols), depending on the growth substrate, with dialkylglycerols contributing to one-fifth to two-fifths of the total ether lipids. The carbon chain distribution of the lipids of D. alkenivorans also depends on that of the substrate, but the chain length and methyl-branching patterns of fatty acids and monoalkyl- and dialkylglycerols are systematically congruent, supporting the idea of a biosynthetic link between the three classes of compounds. Vinyl ethers (1-alken-1′-yl-glycerols, known as plasmalogens) are not detected among the lipids of strain PF2803T. Cultures grown on different (per)deuterated n-alkene, n-alkanol, and n-fatty acid substrates further demonstrate that saturated alkylglycerols are not formed via the reduction of hypothetic alken-1′-yl intermediates. Our results support an unprecedented biosynthetic pathway to monoalkyl/monoacyl- and dialkylglycerols in anaerobic bacteria and suggest that n-alkyl compounds present in the environment can serve as the substrates for supplying the building blocks of ether phospholipids of heterotrophic bacteria. PMID:25724965
46 CFR 280.3 - Standards governing award of an ODS agreement.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Standards governing award of an ODS agreement. 280.3 Section 280.3 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING... LINER OPERATORS § 280.3 Standards governing award of an ODS agreement. No ODS agreement, including any...
48 CFR 970.2803-1 - Workers' Compensation Insurance.
Code of Federal Regulations, 2013 CFR
2013-10-01
... Management, within the Headquarters procurement organization, other officials, and the Heads of Contracting... Office of Resource Management, within the Headquarters procurement organization, is responsible for... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Bonds and Insurance 970.2803-1 Workers...
48 CFR 970.2803-1 - Workers' Compensation Insurance.
Code of Federal Regulations, 2010 CFR
2010-10-01
... Management, within the Headquarters procurement organization, other officials, and the Heads of Contracting... Office of Resource Management, within the Headquarters procurement organization, is responsible for... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Bonds and Insurance 970.2803-1 Workers...
48 CFR 970.2803-1 - Workers' Compensation Insurance.
Code of Federal Regulations, 2011 CFR
2011-10-01
... Management, within the Headquarters procurement organization, other officials, and the Heads of Contracting... Office of Resource Management, within the Headquarters procurement organization, is responsible for... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Bonds and Insurance 970.2803-1 Workers...
48 CFR 970.2803-1 - Workers' Compensation Insurance.
Code of Federal Regulations, 2012 CFR
2012-10-01
... Management, within the Headquarters procurement organization, other officials, and the Heads of Contracting... Office of Resource Management, within the Headquarters procurement organization, is responsible for... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Bonds and Insurance 970.2803-1 Workers...
48 CFR 970.2803-1 - Workers' Compensation Insurance.
Code of Federal Regulations, 2014 CFR
2014-10-01
... Management, within the Headquarters procurement organization, other officials, and the Heads of Contracting... Office of Resource Management, within the Headquarters procurement organization, is responsible for... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Bonds and Insurance 970.2803-1 Workers...
48 CFR 2803.104-10 - Violations or possible violations.
Code of Federal Regulations, 2010 CFR
2010-10-01
... General IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-10 Violations... action to be taken. The types of actions that would normally be taken when a violation has occurred that...
30 CFR 280.3 - What requirements must I follow when I conduct prospecting or research activities?
Code of Federal Regulations, 2010 CFR
2010-07-01
... research activities? You must conduct G&G prospecting activities or scientific research activities under... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I follow when I conduct prospecting or research activities? 280.3 Section 280.3 Mineral Resources MINERALS MANAGEMENT SERVICE...
30 CFR 280.3 - What requirements must I follow when I conduct prospecting or research activities?
Code of Federal Regulations, 2011 CFR
2011-07-01
... when I conduct prospecting or research activities? You must conduct G&G prospecting activities or scientific research activities under this part according to: (a) The Act; (b) The regulations in this part... prospecting or research activities? 280.3 Section 280.3 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT...
48 CFR 2803.104-70 - Ethics program training requirements.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Ethics program training... GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-70 Ethics... should be coordinated with the Department's Ethics Official, who is responsible for developing agency...
48 CFR 2803.104-70 - Ethics program training requirements.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Ethics program training... General IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-70 Ethics... should be coordinated with the Department's Ethics Official, who is responsible for developing agency...
48 CFR 2803.104-70 - Ethics program training requirements.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Ethics program training... GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-70 Ethics... should be coordinated with the Department's Ethics Official, who is responsible for developing agency...
48 CFR 2803.104-70 - Ethics program training requirements.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Ethics program training... GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-70 Ethics... should be coordinated with the Department's Ethics Official, who is responsible for developing agency...
48 CFR 2803.104-70 - Ethics program training requirements.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Ethics program training... GENERAL IMPROPER BUSINESS PRACTICES AND PERSONAL CONFLICTS OF INTEREST Safeguards 2803.104-70 Ethics... should be coordinated with the Department's Ethics Official, who is responsible for developing agency...
34 CFR 280.3 - What regulations apply to this program?
Code of Federal Regulations, 2012 CFR
2012-07-01
... SECONDARY EDUCATION, DEPARTMENT OF EDUCATION MAGNET SCHOOLS ASSISTANCE PROGRAM General § 280.3 What regulations apply to this program? The following regulations apply to the Magnet Schools Assistance Program... Department of Education programs and activities), 80 (Uniform Administrative Requirements for Grants and...
34 CFR 280.3 - What regulations apply to this program?
Code of Federal Regulations, 2010 CFR
2010-07-01
... SECONDARY EDUCATION, DEPARTMENT OF EDUCATION MAGNET SCHOOLS ASSISTANCE PROGRAM General § 280.3 What regulations apply to this program? The following regulations apply to the Magnet Schools Assistance Program... Department of Education programs and activities), 80 (Uniform Administrative Requirements for Grants and...
34 CFR 280.3 - What regulations apply to this program?
Code of Federal Regulations, 2013 CFR
2013-07-01
... SECONDARY EDUCATION, DEPARTMENT OF EDUCATION MAGNET SCHOOLS ASSISTANCE PROGRAM General § 280.3 What regulations apply to this program? The following regulations apply to the Magnet Schools Assistance Program... Department of Education programs and activities), 80 (Uniform Administrative Requirements for Grants and...
34 CFR 280.3 - What regulations apply to this program?
Code of Federal Regulations, 2014 CFR
2014-07-01
... SECONDARY EDUCATION, DEPARTMENT OF EDUCATION MAGNET SCHOOLS ASSISTANCE PROGRAM General § 280.3 What regulations apply to this program? The following regulations apply to the Magnet Schools Assistance Program... Department of Education programs and activities), 80 (Uniform Administrative Requirements for Grants and...
34 CFR 280.3 - What regulations apply to this program?
Code of Federal Regulations, 2011 CFR
2011-07-01
... SECONDARY EDUCATION, DEPARTMENT OF EDUCATION MAGNET SCHOOLS ASSISTANCE PROGRAM General § 280.3 What regulations apply to this program? The following regulations apply to the Magnet Schools Assistance Program... Department of Education programs and activities), 80 (Uniform Administrative Requirements for Grants and...
Information Hiding In Digital Video Using DCT, DWT and CvT
NASA Astrophysics Data System (ADS)
Abed Shukur, Wisam; Najah Abdullah, Wathiq; Kareem Qurban, Luheb
2018-05-01
The type of video that used in this proposed hiding a secret information technique is .AVI; the proposed technique of a data hiding to embed a secret information into video frames by using Discrete Cosine Transform (DCT), Discrete Wavelet Transform (DWT) and Curvelet Transform (CvT). An individual pixel consists of three color components (RGB), the secret information is embedded in Red (R) color channel. On the receiver side, the secret information is extracted from received video. After extracting secret information, robustness of proposed hiding a secret information technique is measured and obtained by computing the degradation of the extracted secret information by comparing it with the original secret information via calculating the Normalized cross Correlation (NC). The experiments shows the error ratio of the proposed technique is (8%) while accuracy ratio is (92%) when the Curvelet Transform (CvT) is used, but compared with Discrete Wavelet Transform (DWT) and Discrete Cosine Transform (DCT), the error rates are 11% and 14% respectively, while the accuracy ratios are (89%) and (86%) respectively. So, the experiments shows the Poisson noise gives better results than other types of noises, while the speckle noise gives worst results compared with other types of noises. The proposed technique has been established by using MATLAB R2016a programming language.
Genome-wide analyses of HTLV-1aD strains from Cape Verde, Africa.
Zanella, Louise; Pina-Araujo I, Isabel de; Morgado, Mariza G; Vicente, Ana Carolina
2016-09-01
We characterised and reported the first full-length genomes of Human T-cell Lymphotropic Virus Type 1 subgroup HTLV-1aD (CV21 and CV79). This subgroup is one of the major determinants of HTLV-1 infections in North and West Africa, and recombinant strains involving this subgroup have been recently demonstrated. The CV21 and CV79 strains from Cape Verde/Africa were characterised as pure HTLV-1aD genomes, comparative analyses including HTLV-1 subtypes and subgroups revealed HTLV-1aD signatures in the envelope, pol, and pX regions. These genomes provide original information that will contribute to further studies on HTLV-1a epidemiology and evolution.
2012-01-01
Background Switchgrass is one of the most promising bioenergy crop candidates for the US. It gives relatively high biomass yield and can grow on marginal lands. However, its yields vary from year to year and from location to location. Thus it is imperative to develop a low input and sustainable switchgrass feedstock production system. One of the most feasible ways to increase biomass yields is to harness benefits of microbial endophytes. Results We demonstrate that one of the most studied plant growth promoting bacterial endophytes, Burkholderia phytofirmans strain PsJN, is able to colonize and significantly promote growth of switchgrass cv. Alamo under in vitro, growth chamber, and greenhouse conditions. In several in vitro experiments, the average fresh weight of PsJN-inoculated plants was approximately 50% higher than non-inoculated plants. When one-month-old seedlings were grown in a growth chamber for 30 days, the PsJN-inoculated Alamo plants had significantly higher shoot and root biomass compared to controls. Biomass yield (dry weight) averaged from five experiments was 54.1% higher in the inoculated treatment compared to non-inoculated control. Similar results were obtained in greenhouse experiments with transplants grown in 4-gallon pots for two months. The inoculated plants exhibited more early tillers and persistent growth vigor with 48.6% higher biomass than controls. We also found that PsJN could significantly promote growth of switchgrass cv. Alamo under sub-optimal conditions. However, PsJN-mediated growth promotion in switchgrass is genotype specific. Conclusions Our results show B. phytofirmans strain PsJN significantly promotes growth of switchgrass cv. Alamo under different conditions, especially in the early growth stages leading to enhanced production of tillers. This phenomenon may benefit switchgrass establishment in the first year. Moreover, PsJN significantly stimulated growth of switchgrass cv. Alamo under sub-optimal conditions
Wehbe, Michel; Huguenin, Antoine; Leveque, Nicolas; Semler, Bert L; Hamze, Monzer; Andreoletti, Laurent; Bouin, Alexis
2016-04-01
Coxsackieviruses B (CV-B) (Picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (DCM) cases. The mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the DCM clinical stage are not fully understood but are influenced by both viral and host factors. Subgenomic replicons of CV-B can be used to assess viral replication mechanisms in human cardiac cells and evaluate the effects of potential antiviral drugs on viral replication activities. Our objectives were to generate a reporter replicon from a cardiotropic prototype CV-B3/28 strain and to characterize its replication properties into human cardiac primary cells. To obtain this replicon, a cDNA plasmid containing the full CV-B3/28 genome flanked by a hammerhead ribozyme sequence and an MluI restriction site was generated and used as a platform for the insertion of sequences encoding emerald green fluorescent protein (EmGFP) in place of those encoding VP3. In vitro transcribed RNA from this plasmid was transfected into HeLa cells and human primary cardiac cells and was able to produce EmGFP and VP1-containing polypeptides. Moreover, non-structural protein biological activity was assessed by the specific cleavage of eIF4G1 by viral 2A(pro). Viral RNA replication was indirectly demonstrated by inhibition assays, fluoxetine was added to cell culture and prevented the EmGFP synthesis. Our results indicated that the EmGFP CV-B3 replicon was able to replicate and translate as well as the CV-B3/28 prototype strain. Our EmGFP CV-B3 replicon will be a valuable tool to readily investigate CV-B3 replication activities in human target cell models. Copyright © 2016 Elsevier B.V. All rights reserved.
Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice; Grasland, Béatrice; Frossard, Jean-Pierre; Dastjerdi, Akbar; Hulst, Marcel; Hanke, Dennis; Pohlmann, Anne; Blome, Sandra; van der Poel, Wim H. M.; Steinbach, Falko; Blanchard, Yannick; Lavazza, Antonio; Bøtner, Anette
2018-01-01
Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence (Accession number AF353511) but they are >99% identical. Unique and shared differences between sequences were identified. The coding region for the surface-exposed spike protein showed the highest proportion of variability including both point mutations and small deletions. The predicted expression of the ORF3 gene product was more dramatically affected in three different variants of this virus through either loss of the initiation codon or gain of a premature termination codon. The genome of one isolate had a substantially rearranged 5´-terminal sequence. This rearrangement was validated through the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies. PMID:29494671
Martínez-Hidalgo, Pilar; Ramírez-Bahena, Martha Helena; Flores-Félix, José David; Rivas, Raúl; Igual, José M; Mateos, Pedro F; Martínez-Molina, Eustoquio; León-Barrios, Milagros; Peix, Álvaro; Velázquez, Encarna
2015-06-01
The species Mesorhizobim loti was isolated from nodules of Lotus corniculatus and its type strain deposited in several collections. Some of these type strains, such as those deposited in the USDA and ATCC collections before 1990, are not coincident with the original strain, NZP 2213T, deposited in the NZP culture collection. The analysis of the 16S rRNA gene showed that strains USDA 3471T and ATCC 33669T formed independent branches from that occupied by Mesorhizobium loti NZP 2213T and related to those occupied by Mesorhizobium opportunistum WSM2075T and Mesorhizobium huakuii IFO 15243T, respectively, with 99.9 % similarity in both cases. However, the analysis of concatenated recA, atpD and glnII genes with similarities lower than 96, 98 and 94 %, respectively, between strains USDA 3471T and M. opportunistum WSM2075T and between strains ATCC 33669T and M. huakuii IFO 15243T, indicated that the strains USDA 3471T and ATCC 33669T represent different species of the genus Mesorhizobium. These results were confirmed by DNA-DNA hybridization experiments and phenotypic characterization. Therefore, the two strains were reclassified as representatives of the two species Mesorhizobium erdmanii sp. nov. (type strain USDA 3471T = CECT 8631T = LMG 17826t2T) and Mesorhizobium jarvisii sp. nov. (type strain ATCC 33669T = CECT 8632T = LMG 28313T).
Li, Xingchen; Cao, Lin; Li, Shaohua; Wang, Ranran; Jiang, Zijing; Che, Zhenming; Lin, Hongbin
2017-01-01
“Hayward” kiwifruit (Actinidia deliciosa cv.), widely planted all around the world, were fermented with six different commercial Saccharomyces cerevisiae strains (BM4×4, RA17, RC212, WLP77, JH-2, and CR476) to reveal their influence on the phenolic profiles, antioxidant activity, and aromatic components. Significant differences in the levels of caffeic acid, protocatechuate, and soluble solid content were found among wines with the six fermented strains. Wines fermented with RC212 strain exhibited the highest total phenolic acids as well as DPPH radical scavenging ability and also had the strongest ability to produce volatile esters. Wines made with S. cerevisiae BM 4×4 had the highest content of volatile acids, while the highest alcohol content was presented in CR476 wines. Scoring spots of wines with these strains were separated in different quadrants on the components of phenolics and aromas by principal component analyses. Kiwifruit wines made with S. cerevisiae RC212 were characterized by a rich fruity flavor, while CR476 strain and WLP77 strain produced floral flavors and green aromas, respectively. Altogether, the results indicated that the use of S. cerevisiae RC212 was the most suitable for the fermentation of kiwifruit wine with desirable characteristics. PMID:28251154
Yu, Jiang; Guan, Xuejiao; Liu, Chongxi; Xiang, Wensheng; Yu, Zhenhua; Liu, Xiaobing; Wang, Guanghua
2016-10-01
A Gram-positive, aerobic, motile, rod-shaped bacterium, designated strain C9(T), was isolated from surface sterilised corn roots (Zea mays cv. Xinken-5) and found to be able to produce indole-3-acetic acid. A polyphasic taxonomic study was carried out to determine the status of strain C9(T). The major cellular fatty acids were found to contain iso-C15:0, anteiso-C15:0 and anteiso-C17:0, and the only menaquinone was identified as MK-7. The polar lipid profile was found to contain diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, two unidentified phospholipids and an unidentified lipid. The cell wall peptidoglycan was found to be of the A4α L-Lys-D-Asp type and the whole cell sugar was found to be glucose. Phylogenetic analysis based on the 16S rRNA gene sequence showed that strain C9(T) belongs to the genus Lysinibacillus and is closely related to Lysinibacillus chungkukjangi NBRC 108948(T) (98.1 % similarity) and Lysinibacillus sinduriensis DSM 27595(T) (98.0 %). However, the low levels of DNA-DNA relatedness and some differential phenotypic characteristics allowed the strain to be distinguished from its close relatives. Therefore, it is concluded that strain C9(T) represents a novel species of the genus Lysinibacillus, for which the name Lysinibacillus endophyticus sp. nov. is proposed. The type strain is C9(T) (=DSM 100506(T) = CGMCC 1.15291(T)).
Genome sequences of Alicycliphilus denitrificans strain BC and K601(T)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oosterkamp, Margreet J.; Veuskens, Teun; Plugge, Caroline M.
2011-01-01
Alicycliphilus denitrificans strain BC and A. denitrificans strain K601T degrade cyclic hydrocarbons. These strains have been isolated from a mixture of wastewater treatment plant material and benzene-polluted soil and from a wastewater treatment plant, respectively, suggesting their role in bioremediation of soil and water. Although the strains are phylogenetically closely related, there are some clear physiological differences. The hydrocarbon cyclohexanol, for example, can be degraded by strain K601T but not by strain BC. Furthermore, both strains can use nitrate and oxygen as an electron acceptor, but only strain BC can use chlorate as electron acceptor. To better understand the nitratemore » and chlorate reduction mechanisms coupled to the oxidation of cyclic compounds, the genomes of A. denitrificans strains BC and K601T were sequenced. Here, we report the complete genome sequences of A. denitrificans strains BC and K601T.« less
Electronic and phononic modulation of MoS2 under biaxial strain
NASA Astrophysics Data System (ADS)
Moghadasi, A.; Roknabadi, M. R.; Ghorbani, S. R.; Modarresi, M.
2017-12-01
Dichalcogenides of transition metals are attractive material due to its unique properties. In this work, it has been investigated the electronic band structure, phonon spectrum and heat capacity of MoS2 under the applied tensile and compressive biaxial strain using the density functional theory. The Molybdenum disulfide under compressive (tensile) strain up to 6% (10%) has stable atomic structure without any negative frequency in the phonon dispersion curves. The tensile biaxial strain reduces the energy gap in the electronic band structure and the optical-acoustic gap in phonon dispersion curves. The tensile biaxial strain also increases the specific heat capacity. On the other hand, the compressive biaxial strain in this material increases phonon gap and reduces the heat capacity and the electronic band gap. The phonon softening/hardening is reported for tensile/compressive biaxial strain in MoS2. We report phonon hardening for out of plane ZA mode in the presence of both tensile and compressive strains. Results show that the linear variation of specific heat with strain (CV ∝ε) and square dependency of specific heat with the temperature (CV ∝T2) for low temperature regime. The results demonstrate that the applied biaxial strain tunes the electronic energy gap and modifies the phonon spectrum of MoS2.
[Habitat factor analysis for Torreya grandis cv. Merrillii based on spatial information technology].
Wang, Xiao-ming; Wang, Ke; Ao, Wei-jiu; Deng, Jin-song; Han, Ning; Zhu, Xiao-yun
2008-11-01
Torreya grandis cv. Merrillii, a tertiary survival plant, is a rare tree species of significant economic value and expands rapidly in China. Its special habitat factor analysis has the potential value to provide guide information for its planting, management, and sustainable development, because the suitable growth conditions for this tree species are special and strict. In this paper, the special habitat factors for T. grandis cv. Merrillii in its core region, i.e., in seven villages of Zhuji City, Zhejiang Province were analyzed with Principal Component Analysis (PCA) and a series of data, such as IKONOS image, Digital Elevation Model (DEM), and field survey data supported by the spatial information technology. The results showed that T. grandis cv. Merrillii exhibited high selectivity of environmental factors such as elevation, slope, and aspect. 96.22% of T. grandis cv. Merrillii trees were located at the elevation from 300 to 600 m, 97.52% of them were found to present on the areas whose slope was less than 300, and 74.43% of them distributed on sunny and half-sunny slopes. The results of PCA analysis indicated that the main environmental factors affecting the habitat of T. grandis cv. Merrillii were moisture, heat, and soil nutrients, and moisture might be one of the most important ecological factors for T. grandis cv. Merrillii due to the unique biological and ecological characteristics of the tree species.
Frank, Oliver; Pradella, Silke; Rohde, Manfred; Scheuner, Carmen; Klenk, Hans-Peter; Göker, Markus; Petersen, Jörn
2014-06-15
Phaeobacter gallaeciensis CIP 105210(T) (= DSM 26640(T) = BS107(T)) is the type strain of the species Phaeobacter gallaeciensis. The genus Phaeobacter belongs to the marine Roseobacter group (Rhodobacteraceae, Alphaproteobacteria). Phaeobacter species are effective colonizers of marine surfaces, including frequent associations with eukaryotes. Strain BS107(T) was isolated from a rearing of the scallop Pecten maximus. Here we describe the features of this organism, together with the complete genome sequence, comprising eight circular replicons with a total of 4,448 genes. In addition to a high number of extrachromosomal replicons, the genome contains six genomic island and three putative prophage regions, as well as a hybrid between a plasmid and a circular phage. Phylogenomic analyses confirm previous results, which indicated that the originally reported P. gallaeciensis type-strain deposit DSM 17395 belongs to P. inhibens and that CIP 105210(T) (= DSM 26640(T)) is the sole genome-sequenced representative of P. gallaeciensis.
Reclassification of strains MAFF 303099T and R7A into Mesorhizobiumjaponicum sp. nov.
Martínez-Hidalgo, Pilar; Ramírez-Bahena, Martha Helena; Flores-Félix, José David; Igual, José M; Sanjuán, Juan; León-Barrios, Milagros; Peix, Alvaro; Velázquez, Encarna
2016-12-01
In this work we revise the taxonomic status of the Lotus-nodulating strains MAFF 303099T and R7A isolated in Japan and New Zealand, respectively. Their 16S rRNA gene sequences are identical and show 98.0, 99.7, 99.8 and 99.9 % similarity values with respect to Mesorhizobium loti NZP 2213T, M. jarvisii ATCC 33669T, M. huakuii USDA 4779T (=CCBAU 2609T) and M. erdmanii USDA 3471T, respectively. The analysis of recA and glnII gene sequeces showed that M. jarvisii ATCC 33669T and M. huakuii USDA 4779T (=CCBAU 2609T) are the most closely related strains to MAFF 303099T and R7A, with similarity values suggesting that these two strains belong to a different species for which MAFF 303099T is selected as the type strain. The DNA-DNA relatedness values between strain MAFF 303099T and its closest phylogenetic relatives ranged from 53 to 60 % in average. Strains MAFF 303099T and R7A presented slight differences in the proportions of C18 : 1ω7c 11-methyl and C19 : 0 cyclo ω8c fatty acids with respect to M. jarvisii ATCC 33669T and M. huakuii USDA 4779T, and also in several phenotypic characteristics. Therefore, we propose the reclassification of these two strains into a novel species named Mesorhizobium japonicum sp. nov., with the type strain being MAFF 303099T (=LMG 29417T=CECT 9101T).
Genome Analysis and Physiological Comparison of Alicycliphilus denitrificans Strains BC and K601T
Talarico Saia, Flávia; Weelink, Sander A. B.; Goodwin, Lynne A.; Daligault, Hajnalka E.; Bruce, David C.; Detter, John C.; Tapia, Roxanne; Han, Cliff S.; Land, Miriam L.; Hauser, Loren J.; Langenhoff, Alette A. M.; Gerritse, Jan; van Berkel, Willem J. H.; Pieper, Dietmar H.; Junca, Howard; Smidt, Hauke; Schraa, Gosse; Davids, Mark; Schaap, Peter J.; Plugge, Caroline M.; Stams, Alfons J. M.
2013-01-01
The genomes of the Betaproteobacteria Alicycliphilus denitrificans strains BC and K601T have been sequenced to get insight into the physiology of the two strains. Strain BC degrades benzene with chlorate as electron acceptor. The cyclohexanol-degrading denitrifying strain K601T is not able to use chlorate as electron acceptor, while strain BC cannot degrade cyclohexanol. The 16S rRNA sequences of strains BC and K601T are identical and the fatty acid methyl ester patterns of the strains are similar. Basic Local Alignment Search Tool (BLAST) analysis of predicted open reading frames of both strains showed most hits with Acidovorax sp. JS42, a bacterium that degrades nitro-aromatics. The genomes include strain-specific plasmids (pAlide201 in strain K601T and pAlide01 and pAlide02 in strain BC). Key genes of chlorate reduction in strain BC were located on a 120 kb megaplasmid (pAlide01), which was absent in strain K601T. Genes involved in cyclohexanol degradation were only found in strain K601T. Benzene and toluene are degraded via oxygenase-mediated pathways in both strains. Genes involved in the meta-cleavage pathway of catechol are present in the genomes of both strains. Strain BC also contains all genes of the ortho-cleavage pathway. The large number of mono- and dioxygenase genes in the genomes suggests that the two strains have a broader substrate range than known thus far. PMID:23825601
Genome analysis and physiological comparison of Alicycliphilus denitrificans strains BC and K601T
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oosterkamp, Margreet J.; Veuskens, Teun; Saia, Flavia Talarico
2013-01-01
The genomes of the Betaproteobacteria Alicycliphilus denitrificans strains BC and K601T have been sequenced to get insight into the physiology of the two strains. Strain BC degrades benzene with chlorate as electron acceptor. The cyclohexanol-degrading denitrifying strain K601T is not able to use chlorate as electron acceptor, while strain BC cannot degrade cyclohexanol. The 16S rRNA sequences of strains BC and K601T are identical and the fatty acid methyl ester patterns of the strains are similar. Basic Local Alignment Search Tool (BLAST) analysis of predicted open reading frames of both strains showed most hits with Acidovorax sp. JS42, a bacteriummore » that degrades nitro-aromatics. The genomes include strain-specific plasmids (pAlide201 in strain K601T and pAlide01 and pAlide02 in strain BC). Key genes of chlorate reduction in strain BC were located on a 120 kb megaplasmid (pAlide01), which was absent in strain K601T. Genes involved in cyclohexanol degradation were only found in strain K601T. Benzene and toluene are degraded via oxygenase-mediated pathways in both strains. Genes involved in the meta-cleavage pathway of catechol are present in the genomes of both strains. Strain BC also contains all genes of the ortho-cleavage pathway. The large number of mono- and dioxygenase genes in the genomes suggests that the two strains have a broader substrate range than known thus far.« less
Fernández Ramírez, Mónica D; Kostopoulos, Ioannis; Smid, Eddy J; Nierop Groot, Masja N; Abee, Tjakko
2017-03-06
Biofilms of Lactobacillus plantarum are a potential source for contamination and recontamination of food products. Although biofilms have been mostly studied using single species or even single strains, it is conceivable that in a range of environmental settings including food processing areas, biofilms are composed of multiple species with each species represented by multiple strains. In this study six spoilage related L. plantarum strains FBR1-FBR6 and the model strain L. plantarum WCFS1 were characterised in single, dual and multiple strain competition models. A quantitative PCR approach was used with added propidium monoazide (PMA) enabling quantification of intact cells in the biofilm, representing the viable cell fraction that determines the food spoilage risk. Our results show that the performance of individual strains in multi-strain cultures generally correlates with their performance in pure culture, and relative strain abundance in multi-strain biofilms positively correlated with the relative strain abundance in suspended (planktonic) cultures. Performance of individual strains in dual-strain biofilms was highly influenced by the presence of the secondary strain, and in most cases no correlation between the relative contributions of viable planktonic cells and viable cells in the biofilm was noted. The total biofilm quantified by CV staining of the dual and multi-strain biofilms formed was mainly correlated to CV values of the dominant strain obtained in single strain studies. However, the combination of strain FBR5 and strain WCFS1 showed significantly higher CV values compared to the individual performances of both strains indicating that total biofilm formation was higher in this specific condition. Notably, L. plantarum FBR5 was able to outgrow all other strains and showed the highest relative abundance in dual and multi-strain biofilms. All the dual and multi-strain biofilms contained a considerable number of viable cells, representing a potential
Electrocardiographic left ventricular strain pattern: everything old is new again.
Schocken, Douglas D
2014-01-01
Electrocardiographic left ventricular hypertrophy (LVH) has many faces with countless features. Beyond the classic measures of LVH, including QRS voltage and duration, the left ventricular (LV) strain pattern is an element whereby characteristic R-ST depression is followed by a concave ST segment that ends in an asymmetrically inverted T wave. The LV strain pattern generally appears in states of increased systemic blood pressure and must be differentiated from similar but not identical ST-T waves indicating ischemia. The LV strain pattern has been found in population studies to be associated with poor prognosis and increased risk of adverse cardiovascular outcomes. Regression of LV strain pattern parallels decline in systemic BP during clinical trials of anti-hypertensive therapies but does not indicate or serve as a surrogate for decrease in LV mass. Newer techniques in data collection and processing may allow the process of strain to be studied in more detail to determine the ways in which electrical remodeling of the left ventricle as characterized by LVH with 'repolarization abnormalities' indicates how CV risk might be managed by using LV strain pattern as an electrocardiographic biomarker. Copyright © 2014 Elsevier Inc. All rights reserved.
Agrobacterium-mediated transformation of Easter lily (Lilium longiflorum cv. Nellie White)
USDA-ARS?s Scientific Manuscript database
Conditions were optimized for transient transformation of Lilium longiflorum cv. Nellie White using Agrobacterium tumefaciens. Bulb scale and basal meristem explants were inoculated with A. tumefaciens strain AGL1 containing the binary vector pCAMBIA 2301 which has the uidA gene that codes for ß-gl...
Draft Genome Sequence of Vibrio mimicus Strain CAIM 602T
Guardiola-Avila, Iliana; Acedo-Felix, Evelia; Yepiz-Plascencia, Gloria; Sifuentes-Romero, Itzel
2013-01-01
Vibrio mimicus is a Gram-negative bacterium associated with gastrointestinal diseases in humans around the world. We report the complete genome sequence of the Vibrio mimicus strain CAIM 602T (CDC1721-77, LMG 7896T, ATCC 33653T). PMID:23516211
In vitro characterization of the Meq proteins of Marek's disease virus vaccine strain CV1988
USDA-ARS?s Scientific Manuscript database
Gallid herpesvirus 2 (GaHV-2), commonly known as Marek’s disease virus serotype-1 (MDV-1), causes T cell lymphoma in chickens. Vaccines prepared from the CVI988/Rispens MDV-1 strain currently offers the best protection. Although, CVI988 is non-oncogenic, it codes for at least two forms of the MDV on...
Yassin, Atteyet F.; Lapidus, Alla; Han, James; ...
2015-08-05
We report that the Corynebacterium ulceribovis strain IMMIB L-1395T (= DSM 45146T) is an aerobic to facultative anaerobic, Gram-positive, non-spore-forming, non-motile rod-shaped bacterium that was isolated from the skin of the udder of a cow, in Schleswig Holstein, Germany. The cell wall of C. ulceribovis contains corynemycolic acids. The cellular fatty acids are those described for the genus Corynebacterium, but tuberculostearic acid is not present. Here we describe the features of C. ulceribovis strain IMMIB L-1395T, together with genome sequence information and its annotation. The 2,300,451 bp long genome containing 2,104 protein-coding genes and 54 RNA-encoding genes and is partmore » of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yassin, Atteyet F.; Lapidus, Alla; Han, James
We report that the Corynebacterium ulceribovis strain IMMIB L-1395T (= DSM 45146T) is an aerobic to facultative anaerobic, Gram-positive, non-spore-forming, non-motile rod-shaped bacterium that was isolated from the skin of the udder of a cow, in Schleswig Holstein, Germany. The cell wall of C. ulceribovis contains corynemycolic acids. The cellular fatty acids are those described for the genus Corynebacterium, but tuberculostearic acid is not present. Here we describe the features of C. ulceribovis strain IMMIB L-1395T, together with genome sequence information and its annotation. The 2,300,451 bp long genome containing 2,104 protein-coding genes and 54 RNA-encoding genes and is partmore » of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.« less
Electronic structure in 1T-ZrS2 monolayer by strain
NASA Astrophysics Data System (ADS)
Xin, Qianqian; Zhao, Xu; Ma, Xu; Wu, Ninghua; Liu, Xiaomeng; Wei, Shuyi
2017-09-01
We report electronic structure of 1T-ZrS2 monolayer with biaxial strain from -10% to 15%, basing the first principles calculations. Our calculation results indicate that the band structure of ZrS2 monolayer was changed clearly. The location of conduction band minimum (CBM) and valence band maximum (VBM) changed with the variation of isotropic strain. At compressive strain, the location of CBM and VBM retains at M and Γ point, respectively. The band gap of ZrS2 monolayer decreases from 1.111 eV to 0 eV when compressive strain increases from 0% to -8%, which means that the ZrS2 monolayer turns to metal at -8% compressive strain. Under the tensile strain, the ZrS2 monolayer also retains be an indirect band gap semiconductor. The location of CBM moves from M to Γ point and the location of VBM moves along Γ-A-K-Γ direction. The band gap of ZrS2 monolayer firstly increases and then decreases and the biggest band gap is 1.577 eV at tensile strain 6%. We can see the compression strain is more effective than tensile strain in modulating band gap of 1T-ZrS2 monolayer.
Development of a multiplex Q-PCR to detect Trichoderma harzianum Rifai strain T22 in plant roots.
Horn, Ivo R; van Rijn, Menno; Zwetsloot, Tom J J; Basmagi, Said; Dirks-Mulder, Anita; van Leeuwen, Willem B; Ravensberg, Willem J; Gravendeel, Barbara
2016-02-01
The fungal species Trichoderma harzianum is widely used as a biological agent in crop protection. To verify the continued presence of this fungus on plant roots manually inoculated with T. harzianum strain T22, a Q-PCR was designed using specific probes for this particular strain. To develop these molecular diagnostic tools, genome mining was first carried out to retrieve putative new regions by which different strains of T. harzianum could be distinguished. Subsequently, Sanger sequencing of the L-aminoacid oxidase gene (aox1) in T. harzianum was applied to determine the mutations differing between various strains isolated from the Trichoderma collection of Koppert Biological Systems. Based on the sequence information obtained, a set of hydrolysis probes was subsequently developed which discriminated T. harzianum T22 strains varying in only a single nucleotide. Probes designed for two strains uniquely recognized the respective strains in Q-PCR with a detection limit of 12,5ng DNA. Titration assays in which T. harzianum DNA from distinct strains was varied further underscored the specificity of the probes. Lastly, fungal DNA extracted from roots of greenhouse cultured tomato plants was analyzed using the probe-based assay. DNA from T. harzianum strain T22 could readily be identified on roots of greenhouse reared tomato plants inoculated with varying concentrations up to one week after treatment with a detection limit of 3e6 colony forming units of T. harzianum T22. We conclude that the Q-PCR method is a reliable and robust method for assessing the presence and quantity of T. harzianum strain T22 in manually inoculated plant material. Our method provides scope for the development of DNA based strain specific identification of additional strains of Trichoderma and other fungal biological control agents. Copyright © 2015 Elsevier B.V. All rights reserved.
Complete genome sequence of Thauera aminoaromatica strain MZ1T
Jiang, Ke; Sanseverino, John; Chauhan, Archana; Lucas, Susan; Copeland, Alex; Lapidus, Alla; Del Rio, Tijana Glavina; Dalin, Eileen; Tice, Hope; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Chang, Y.J.; Larimer, Frank; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Mikhailova, Natalia; Moser, Scott; Jegier, Patricia; Close, Dan; DeBruyn, Jennifer M.; Wang, Ying; Layton, Alice C.; Allen, Michael S.; Sayler, Gary S.
2012-01-01
Thauera aminoaromatica strain MZ1T, an isolate belonging to genus Thauera, of the family Rhodocyclaceae and the class the Betaproteobacteria, has been characterized for its ability to produce abundant exopolysaccharide and degrade various aromatic compounds with nitrate as an electron acceptor. These properties, if fully understood at the genome-sequence level, can aid in environmental processing of organic matter in anaerobic cycles by short-circuiting a central anaerobic metabolite, acetate, from microbiological conversion to methane, a critical greenhouse gas. Strain MZ1T is the first strain from the genus Thauera with a completely sequenced genome. The 4,496,212 bp chromosome and 78,374 bp plasmid contain 4,071 protein-coding and 71 RNA genes, and were sequenced as part of the DOE Community Sequencing Program CSP_776774. PMID:23407619
IJ-OpenCV: Combining ImageJ and OpenCV for processing images in biomedicine.
Domínguez, César; Heras, Jónathan; Pascual, Vico
2017-05-01
The effective processing of biomedical images usually requires the interoperability of diverse software tools that have different aims but are complementary. The goal of this work is to develop a bridge to connect two of those tools: ImageJ, a program for image analysis in life sciences, and OpenCV, a computer vision and machine learning library. Based on a thorough analysis of ImageJ and OpenCV, we detected the features of these systems that could be enhanced, and developed a library to combine both tools, taking advantage of the strengths of each system. The library was implemented on top of the SciJava converter framework. We also provide a methodology to use this library. We have developed the publicly available library IJ-OpenCV that can be employed to create applications combining features from both ImageJ and OpenCV. From the perspective of ImageJ developers, they can use IJ-OpenCV to easily create plugins that use any functionality provided by the OpenCV library and explore different alternatives. From the perspective of OpenCV developers, this library provides a link to the ImageJ graphical user interface and all its features to handle regions of interest. The IJ-OpenCV library bridges the gap between ImageJ and OpenCV, allowing the connection and the cooperation of these two systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Li, Gengmi; Hu, Zonghai; Zeng, Ping; Zhu, Bing; Wu, Lijuan
2015-04-01
Enterobacter ludwigii strain EN-119(T) is the type strain of E. ludwigii, which belongs to the E. cloacae complex (Ecc). This strain was first reported and nominated in 2005 and later been found in many hospitals. In this paper, the whole genome sequencing of this strain was carried out. The total genome size of EN-119(T) is 4952,770 bp with 4578 coding sequences, 88 tRNAs and 10 rRNAs. The genome sequence of EN-119(T) is the first whole genome sequence of E. ludwigii, which will further our understanding of Ecc. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Draft Genome Sequence of Thalassospira xiamenensis Strain MCCC 1A03042T
Li, Meiqing; Yang, Shuo; Lai, Qiliang
2017-01-01
ABSTRACT Thalassospira xiamenensis strain MCCC 1A03042T was isolated from deep-sea sediment of the Indian Ocean, and it was characterized with heavy-metal arsenic tolerance. Here, we present the draft genome of strain MCCC 1A03042T, which contains 4,786,207 bp with a G+C content of 52.6% and 4,359 protein-coding genes. PMID:28254975
Draft Genome Sequence of Thalassospira xiamenensis Strain MCCC 1A03042T.
Li, Meiqing; Yang, Shuo; Lai, Qiliang; Shao, Zongze
2017-03-02
Thalassospira xiamenensis strain MCCC 1A03042 T was isolated from deep-sea sediment of the Indian Ocean, and it was characterized with heavy-metal arsenic tolerance. Here, we present the draft genome of strain MCCC 1A03042 T , which contains 4,786,207 bp with a G+C content of 52.6% and 4,359 protein-coding genes. Copyright © 2017 Li et al.
40 CFR 180.1201 - Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Trichoderma harzianum strain T-39... RESIDUES IN FOOD Exemptions From Tolerances § 180.1201 Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance. Trichoderma harzianum strain T-39 is exempt from the requirement of a...
40 CFR 180.1201 - Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Trichoderma harzianum strain T-39... RESIDUES IN FOOD Exemptions From Tolerances § 180.1201 Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance. Trichoderma harzianum strain T-39 is exempt from the requirement of a...
40 CFR 180.1201 - Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Trichoderma harzianum strain T-39... RESIDUES IN FOOD Exemptions From Tolerances § 180.1201 Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance. Trichoderma harzianum strain T-39 is exempt from the requirement of a...
40 CFR 180.1201 - Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Trichoderma harzianum strain T-39... RESIDUES IN FOOD Exemptions From Tolerances § 180.1201 Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance. Trichoderma harzianum strain T-39 is exempt from the requirement of a...
40 CFR 180.1201 - Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Trichoderma harzianum strain T-39... RESIDUES IN FOOD Exemptions From Tolerances § 180.1201 Trichoderma harzianum strain T-39; exemption from the requirement of a tolerance. Trichoderma harzianum strain T-39 is exempt from the requirement of a...
Draft Genome Sequence of Mycobacterium neoaurum Strain DSM 44074T.
Phelippeau, Michael; Robert, Catherine; Croce, Olivier; Raoult, Didier; Drancourt, Michel
2014-07-10
We report the draft genome sequence of Mycobacterium neoaurum strain DSM 44074(T), a nontuberculosis species responsible for opportunistic infections in immunocompromised patients. The strain described here is composed of 5,536,033 bp, with a G+C content of 66.24%, and carries 5,274 protein-coding genes and 72 RNA genes. Copyright © 2014 Phelippeau et al.
Aliberti, Luigi; Caputo, Lucia; De Feo, Vincenzo; De Martino, Laura; Nazzaro, Filomena; Souza, Lucéia Fátima
2016-09-18
Citrus medica cv. 'liscia' and C. medica cv. 'rugosa' are two taxa of citron, belonging to the biodiversity of South Italy, in particular of Amalfi Coast, in the Campania region. The chemical composition of the essential oils (EOs) from fruit peels of both C. medica cultivars was studied by gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS) analyses. In all, 100 compounds were identified, 82 for C. medica cv. 'liscia', accounting for 91.4% of the total oil, and 88 for C. medica cv. 'rugosa', accounting for 92.0% of the total oil. Monoterpene hydrocarbons are the main constituents in both oils of C. medica cv. 'liscia' (79.1%) and C. medica cv. 'rugosa' (80.2%). In both oils, limonene (67.2%-62.8%) and camphene (8.5%-10.9%) are the main constituents. The antimicrobial activity of the EOs was assayed against some bacterial strains: Bacillus cereus (DSM 4313), Bacillus cereus (DSM 4384), Staphylococcus aureus (DSM 25693), Pseudomonas aeruginosa (ATCC 50071), and Escherichia coli (DSM 8579). Low concentrations of C. medica cv. 'rugosa' EO showed an inhibitory effect on P. aeruginosa and higher concentrations inhibited more B. cereus (4384) and E. coli than S. aureus. The cytotoxicity of the EO was evaluated against SH-SY5Y cell line. The influence of the EO on the expression of adenylate cyclase 1 (ADCY1) was also studied. The antimicrobial activity registered confirm their traditional uses as food preserving agents and led us to hypothesize the possible use of these oils as antimicrobials. The alterations in ADCY1 expression suggested a role for limonene in effects on the central nervous system.
Involvement of Trichoderma asperellum strain T6 in regulating iron acquisition in plants.
Zhao, Lei; Wang, Fei; Zhang, Yaqing; Zhang, Jiaojiao
2014-07-01
Iron (Fe) deficiency is a major plant nutritional disorder in many parts of the world, particularly in areas with saline soils. Among the numerous root-associated microbes that are beneficial for plant nutrient uptake, Trichoderma spp. are the most effective rhizosphere fungi for enhancing plant growth and plant resistance to biotic and abiotic stresses. To investigate the potential mechanisms of action of Trichoderma on insoluble Fe in the soil, which is difficult for plants to absorb and utilize, a high siderophore-producing strain of Trichoderma T6, was isolated from the rhizosphere of cucumber plants. The strain was identified as T. asperellum based on the morphological features and molecular phylogenetic analyses. Applying strain T6 to sterile soil could increase soil levels of Fe(2+) and siderophores, as well as increase Fe(2+) and Fe(3+)-chelate reductase (FCR) activity in cucumber tissues. Purified siderophore eluent (PSE) increased plant growth, thus confirming its role in plant growth promotion. Moreover, extracellular Fe(3+) reducing activity and three kinds of organic acids were detected in the culture filtrate of strain T6. These results indicate that strain T6 influences plant Fe absorption in several ways. Siderophore-based Fe chelation is effective in providing Fe to plants, organic acids, and Fe(3+) reducing enzymes may participate in the solubilization and reduction of insoluble Fe(3+) to Fe(2+). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Extensive T cell cross-reactivity between diverse seasonal influenza strains in the ferret model.
Reber, Adrian J; Music, Nedzad; Kim, Jin Hyang; Gansebom, Shane; Chen, Jufu; York, Ian
2018-04-17
Influenza virus causes widespread, yearly epidemics by accumulating surface protein mutations to escape neutralizing antibodies established from prior exposure. In contrast to antibody epitopes, T cell mediated immunity targets influenza epitopes that are more highly conserved and have potential for cross-protection. The extent of T cell cross-reactivity between a diverse array of contemporary and historical influenza strains was investigated in ferrets challenged with 2009 pandemic H1N1 influenza or the seasonal H3N2 strain, A/Perth/16/2009. Post-challenge cell-mediated immune responses demonstrated extensive cross-reactivity with a wide variety of contemporary and historical influenza A strains as well as influenza B. Responses in peripheral blood were undetectable by 36d post-challenge, but cross-reactivity persisted in spleen. The strongest responses targeted peptides from the NP protein and demonstrated cross-reactivity in both the CD4+ and CD8+ T cell populations. Cross-reactive CD4+ T cells also targeted HA and NA epitopes, while cross-reactive CD8+ T cells targeted internal M1, NS2, and PA. T cell epitopes demonstrated extensive cross-reactivity between diverse influenza strains in outbred animals, with NP implicated as a significant antigenic target demonstrating extensive cross-reactivity for both CD4+ and CD8+ T cells.
Microstructural and strain rate effects on plastic deformation in aluminum 2219-T87
NASA Astrophysics Data System (ADS)
Rincon, Carlos D.
A fundamental investigation has been conducted on the effects of microstructure and strain rate on the plastic deformation of theta-prime-strengthened 2219 aluminum. The motivation for this work is based upon a previous study which showed inhomogeneous and locally extreme work hardening in the HAZ regions in VPPA 2219-T87 butt welds. This strongly suggests that the HAZ microstructure plays a major role in the deformation and fracture process in precipitation hardened aluminum alloy 2219. Tensile specimens of the weld joint exhibited more rapid work hardening in the heat-affected-zone (HAZ) at higher strain levels. Microhardness contour maps for these welds illustrated that late stage deformation was concentrated in two crossing bands at about 45sp° to the tensile axis. The width of the deformation bands and the ultimate tensile strength seemed to be dictated by the amount of work hardening in the HAZ. In this study, three different heat treatments were used to produce samples with different particle sizes and particle spacings, but all hardened by copper aluminide precipitates of the thetasp' structure. The heat treatments were categorized as being (A) as-received T87 condition, (B) T87 condition aged at approximately 204sp°C for 3 hours and (C) T87 over-aged at 204sp°C for 7 days. Uniaxial tensile tests consisted of two sets of experiments: (1) three heat treatments (A, B, and C) at two strain rates (0.02 minsp{-1} and 0.2 minsp{-1}) and (2) three heat treatments that were interrupted at select stress-strain levels (0.8% and 2% total strain) during the tensile tests at strain rate equal to 0.02 minsp{-1} at room temperature. Furthermore, a detailed transmission electron microscopy (TEM) study demonstrates the microstructural development during tensile deformation. The Voce equation of strain-hardening provides a slightly better fit to the tensile curves than the Ludwik-Hollomon equation. At higher strains, localized areas showed strain fields around thetasp
Kaur, Jasvinder; Verma, Helianthous; Tripathi, Charu; Khurana, J. P.
2013-01-01
Sphingobium baderi strain LL03T was isolated from hexachlorocyclohexane (HCH)-contaminated soil from Spolana, Czech Republic. Strain LL03T is a mutant that is deficient in linB and linC (genes that encode hexachlorocyclohexane haloalkane dehalogenase and dehydrogenase, respectively). The draft genome sequence of LL03T (~4.85 Mb) consists of 92 contigs and 4,914 coding sequences, with a G+C content of 63.5%. PMID:24051322
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei
Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less
Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; ...
2015-01-20
Species of the genus Halomonas are halophilic and their flexible adaption to changes of salinity and temperature brings considerable potential biotechnology applications, such as degradation of organic pollutants and enzyme production. The type strain Halomonas lutea YIM 91125 T was isolated from a hypersaline lake in China. The genome of strain YIM 91125 T becomes the twelfth species sequenced in Halomonas, and the thirteenth species sequenced in Halomonadaceae. We described the features of H. lutea YIM 91125 T, together with the high quality draft genome sequence and annotation of its type strain. The 4,533,090 bp long genome of strain YIMmore » 91125 T with its 4,284 protein-coding and 84 RNA genes is a part of Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project. From the viewpoint of comparative genomics, H. lutea has a larger genome size and more specific genes, which indicated acquisition of function bringing better adaption to its environment. Finally, DDH analysis demonstrated that H. lutea is a distinctive species, and halophilic features and nitrogen metabolism related genes were discovered in its genome.« less
Englert, Markus; Vargas-Rodriguez, Oscar; Reynolds, Noah M; Wang, Yane-Shih; Söll, Dieter; Umehara, Takuya
2017-11-01
Development of new aminoacyl-tRNA synthetase (aaRS)•tRNA pairs is central for incorporation of novel non-canonical amino acids (ncAAs) into proteins via genetic code expansion (GCE). The Escherichia coli and Caulobacter crescentus histidyl-tRNA synthetases (HisRS) evolved divergent mechanisms of tRNA His recognition that prevent their cross-reactivity. Although the E. coli HisRS•tRNA His pair is a good candidate for GCE, its use in C. crescentus is limited by the lack of established genetic selection methods and by the low transformation efficiency of C. crescentus. E. coli was genetically engineered to use a C. crescentus HisRS•tRNA His pair. Super-folder green fluorescent protein (sfGFP) and chloramphenicol acetyltransferase (CAT) were used as reporters for read-through assays. A library of 313 ncAAs coupled with the sfGFP reporter system was employed to investigate the specificity of E. coli HisRS in vivo. A genomically modified E. coli strain (named MEOV1) was created. MEVO1 requires an active C. crescentus HisRS•tRNA His pair for growth, and displays a similar doubling time as the parental E. coli strain. sfGFP- and CAT-based assays showed that the E. coli HisRS•tRNA His pair is orthogonal in MEOV1 cells. A mutation in the anticodon loop of E. coli tRNA His CUA elevated its suppression efficiency by 2-fold. The C. crescentus HisRS•tRNA His pair functionally complements an E. coli ΔhisS strain. The E. coli HisRS•tRNA His is orthogonal in MEOV1 cells. E. coli tRNA His CUA is an efficient amber suppressor in MEOV1. We developed a platform that allows protein engineering of E. coli HisRS that should facilitate GCE in E. coli. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Complete genome sequence of Rhodospirillum rubrum type strain (S1T)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Munk, Christine; Copeland, A; Lucas, Susan
2011-01-01
Rhodospirillum rubrum (Esmarch 1887) Molisch 1907 is the type species of the genus Rho- dospirillum, which is the type genus of the family Rhodospirillaceae in the class Alphaproteo- bacteria. The species is of special interest because it is an anoxygenic phototroph that pro- duces extracellular elemental sulfur (instead of oxygen) while harvesting light. It contains one of the most simple photosynthetic systems currently known, lacking light harvesting complex 2. Strain S1T can grow on carbon monoxide as sole energy source. With currently over 1,750 PubMed entries, R. rubrum is one of the most intensively studied microbial species, in partic- ularmore » for physiological and genetic studies. Next to R. centenum strain SW, the genome se- quence of strain S1T is only the second genome of a member of the genus Rhodospirillum to be published, but the first type strain genome from the genus. The 4,352,825 bp long chro- mosome and 53,732 bp plasmid with a total of 3,850 protein-coding and 83 RNA genes were sequenced as part of the DOE Joint Genome Institute Program DOEM 2002.« less
Draft genome sequence of type strain HBR26T and description of Rhizobium aethiopicum sp. nov.
Aserse, Aregu Amsalu; Woyke, Tanja; Kyrpides, Nikos C.; ...
2017-01-26
Rhizobium aethiopicum sp. nov. is a newly proposed species within the genus Rhizobium. This species includes six rhizobial strains; which were isolated from root nodules of the legume plant Phaseolus vulgaris growing in soils of Ethiopia. The species fixes nitrogen effectively in symbiosis with the host plant P. vulgaris, and is composed of aerobic, Gram-negative staining, rod-shaped bacteria. The genome of type strain HBR26 T of R. aethiopicum sp. nov. was one of the rhizobial genomes sequenced as a part of the DOE JGI 2014 Genomic Encyclopedia project designed for soil and plant-associated and newly described type strains. The genomemore » sequence is arranged in 62 scaffolds and consists of 6,557,588 bp length, with a 61% G + C content and 6221 protein-coding and 86 RNAs genes. The genome of HBR26 T contains repABC genes (plasmid replication genes) homologous to the genes found in five differen t Rhizobium etli CFN42 T plasmids, suggesting that HBR26 T may have five additional replicons other than the chromosome. In the genome of HBR26 T , the nodulation genes nodB, nodC, nodS, nodI, nodJ and nodD are located in the same module, and organized in a similar way as nod genes found in the genome of other known common bean-nodulating rhizobial species. nodA gene is found in a different scaffold, but it is also very similar to nodA genes of other bean-nodulating rhizobial strains. Though HBR26 T is distinct on the phylogenetic tree and based on ANI analysis (the highest value 90.2% ANI with CFN42 T ) from other bean-nodulating species, these nod genes and most nitrogen-fixing genes found in the genome of HBR26 T share high identity with the corresponding genes of known bean-nodulating rhizobial species (96-100% identity). This suggests that symbiotic genes might be shared between bean-nodulating rhizobia through horizontal gene transfer. R. aethiopicum sp. nov. was grouped into the genus Rhizobium but was distinct from all recognized species of that genus by
Draft genome sequence of type strain HBR26T and description of Rhizobium aethiopicum sp. nov.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aserse, Aregu Amsalu; Woyke, Tanja; Kyrpides, Nikos C.
Rhizobium aethiopicum sp. nov. is a newly proposed species within the genus Rhizobium. This species includes six rhizobial strains; which were isolated from root nodules of the legume plant Phaseolus vulgaris growing in soils of Ethiopia. The species fixes nitrogen effectively in symbiosis with the host plant P. vulgaris, and is composed of aerobic, Gram-negative staining, rod-shaped bacteria. The genome of type strain HBR26 T of R. aethiopicum sp. nov. was one of the rhizobial genomes sequenced as a part of the DOE JGI 2014 Genomic Encyclopedia project designed for soil and plant-associated and newly described type strains. The genomemore » sequence is arranged in 62 scaffolds and consists of 6,557,588 bp length, with a 61% G + C content and 6221 protein-coding and 86 RNAs genes. The genome of HBR26 T contains repABC genes (plasmid replication genes) homologous to the genes found in five differen t Rhizobium etli CFN42 T plasmids, suggesting that HBR26 T may have five additional replicons other than the chromosome. In the genome of HBR26 T , the nodulation genes nodB, nodC, nodS, nodI, nodJ and nodD are located in the same module, and organized in a similar way as nod genes found in the genome of other known common bean-nodulating rhizobial species. nodA gene is found in a different scaffold, but it is also very similar to nodA genes of other bean-nodulating rhizobial strains. Though HBR26 T is distinct on the phylogenetic tree and based on ANI analysis (the highest value 90.2% ANI with CFN42 T ) from other bean-nodulating species, these nod genes and most nitrogen-fixing genes found in the genome of HBR26 T share high identity with the corresponding genes of known bean-nodulating rhizobial species (96-100% identity). This suggests that symbiotic genes might be shared between bean-nodulating rhizobia through horizontal gene transfer. R. aethiopicum sp. nov. was grouped into the genus Rhizobium but was distinct from all recognized species of that genus by
Strain Measurements of Chondrules and Refraction Inclusion in Allende
NASA Technical Reports Server (NTRS)
Tait, Alastair W.; Fisher, Kent R.; Simon, Justin I.
2013-01-01
This study uses traditional strain measurement techniques, combined with X-ray computerized tomography (CT), to evaluate petrographic evidence in the Allende CV3 chondrite for preferred orientation and to measure strain in three dimensions. The existence of petrofabrics and lineations was first observed in carbonaceous meteorites in the 1960's. Yet, fifty years later only a few studies have reported that meteorites record such features. Impacts are often cited as the mechanism for this feature, although plastic deformation from overburden and nebular imbrication have also been proposed. Previous work conducted on the Leoville CV3 and the Parnallee LL3 chondrites, exhibited a minimum uniaxial shortening of 33% and 21%, respectively. Petrofabrics in Allende CV3 have been looked at before; previous workers using Electron Back Scatter Diffraction (EBSD) found a major-axis alignment of olivine inside dark inclusions and an "augen"-like preferred orientation of olivine grains around more competent chondrules
Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake
2017-08-01
Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course. © 2017 Wiley Periodicals, Inc.
Niharika, Neha; Sangwan, Naseer; Ahmad, Salar; Singh, Priya; Khurana, J. P.
2013-01-01
Sphingobium chinhatense strain IP26T is a conducive hexachlorocyclohexane (HCH) degrader isolated from a heavily contaminated (450 mg HCH/g soil) HCH dumpsite. IP26T degrades α-, β-, γ-, and δ-HCH, which are highly persistent in the environment. Here we report the draft genome sequence (~5.8 Mbp) of this strain. PMID:23990581
DiMarzio, Michael; Rusconi, Brigida; Yennawar, Neela H.; Eppinger, Mark; Patterson, Andrew D.
2017-01-01
Bile salt hydrolase (BSH) activity against the bile acid tauro-beta-muricholic acid (T-β-MCA) was recently reported to mediate host bile acid, glucose, and lipid homeostasis via the farnesoid X receptor (FXR) signaling pathway. An earlier study correlated decreased Lactobacillus abundance in the cecum with increased concentrations of intestinal T-β-MCA, an FXR antagonist. While several studies have characterized BSHs in lactobacilli, deconjugation of T-β-MCA remains poorly characterized among members of this genus, and therefore it was unclear what strain(s) were responsible for this activity. Here, a strain of L. johnsonii with robust BSH activity against T-β-MCA in vitro was isolated from the cecum of a C57BL/6J mouse. A screening assay performed on a collection of 14 Lactobacillus strains from nine different species identified BSH substrate specificity for T-β-MCA only in two of three L. johnsonii strains. Genomic analysis of the two strains with this BSH activity revealed the presence of three bsh genes that are homologous to bsh genes in the previously sequenced human-associated strain L. johnsonii NCC533. Heterologous expression of several bsh genes in E. coli followed by enzymatic assays revealed broad differences in substrate specificity even among closely related bsh homologs, and suggests that the phylogeny of these enzymes does not closely correlate with substrate specificity. Predictive modeling allowed us to propose a potential mechanism driving differences in BSH activity for T-β-MCA in these homologs. Our data suggests that L. johnsonii regulates T-β-MCA levels in the mouse intestinal environment, and that this species may play a central role in FXR signaling in the mouse. PMID:28910295
DiMarzio, Michael; Rusconi, Brigida; Yennawar, Neela H; Eppinger, Mark; Patterson, Andrew D; Dudley, Edward G
2017-01-01
Bile salt hydrolase (BSH) activity against the bile acid tauro-beta-muricholic acid (T-β-MCA) was recently reported to mediate host bile acid, glucose, and lipid homeostasis via the farnesoid X receptor (FXR) signaling pathway. An earlier study correlated decreased Lactobacillus abundance in the cecum with increased concentrations of intestinal T-β-MCA, an FXR antagonist. While several studies have characterized BSHs in lactobacilli, deconjugation of T-β-MCA remains poorly characterized among members of this genus, and therefore it was unclear what strain(s) were responsible for this activity. Here, a strain of L. johnsonii with robust BSH activity against T-β-MCA in vitro was isolated from the cecum of a C57BL/6J mouse. A screening assay performed on a collection of 14 Lactobacillus strains from nine different species identified BSH substrate specificity for T-β-MCA only in two of three L. johnsonii strains. Genomic analysis of the two strains with this BSH activity revealed the presence of three bsh genes that are homologous to bsh genes in the previously sequenced human-associated strain L. johnsonii NCC533. Heterologous expression of several bsh genes in E. coli followed by enzymatic assays revealed broad differences in substrate specificity even among closely related bsh homologs, and suggests that the phylogeny of these enzymes does not closely correlate with substrate specificity. Predictive modeling allowed us to propose a potential mechanism driving differences in BSH activity for T-β-MCA in these homologs. Our data suggests that L. johnsonii regulates T-β-MCA levels in the mouse intestinal environment, and that this species may play a central role in FXR signaling in the mouse.
Dominova, I. N.; Kublanov, I. V.; Podosokorskaya, O. A.; Derbikova, K. S.; Patrushev, M. V.
2013-01-01
The complete genomic sequence of a novel hyperthermophilic crenarchaeon, strain 1910bT, was determined. The genome comprises a 1,750,259-bp circular chromosome containing single copies of 3 rRNA genes, 43 tRNA genes, and 1,896 protein-coding sequences. In silico genome-genome hybridization suggests the proposal of a novel species, “Thermofilum adornatus” strain 1910bT. PMID:24029764
[In vitro function of outer membrane protease T of Escherichia coli K1 pathogenic strain].
Hui, Changye; Guo, Yan; Wu, Shuchi; Peng, Liang; Cao, Hong; Huang, Shenghe
2010-01-01
Plasminogen activation and antimicrobial peptide hydrolysis contribute to pathogens invasion and survival in vivo. To demonstrate the expression of outer membrane protease T in E. coli K1 pathogenic strain E44, its activity of plasminogen activator and protamine hydrolysis. After Benzamidine Sepharose Fast Flow and SOURCE 30Q chromatography, we got E44 outer membrane mixed fraction, and examined its activity of plasminogen activation with chromogenic substrate S-2251 method. An ompT deletion mutant of E44 was constructed by using the suicide vector pCVD442, termed as E44ompT. We examined 0.1 mg/mL cationic antimicrobial peptide protamine susceptibility of E44, ompT mutant strain E44ompT and E44ompT harboring pUCT, which was constructed by inserting complete ompT open reading frame into pUC13. We got about 37 kDa E44 membrane extract, which could activate plasminogen, and activation was membrane extract dose dependent. This confirmed the expression of outer membrane protease T in the outer membrane of E44. E44ompT was, more susceptible to 0.1 mg/mL protamine than E44, and E440mpT was partially complemented by pUCT. Outer membrane protease T is expressed in E. coli K1 pathogenic strain E44, and can activate plasminogen and hydrolyze protamine.
Yang, Feng-Juan; Cheng, Li-Li; Zhang, Ling; Dai, Wei-Jun; Liu, Zhe; Yao, Nan; Xie, Zhi-Ping; Staehelin, Christian
2009-01-01
Type 3 (T3) effector proteins, secreted by nitrogen-fixing rhizobia with a bacterial T3 secretion system, affect the nodulation of certain host legumes. The open reading frame y4lO of Rhizobium sp. strain NGR234 encodes a protein with sequence similarities to T3 effectors from pathogenic bacteria (the YopJ effector family). Transcription studies showed that the promoter activity of y4lO depended on the transcriptional activator TtsI. Recombinant Y4lO protein expressed in Escherichia coli did not acetylate two representative mitogen-activated protein kinase kinases (human MKK6 and MKK1 from Medicago truncatula), indicating that YopJ-like proteins differ with respect to their substrate specificities. The y4lO gene was mutated in NGR234 (strain NGRΩy4lO) and in NGRΩnopL, a mutant that does not produce the T3 effector NopL (strain NGRΩnopLΩy4lO). When used as inoculants, the symbiotic properties of the mutants differed. Tephrosia vogelii, Phaseolus vulgaris cv. Yudou No. 1, and Vigna unguiculata cv. Sui Qing Dou Jiao formed pink effective nodules with NGR234 and NGRΩnopLΩy4lO. Nodules induced by NGRΩy4lO were first pink but rapidly turned greenish (ineffective nodules), indicating premature senescence. An ultrastructural analysis of the nodules induced by NGRΩy4lO revealed abnormal formation of enlarged infection droplets in ineffective nodules, whereas symbiosomes harboring a single bacteroid were frequently observed in effective nodules induced by NGR234 or NGRΩnopLΩy4lO. It is concluded that Y4lO is a symbiotic determinant involved in the differentiation of symbiosomes. Y4lO mitigated senescence-inducing effects caused by the T3 effector NopL, suggesting synergistic effects for Y4lO and NopL in nitrogen-fixing nodules. PMID:19060155
Yang, Feng-Juan; Cheng, Li-Li; Zhang, Ling; Dai, Wei-Jun; Liu, Zhe; Yao, Nan; Xie, Zhi-Ping; Staehelin, Christian
2009-02-01
Type 3 (T3) effector proteins, secreted by nitrogen-fixing rhizobia with a bacterial T3 secretion system, affect the nodulation of certain host legumes. The open reading frame y4lO of Rhizobium sp. strain NGR234 encodes a protein with sequence similarities to T3 effectors from pathogenic bacteria (the YopJ effector family). Transcription studies showed that the promoter activity of y4lO depended on the transcriptional activator TtsI. Recombinant Y4lO protein expressed in Escherichia coli did not acetylate two representative mitogen-activated protein kinase kinases (human MKK6 and MKK1 from Medicago truncatula), indicating that YopJ-like proteins differ with respect to their substrate specificities. The y4lO gene was mutated in NGR234 (strain NGROmegay4lO) and in NGR Omega nopL, a mutant that does not produce the T3 effector NopL (strain NGR Omega nopLOmegay4lO). When used as inoculants, the symbiotic properties of the mutants differed. Tephrosia vogelii, Phaseolus vulgaris cv. Yudou No. 1, and Vigna unguiculata cv. Sui Qing Dou Jiao formed pink effective nodules with NGR234 and NGR Omega nopL Omega y4lO. Nodules induced by NGR Omega y4lO were first pink but rapidly turned greenish (ineffective nodules), indicating premature senescence. An ultrastructural analysis of the nodules induced by NGR Omega y4lO revealed abnormal formation of enlarged infection droplets in ineffective nodules, whereas symbiosomes harboring a single bacteroid were frequently observed in effective nodules induced by NGR234 or NGR Omega nopL Omega y4lO. It is concluded that Y4lO is a symbiotic determinant involved in the differentiation of symbiosomes. Y4lO mitigated senescence-inducing effects caused by the T3 effector NopL, suggesting synergistic effects for Y4lO and NopL in nitrogen-fixing nodules.
76 FR 55268 - Chromobacterium subtsugae Strain PRAA4-1T
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-07
... (irritation symptoms cleared by 24 hours; Toxicity Category IV). 9. Dermal sensitization--guinea pig... that Chromobacterium subtsugae strain PRAA4-1\\T\\ was not a dermal sensitizer to guinea pigs. IV... production (NAICS code 111). Animal production (NAICS code 112). Food manufacturing (NAICS code 311...
Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe
2016-02-01
The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Nitrous Oxide Reduction by an Obligate Aerobic Bacterium, Gemmatimonas aurantiaca Strain T-27
Park, Doyoung; Kim, Hayeon
2017-01-01
ABSTRACT N2O-reducing organisms with nitrous oxide reductases (NosZ) are known as the only biological sink of N2O in the environment. Among the most abundant nosZ genes found in the environment are nosZ genes affiliated with the understudied Gemmatimonadetes phylum. In this study, a unique regulatory mechanism of N2O reduction in Gemmatimonas aurantiaca strain T-27, an isolate affiliated with the Gemmatimonadetes phylum, was examined. Strain T-27 was incubated with N2O and/or O2 as the electron acceptor. Significant N2O reduction was observed only when O2 was initially present. When batch cultures of strain T-27 were amended with O2 and N2O, N2O reduction commenced after O2 was depleted. In a long-term incubation with the addition of N2O upon depletion, the N2O reduction rate decreased over time and came to an eventual stop. Spiking of the culture with O2 resulted in the resuscitation of N2O reduction activity, supporting the hypothesis that N2O reduction by strain T-27 required the transient presence of O2. The highest level of nosZ transcription (8.97 nosZ transcripts/recA transcript) was observed immediately after O2 depletion, and transcription decreased ∼25-fold within 85 h, supporting the observed phenotype. The observed difference between responses of strain T-27 cultures amended with and without N2O to O2 starvation suggested that N2O helped sustain the viability of strain T-27 during temporary anoxia, although N2O reduction was not coupled to growth. The findings in this study suggest that obligate aerobic microorganisms with nosZ genes may utilize N2O as a temporary surrogate for O2 to survive periodic anoxia. IMPORTANCE Emission of N2O, a potent greenhouse gas and ozone depletion agent, from the soil environment is largely determined by microbial sources and sinks. N2O reduction by organisms with N2O reductases (NosZ) is the only known biological sink of N2O at environmentally relevant concentrations (up to ∼1,000 parts per million by volume [ppmv
Nitrous Oxide Reduction by an Obligate Aerobic Bacterium, Gemmatimonas aurantiaca Strain T-27.
Park, Doyoung; Kim, Hayeon; Yoon, Sukhwan
2017-06-15
N 2 O-reducing organisms with nitrous oxide reductases (NosZ) are known as the only biological sink of N 2 O in the environment. Among the most abundant nosZ genes found in the environment are nosZ genes affiliated with the understudied Gemmatimonadetes phylum. In this study, a unique regulatory mechanism of N 2 O reduction in Gemmatimonas aurantiaca strain T-27, an isolate affiliated with the Gemmatimonadetes phylum, was examined. Strain T-27 was incubated with N 2 O and/or O 2 as the electron acceptor. Significant N 2 O reduction was observed only when O 2 was initially present. When batch cultures of strain T-27 were amended with O 2 and N 2 O, N 2 O reduction commenced after O 2 was depleted. In a long-term incubation with the addition of N 2 O upon depletion, the N 2 O reduction rate decreased over time and came to an eventual stop. Spiking of the culture with O 2 resulted in the resuscitation of N 2 O reduction activity, supporting the hypothesis that N 2 O reduction by strain T-27 required the transient presence of O 2 The highest level of nosZ transcription (8.97 nosZ transcripts/ recA transcript) was observed immediately after O 2 depletion, and transcription decreased ∼25-fold within 85 h, supporting the observed phenotype. The observed difference between responses of strain T-27 cultures amended with and without N 2 O to O 2 starvation suggested that N 2 O helped sustain the viability of strain T-27 during temporary anoxia, although N 2 O reduction was not coupled to growth. The findings in this study suggest that obligate aerobic microorganisms with nosZ genes may utilize N 2 O as a temporary surrogate for O 2 to survive periodic anoxia. IMPORTANCE Emission of N 2 O, a potent greenhouse gas and ozone depletion agent, from the soil environment is largely determined by microbial sources and sinks. N 2 O reduction by organisms with N 2 O reductases (NosZ) is the only known biological sink of N 2 O at environmentally relevant concentrations (up to ∼1
ERIC Educational Resources Information Center
Abrahams, A. L.
1976-01-01
Describes results of a study that used CV 100, a fuel additive for use in oil-fired heating systems, on a trial basis in 12 Ontario schools. The test showed an average 12 percent reduction in fuel costs in the schools using CV 100. (JG)
Compressive strain induced dynamical stability of monolayer 1T-MX2 (M = Mo, W; X = S, Se)
NASA Astrophysics Data System (ADS)
Li, Xiaoyong; Wu, Musheng; Xu, Bo; Liu, Ruifan; Ouyang, Chuying
2017-11-01
The lattice dynamical properties of 1T-MX2 (M = Mo, W; X = S, Se) under different strains were studied by using density functional perturbation theory method. Our results show that all MX2 with 1T phase in our calculations are dynamical instable under zero strain or tensile strain as obvious imaginary frequencies (soft modes) exist. When 3% biaxial compressive strains are applied, the imaginary frequencies remain except that the absolute values of maximum imaginary frequency decrease. With the increase of compressive strain to be 6%, 1T-MoS2, 1T-MoSe2, 1T-WS2 become stable, whereas 1T-WSe2 has small imaginary frequencies. When biaxial compressive strain reaches 9%, all 1T-MX2 are dynamical stable without imaginary frequencies in the phonon dispersion curves. Energy band structures show that all 1T-MX2 are metallic, regardless of zero strain or compressive strain. Therefore, compressive strain could be a practical approach to enhance the stability of 1T-MX2 while maintaining the metallic property.
Mucosal-associated invariant T cell-rich congenic mouse strain allows functional evaluation.
Cui, Yue; Franciszkiewicz, Katarzyna; Mburu, Yvonne K; Mondot, Stanislas; Le Bourhis, Lionel; Premel, Virginie; Martin, Emmanuel; Kachaner, Alexandra; Duban, Livine; Ingersoll, Molly A; Rabot, Sylvie; Jaubert, Jean; De Villartay, Jean-Pierre; Soudais, Claire; Lantz, Olivier
2015-11-02
Mucosal-associated invariant T cells (MAITs) have potent antimicrobial activity and are abundant in humans (5%-10% in blood). Despite strong evolutionary conservation of the invariant TCR-α chain and restricting molecule MR1, this population is rare in laboratory mouse strains (≈0.1% in lymphoid organs), and lack of an appropriate mouse model has hampered the study of MAIT biology. Herein, we show that MAITs are 20 times more frequent in clean wild-derived inbred CAST/EiJ mice than in C57BL/6J mice. Increased MAIT frequency was linked to one CAST genetic trait that mapped to the TCR-α locus and led to higher usage of the distal Vα segments, including Vα19. We generated a MAIThi congenic strain that was then crossed to a transgenic Rorcgt-GFP reporter strain. Using this tool, we characterized polyclonal mouse MAITs as memory (CD44+) CD4-CD8lo/neg T cells with tissue-homing properties (CCR6+CCR7-). Similar to human MAITs, mouse MAITs expressed the cytokine receptors IL-7R, IL-18Rα, and IL-12Rβ and the transcription factors promyelocytic leukemia zinc finger (PLZF) and RAR-related orphan receptor γ (RORγt). Mouse MAITs produced Th1/2/17 cytokines upon TCR stimulation and recognized a bacterial compound in an MR1-dependent manner. During experimental urinary tract infection, MAITs migrated to the bladder and decreased bacterial load. Our study demonstrates that the MAIThi congenic strain allows phenotypic and functional characterization of naturally occurring mouse MAITs in health and disease.
Draft Genome Sequence of Mycobacterium bohemicum Strain DSM 44277T.
Asmar, Shady; Phelippeau, Michael; Robert, Catherine; Croce, Olivier; Drancourt, Michel
2015-08-06
The Mycobacterium bohemicum strain is a nontuberculosis species mainly responsible for pediatric cervical lymphadenitis. The draft genome of M. bohemicum DSM 44277(T) comprises 5,097,190 bp exhibiting a 68.64% G+C content, 4,840 protein-coding genes, and 75 predicted RNA genes. Copyright © 2015 Asmar et al.
Mucosal-associated invariant T cell–rich congenic mouse strain allows functional evaluation
Cui, Yue; Franciszkiewicz, Katarzyna; Mburu, Yvonne K.; Mondot, Stanislas; Le Bourhis, Lionel; Premel, Virginie; Martin, Emmanuel; Kachaner, Alexandra; Duban, Livine; Ingersoll, Molly A.; Rabot, Sylvie; Jaubert, Jean; De Villartay, Jean-Pierre; Soudais, Claire; Lantz, Olivier
2015-01-01
Mucosal-associated invariant T cells (MAITs) have potent antimicrobial activity and are abundant in humans (5%–10% in blood). Despite strong evolutionary conservation of the invariant TCR-α chain and restricting molecule MR1, this population is rare in laboratory mouse strains (≈0.1% in lymphoid organs), and lack of an appropriate mouse model has hampered the study of MAIT biology. Herein, we show that MAITs are 20 times more frequent in clean wild-derived inbred CAST/EiJ mice than in C57BL/6J mice. Increased MAIT frequency was linked to one CAST genetic trait that mapped to the TCR-α locus and led to higher usage of the distal Vα segments, including Vα19. We generated a MAIThi congenic strain that was then crossed to a transgenic Rorcgt-GFP reporter strain. Using this tool, we characterized polyclonal mouse MAITs as memory (CD44+) CD4–CD8lo/neg T cells with tissue-homing properties (CCR6+CCR7–). Similar to human MAITs, mouse MAITs expressed the cytokine receptors IL-7R, IL-18Rα, and IL-12Rβ and the transcription factors promyelocytic leukemia zinc finger (PLZF) and RAR-related orphan receptor γ (RORγt). Mouse MAITs produced Th1/2/17 cytokines upon TCR stimulation and recognized a bacterial compound in an MR1-dependent manner. During experimental urinary tract infection, MAITs migrated to the bladder and decreased bacterial load. Our study demonstrates that the MAIThi congenic strain allows phenotypic and functional characterization of naturally occurring mouse MAITs in health and disease. PMID:26524590
Moudgil, K D; Kim, E; Yun, O J; Chi, H H; Brahn, E; Sercarz, E E
2001-03-15
Both genetic and environmental factors are believed to be involved in the induction of autoimmune diseases. Adjuvant arthritis (AA) is inducible in susceptible rat strains by injection of Mycobacterium tuberculosis, and arthritic rats raise T cell responses to the 65-kDa mycobacterial heat-shock protein (Bhsp65). We observed that Fischer 344 (F344) rats raised in a barrier facility (BF-F344) are susceptible to AA, whereas F344 rats maintained in a conventional facility (CV-F344) show significantly reduced incidence and severity of AA, despite responding well to the arthritogenic determinant within Bhsp65. The acquisition of protection from AA can be circumvented if rats are maintained on neomycin/acidified water. Strikingly, naive unimmunized CV-F344 rats but not BF-F344 rats raised T cell responses to Bhsp65 C-terminal determinants (BCTD) (we have previously shown that BCTD are involved in regulation of acute AA in the Lewis rat); however, T cells of naive CV-F344 and BF-F344 gave a comparable level of proliferative response to a mitogen, but no response at all to an irrelevant Ag. Furthermore, adoptive transfer into naive BF-F344 rats of splenic cells of naive CV-F344 rats (restimulated with BCTD in vitro) before induction of AA resulted in a considerably reduced severity of AA. These results suggest that spontaneous (inadvertent) priming of BCTD-reactive T cells, owing to determinant mimicry between Bhsp65 and its homologues in microbial agents in the conventional environment, is involved in modulating the severity of AA in CV-F344 rats. These results have important implications in broadening understanding of the host-microbe interaction in human autoimmune diseases.
Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan
2016-04-10
Erysipelothrix larvae LV19(T) was preliminary isolated from the larval gut of a rhinoceros beetle, Trypoxylus dichotomus in Korea. Here, we present the whole genome sequence of E. larvae LV19(T) strain, which consisted of 2,511,486 base pairs with a GC content of 37.4% and one plasmid. Unlike other Erysipelothrix strains (SY 1027, Fujisawa and ATCC 19414), the arsenic-resistance genes were identified in LV19(T) strain. Copyright © 2016 Elsevier B.V. All rights reserved.
Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain
2013-01-01
Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36–42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing. PMID:23442823
Feroldi, Emmanuel; Capeding, Maria Rosario; Boaz, Mark; Gailhardou, Sophia; Meric, Claude; Bouckenooghe, Alain
2013-04-01
Japanese encephalitis chimeric virus vaccine (JE-CV) is a licensed vaccine indicated in a single dose administration for primary immunization. This controlled phase III comparative trial enrolled children aged 36-42 mo in the Philippines. 345 children who had received one dose of JE-CV in a study two years earlier, received a JE-CV booster dose. 105 JE-vaccine-naïve children in general good health were randomized to receive JE-CV (JE-vaccine naïve group; 46 children) or varicella vaccine (safety control group; 59 children). JE neutralizing antibody titers were assessed using PRNT50. Immunological memory was observed in children who had received the primary dose of JE-CV before. Seven days after the JE-CV booster dose administration, 96.2% and 66.8% of children were seroprotected and had seroconverted, respectively, and the geometric mean titer (GMT) was 231 1/dil. Twenty-eight days after the JE-CV booster dose seroprotection and seroconversion were achieved in 100% and 95.3% of children, respectively, and the GMT was 2,242 1/dil. In contrast, only 15.4% of JE-CV-vaccine naïve children who had not received any prior JE vaccine were seroprotected seven days after they received JE-CV. One year after receiving the JE-CV booster dose, 99.4% of children remained seroprotected. We conclude that JE-CV is effective and safe, both as a single dose and when administrated as a booster dose. A booster dose increases the peak GMT above the peak level reached after primary immunization and the antibody persistence is maintained at least one year after the JE-CV booster dose administration. Five year follow up is ongoing.
NASA Aircraft on ramp (Aerial view) Sides: (L) QSRA (R) C-8A AWJSRA - Back to Front: CV-990 (711)
NASA Technical Reports Server (NTRS)
1981-01-01
NASA Aircraft on ramp (Aerial view) Sides: (L) QSRA (R) C-8A AWJSRA - Back to Front: CV-990 (711) C-141 KAO, CV-990 (712) Galileo, T-38, YO-3A, Lear Jet, X-14, U-2, OH-6, CH-47, SH-3G, RSRA, AH-1G, XV-15, UH-1H
Mangion, Kenneth; Clerfond, Guillaume; McComb, Christie; Carrick, David; Rauhalammi, Samuli M; McClure, John; Corcoran, David S; Woodward, Rosemary; Orchard, Vanessa; Radjenovic, Aleksandra; Zhong, Xiaodong; Berry, Colin
2016-11-01
To assess myocardial strain using cine displacement encoding with stimulated echoes (DENSE) using 1.5T and 3.0T MRI in healthy adults. Healthy adults without any history of cardiovascular disease underwent magnetic resonance imaging (MRI) at 1.5T and 3.0T within 2 days. The MRI protocol included balanced steady-state free-precession (b-SSFP), 2D cine-echo planar imaging (EPI)-DENSE, and late gadolinium enhancement in subjects >45 years. Acquisitions were divided into six segments; global and segmental peak longitudinal and circumferential strain were derived and analyzed by field strength, age, and gender. In all, 89 volunteers (mean age 44.8 ± 18.0 years, range: 18-87 years) underwent MRI at 1.5T, and 88 of these subjects underwent MRI at 3.0T (1.4 ± 1.4 days between the scans). Compared with 3.0T, the magnitudes of global circumferential (-19.5 ± 2.6% vs. -18.47 ± 2.6%; P = 0.001) and longitudinal (-12.47 ± 3.2% vs. -10.53 ± 3.1%; P = 0.004) strain were greater at 1.5T. At 1.5T, longitudinal strain was greater in females than in males: -10.17 ± 3.4% vs. -13.67 ± 2.4%; P = 0.001. Similar observations occurred for circumferential strain at 1.5T (-18.72 ± 2.2% vs. -20.10 ± 2.7%; P = 0.014) and at 3.0T (-17.92 ± 1.8% vs. -19.1 ± 3.1%; P = 0.047). At 1.5T, longitudinal and circumferential strain were not associated with age after accounting for sex (longitudinal strain P = 0.178, circumferential strain P = 0.733). At 3.0T, longitudinal and circumferential strain were associated with age (P < 0.05). Longitudinal strain values were greater in the apico-septal, basal-lateral, and mid-lateral segments and circumferential strain in the inferior, infero-lateral, and antero-lateral LV segments. Myocardial strain parameters as revealed by cine-DENSE at different MRI field strengths were associated with myocardial region, age, and sex. J. Magn. Reson. Imaging 2016;44:1197-1205. © 2016 The Authors Journal of Magnetic Resonance Imaging published by Wiley Periodicals
Mine Improvement and New Emergency Response Act of 2006. Public Law 109-236, S2803
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
2006-06-15
This Act may be cited as the 'Mine Improvement and New Emergency Response Act of 2006' or the 'MINER Act'. It amends the Federal Mine Safety and Health Act of 1977 to improve the safety of mines and mining. The Act requires operators of underground coal mines to improve accident preparedness. The legislation requires mining companies to develop an emergency response plan specific to each mine they operate, and requires that every mine has at least two rescue teams located within one hour. S. 2803 also limits the legal liability of rescue team members and the companies that employ them.more » The act increases both civil and criminal penalties for violations of federal mining safety standards and gives the Mine Safety and Health Administration (MSHA) the ability to temporarily close a mine that fails to pay the penalties or fines. In addition, the act calls for several studies into ways to enhance mine safety, as well as the establishment of a new office within the National Institute for Occupational Safety and Health devoted to improving mine safety. Finally, the legislation establishes new scholarship and grant programs devoted to training individuals with respect to mine safety.« less
Chen, Xuanzhen; Peng, Yong; Peng, Shan; Yao, Song; Chen, Chao; Xu, Ping
2017-01-01
This study aims to investigate the flow and fracture behavior of aluminum alloy 6082-T6 (AA6082-T6) at different strain rates and triaxialities. Two groups of Charpy impact tests were carried out to further investigate its dynamic impact fracture property. A series of tensile tests and numerical simulations based on finite element analysis (FEA) were performed. Experimental data on smooth specimens under various strain rates ranging from 0.0001~3400 s-1 shows that AA6082-T6 is rather insensitive to strain rates in general. However, clear rate sensitivity was observed in the range of 0.001~1 s-1 while such a characteristic is counteracted by the adiabatic heating of specimens under high strain rates. A Johnson-Cook constitutive model was proposed based on tensile tests at different strain rates. In this study, the average stress triaxiality and equivalent plastic strain at facture obtained from numerical simulations were used for the calibration of J-C fracture model. Both of the J-C constitutive model and fracture model were employed in numerical simulations and the results was compared with experimental results. The calibrated J-C fracture model exhibits higher accuracy than the J-C fracture model obtained by the common method in predicting the fracture behavior of AA6082-T6. Finally, the Scanning Electron Microscope (SEM) of fractured specimens with different initial stress triaxialities were analyzed. The magnified fractographs indicate that high initial stress triaxiality likely results in dimple fracture.
Chen, Xuanzhen; Peng, Shan; Yao, Song; Chen, Chao; Xu, Ping
2017-01-01
This study aims to investigate the flow and fracture behavior of aluminum alloy 6082-T6 (AA6082-T6) at different strain rates and triaxialities. Two groups of Charpy impact tests were carried out to further investigate its dynamic impact fracture property. A series of tensile tests and numerical simulations based on finite element analysis (FEA) were performed. Experimental data on smooth specimens under various strain rates ranging from 0.0001~3400 s-1 shows that AA6082-T6 is rather insensitive to strain rates in general. However, clear rate sensitivity was observed in the range of 0.001~1 s-1 while such a characteristic is counteracted by the adiabatic heating of specimens under high strain rates. A Johnson-Cook constitutive model was proposed based on tensile tests at different strain rates. In this study, the average stress triaxiality and equivalent plastic strain at facture obtained from numerical simulations were used for the calibration of J-C fracture model. Both of the J-C constitutive model and fracture model were employed in numerical simulations and the results was compared with experimental results. The calibrated J-C fracture model exhibits higher accuracy than the J-C fracture model obtained by the common method in predicting the fracture behavior of AA6082-T6. Finally, the Scanning Electron Microscope (SEM) of fractured specimens with different initial stress triaxialities were analyzed. The magnified fractographs indicate that high initial stress triaxiality likely results in dimple fracture. PMID:28759617
Buddruhs, Nora; Pradella, Silke; Göker, Markus; Päuker, Orsola; Pukall, Rüdiger; Spröer, Cathrin; Schumann, Peter; Petersen, Jörn; Brinkhoff, Thorsten
2013-11-01
The marine genus Phaeobacter currently comprises six species, some of which were intensively studied mainly due to their ability to produce secondary metabolites. The type strain of the type species, Phaeobacter gallaeciensis BS107(T), has been deposited at several public culture collections worldwide. Based on differences in plasmid profiles, we detected that the alleged P. gallaeciensis type strains deposited at the Collection Institute Pasteur (CIP; Paris, France) as CIP 105210 and at the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany) as DSM 17395 are not identical. To determine the identity of these strains, we conducted DNA-DNA hybridization, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF), 16S rRNA gene and internal transcribed spacer (ITS) sequence analyses, as well as physiological experiments. Based on the detailed 16S rRNA gene reanalysis we showed that strain CIP 105210 most likely corresponds to the original P. gallaeciensis type strain BS107(T). In contrast, the Phaeobacter strain DSM 17395 exhibits a much closer affiliation to Phaeobacter inhibens DSM 16374(T) ( = T5(T)) and should thus be allocated to this species. The detection of the dissimilarity of strains CIP 105210(T) and DSM 17395 will influence future comparative studies within the genus Phaeobacter.
NASA Astrophysics Data System (ADS)
Kolb, Ulrich; Baraffe, Isabelle
Using improved, up-to-date stellar input physics tested against observations of low-mass stars and brown dwarfs we calculate the secular evolution of low-donor-mass CVs, including those which form with a brown dwarf donor star. Our models confirm the mismatch between the calculated minimum period (plus or minus in ~= 70 min) and the observed short-period cut-off (~= 80 min) in the CV period histogram. Theoretical period distributions synthesized from our model sequences always show an accumulation of systems at the minimum period, a feature absent in the observed distribution. We suggest that non-magnetic CVs become unobservable as they are effectively trapped in permanent quiescence before they reach plus or minus in, and that small-number statistics may hide the period spike for magnetic CVs. We calculate the minimum period for high mass transfer rate sequences and discuss the relevance of these for explaining the location of CV secondaries in the orbital-period-spectral-type diagram. We also show that a recently suggested revised mass-radius relation for low-mass main-sequence stars cannot explain the CV period gap.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Iain; Teshima, Hazuki; Nolan, Matt
2013-01-01
rateuria aurantia (ex Kondo and Ameyama 1958) Swings et al. 1980 is a member of the bispecific genus Frateuria in the family Xanthomonadaceae, which is already heavily targeted for non-type strain genome sequencing. Strain Kondo 67(T) was initially (1958) identified as a member of 'Acetobacter aurantius', a name that was not considered for the approved list. Kondo 67(T) was therefore later designated as the type strain of the newly proposed acetogenic species Frateuria aurantia. The strain is of interest because of its triterpenoids (hopane family). F. aurantia Kondo 67(T) is the first member of the genus Frateura whose genome sequencemore » has been deciphered, and here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,603,458-bp long chromosome with its 3,200 protein-coding and 88 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Genome sequence of the Thermotoga thermarum type strain (LA3(T)) from an African solfataric spring.
Göker, Markus; Spring, Stefan; Scheuner, Carmen; Anderson, Iain; Zeytun, Ahmet; Nolan, Matt; Lucas, Susan; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Rohde, Manfred; Detter, John C; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla
2014-06-15
Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum 'Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3(T) is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significant discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Genome sequence of the Thermotoga thermarum type strain (LA 3 T) from an African solfataric spring
Goker, Markus; Spring, Stefan; Scheuner, Carmen; ...
2014-06-15
Thermotoga thermarum Windberger et al. 1989 is a member to the genomically well characterized genus Thermotoga in the phylum ' Thermotogae'. T. thermarum is of interest for its origin from a continental solfataric spring vs. predominantly marine oil reservoirs of other members of the genus. The genome of strain LA3T also provides fresh data for the phylogenomic positioning of the (hyper-)thermophilic bacteria. T. thermarum strain LA3 T is the fourth sequenced genome of a type strain from the genus Thermotoga, and the sixth in the family Thermotogaceae to be formally described in a publication. Phylogenetic analyses do not reveal significantmore » discrepancies between the current classification of the group, 16S rRNA gene data and whole-genome sequences. Nevertheless, T. thermarum significantly differs from other Thermotoga species regarding its iron-sulfur cluster synthesis, as it contains only a minimal set of the necessary proteins. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,039,943 bp long chromosome with its 2,015 protein-coding and 51 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex; ...
2017-09-21
Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex
Dethiobacter alkaliphilus strain AHT1 T is an anaerobic, sulfidogenic, moderately salt-tolerant alkaliphilic chemolithotroph isolated from hypersaline soda lake sediments in northeastern Mongolia. It is thus a Gram-positive bacterium with low GC content, within the phylum Firmicutes. We report its draft genome sequence, which consists of 34 contigs with a total sequence length of 3.12 Mbp. D. alkaliphilus strain AHT1 T was sequenced by the Joint Genome Institute (JGI) as part of the Community Science Program due to its relevance to bioremediation and biotechnological applications.
Panschin, Irina; Huang, Sixing; Meier-Kolthoff, Jan P.; ...
2016-06-03
Strains of the genus Gramella (family Flavobacteriacae, phylum Bacteroidetes) were isolated from marine habitats such as tidal flat sediments, coastal surface seawater and sea urchins. Flavobacteriaceae have been shown to be involved in the decomposition of plant and algal polysaccharides. However, the potential to decompose polysaccharides may differ tremendously even between species of the same genus. Gramella echinicola KMM 6050 T (DSM 19838 T ) and Gramella portivictoriae UST040801-001 T (DSM 23547 T ) have genomes of similar lengths, similar numbers of protein coding genes and RNA genes. Both genomes encode for a greater number of peptidases compared to 'G.more » forsetii'. In contrast to the genome of 'G. forsetii', both genomes comprised a smaller set of CAZymes. Seven polysaccharide utilization loci were identified in the genomes of DSM 19838 T and DSM 23547 T . Both Gramella strains hydrolyzed starch, galactomannan, arabinoxylan and hydroxyethyl-cellulose, but not pectin, chitosan and cellulose (Avicel). Galactan and xylan were hydrolyzed by strain DSM 19838 T , whereas strain DSM 23547 T hydrolyzed pachyman and carboxy-methyl cellulose. Conclusively, both Gramella type strains exhibit characteristic physiological, morphological and genomic differences that might be linked to their habitat. Furthermore, the identified enzymes mediating polysaccharide decomposition, are of biotechnological interest.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panschin, Irina; Huang, Sixing; Meier-Kolthoff, Jan P.
Strains of the genus Gramella (family Flavobacteriacae, phylum Bacteroidetes) were isolated from marine habitats such as tidal flat sediments, coastal surface seawater and sea urchins. Flavobacteriaceae have been shown to be involved in the decomposition of plant and algal polysaccharides. However, the potential to decompose polysaccharides may differ tremendously even between species of the same genus. Gramella echinicola KMM 6050 T (DSM 19838 T ) and Gramella portivictoriae UST040801-001 T (DSM 23547 T ) have genomes of similar lengths, similar numbers of protein coding genes and RNA genes. Both genomes encode for a greater number of peptidases compared to 'G.more » forsetii'. In contrast to the genome of 'G. forsetii', both genomes comprised a smaller set of CAZymes. Seven polysaccharide utilization loci were identified in the genomes of DSM 19838 T and DSM 23547 T . Both Gramella strains hydrolyzed starch, galactomannan, arabinoxylan and hydroxyethyl-cellulose, but not pectin, chitosan and cellulose (Avicel). Galactan and xylan were hydrolyzed by strain DSM 19838 T , whereas strain DSM 23547 T hydrolyzed pachyman and carboxy-methyl cellulose. Conclusively, both Gramella type strains exhibit characteristic physiological, morphological and genomic differences that might be linked to their habitat. Furthermore, the identified enzymes mediating polysaccharide decomposition, are of biotechnological interest.« less
De Groot, Anne S; Martin, William; Moise, Leonard; Guirakhoo, Farshad; Monath, Thomas
2007-11-19
T-cell epitope variability is associated with viral immune escape and may influence the outcome of vaccination against the highly variable Japanese Encephalitis Virus (JEV). We computationally analyzed the ChimeriVax-JEV vaccine envelope sequence for T helper epitopes that are conserved in 12 circulating JEV strains and discovered 75% conservation among putative epitopes. Among non-identical epitopes, only minor amino acid changes that would not significantly affect HLA-binding were present. Therefore, in most cases, circulating strain epitopes could be restricted by the same HLA and are likely to stimulate a cross-reactive T-cell response. Based on this analysis, we predict no significant abrogation of ChimeriVax-JEV-conferred protection against circulating JEV strains.
Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor; Morais, Paula V
2012-07-01
Here we report the draft genome sequence of Serratia sp. strain M24T3, which is associated with pinewood nematode Bursaphelenchus xylophilus, the causative agent of pine wilt disease. Serratia sp. strain M24T3 has been identified as a bionematocide for B. xylophilus in vitro, and multiple genes potentially involved in virulence and nematotoxity were identified.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2014-08-01
A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.
NASA Astrophysics Data System (ADS)
Brooks, D. H.; Costa, V. M.; Lago, M. T. V. T.; Lanzafame, A. C.
2001-10-01
We report results from our study of International Ultraviolet Explorer (IUE) data of a group of T Tauri stars (TTS). Comparisons between UV-line fluxes in these stars and in the Sun indicate very high levels of activity in their atmospheres and comparatively higher electron densities. Spectroscopic diagnostic line ratios indicate densities over an order of magnitude higher than in the `quiet' Sun at `transition region' temperatures. At these densities, metastable levels can attain comparable populations to the ground level and ionization fractions can be altered as a result of the sensitivity of dielectronic recombination. In Brooks et al. we improved the treatment of these effects using the adas software package, the atomic models and data of which are based on collisional-radiative theory. Here we extend the analysis to a sample of five TTS: RY Tau, BP Tau, RU Lupi, GW Ori and CV Cha. Using these models and data we derive the emission measure (EM) distribution for each star in the sample. We find that the decrease in EM with increasing temperature appears to be sharper than that found in previous work. In comparison with the Sun, the results suggest that the UV emission is formed in a region with a steeper density or volume gradient. We find mismatches between the theoretical and observed fluxes which cannot be explained by density effects and thus must be a result of uncertainties in the atomic data, unreliabilities in the fluxes or the failure of physical assumptions in the method. We have made a series of tests and comparisons, including examination of opacity effects, and these clearly favour the latter explanation. They also lead us to suggest the presence of two separate components in the UV emission for each of the TTS, although the case of CV Cha is more ambiguous. This supports and extends the earlier work of Jordan & Kuin on RU Lupi. Interestingly, we find that the EM distribution for GW Ori has values at least 10 times larger than those of RY Tau
Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor
2012-01-01
Here we report the draft genome sequence of Serratia sp. strain M24T3, which is associated with pinewood nematode Bursaphelenchus xylophilus, the causative agent of pine wilt disease. Serratia sp. strain M24T3 has been identified as a bionematocide for B. xylophilus in vitro, and multiple genes potentially involved in virulence and nematotoxity were identified. PMID:22740681
Romanyk, Dan L; Guan, Raymond; Major, Paul W; Dennison, Christopher R
2017-03-21
Measurement of periodontal ligament (PDL) strain in an ex vivo or in vivo setting of a complete tooth-PDL-bone complex (TPBC) has yet to be achieved in the literature. The objective of this study was to investigate inter- and intra-TPBC PDL strain measurement using fibre Bragg grating (FBG) strain sensors. Second and third premolars from the left and the right side of four swine mandibles were removed to yield sixteen TPBC samples. Samples were secured in a miniature load-frame equipped with a digital actuator used to apply apical-directed displacement to the tooth. The same tooth on left and right sides of the mouth were exposed to the same loading condition over ten trials allowing for comparisons in a split-mouth study. Displacements of 0.2 and 0.3mm were considered along with displacement rates of 0.025, 0.05, and 0.1mm/s, yielding six loading combinations. Hypothesis testing between left and right teeth revealed FBGs did not always measure the same strain between left and right TPBCs. For all strain measures, the average coefficient of variation (CV) (all data collected) was 2.16 (range: 0.274-10.71). For repeated measures in single TPBCs, the minimum CV ranged from 0.037 to 0.449, and generally coincided with the time of maximum strain measured over the test duration. Based on the findings of this study, it is suggested that FBGs can provide repeatable ex vivo strain measures in the PDL of complete TPBCs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Anderson, Iain; Teshima, Huzuki; Nolan, Matt; Lapidus, Alla; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Rohde, Manfred; Lang, Elke; Detter, John C.; Göker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2013-01-01
Frateuria aurantia (ex Kondô and Ameyama 1958) Swings et al. 1980 is a member of the bispecific genus Frateuria in the family Xanthomonadaceae, which is already heavily targeted for non-type strain genome sequencing. Strain Kondô 67T was initially (1958) identified as a member of ‘Acetobacter aurantius’, a name that was not considered for the approved list. Kondô 67T was therefore later designated as the type strain of the newly proposed acetogenic species Frateuria aurantia. The strain is of interest because of its triterpenoids (hopane family). F. aurantia Kondô 67T is the first member of the genus Frateura whose genome sequence has been deciphered, and here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,603,458-bp long chromosome with its 3,200 protein-coding and 88 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:24501647
Anderson, Iain; Teshima, Huzuki; Nolan, Matt; ...
2013-10-16
Frateuria aurantia (ex Kondô and Ameyama 1958) Swings et al. 1980 is a member of the bispecific genus Frateuria in the family Xanthomonadaceae, which is already heavily targeted for non-type strain genome sequencing. Strain Kondô 67 T was initially (1958) identified as a member of ‘Acetobacter aurantius’, a name that was not considered for the approved list. Kondô 67 T was therefore later designated as the type strain of the newly proposed acetogenic species Frateuria aurantia. The strain is of interest because of its triterpenoids (hopane family). F. aurantia Kondô 67 T is the first member of the genus Frateuramore » whose genome sequence has been deciphered, and here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,603,458-bp long chromosome with its 3,200 protein-coding and 88 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Hyun, Dong-Wook; Whon, Tae Woong; Cho, Yong-Joon; Chun, Jongsik; Kim, Min-Soo; Jung, Mi-Ja; Shin, Na-Ri; Kim, Joon-Yong; Kim, Pil Soo; Yun, Ji-Hyun; Lee, Jina; Oh, Sei Joon; Bae, Jin-Woo
2013-01-01
Salinicoccus carnicancri Jung et al. 2010 belongs to the genus Salinicoccus in the family Staphylococcaceae. Members of the Salinicoccus are moderately halophilic and originate from various salty environments. The halophilic features of the Salinicoccus suggest their possible uses in biotechnological applications, such as biodegradation and fermented food production. However, the genus Salinicoccus is poorly characterized at the genome level, despite its potential importance. This study presents the draft genome sequence of S. carnicancri strain Crm(T) and its annotation. The 2,673,309 base pair genome contained 2,700 protein-coding genes and 78 RNA genes with an average G+C content of 47.93 mol%. It was notable that the strain carried 72 predicted genes associated with osmoregulation, which suggests the presence of beneficial functions that facilitate growth in high-salt environments.
Genome Sequence of the Symbiotic Type Strain Rhizobium tibeticum CCBAU85039T
Wibberg, Daniel; Winkler, Anika; Ormeño-Orrillo, Ernesto; Martínez-Romero, Esperanza; Niehaus, Karsten; Pühler, Alfred; Kalinowski, Jörn; Lagares, Antonio; Schlüter, Andreas; Pistorio, Mariano
2017-01-01
ABSTRACT Rhizobium tibeticum was originally isolated from root nodules of Trigonella archiducis-nicolai grown in Tibet, China. This species is also able to nodulate Medicago sativa and Phaseolus vulgaris. The whole-genome sequence of the type strain, R. tibeticum CCBAU85039T, is reported in this study. PMID:28126941
Kumar, Ranjan; Mooventhan, A; Manjunath, Nandi Krishnamurthy
2017-08-01
Diabetes mellitus is a major global health problem. Needling at CV-12 has reduced blood glucose level in diabetic rats. The aim of this study was to evaluate the effect of needling at CV-12 (Zhongwan) on blood glucose level in patients with type 2 diabetes mellitus (T2DM). Forty T2DM patients were recruited and randomized into either the acupuncture group or placebo control group. The participants in the acupuncture group were needled at CV-12 (4 cun above the center of the umbilicus), and those in the placebo control group were needled at a placebo point on the right side of the abdomen (1 cun beside the CV-12). For both groups, the needle was retained for 30 minutes. Assessments were performed prior to and after the intervention. Statistical analysis was performed using SPSS version 16. There was a significant reduction in random blood glucose level in the acupuncture group compared to baseline. No such significant change was observed in the placebo control group. The result of this study suggests that 30 minutes of needling at CV-12 might be useful in reducing blood glucose level in patients with T2DM. Copyright © 2017. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Ma, Fengxian; Gao, Guoping; Jiao, Yalong; Gu, Yuantong; Bilic, Ante; Zhang, Haijun; Chen, Zhongfang; Du, Aijun
2016-02-01
Single layered transition metal dichalcogenides have attracted tremendous research interest due to their structural phase diversities. By using a global optimization approach, we have discovered a new phase of transition metal dichalcogenides (labelled as T''), which is confirmed to be energetically, dynamically and kinetically stable by our first-principles calculations. The new T'' MoS2 phase exhibits an intrinsic quantum spin Hall (QSH) effect with a nontrivial gap as large as 0.42 eV, suggesting that a two-dimensional (2D) topological insulator can be achieved at room temperature. Most interestingly, there is a topological phase transition simply driven by a small tensile strain of up to 2%. Furthermore, all the known MX2 (M = Mo or W; X = S, Se or Te) monolayers in the new T'' phase unambiguously display similar band topologies and strain controlled topological phase transitions. Our findings greatly enrich the 2D families of transition metal dichalcogenides and offer a feasible way to control the electronic states of 2D topological insulators for the fabrication of high-speed spintronics devices.Single layered transition metal dichalcogenides have attracted tremendous research interest due to their structural phase diversities. By using a global optimization approach, we have discovered a new phase of transition metal dichalcogenides (labelled as T''), which is confirmed to be energetically, dynamically and kinetically stable by our first-principles calculations. The new T'' MoS2 phase exhibits an intrinsic quantum spin Hall (QSH) effect with a nontrivial gap as large as 0.42 eV, suggesting that a two-dimensional (2D) topological insulator can be achieved at room temperature. Most interestingly, there is a topological phase transition simply driven by a small tensile strain of up to 2%. Furthermore, all the known MX2 (M = Mo or W; X = S, Se or Te) monolayers in the new T'' phase unambiguously display similar band topologies and strain controlled topological
Ouwerkerk, Janneke P; Koehorst, Jasper J; Schaap, Peter J; Ritari, Jarmo; Paulin, Lars; Belzer, Clara; de Vos, Willem M
2017-01-05
Akkermansia glycaniphila is a novel Akkermansia species that was isolated from the intestine of the reticulated python and shares the capacity to degrade mucin with the human strain Akkermansia muciniphila Muc T Here, we report the complete genome sequence of strain Pyt T of 3,074,121 bp. The genomic analysis reveals genes for mucin degradation and aerobic respiration. Copyright © 2017 Ouwerkerk et al.
Ouwerkerk, Janneke P.; Schaap, Peter J.; Ritari, Jarmo; Paulin, Lars; Belzer, Clara
2017-01-01
ABSTRACT Akkermansia glycaniphila is a novel Akkermansia species that was isolated from the intestine of the reticulated python and shares the capacity to degrade mucin with the human strain Akkermansia muciniphila MucT. Here, we report the complete genome sequence of strain PytT of 3,074,121 bp. The genomic analysis reveals genes for mucin degradation and aerobic respiration. PMID:28057747
Proença, Diogo Neves; Espírito Santo, Christophe; Grass, Gregor; Morais, Paula V
2012-09-01
The draft genome sequence of Pseudomonas sp. strain M47T1, carried by the Bursaphelenchus xylophilus pinewood nematode, the causative agent of pine wilt disease, is presented. In Pseudomonas sp. strain M47T1, genes that make this a plant growth-promoting bacterium, as well as genes potentially involved in nematotoxicity, were identified.
Self-assembling of impurity clusters in AlN:(Ga, BV, CV), (BV, CV = P, As; P, Sb; As, Sb)
NASA Astrophysics Data System (ADS)
Elyukhin, V. A.
2015-11-01
The self-assembling conditions of arrays of tetrahedral impurity clusters of two types in zinc blende AlN:(Ga, BV, CV), (BV, CV = P, As; P, Sb; As, Sb) are represented. Doping with one cation and two anion isoelectronic impurities transforms AlN into AlN-rich GaxAl1-xBVyCVzN1-y-z alloy of GaBV, GaCV, GaN, AlBV, AlCV and AlN. The cause of self-assembling is the preference of GaBV, GaCV and AlN bonding over that of GaN, AlBV, AlCV. The conditions are considered from 0 °C to 1000 °C in the dilute and ultra dilute limits for the cation and anion impurities, correspondingly. The temperature ranges between the cluster occurrence and self-assembling completion when the same anion impurities are in clusters are very small. 1P4Ga and 1As4Ga cluster occurrence temperatures are equal, correspondingly, to 797 °C and 736 °C at Ga content 2% and P and As contents 0.01%. 1P4Ga and 1Sb4Ga cluster occurrence temperatures are equal, correspondingly, to 976 °C and 736 °C at the same impurity contents. The cluster densities in AlN:(Ga, As, Sb) are close to those in AlN:(Ga, P, Sb). The results demonstrate that studied semiconductors are promising materials to produce arrays of identical ∼1 nm low band gap objects of two types embedded in the wide band gap matrix.
Simões-Araújo, Jean Luiz; Rumjanek, Norma Gouvêa; Xavier, Gustavo Ribeiro; Zilli, Jerri Édson
The strain BR 3351 T (Bradyrhizobium manausense) was obtained from nodules of cowpea (Vigna unguiculata L. Walp) growing in soil collected from Amazon rainforest. Furthermore, it was observed that the strain has high capacity to fix nitrogen symbiotically in symbioses with cowpea. We report here the draft genome sequence of strain BR 3351 T . The information presented will be important for comparative analysis of nodulation and nitrogen fixation for diazotrophic bacteria. A draft genome with 9,145,311bp and 62.9% of GC content was assembled in 127 scaffolds using 100bp pair-end Illumina MiSeq system. The RAST annotation identified 8603 coding sequences, 51 RNAs genes, classified in 504 subsystems. Published by Elsevier Editora Ltda.
Sakamoto, Mitsuo; Lapidus, Alla L.; Han, James; ...
2015-08-02
Bacteroides barnesiae Lan et al. 2006 is a species of the genus Bacteroides, which belongs to the family Bacteroidaceae. Strain BL2T is of interest because it was isolated from the gut of a chicken and the growing awareness that the anaerobic microbiota of the caecum is of benefit for the host and may impact poultry farming. We report that the 3,621,509 bp long genome with its 3,059 protein-coding and 97 RNA genes is a part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakamoto, Mitsuo; Lapidus, Alla L.; Han, James
Bacteroides barnesiae Lan et al. 2006 is a species of the genus Bacteroides, which belongs to the family Bacteroidaceae. Strain BL2T is of interest because it was isolated from the gut of a chicken and the growing awareness that the anaerobic microbiota of the caecum is of benefit for the host and may impact poultry farming. We report that the 3,621,509 bp long genome with its 3,059 protein-coding and 97 RNA genes is a part of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project.
The relationship between CK and CV chondrites
NASA Astrophysics Data System (ADS)
Greenwood, R. C.; Franchi, I. A.; Kearsley, A. T.; Alard, O.
2010-03-01
CK chondrites are highly oxidized meteorites containing abundant magnetite and trace amounts of Fe,Ni metal. Although the group is predominately composed of equilibrated meteorites (types 4-6), in recent years a significant number of new samples have been classified as being either CK3 or CK3-anomalous. These unequilibrated CKs often display a close affinity with members of the CV oxidized subgroup. CKs and CVs (oxidized subgroup) may therefore form a continuum and by implication could be derived from a single common parent body. To investigate the relationship between these two groups a detailed study of the oxygen isotope composition, opaque mineralogy and major and trace element geochemistry of a suite of CV and CK chondrites has been undertaken. The results of oxygen isotope analysis confirm the close affinity between CV and CK chondrites, while excluding the possibility of a linkage between the CO and CK groups. Magnetites in both CV and CK chondrites show significant compositional similarities, but high Ti contents are a diagnostic feature of the latter group. The results of major and trace element analysis demonstrate that both CV and CK chondrites show overlapping variation. Supporting evidence for a single common source for both groups comes from their similar cosmic-ray exposure age distributions. Recent reflectance spectral analysis is consistent with both the CVs and CKs being derived from Eos family asteroids, which are believed to have formed by the catastrophic disruption of a single large asteroid. Thus, a range of evidence appears to be consistent with CV and CK chondrites representing samples from a single thermally stratified parent body. In view of the close similarity between CV and CK chondrites some modification of the present classification scheme may be warranted, possibly involving integration of the two groups. One means of achieving this would be to reassigned CK chondrites to a subgroup of the oxidized CVs. It is recognized that a full
Watanabe, Miho; Tokizawa, Riho; Kojima, Hisaya; Fukui, Manabu
2017-01-01
10.1601/nm.25721 strain skLN1 T is the type strain of the type species in the genus 10.1601/nm.25720 which is the one of the genera in the family 10.1601/nm.5070 within the phylum 10.1601/nm.3874. 10.1601/nm.25721 strain skLN1 T is a Gram-positive, spore-forming thermophilic neutrophile isolated from freshwater lake sediment. Here, we present the draft genome sequence of strain skLN1 T , which consists of 3,902,380 bp with a G + C content of 50.38%.
Genome Sequence of the Symbiotic Type Strain Rhizobium tibeticum CCBAU85039T.
Torres Tejerizo, Gonzalo; Wibberg, Daniel; Winkler, Anika; Ormeño-Orrillo, Ernesto; Martínez-Romero, Esperanza; Niehaus, Karsten; Pühler, Alfred; Kalinowski, Jörn; Lagares, Antonio; Schlüter, Andreas; Pistorio, Mariano
2017-01-26
Rhizobium tibeticum was originally isolated from root nodules of Trigonella archiducis-nicolai grown in Tibet, China. This species is also able to nodulate Medicago sativa and Phaseolus vulgaris The whole-genome sequence of the type strain, R. tibeticum CCBAU85039 T , is reported in this study. Copyright © 2017 Torres Tejerizo et al.
Complete genome sequence of Parvibaculum lavamentivorans type strain (DS-1(T)).
Schleheck, David; Weiss, Michael; Pitluck, Sam; Bruce, David; Land, Miriam L; Han, Shunsheng; Saunders, Elizabeth; Tapia, Roxanne; Detter, Chris; Brettin, Thomas; Han, James; Woyke, Tanja; Goodwin, Lynne; Pennacchio, Len; Nolan, Matt; Cook, Alasdair M; Kjelleberg, Staffan; Thomas, Torsten
2011-12-31
Parvibaculum lavamentivorans DS-1(T) is the type species of the novel genus Parvibaculum in the novel family Rhodobiaceae (formerly Phyllobacteriaceae) of the order Rhizobiales of Alphaproteobacteria. Strain DS-1(T) is a non-pigmented, aerobic, heterotrophic bacterium and represents the first tier member of environmentally important bacterial communities that catalyze the complete degradation of synthetic laundry surfactants. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,914,745 bp long genome with its predicted 3,654 protein coding genes is the first completed genome sequence of the genus Parvibaculum, and the first genome sequence of a representative of the family Rhodobiaceae.
Singh, Aditya; Sreenivas, Ara; Sathyanarayana Reddy, Gundlapally; Pinnaka, Anil Kumar; Shivaji, Sisinthy
2014-07-24
The 4.3-Mb genome of Lutibaculum baratangense strain AMV1(T), isolated from a soil sample collected from a mud volcano in Andamans, India, is reported. The draft genome of strain Lutibaculum baratangense AMV1(T) consists of 4,300,776 bp with a G+C content of 66.93 mol% and 4,198 predicted coding regions, including 56 RNAs. Copyright © 2014 Singh et al.
Opaque Assemblages in CK and CV Carbonaceous Chondrites
NASA Technical Reports Server (NTRS)
Neff, K. E.; Righter, K.
2006-01-01
CK carbonaceous chondrites are the only group of carbonaceous chondrites that exhibit thermal metamorphism. As a result, CKs display features of metamorphism such as silicate darkening, recrystallization and shock veins. Calcium Aluminum Inclusions and Fe-Ni metal are rare. CV carbonaceous chondrites are unequilibrated and have two subgroups; oxidized and reduced. The CV and CK carbonaceous chondrite groups have been compared to each other often because of petrographic similarities, such as overlapping oxygen isotopic ratios. Scientists have suggested the two groups of carbonaceous chondrites formed from the same parent body and CKs are equilibrated CV chondrites [1, 2]. The oxidized CV group has been most closely related to CKs. This study examines the petrology and mineralogy of CKs and CVs focusing on opaque minerals found in the meteorites. Using the oxide, metal and sulfide assemblages, constraints can be placed on the temperature and oxygen fugacity at which the meteorites equilibrated. The temperature and oxygen fugacity of the CK and CV chondrites can be compared in order to help define their formation history.
Complete genome sequence of Hippea maritima type strain (MH2T)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huntemann, Marcel; Lu, Megan; Nolan, Matt
2011-01-01
Hippea maritima (Miroshnichenko et al. 1999) is the type species of the genus Hippea, which belongs to the family Desulfurellaceae within the class Deltaproteobacteria. The anaerobic, moderately thermophilic marine sulfur-reducer was first isolated from shallow-water hot vents in Matipur Harbor, Papua New Guinea. H. maritima was of interest for genome se- quencing because of its isolated phylogenetic location, as a distant next neighbor of the ge- nus Desulfurella. Strain MH2T is the first type strain from the order Desulfurellales with a com- pletely sequenced genome. The 1,694,430 bp long linear genome with its 1,723 protein- coding and 57 RNA genesmore » consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Louie, Tiffany S.; Giovannelli, Donato; Yee, Nathan
Sedimenticola selenatireducens strain AK4OH1 T (= DSM 17993 T = ATCC BAA-1233 T) is a microaerophilic bacterium isolated from sediment from the Arthur Kill intertidal strait between New Jersey and Staten Island, NY. S. selenatireducens is Gram-negative and belongs to the Gammaproteobacteria. Strain AK4OH1 T was the first representative of its genus to be isolated for its unique coupling of the oxidation of aromatic acids to the respiration of selenate. It is a versatile heterotroph and can use a variety of carbon compounds, but can also grow lithoautotrophically under hypoxic and anaerobic conditions. Furthermore, the draft genome comprises 4,588,530 bpmore » and 4276 predicted protein-coding genes including genes for the anaerobic degradation of 4-hydroxybenzoate and benzoate. We report the main features of the genome of S. selenatireducens strain AK4OH1 T.« less
Louie, Tiffany S.; Giovannelli, Donato; Yee, Nathan; ...
2016-09-08
Sedimenticola selenatireducens strain AK4OH1 T (= DSM 17993 T = ATCC BAA-1233 T) is a microaerophilic bacterium isolated from sediment from the Arthur Kill intertidal strait between New Jersey and Staten Island, NY. S. selenatireducens is Gram-negative and belongs to the Gammaproteobacteria. Strain AK4OH1 T was the first representative of its genus to be isolated for its unique coupling of the oxidation of aromatic acids to the respiration of selenate. It is a versatile heterotroph and can use a variety of carbon compounds, but can also grow lithoautotrophically under hypoxic and anaerobic conditions. Furthermore, the draft genome comprises 4,588,530 bpmore » and 4276 predicted protein-coding genes including genes for the anaerobic degradation of 4-hydroxybenzoate and benzoate. We report the main features of the genome of S. selenatireducens strain AK4OH1 T.« less
Lee, Hae-Won; Kim, Dae-Won; Lee, Mi-Hwa; Kim, Byung-Yong; Cho, Yong-Joon; Yim, Kyung June; Song, Hye Seon; Rhee, Jin-Kyu; Seo, Myung-Ji; Choi, Hak-Jong; Choi, Jong-Soon; Lee, Dong-Gi; Yoon, Changmann; Nam, Young-Do; Roh, Seong Woon
2015-01-01
An extremely halophilic archaeon, Haladaptatus cibarius D43(T), was isolated from traditional Korean salt-rich fermented seafood. Strain D43(T) shows the highest 16S rRNA gene sequence similarity (98.7 %) with Haladaptatus litoreus RO1-28(T), is Gram-negative staining, motile, and extremely halophilic. Despite potential industrial applications of extremely halophilic archaea, their genome characteristics remain obscure. Here, we describe the whole genome sequence and annotated features of strain D43(T). The 3,926,724 bp genome includes 4,092 protein-coding and 57 RNA genes (including 6 rRNA and 49 tRNA genes) with an average G + C content of 57.76 %.
Complete genome sequence of Streptobacillus moniliformis type strain (9901T)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nolan, Matt; Gronow, Sabine; Lapidus, Alla L.
2009-01-01
Streptobacillus moniliformis Levaditi et al. 1925 is the sole and type species of the genus, and is of phylogenetic interest because of its isolated location in the sparsely populated and neither taxonomically nor genomically much accessed family 'Leptotrichiaceae' within the phylum 'Fusobacteria'. S. moniliformis, a Gram-negative, non-motile and pleomorphic bacterium, is the etiologic agent of rat bite fever and Haverhill fever. Strain 9901T, the type strain of the species, was isolated from a patient with rat bite fever. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is only the second completedmore » genome sequence of the order 'Fusobacteriales' and no more than the third sequence from the phylum 'Fusobacteria'. The 1,662,578 bp long chromosome and the 10,702 bp plasmid with a total of 1511 protein-coding and 55 RNA genes are part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Draft Genome Sequence of Pseudomonas pachastrellae Strain CCUG 46540T, a Deep-Sea Bacterium
2017-01-01
ABSTRACT Pseudomonas pachastrellae strain CCUG 46540T (KMM 330T) was isolated from a deep-sea sponge specimen collected in the Philippine Sea at a depth of 750 m. The draft genome has an estimated size of 4.0 Mb, exhibits a G+C content of 61.2 mol%, and is predicted to encode 3,592 proteins, including pathways for the degradation of aromatic compounds. PMID:28385850
Sobol, Eyal; Bialer, Meir
2004-05-01
In the one-compartment model following i.v. administration the mean residence time (MRT) of a drug is always greater than its half-life (t(1/2)). However, following i.v. administration, drug plasma concentration (C) versus time (t) is best described by a two-compartment model or a two exponential equation:C=Ae(-alpha t)+Be(-beta t), where A and B are concentration unit-coefficients and alpha and beta are exponential coefficients. The relationships between t(1/2) and MRT in the two-compartment model have not been explored and it is not clear whether in this model too MRT is always greater than t(1/2). In the current paper new equations have been developed that describe the relationships between the terminal t(1/2) (or t(1/2 beta)) and MRT in the two-compartment model following administration of i.v. bolus, i.v. infusion (zero order input) and oral administration (first order input). A critical value (CV) equals to the quotient of (1-ln2) and (1-beta/alpha) (CV=(1-ln2)/(1-beta/alpha)=0.307/(1-beta/alpha)) has been derived and was compared with the fraction (f(1)) of drug elimination or AUC (AUC-area under C vs t curve) associated with the first exponential term of the two-compartment equation (f(1)=A/alpha/AUC). Following i.v. bolus, CV ranges between a minimal value of 0.307 (1-ln2) and infinity. As long as f(1)<CV,MRT>t(1/2) and vice versa, and when f(1)=CV, then MRT=t(1/2). Following i.v. infusion and oral administration the denominator of the CV equation does not change but its numerator increases to (0.307+beta T/2) (T-infusion duration) and (0.307+beta/ka) (ka-absorption rate constant), respectively. Examples of various drugs are provided. For every drug that after i.v. bolus shows two-compartment disposition kinetics the following conclusions can be drawn (a) When f(1)<0.307, then f(1)<CV and thus, MRT>t(1/2). (b) When beta/alpha>ln2, then CV>1>f(1) and thus(,) MRT>t(1/2). (c) When ln2>beta/alpha>(ln4-1), then 1>CV>0.5 and thus, in order for t(1/2)>MRT, f(1
Fully moderated T-statistic for small sample size gene expression arrays.
Yu, Lianbo; Gulati, Parul; Fernandez, Soledad; Pennell, Michael; Kirschner, Lawrence; Jarjoura, David
2011-09-15
Gene expression microarray experiments with few replications lead to great variability in estimates of gene variances. Several Bayesian methods have been developed to reduce this variability and to increase power. Thus far, moderated t methods assumed a constant coefficient of variation (CV) for the gene variances. We provide evidence against this assumption, and extend the method by allowing the CV to vary with gene expression. Our CV varying method, which we refer to as the fully moderated t-statistic, was compared to three other methods (ordinary t, and two moderated t predecessors). A simulation study and a familiar spike-in data set were used to assess the performance of the testing methods. The results showed that our CV varying method had higher power than the other three methods, identified a greater number of true positives in spike-in data, fit simulated data under varying assumptions very well, and in a real data set better identified higher expressing genes that were consistent with functional pathways associated with the experiments.
Physicochemical characterization of a new pineapple hybrid (FLHORAN41 Cv.).
Brat, Pierre; Hoang, Lan Nguyen Thi; Soler, Alain; Reynes, Max; Brillouet, Jean-Marc
2004-10-06
The physicochemical characteristics (pH, total and soluble solids, and titratable acidity), sugars, organic acids, carotenoids, anthocyanins, volatile compounds, and cell wall polysaccharides of a new pineapple hybrid (FLHORAN41 cultivar) were measured throughout maturation and compared with the Smooth Cayenne cv. At full maturity, the FLHORAN41 cv. has a higher titratable acidity and soluble solids content than the Smooth Cayenne cv. The golden yellow flesh and red-orange to scarlet shell of ripe FLHORAN41 cv. fruits are due to carotenoid and anthocyanin levels that are, respectively, 2.5 and 1.5 times higher than those of the flesh and shell of the ripe Smooth Cayenne cv., respectively. During maturation of the FLHORAN41 cv., there was an increase in all classes of aroma compounds (mainly terpene hydrocarbons and esters), although their relative proportions were similar in both cultivars at full maturity. Cell wall polysaccharides undergo little change during maturation.
Ogg, Christopher D.; Patel, Bharat K. C.
2011-01-01
Caloramator australicus strain RC3T (JCM 15081T = KCTC 5601T) is the type strain of a newly identified thermophilic species, which was isolated from red microbial mats that thrive at 66°C in the runoff channel of a Great Artesian Basin bore (New Lorne bore, registered number 17263) in outback Queensland, Australia. The ability of the C. australicus strain to use metals as terminal electron acceptors has led to concerns that it could colonize and enhance corrosion of the metal casing of Great Artesian Basin bore well pipes and that this could subsequently lead to bore failure and loss of water availability for the community which is so reliant on it. The genome of the C. australicus strain has been sequenced, and annotation of the ∼2.65-Mb sequence indicates that the attributes are consistent with physiological and phenotypic traits. PMID:21421756
Bang, Casper N; Devereux, Richard B; Okin, Peter M
2014-01-01
Cornell product criteria, Sokolow-Lyon voltage criteria and electrocardiographic (ECG) strain (secondary ST-T abnormalities) are markers for left ventricular hypertrophy (LVH) and adverse prognosis in population studies. However, the relationship of regression of ECG LVH and strain during antihypertensive therapy to cardiovascular (CV) risk was unclear before the Losartan Intervention for Endpoint Reduction in Hypertension (LIFE) study. We reviewed findings on ECG LVH regression and strain over time in 9193 hypertensive patients with ECG LVH at baseline enrolled in the LIFE study. The composite endpoint of CV death, nonfatal MI, or stroke occurred in 1096 patients during 4.8±0.9years follow-up. In Cox multivariable models adjusting for randomized treatment, known risk factors including in-treatment blood pressure, and for severity ECG LVH by Cornell product and Sokolow-Lyon voltage, baseline ECG strain was associated with a 33% higher risk of the LIFE composite endpoint (HR. 1.33, 95% CI [1.11-1.59]). Development of new ECG strain between baseline and year-1 was associated with a 2-fold increased risk of the composite endpoint (HR. 2.05, 95% CI [1.51-2.78]), whereas the risk associated with regression or persistence of ECG strain was attenuated and no longer statistically significant (both p>0.05). After controlling for treatment with losartan or atenolol, for baseline Framingham risk score, Cornell product, and Sokolow-Lyon voltage, and for baseline and in-treatment systolic and diastolic blood pressure, 1 standard deviation (SD) lower in-treatment Cornell product was associated with a 14.5% decrease in the composite endpoint (HR. 0.86, 95% CI [0.82-0.90]). In a parallel analysis, 1 SD lower in-treatment Sokolow-Lyon voltage was associated with a 16.6% decrease in the composite endpoint (HR. 0.83, 95% CI [0.78-0.88]). The LIFE study shows that evaluation of both baseline and in-study ECG LVH defined by Cornell product criteria, Sokolow-Lyon voltage criteria or
Junker, F; Saller, E; Schläfli Oppenberg, H R; Kroneck, P M; Leisinger, T; Cook, A M
1996-09-01
Three multicomponent oxygenases involved in the degradation of p-toluenesulfonate and p-toluenecarboxylate and the regulation of their synthesis have been examined in three strains (T-2, PSB-4 and TER-1) of Comamonas testosteroni. Strain T-2 utilizes p-toluenesulfonate as a source of carbon and energy for growth via p-sulfobenzoate and protocatechuate, and p-toluenecarboxylate via terephthalate and protocatechuate, and has the unusual property of requiring the reductase (TsaB) of the toluenesulfonate methyl monooxygenase system (TsaMB) in an incompletely expressed sulfobenzoate dioxygenase system (PsbAC) [Schläfli Oppenberg, H.R., Chen, G., Leisinger, T. & Cook, A. M. (1995). Microbiology 141, 1891-1899]. The independently isolated C. testosteroni PSB-4 utilized only sulfobenzoate and terephthalate via protocatechuate. Mutant TER-1, derived from strain T-2, utilized only terephthalate via protocatechuate. We detected no enzymes of the pathway from toluenesulfonate to sulfobenzoate in strains PSB-4 and TER-1, and confirmed by PCR and Southern blot analysis that the genes (tsaMB) encoding toluenesulfonate monooxygenase were absent. We concluded that, in strain PSB-4, the regulatory unit encoding the genes for the conversion of toluenesulfonate to sulfobenzoate was missing, and that generation of mutant TER-1 involved deletion of this regulatory unit and of the regulatory unit encoding desulfonation of sulfobenzoate. The degradation of sulfobenzoate in strain PSB-4 was catalysed by a fully inducible sulfobenzoate dioxygenase system (PsbACPSB-4), which, after purification of the oxygenase component (PsbAPSB-4), turned out to be indistinguishable from the corresponding component from strain T-2 (PsbAT-2). Reductase PsbCPSB-4, which we could separate but not purify, was active with oxygenase PsbAPSB-4 and PsbAT-2. Oxygenase PsbAPSB-4 was shown by electron paramagnetic resonance spectroscopy to contain a Rieske [2Fe-2S] centre. The enzyme system oxygenating terephthalate
Kumar, Roshan; Dwivedi, Vatsala; Negi, Vivek; Khurana, J. P.
2013-01-01
Sphingobium lactosutens DS20T has been isolated from the hexachlorocyclohexane (HCH) dumpsite in Lucknow, India, but does not degrade any of the HCH isomers. Here, we present the ~5.36-Mb draft genome sequence of strain DS20T, which consists of 110 contigs and 5,288 coding sequences, with a G+C content of 63.1%. PMID:24051323
Draft Genome Sequence of Pseudomonas pachastrellae Strain CCUG 46540T, a Deep-Sea Bacterium.
Gomila, Margarita; Mulet, Magdalena; Lalucat, Jorge; García-Valdés, Elena
2017-04-06
Pseudomonas pachastrellae strain CCUG 46540 T (KMM 330 T ) was isolated from a deep-sea sponge specimen collected in the Philippine Sea at a depth of 750 m. The draft genome has an estimated size of 4.0 Mb, exhibits a G+C content of 61.2 mol%, and is predicted to encode 3,592 proteins, including pathways for the degradation of aromatic compounds. Copyright © 2017 Gomila et al.
Luedin, Samuel M; Pothier, Joël F; Danza, Francesco; Storelli, Nicola; Frigaard, Niels-Ulrik; Wittwer, Matthias; Tonolla, Mauro
2018-01-01
" Thiodictyon syntrophicum" sp. nov. strain Cad16 T is a photoautotrophic purple sulfur bacterium belonging to the family of Chromatiaceae in the class of Gammaproteobacteria . The type strain Cad16 T was isolated from the chemocline of the alpine meromictic Lake Cadagno in Switzerland. Strain Cad16 T represents a key species within this sulfur-driven bacterial ecosystem with respect to carbon fixation. The 7.74-Mbp genome of strain Cad16 T has been sequenced and annotated. It encodes 6237 predicted protein sequences and 59 RNA sequences. Phylogenetic comparison based on 16S rRNA revealed that Thiodictyon elegans strain DSM 232 T the most closely related species. Genes involved in sulfur oxidation, central carbon metabolism and transmembrane transport were found. Noteworthy, clusters of genes encoding the photosynthetic machinery and pigment biosynthesis are found on the 0.48 Mb plasmid pTs485. We provide a detailed insight into the Cad16 T genome and analyze it in the context of the microbial ecosystem of Lake Cadagno.
Tripathi, Charu; Mahato, Nitish K; Rani, Pooja; Singh, Yogendra; Kamra, Komal; Lal, Rup
2016-01-01
Lampropedia cohaerens strain CT6(T), a non-motile, aerobic and coccoid strain was isolated from arsenic rich microbial mats (temperature ~45 °C) of a hot water spring located atop the Himalayan ranges at Manikaran, India. The present study reports the first genome sequence of type strain CT6(T) of genus Lampropedia cohaerens. Sequencing data was generated using the Illumina HiSeq 2000 platform and assembled with ABySS v 1.3.5. The 3,158,922 bp genome was assembled into 41 contigs with a mean GC content of 63.5 % and 2823 coding sequences. Strain CT6(T) was found to harbour genes involved in both the Entner-Duodoroff pathway and non-phosphorylated ED pathway. Strain CT6(T) also contained genes responsible for imparting resistance to arsenic, copper, cobalt, zinc, cadmium and magnesium, providing survival advantages at a thermal location. Additionally, the presence of genes associated with biofilm formation, pyrroloquinoline-quinone production, isoquinoline degradation and mineral phosphate solubilisation in the genome demonstrate the diverse genetic potential for survival at stressed niches.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siddaramappa, Shivakumara; Delano, Susana; Green, Lance D.
2012-01-01
Dehalogenimonas lykanthroporepellens is the type species of the genus Dehalogenimonas, which belongs to a deeply branching lineage within the phylum Chloroflexi. This strictly anaerobic, mesophilic, non spore forming, Gram negative staining bacterium was first isolated from chlorinated solvent contaminated groundwater at a Superfund site located near Baton Rouge, Louisiana, USA. D. lykanthroporepellens was of interest for genome sequencing for two reasons: (a) its unusual ability to couple growth with reductive dechlorination of environmentally important polychlorinated aliphatic alkanes and (b) its phylogenetic position distant from previously sequenced bacteria. The 1,686,510 bp circular chromosome of strain BL-DC-9{sup T} contains 1,720 predicted proteinmore » coding genes, 47 tRNA genes, a single large subunit rRNA (23S-5S) locus, and a single, orphan, small unit rRNA (16S) locus.« less
Handisurya, Alessandra; Day, Patricia M.; Thompson, Cynthia D.; Bonelli, Michael; Lowy, Douglas R.; Schiller, John T.
2014-01-01
The immunocytes that regulate papillomavirus infection and lesion development in humans and animals remain largely undefined. We found that immunocompetent mice with varying H-2 haplotypes displayed asymptomatic skin infection that produced L1 when challenged with 6×1010 MusPV1 virions, the recently identified domestic mouse papillomavirus (also designated “MmuPV1”), but were uniformly resistant to MusPV1-induced papillomatosis. Broad immunosuppression with cyclosporin A resulted in variable induction of papillomas after experimental infection with a similar dose, from robust in Cr:ORL SENCAR to none in C57BL/6 mice, with lesional outgrowth correlating with early viral gene expression and partly with reported strain-specific susceptibility to chemical carcinogens, but not with H-2 haplotype. Challenge with 1×1012 virions in the absence of immunosuppression induced small transient papillomas in Cr:ORL SENCAR but not in C57BL/6 mice. Antibody-induced depletion of CD3+ T cells permitted efficient virus replication and papilloma formation in both strains, providing experimental proof for the crucial role of T cells in controlling papillomavirus infection and associated disease. In Cr:ORL SENCAR mice, immunodepletion of either CD4+ or CD8+ T cells was sufficient for efficient infection and papillomatosis, although deletion of one subset did not inhibit the recruitment of the other subset to the infected epithelium. Thus, the functional cooperation of CD4+ and CD8+ T cells is required to protect this strain. In contrast, C57BL/6 mice required depletion of both CD4+ and CD8+ T cells for infection and papillomatosis, and separate CD4 knock-out and CD8 knock-out C57BL/6 were also resistant. Thus, in C57BL/6 mice, either CD4+ or CD8+ T cell-independent mechanisms exist that can protect this particular strain from MusPV1-associated disease. These findings may help to explain the diversity of pathological outcomes in immunocompetent humans after infection with a specific
Reduced and unstratified crust in CV chondrite parent body.
Ganino, Clément; Libourel, Guy
2017-08-15
Early Solar System planetesimal thermal models predict the heating of the chondritic protolith and the preservation of a chondritic crust on differentiated parent bodies. Petrological and geochemical analyses of chondrites have suggested that secondary alteration phases formed at low temperatures (<300 °C) by fluid-rock interaction where reduced and oxidized Vigarano type Carbonaceous (CV) chondrites witness different physicochemical conditions. From a thermodynamical survey of Ca-Fe-rich secondary phases in CV3 chondrites including silica activity (aSiO 2 ), here we show that the classical distinction between reduced and oxidized chondrites is no longer valid and that their Ca-Fe-rich secondary phases formed in similar reduced conditions near the iron-magnetite redox buffer at low aSiO 2 (log(aSiO 2 ) <-1) and moderate temperature (210-610 °C). The various lithologies in CV3 chondrites are inferred to be fragments of an asteroid percolated heterogeneously via porous flow of hydrothermal fluid. Putative 'onion shell' structures are not anymore a requirement for the CV parent body crust.Meteorites may unlock the history of the early solar system. Here, the authors find, through Ca-Fe-rich secondary phases, that the distinction between reduced and oxidized CV chondrites is invalid; therefore, CV3 chondrites are asteroid fragments that percolated heterogeneously via porous flow of hydrothermal fluid.
Yu, Chang-You; Chou, Shih-Jen; Yeh, Chia-Ming; Chao, Maw-Rong; Huang, Kwo-Ching; Chang, Yung-Fu; Chiou, Chien-Shun; Weill, Francois-Xavier; Chiu, Cheng-Hsun; Chu, Chi-Hong; Chu, Chishih
2008-02-01
Salmonella enterica serovar Typhimurium strains of phage types DT104 and U302 are often resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline (the ACSSuT resistance type) and are major zoonotic pathogens. Increased consumption of goose meat may enhance the risk of transferring S. enterica serovar Typhimurium and other enteric pathogens from geese to human due to the consumption of meats from infected geese or improper preparation of meats. Therefore, we characterized S. enterica serovar Typhimurium strains isolated from four goose farms (farms A, B, C, and D) and one hatchery farm (farm E) to determine the epidemic and genetic differences among them. Antibiotic susceptibility tests and multiplex PCR confirmed that 77.6% (52/67) of strains were ACSSuT strains isolated from farms A, C, and E. Antibiotic-susceptible strains were isolated mostly from farm B, and no strain was observed in farm D. All ACSSuT strains harbored a 94.7-kb virulence plasmid and contained one 1.1-kb conserved segment identical to that of Salmonella genomic island 1. Four genotypes were determined among these S. enterica serovar Typhimurium isolates by pulsed-field gel electrophoresis analysis of XbaI-digested DNA fragments. Most isolates (85.29%; 29/34) of major genotype Ib were ACSSuT strains isolated mainly from goslings of farm C and egg membranes of farm E, a hatchery farm, suggesting that S. enterica serovar Typhimurium strains in isolates from goslings might originate from its hatchery, from the egg membranes to the gosling fluff after hatching. Multiple phage types, types 8, 12, U283, DT104, and U302, were identified. In conclusion, geese were a reservoir of diverse multidrug-resistant (type ACSSuT) S. enterica serovar Typhimurium strains, and each farm was colonized with genetically closely related S. enterica serovar Typhimurium strains.
Nicholson, Wayne L.; Davis, Christina L.; Shapiro, Nicole; ...
2016-09-08
Despite their ubiquity and their involvement in food spoilage, the genus Carnobacterium remains rather sparsely characterized at the genome level. Carnobacterium inhibens K1 T is a member of the Carnobacteriaceae family within the class Bacilli. This strain is a Gram-positive, rod-shaped bacterium isolated from the intestine of an Atlantic salmon. The present study determined the genome sequence and annotation of Carnobacterium inhibens K1 T. The genome comprised 2,748,608 bp with a G+C content of 34.85 %, which included 2621 protein-coding genes and 116 RNA genes. The strain contained five contigs corresponding to presumptive plasmids of sizes: 19,036; 24,250; 26,581; 65,272;more » and 65,904 bp.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicholson, Wayne L.; Davis, Christina L.; Shapiro, Nicole
Despite their ubiquity and their involvement in food spoilage, the genus Carnobacterium remains rather sparsely characterized at the genome level. Carnobacterium inhibens K1 T is a member of the Carnobacteriaceae family within the class Bacilli. This strain is a Gram-positive, rod-shaped bacterium isolated from the intestine of an Atlantic salmon. The present study determined the genome sequence and annotation of Carnobacterium inhibens K1 T. The genome comprised 2,748,608 bp with a G+C content of 34.85 %, which included 2621 protein-coding genes and 116 RNA genes. The strain contained five contigs corresponding to presumptive plasmids of sizes: 19,036; 24,250; 26,581; 65,272;more » and 65,904 bp.« less
NASA Technical Reports Server (NTRS)
Rigby, Jane Rebecca; Bayliss, M. B.; Gladders, M. D.; Sharon, K.; Wuyts, E.; Dahle, H.
2014-01-01
We examine the Mg II 2796, 2803 Angstrom, Lyman alpha, and nebular line emission in five bright star-forming galaxies at 1.66 less than z less than 1.91 that have been gravitationally lensed by foreground galaxy clusters. All five galaxies show prominent Mg II emission and absorption in a P Cygni profile. We find no correlation between the equivalent widths of Mg II and Lyman alpha emission. The Mg II emission has a broader range of velocities than do the nebular emission line profiles; the Mg II emission is redshifted with respect to systemic by 100 to 200 km s(exp-1). When present, Lyman alpha is even more redshifted. The reddest components of Mg II and Lyman alpha emission have tails to 500-600 km s(exp-1), implying a strong outflow. The lack of correlation in the Mg II and Lyman alpha equivalent widths, the differing velocity profiles, and the high ratios of Mg II to nebular line fluxes together suggest that the bulk of Mg II emission does not ultimately arise as nebular line emission, but may instead be reprocessed stellar continuum emission.
Meier-Kolthoff, Jan P; Hahnke, Richard L; Petersen, Jörn; Scheuner, Carmen; Michael, Victoria; Fiebig, Anne; Rohde, Christine; Rohde, Manfred; Fartmann, Berthold; Goodwin, Lynne A; Chertkov, Olga; Reddy, Tbk; Pati, Amrita; Ivanova, Natalia N; Markowitz, Victor; Kyrpides, Nikos C; Woyke, Tanja; Göker, Markus; Klenk, Hans-Peter
2014-01-01
Although Escherichia coli is the most widely studied bacterial model organism and often considered to be the model bacterium per se, its type strain was until now forgotten from microbial genomics. As a part of the G enomic E ncyclopedia of B acteria and A rchaea project, we here describe the features of E. coli DSM 30083(T) together with its genome sequence and annotation as well as novel aspects of its phenotype. The 5,038,133 bp containing genome sequence includes 4,762 protein-coding genes and 175 RNA genes as well as a single plasmid. Affiliation of a set of 250 genome-sequenced E. coli strains, Shigella and outgroup strains to the type strain of E. coli was investigated using digital DNA:DNA-hybridization (dDDH) similarities and differences in genomic G+C content. As in the majority of previous studies, results show Shigella spp. embedded within E. coli and in most cases forming a single subgroup of it. Phylogenomic trees also recover the proposed E. coli phylotypes as monophyla with minor exceptions and place DSM 30083(T) in phylotype B2 with E. coli S88 as its closest neighbor. The widely used lab strain K-12 is not only genomically but also physiologically strongly different from the type strain. The phylotypes do not express a uniform level of character divergence as measured using dDDH, however, thus an alternative arrangement is proposed and discussed in the context of bacterial subspecies. Analyses of the genome sequences of a large number of E. coli strains and of strains from > 100 other bacterial genera indicate a value of 79-80% dDDH as the most promising threshold for delineating subspecies, which in turn suggests the presence of five subspecies within E. coli.
Szabó, Zsolt; Gyula, Péter; Robotka, Hermina; Bató, Emese; Gálik, Bence; Pach, Péter; Pekker, Péter; Papp, Ildikó; Bihari, Zoltán
2015-01-01
Methylibium sp. strain T29 was isolated from a gasoline-contaminated aquifer and proved to have excellent capabilities in degrading some common fuel oxygenates like methyl tert-butyl ether, tert-amyl methyl ether and tert-butyl alcohol along with other organic compounds. Here, we report the draft genome sequence of M. sp. strain T29 together with the description of the genome properties and its annotation. The draft genome consists of 608 contigs with a total size of 4,449,424 bp and an average coverage of 150×. The genome exhibits an average G + C content of 68.7 %, and contains 4754 protein coding and 52 RNA genes, including 48 tRNA genes. 71 % of the protein coding genes could be assigned to COG (Clusters of Orthologous Groups) categories. A formerly unknown circular plasmid designated as pT29A was isolated and sequenced separately and found to be 86,856 bp long.
Draft Genome Sequence of the Psychrophilic and Alkaliphilic Rhodonellum psychrophilum Strain GCM71T
Hauptmann, Aviaja L.; Glaring, Mikkel A.; Hallin, Peter F.; Priemé, Anders
2013-01-01
Rhodonellum psychrophilum GCM71T, isolated from the cold and alkaline submarine ikaite columns in the Ikka Fjord in Greenland, displays optimal growth at 5 to 10°C and pH 10. Here, we report the draft genome sequence of this strain, which may provide insight into the mechanisms of adaptation to these extreme conditions. PMID:24309741
Draft Genome Sequence of the Psychrophilic and Alkaliphilic Rhodonellum psychrophilum Strain GCM71T.
Hauptmann, Aviaja L; Glaring, Mikkel A; Hallin, Peter F; Priemé, Anders; Stougaard, Peter
2013-12-05
Rhodonellum psychrophilum GCM71(T), isolated from the cold and alkaline submarine ikaite columns in the Ikka Fjord in Greenland, displays optimal growth at 5 to 10°C and pH 10. Here, we report the draft genome sequence of this strain, which may provide insight into the mechanisms of adaptation to these extreme conditions.
Castellani, John W; Spitz, Marissa G; Karis, Anthony J; Martini, Svein; Young, Andrew J; Margolis, Lee M; Phillip Karl, J; Murphy, Nancy E; Xu, Xiaojiang; Montain, Scott J; Bohn, Jamie A; Teien, Hilde K; Stenberg, Pål H; Gundersen, Yngvar; Pasiakos, Stefan M
2017-01-01
Cardiovascular (CV) and thermal responses to metabolically demanding multi-day military operations in extreme cold-weather environments are not well described. Characterization of these operations will provide greater insights into possible performance capabilities and cold injury risk. Soldiers from two cold-weather field training exercises (FTX) were studied during 3-day (study 1, n = 18, age: 20 ± 1 year, height: 182 ± 7 cm, mass: 82 ± 9 kg) and 4-day (study 2, n = 10, age: 20 ± 1 year, height: 182 ± 6 cm, mass: 80.7 ± 8.3 kg) ski marches in the Arctic. Ambient temperature ranged from -18 to -4 °C during both studies. Total daily energy expenditure (TDEE, from doubly labeled water), heart rate (HR), deep body ( T pill ), and torso ( T torso ) skin temperature (obtained in studies 1 and 2) as well as finger ( T fing ), toe ( T toe ), wrist, and calf temperatures (study 2) were measured. TDEE was 6821 ± 578 kcal day -1 and 6394 ± 544 for study 1 and study 2, respectively. Mean HR ranged from 120 to 140 bpm and mean T pill ranged between 37.5 and 38.0 °C during skiing in both studies. At rest, mean T pill ranged from 36.0 to 36.5 °C, (lowest value recorded was 35.5 °C). Mean T fing ranged from 32 to 35 °C during exercise and dropped to 15 °C during rest, with some T fing values as low as 6-10 °C. T toe was above 30 °C during skiing but dropped to 15-20 °C during rest. Daily energy expenditures were among the highest observed for a military training exercise, with moderate exercise intensity levels (~65% age-predicted maximal HR) observed. The short-term cold-weather training did not elicit high CV and T pill strain. T fing and T toe were also well maintained while skiing, but decreased to values associated with thermal discomfort at rest.
EARTH, MOON, SUN, AND CV ACCRETION DISKS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Montgomery, M. M.
2009-11-01
Net tidal torque by the secondary on a misaligned accretion disk, like the net tidal torque by the Moon and the Sun on the equatorial bulge of the spinning and tilted Earth, is suggested by others to be a source to retrograde precession in non-magnetic, accreting cataclysmic variable (CV) dwarf novae (DN) systems that show negative superhumps in their light curves. We investigate this idea in this work. We generate a generic theoretical expression for retrograde precession in spinning disks that are misaligned with the orbital plane. Our generic theoretical expression matches that which describes the retrograde precession of Earths'more » equinoxes. By making appropriate assumptions, we reduce our generic theoretical expression to those generated by others, or to those used by others, to describe retrograde precession in protostellar, protoplanetary, X-ray binary, non-magnetic CV DN, quasar, and black hole systems. We find that spinning, tilted CV DN systems cannot be described by a precessing ring or by a precessing rigid disk. We find that differential rotation and effects on the disk by the accretion stream must be addressed. Our analysis indicates that the best description of a retrogradely precessing spinning, tilted, CV DN accretion disk is a differentially rotating, tilted disk with an attached rotating, tilted ring located near the innermost disk annuli. In agreement with the observations and numerical simulations by others, we find that our numerically simulated CV DN accretion disks retrogradely precess as a unit. Our final, reduced expression for retrograde precession agrees well with our numerical simulation results and with selective observational systems that seem to have main-sequence secondaries. Our results suggest that a major source to retrograde precession is tidal torques like that by the Moon and the Sun on the Earth. In addition, these tidal torques should be common to a variety of systems where one member is spinning and tilted, regardless
Limited geographic distribution of the novel cyclovirus CyCV-VN.
Le, Van Tan; de Jong, Menno D; Nguyen, Van Kinh; Nguyen, Vu Trung; Taylor, Walter; Wertheim, Heiman F L; van der Ende, Arie; van der Hoek, Lia; Canuti, Marta; Crusat, Martin; Sona, Soeng; Nguyen, Hanh Uyen; Giri, Abhishek; Nguyen, Thi Thuy Chinh Bkrong; Ho, Dang Trung Nghia; Farrar, Jeremy; Bryant, Juliet E; Tran, Tinh Hien; Nguyen, Van Vinh Chau; van Doorn, H Rogier
2014-02-05
A novel cyclovirus, CyCV-VN, was recently identified in cerebrospinal fluid (CSF) from patients with central nervous system (CNS) infections in central and southern Vietnam. To explore the geographic distribution of this novel virus, more than 600 CSF specimens from patients with suspected CNS infections in northern Vietnam, Cambodia, Nepal and The Netherlands were screened for the presence of CyCV-VN but all were negative. Sequence comparison and phylogenetic analysis between CyCV-VN and another novel cyclovirus recently identified in CSF from Malawian patients indicated that these represent distinct cycloviral species, albeit phylogenetically closely related. The data suggest that CyCV-VN has a limited geographic distribution within southern and central Vietnam. Further research is needed to determine the global distribution and diversity of cycloviruses and importantly their possible association with human disease.
Jiao, Jian-Yu; Carro, Lorena; Liu, Lan; ...
2017-02-03
Jiangella gansuensis strain YIM 002 T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon. The genome of J. gansuensis strainmore » YIM 002T contains a single scaffold of size 5,585,780 bp, which involves 149 pseudogenes, 4905 protein-coding genes and 50 RNA genes, including 2520 hypothetical proteins and 4 rRNA genes. From the investigation of genome sizes of Jiangella species, J. gansuensis shows a smaller size, which indicates this strain might have discarded too much genetic information to adapt to desert environment. Seven new compounds from this bacterium have recently been described; however, its potential should be higher, as secondary metabolite gene cluster analysis predicted 60 gene clusters, including the potential to produce the pristinamycin.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiao, Jian-Yu; Carro, Lorena; Liu, Lan
Jiangella gansuensis strain YIM 002 T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon. The genome of J. gansuensis strainmore » YIM 002T contains a single scaffold of size 5,585,780 bp, which involves 149 pseudogenes, 4905 protein-coding genes and 50 RNA genes, including 2520 hypothetical proteins and 4 rRNA genes. From the investigation of genome sizes of Jiangella species, J. gansuensis shows a smaller size, which indicates this strain might have discarded too much genetic information to adapt to desert environment. Seven new compounds from this bacterium have recently been described; however, its potential should be higher, as secondary metabolite gene cluster analysis predicted 60 gene clusters, including the potential to produce the pristinamycin.« less
Tornow, J; Polvino-Bodnar, M; Santangelo, G; Cole, C N
1985-01-01
The carboxyl-terminal portion of simian virus 40 large T antigen is essential for productive infection of CV-1 and CV-1p green monkey kidney cells. Mutant dlA2459, lacking 14 base pairs at 0.193 map units, was positive for viral DNA replication, but unable to form plaques in CV-1p cells (J. Tornow and C.N. Cole, J. Virol. 47:487-494, 1983). In this report, the defect of dlA2459 is further defined. Simian virus 40 late mRNAs were transcribed, polyadenylated, spliced, and transported in dlA2459-infected cells, but the level of capsid proteins produced in infected CV-1 green monkey kidney cells was extremely low. dlA2459 large T antigen lacks those residues known to be required for adenovirus helper function, and the block to productive infection by dlA2459 occurs at the same stage of infection as the block to productive adenovirus infection of CV-1 cells. These results suggest that the adenovirus helper function is required for productive infection by simian virus 40. Mutant dlA2459 was able to grow on the Vero and BSC-1 lines of African green monkey kidney cells. Additional mutants affecting the carboxyl-terminal portion of large T were prepared. Mutant inv2408 contains an inversion of the DNA between the BamHI and BclI sites (0.144 to 0.189 map units). This inversion causes transposition of the carboxyl-terminal 26 amino acids of large T antigen and the carboxyl-terminal 18 amino acids of VP1. This mutant was viable, even though the essential information absent from dlA2459 large T antigen has been transferred to the carboxyl terminus of VP1 of inv2408. The VP1 polypeptide carrying this carboxyl-terminal portion of large T could overcome the defect of dlA2459. This indicates that the carboxyl terminus of large T antigen is a separate and separable functional domain. Images PMID:2982029
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Meyer, Sofie E.; Tian, Rui; Seshadri, Rekha
Burkholderia dilworthii strain WSM3556T is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective N2-fixing root nodule of Lebeckia ambigua collected near Grotto Bay Nature Reserve, in the Western Cape of South Africa, in October 2004. This plant persists in infertile and deep sandy soils with acidic pH, and is therefore an ideal candidate for a perennial based agriculture system in Western Australia. WSM3556T thus represents a potential inoculant quality strain for L. ambigua for which we describe the general features, together with genome sequence and annotation. Lastly, the 7,679,067 bp high-quality permanent draft genome is arrangedmore » in 140 scaffolds of 141 contigs, contains 7,059 protein-coding genes and 64 RNA-only encoding genes, and is part of the GEBA-RNB project proposal.« less
De Meyer, Sofie E.; Tian, Rui; Seshadri, Rekha; ...
2015-09-19
Burkholderia dilworthii strain WSM3556T is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective N2-fixing root nodule of Lebeckia ambigua collected near Grotto Bay Nature Reserve, in the Western Cape of South Africa, in October 2004. This plant persists in infertile and deep sandy soils with acidic pH, and is therefore an ideal candidate for a perennial based agriculture system in Western Australia. WSM3556T thus represents a potential inoculant quality strain for L. ambigua for which we describe the general features, together with genome sequence and annotation. Lastly, the 7,679,067 bp high-quality permanent draft genome is arrangedmore » in 140 scaffolds of 141 contigs, contains 7,059 protein-coding genes and 64 RNA-only encoding genes, and is part of the GEBA-RNB project proposal.« less
Anonymous voting for multi-dimensional CV quantum system
NASA Astrophysics Data System (ADS)
Rong-Hua, Shi; Yi, Xiao; Jin-Jing, Shi; Ying, Guo; Moon-Ho, Lee
2016-06-01
We investigate the design of anonymous voting protocols, CV-based binary-valued ballot and CV-based multi-valued ballot with continuous variables (CV) in a multi-dimensional quantum cryptosystem to ensure the security of voting procedure and data privacy. The quantum entangled states are employed in the continuous variable quantum system to carry the voting information and assist information transmission, which takes the advantage of the GHZ-like states in terms of improving the utilization of quantum states by decreasing the number of required quantum states. It provides a potential approach to achieve the efficient quantum anonymous voting with high transmission security, especially in large-scale votes. Project supported by the National Natural Science Foundation of China (Grant Nos. 61272495, 61379153, and 61401519), the Research Fund for the Doctoral Program of Higher Education of China (Grant No. 20130162110012), and the MEST-NRF of Korea (Grant No. 2012-002521).
Alcohol and CV Health: Jekyll and Hyde J-Curves.
O'Keefe, Evan L; DiNicolantonio, James J; O'Keefe, James H; Lavie, Carl J
2018-02-16
A routine of light or moderate alcohol consumption (≤1 drink/day for women and 1 to 2 drinks/day for men) is associated with a lower risk for all-cause mortality, coronary artery disease (CAD), type 2 diabetes mellitus (T2D), heart failure (HF), and stroke. Conversely, heavy drinking, (>4 drinks/day) is associated with an increased risk for death and cardiovascular (CV) disease (CVD). Excessive alcohol intake trails behind only smoking and obesity among the 3 leading causes of premature deaths in the United States (US). Heavy alcohol use is a common cause of reversible hypertension (HTN), nonischemic dilated cardiomyopathy, atrial fibrillation (AF), and stroke (both ischemic and hemorrhagic). Among males aged 15 to 59 years, alcohol abuse is perhaps the leading cause of premature death. As such, the risk-to-benefit ratio of drinking is less favorable in younger individuals. A daily habit of light to moderate drinking is ideal for those who choose to consume alcohol regularly. Red wine in particular before or during the evening meal is linked with the best long-term CV outcomes. Most of the studies on alcohol and health are observational, and correlation does not prove causation. Health care professionals should not advise nondrinkers to begin drinking because of the paucity of randomized outcome data coupled with the potential for alcohol abuse even among seemingly low risk individuals. Copyright © 2017. Published by Elsevier Inc.
Blum, Jodi Switzer; Han, Sukkyun; Lanoil, Brian; Saltikov, Chad; Witte, Brian; Tabita, F Robert; Langley, Sean; Beveridge, Terry J; Jahnke, Linda; Oremland, Ronald S
2009-04-01
Searles Lake occupies a closed basin harboring salt-saturated, alkaline brines that have exceptionally high concentrations of arsenic oxyanions. Strain SLAS-1(T) was previously isolated from Searles Lake (R. S. Oremland, T. R. Kulp, J. Switzer Blum, S. E. Hoeft, S. Baesman, L. G. Miller, and J. F. Stolz, Science 308:1305-1308, 2005). We now describe this extremophile with regard to its substrate affinities, its unusual mode of motility, sequenced arrABD gene cluster, cell envelope lipids, and its phylogenetic alignment within the order Halanaerobacteriales, assigning it the name "Halarsenatibacter silvermanii" strain SLAS-1(T). We also report on the substrate dynamics of an anaerobic enrichment culture obtained from Searles Lake that grows under conditions of salt saturation and whose members include a novel sulfate reducer of the order Desulfovibriales, the archaeon Halorhabdus utahensis, as well as a close homolog of strain SLAS-1(T).
Patil, Yogita; Müller, Nicolai; Schink, Bernhard; ...
2017-02-20
Anaerobium acetethylicum strain GluBS11 T belongs to the family Lachnospiraceae within the order Clostridiales. It is a Gram-positive, non-motile and strictly anaerobic bacterium isolated from biogas slurry that was originally enriched with gluconate as carbon source (Patil, et al., Int J Syst Evol Microbiol 65:3289-3296, 2015). Here we describe the draft genome sequence of strain GluBS11 T and provide a detailed insight into its physiological and metabolic features. The draft genome sequence generated 4,609,043 bp, distributed among 105 scaffolds assembled using the SPAdes genome assembler method. It comprises in total 4,132 genes, of which 4,008 were predicted to be proteinmore » coding genes, 124 RNA genes and 867 pseudogenes. The content was 43.51 mol %. The annotated genome of strain GluBS11 T contains putative genes coding for the pentose phosphate pathway, the Embden-Meyerhoff-Parnas pathway, the Entner-Doudoroff pathway and the tricarboxylic acid cycle. The genome revealed the presence of most of the necessary genes required for the fermentation of glucose and gluconate to acetate, ethanol, and hydrogen gas. However, a candidate gene for production of formate was not identified.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patil, Yogita; Müller, Nicolai; Schink, Bernhard
Anaerobium acetethylicum strain GluBS11 T belongs to the family Lachnospiraceae within the order Clostridiales. It is a Gram-positive, non-motile and strictly anaerobic bacterium isolated from biogas slurry that was originally enriched with gluconate as carbon source (Patil, et al., Int J Syst Evol Microbiol 65:3289-3296, 2015). Here we describe the draft genome sequence of strain GluBS11 T and provide a detailed insight into its physiological and metabolic features. The draft genome sequence generated 4,609,043 bp, distributed among 105 scaffolds assembled using the SPAdes genome assembler method. It comprises in total 4,132 genes, of which 4,008 were predicted to be proteinmore » coding genes, 124 RNA genes and 867 pseudogenes. The content was 43.51 mol %. The annotated genome of strain GluBS11 T contains putative genes coding for the pentose phosphate pathway, the Embden-Meyerhoff-Parnas pathway, the Entner-Doudoroff pathway and the tricarboxylic acid cycle. The genome revealed the presence of most of the necessary genes required for the fermentation of glucose and gluconate to acetate, ethanol, and hydrogen gas. However, a candidate gene for production of formate was not identified.« less
Sade, Leyla Elif; Hazirolan, Tuncay; Kozan, Hatice; Ozdemir, Handan; Hayran, Mutlu; Eroglu, Serpil; Pirat, Bahar; Sezgin, Atilla; Muderrisoglu, Haldun
2018-04-14
The aim of this study was to test the hypothesis that echocardiographic strain imaging, by tracking subtle alterations in myocardial function, and cardiac magnetic resonance T1 mapping, by quantifying tissue properties, are useful and complement each other to detect acute cellular rejection in heart transplant recipients. Noninvasive alternatives to endomyocardial biopsy are highly desirable to monitor acute cellular rejection. Surveillance endomyocardial biopsies, catheterizations, and echocardiograms performed serially according to institutional protocol since transplantation were retrospectively reviewed. Sixteen-segment global longitudinal strain (GLS) and circumferential strain were measured before, during, and after the first rejection and at 2 time points for patients without rejection using Velocity Vector Imaging for the first part of the study. The second part, with cardiac magnetic resonance added to the protocol, served to validate previously derived strain cutoffs, examine the progression of strain over time, and to determine the accuracy of strain and T1 measurements to define acute cellular rejection. All tests were performed within 48 h. Median time to first rejection (16 grade 1 rejection, 15 grade ≥2 rejection) was 3 months (interquartile range: 3 to 36 months) in 49 patients. GLS and global circumferential strain worsened significantly during grade 1 rejection and ≥2 rejection and were independent predictors of any rejection. In the second part of the study, T1 time ≥1,090 ms, extracellular volume ≥32%, GLS >-14%, and global circumferential strain ≥-24% had 100% sensitivity and 100% negative predictive value to define grade ≥2 rejection with 70%, 63%, 55%, and 35% positive predictive values, respectively. The combination of GLS >-16% and T1 time ≥1,060 ms defined grade 1 rejection with 91% sensitivity and 92% negative predictive value. After successful treatment, T1 times decreased significantly. T1 mapping and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rae, Philip J; Trujillo, Carl; Lovato, Manuel
2009-01-01
The assumption that Young's modulus is strain-rate invariant is tested for 6061-T6 aluminium alloy and 1018 steel over 10 decades of strain-rate. For the same billets of material, 3 quasi-static strain-rates are investigated with foil strain gauges at room temperature. The ultrasonic sound speeds are measured and used to calculate the moduli at approximately 10{sup 4} s{sup -1}. Finally, ID plate impact is used to generate an elastic pre-cursor in the alloys at a strain-rate of approximately 10{sup 6} s{sup -1} from which the longitudinal sound speed may be obtained. It is found that indeed the Young's modulus is strain-ratemore » independent within the experimental accuracy.« less
Verwaaijen, Bart; Wibberg, Daniel; Nelkner, Johanna; Gordin, Miriam; Rupp, Oliver; Winkler, Anika; Bremges, Andreas; Blom, Jochen; Grosch, Rita; Pühler, Alfred; Schlüter, Andreas
2018-02-10
Lettuce (Lactuca sativa, L.) is an important annual plant of the family Asteraceae (Compositae). The commercial lettuce cultivar Tizian has been used in various scientific studies investigating the interaction of the plant with phytopathogens or biological control agents. Here, we present the de novo draft genome sequencing and gene prediction for this specific cultivar derived from transcriptome sequence data. The assembled scaffolds amount to a size of 2.22 Gb. Based on RNAseq data, 31,112 transcript isoforms were identified. Functional predictions for these transcripts were determined within the GenDBE annotation platform. Comparison with the cv. Salinas reference genome revealed a high degree of sequence similarity on genome and transcriptome levels, with an average amino acid identity of 99%. Furthermore, it was observed that two large regions are either missing or are highly divergent within the cv. Tizian genome compared to cv. Salinas. One of these regions covers the major resistance complex 1 region of cv. Salinas. The cv. Tizian draft genome sequence provides a valuable resource for future functional and transcriptome analyses focused on this lettuce cultivar. Copyright © 2017 Elsevier B.V. All rights reserved.
Xie, Cheng-Hui; Yokota, Akira
2005-11-01
The aim of this study was to clarify the taxonomic position of the nitrogen-fixing and hydrogen-oxidizing bacteria Alcaligenes latus strains IAM 12599T, IAM 12664 and IAM 12665 and Pseudomonas saccharophila IAM 14368T. It was found that the type strain of Alcaligenes latus, IAM 12599T, showed 99 x 9 and 96 x 1 % 16S rRNA gene sequence similarity to strains IAM 12665 and IAM 12664, respectively. A comparison using DNA-DNA hybridization suggested that strains IAM 12599T and IAM 12665 belong to a single species (89 x 7 %) and that strain IAM 12664 (35 x 1 %) forms a separate species. The phenotypic characteristics also support the conclusion that these bacteria should be identified as two species of a new genus: Azohydromonas lata gen. nov., comb. nov. (type strain IAM 12599T=DSM 1122T=LMG 3321T=ATCC 29712T; reference strain IAM 12665=DSM 1123=LMG 3325=ATCC 29714) and Azohydromonas australica sp. nov. (type strain IAM 12664T=DSM 1124T=LMG 3324T=ATCC 29713T). Pseudomonas saccharophila IAM 14368T was found to be closely related to the phototrophic bacterium Roseateles depolymerans, with 96 x 8 % 16S rRNA gene sequence similarity, but the two bacteria are quite different with respect to their metabolism and some significant phenotypic characteristics, suggesting that they cannot be included in a single genus. Further studies on their nifH gene sequences, G+C content of the DNA and cellular fatty acid composition confirm that Pseudomonas saccharophila should be reclassified: the name Pelomonas saccharophila gen. nov., comb. nov. is proposed, with the type strain IAM 14368T (=LMG 2256T=ATCC 15946T).
Hallén, Jonas; Johansen, Odd Erik; Birkeland, Kåre I; Gullestad, Lars; Aakhus, Svend; Endresen, Knut; Tjora, Solve; Jaffe, Allan S; Atar, Dan
2010-09-15
The cardiac troponins are biomarkers used for diagnosis of myocardial injury. They are also powerful prognostic markers in many diseases and settings. Recently introduced high-sensitivity assays indicate that chronic cardiac troponin elevations are common in response to cardiovascular (CV) morbidity. Type 2 diabetes mellitus (T2DM) confers a high risk of CV disease, but little is known about chronic cardiac troponin elevations in diabetic subjects. Accordingly, we aimed to understand the prevalence, determinants, and prognostic implications of cardiac troponin T (cTnT) elevations measured with a high-sensitivity assay in patients with T2DM. cTnT was measured in stored, frozen serum samples from 124 subjects enrolled in the Asker and Bærum Cardiovascular Diabetes trial at baseline and at 2-year follow-up, if available (96 samples available). Results were analyzed in relation to baseline variables, hospitalizations, and group assignment (multifactorial intensive versus conventional diabetes care for lowering CV risk). One-hundred thirteen (90%) had detectable cTnT at baseline and of those, 22 (18% of the total population) subjects had values above the 99th percentile for healthy controls (13.5 ng/L). Levels at baseline were associated with conventional CV risk factors (age, renal function, gender). There was a strong correlation between cTnT levels at the two time-points (r=0.92, p>0.001). Risk for hospitalizations during follow-up increased step-wise by quartiles of hscTnT measured at baseline (p=0.058). Elevations of cTnT above the 99th percentile measured by a highly sensitive assay were encountered frequently in a population of T2DM patients. cTnT levels appeared to be stable over time and associated with conventional CV risk factors. Although a clear trend was present, no statistically robust associations with adverse outcomes could be found.
Blum, J.S.; Han, S.; Lanoil, B.; Saltikov, C.; Witte, B.; Tabita, F.R.; Langley, S.; Beveridge, T.J.; Jahnke, L.; Oremland, R.S.
2009-01-01
Searles Lake occupies a closed basin harboring salt-saturated, alkaline brines that have exceptionally high concentrations of arsenic oxyanions. Strain SLAS-1T was previously isolated from Searles Lake (R. S. Oremland, T. R. Kulp, J. Switzer Blum, S. E. Hoeft, S. Baesman, L. G. Miller, and J. F. Stolz, Science 308:1305-1308, 2005). We now describe this extremophile with regard to its substrate affinities, its unusual mode of motility, sequenced arrABD gene cluster, cell envelope lipids, and its phylogenetic alignment within the order Halanaero-bacteriales, assigning it the name "Halarsenatibacter silvermanii" strain SLAS-1T. We also report on the substrate dynamics of an anaerobic enrichment culture obtained from Searles Lake that grows under conditions of salt saturation and whose members include a novel sulfate reducer of the order Desulfovibriales, the archaeon Halorhabdus utahensis, as well as a close homolog of strain SLAS-1T. Copyright ?? 2009, American Society for Microbiology. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.
Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less
Zhou, En -Min; Murugapiran, Senthil K.; Mefferd, Chrisabelle C.; ...
2016-02-27
Thermus amyloliquefaciens type strain YIM 77409 T is a thermophilic, Gram-negative, non-motile and rod-shaped bacterium isolated from Niujie Hot Spring in Eryuan County, Yunnan Province, southwest China. In the present study we describe the features of strain YIM 77409 T together with its genome sequence and annotation. The genome is 2,160,855 bp long and consists of 6 scaffolds with 67.4 % average GC content. A total of 2,313 genes were predicted, comprising 2,257 protein-coding and 56 RNA genes. The genome is predicted to encode a complete glycolysis, pentose phosphate pathway, and tricarboxylic acid cycle. Additionally, a large number of transportersmore » and enzymes for heterotrophy highlight the broad heterotrophic lifestyle of this organism. Furthermore, a denitrification gene cluster included genes predicted to encode enzymes for the sequential reduction of nitrate to nitrous oxide, consistent with the incomplete denitrification phenotype of this strain.« less
Peña, Arantxa; Busquets, Antonio; Gomila, Margarita; ...
2016-09-01
Pseudomonas has the highest number of species out of any genus of Gram-negative bacteria and is phylogenetically divided into several groups. The Pseudomonas putida phylogenetic branch includes at least 13 species of environmental and industrial interest, plant-associated bacteria, insect pathogens, and even some members that have been found in clinical specimens. In the context of the Genomic Encyclopedia of Bacteria and Archaea project, we present the permanent, high-quality draft genomes of the type strains of 3 taxonomically and ecologically closely related species in the Pseudomonas putida phylogenetic branch: Pseudomonas fulva DSM 17717 T, Pseudomonas parafulva DSM 17004 T and Pseudomonasmore » cremoricolorata DSM 17059T. All three genomes are comparable in size (4.6-4.9Mb), with 4,119-4,459 protein-coding genes. Average nucleotide identity based on BLAST comparisons and digital genome-to-genome distance calculations are in good agreement with experimental DNA-DNA hybridization results. The genome sequences presented here will be very helpful in elucidating the taxonomy, phylogeny and evolution of the Pseudomonas putida species complex.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peña, Arantxa; Busquets, Antonio; Gomila, Margarita
Pseudomonas has the highest number of species out of any genus of Gram-negative bacteria and is phylogenetically divided into several groups. The Pseudomonas putida phylogenetic branch includes at least 13 species of environmental and industrial interest, plant-associated bacteria, insect pathogens, and even some members that have been found in clinical specimens. In the context of the Genomic Encyclopedia of Bacteria and Archaea project, we present the permanent, high-quality draft genomes of the type strains of 3 taxonomically and ecologically closely related species in the Pseudomonas putida phylogenetic branch: Pseudomonas fulva DSM 17717 T, Pseudomonas parafulva DSM 17004 T and Pseudomonasmore » cremoricolorata DSM 17059T. All three genomes are comparable in size (4.6-4.9Mb), with 4,119-4,459 protein-coding genes. Average nucleotide identity based on BLAST comparisons and digital genome-to-genome distance calculations are in good agreement with experimental DNA-DNA hybridization results. The genome sequences presented here will be very helpful in elucidating the taxonomy, phylogeny and evolution of the Pseudomonas putida species complex.« less
Hosking, Jamie; Rasanathan, Kumanan; Mow, Florina Chan; Jackson, Catherine; Martin, Diana; O'Hallahan, Jane; Oster, Philipp; Ypma, Ellen; Reid, Stewart; Aaberge, Ingeborg; Crengle, Sue; Stewart, Joanna; Lennon, Diana
2007-11-01
New Zealand (NZ) has experienced a Neisseria meningitidis serogroup B epidemic since 1991. MeNZB, a strain-specific outer membrane vesicle vaccine made using an NZ epidemic strain isolate, NZ98/254 (B:4:P1.7b,4), from two manufacturing sites, the Norwegian Institute of Public Health (NIPH) and Chiron Vaccines (CV; now Novartis), was evaluated for safety, immunogenicity, and reactogenicity in this observer-blind trial with 8- to 12-year-old children. In year 1, cohort A (n = 302) was randomized 4:1 for receipt of NIPH-MeNZB or MenBvac (Norwegian parent vaccine strain 44/76; B:15:P1.7,16). In year 2, cohort B (n = 313) was randomized 4:1 for receipt of CV-MeNZB or NIPH-MeNZB. Participants all received three vaccinations 6 weeks apart. Local and systemic reactions were monitored for 7 days. Seroresponse was defined as a fourfold or greater rise in the serum bactericidal antibody titer from the baseline titer as measured by a serum bactericidal assay. Those with baseline titers of <1:4 required titers of >/=1:8 to serorespond. Intention-to-treat (ITT) and per protocol (PP) analyses are presented. In cohort A, 74% (ITT) and 73% (PP) of NIPH-MeNZB recipients demonstrated seroresponses against NZ98/254 after three doses, versus 32% (ITT and PP) of MenBvac recipients. In cohort B, seroresponses against NZ98/254 after three doses occurred in 79% (ITT and PP) of CV-MeNZB versus 75% (ITT) and 76% (PP) of NIPH-MeNZB recipients. Vaccines were tolerable, with no vaccine-related serious adverse events. In conclusion, the NZ strain meningococcal B vaccine (MeNZB) from either manufacturing site was immunogenic against New Zealand epidemic vaccine strain meningococci with no safety concerns when given in three doses to these 8- to 12-year-old children.
Nohynek, L J; Nurmiaho-Lassila, E L; Suhonen, E L; Busse, H J; Mohammadi, M; Hantula, J; Rainey, F; Salkinoja-Salonen, M S
1996-10-01
Gram-negative polychlorophenol-degrading bacterial strains KF1T (T = type strain), KF3, and NKF1, which were described previously as Pseudomonas saccharophila strains, were studied by chemotaxonomic, genetic, and physiological methods and by electron microscopy and compared with selected xenobiotic compound-degrading bacteria. These strains contained sphingolipids with d-18:0, d-20:1, and d-21:1 as the main dihydrosphingosines, ubiquinone 10 as the main respiratory quinone, and spermidine as the major polyamine, and the DNA G + C content was 66 mol%. The cellular fatty acids included about 60% octadecenoic acid, 9% 2-hydroxymyristic acid, 14% cis-9-hexadecenoic acid, and 10% hexadecanoic acid. These strains exhibited less than 97% 16S ribosomal DNA sequence similarity to all of the other taxa studied. In the DNA-DNA reassociation studies the highest levels of reassociation between these strains and previously described species were less than 40%. Thin sections of cells of strains KF1T, KF3, and NKF1 were examined by electron microscopy, and the results showed that the cells had peculiar concentrically arranged layered membranous blebs that extruded from the outer membrane, especially at the cell division points. On the basis of the results of this study, polychlorophenol-degrading strains KF1T, KF3, and NKF1 are considered members of a new species of the genus Sphingomonas, Sphingomonas subarctica. The polycyclic aromatic hydrocarbon-degrading organism Sphingomonas paucimobilis EPA 505 was closely related to Sphingomonas chlorophenolica as determined by chemotaxonomic, phylogenetic, and physiological criteria. The xenobiotic compound degraders Alcaligenes sp. strain A175 and Pseudomonas sp. strain BN6 were identified as members of species of the genus Sphingomonas.
Magnetic characteristics of CV chondrules with paleointensity implications
NASA Astrophysics Data System (ADS)
Emmerton, Stacey; Muxworthy, Adrian R.; Hezel, Dominik C.; Bland, Philip A.
2011-12-01
We have conducted a detailed magnetic study on 45 chondrules from two carbonaceous chondrites of the CV type: (1) Mokoia and (2) Allende. Allende has been previously extensively studied and is thought to have a high potential of retaining an extra-terrestrial paleofield. Few paleomagnetic studies of Mokoia have previously been undertaken. We report a range of magnetic measurements including hysteresis, first-order reversal curve analysis (FORCs), demagnetization characteristics, and isothermal remanent (IRM) acquisition behavior on both Mokoia and Allende chondrules. The Mokoia chondrules displayed more single domain-like behavior than the Allende chondrules, suggesting smaller grain sizes and higher magnetic stability. The Mokoia chondrules also had higher average concentrations of magnetic minerals and a larger range of magnetic characteristics than the Allende chondrules. IRM acquisition analysis found that both sets of chondrules have the same dominant magnetic mineral, likely to be a FeNi phase (taenite, kamacite, and/or awaruite) contributing to 48% of the Mokoia chondrules and 42% of the Allende chondrule characteristics. FORC analysis revealed that generally the Allende chondrules displayed low-field coercivity distributions with little interactions, and the Mokoia chondrules show clear single-domain like distributions. Paleointensity estimates for the two meteorites using the REMc and Preisach methods yielded estimates between 13 and 60 μT and 3-56 μT, respectively, for Allende and 3-140 μT and 1-110 μT, respectively, for Mokoia. From the data, we suggest that Mokoia chondrules carry a non-primary remagnetization, and while Allende is more likely than Mokoia to retain its primary magnetization, it also displays signs of post accretionary magnetization.
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Zhang, Qiaoling; Liu, Xinsheng; Fang, Yuzhen; Zhou, Peng; Wang, Yonglu; Zhang, Yongguang
2017-10-10
Large-scale outbreaks of porcine epidemic diarrhea (PED) have re-emerged in China in recent years. However, little is known about the genetic diversity and molecular epidemiology of field strains of PED virus (PEDV) in China in 2016-2017. To address this issue, in this study, 116 diarrhea samples were collected from pig farms in 6 Chinese provinces in 2016-2017 and were detected using PCR for main porcine enteric pathogens, including PEDV, porcine deltacoronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV) and porcine kobuvirus (PKV). In addition, the complete S genes from 11 representative PEDV strains were sequenced and analyzed. PCR detection showed that 52.6% (61/116) of these samples were positive for PEDV. Furthermore, sequencing results for the spike (S) genes from 11 of the epidemic PEDV strains showed 93-94% nucleotide identity and 92-93% amino acid identity with the classical CV777 strain. Compared with the CV777 vaccine strain, these strains had an insertion (A 133 ), a deletion (G 155 ), and a continuous 4-amino-acid insertion ( 56 NNTN 59 ) in the S1 region. Phylogenetic analysis based on the S gene indicated that the 11 assessed PEDV strains were genetically diverse and clustered into the G2 group. These results demonstrate that the epidemic strains of PEDV in China in 2016-2017 are mainly virulent strains that belong to the G2 group and genetically differ from the vaccine strain. Importantly, this is the first report that the samples collected in Hainan Province were positive for PEDV (59.2%, 25/42). To our knowledge, this article presents the first report of a virulent PEDV strain isolated from Hainan Island, China. The results of this study will contribute to the understanding of the epidemiology and genetic characteristics of PEDV in China.
2010-01-01
Background The cardiac troponins are biomarkers used for diagnosis of myocardial injury. They are also powerful prognostic markers in many diseases and settings. Recently introduced high-sensitivity assays indicate that chronic cardiac troponin elevations are common in response to cardiovascular (CV) morbidity. Type 2 diabetes mellitus (T2DM) confers a high risk of CV disease, but little is known about chronic cardiac troponin elevations in diabetic subjects. Accordingly, we aimed to understand the prevalence, determinants, and prognostic implications of cardiac troponin T (cTnT) elevations measured with a high-sensitivity assay in patients with T2DM. Methods cTnT was measured in stored, frozen serum samples from 124 subjects enrolled in the Asker and Bærum Cardiovascular Diabetes trial at baseline and at 2-year follow-up, if availabe (96 samples available). Results were analyzed in relation to baseline variables, hospitalizations, and group assignment (multifactorial intensive versus conventional diabetes care for lowering CV risk). Results One-hundred thirteen (90 %) had detectable cTnT at baseline and of those, 22 (18 % of the total population) subjects had values above the 99th percentile for healthy controls (13.5 ng/L). Levels at baseline were associated with conventional CV risk factors (age, renal function, gender). There was a strong correlation between cTnT levels at the two time-points (r = 0.92, p > 0.001). Risk for hospitalizations during follow-up increased step-wise by quartiles of hscTnT measured at baseline (p = 0.058). Conclusions Elevations of cTnT above the 99th percentile measured by a highly sensitive assay were encountered frequently in a population of T2DM patients. cTnT levels appeared to be stable over time and associated with conventional CV risk factors. Although a clear trend was present, no statistically robust associations with adverse outcomes could be found. PMID:20843304
Dynamic Behavior of AA2519-T8 Aluminum Alloy Under High Strain Rate Loading in Compression
NASA Astrophysics Data System (ADS)
Olasumboye, A. T.; Owolabi, G. M.; Odeshi, A. G.; Yilmaz, N.; Zeytinci, A.
2018-06-01
In this study, the effects of strain rate on the dynamic behavior, microstructure evolution and hence, failure of the AA2519-T8 aluminum alloy were investigated under compression at strain rates ranging from 1000 to 3500 s-1. Cylindrical specimens of dimensions 3.3 mm × 3.3 mm (L/D = 1) were tested using the split-Hopkinson pressure bar integrated with a digital image correlation system. The microstructure of the alloy was assessed using optical and scanning electron microscopes. Results showed that the dynamic yield strength of the alloy is strain rate dependent, with the maximum yield strength attained by the material being 500 MPa. The peak flow stress of 562 MPa was attained by the material at 3500 s-1. The alloy also showed a significant rate of strain hardening that is typical of other Al-Cu alloys; the rate of strain hardening, however, decreased with increase in strain rate. It was determined that the strain rate sensitivity coefficient of the alloy within the range of high strain rates used in this study is approximately 0.05 at 0.12 plastic strain; a more significant value than what was reported in literature under quasi-static loading. Micrographs obtained showed potential sites for the evolution of adiabatic shear band at 3500 s-1, with a characteristic circular-shaped surface profile comprising partially dissolved second phase particles in the continuous phase across the incident plane of the deformed specimen. The regions surrounding the site showed little or no change in the size of particles. However, the constituent coarse particles were observed as agglomerations of fractured pieces, thus having a shape factor different from those contained in the as-received alloy. Since the investigated alloy is a choice material for military application where it can be exposed to massive deformation at high strain rates, this study provides information on its microstructural and mechanical responses to such extreme loading condition.
Dynamic Behavior of AA2519-T8 Aluminum Alloy Under High Strain Rate Loading in Compression
NASA Astrophysics Data System (ADS)
Olasumboye, A. T.; Owolabi, G. M.; Odeshi, A. G.; Yilmaz, N.; Zeytinci, A.
2018-02-01
In this study, the effects of strain rate on the dynamic behavior, microstructure evolution and hence, failure of the AA2519-T8 aluminum alloy were investigated under compression at strain rates ranging from 1000 to 3500 s-1. Cylindrical specimens of dimensions 3.3 mm × 3.3 mm (L/D = 1) were tested using the split-Hopkinson pressure bar integrated with a digital image correlation system. The microstructure of the alloy was assessed using optical and scanning electron microscopes. Results showed that the dynamic yield strength of the alloy is strain rate dependent, with the maximum yield strength attained by the material being 500 MPa. The peak flow stress of 562 MPa was attained by the material at 3500 s-1. The alloy also showed a significant rate of strain hardening that is typical of other Al-Cu alloys; the rate of strain hardening, however, decreased with increase in strain rate. It was determined that the strain rate sensitivity coefficient of the alloy within the range of high strain rates used in this study is approximately 0.05 at 0.12 plastic strain; a more significant value than what was reported in literature under quasi-static loading. Micrographs obtained showed potential sites for the evolution of adiabatic shear band at 3500 s-1, with a characteristic circular-shaped surface profile comprising partially dissolved second phase particles in the continuous phase across the incident plane of the deformed specimen. The regions surrounding the site showed little or no change in the size of particles. However, the constituent coarse particles were observed as agglomerations of fractured pieces, thus having a shape factor different from those contained in the as-received alloy. Since the investigated alloy is a choice material for military application where it can be exposed to massive deformation at high strain rates, this study provides information on its microstructural and mechanical responses to such extreme loading condition.
Mukherjee, Supratim; Lapidus, Alla; Shapiro, Nicole; ...
2015-02-09
Pontibacter roseus is a member of genus Pontibacter family Cytophagaceae, class Cytophagia. While the type species of the genus Pontibacter actiniarum was isolated in 2005 from a marine environment, subsequent species of the same genus have been found in different types of habitats ranging from seawater, sediment, desert soil, rhizosphere, contaminated sites, solar saltern and muddy water. Here we describe the features of Pontibacter roseus strain SRC-1 T along with its complete genome sequence and annotation from a culture of DSM 17521 T. In conclusion, the 4,581,480 bp long draft genome consists of 12 scaffolds with 4,003 protein-coding and 50more » RNA genes and is a part of Genomic Encyclopedia of Type Strains: KMG-I project.« less
26Al-26Mg systematics in chondrules from Kaba and Yamato 980145 CV3 carbonaceous chondrites
NASA Astrophysics Data System (ADS)
Nagashima, Kazuhide; Krot, Alexander N.; Komatsu, Mutsumi
2017-03-01
We report the mineralogy, petrography, and in situ measured 26Al-26Mg systematics in chondrules from the least metamorphosed CV3 (Vigarano-type) chondrites, Kaba and Yamato (Y) 980145. Two Y 980145 chondrules measured show no resolvable excesses in 26Mg (26Mg∗), a decay product of a short-lived (t1/2 ∼0.7 Ma) radionuclide 26Al. Plagioclase in one of the chondrules is replaced by nepheline, indicative of thermal metamorphism. The lack of 26Mg∗ in the Y 980145 chondrules is most likely due to disturbance of their 26Al-26Mg systematics during the metamorphism. Although Kaba experienced extensive metasomatic alteration (<300 °C), it largely avoided subsequent thermal metamorphism, and the 26Al-26Mg systematics of its chondrules appear to be undisturbed. All eight Kaba chondrules measured show 26Mg∗, corresponding to the initial 26Al/27Al ratios [(26Al/27Al)0] ranging from (2.9 ± 1.7) × 10-6 to (6.3 ± 2.7) × 10-6. If CV parent asteroid accreted rapidly after chondrule formation, the inferred (26Al/27Al)0 ratios in Kaba chondrules provide an upper limit on 26Al available in this asteroid at the time of its accretion. The estimated initial abundance of 26Al in the CV asteroid is too low to melt it and contradicts the existence of a molten core in this body suggested from the paleomagnetic records of Allende [Carporzen et al. (2011) Magnetic evidence for a partially differentiated carbonaceous chondrite parent body. Proc. Natl. Acad. Sci. USA108, 6386-6389] and Kaba [Gattacceca et al. (2013) More evidence for a partially differentiated CV parent body from the meteorite Kaba. Lunar Planet. Sci.44, abstract#1721].
NASA Astrophysics Data System (ADS)
Zhu, Haiyan; Shi, Liwei; Li, Shuaiqi; Duan, Yifeng; Zhang, Shaobo; Xia, Wangsuo
2018-04-01
The effects of hydrostatic pressure and biaxial strains on the elastic and electronic properties of a superhard material t-C8B2N2 have been studied using first-principles calculations. The structure is proven to be mechanically and dynamically stable under the applied external forces. All the elastic constants (except C66) and elastic modulus increase (decrease) with increasing pressure and compressive (tensile) biaxial strain ɛxx. A microscopic model is used to calculate the Vicker's hardness of every single bond as well as the crystal. The hardness of t-C8B2N2 (64.7 GPa) exceeds that of c-BN (62 GPa) and increases obviously by employing pressure and compressive ɛxx. Furthermore, the Debye temperature and anisotropy of sound velocities for t-C8B2N2 have been discussed. t-C8B2N2 undergoes an indirect to direct bandgap transition when ɛxx > 2%; however, the indirect bandgap character of the material remains under pressure.
Creep Strain and Strain Rate Response of 2219 Al Alloy at High Stress Levels
NASA Technical Reports Server (NTRS)
Taminger, Karen M. B.; Wagner, John A.; Lisagor, W. Barry
1998-01-01
As a result of high localized plastic deformation experienced during proof testing in an International Space Station connecting module, a study was undertaken to determine the deformation response of a 2219-T851 roll forging. After prestraining 2219-T851 Al specimens to simulate strains observed during the proof testing, creep tests were conducted in the temperature range from ambient temperature to 107 C (225 F) at stress levels approaching the ultimate tensile strength of 2219-T851 Al. Strain-time histories and strain rate responses were examined. The strain rate response was extremely high initially, but decayed rapidly, spanning as much as five orders of magnitude during primary creep. Select specimens were subjected to incremental step loading and exhibited initial creep rates of similar magnitude for each load step. Although the creep rates decreased quickly at all loads, the creep rates dropped faster and reached lower strain rate levels for lower applied loads. The initial creep rate and creep rate decay associated with primary creep were similar for specimens with and without prestrain; however, prestraining (strain hardening) the specimens, as in the aforementioned proof test, resulted in significantly longer creep life.
1992-05-27
A NASA CV-990, modified as a Landing Systems Research Aircraft (LSRA), is serviced on the ramp at NASA's Dryden Flight Research Center, Edwards, California, before a test of the space shuttle landing gear system. The space shuttle landing gear test unit, operated by a high-pressure hydraulic system, allowed engineers to assess and document the performance of space shuttle main and nose landing gear systems, tires and wheel assemblies, plus braking and nose wheel steering performance. The series of 155 test missions for the space shuttle program provided extensive data about the life and endurance of the shuttle tire systems and helped raise the shuttle crosswind landing limits at Kennedy.
Luo, Ke-Wang; Yue, Grace Gar-Lee; Ko, Chun-Hay; Lee, Julia Kin-Ming; Gao, Si; Li, Long-Fei; Li, Gang; Fung, Kwok-Pui; Leung, Ping-Chung; Lau, Clara Bik-San
2014-01-01
Coriolus versicolor (CV), a medicinal mushroom widely consumed in Asian countries, has been demonstrated to be effective in stimulation of immune system and inhibition of tumor growth. The present study aimed to investigate the anti-tumor and anti-metastasis effects of CV aqueous extract in mouse mammary carcinoma 4T1 cells and in 4T1-tumor bearing mouse model. Our results showed that CV aqueous extract (0.125-2 mg/ml) did not inhibit 4T1 cell proliferation while the non-cytotoxic dose of CV extract (1-2 mg/ml) significantly inhibited cell migration and invasion (p<0.05). Besides, the enzyme activities and protein levels of MMP-9 were suppressed by CV extract significantly. Animal studies showed that CV aqueous extract (1 g/kg, orally-fed daily for 4 weeks) was effective in decreasing the tumor weight by 36%, and decreased the lung metastasis by 70.8% against untreated control. Besides, micro-CT analysis of the tumor-bearing mice tibias indicated that CV extract was effective in bone protection against breast cancer-induced bone destruction as the bone volume was significantly increased. On the other hand, CV aqueous extract treatments resulted in remarkable immunomodulatory effects, which was reflected by the augmentation of IL-2, 6, 12, TNF-α and IFN-γ productions from the spleen lymphocytes of CV-treated tumor-bearing mice. In conclusion, our results demonstrated for the first time that the CV aqueous extract exhibited anti-tumor, anti-metastasis and immunomodulation effects in metastatic breast cancer mouse model, and could protect the bone from breast cancer-induced bone destruction. These findings provided scientific evidences for the clinical application of CV aqueous extract in breast cancer patients. Copyright © 2014 Elsevier GmbH. All rights reserved.
Regulatory T cells control strain specific resistance to Experimental Autoimmune Prostatitis
Breser, Maria L.; Lino, Andreia C.; Motrich, Ruben D.; Godoy, Gloria J.; Demengeot, Jocelyne; Rivero, Virginia E.
2016-01-01
Susceptibility to autoimmune diseases results from the encounter of a complex and long evolved genetic context with a no less complex and changing environment. Major actors in maintaining health are regulatory T cells (Treg) that primarily dampen a large subset of autoreactive lymphocytes escaping thymic negative selection. Here, we directly asked whether Treg participate in defining susceptibility and resistance to Experimental Autoimmune Prostatitis (EAP). We analyzed three common laboratory strains of mice presenting with different susceptibility to autoimmune prostatitis upon immunization with prostate proteins. The NOD, the C57BL/6 and the BALB/c mice that can be classified along a disease score ranging from severe, mild and to undetectable, respectively. Upon mild and transient depletion of Treg at the induction phase of EAP, each model showed an increment along this score, most remarkably with the BALB/c mice switching from a resistant to a susceptible phenotype. We further show that disease associates with the upregulation of CXCR3 expression on effector T cells, a process requiring IFNγ. Together with recent advances on environmental factors affecting Treg, these findings provide a likely cellular and molecular explanation to the recent rise in autoimmune diseases incidence. PMID:27624792
Luong, Preston M.; Shogan, Benjamin D.; Zaborin, Alexander; Belogortseva, Natalia; Shrout, Joshua D.
2014-01-01
We recently demonstrated that Pseudomonas aeruginosa PAO1 undergoes a pronounced phenotypic change when introduced into the intestines of rats during surgical injury. Recovered strains displayed a specific phenotype (termed the P2 phenotype) characterized by altered pyocyanin production, high collagenase activity, high swarming motility, low resistance to chloramphenicol, and increased killing of Caenorhabditis elegans compared to the inoculating strain (termed the P1 phenotype). The aims of this study were to characterize the differences between the P. aeruginosa P1 and P2 phenotypes in quorum sensing and competitiveness. We then determined the presence of the P2 phenotype among PAO1 strains from various laboratories. Results demonstrated that P2 cells display accelerated growth during early exponential phase and early activation of quorum-sensing systems and overcome the growth of P1 cells in a mixed population. Among eight PAO1 strains obtained from different laboratories, four exhibited the P2 phenotype. Of 27 mutants analyzed from the P. aeruginosa MPAO1 transposon library, 25 displayed P2 phenotypes. The P2 phenotype in both cases correlated with a lack of expression of mexE or mexF due to mutations in mexT and mexF genes. In summary, strains possessing the P2 phenotype are distributed among PAO1 strains commonly used across a variety of research laboratories. Genetically, they are characterized by various mutations in mexT or mexF. PMID:24244000
So you want to be a specialist registrar?--What to put in your CV.
Ellis, P E; Ellis, S G S; O'Brien, K D; Joshi, R I
2002-02-09
Dentists applying to a specialist training programme often receive conflicting advice over what to put in their curriculum vitae (CV). We conducted a survey of the Training Programme Directors of the dental specialties to determine what aspects of CV content and presentation styles are considered important. This has allowed us to construct guidelines for what to put in a CV. Recently, structured application forms have become increasingly popular and may be a more objective way to carry out the shortlisting process. The guidelines presented could also be used as a framework for medical personnel departments if structured application forms eventually replace the CV.
Genome Sequence of Acidovorax avenae Strain T10_61 Associated with Sugarcane Red Stripe in Argentina
Fontana, Cecilia A.; Bassi, Daniela; Puglisi, Edoardo; Salazar, Sergio M.; Vignolo, Graciela M.; Coccocelli, Pier S.
2016-01-01
Red stripe of sugarcane in Argentina is a bacterial disease caused by Acidovorax avenae. The genome sequence from the first isolate of this bacterium in Argentina is presented here. The draft genome of the A. avenae T10_61 strain contains 5,646,552 bp and has a G+C content of 68.6 mol%. PMID:26847889
Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids.
Kanamoto, Hirosuke; Yamashita, Atsushi; Asao, Hiroshi; Okumura, Satoru; Takase, Hisabumi; Hattori, Masahira; Yokota, Akiho; Tomizawa, Ken-Ichi
2006-04-01
Transgenic plastids offer unique advantages in plant biotechnology, including high-level foreign protein expression. However, broad application of plastid genome engineering in biotechnology has been largely hampered by the lack of plastid transformation systems for major crops. Here we describe the development of a plastid transformation system for lettuce, Lactuca sativa L. cv. Cisco. The transforming DNA carries a spectinomycin-resistance gene (aadA) under the control of lettuce chloroplast regulatory expression elements, flanked by two adjacent lettuce plastid genome sequences allowing its targeted insertion between the rbcL and accD genes. On average, we obtained 1 transplastomic lettuce plant per bombardment. We show that lettuce leaf chloroplasts can express transgene-encoded GFP to approximately 36% of the total soluble protein. All transplastomic T0 plants were fertile and the T1 progeny uniformly showed stability of the transgene in the chloroplast genome. This system will open up new possibilities for the efficient production of edible vaccines, pharmaceuticals, and antibodies in plants.
Kim, Minsuk; Yi, Jeong Sang; Lakshmanan, Meiyappan; Lee, Dong-Yup; Kim, Byung-Gee
2016-03-01
In silico model-driven analysis using genome-scale model of metabolism (GEM) has been recognized as a promising method for microbial strain improvement. However, most of the current GEM-based strain design algorithms based on flux balance analysis (FBA) heavily rely on the steady-state and optimality assumptions without considering any regulatory information. Thus, their practical usage is quite limited, especially in its application to secondary metabolites overproduction. In this study, we developed a transcriptomics-based strain optimization tool (tSOT) in order to overcome such limitations by integrating transcriptomic data into GEM. Initially, we evaluated existing algorithms for integrating transcriptomic data into GEM using Streptomyces coelicolor dataset, and identified iMAT algorithm as the only and the best algorithm for characterizing the secondary metabolism of S. coelicolor. Subsequently, we developed tSOT platform where iMAT is adopted to predict the reaction states, and successfully demonstrated its applicability to secondary metabolites overproduction by designing actinorhodin (ACT), a polyketide antibiotic, overproducing strain of S. coelicolor. Mutants overexpressing tSOT targets such as ribulose 5-phosphate 3-epimerase and NADP-dependent malic enzyme showed 2 and 1.8-fold increase in ACT production, thereby validating the tSOT prediction. It is expected that tSOT can be used for solving other metabolic engineering problems which could not be addressed by current strain design algorithms, especially for the secondary metabolite overproductions. © 2015 Wiley Periodicals, Inc.
Segmentation of kidney using C-V model and anatomy priors
NASA Astrophysics Data System (ADS)
Lu, Jinghua; Chen, Jie; Zhang, Juan; Yang, Wenjia
2007-12-01
This paper presents an approach for kidney segmentation on abdominal CT images as the first step of a virtual reality surgery system. Segmentation for medical images is often challenging because of the objects' complicated anatomical structures, various gray levels, and unclear edges. A coarse to fine approach has been applied in the kidney segmentation using Chan-Vese model (C-V model) and anatomy prior knowledge. In pre-processing stage, the candidate kidney regions are located. Then C-V model formulated by level set method is applied in these smaller ROI, which can reduce the calculation complexity to a certain extent. At last, after some mathematical morphology procedures, the specified kidney structures have been extracted interactively with prior knowledge. The satisfying results on abdominal CT series show that the proposed approach keeps all the advantages of C-V model and overcome its disadvantages.
Fatty acid and hydrocarbon composition in tropical marine Shewanella amazonensis strain SB2B(T).
Motoigi, Taro; Okuyama, Hidetoshi
2011-10-01
Shewanella amazonensis strain SB2B(T) is an isolate from shallow-water marine sediments derived from the Amazon River delta. This bacterium contained a long-chain polyunsaturated hydrocarbon, all-cis -3,6,9,12,16,19,22,25,28 hentriacontanonaene (C31:9), constituting 1-2% of the total fatty acid methyl ester and hydrocarbon fraction, which was produced dependently of decreased growth temperature. Analysis of its cellular fatty acid composition demonstrated that isopentadecanoic acid was the major fatty acid component and that all the main monounsaturated fatty acids had straight chains with a cis configuration. However, monoenoic cyclopropyl fatty acids, which were previously reported to be present in this bacterium, were not detected by mass spectrometric analysis. The growth temperature affected the content of Δ9-cis -hexadecenoic [16:1(Δ9c)], palmitic, and heptadecanoic acids. These results suggest that C31:9, as well as 16:1(Δ9c) might be involved in adaptation to low temperature in S. amazonensis strain SB2B(T) . Our result suggests that polyunsaturated fatty acid synthase protein complex may be involved in synthesis of C31:9 but not in production of eicosapentaenoic acid. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
IVIM diffusion-weighted imaging of the liver at 3.0 T: Comparison with 1.5 T
Cui, Yong; Dyvorne, Hadrien; Besa, Cecilia; Cooper, Nancy; Taouli, Bachir
2015-01-01
Purpose To compare intravoxel incoherent motion (IVIM) diffusion-weighted imaging (DWI) of the liver between 1.5 T and 3.0 T in terms of parameter quantification and inter-platform reproducibility. Materials and methods In this IRB approved prospective study, 19 subjects (17 patients with chronic liver disease and 2 healthy volunteers) underwent two repeat scans at 1.5 T and 3.0 T. Each scan included IVIM DWI using 16 b values from 0 to 800 s/mm2. A single observer measured IVIM parameters for each platform and estimated signal to noise ratio (eSNR) at b0, 200, 400 and 800 s/mm2. Wilcoxon paired tests were used to compare liver eSNR and IVIM parameters. Inter-platform reproducibility was assessed by calculating within-subject coefficient of variation (CV) and Bland–Altman limits of agreement. An ice water phantom was used to test ADC variability between the two MRI systems. Results The mean invitro difference in ADC between the two platforms was 6.8%. eSNR was significantly higher at 3.0T for all selected b values (p = 0.006–0.020), except for b0 (p = 0.239). Liver IVIM parameters were significantly different between 1.5 T and 3.0 T (p = 0.005–0.044), except for ADC (p = 0.748). The inter-platform reproducibility of true diffusion coefficient (D) and ADC were good, with mean CV of 10.9% and 11.1%, respectively. Perfusion fraction (PF) and pseudodiffusion coefficient (D*) showed more limited inter-platform reproducibility (mean CV of 22.6% for PF and 46.9% for D*). Conclusion Liver D and ADC values showed good reproducibility between 1.5 T and 3.0 T platforms; while there was more variability in PF, and large variability in D* parameters between the two platforms. These findings may have implications for drug trials assessing the role of IVIM DWI in tumor response and liver fibrosis. PMID:26393236
Suarez, Rudy; Lazo, Eduardo; Bravo, Diego; Llegues, Katerina O.; Romalde, Jesús L.; Godoy, Marcos G.
2014-01-01
Streptococcus phocae subsp. salmonis is a fish pathogen that has an important impact on the Chilean salmon industry. Here, we report the genome sequence of the type strain C-4T isolated from Atlantic salmon (Salmo salar), showing a number of interesting features and genes related to its possible virulence factors. PMID:25502668
AstroCV: Astronomy computer vision library
NASA Astrophysics Data System (ADS)
González, Roberto E.; Muñoz, Roberto P.; Hernández, Cristian A.
2018-04-01
AstroCV processes and analyzes big astronomical datasets, and is intended to provide a community repository of high performance Python and C++ algorithms used for image processing and computer vision. The library offers methods for object recognition, segmentation and classification, with emphasis in the automatic detection and classification of galaxies.
Core Problem: Does the CV Parent Body Magnetization require differentiation?
NASA Astrophysics Data System (ADS)
O'Brien, T.; Tarduno, J. A.; Smirnov, A. V.
2016-12-01
Evidence for the presence of past dynamos from magnetic studies of meteorites can provide key information on the nature and evolution of parent bodies. However, the suggestion of a past core dynamo for the CV parent body based on the study of the Allende meteorite has led to a paradox: a core dynamo requires differentiation, evidence for which is missing in the meteorite record. The key parameter used to distinguish core dynamo versus external field mechanisms is absolute field paleointensity, with high values (>>1 μT) favoring the former. Here we explore the fundamental requirements for absolute field intensity measurement in the Allende meteorite: single domain grains that are non-interacting. Magnetic hysteresis and directional data define strong magnetic interactions, negating a standard interpretation of paleointensity measurements in terms of absolute paleofield values. The Allende low field magnetic susceptibility is dominated by magnetite and FeNi grains, whereas the magnetic remanence is carried by an iron sulfide whose remanence-carrying capacity increases with laboratory cycling at constant field values, indicating reordering. The iron sulfide and FeNi grains are in close proximity, providing mineralogical context for interactions. We interpret the magnetization of Allende to record the intense early solar wind with metal-sulfide interactions amplifying the field, giving the false impression of a higher field value in some prior studies. An undifferentiated CV parent body is thus compatible with Allende's magnetization. Early solar wind magnetization should be the null hypothesis for evaluating the source of magnetization for chondrites and other meteorites.
1988-07-22
Inc. of Savannah, Georgia and Tallahassee, Florida provided analytical services. Michael Newberry, Captain USAF, and Jeff Mason, 2d LT., USAF, from...2803-19 AG AP6 ST;- ES Ci eit 2803-20 A? APC S -2 ES 23033-23 AG .AF6 SD-S 2803-22 AC AP6 SD-4 E.> PARAMIETER 280u- .y 2&u r 23-2: 2803-22 Bezo (g.h.1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukherjee, Supratim; Lapidus, Alla; Shapiro, Nicole
2015-01-01
Pontibacter roseus Suresh et al 2006 is a member of genus Pontibacter family Cytophagaceae, class Cytophagia. While the type species of the genus Pontibacter actiniarum was isolated in 2005 from a marine environment, subsequent species of the same genus have been found in different types of habitats ranging from seawater, sediment, desert soil, rhizosphere, contaminated sites, solar saltern and muddy water. Here we describe the features of Pontibacter roseus strain SRC-1T along with its complete genome sequence and annotation from a culture of DSM 17521T. The 4,581,480 bp long draft genome consists of 12 scaffolds with 4,003 protein-coding and 50more » RNA genes and is a part of Genomic encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG-I) project.« less
Segarra, Guillem; Casanova, Eva; Avilés, Manuel; Trillas, Isabel
2010-01-01
Trichoderma asperellum strain T34 has been reported to control the disease caused by Fusarium oxysporum f.sp. lycopersici (Fol) on tomato plants. To study the importance of iron concentration in the growth media for the activity and competitiveness of T34 and the pathogen, we tested four iron concentrations in the nutrient solution [1, 10, 100, and 1000 microM provided as EDTA/Fe(III)] in a biological control experiment with T34 and Fol in tomato plants. The reduction of the Fusarium-infected shoot by T34 was only significant at 10 microM Fe. We hypothesized that Fe competition is one of the key factors in the biocontrol activity exerted by T34 against Fol, as an increase in Fe concentration over 10 microM would lead to the suppression of T34 siderophore synthesis and thus inhibition of Fe competition with Fol. T34 significantly reduced the populations of Fol at all the doses of Fe assayed. In contrast, Fol enhanced the populations of T34 at 1 and 10 microM Fe. Nevertheless, several plant physiological parameters like net CO(2) assimilation (A), stomatal conductance (g(s)), relative quantum efficiency of PSII (Phi(PSII)), and efficiency of excitation energy capture by open PSII reactive centers (Fv'/Fm') demonstrated the protection against Fol damage by treatment with T34 at 100 microM Fe. The first physiological parameter affected by the disease progression was g(s). Plant dry weight was decreased by Fe toxicity at 100 and 1,000 microM. T34-treated plants had significantly greater heights and dry weights than control plants at 1,000 microM Fe, even though T34 did not reduce the Fe content in leaves or stems. Furthermore, T34 enhanced plant height even at the optimal Fe concentration (10 microM) compared to control plants. In conclusion, T. asperellum strain T34 protected tomato plants from both biotic (Fusarium wilt disease) and abiotic stress [Fe(III) toxic effects].
NASA Astrophysics Data System (ADS)
Treiman, A. H.; Dehart, J. M.
1992-07-01
A new meteorite find from West Texas, U.S.A., is a CV3 carbonaceous chondrite. The provisional name of Red Bluff has been proposed to the Nomenclature Committee by R. Farrell. Red Bluff consists of chondrules (56.4%), CAIs (8.3%), amoboid olivine aggregates (0.6%), mineral fragments (0.8%), and Ca-Al chondrules (0.4%) in a fine-grained, clay-rich matrix (33.1%). Chondrules in Red Bluff are spherical to irregular in shape, and from 0.25-3.5 mm diameter in thin section; the average diameter is 0.95 mm, with standard deviation of 0.6 mm (69 chondrules). Three of the chondrules are distinctly larger than the rest; without these three, the average diameter is 0.86 mm (s.d. 0.4 mm). The chondrules are almost all of type I (Fe-poor), as shown by cathodoluminescence and chemical analyses; most are also rich in opaques. Compositions of chondrule olivines average Fa1.9+-1.2 (s.d.); compositions of chondrule pyroxenes average Fs3.4+-3.3 (s.d.). Chondrule varieties include porphyritic olivine, microporphyritic olivine, granular olivine, macroporphyritic olivine, barred olivine, and rare extracentroradial pyroxene (0.25 mm diam.) [1,2]. Two calcium-aluminum chondrules were observed. The largest, 1.5 mm diam., contains spinel, plagioclase, and fassaite, and includes a circular spinel palisade [3]. The other Ca-Al chondrule is within a coarse-grained CAI, and could also be a well-developed spinel palisade [3]. Fine- and coarse-grained CAIs are present but have been studied little; most appear to be type B (melilite+pyroxene+plagioclase). Red Bluff's matrix is composed of fine-grained clay, with minor olivine, "limonite," troilite, and Fe metal. Alignment of grains and oxide-rich streaks in the matrix mark a planar fabric that wraps around chondrules and inclusions. Chondrules are commonly surrounded by shells of dark red alteration, darker than the bulk of matrix material. Red Bluff is weathered. It is stained red by oxidized iron minerals, which are most common as veinlets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klenk, Hans-Peter; Lapidus, Alla L.; Chertkov, Olga
Bacillus tusciae Bonjour & Aragno 1994 is a hydrogen-oxidizing, thermoacidophilic spore former that lives as a facultative chemolithoautotroph in solfataras. Although 16S rRNA gene sequencing was well established at the time of the initial description of the organism, 16S se- quence data were not available and the strain was placed into the genus Bacillus based on limited chemotaxonomic information. Despite the now obvious misplacement of strain T2T as a member of the genus Bacillus in 16S rRNA-based phylogenetic trees, the misclassification remained uncorrected for many years, which was likely due to the extremely difficult, analy- sis-hampering cultivation conditions and poormore » growth rate of the strain. Here we provide a taxonomic re-evaluation of strain T2T (= DSM 2912 = NBRC 15312) and propose its reclassi- fication as the type strain of a new species, Kyrpidia tusciae, and the type species of the new genus Kyrpidia, which is a sister-group of Alicyclobacillus. The family Alicyclobacillaceae da Costa and Rainey, 2010 is emended. The 3,384,766 bp genome with its 3,323 protein-coding and 78 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Shen, Cimin; Xu, Jinsen; Zheng, Shuxia; Lin, Lijiao; Yang, Xiaomei; Liu, Chunlan
2016-02-01
To observe the effect of electroacupuncture(EA) at Zhongwan(CV 12) on the energy metabolism along the conception vessel(CV) in volunteers with yang-deficiency constitution,and to explore the relationship of electroacupuncture regulation and body constitution. Eighteen volunteers with mild constitution and 18 volunteers with yang-deficiency constitution were collected out of 200 students of Fujian University of TCM by body constitution questionnaire. Skin microcirculatory blood perfusion units (MBPU) at Danzhong (CV 17), Xiawan(CV 10) and Qihai(CV 6) of CV were measured by a laser Doppler flowmetry in the normal condition and after EA stimulation at Zhongwan(CV 12) for 20 min. (1)Before treatment, (1)MBPU values at Danzhong(CV 17), Xiawan(CV 10) and Qihai(CV 6) in the yang-deficiency constitution group were lower than those in the mild constitution group,but there was no statistical significance (both P>0. 05) except Danzhong(CV 17) (P<0. 01). (Z)As for the three acupoints in the mild constitution group, MBPU level of Danzhong(CV 17) was higher than that of Xiawan(CV 10) without statistical significance(P->0. 05),and MBPU values of Danzhong(CV 17) and Xiawan(CV 10) were higher than that of Qihai(CV 6) (both P<0. 01). (3About the three acupoints in the yang-deficiency constitution group, MBPU result of Danzhong(CV 17) was lower than the value of Xiawan(CV 10), but higher compared with Qihai(CV 6)(P<0. 05, P<0. 01). MBPU of Xiawan(CV 10) was higher than Qihai (CV 6) as well(P<0. 01). (2) MBPU values of Danzhong(CV 17), Xiawan(CV 10) and Qihai(CV 6) were increased apparently compared with those before treatment after EA stimulation at Zhongwan(CV 12) for 20 min in the two groups(all P<0. 01). (3) The rise rates of MBPU level about Danzhong(CV 17) and Qihai(CV 6) in the yang-deficiency constitution group were higher than those in the mild constitution group without statistical significance after EA at Zhongwan(CV 12) for 20 min(both P>0. 05). The energy metabolism in CV
PlantCV v2: Image analysis software for high-throughput plant phenotyping
Abbasi, Arash; Berry, Jeffrey C.; Callen, Steven T.; Chavez, Leonardo; Doust, Andrew N.; Feldman, Max J.; Gilbert, Kerrigan B.; Hodge, John G.; Hoyer, J. Steen; Lin, Andy; Liu, Suxing; Lizárraga, César; Lorence, Argelia; Miller, Michael; Platon, Eric; Tessman, Monica; Sax, Tony
2017-01-01
Systems for collecting image data in conjunction with computer vision techniques are a powerful tool for increasing the temporal resolution at which plant phenotypes can be measured non-destructively. Computational tools that are flexible and extendable are needed to address the diversity of plant phenotyping problems. We previously described the Plant Computer Vision (PlantCV) software package, which is an image processing toolkit for plant phenotyping analysis. The goal of the PlantCV project is to develop a set of modular, reusable, and repurposable tools for plant image analysis that are open-source and community-developed. Here we present the details and rationale for major developments in the second major release of PlantCV. In addition to overall improvements in the organization of the PlantCV project, new functionality includes a set of new image processing and normalization tools, support for analyzing images that include multiple plants, leaf segmentation, landmark identification tools for morphometrics, and modules for machine learning. PMID:29209576
PlantCV v2: Image analysis software for high-throughput plant phenotyping.
Gehan, Malia A; Fahlgren, Noah; Abbasi, Arash; Berry, Jeffrey C; Callen, Steven T; Chavez, Leonardo; Doust, Andrew N; Feldman, Max J; Gilbert, Kerrigan B; Hodge, John G; Hoyer, J Steen; Lin, Andy; Liu, Suxing; Lizárraga, César; Lorence, Argelia; Miller, Michael; Platon, Eric; Tessman, Monica; Sax, Tony
2017-01-01
Systems for collecting image data in conjunction with computer vision techniques are a powerful tool for increasing the temporal resolution at which plant phenotypes can be measured non-destructively. Computational tools that are flexible and extendable are needed to address the diversity of plant phenotyping problems. We previously described the Plant Computer Vision (PlantCV) software package, which is an image processing toolkit for plant phenotyping analysis. The goal of the PlantCV project is to develop a set of modular, reusable, and repurposable tools for plant image analysis that are open-source and community-developed. Here we present the details and rationale for major developments in the second major release of PlantCV. In addition to overall improvements in the organization of the PlantCV project, new functionality includes a set of new image processing and normalization tools, support for analyzing images that include multiple plants, leaf segmentation, landmark identification tools for morphometrics, and modules for machine learning.
PlantCV v2: Image analysis software for high-throughput plant phenotyping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gehan, Malia A.; Fahlgren, Noah; Abbasi, Arash
Systems for collecting image data in conjunction with computer vision techniques are a powerful tool for increasing the temporal resolution at which plant phenotypes can be measured non-destructively. Computational tools that are flexible and extendable are needed to address the diversity of plant phenotyping problems. We previously described the Plant Computer Vision (PlantCV) software package, which is an image processing toolkit for plant phenotyping analysis. The goal of the PlantCV project is to develop a set of modular, reusable, and repurposable tools for plant image analysis that are open-source and community-developed. Here in this paper we present the details andmore » rationale for major developments in the second major release of PlantCV. In addition to overall improvements in the organization of the PlantCV project, new functionality includes a set of new image processing and normalization tools, support for analyzing images that include multiple plants, leaf segmentation, landmark identification tools for morphometrics, and modules for machine learning.« less
PlantCV v2: Image analysis software for high-throughput plant phenotyping
Gehan, Malia A.; Fahlgren, Noah; Abbasi, Arash; ...
2017-12-01
Systems for collecting image data in conjunction with computer vision techniques are a powerful tool for increasing the temporal resolution at which plant phenotypes can be measured non-destructively. Computational tools that are flexible and extendable are needed to address the diversity of plant phenotyping problems. We previously described the Plant Computer Vision (PlantCV) software package, which is an image processing toolkit for plant phenotyping analysis. The goal of the PlantCV project is to develop a set of modular, reusable, and repurposable tools for plant image analysis that are open-source and community-developed. Here in this paper we present the details andmore » rationale for major developments in the second major release of PlantCV. In addition to overall improvements in the organization of the PlantCV project, new functionality includes a set of new image processing and normalization tools, support for analyzing images that include multiple plants, leaf segmentation, landmark identification tools for morphometrics, and modules for machine learning.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rawat, Suman R.; Mannisto, Minna; Starovoytov, Valentin
2013-01-01
Granulicella tundricola strain MP5ACTX9T is a novel species of the genus Granulicella in subdivision 1 Acidobacteria. G. tundricola is a predominant member of soil bacterial communities, active at low temperatures and nutrient limiting conditions in Arctic alpine tundra. The organism is a cold-adapted acidophile and a versatile heterotroph that hydro-lyzes a suite of sugars and complex polysaccharides. Genome analysis revealed metabolic versatility with genes involved in metabolism and transport of carbohydrates, including gene modules encoding for the carbohydrate-active enzyme (CAZy) families for the break-down, utilization and biosynthesis of diverse structural and storage polysaccharides such as plant based carbon polymers. Themore » genome of G. tundricola strain MP5ACTX9T consists of 4,309,151 bp of a circular chromosome and five mega plasmids with a total genome con-tent of 5,503,984 bp. The genome comprises 4,705 protein-coding genes and 52 RNA genes.« less
Hosking, Jamie; Rasanathan, Kumanan; Mow, Florina Chan; Jackson, Catherine; Martin, Diana; O'Hallahan, Jane; Oster, Philipp; Ypma, Ellen; Reid, Stewart; Aaberge, Ingeborg; Crengle, Sue; Stewart, Joanna; Lennon, Diana
2007-01-01
New Zealand (NZ) has experienced a Neisseria meningitidis serogroup B epidemic since 1991. MeNZB, a strain-specific outer membrane vesicle vaccine made using an NZ epidemic strain isolate, NZ98/254 (B:4:P1.7b,4), from two manufacturing sites, the Norwegian Institute of Public Health (NIPH) and Chiron Vaccines (CV; now Novartis), was evaluated for safety, immunogenicity, and reactogenicity in this observer-blind trial with 8- to 12-year-old children. In year 1, cohort A (n = 302) was randomized 4:1 for receipt of NIPH-MeNZB or MenBvac (Norwegian parent vaccine strain 44/76; B:15:P1.7,16). In year 2, cohort B (n = 313) was randomized 4:1 for receipt of CV-MeNZB or NIPH-MeNZB. Participants all received three vaccinations 6 weeks apart. Local and systemic reactions were monitored for 7 days. Seroresponse was defined as a fourfold or greater rise in the serum bactericidal antibody titer from the baseline titer as measured by a serum bactericidal assay. Those with baseline titers of <1:4 required titers of ≥1:8 to serorespond. Intention-to-treat (ITT) and per protocol (PP) analyses are presented. In cohort A, 74% (ITT) and 73% (PP) of NIPH-MeNZB recipients demonstrated seroresponses against NZ98/254 after three doses, versus 32% (ITT and PP) of MenBvac recipients. In cohort B, seroresponses against NZ98/254 after three doses occurred in 79% (ITT and PP) of CV-MeNZB versus 75% (ITT) and 76% (PP) of NIPH-MeNZB recipients. Vaccines were tolerable, with no vaccine-related serious adverse events. In conclusion, the NZ strain meningococcal B vaccine (MeNZB) from either manufacturing site was immunogenic against New Zealand epidemic vaccine strain meningococci with no safety concerns when given in three doses to these 8- to 12-year-old children. PMID:17898183
Yang, Yunhuang; Ramelot, Theresa A; Cort, John R; Garcia, Maite; Yee, Adelinda; Arrowsmith, Cheryl H; Kennedy, Michael A
2012-01-01
CV_2116 is a small hypothetical protein of 82 amino acids from the Gram-negative coccobacillus Chromobacterium violaceum. A PSI-BLAST search using the CV_2116 sequence as a query identified only one hit (E = 2e(-07)) corresponding to a hypothetical protein OR16_04617 from Cupriavidus basilensis OR16, which failed to provide insight into the function of CV_2116. The CV_2116 gene was cloned into the p15TvLic expression plasmid, transformed into E. coli, and (13)C- and (15)N-labeled NMR samples of CV_2116 were overexpressed in E. coli and purified for structure determination using NMR spectroscopy. The resulting high-quality solution NMR structure of CV_2116 revealed a novel α + β fold containing two anti-parallel β-sheets in the N-terminal two-thirds of the protein and one α-helix in the C-terminal third of the protein. CV_2116 does not belong to any known protein sequence family and a Dali search indicated that no similar structures exist in the protein data bank. Although no function of CV_2116 could be derived from either sequence or structural similarity searches, the neighboring genes of CV_2116 encode various proteins annotated as similar to bacteriophage tail assembly proteins. Interestingly, C. violaceum exhibits an extensive network of bacteriophage tail-like structures that likely result from lateral gene transfer by incorporation of viral DNA into its genome (prophages) due to bacteriophage infection. Indeed, C. violaceum has been shown to contain four prophage elements and CV_2116 resides in the fourth of these elements. Analysis of the putative operon in which CV_2116 resides indicates that CV_2116 might be a component of the bacteriophage tail-like assembly that occurs in C. violaceum.
Shields, E; Seiden-Long, I; Massie, S; Passante, S; Leguillette, R
2016-06-13
Cardiac troponin-I assays have been validated in horses.'High-sensitivity' cardiac troponin assays are now the standard in human cardiology. Appropriately validate the'high-sensitivity' cardiac Troponin-T (hscTnT) assay for clinical use in horses, establish reference intervals, determine the biological variation, and demonstrate assay utility in selected clinical cases. Analytical validation of the Roche hscTnT assay included within- and between-run precision, linear dose response, limit of quantitation (LoQ), stability, and comparison with cTn-I (iSTAT). Reference intervals and biological variation were determined using adult, healthy, Non-Competition Horses (N = 125) and Racing-Thoroughbreds (N = 178). HscTnT levels were measured in two horses with cardiac pathology. The hscTnT demonstrates acceptable within-run (L1 = 6.5 ng/L, CV 14.9 %, L2 = 10.1 ng/L, CV 8.7 %, L3 = 15.3 ng/L, CV 5.4 %) and between-run precision (L1 = 12.2 ng/L, CV 8.4 %, L2 = 57.0 ng/L, CV 8.4 %, L3 = 256.0 ng/L, CV 9.0 %). The assay was linear from 3 to 391 ng/L. The LoQ was validated at 3 ng/L. Samples demonstrated insignificant decay over freeze-thaw cycle. Comparison with cTnI assay showed excellent correlation (range: 8.0-3535.0 ng/L, R(2) = 0.9996). Reference intervals: The upper 95(th) and 99(th) percentile of the hscTnT population distribution were 6.8 and 16.2 ng/L in Non-Competition Horses, and 14.0 and 23.2 ng/L in Racing-Thoroughbreds. Between-breed, diurnal effect, and between-day variation was below LoQ. Two clinical cases with presumed cardiac pathology had hscTnT levels of 220.9 ng/L and 5723.0 ng/L. This benchmark study is the first to comply with CLSI guidelines, thus further establishing the performance characteristics of the hscTnT assay, and reference intervals in healthy horses. Two clinical cases demonstrated further the clinical utility of the assay.
Aqueous alteration in the Kaba CV3 carbonaceous chondrite
NASA Technical Reports Server (NTRS)
Keller, Lindsay P.; Buseck, Peter R.
1990-01-01
Results from TEM and SEM examinations of the Kaba CV3 carbonaceous chondrite are presented, showing that the chondrules and the matrix of Kaba have undergone pervasive low-temperature aqueous alteration, resulting in the formation of Fe-bearing saponite from glass and enstatite in chondrules, and from anhydrous silicates in matrix. The alteration products in Kaba were found to resemble those in other aqueously altered carbonaceous chondrites such as the Mokoia CV3 and in Orgueil CI chondrites and Y-82162 chondrites. However, Kaba lacks the abundant high-Al phyllosilicates, reported for CAIs from Mokoia, and the serpentine and ferrihydrite, found in Orgueil.
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex; ...
2016-09-08
Desulfurivibrio alkaliphilus strain AHT2 T is a strictly anaerobic sulfidogenic haloalkaliphile isolated from a composite sediment sample of eight hypersaline alkaline lakes in the Wadi al Natrun valley in the Egyptian Libyan Desert. D. alkaliphilus AHT2 T is Gram-negative and belongs to the family Desulfobulbaceae within the Deltaproteobacteria. Here we report its genome sequence, which contains a 3.10 Mbp chromosome. Here, D. alkaliphilus AHT2 T is adapted to survive under highly alkaline and moderately saline conditions and therefore, is relevant to the biotechnology industry and life under extreme conditions. For these reasons, D. alkaliphilus AHT2 T was sequenced by themore » DOE Joint Genome Institute as part of the Community Science Program.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melton, Emily Denise; Sorokin, Dimitry Y.; Overmars, Lex
Desulfurivibrio alkaliphilus strain AHT2 T is a strictly anaerobic sulfidogenic haloalkaliphile isolated from a composite sediment sample of eight hypersaline alkaline lakes in the Wadi al Natrun valley in the Egyptian Libyan Desert. D. alkaliphilus AHT2 T is Gram-negative and belongs to the family Desulfobulbaceae within the Deltaproteobacteria. Here we report its genome sequence, which contains a 3.10 Mbp chromosome. Here, D. alkaliphilus AHT2 T is adapted to survive under highly alkaline and moderately saline conditions and therefore, is relevant to the biotechnology industry and life under extreme conditions. For these reasons, D. alkaliphilus AHT2 T was sequenced by themore » DOE Joint Genome Institute as part of the Community Science Program.« less
Li, Junwei; Arévalo, Maria T; Chen, Yanping; Chen, Shan; Zeng, Mingtao
2014-10-01
Antigenic drift and shift of influenza viruses require frequent reformulation of influenza vaccines. In addition, seasonal influenza vaccines are often mismatched to the epidemic influenza strains. This stresses the need for a universal influenza vaccine. BALB/c mice were vaccinated with the trivalent live attenuated (LAIV; FluMist) or inactivated (TIV; FluZone) influenza vaccines and challenged with PR8 (H1N1), FM/47 (H1N1), or HK/68 (H3N2) influenza virus. Cytokines and antibody responses were tested by ELISA. Furthermore, different LAIV dosages were applied in BALB/c mice. LAIV vaccinated mice were also depleted of T-cells and challenged with PR8 virus. LAIV induced significant protection against challenge with the non-vaccine strain PR8 influenza virus. Furthermore, protective immunity against PR8 was dose-dependent. Of note, interleukin 2 and interferon gamma cytokine secretion in the lung alveolar fluid were significantly elevated in mice vaccinated with LAIV. Moreover, T-cell depletion of LAIV vaccinated mice compromised protection, indicating that T-cell-mediated immunity is required. In contrast, passive transfer of sera from mice vaccinated with LAIV into naïve mice failed to protect against PR8 challenge. Neutralization assays in vitro confirmed that LAIV did not induce cross-strain neutralizing antibodies against PR8 virus. Finally, we showed that three doses of LAIV also provided protection against challenge with two additional heterologous viruses, FM/47 and HK/68. These results support the potential use of the LAIV as a universal influenza vaccine under a prime-boost vaccination regimen. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Yunos, Nina Yusrina Muhamad; Tan, Wen-Si; Koh, Chong-Lek; Sam, Choon-Kook; Mohamad, Nur Izzati; Tan, Pui-Wan; Adrian, Tan-Guan-Sheng; Yin, Wai-Fong; Chan, Kok-Gan
2014-01-01
Quorum sensing (QS) is a bacterial cell-to-cell communication system controlling QS-mediated genes which is synchronized with the population density. The regulation of specific gene activity is dependent on the signaling molecules produced, namely N-acyl homoserine lactones (AHLs). We report here the identification and characterization of AHLs produced by bacterial strain ND07 isolated from a Malaysian fresh water sample. Molecular identification showed that strain ND07 is clustered closely to Pseudomonas cremoricolorata. Spent culture supernatant extract of P. cremoricolorata strain ND07 activated the AHL biosensor Chromobacterium violaceum CV026. Using high resolution triple quadrupole liquid chromatography-mass spectrometry, it was confirmed that P. cremoricolorata strain ND07 produced N-octanoyl-l-homoserine lactone (C8-HSL) and N-decanoyl-l-homoserine lactone (C10-HSL). To the best of our knowledge, this is the first documentation on the production of C10-HSL in P. cremoricolorata strain ND07. PMID:24984061
Sugiyama, Miki; Koimaru, Hiroyuki; Shiba, Masahiro; Ono, Eriko; Nagata, Tadashi; Ito, Toshihiro
2006-08-01
Decreases in egg production and increased incidence of abnormal eggs due to malformation of egg shells were observed in specific pathogen free (SPF) 173-day-old laying hens inoculated intravenously with an avian metapneumovirus (aMPV) strain PLE8T1. This strain was derived from an isolate from broiler birds exhibiting swollen head syndrome (SHS). Some SPF birds inoculated with the virus showed, slight diarrhea without any respiratory symptoms. Thus, the PLE8T1 strain was used as a challenge virus to evaluate efficacy of aMPV vaccines. SPF chickens which received a live attenuated aMPV vaccine (NEMOVAC; Merial) at 7 or 77 days old and an inactivated aMPV vaccine (OVO-4; Merial) at 105 days old were protected against poor egg production caused by the challenge with the PLE8T1 strain. Thus, aMPV, the PLE8T1 strain passaged 22 times after isolation, from birds exhibiting SHS, could induce a drop in egg production in laying hens accompanied by malformation of egg shells. It was suggested that this challenge system could be applied to evaluate the efficacy of aMPV vaccine.
NASA Astrophysics Data System (ADS)
Dunn, Tasha L.; Gross, Juliane
2017-11-01
The single parent body model for the CV and CK chondrites (Greenwood et al.) was challenged by Dunn et al., who argued that magnetite compositions could not be reconciled by a single metamorphic sequence (i.e., CV3 → CK3 → CK4-6). Cr isotopic compositions, which are distinguishable between the CV and CK chondrites, also support two different parent bodies (Yin et al.). Despite this, there are many petrographic and mineralogical similarities between the unequilibrated (petrologic type 3) CK chondrites and the CV chondrites (also type 3), which may result in misclassification of samples. Hart and Northwest Africa 6047 (NWA 6047) are an excellent example of this. In this study, we revisit the classification of Hart and NWA 6047 using magnetite compositions, petrography, and compositions of olivine, the most ubiquitous mineral in both CV and CK chondrites. Not only do our results suggest that NWA 6047 and Hart were misclassified, but our assessment of CV and CK3 chondrites has also led to the development of criteria that can be used to distinguish between CV and CK3 chondrites. These criteria include: abundances of Cr2O3, TiO2, NiO, and Al2O3 in magnetite; Fa content and NiO abundance of matrix olivine; FeO content of chondrules; and the chondrule:matrix ratio. Classification as a CV chondrite is also supported by the presence of igneous chondrule rims, calcium-aluminum-rich inclusions, and an elongated petrofabric. However, none of these petrographic characteristics can be used conclusively to distinguish between CV and CK3 chondrites.
Identification of Sterochemical Configurations of Cyclopent A[cd]Pyrene DNA Adducts in Strain A/J Mouse Lung and C3H10T1/2CL8 Cells.
Four major and several minor DNA adducts were resolved by 32P-postlabeling analysis of DNA from strain A/J mouse lung and C3H10T1/2CL8 (C3H...
Avendaño-Herrera, Ruben; Suarez, Rudy; Lazo, Eduardo; Bravo, Diego; Llegues, Katerina O; Romalde, Jesús L; Godoy, Marcos G
2014-12-11
Streptococcus phocae subsp. salmonis is a fish pathogen that has an important impact on the Chilean salmon industry. Here, we report the genome sequence of the type strain C-4(T) isolated from Atlantic salmon (Salmo salar), showing a number of interesting features and genes related to its possible virulence factors. Copyright © 2014 Avendaño-Herrera et al.
Šuligoj, Tanja; Gregorini, Armando; Colomba, Mariastella; Ellis, H Julia; Ciclitira, Paul J
2013-12-01
Coeliac disease is a chronic small intestinal immune-mediated enteropathy triggered by dietary gluten in genetically predisposed individuals. Since it is unknown if all wheat varieties are equally toxic to coeliac patients seven Triticum accessions showing different origin (ancient/modern) and ploidy (di-, tetra- hexaploid) were studied. Selected strains of wheat were ancient Triticum monococcum precoce (AA genome) and Triticum speltoides (BB genome), accessions of Triticum turgidum durum (AABB genome) including two ancient (Graziella Ra and Kamut) and two modern (Senatore Cappelli and Svevo) durum strains of wheat and Triticum aestivum compactum (AABBDD genome). Small intestinal gluten-specific T-cell lines generated from 13 coeliac patients were tested with wheat accessions by proliferation assays. All strains of wheat independent of ploidy or ancient/modern origin triggered heterogeneous responses covering wide ranges of stimulation indices. Ancient strains of wheat, although previously suggested to be low or devoid of coeliac toxicity, should be tested for immunogenicity using gluten-specific T-cell lines from multiple coeliac patients rather than gluten-specific clones to assess their potential toxicity. Our findings provide further evidence for the need for a strict gluten-free diet in coeliac patients, including avoidance of ancient strains of wheat. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Aqueous Alteration of the Grosnaja CV3 Carbonaceous Chondrite
NASA Astrophysics Data System (ADS)
Keller, L. P.; McKay, D. S.
1993-07-01
Previous petrographic studies have shown that aqueous alteration products are locally well developed in some of the CV3 falls [e.g., 1-3]. In this abstract, we describe our transmission electron microscope (TEM) study of the extent of aqueous alteration in matrix and in chondrules in the Grosnaja CV3 carbonaceous chondrite. Grosnaja is an observed fall and belongs to the oxidized subgroup of the CV chondrites [4]. We obtained fragments of Grosnaja from the Naturhistorisches Museum in Vienna. Regions of interest were extracted from polished thin sections and prepared for TEM observation by ion milling. Quantitative energy-dispersive X-ray (EDX) analyses were obtained using a JEOL 2000FX TEM equipped with a LINK thin- window EDX detector. Grosnaja has undergone aqueous alteration, which has resulted in the formation of phyllosilicates in matrix and in chondrules. The suprising result from Grosnaja is that three different types of phyllosilicates are intimately intergrown. Serpentine is the most abundant phyllosilicate in matrix and occurs as fine-grained packets along grain boundaries and as fracture-fillings and veinlets that cross cut olivine and pyroxene grains. Mixed with the serpentine are packets of fine-grained phyllosilicates with a distinct 1.4-nm basal spacing that is probably a chlorite group mineral. Rare packets of smectite occur as epitaxial intergrowths with olivine, but are not interstratified with serpentine as observed in the CI chondrites. Phyllosilicates in Grosnaja matrix occur with Mg-rich carbonates, fine-grained magnetite, chromite and pentlandite, and poorly-crystalline FeNi- oxide/hydroxides, which stain the matrix a brownish-red color. Some of the rust may be of terrestrial origin (Grosnaja fell in 1861). Although the matrix phyllosilicates are too small to obtain single-phase chemical analyses in the TEM, quantitative EDX analyses suggest that the serpentine contains significant Fe (Mg/Mg + Fe ~0.5). The serpentine/chlorite forms as an
[Investigation of some virulence factors in Trichosporon spp. strains].
Demir, Feyza; Kuştimur, Semra
2014-10-01
The frequency of fungal infections have increased recently in parallel to prolonged survival of patients with chronical infections, common use of the broad-spectrum antibiotics and cytotoxic drugs and surgical interventions. Fungi such as Trichosporon, Fusarium and Geotrichum that were previously evaluated as contaminant/colonization, become important causes of morbidity and mortality especially in neutropenic patients. The aim of this study was to investigate the presence of virulence factors such as acid proteinase, phospholipase, esterase, coagulase and hemolytic activity among Trichosporon species. A total of 40 Trichosporon strains, of them 24 (60%) were T.asahii, 6 (15%) were T.inkin and 10 (25%) were the other species (one of each of T.aquatile, T.asteroides, T.coremiiforme, T.cutaneum, T.dermatis, T.faecale, T.japonicum, T.montevideense, T.mucoides, T.ovoides) were included in the study. Identification of the isolates was performed according to microscopic morphology (blastospores, arthrospores, pseudohyphae and true hyphae) on corn meal agar media, and carbohydrate assimilation patterns (API ID32C; bioMérieux, France). Secretory acid proteinase, phospholipase and esterase activities of the strains were evaluated by 1% bovine serum albumin containing agar, by egg yolk containing solid medium, and by Tween 80 containing solid medium, respectively. Hemolytic activity of the isolates were evaluated by 5-10% sheep blood Sabouraud dextrose agar. Coagulase enzyme activity was determined by using human and rabbit plasma. In our study, all of the 40 Trichosporon spp. strains were found negative in terms of acid proteinase and phospholipase enzyme activity, however all were positive for esterase enzyme activity. Hemolytic enzyme activity were identified in a total of 15 (37.5%) strains, being "+++" in three strains (2 T.asahii, 1 T.japonicum), and "++" in 12 isolates (9 T.asahii, 1 T.inkin, 1 T.asteroides, 1 T.mentevideense). Although 11 of those 15 positive
Bardet, Lucie; Cimmino, Teresa; Buffet, Clémence; Michelle, Caroline; Rathored, Jaishriram; Tandina, Fatalmoudou; Lagier, Jean-Christophe; Khelaifia, Saber; Abrahão, Jônatas; Raoult, Didier; Rolain, Jean-Marc
2018-02-01
Culturomics is a new postgenomics field that explores the microbial diversity of the human gut coupled with taxono-genomic strategy. Culturomics, and the microbiome science more generally, are anticipated to transform global health diagnostics and inform the ways in which gut microbial diversity contributes to human health and disease, and by extension, to personalized medicine. Using culturomics, we report in this study the description of strain CB1 T ( = CSUR P1334 = DSM 29075), a new species isolated from a stool specimen from a 37-year-old Brazilian woman. This description includes phenotypic characteristics and complete genome sequence and annotation. Strain CB1 T is a gram-negative aerobic and motile bacillus, exhibits neither catalase nor oxidase activities, and presents a 98.3% 16S rRNA sequence similarity with Pseudomonas putida. The 4,723,534 bp long genome contains 4239 protein-coding genes and 74 RNA genes, including 15 rRNA genes (5 16S rRNA, 4 23S rRNA, and 6 5S rRNA) and 59 tRNA genes. Strain CB1 T was named Pseudomonas massiliensis sp. nov. and classified into the family Pseudomonadaceae. This study demonstrates the usefulness of microbial culturomics in exploration of human microbiota in diverse geographies and offers new promise for incorporating new omics technologies for innovation in diagnostic medicine and global health.
Bandyopadhyay, Saumya; Das, Subrata K
2016-04-01
Arsenic is a naturally occurring ubiquitous highly toxic metalloid. In this study, we have identified ars gene cluster in Pannonibacter indicus strain HT23(T) (DSM 23407(T)), responsible for reduction of toxic pentavalent arsenate. The ars gene cluster is comprised of four non-overlapping open reading frames (ORFs) encoding a transcriptional regulator (ArsR), a low molecular weight protein tyrosine phosphatases (LMW-PTPase) with hypothetical function, an arsenite efflux pump (Acr3), and an arsenate reductase (ArsC). Heterologous expression of arsenic inducible ars gene cluster conferred arsenic resistance to Escherichia coli ∆ars mutant strain AW3110. The recombinant ArsC was purified and assayed. Site-directed mutagenesis was employed to ascertain the role of specific amino acids in ArsC catalysis. Pro94X (X = Ala, Arg, Cys, and His) amino acid substitutions led to enzyme inactivation. Circular dichroism spectra analysis suggested Pro94 as an essential amino acid for enzyme catalytic activity as it is indispensable for optimum protein folding in P. indicus Grx-coupled ArsC.
Complete genome sequence of Conexibacter woesei type strain (ID131577T)
Pukall, Rüdiger; Lapidus, Alla; Glavina Del Rio, Tijana; Copeland, Alex; Tice, Hope; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Mavromatis, Konstantinos; Ivanova, Natalia; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Chain, Patrick; Meincke, Linda; Sims, David; Brettin, Thomas; Detter, John C.; Rohde, Manfred; Göker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Kyrpides, Nikos C.; Klenk, Hans-Peter; Hugenholtz, Philip
2010-01-01
The genus Conexibacter (Monciardini et al. 2003) represents the type genus of the family Conexibacteraceae (Stackebrandt 2005, emend. Zhi et al. 2009) with Conexibacter woesei as the type species of the genus. C. woesei is a representative of a deep evolutionary line of descent within the class Actinobacteria. Strain ID131577T was originally isolated from temperate forest soil in Gerenzano (Italy). Cells are small, short rods that are motile by peritrichous flagella. They may form aggregates after a longer period of growth and, then as a typical characteristic, an undulate structure is formed by self-aggregation of flagella with entangled bacterial cells. Here we describe the features of the organism, together with the complete sequence and annotation. The 6,359,369 bp long genome of C. woesei contains 5,950 protein-coding and 48 RNA genes and is part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:21304704
Cousin, Sylvie; Loux, Valentin; Ma, Laurence; Creno, Sophie; Clermont, Dominique; Bizet, Chantal; Bouchier, Christiane
2013-08-22
We report the draft genome sequences of strain Lactobacillus equicursoris CIP 110162(T), isolated from racehorse breed feces, and Lactobacillus sp. strain CRBIP 24.137, isolated from human urine; the two strains are closely related. The total lengths of the 116 and 62 scaffolds are about 2.157 and 2.358 Mb, with G+C contents of 46 and 45% and 2,279 and 2,342 coding sequences (CDSs), respectively.
Fink, Lisbeth N; Zeuthen, Louise H; Ferlazzo, Guido; Frøkiaer, Hanne
2007-12-01
The intestinal microbiota is essential for homeostasis of the local and systemic immune system, and particularly strains of lactic acid bacteria and Escherichia coli have been shown to have balancing effects on inflammatory conditions such as allergy and inflammatory bowel disease. However, in vitro assessment of the immunomodulatory effects of distinct strains may depend strongly on the cell type used as a model. To select the most appropriate model for screening of beneficial bacteria in human cells, the response to strains of intestinal bacteria of three types of antigen-presenting cells (APC) was compared; blood myeloid dendritic cells (DC), monocyte-derived DC and monocytes, and the effector response of natural killer cells and naïve T cells was characterized. Maturation induced by gut-derived bacteria differed between APC, with blood DC and monocytes responding with the production of IL-6 and tumour necrosis factor-alpha to bacteria, which elicited mainly IL-10 in monocyte-derived DC. In contrast, comparable IFN-gamma production patterns were found in both natural killer cells and T cells induced by all bacteria-matured APC. An inhibitory effect of certain strains on this IFN-gamma production was also mediated by all types of APC. The most potent responses were induced by monocyte-derived DC, which thus constitute a sensitive screening model.
Candida olivae sp. nov., a novel yeast species from 'Greek-style' black olive fermentation.
Nisiotou, Aspasia A; Panagou, Efstathios Z; Nychas, George-John E
2010-05-01
Two yeast strains (FMCC Y-1(T) and FMCC Y-2) were recovered during a survey of the yeast biota associated with fermenting black olives, collected from an olive tree (Olea europaea L. cv. 'Conservolea') orchard in Central Greece. Phylogenetic analysis based on rRNA gene sequences (18S, 26S, and 5.8S-ITS) indicated that the two strains represent a separate species within the Candida membranifaciens clade, in close relation to Candida blattariae NRRL Y-27703(T). Electrophoretic karyotyping and physiological analysis support the affiliation of the two strains to a novel species as Candida olivae sp. nov. The novel strains are conspecific with two Candida sp. strains previously isolated from the Mid-Atlantic Ridge hydrothermal fields [Gadanho & Sampaio (2005). Microb Ecol 50, 408-417], indicating that Candida olivae sp. nov. may occupy diverse ecological niches. FMCC Y-1(T) (=CBS 11171(T) =ATCC MYA-4568(T)) is the type strain.
T-Shirt fabric and color affect the physiological strain but not 10 km outdoor running performance.
DE Alcantara Borba, Diego; Ferreira, João B; Coelho, Leonardo G; Martini, Angelo R; Lgonçalves Madeira, Luciana; Coelho, Daniel B; Prado, Luciano S; Bemben, Michael G; Rodrigues, Luiz O
2016-04-01
The aim of the present study was to evaluate the effects of T-Shirt fabric and color on the 10 km outdoor running performance. Six men and six women (mean±SD: age: 27±5 years; height: 1.70±0.13 m; weight: 64.0±12.7 kg; body surface area: 1.73±0.29 m2; Σskinfolds: 107±24 mm; VO2max: 40.2±8.4 mL.kg-1.min-1) took part in five experimental trials, during each of which they wore: 1) no T-shirt (CON); 2) white polyester T-shirt (WP); 3) black polyester T-shirt (BP); 4) white cotton T-shirt (WC); and 5) black cotton T-shirt (BC). Average running velocity (pace) was calculated from each 2 km running time. Rectal, skin and T-shirt temperatures, heart rates and Physiological Strain Index (PSI) were measured before and after the 10 km runs and at the end of each 2 km. There were no differences in pace, heart rate, rectal and skin temperatures among conditions (P>0.05). PSI was higher in BC and WC conditions when compared to BP and WP conditions. T-shirt temperature was higher for the BC when compared to WP, BP and WC conditions. Rectal temperature and heart rate increased simultaneously with reduced pace throughout self-paced running (P<0.05). Despite fabric type T-shirt altered PSI, running performance in the 10 km run was not affected by T-shirt type or color.
Valyl-tRNA synthetase modification-dependent restriction of bacteriophage T4.
Olson, N J; Marchin, G L
1984-01-01
A strain of Escherichia coli, CP 790302, severely restricts the growth of wild-type bacteriophage T4. In broth culture, most infections of single cells are abortive, although a few infected cells exhibit reduced burst sizes. In contrast, bacteriophage T4 mutants impaired in the ability to modify valyl-tRNA synthetase develop normally on this strain. Biochemical evidence indicates that the phage-modified valyl-tRNA synthetase in CP 790302 is different from that previously described. Although the enzyme is able to support normal protein synthesis, a disproportionate amount of phage structural protein (serum blocking power) fails to mature into particles of the appropriate density. The results with host strain CP 790302 are consistent with either a gratuitous inhibition of phage assembly by faulty modification or abrogation of an unknown role that valyl-tRNA synthetase might normally play in viral assembly. PMID:6374167
Palaniappan, Krishna; Meier-Kolthoff, Jan P.; Teshima, Hazuki; Nolan, Matt; Lapidus, Alla; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Goodwin, Lynne A.; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Rohde, Manfred; Mayilraj, Shanmugam; Spring, Stefan; Detter, John C.; Göker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Woyke, Tanja
2013-01-01
Thermanaerovibrio velox Zavarzina et al. 2000 is a member of the Synergistaceae, a family in the phylum Synergistetes that is already well-characterized at the genome level. Members of this phylum were described as Gram-negative staining anaerobic bacteria with a rod/vibrioid cell shape and possessing an atypical outer cell envelope. They inhabit a large variety of anaerobic environments including soil, oil wells, wastewater treatment plants and animal gastrointestinal tracts. They are also found to be linked to sites of human diseases such as cysts, abscesses, and areas of periodontal disease. The moderately thermophilic and organotrophic T. velox shares most of its morphologic and physiologic features with the closely related species, T. acidaminovorans. In addition to Su883T, the type strain of T. acidaminovorans, stain Z-9701T is the second type strain in the genus Thermanaerovibrio to have its genome sequence published. Here we describe the features of this organism, together with the non-contiguous genome sequence and annotation. The 1,880,838 bp long chromosome (non-contiguous finished sequence) with its 1,751 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:24501645
Refractive index and strain sensor based on twin-core fiber with a novel T-shaped taper
NASA Astrophysics Data System (ADS)
Zhang, Chuanbiao; Ning, Tigang; Li, Jing; Zheng, JingJing; Gao, Xuekai; Pei, Li
2018-06-01
A compact in-fiber Mach-Zehnder interferometer (MZI) based on twin-core fiber (TCF) with a novel T-shaped taper is proposed and demonstrated. The taper was firstly fabricated by a short section of TCF, and then spliced with a section of cleaved single mode fiber (SMF). When the light transmit into the TCF, multiple modes will be excited and will propagate within the TCF. In experiment, the proposed device had a maximum interferometric extinction ratio about 17 dB. And the refractive index (RI), strain, and temperature response properties of the sensor have been investigated, which show a relatively high RI, strain sensitivity and low temperature cross sensitivity. Hence, the sensor can be a suitable candidate in the biochemical and physical sensing applications. And due to its easy and controllable fabrication, the novel drawing technology can be applied to more multicore optical fibers.
Deng, Mei-Jun; Liu, Chun-Yan; Xie, Yu; Zhu, Jie-Bin; Xu, Zhen-Hua
2018-03-25
To summarize the regularity of application of Lianquan (CV 23) in clinical practice in Chinese ancient times through analysis of ancient traditional Chinese medical (TCM) literature. A total of 60 books involving CV 23 from the 1 156 ancient TCM books listed in the fifth edition of Encyclopedia of Traditional Chinese Medicine were collected by using CV 23 as the main keyword and "Sheben" "Benchi", and "Jieben" (the other names of CV 23 in TCM)as the supplementary keywords and analyzed systematically. A database was then constructed from the collected data, including the related types of disorders or symptoms, acupoint recipes, and methods of needling and moxibustion, contraindications, etc. A total of 196 articles related to the application of CV 23 from 60 ancient classical books were collected in accordance with the inclusive criteria. Among them, 155 articles are referred to the indications of CV 23, 35 to types of disorders such as asthma, cough, tongue swelling with difficulty in speaking, protracted tongue, acute contraction of tongue root, vomiting, spasm syndrome, stroke, aphtha, problems of mouth and teeth, throat problems, etc. of the internal medicine, surgery, pediatrics, and five-sense organs; 64 items are referred to the application of single CV 23, 91 to CV 23-included recipes containing 111 adjunct acupoints, and 78 to stimulation of CV 23 with acupuncture needle, moxibustion, pricking blood, and fire needle. Moreover, of the 111 adjunct acupoints, the most commonly used are Shaoshang (LU 11), Tiantu (CV 22), Hegu (LI 4), Yuye (EX-HN 13), Zhongchong (PC 9), etc. Lianquan (CV 23) is mainly used for glossopharyngeal problems chiefly by syndrome-meridian differentiation. The supplement of complementary acupoints or five-shu points in combination with CV 23 has a synergistic effect. Moxibustion (3 moxa- cones in general) is often employed, and the needling depth is usually about 7.5 mm. The common contraindication of CV 23 is severe tongue swelling.
MIZEX, 1984, NASA CV-990 flight report
NASA Technical Reports Server (NTRS)
1985-01-01
During June/July 1984, the NASA CV-990 Airborne Laboratory was utilized in a mission to overly the Fram Strait/East Greenland Sea marginal ice zone (MIZ) during the main summer marginal ice zone experiment (MIZEX '84). The eight data flights were coordinated where possible with overpasses of the Nimbus-7 satellite, and with measurement of sea ice, open ocean, and atmospheric properties at the surface. The surface research teams were based on seven research vessels, some with helicopters: (1) M/V Kvitbjorn, (2) M/V Polarqueen; (3) M/S Haakon Mosby; (4) a M/S H.U. Sverdrup, all from Norway; (5) F/S Polarstern from the Federal Republic of Germany; and (6) the USNS Lynch from the USA. There were also coordinated flights with the NRL P3, NOAA P3, Canadian CV580, and the French B-17 during the overlap portions of their respective missions. Analysis of the real-time data acquired during the mission and uncalibrated data stored on tape has served to indicate the mission was over 90% successful.
Isolation and Characterization of CvIV4: A Pain Inducing α- Scorpion Toxin
Rowe, Ashlee H.; Xiao, Yucheng; Scales, Joseph; Linse, Klaus D.; Rowe, Matthew P.; Cummins, Theodore R.; Zakon, Harold H.
2011-01-01
Background Among scorpion species, the Buthidae produce the most deadly and painful venoms. However, little is known regarding the venom components that cause pain and their mechanism of action. Using a paw-licking assay (Mus musculus), this study compared the pain-inducing capabilities of venoms from two species of New World scorpion (Centruroides vittatus, C. exilicauda) belonging to the neurotoxin-producing family Buthidae with one species of non-neurotoxin producing scorpion (Vaejovis spinigerus) in the family Vaejovidae. A pain-inducing α-toxin (CvIV4) was isolated from the venom of C. vittatus and tested on five Na+ channel isoforms. Principal Findings C. vittatus and C. exilicauda venoms produced significantly more paw licking in Mus than V. spinigerus venom. CvIV4 produced paw licking in Mus equivalent to the effects of whole venom. CvIV4 slowed the fast inactivation of Nav1.7, a Na+ channel expressed in peripheral pain-pathway neurons (nociceptors), but did not affect the Nav1.8-based sodium currents of these neurons. CvIV4 also slowed the fast inactivation of Nav1.2, Nav1.3 and Nav1.4. The effects of CvIV4 are similar to Old World α-toxins that target Nav1.7 (AahII, BmK MI, LqhIII, OD1), however the primary structure of CvIV4 is not similar to these toxins. Mutant Nav1.7 channels (D1586A and E1589Q, DIV S3–S4 linker) reduced but did not abolish the effects of CvIV4. Conclusions This study: 1) agrees with anecdotal evidence suggesting that buthid venom is significantly more painful than non-neurotoxic venom; 2) demonstrates that New World buthids inflict painful stings via toxins that modulate Na+ channels expressed in nociceptors; 3) reveals that Old and New World buthids employ similar mechanisms to produce pain. Old and New World α-toxins that target Nav1.7 have diverged in sequence, but the activity of these toxins is similar. Pain-inducing toxins may have evolved in a common ancestor. Alternatively, these toxins may be the product of convergent
Atmospheric Science Data Center
2018-06-11
... Data Products Catalog: DPC ES4 R7V1 (PDF) Validation Graphics Readme Files: Readme R6V1-894 ... Data: Note: Edition1-CV is for instrument validation purposes only and not suited for science publications. ...
Altering thermal transport by strained-layer epitaxy
NASA Astrophysics Data System (ADS)
Majdi, Tahereh; Pal, Souvik; Hafreager, Anders; Murad, Sohail; Sahu, Rakesh P.; Puri, Ishwar K.
2018-05-01
Since strain changes the interatomic spacing of matter and alters electron and phonon dispersion, an applied strain can modify the thermal conductivity k of a material. We show how the strain induced by heteroepitaxy is a passive mechanism to change k in a thin film. Molecular dynamics simulations of the deposition and epitaxial growth of ZnTe thin films provide insights into the role of interfacial strain in the conductivity of a deposited film. ZnTe films grow strain-free on lattice-matched ZnTe substrates, but similar thin films grown on a lattice-mismatched CdTe substrate exhibit ˜6% biaxial in-plane tensile strain and ˜7% uniaxial out-of-plane compressive strain. In the T = 700 K-1100 K temperature range, the conductivities of strained ZnTe layers decrease to ˜60% of their unstrained values. The resulting understanding of dk/dT shows that strain engineering can be used to alter the performance of a thermal rectifier and also provides a framework for enhancing thermoelectric devices.
Karakavuk, Muhammet; Aldemir, Duygu; Mercier, Aurélien; Atalay Şahar, Esra; Can, Hüseyin; Murat, Jean-Benjamin; Döndüren, Ömer; Can, Şengül; Özdemir, Hüseyin Gökhan; Değirmenci Döşkaya, Aysu; Pektaş, Bayram; Dardé, Marie-Laure; Gürüz, Adnan Yüksel; Döşkaya, Mert
2018-01-01
Toxoplasma gondii is a protozoon parasite that causes congenital toxoplasmosis, as well as other serious clinical presentations, in immune compromised humans. Analyses of the prevalence and genotyping of strains from the definitive host and intermediate hosts will help to understanding the circulation of the different strains and elucidating the role of the genotype(s) in human toxoplasmosis. Turkey has a specific geographic location bridging Africa, Europe, and Asia. We hypothesized that T. gondii strains may have been transferred to Turkey from these continents via migratory birds or vice versa. The present study aimed to assess the prevalence of toxoplasmosis in wild birds of prey of İzmir and Manisa provinces as well as genetically characterize T. gondii strains from these wild birds to show the relation between bird strains and neighboring stray cats as well as human strains previously isolated in Turkey. Tissues obtained from 48 wild birds were investigated for the presence of T. gondii DNA and then bioassayed in mouse. Isolated strains were genotyped using 15 microsatellite markers. The prevalence of T. gondii DNA was found to be 89.6% (n: 43/48) in wild birds. Out of 43 positive samples, a total of 14 strains were genotyped by 15 microsatellite markers. Among them, eight were type II, three were type III and three were mixture of genotypes (two type II/II and one was II/III). These are the first data that showed the presence of T. gondii and types II and III genotypes in wild birds of Turkey. Moreover, Africa 1 was not detected. In addition, cluster analysis showed that T. gondii strains within type II and III lineage have close relation with strains previously isolated from stray cats in İzmir. Further studies are required to isolate more strains from human cases, other intermediate hosts, and water sources to reveal this relation.
Karakavuk, Muhammet; Aldemir, Duygu; Mercier, Aurélien; Atalay Şahar, Esra; Can, Hüseyin; Murat, Jean-Benjamin; Döndüren, Ömer; Can, Şengül; Özdemir, Hüseyin Gökhan; Değirmenci Döşkaya, Aysu; Pektaş, Bayram; Dardé, Marie-Laure; Gürüz, Adnan Yüksel
2018-01-01
Toxoplasma gondii is a protozoon parasite that causes congenital toxoplasmosis, as well as other serious clinical presentations, in immune compromised humans. Analyses of the prevalence and genotyping of strains from the definitive host and intermediate hosts will help to understanding the circulation of the different strains and elucidating the role of the genotype(s) in human toxoplasmosis. Turkey has a specific geographic location bridging Africa, Europe, and Asia. We hypothesized that T. gondii strains may have been transferred to Turkey from these continents via migratory birds or vice versa. The present study aimed to assess the prevalence of toxoplasmosis in wild birds of prey of İzmir and Manisa provinces as well as genetically characterize T. gondii strains from these wild birds to show the relation between bird strains and neighboring stray cats as well as human strains previously isolated in Turkey. Tissues obtained from 48 wild birds were investigated for the presence of T. gondii DNA and then bioassayed in mouse. Isolated strains were genotyped using 15 microsatellite markers. The prevalence of T. gondii DNA was found to be 89.6% (n: 43/48) in wild birds. Out of 43 positive samples, a total of 14 strains were genotyped by 15 microsatellite markers. Among them, eight were type II, three were type III and three were mixture of genotypes (two type II/II and one was II/III). These are the first data that showed the presence of T. gondii and types II and III genotypes in wild birds of Turkey. Moreover, Africa 1 was not detected. In addition, cluster analysis showed that T. gondii strains within type II and III lineage have close relation with strains previously isolated from stray cats in İzmir. Further studies are required to isolate more strains from human cases, other intermediate hosts, and water sources to reveal this relation. PMID:29668747
The draft genome of Corchorus olitorius cv. JRO-524 (Navin).
Sarkar, Debabrata; Mahato, Ajay Kumar; Satya, Pratik; Kundu, Avijit; Singh, Sangeeta; Jayaswal, Pawan Kumar; Singh, Akshay; Bahadur, Kaushlendra; Pattnaik, Sasmita; Singh, Nisha; Chakraborty, Avrajit; Mandal, Nur Alam; Das, Debajeet; Basu, Tista; Sevanthi, Amitha Mithra; Saha, Dipnarayan; Datta, Subhojit; Kar, Chandan Sourav; Mitra, Jiban; Datta, Karabi; Karmakar, Pran Gobinda; Sharma, Tilak Raj; Mohapatra, Trilochan; Singh, Nagendra Kumar
2017-06-01
Here, we present the draft genome (377.3 Mbp) of Corchorus olitorious cv. JRO-524 (Navin), which is a leading dark jute variety developed from a cross between African (cv. Sudan Green) and indigenous (cv. JRO-632) types. We predicted from the draft genome a total of 57,087 protein-coding genes with annotated functions. We identified a large number of 1765 disease resistance-like and defense response genes in the jute genome. The annotated genes showed the highest sequence similarities with that of Theobroma cacao followed by Gossypium raimondii . Seven chromosome-scale genetically anchored pseudomolecules were constructed with a total size of 8.53 Mbp and used for synteny analyses with the cocoa and cotton genomes. Like other plant species, gypsy and copia retrotransposons were the most abundant classes of repeat elements in jute. The raw data of our study are available in SRA database of NCBI with accession number SRX1506532. The genome sequence has been deposited at DDBJ/EMBL/GenBank under the accession LLWS00000000, and the version described in this paper will be the first version (LLWS01000000).
Indoor Trichoderma strains emitting peptaibols in guttation droplets.
Castagnoli, E; Marik, T; Mikkola, R; Kredics, L; Andersson, M A; Salonen, H; Kurnitski, J
2018-05-19
The production of peptaibols, toxic secondary metabolites of Trichoderma, in the indoor environment is not well-documented. Here we investigated the toxicity of peptaibols in the guttation droplets and biomass of Trichoderma strains isolated from problematic buildings. Seven indoor-isolated strains of T. atroviride, T. trixiae, T. paraviridescens and T. citrinoviride were cultivated on malt extract agar, gypsum boards and paperboards. Their biomass extracts and guttation droplets were highly cytotoxic in resting and motile boar sperm cell assays and in inhibition of somatic cell proliferation assays. The toxins were identified with HPLC/ESI-MS/MS as trichorzianines, trilongins, trichostrigocins and trichostrigocin-like peptaibols. They exhibited toxicity profiles similar to the reference peptaibols alamethicin, trilongins, and trichorzianine TA IIIc purified from T. atroviride H1/226. Particular Trichoderma strains emitted the same peptaibols in both their biomasses and exudate droplets. The trilongin-producing T. citrinoviride SJ40 strain grew at 37°C. To our knowledge, this is the first report of indoor-isolated Trichoderma strains producing toxic peptaibols in their guttation droplets. This report proves that indoor isolates of Trichoderma release peptaibols in their guttation droplets. The presence of toxins in these type of exudates may serve as a mechanism of aerosol formation for nonvolatile toxins in the indoor air. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Using CV-GLUE procedure in analysis of wetland model predictive uncertainty.
Huang, Chun-Wei; Lin, Yu-Pin; Chiang, Li-Chi; Wang, Yung-Chieh
2014-07-01
This study develops a procedure that is related to Generalized Likelihood Uncertainty Estimation (GLUE), called the CV-GLUE procedure, for assessing the predictive uncertainty that is associated with different model structures with varying degrees of complexity. The proposed procedure comprises model calibration, validation, and predictive uncertainty estimation in terms of a characteristic coefficient of variation (characteristic CV). The procedure first performed two-stage Monte-Carlo simulations to ensure predictive accuracy by obtaining behavior parameter sets, and then the estimation of CV-values of the model outcomes, which represent the predictive uncertainties for a model structure of interest with its associated behavior parameter sets. Three commonly used wetland models (the first-order K-C model, the plug flow with dispersion model, and the Wetland Water Quality Model; WWQM) were compared based on data that were collected from a free water surface constructed wetland with paddy cultivation in Taipei, Taiwan. The results show that the first-order K-C model, which is simpler than the other two models, has greater predictive uncertainty. This finding shows that predictive uncertainty does not necessarily increase with the complexity of the model structure because in this case, the more simplistic representation (first-order K-C model) of reality results in a higher uncertainty in the prediction made by the model. The CV-GLUE procedure is suggested to be a useful tool not only for designing constructed wetlands but also for other aspects of environmental management. Copyright © 2014 Elsevier Ltd. All rights reserved.
Okada, Kazunori; Kaga, Sanae; Mikami, Taisei; Masauzi, Nobuo; Abe, Ayumu; Nakabachi, Masahiro; Yokoyama, Shinobu; Nishino, Hisao; Ichikawa, Ayako; Nishida, Mutsumi; Murai, Daisuke; Hayashi, Taichi; Shimizu, Chikara; Iwano, Hiroyuki; Yamada, Satoshi; Tsutsui, Hiroyuki
2017-05-01
We analyzed the waveform of systolic strain and strain-rate curves to find a characteristic left ventricular (LV) myocardial contraction pattern in patients with hypertrophic cardiomyopathy (HCM), and evaluated the utility of these parameters for the differentiation of HCM and LV hypertrophy secondary to hypertension (HT). From global strain and strain-rate curves in the longitudinal and circumferential directions, the time from mitral valve closure to the peak strains (T-LS and T-CS, respectively) and the peak systolic strain rates (T-LSSR and T-CSSR, respectively) were measured in 34 patients with HCM, 30 patients with HT, and 25 control subjects. The systolic strain-rate waveform was classified into 3 patterns ("V", "W", and "√" pattern). In the HCM group, T-LS was prolonged, but T-LSSR was shortened; consequently, T-LSSR/T-LS ratio was distinctly lower than in the HT and control groups. The "√" pattern of longitudinal strain-rate waveform was more frequently seen in the HCM group (74 %) than in the control (4 %) and HT (20 %) groups. Similar but less distinct results were obtained in the circumferential direction. To differentiate HCM from HT, the sensitivity and specificity of the T-LSSR/T-LS ratio <0.34 and the "√"-shaped longitudinal strain-rate waveform were 85 and 63 %, and 74 and 80 %, respectively. In conclusion, in patients with HCM, a reduced T-LSSR/T-LS ratio and a characteristic "√"-shaped waveform of LV systolic strain rate was seen, especially in the longitudinal direction. The timing and waveform analyses of systolic strain rate may be useful to distinguish between HCM and HT.
Liu, Shuchang; Ruban, Ludmila; Wang, Yaohe; Zhou, Yuhong; Nesbeth, Darren N
2017-02-01
Vaccinia virus (VACV) is an established vector for vaccination and is beginning to prove effective as an oncolytic agent. Industrial production of VACV stands to benefit in future from advances made by synthetic biology in genome engineering and standardisation. The CV-1 cell line can be used for VACV propagation and has been used extensively with the CRISPR/Cas9 system for making precise edits of the VACV genome. Here we take first steps toward establishing a scalable synthetic biology platform for VACV production with CV-1 cells featuring standardised biological tools and serum free cell cultivation. We propose a new BioBrick™ plasmid backbone format for inserting transgenes into VACV. We then test the performance of CV-1 cells in propagation of a conventional recombinant Lister strain VACV, VACVL-15 RFP, in a serum-free process. CV-1 cells grown in 5% foetal bovine serum (FBS) Dulbecco's Modified Eagle Medium (DMEM) were adapted to growth in OptiPRO and VP-SFM brands of serum-free media. Specific growth rates of 0.047 h -1 and 0.044 h -1 were observed for cells adapted to OptiPRO and VP-SFM respectively, compared to 0.035 h -1 in 5% FBS DMEM. Cells adapted to OptiPRO and to 5% FBS DMEM achieved recovery ratios of over 96%, an indication of their robustness to cryopreservation. Cells adapted to VP-SFM showed a recovery ratio of 82%. Virus productivity in static culture, measured as plaque forming units (PFU) per propagator cell, was 75 PFU/cell for cells in 5% FBS DMEM. VP-SFM and OptiPRO adaptation increased VACV production to 150 PFU/cell and 350 PFU/cell respectively. Boosted PFU/cell from OptiPRO-adapted cells persisted when 5% FBS DMEM or OptiPRO medium was observed during the infection step and when titre was measured using cells adapted to 5% FBS DMEM or OptiPRO medium. Finally, OptiPRO-adapted CV-1 cells were successfully cultivated using Cytodex-1 microcarriers to inform future scale up studies.
Plastic Stress-strain Relations for 75S-T6 Aluminum Alloy Subjected to Biaxial Tensile Stresses
NASA Technical Reports Server (NTRS)
Marin, Joseph; Ulrich, B H; Hughes, W P
1951-01-01
In this investigation, the material tested was a 75S-T6 aluminum alloy and the stresses were essentially biaxial and tensile. The biaxial tensile stresses were produced in a specially designed testing machine by subjecting a thin-walled tubular specimen to axial tension and internal pressure. Plastic stress-strain relations for various biaxial stress conditions were obtained using a clip-type SR-4 strain gage. Three types of tests were made: Constant-stress-ratio tests, variable-stress-ratio tests, and special tests. The constant-stress-ratio test results gave control data and showed the influence of biaxial stresses on the yield, fracture, and ultimate strength of the material. By means of the variable-stress-ratio tests, it is possible to determine whether there is any significant difference between the flow and deformation type of theory. Finally, special tests were conducted to check specific assumptions made in the theories of plastic flow. The constant-stress-ratio tests show that the deformation theory based on the octahedral, effective; or significant stress-strain relations is in approximate agreement with the test results. The variable-stress-ratio tests show that both the deformation and flow theory are in equally good agreement with the test results.
NASA Astrophysics Data System (ADS)
Malkin, B. Z.; Abishev, N. M.; Baibekov, E. I.; Pytalev, D. S.; Boldyrev, K. N.; Popova, M. N.; Bettinelli, M.
2017-07-01
We construct a distribution function of the strain-tensor components induced by point defects in an elastically anisotropic continuum, which can be used to account quantitatively for many effects observed in different branches of condensed matter physics. Parameters of the derived six-dimensional generalized Lorentz distribution are expressed through the integrals computed over the array of strains. The distribution functions for the cubic diamond and elpasolite crystals and tetragonal crystals with the zircon and scheelite structures are presented. Our theoretical approach is supported by a successful modeling of specific line shapes of singlet-doublet transitions of the T m3 + ions doped into AB O4 (A =Y , Lu; B =P , V) crystals with zircon structure, observed in high-resolution optical spectra. The values of the defect strengths of impurity T m3 + ions in the oxygen surroundings, obtained as a result of this modeling, can be used in future studies of random strains in different rare-earth oxides.
Chen, Qian; Pang, Min-Hui; Ye, Xiao-Hong; Yang, Guang; Lin, Chen
2018-05-18
Acute T-lymphocyte leukaemia is a form of haematological malignancy with abnormal activation of NF-κB pathway, which results in high expression of A20 and ABIN1, which constitute a negative feedback mechanism for the regulation of NF-κB activation. Clinical studies have found that acute T-lymphocyte leukaemia patients are susceptible to Toxoplasma gondii infection; however, the effect of T. gondii on the proliferation and apoptosis of human leukaemia T-cells remains unclear. Here, we used the T. gondii ME-49 strain to infect human leukaemia T-cell lines Jurkat and Molt-4, to explore the effect of T. gondii on proliferation and apoptosis, which is mediated by NF-κB in human leukaemia T-cells. The Tunel assay was used to detect cell apoptosis. Cell Counting Kit-8 was used to detect cell proliferation viability. The apoptosis level and the expression level of NF-κB related proteins in human leukaemia T-cells were detected by flow cytometry and Western blotting. Western blotting analyses revealed that the T. gondii ME-49 strain increased the expression of A20 and decreased both ABIN1 expression and NF-κB p65 phosphorylation. By constructing a lentiviral-mediated shRNA to knockdown the A20 gene in Jurkat T-cells and Molt-4 T-cells, the apoptosis levels of the two cell lines decreased after T. gondii ME-49 infection, and levels of NF-κB p65 phosphorylation and ABIN1 were higher than in the non-konckdown group. After knockingdown ABIN1 gene expression by constructing the lentiviral-mediated shRNA and transfecting the recombinant expression plasmid containing the ABIN1 gene into two cell lines, apoptosis levels and cleaved caspase-8 expression increased or decreased in response to T. gondii ME-49 infection, respectively. Our data suggest that ABIN1 protects human leukaemia T-cells by allowing them to resist the apoptosis induced by T. gondii ME-49 and that the T. gondii ME-49 strain induces the apoptosis of human leukaemia T-cells via A20-mediated downregulation of
Guidelines on CV networking information flow optimization for Texas.
DOT National Transportation Integrated Search
2017-03-01
Recognizing the fundamental role of information flow in future transportation applications, the research team investigated the quality and security of information flow in the connected vehicle (CV) environment. The research team identified key challe...
NASA Astrophysics Data System (ADS)
Croke, Edward; Borselli, Matthew; Kiselev, Andrey; Deelman, Peter; Milosavljevic, Ivan; Alvarado-Rodriguez, Ivan; Ross, Richard; Schmitz, Adele; Gyure, Mark; Hunter, Andrew
2011-03-01
We report measurements of the spin-relaxation lifetime (T1) as a function of magnetic field in a strained-Si, accumulation-mode quantum dot. An integrated quantum-point contact (QPC) charge sensor was used to detect changes in dot occupancy as a function of bias applied to a single gate electrode. The addition spectra we obtained are consistent with theoretical predictions starting at N=0. The conductance of the charge sensor was measured by applying an AC voltage across the QPC and a 3 k Ω resistor. Lifetime measurements were conducted using a three-pulse technique consisting of a load, read, and flush sequence. T1 was measured by observing the decay of the spin bump amplitude as a function of the load pulse length. We measured decay times ranging from approximately 75 msec at 2T to 12 msec at 3T, consistent with previous reports and theoretical predictions. Sponsored by United States Department of Defense. Approved for Public Release, Distribution Unlimited.
Palaniappan, Krishna; Meier-Kolthoff, Jan P.; Teshima, Hazuki; ...
2013-10-16
Thermanaerovibrio velox Zavarzina et al. 2000 is a member of the Synergistaceae, a family in the phylum Synergistetes that is already well-characterized at the genome level. Members of this phylum were described as Gram-negative staining anaerobic bacteria with a rod/vibrioid cell shape and possessing an atypical outer cell envelope. They inhabit a large variety of anaerobic environments including soil, oil wells, wastewater treatment plants and animal gastrointestinal tracts. They are also found to be linked to sites of human diseases such as cysts, abscesses, and areas of periodontal disease. The moderately thermophilic and organotrophic T. velox shares most of itsmore » morphologic and physiologic features with the closely related species, T. acidaminovorans. In addition to Su883 T, the type strain of T. acidaminovorans, stain Z-9701 T is the second type strain in the genus Thermanaerovibrio to have its genome sequence published. Here we describe the features of this organism, together with the non-contiguous genome sequence and annotation. The 1,880,838 bp long chromosome (non-contiguous finished sequence) with its 1,751 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palaniappan, Krishna; Meier-Kolthoff, Jan P.; Teshima, Hazuki
Thermanaerovibrio velox Zavarzina et al. 2000 is a member of the Synergistaceae, a family in the phylum Synergistetes that is already well-characterized at the genome level. Members of this phylum were described as Gram-negative staining anaerobic bacteria with a rod/vibrioid cell shape and possessing an atypical outer cell envelope. They inhabit a large variety of anaerobic environments including soil, oil wells, wastewater treatment plants and animal gastrointestinal tracts. They are also found to be linked to sites of human diseases such as cysts, abscesses, and areas of periodontal disease. The moderately thermophilic and organotrophic T. velox shares most of itsmore » morphologic and physiologic features with the closely related species, T. acidaminovorans. In addition to Su883 T, the type strain of T. acidaminovorans, stain Z-9701 T is the second type strain in the genus Thermanaerovibrio to have its genome sequence published. Here we describe the features of this organism, together with the non-contiguous genome sequence and annotation. The 1,880,838 bp long chromosome (non-contiguous finished sequence) with its 1,751 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.« less
Yamashita, Teruo; Ito, Miyabi; Tsuzuki, Hideaki; Sakae, Kenji; Minagawa, Hiroko
2010-04-01
Of 58 enterovirus strains isolated from Japanese travellers returning from Asian countries, eight were non-serotypable with existing antisera. By sequencing a part of the VP1 region, six of these strains were typed as echovirus 9, enterovirus (EV)-73, EV-79 or EV-97. The nucleotide identity of the VP1 region of isolate T92-1499 to all enterovirus prototypes was <70 %. The VP1 sequence of isolate TN94-0349 was closely related to coxsackievirus (CV)-A9 (73.3 % nucleotide identity), but the virus could not be neutralized with a serum raised against the prototype CV-A9 strain. On the basis of complete molecular comparisons, T92-1499 and TN94-0349 were identified as EV-98 and EV-107, respectively, by the ICTV Picornavirus Study Group. Serum neutralization tests of Japanese individuals revealed a seroprevalence rate of 11 % for EV-73, and even lower seroprevalence rates, 1.0-3.8 %, were found for the other new enteroviruses, suggesting that prior circulation of these viruses in Japan was unlikely.
Complete genome sequence of Desulfarculus baarsii type strain (2st14T)
Sun, Hui; Spring, Stefan; Lapidus, Alla; Davenport, Karen; Del Rio, Tijana Glavina; Tice, Hope; Nolan, Matt; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Tapia, Roxanne; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Pagani, Ionna; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Detter, John C.; Han, Cliff; Rohde, Manfred; Brambilla, Evelyne; Göker, Markus; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Land, Miriam
2010-01-01
Desulfarculus baarsii (Widdel 1981) Kuever et al. 2006 is the type and only species of the genus Desulfarculus, which represents the family Desulfarculaceae and the order Desulfarculales. This species is a mesophilic sulfate-reducing bacterium with the capability to oxidize acetate and fatty acids of up to 18 carbon atoms completely to CO2. The acetyl-CoA/CODH (Wood-Ljungdahl) pathway is used by this species for the complete oxidation of carbon sources and autotrophic growth on formate. The type strain 2st14T was isolated from a ditch sediment collected near the University of Konstanz, Germany. This is the first completed genome sequence of a member of the order Desulfarculales. The 3,655,731 bp long single replicon genome with its 3,303 protein-coding and 52 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:21304732
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, Will; Korber, Bette
2009-01-01
Creation of a successful HIV vaccine will require the development of a strategy to generate cellular immunity with sufficient cross-clade breadth to deal with the extreme genetic diversity of the virus. Polyvalent mosaic immunogens derived from in silica recombination of natural strains of HIV are designed to induce cellular immune responses that maximally cover the sequence diversity of circulating virus isolates. Immunization of rhesus monkeys with plasmid DNA and recombinant vaccinia virus vaccine constructs expressing either consensus immunogens or polyvalent mosaic immunogens elicited a CD4+ T lymphocyte-biased response with comparably broad epitope-specific total T lymphocyte specificities. However, immunization with themore » mosaic immunogens induced HIV-specific CD8+ T lymphocyte responses with markedly greater depth and breadth. Therefore, the use of polyvalent mosaic immunogens is a promising strategy for a global vaccine for HIV.« less
Oh, Hyung Jung; Lee, Mi Jung; Lee, Hye Sun; Park, Jung Tak; Han, Seung Hyeok; Yoo, Tae-Hyun; Kim, Yong-Lim; Kim, Yon Su; Yang, Chul Woo; Kim, Nam-Ho; Kang, Shin-Wook
2014-01-01
Abstract Numerous studies have demonstrated that cardiac biomarkers are significant predictors of cardiovascular (CV) and all-cause mortality in ESRD patients, but most of the studies were retrospective or included small numbers of patients, only prevalent dialysis patients, or measured 1 or 2 biomarkers. This study was to analyze the association between 3 cardiac biomarkers and mortality in incident HD patients. A prospective cohort of 864 incident HD patients was followed for 30 months. Based on the median values of baseline NT-proBNP, cTnT, and hsCRP, the patients were divided into “high” and “low” groups, and CV and all-cause mortality were compared between each group. Additionally, time-dependent ROC curves were constructed, and the NRI and IDI of the models with various biomarkers were calculated. The CV survival rates were significantly lower in the “high” NT-proBNP and cTnT groups compared to the corresponding “low” groups, while there was no significant difference in CV survival rate between the 2 hsCRP groups. However, all-cause mortality rates were significantly higher in all 3 “high” groups compared to each lower group. In multivariate analyses, only Ln NT-proBNP was found to be an independent predictor of mortality. Moreover, NT-proBNP was a more prognostic marker for mortality compared to cTnT. In conclusion, NT-proBNP is the biomarker that results in the most added prognostic value on top of traditional risk factors for CV and all-cause mortality in incident HD patients. PMID:25501091
NASA Astrophysics Data System (ADS)
Shollenberger, Quinn R.; Borg, Lars E.; Render, Jan; Ebert, Samuel; Bischoff, Addi; Russell, Sara S.; Brennecka, Gregory A.
2018-05-01
Calcium-aluminum-rich inclusions (CAIs) are the oldest dated materials in the Solar System and numerous previous studies have revealed nucleosynthetic anomalies relative to terrestrial rock standards in many isotopic systems. However, most of the isotopic data from CAIs has been limited to the Allende meteorite and a handful of other CV3 chondrites. To better constrain the isotopic composition of the CAI-forming region, we report the first Sr, Mo, Ba, Nd, and Sm isotopic compositions of two CAIs hosted in the CK3 desert meteorites NWA 4964 and NWA 6254 along with two CAIs from the CV3 desert meteorites NWA 6619 and NWA 6991. After consideration of neutron capture processes and the effects of hot-desert weathering, the Sr, Mo, Ba, Nd, and Sm stable isotopic compositions of the samples show clearly resolvable nucleosynthetic anomalies that are in agreement with previous results from Allende and other CV meteorites. The extent of neutron capture, as manifested by shifts in the observed 149Sm-150Sm isotopic composition of the CAIs is used to estimate the neutron fluence experienced by some of these samples and ranges from 8.40 × 1013 to 2.11 × 1015 n/cm2. Overall, regardless of CAI type or host meteorite, CAIs from CV and CK chondrites have similar nucleosynthetic anomalies within analytical uncertainty. We suggest the region that CV and CK CAIs formed was largely uniform with respect to Sr, Mo, Ba, Nd, and Sm isotopes when CAIs condensed and that CAIs hosted in CV and CK meteorites are derived from the same isotopic reservoir.
Kumar Singh, Amit; Sangwan, Naseer; Sharma, Anukriti; Gupta, Vipin; Khurana, J. P.
2013-01-01
Here, we report the draft genome sequence (4.2 Mb) of Sphingobium quisquiliarum strain P25T, a natural lin (genes involved in degradation of hexachlorocyclohexane [HCH] isomers) variant genotype, isolated from a heavily contaminated (450 mg HCH/g of soil) HCH dumpsite. PMID:24029763
Rubin, Clinton T.; Seeherman, Howard; Qin, Yi-Xian; Gross, Ted S.
2013-01-01
Distributions of normal strain, shear strain, and strain energy density (SED) were determined across the midshaft of the third metacarpal (MCIII, or cannon bone) of 3 adult thoroughbred horses as a function of speed and gait. A complete characterization of the mechanical demands of the bone made through the stride and from mild through the extremes of locomotion was possible by using three 3-element rosette strain gauges bonded at the diaphyseal midshaft of the MCIII and evaluating the strain output with beam theory and finite element analysis. Mean ± sd values of normal strain, shear strain, and SED increased with speed and peaked during a canter (−3560±380 microstrain, 1760±470 microstrain, and 119±23 kPa, respectively). While the location of these peaks was similar across animals and gaits, the resulting strain distributions across the cortex were consistently nonuniform, establishing between a 73-fold (slow trot) to a 330-fold (canter) disparity between the sites of maximum and minimum SED for each gait cycle. Using strain power density as an estimate of strain history across the bone revealed a 154-fold disparity between peak and minimum at the walk but fell to ∼32-fold at the canter. The nonuniform, minimally varying, strain environment suggests either that bone homeostasis is mediated by magnitude-independent mechanical signals or that the duration of stimuli necessary to establish and maintain tissue integrity is relatively brief, and thus the vast majority of strain information is disregarded.—Rubin, C. T., Seeherman, H., Qin, Y.-X., Gross, T. S., The mechanical consequences of load bearing in the equine third metacarpal across speed and gait: the nonuniform distributions of normal strain, shear strain, and strain energy density. PMID:23355269
1984-04-01
Applied Science Publications Ltd. (U.K.) "Strain Gauges, Kinds and Uses", H.K.P. Neubert . McMillan, London (U.K.) "A Strain Gauge Primer", Perry and...G.R. Paul (Materials) A.A. Baker (Materials) I.G. Powlesland G. Wright ." P. Ferrerotto J. Madej B. Ashcroft E.S. Moody M.T. Adams M. Cameron (GAF) (2
Marcelletti, Simone; Ferrante, Patrizia; Petriccione, Milena; Firrao, Giuseppe; Scortichini, Marco
2011-01-01
A recent re-emerging bacterial canker disease incited by Pseudomonas syringae pv. actinidiae (Psa) is causing severe economic losses to Actinidia chinensis and A. deliciosa cultivations in southern Europe, New Zealand, Chile and South Korea. Little is known about the genetic features of this pathovar. We generated genome-wide Illumina sequence data from two Psa strains causing outbreaks of bacterial canker on the A. deliciosa cv. Hayward in Japan (J-Psa, type-strain of the pathovar) and in Italy (I-Psa) in 1984 and 1992, respectively as well as from a Psa strain (I2-Psa) isolated at the beginning of the recent epidemic on A. chinensis cv. Hort16A in Italy. All strains were isolated from typical leaf spot symptoms. The phylogenetic relationships revealed that Psa is more closely related to P. s. pv. theae than to P. avellanae within genomospecies 8. Comparative genomic analyses revealed both relevant intrapathovar variations and putative pathovar-specific genomic regions in Psa. The genomic sequences of J-Psa and I-Psa were very similar. Conversely, the I2-Psa genome encodes four additional effector protein genes, lacks a 50 kb plasmid and the phaseolotoxin gene cluster, argK-tox but has acquired a 160 kb plasmid and putative prophage sequences. Several lines of evidence from the analysis of the genome sequences support the hypothesis that this strain did not evolve from the Psa population that caused the epidemics in 1984–1992 in Japan and Italy but rather is the product of a recent independent evolution of the pathovar actinidiae for infecting Actinidia spp. All Psa strains share the genetic potential for copper resistance, antibiotic detoxification, high affinity iron acquisition and detoxification of nitric oxide of plant origin. Similar to other sequenced phytopathogenic pseudomonads associated with woody plant species, the Psa strains isolated from leaves also display a set of genes involved in the catabolism of plant-derived aromatic compounds. PMID
Vinale, F; Marra, R; Scala, F; Ghisalberti, E L; Lorito, M; Sivasithamparam, K
2006-08-01
Trichoderma harzianum strains T22 and T39 are two micro-organisms used as active agents in a variety of commercial biopesticides and biofertilizers and widely applied amongst field and greenhouse crops. The production, isolation, biological and chemical characterization of the main secondary metabolites produced by these strains are investigated. Of the three major compounds produced by strain T22, one is a new azaphilone that shows marked in vitro inhibition of Rhizoctonia solani, Pythium ultimum and Gaeumannomyces graminis var. tritici. In turn, filtrates from strain T39 were demonstrated to contain two compounds previously isolated from other T. harzianum strains and a new butenolide. The production of the isolated metabolites was also monitored by liquid chromatography/mass spectrometry during in vitro interaction with R. solani. This paper reports the isolation and characterization of the main secondary metabolites obtained from culture filtrates of two T. harzianum strains and their production during antagonistic interaction with the pathogen R. solani. This is the first work on secondary metabolites produced by the commercially applied strains T22 and T39. Our results provide a better understanding of the metabolism of these fungi, which are both widely used as biopesticides and/or biofertilizers in biocontrol.
Bogado, Alexey Leon Gomel; Garcia, João Luis; Silva, Patrícia Fernandes Nunes da; Balarin, Mara Regina Stipp; Junior, José da Silva Guimarães
2010-01-01
Hematological parameters were evaluated in broilers immunized and challenged with Eimeria tenella. Broiler chickens of Hubbard strain, females, coccidian-free, were kept in wire cages and inoculated on the third day. The experiment was designed to include five sorts of treatment with three replicates each. T1 was the negative control group, T2 received 500 attenuated sporulated oocysts by gavage, T3 was the positive control, T4 received 50 μg of sporozoite protein + Quil A vaccine, and T5 received Quil A without sporozoite protein + PBS, the last two through nasal route on days 0, 7, and 21. On the 31st day, all treatments were challenged with homologous virulent strain of E. tenella in the dose of 8.0 x 10⁴ oocysts, with the exception of T1. One week later, blood sampling, lesion scores, and cecal oocyst count were carried out. The parasitological parameters showed statistical significance (p < 0.05) and there was no damage to the hematological parameters of birds (p > 0.05) by ANOVA test. The correlations suggest that the blood parameters were impaired by effects of the parasite on tissue, showing levels of hemorrhage and/or hydration.
NASA Astrophysics Data System (ADS)
Chapelier, Jean-Baptiste; Wasistho, Bono; Scalo, Carlo
2017-11-01
A new approach to Large-Eddy Simulation (LES) is introduced, where subgrid-scale (SGS) dissipation is applied proportionally to the degree of local spectral broadening, hence mitigated in regions dominated by large-scale vortical motion. The proposed CvP-LES methodology is based on the evaluation of the ratio of the test-filtered to resolved (or grid-filtered) enstrophy: σ = ξ ∧ / ξ . Values of σ = 1 indicate low sub-test-filter turbulent activity, justifying local deactivation of any subgrid-scale model. Values of σ < 1 span conditions ranging from incipient spectral broadening σ <= 1 , to equilibrium turbulence σ =σeq < 1 , where σeq is solely as a function of the test-to-grid filter-width ratio Δ ∧ / Δ , derived assuming a Kolmogorov's spectrum. Eddy viscosity is fully restored for σ <=σeq . The proposed approach removes unnecessary SGS dissipation, can be applied to any eddy-viscosity model, is algorithmically simple and computationally inexpensive. A CvP-LES of a pair of unstable helical vortices, representative of rotor-blade wake dynamics, show the ability of the method to sort the coherent motion from the small-scale dynamics. This work is funded by subcontract KSC-17-001 between Purdue University and Kord Technologies, Inc (Huntsville), under the US Navy Contract N68335-17-C-0159 STTR-Phase II, Purdue Proposal No. 00065007, Topic N15A-T002.
Haolla, Filipe A; Claser, Carla; de Alencar, Bruna C G; Tzelepis, Fanny; de Vasconcelos, José Ronnie; de Oliveira, Gabriel; Silvério, Jaline C; Machado, Alexandre V; Lannes-Vieira, Joseli; Bruna-Romero, Oscar; Gazzinelli, Ricardo T; dos Santos, Ricardo Ribeiro; Soares, Milena B P; Rodrigues, Mauricio M
2009-09-18
Immunisation with Amastigote Surface Protein 2 (asp-2) and trans-sialidase (ts) genes induces protective immunity in highly susceptible A/Sn mice, against infection with parasites of the Y strain of Trypanosoma cruzi. Based on immunological and biological strain variations in T. cruzi parasites, our goal was to validate our vaccination results using different parasite strains. Due to the importance of the CD8(+) T cells in protective immunity, we initially determined which strains expressed the immunodominant H-2K(k)-restricted epitope TEWETGQI. We tested eight strains, four of which elicited immune responses to this epitope (Y, G, Colombian and Colombia). We selected the Colombian and Colombia strains for our studies. A/Sn mice were immunised with different regimens using both T. cruzi genes (asp-2 and ts) simultaneously and subsequently challenged with blood trypomastigotes. Immune responses before the challenge were confirmed by the presence of specific antibodies and peptide-specific T cells. Genetic vaccination did not confer protective immunity against acute infection with a lethal dose of the Colombian strain. In contrast, we observed a drastic reduction in parasitemia and a significant increase in survival, following challenge with an otherwise lethal dose of the Colombia strain. In many surviving animals with late-stage chronic infection, we observed alterations in the heart's electrical conductivity, compared to naive mice. In summary, we concluded that immunity against T. cruzi antigens, similar to viruses and bacteria, may be strain-specific and have a negative impact on vaccine development.
USDA-ARS?s Scientific Manuscript database
Bradyrhizobium elkanii USDA 76T (INSCD = ARAG00000000), the type strain for Bradyrhizobium elkanii, is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing root nodule of Glycine max (L. Merr) grown in the USA. Because of its significance as a ...
PALOMA:A Magnetic CV between Polars and Intermediate Polars
NASA Astrophysics Data System (ADS)
Joshi, Arti; Pandey, J. C.
Using observations made with XMM-Newton, we present temporal and spectral analysis of an intermediate polar-like object Paloma. We also interpreted Paloma as a key object for magnetic CV evolution with an orbital period right within the period gap.
Segura, Ana; Duque, Estrella; Hurtado, Ana; Ramos, Juan L.
2001-01-01
Pseudomonas putida DOT-T1E is a solvent-tolerant strain able to grow in the presence of 1% (vol/vol) toluene in the culture medium. Random mutagenesis with mini-Tn5-′phoA-Km allowed us to isolate a mutant strain (DOT-T1E-42) that formed blue colonies on Luria-Bertani medium supplemented with 5-bromo-4-chloro-3-indolylphosphate and that, in contrast to the wild-type strain, was unable to tolerate toluene shocks (0.3%, vol/vol). The mutant strain exhibited patterns of tolerance or sensitivity to a number of antibiotics, detergents, and chelating agents similar to those of the wild-type strain. The mutation in this strain therefore seemed to specifically affect toluene tolerance. Cloning and sequencing of the mutation revealed that the mini-Tn5-′phoA-Km was inserted within the fliP gene, which is part of the fliLMNOPQRflhBA cluster, a set of genes that encode flagellar structure components. FliP is involved in the export of flagellar proteins, and in fact, the P. putida fliP mutant was nonmotile. The finding that, after replacing the mutant allele with the wild-type one, the strain recovered the wild-type pattern of toluene tolerance and motility unequivocally assigned FliP a function in solvent resistance. An flhB knockout mutant, another gene component of the flagellar export apparatus, was also nonmotile and hypersensitive to toluene. In contrast, a nonpolar mutation at the fliL gene, which encodes a cytoplasmic membrane protein associated with the flagellar basal body, yielded a nonmotile yet toluene-resistant strain. The results are discussed regarding a possible role of the flagellar export apparatus in the transport of one or more proteins necessary for toluene tolerance in P. putida DOT-T1E to the periplasm. PMID:11418551
NASA Astrophysics Data System (ADS)
Pradeep, Krishna; Poiroux, Thierry; Scheer, Patrick; Juge, André; Gouget, Gilles; Ghibaudo, Gérard
2018-07-01
This work details the analysis of wafer level global process variability in 28 nm FD-SOI using split C-V measurements. The proposed approach initially evaluates the native on wafer process variability using efficient extraction methods on split C-V measurements. The on-wafer threshold voltage (VT) variability is first studied and modeled using a simple analytical model. Then, a statistical model based on the Leti-UTSOI compact model is proposed to describe the total C-V variability in different bias conditions. This statistical model is finally used to study the contribution of each process parameter to the total C-V variability.
Genotyping of enteroviruses isolated in Kenya from pediatric patients using partial VP1 region.
Opanda, Silvanos M; Wamunyokoli, Fred; Khamadi, Samoel; Coldren, Rodney; Bulimo, Wallace D
2016-01-01
Enteroviruses (EV) are responsible for a wide range of clinical diseases in humans. Though studied broadly in several regions of the world, the genetic diversity of human enteroviruses (HEV) circulating in the sub-Saharan Africa remains under-documented. In the current study, we molecularly typed 61 HEV strains isolated in Kenya between 2008 and 2011 targeting the 3'-end of the VP1 gene. Viral RNA was extracted from the archived isolates and part of the VP1 gene amplified by RT-PCR, followed by sequence analysis. Twenty-two different EV types were detected. Majority (72.0 %) of these belonged to Enterovirus B species followed by Enterovirus D (21.3 %) and Enterovirus A (6.5 %). The most frequently detected types were Enterovirus-D68 (EV-D68), followed by Coxsackievirus B2 (CV-B2), CV-B1, CV-B4 and CV-B3. Phylogenetic analyses of these viruses revealed that Kenyan CV-B1 isolates were segregated among sequences of global CV-B1 strains. Conversely, the Kenyan CV-B2, CV-B3, CV-B4 and EV-D68 strains generally grouped together with those detected from other countries. Notably, the Kenyan EV-D68 strains largely clustered with sequences of global strains obtained between 2008 and 2010 than those circulating in recent years. Overall, our results indicate that HEV strains belonging to Enterovirus D and Enterovirus B species pre-dominantly circulated and played a significant role in pediatric respiratory infection in Kenya, during the study period. The Kenyan CV-B1 strains were genetically divergent from those circulating in other countries. Phylogenetic clustering of Kenyan EV-D68 strains with sequences of global strains circulating between 2008 and 2010 than those obtained in recent years suggests a high genomic variability associated with the surface protein encoding VP1 gene in these enteroviruses.
Constitutive Model Constants for Al7075-T651 and Al7075-T6
NASA Astrophysics Data System (ADS)
Brar, N. S.; Joshi, V. S.; Harris, B. W.
2009-12-01
Aluminum 7075-T651 and 7075-T6 are characterized at quasi-static and high strain rates to determine Johnson-Cook (J-C) strength and fracture model constants. Constitutive model constants are required as input to computer codes to simulate projectile (fragment) impact or similar impact events on structural components made of these materials. Although the two tempers show similar elongation at breakage, the ultimate tensile strength of T651 temper is generally lower than the T6 temper. Johnson-Cook strength model constants (A, B, n, C, and m) for the two alloys are determined from high strain rate tension stress-strain data at room and high temperature to 250°C. The Johnson-Cook fracture model constants are determined from quasi-static and medium strain rate as well as high temperature tests on notched and smooth tension specimens. Although the J-C strength model constants are similar, the fracture model constants show wide variations. Details of the experimental method used and the results for the two alloys are presented.
Liu, Shugen; Zhu, Nanwen; Li, Loretta Y; Yuan, Haiping
2011-11-15
Two representative thermophilic bacterial strains (T1 and T2) were isolated from a one-stage autothermal thermophilic aerobic digestion pilot-scale reactor. 16S rRNA gene analysis indicated that they were Hydrogenophilaceae and Xanthomonodaceae. These isolated strains were inoculated separately and/or jointly in sewage sludge, to investigate their effects on sludge stabilization under thermophilic aerobic digestion condition. Four digestion conditions were tested for 480 h. Digestion without inoculation and inoculation with strain T2, as well as joint- inoculation with strains T1 and T2, achieved 32.6%, 43.0%, and 38.2% volatile solids (VS) removal, respectively. Removal in a digester inoculated with stain T1 only reached 27.2%. For the first 144 h, the three inoculated digesters all experienced higher VS removal than the digester without inoculations. Both specific thermophilic strains and micro-environment significantly affected the VS removal. DGGE profiles revealed that the isolated strains T1 and T2 can successfully establish in the thermophilic digesters. Other viable bacteria (including anaerobic or facultative microbes) also appeared in the digestion system, enhancing the microbial activity. Copyright © 2011. Published by Elsevier Ltd.
Gaddy, Jennifer A.; Arivett, Brock A.; McConnell, Michael J.; López-Rojas, Rafael; Pachón, Jerónimo
2012-01-01
Acinetobacter baumannii, which causes serious infections in immunocompromised patients, expresses high-affinity iron acquisition functions needed for growth under iron-limiting laboratory conditions. In this study, we determined that the initial interaction of the ATCC 19606T type strain with A549 human alveolar epithelial cells is independent of the production of BasD and BauA, proteins needed for acinetobactin biosynthesis and transport, respectively. In contrast, these proteins are required for this strain to persist within epithelial cells and cause their apoptotic death. Infection assays using Galleria mellonella larvae showed that impairment of acinetobactin biosynthesis and transport functions significantly reduces the ability of ATCC 19606T cells to persist and kill this host, a defect that was corrected by adding inorganic iron to the inocula. The results obtained with these ex vivo and in vivo approaches were validated using a mouse sepsis model, which showed that expression of the acinetobactin-mediated iron acquisition system is critical for ATCC 19606T to establish an infection and kill this vertebrate host. These observations demonstrate that the virulence of the ATCC 19606T strain depends on the expression of a fully active acinetobactin-mediated system. Interestingly, the three models also showed that impairment of BasD production results in an intermediate virulence phenotype compared to those of the parental strain and the BauA mutant. This observation suggests that acinetobactin intermediates or precursors play a virulence role, although their contribution to iron acquisition is less relevant than that of mature acinetobactin. PMID:22232188
[Influence of staphylococcin T on Enterococcus sp. growth].
Białucha, Agata; Kozuszko, Sylwia; Gospodarek, Eugenia; Bugalski, Roman Marian; Gierlotka, Krzysztof
2007-01-01
Bacteriocins are ribosomally synthesised, extracellular bacterial products. Generally, spectrum of inhibition is limited to the same or closely related species to bacteriocin producer. Staphylococcin T is produced by Staphylococcus cohnii strain. The present study concerns influence of StT to 267 Enterococcus sp. strains growth isolated between 2003 and 2006 in Department of Microbiology University Hospital of dr. A. Jurasz in Bydgoszcz. S. cohnii T antagonistic ability evaluated towards bacteries on Mueller-Hinton Agar (bio Mérieux) in aerobic conditions. After 24 and 48 hours tested enterococci suspensions were plated perpendiculary. Susceptibility to antibiotics was assessed by disc diffusion method according to the guideless of Clinical and Laboratory Standards Institute and National Reference Centre for Antimicrobial Susceptibility. Among Enterococcus sp. strains tested 7.1% were sensitive to StT. The highest percentage of sensitive enterococci isolated from wound swabs, urine, blood and pus. Enterococcus faecium strains dominated (63.2%) among enterococci sensitive to StT. Moderate inhibition degree on S. cohnii T bacteriocin action was observed in majority sensitive enterococci strains. Enterococcus sp. sensitive to StT strains were frequently multidrug resistant (68.4%). According to the study results and increasing resistance to antibiotics, StT could be an alternative agent used to treat infections caused by Enterococcus sp.
CV-Muzar - The Virtual Community Environment that Uses Multiagent Systems for Formation of Groups
NASA Astrophysics Data System (ADS)
de Marchi, Ana Carolina Bertoletti; Moraes, Márcia Cristina
The purpose of this chapter is to present two agents' societies responsible for group formation (sub-communities) in CV-Muzar (Augusto Ruschi Zoobotanical Museum Virtual Community of the University of Passo Fundo). These societies are integrated to execute a data mining classification process. The first society is a static society that intends preprocessing data, investigating the information about groups in the CV-Muzar. The second society is a dynamical society that will make a classification process by analyzing the existing groups and look for participants that have common subjects in order to constitute a sub-community. The formation of sub-communities is a new functionality within the CV-Muzar that intends to bring the participants together according to two scopes: interest similarity and knowledge complementarities.
Tang, Yi; Wang, Pin; Van Deventer, James A.; Link, A. James; Tirrell, David A.
2011-01-01
A leucine analog containing a ketone has been incorporated into proteins in E. coli. Only E. coli strains overexpressing an editing-deficient leucyl-tRNA synthetase were capable of synthesizing proteins with the aliphatic ketone amino acid. Modification of ketone-containing proteins under mild conditions has been demonstrated. PMID:19670197
DFT+DMFT study of strain and interface effects in d1 and d2 t2 g-perovskites
NASA Astrophysics Data System (ADS)
Sclauzero, Gabriele; Dymkowski, Krzysztof; Ederer, Claude
2015-03-01
Metal-insulator transitions in thin films of early-transition metal correlated oxides are linked to both epitaxial strain and electronic reconstruction at the film/substrate interface. We separately address these two key factors for LaTiO3 and LaVO3 through density functional theory plus dynamical mean-field theory (DFT+DMFT). We find that mere epitaxial strain suffices to induce an insulator-to-metal transition in LaTiO3, but not in LaVO3, in agreement with recent experiments. We show that this difference can be explained by the combined effect of strain-induced changes in the crystal field splitting of t2 g orbitals and different orbital filling in these two materials. The role of the interface is investigated through DFT+DMFT simulations of LaVO3/SrTiO3 heterostructures with varying superlattice periodicities and substrate terminations. Our aim is to assess whether the metallicity observed at the LaVO3/SrTiO3 interface could be driven by pure electronic reconstruction effects, rather than structural or stoichiometric reasons (such as, e.g., O-related defects).
Goudarzi, Mehdi; Bahramian, Mahnaz; Satarzadeh Tabrizi, Mahboobeh; Udo, Edet E; Figueiredo, Agnes Marie Sá; Fazeli, Maryam; Goudarzi, Hossein
2017-04-01
Methicillin-resistant Staphylococcus aureus (MRSA) as a major cause of infection in health care, hospital and community settings is a global health concern. The purpose of this study was to determine the antibiotic susceptibility pattern and distribution of circulating molecular types of MRSA in a burn hospital in Tehran, the capital of Iran. During a 10-month study period, 106 Staphylococcus aureus isolates were assessed. Isolates were subjected to susceptibility testing using the disk diffusion method and Polymerase Chain Reaction (PCR) for detection of mecA, fem and nuc genes. The presence of PVL and tst encoding genes were determined by PCR method. All the MRSA isolates were genotyped by multilocus sequence typing (MLST), spa typing, SCCmec typing and agr typing. The presence of mecA gene was confirmed in all the Staphylococcus aureus isolates. Antimicrobial susceptibility testing revealed a high resistance rate (90.6%) to ampicillin, tetracycline, and erythromycin. The rates of resistance to remaining antibiotics tested varied between 18.9% and 84.9%. The high- level of resistance to mupirocin was confirmed in 19.8% of MRSA strains isolated from burn patients. Multi-drug resistance was observed in 90.6% of isolates. Sixteen of the 106 MRSA isolates (15.1%) harbored PVL-encoding genes. The majority of our MRSA strains carried SCCmec III (71.7%). ST239-SCCmec III/t037 (34%) was the most common genotype followed by ST239-SCCmec III/t030 (24.5%), ST15-SCCmec IV/t084 (15.1%), ST22-SCCmec IV/t790 (13.2%), and ST239-SCCmec III/t631 (13.2%). Mupirocin resistant MRSA isolates belonged to ST15-SCCmec IV/t084 (40%), ST22-SCCmec IV/t790 (23.3%), ST239-SCCmec III/t631 (20%), and ST239-SCCmec III/t030 (16.7%) clones. The results showed that genetically diverse strains of MRSA are circulating in our burn hospitals with relatively high prevalence of ST239-SCCmec III/t037 clone. The findings support the need for regular surveillance of MRSA to determine the distribution of
Derivation of the Johnson-Samwer T2/3 temperature dependence of the yield strain in metallic glasses
NASA Astrophysics Data System (ADS)
Dasgupta, Ratul; Joy, Ashwin; Hentschel, H. G. E.; Procaccia, Itamar
2013-01-01
Metallic glasses are prone to fail mechanically via a shear-banding instability. In a remarkable paper Johnson and Samwer demonstrated that this failure enjoys a high degree of universality in the sense that a large group of metallic glasses appears to possess a yield strain that decreases with temperature following a -T2/3 law up to logarithmic corrections. In this Rapid Communication we offer a theoretical derivation of this law. We show that our formula fits very well simulation data on typical amorphous solids.
NASA Technical Reports Server (NTRS)
Miller, I.; Moore, R.
1990-01-01
Root caps of primary, secondary, and seminal roots of Z. mays cv. Kys secrete large amounts of mucilage and are in close contact with the root all along the root apex. These roots are strongly graviresponsive. Secondary and seminal roots of Z. mays cv. Ageotropic are also strongly graviresponsive. Similarly, their caps secrete mucilage and closely appress the root all along the root apex. However, primary roots of Z. mays cv. Ageotropic are non-responsive to gravity. Their caps secrete negligible amounts of mucilage and contact the root only at the extreme apex of the root along the calyptrogen. These roots become graviresponsive when their tips are coated with mucilage or mucilage-like materials. Peripheral cells of root caps of roots of Z. mays cv. Kys contain many dictyosomes associated with vesicles that migrate to and fuse with the plasmalemma. Root-cap cells of secondary and seminal (i.e. graviresponsive) roots of Z. mays cv. Ageotropic are similar to those of primary roots of Z. mays cv. Kys. However, root-cap cells of primary (i.e. non-graviresponsive) roots of Z. mays cv. Ageotropic have distended dictyosomal cisternae filled with an electron-dense, granular material. Large vesicles full of this material populate the cells and apparently do not fuse with the plasmalemma. Taken together, these results suggest that non-graviresponsiveness of primary roots of Z. mays cv. Ageotropic results from the lack of apoplastic continuity between the root and the periphery of the root cap. This is a result of negligible secretion of mucilage by cells along the edge of the root cap which, in turn, appears to be due to the malfunctioning of dictyosomes in these cells.
Light equation in eclipsing binary CV Boo: third body candidate in elliptical orbit
NASA Astrophysics Data System (ADS)
Bogomazov, A. I.; Kozyreva, V. S.; Satovskii, B. L.; Krushevska, V. N.; Kuznyetsova, Y. G.; Ehgamberdiev, S. A.; Karimov, R. G.; Khalikova, A. V.; Ibrahimov, M. A.; Irsmambetova, T. R.; Tutukov, A. V.
2016-12-01
A short period eclipsing binary star CV Boo is tested for the possible existence of additional bodies in the system with a help of the light equation method. We use data on the moments of minima from the literature as well as from our observations during 2014 May-July. A variation of the CV Boo's orbital period is found with a period of {≈}75 d. This variation can be explained by the influence of a third star with a mass of {≈}0.4 M_{⊙} in an eccentric orbit with e≈0.9. A possibility that the orbital period changes on long time scales is discussed. The suggested tertiary companion is near the chaotic zone around the central binary, so CV Boo represents an interesting example to test its dynamical evolution. A list of 14 minima moments of the binary obtained from our observations is presented.
CV-990 Landing Systems Research Aircraft (LSRA) during final Space Shuttle tire test
NASA Technical Reports Server (NTRS)
1995-01-01
A Convair 990 (CV-990) was used as a Landing Systems Research Aircraft (LSRA) at NASA's Dryden Flight Research Center, Edwards, California, to test space shuttle landing gear and braking systems as part of NASA's effort to upgrade and improve space shuttle capabilities. The first flight at Dryden of the CV-990 with shuttle test components occurred in April 1993, and tests continued into August 1995, when this photo shows a test of the shuttle tires. The purpose of this series of tests was to determine the performance parameters and failure limits of the tires. This particular landing was on the dry lakebed at Edwards, but other tests occurred on the main runway there. The CV-990, built in 1962 by the Convair Division of General Dynamics Corp., Ft. Worth, Texas, served as a research aircraft at Ames Research Center, Moffett Field, California, before it came to Dryden.
Grall, Sophie; Manceau, Charles
2003-01-01
The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-marked strains of the CFBP2098 strain of X. ampelinus for histological studies. We studied the colonization of young plants of V. vinifera cv. Ugni blanc by X. ampelinus after three types of artificial contamination in a growth chamber and in a greenhouse. (i) After wounding of the stem and inoculation, the bacteria progressed down to the crown through the xylem vessels, where they organized into biofilms. (ii) When the bacteria were forced into woody cuttings, they rarely colonized the emerging plantlets. Xylem vessels could play a key role in the multiplication and conservation of the bacteria, rather than being a route for plant colonization. (iii) When bacterial suspensions were sprayed onto the plants, bacteria progressed in two directions: both in emerging organs and down to the crown, thus displaying the importance of epiphytic colonization in disease development. PMID:12676663
Grall, Sophie; Manceau, Charles
2003-04-01
The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-marked strains of the CFBP2098 strain of X. ampelinus for histological studies. We studied the colonization of young plants of V. vinifera cv. Ugni blanc by X. ampelinus after three types of artificial contamination in a growth chamber and in a greenhouse. (i) After wounding of the stem and inoculation, the bacteria progressed down to the crown through the xylem vessels, where they organized into biofilms. (ii) When the bacteria were forced into woody cuttings, they rarely colonized the emerging plantlets. Xylem vessels could play a key role in the multiplication and conservation of the bacteria, rather than being a route for plant colonization. (iii) When bacterial suspensions were sprayed onto the plants, bacteria progressed in two directions: both in emerging organs and down to the crown, thus displaying the importance of epiphytic colonization in disease development.
USDA-ARS?s Scientific Manuscript database
This report includes the complete genome of the Campylobacter concisus type strain ATCC 33237T and the draft genomes of eight additional well characterized C. concisus genomes. C. concisus has been shown to be a genetically heterogeneous species and these nine genomes provide valuable information re...
Tensile and compressive stress-strain behavior of heat treated boron-aluminum
NASA Technical Reports Server (NTRS)
Kennedy, J. M.; Tenney, D. R.; Herakovich, C. T.
1978-01-01
An experimental study was conducted to assess the effects of heat treatment and cyclic mechanical loading on the tensile and compressive stress-strain behavior of six boron-aluminum composites having different laminate orientations and being subjected to different heat treatments. The heat treatments were as-fabricated, T6, and T6N consisting of T6 treatment followed by cryogenic quench in liquid nitrogen prior to testing. All laminates were tested in monotonic and cyclic compression, while the tensile-test data are taken from the literature for comparison purposes. It is shown that the linear elastic range of the T6- and T6N-condition specimens is larger than that of the as-fabricated specimens, and that cyclic loading in tension or compression strain hardens the specimens and extends the linear elastic range. For laminates containing 0-deg plies, the stress-strain behavior upon unloading is found to be nonlinear, whereas the other laminates exhibit a linear behavior upon unloading. Specimens in the T6 and T6N conditions show higher strain hardening than the as-fabricated specimens.
Lyke, Kirsten E; Ishizuka, Andrew S; Berry, Andrea A; Chakravarty, Sumana; DeZure, Adam; Enama, Mary E; James, Eric R; Billingsley, Peter F; Gunasekera, Anusha; Manoj, Anita; Li, Minglin; Ruben, Adam J; Li, Tao; Eappen, Abraham G; Stafford, Richard E; Kc, Natasha; Murshedkar, Tooba; Mendoza, Floreliz H; Gordon, Ingelise J; Zephir, Kathryn L; Holman, LaSonji A; Plummer, Sarah H; Hendel, Cynthia S; Novik, Laura; Costner, Pamela J M; Saunders, Jamie G; Berkowitz, Nina M; Flynn, Barbara J; Nason, Martha C; Garver, Lindsay S; Laurens, Matthew B; Plowe, Christopher V; Richie, Thomas L; Graham, Barney S; Roederer, Mario; Sim, B Kim Lee; Ledgerwood, Julie E; Hoffman, Stephen L; Seder, Robert A
2017-03-07
A live-attenuated malaria vaccine, Plasmodium falciparum sporozoite vaccine (PfSPZ Vaccine), confers sterile protection against controlled human malaria infection (CHMI) with Plasmodium falciparum (Pf) parasites homologous to the vaccine strain up to 14 mo after final vaccination. No injectable malaria vaccine has demonstrated long-term protection against CHMI using Pf parasites heterologous to the vaccine strain. Here, we conducted an open-label trial with PfSPZ Vaccine at a dose of 9.0 × 10 5 PfSPZ administered i.v. three times at 8-wk intervals to 15 malaria-naive adults. After CHMI with homologous Pf parasites 19 wk after final immunization, nine (64%) of 14 (95% CI, 35-87%) vaccinated volunteers remained without parasitemia compared with none of six nonvaccinated controls ( P = 0.012). Of the nine nonparasitemic subjects, six underwent repeat CHMI with heterologous Pf7G8 parasites 33 wk after final immunization. Five (83%) of six (95% CI, 36-99%) remained without parasitemia compared with none of six nonvaccinated controls. PfSPZ-specific T-cell and antibody responses were detected in all vaccine recipients. Cytokine production by T cells from vaccinated subjects after in vitro stimulation with homologous (NF54) or heterologous (7G8) PfSPZ were highly correlated. Interestingly, PfSPZ-specific T-cell responses in the blood peaked after the first immunization and were not enhanced by subsequent immunizations. Collectively, these data suggest durable protection against homologous and heterologous Pf parasites can be achieved with PfSPZ Vaccine. Ongoing studies will determine whether protective efficacy can be enhanced by additional alterations in the vaccine dose and number of immunizations.
Ombra, Maria Neve; Fratianni, Florinda; Granese, Tiziana; Cardinale, Federica; Cozzolino, Autilia; Nazzaro, Filomena
2015-01-01
Analyses of antioxidant and in vitro antimicrobial and anti-proliferative activities of anthocyanin-rich extracts from purple potatoes, Solanum tuberosum L. cv Vitelotte noire (Solanaceae), were performed by simulating both a domestic cooking process and human digestion. Extracts of crude and cooked purple potato did not exhibit antimicrobial activity against the tester strains: Bacillus cereus, Escherichia coli and Pseudomonas aeruginosa. The behaviour changed after the simulated gastrointestinal transit, when an inhibition halo was observed against all tester strains used, ranging from 0.53 cm against B. cereus to 0.82 cm against E. coli. In addition antioxidant activity exhibited, before and after the simulated gastrointestinal digestion (5.96 mg/mL ± 0.92; 28 mg/mL ± 0 .13, respectively) and the persistence of anti-proliferative activity against the colon cancer cells Caco-2, SW48 and MCF7, MDA-MB-231 breast cancer cells, after the simulated digestion, (EC50 = 0.21; 1.13 μg/mL), suggest that vitelotte consumption might bring tangible benefits for human health.
Cryopreservation of banana's cv Grand Naine in vitro rhizomes.
Londe, Luciana C N; Vendrame, Wagner A; Sanaei, Massy; Oliveira, Alexandre B DE
2018-01-01
The preservation of banana genetic material is usually performed through seedlings. However, most banana cultivars do not produce seed and are propagated vegetatively. Therefore, cryopreservation is a feasible technique that allows the preservation of banana genotypes indefinitely. For the success of cryopreservation protocols, the selection of cryoprotectants and pre-freezing techniques are important factor. Therefore, the objective of this study was to verify the effects of different cryoprotectants with and without 1% phloroglucinol and pre-cooling periods on the development of a protocol for cryopreservation of in vitro rhizomes ofMusa accuminata(AAA) cv Grand Naine banana. The addition of 1% phloroglucinol to the cryoprotective solutions, such as PVS2 enhanced recovery of cryopreserved banana rhizomes. In addition, pre-cooling of explants in ice for 3 hours in PVS2 + 1% of phloroglucinol allowed efficient cryopreservation of banana rhizomes, followed by successful recovery and regeneration of in vitro shoots of banana cv Grand Naine.
Biodegradation potentiality of psychrophilic bacterial strain Oleispira antarctica RB-8(T).
Gentile, G; Bonsignore, M; Santisi, S; Catalfamo, M; Giuliano, L; Genovese, L; Yakimov, M M; Denaro, R; Genovese, M; Cappello, S
2016-04-15
The present study is focused on assessing the growth and hydrocarbon-degrading capability of the psychrophilic strain Oleispira antarctica RB-8(T). This study considered six hydrocarbon mixtures that were tested for 22days at two different cultivation temperatures (4 and 15°C). During the incubation period, six sub-aliquots of each culture at different times were processed for total bacterial abundance and GC-FID (gas chromatography-flame ionization detection) hydrocarbon analysis. Results from DNA extraction and DAPI (4',6-diamidino-2-phenylindole) staining showed a linear increase during the first 18days of the experiment in almost all the substrates used; both techniques showed a good match, but the difference in values obtained was approximately one order of magnitude. GC-FID results revealed a substantial hydrocarbon degradation rate in almost all hydrocarbon sources and in particular at 15°C rather than 4°C (for commercial oil engine, oily waste, fuel jet, and crude oil). A more efficient degradation was observed in cultures grown with diesel and bilge water at 4°C. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hert, A P; Roberts, P D; Momol, M T; Minsavage, G V; Tudor-Nelson, S M; Jones, J B
2005-07-01
In a previous study, tomato race 3 (T3) strains of Xanthomonas perforans became predominant in fields containing both X. euvesicatoria and X. perforans races T1 and T3, respectively. This apparent ability to take over fields led to the discovery that there are three bacteriocin-like compounds associated with T3 strains. T3 strain 91-118 produces at least three different bacteriocin-like compounds (BCN-A, BCN-B, and BCN-C) antagonistic toward T1 strains. We determined the relative importance of the bacteriocin-like compounds by constructing the following mutant forms of a wild-type (WT) T3 strain to evaluate the antagonism to WT T1 strains: Mut-A (BCN-A-), Mut-B (BCN-B-), Mut-C (BCN-C-), Mut-AB, Mut-BC, and Mut-ABC. Although all mutant and WT T3 strains reduced the T1 populations in in planta growth room experiments, Mut-B and WT T3 were significantly more effective. Mutants expressing BCN-B and either BCN-A or BCN-C reduced T1 populations less than mutants expressing only BCN-A or BCN-C. The triple-knockout mutant Mut-ABC also had a significant competitive advantage over the T1 strain. In pairwise-inoculation field experiments where plants were coinoculated with an individual mutant or WT T3 strain and the T1 strain, the mutant strains and the WT T3 strain were reisolated from more than 70% of the lesions. WT T3 and Mut-B were the most frequently reisolated strains. In field experiments where plants were group inoculated with Mut-A, Mut-B, Mut-C, Mut-ABC, and WT T1 and T3 strains, Mut-B populations dominated all three seasons. In greenhouse and field experiments, the WT and mutant T3 strains had a selective advantage over T1 strains. Bacterial strains expressing both BCN-A and BCN-C appeared to have a competitive advantage over all other mutant and WT strains. Furthermore, BCN-B appeared to be a negative factor, with mutant T3 strains lacking BCN-B having a selective advantage in the field.
Kappler, Ulrike; Davenport, Karen W.; Beatson, Scott; ...
2016-06-03
Thioalkalimicrobium cyclicum (Sorokin et al. 2002) is a member of the family Piscirickettsiaceae in the order Thiotrichales. The -proteobacterium belongs to the colourless sulfur-oxidizing bacteria isolated from saline soda lakes with stable alkaline pH, such as Lake Mono (California) and Soap Lake (Washington State). Strain ALM 1 T is characterized by its adaptation to life in the oxic/anoxic interface towards the less saline aerobic waters (mixolimnion) of the stable stratified alkaline salt lakes. Strain ALM 1 T is the first representative of the genus Thioalkalimicrobium whose genome sequence has been deciphered and the fourth genome sequence of a type strainmore » of the Piscirickettsiaceae to be published. As a result, the 1,932,455 bp long chromosome with its 1,684 protein-coding and 50 RNA genes was sequenced as part of the DOE Joint Genome Institute Community Sequencing Program (CSP) 2008.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kappler, Ulrike; Davenport, Karen W.; Beatson, Scott
Thioalkalimicrobium cyclicum (Sorokin et al. 2002) is a member of the family Piscirickettsiaceae in the order Thiotrichales. The -proteobacterium belongs to the colourless sulfur-oxidizing bacteria isolated from saline soda lakes with stable alkaline pH, such as Lake Mono (California) and Soap Lake (Washington State). Strain ALM 1 T is characterized by its adaptation to life in the oxic/anoxic interface towards the less saline aerobic waters (mixolimnion) of the stable stratified alkaline salt lakes. Strain ALM 1 T is the first representative of the genus Thioalkalimicrobium whose genome sequence has been deciphered and the fourth genome sequence of a type strainmore » of the Piscirickettsiaceae to be published. As a result, the 1,932,455 bp long chromosome with its 1,684 protein-coding and 50 RNA genes was sequenced as part of the DOE Joint Genome Institute Community Sequencing Program (CSP) 2008.« less
Huang, Xia; Huang, Xue-Lin; Xiao, Wang; Zhao, Jie-Tang; Dai, Xue-Mei; Chen, Yun-Feng; Li, Xiao-Ju
2007-10-01
A high efficient protocol of Agrobacterium-mediated transformation of Musa acuminata cv. Mas (AA), a major banana variety of the South East Asia region, was developed in this study. Male-flower-derived embryogenic cell suspensions (ECS) were co-cultivated in liquid medium with Agrobacterium strain EHA105 harboring a binary vector pCAMBIA2301 carrying nptII and gusA gene in the T-DNA. Depending upon conditions and duration of co-cultivation in liquid medium, 0-490 transgenic plants per 0.5 ml packed cell volume (PCV) of ECS were obtained. The optimum duration of inoculation was 2 h, and the highest transformation frequency was achieved when infected ECS were co-cultivated in liquid medium first for 12 h at 40 rpm and then for 156 h at 100 rpm on a rotary shaker. Co-cultivation for a shorter duration (72 h) or shaking constantly at 100 rpm at the same duration gave 1.6 and 1.8 folds lower transformation efficiency, respectively. No transgenic plants were obtained in parallel experiments carried on semi-solid media. Histochemical GUS assay and molecular analysis in several tissues of the transgenic plants demonstrated that foreign genes were stably integrated into the banana genome. Compared to semi-solid co-cultivation transformation in other banana species, it is remarkable that liquid co-cultivation was much more efficient for transformation of the Mas cultivar, and was at least 1 month faster for regenerating transgenic plants.
Cui, Peng; Liu, Huitao; Lin, Qiang; Ding, Feng; Zhuo, Guoyin; Hu, Songnian; Liu, Dongcheng; Yang, Wenlong; Zhan, Kehui; Zhang, Aimin; Yu, Jun
2009-12-01
Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.
Galaxy and Mass Assembly (GAMA): the GAMA galaxy group catalogue (G3Cv1)
NASA Astrophysics Data System (ADS)
Robotham, A. S. G.; Norberg, P.; Driver, S. P.; Baldry, I. K.; Bamford, S. P.; Hopkins, A. M.; Liske, J.; Loveday, J.; Merson, A.; Peacock, J. A.; Brough, S.; Cameron, E.; Conselice, C. J.; Croom, S. M.; Frenk, C. S.; Gunawardhana, M.; Hill, D. T.; Jones, D. H.; Kelvin, L. S.; Kuijken, K.; Nichol, R. C.; Parkinson, H. R.; Pimbblet, K. A.; Phillipps, S.; Popescu, C. C.; Prescott, M.; Sharp, R. G.; Sutherland, W. J.; Taylor, E. N.; Thomas, D.; Tuffs, R. J.; van Kampen, E.; Wijesinghe, D.
2011-10-01
Using the complete Galaxy and Mass Assembly I (GAMA-I) survey covering ˜142 deg2 to rAB= 19.4, of which ˜47 deg2 is to rAB= 19.8, we create the GAMA-I galaxy group catalogue (G3Cv1), generated using a friends-of-friends (FoF) based grouping algorithm. Our algorithm has been tested extensively on one family of mock GAMA lightcones, constructed from Λ cold dark matter N-body simulations populated with semi-analytic galaxies. Recovered group properties are robust to the effects of interlopers and are median unbiased in the most important respects. G3Cv1 contains 14 388 galaxy groups (with multiplicity ≥2), including 44 186 galaxies out of a possible 110 192 galaxies, implying ˜40 per cent of all galaxies are assigned to a group. The similarities of the mock group catalogues and G3Cv1 are multiple: global characteristics are in general well recovered. However, we do find a noticeable deficit in the number of high multiplicity groups in GAMA compared to the mocks. Additionally, despite exceptionally good local spatial completeness, G3Cv1 contains significantly fewer compact groups with five or more members, this effect becoming most evident for high multiplicity systems. These two differences are most likely due to limitations in the physics included of the current GAMA lightcone mock. Further studies using a variety of galaxy formation models are required to confirm their exact origin. The G3Cv1 catalogue will be made publicly available as and when the relevant GAMA redshifts are made available at .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Steve; Elisberg, Brenton; Calderone, James
Thermal mechanical stresses of glass-ceramic to stainless steel (GCtSS) seals are analyzed using finite element modeling over a temperature cycle from a set temperature (T set) 500°C to -55°C, and then back to 600°C. There are two glass-ceramics that have an identical coefficient of thermal expansion (CTE) at ~16 ppm/°C but have very different linearity of thermal strains, designated as near-linear NL16 and step-like SL16, and were formed from the same parent glass using different crystallization processes. Stress modeling reveals much higher plastic strain in the stainless steel using SL16 glass-ceramic when the GCtSS seal cools from T set. Uponmore » heating tensile stresses start to develop at the GC-SS interface before the temperature reaches T set. On the other hand, the much lower plastic deformation in stainless steel accumulated during cooling using NL16 glass-ceramic allows for radially compressive stress at the GC-SS interface to remain present when the seal is heated back to T set. Finally, the qualitative stress comparison suggests that with a better match of thermal strain rate to that of stainless steel, the NL16 glass-ceramic not only improves the hermeticity of the GCtSS seals, but would also improve the reliability of the seals exposed to high-temperature and/or high-pressure abnormal environments.« less
Dai, Steve; Elisberg, Brenton; Calderone, James; ...
2017-04-21
Thermal mechanical stresses of glass-ceramic to stainless steel (GCtSS) seals are analyzed using finite element modeling over a temperature cycle from a set temperature (T set) 500°C to -55°C, and then back to 600°C. There are two glass-ceramics that have an identical coefficient of thermal expansion (CTE) at ~16 ppm/°C but have very different linearity of thermal strains, designated as near-linear NL16 and step-like SL16, and were formed from the same parent glass using different crystallization processes. Stress modeling reveals much higher plastic strain in the stainless steel using SL16 glass-ceramic when the GCtSS seal cools from T set. Uponmore » heating tensile stresses start to develop at the GC-SS interface before the temperature reaches T set. On the other hand, the much lower plastic deformation in stainless steel accumulated during cooling using NL16 glass-ceramic allows for radially compressive stress at the GC-SS interface to remain present when the seal is heated back to T set. Finally, the qualitative stress comparison suggests that with a better match of thermal strain rate to that of stainless steel, the NL16 glass-ceramic not only improves the hermeticity of the GCtSS seals, but would also improve the reliability of the seals exposed to high-temperature and/or high-pressure abnormal environments.« less
FAN, HUAILING; JI, FENG; LIN, YING; ZHANG, MULAN; QIN, WEI; ZHOU, QI; WU, QIANG
2016-01-01
The present study aimed to investigate the effect of electroacupuncture stimulation at CV4 (also termed Guanyuan) on femoral osteocalcin also termed bone gla protein (BGP), alkaline phosphatase (ALP), bone mineral density (BMD) and biomechanics, as well as the Wnt-β-catenin signaling pathway in rats with postmenopausal osteoporosis. Female Sprague-Dawley rats (4.5-months old) were randomly divided into sham, Ovx, CV4 and mock groups (n=10/group). With the exception of those in the sham group, the rats were ovariectomized to induce postmenopausal osteoporosis. The rats in the CV4 and mock groups were given electroacupuncture at CV4 and non-acupoint, respectively. The rats in the Ovx model and sham groups underwent identical fixing procedures, but did not undergo electroacupuncture. Following treatment, hematoxylin and eosin staining was used to observe morphological changes in the left femoral trabecular bone, and a three-point-bending test was used to analyze femur biomechanics and determine the BMD. In addition, an enzyme-linked immunosorbent assay was used to measure the serum levels of ALP/BGP and reverse transcription-quantitative polymerase chain reaction was used detect the expression levels of Wnt3a, β-catenin and Runx2. In the present study, it was demonstrated that electroacupuncture at CV4 significantly improved the osteoporotic morphological changes that occurred in the ovariectomized rats, increased serum ALP and BGP levels, enhanced the maximum and fracture loads, increased BMD (P<0.01), and activated the Wnt-β-catenin signaling pathway. These findings demonstrated that electroacupuncture stimulation at CV4 affected bone formation and promoted bone metabolism in rats with postmenopausal osteoporosis, possibly by activating the Wnt-β-catenin signaling pathway. PMID:26846191
NASA Astrophysics Data System (ADS)
Lenzen, Matthias; Merklein, Marion
2017-10-01
In the automotive sector, a major challenge is the deep-drawing of modern lightweight sheet metals with limited formability. Thus, conventional material models lack in accuracy due to the complex material behavior. A current field of research takes into account the evolution of the Lankford coefficient. Today, changes in anisotropy under increasing degree of deformation are not considered. Only a consolidated average value of the Lankford coefficient is included in conventional material models. This leads to an increasing error in prediction of the flow behavior and therefore to an inaccurate prognosis of the forming behavior. To increase the accuracy of the prediction quality, the strain dependent Lankford coefficient should be respected, because the R-value has a direct effect on the contour of the associated flow rule. Further, the investigated materials show a more or less extinct rate dependency of the yield stress. For this reason, the rate dependency of the Lankford coefficient during uniaxial tension is focused within this contribution. To quantify the influence of strain rate on the Lankford coefficient, tensile tests are performed for three commonly used materials, the aluminum alloy AA6016-T4, the advanced high strength steel DP800 and the deep drawing steel DC06 at three different strain rates. The strain measurement is carried out by an optical strain measurement system. An evolution of the Lankford coefficient was observed for all investigated materials. Also, an influence of the deformation velocity on the anisotropy could be detected.
Temperature Driven Topological Switch in 1T'-MoTe2 and Strain Induced Nematicity in NaFeAs
NASA Astrophysics Data System (ADS)
Berger, Ayelet Denise Notis
Quasiparticle interference (QPI) is a powerful technique within Scanning Tunneling Microscopy (STM) that is used to probe the electronic bandstructure of materials. This thesis presents two examples using QPI to measure the bandstructure in materials with exotic electronic states that can be tuned via outside parameters (temperature and strain). In Part I of the thesis, we discuss the temperature dependence of Fermi Arcs in 1T'-MoTe 2, and then in Part II, the strain dependent nematic state in NaFeAs. The recent discovery of Weyl semimetals has introduced a new family of materials with topologically protected electronic properties and potential applications due to their anomalous transport effects. Even more useful is a Weyl semimetal that can be turned "on" and "off," switching between a topological and trivial state. One possible material is MoTe2, which undergoes a phase transition at 240K. This thesis consists of experiments using Scanning Tunneling Microscopy (STM) and Spectroscopy (STS) at different temperatures to visualize changes in the electronic bandstructure of MoTe2 across the topological phase transition. We show that a signature of topologically protected Fermi Arcs is present at low temperatures but disappears at room temperature, in the trivial phase. We include an in-depth discussion of how to account for thermal effects when comparing these two types of measurements. In Part II, we discuss strain induced nematicity in NaFeAs, an iron pnictide. Nematic fluctuations and spin correlations play an important role in the phase diagram of the iron pnictides, a family of unconventional superconductors. Illuminating the mechanism behind this symmetry breaking is key to understanding the superconducting state. Previous work has shown that nematicity in the iron pnictides responds strongly to applied strain [1, 2]. In this thesis, I present results from a new experimental technique, elasto-scanning tunneling microscopy (E-STM), which combines in situ strain
Sugiyama, Y; Fujita, T; Matsumoto, M; Okamoto, K; Imada, I
1985-12-01
The effects of idebenone (CV-2619) and its metabolites on respiratory activity and lipid peroxidation in isolated brain mitochondria from rats and dogs were studied. CV-2619 was easily reduced by canine brain mitochondria in the presence of respiratory substrates. Reduced CV-2619 (2H-CV-2619) was rapidly oxidized through the cytochrome b chain, indicating that the compound functioned simply as an electron carrier of mitochondrial respiratory system. Both nicotinamide adenine dinucleotide (NADH)- and nicotinamide adenine dinucleotide phosphate (NADPH)-dependent lipid peroxidations were examined in canine brain mitochondria in the presence of adenosine diphosphate (ADP) and Fe3+. NADH-cytochrome c reductase activity was sensitive to NADPH-dependent lipid peroxidation. CV-2619 (10(-5)M) strongly inhibited both types of the lipid peroxidation reactions and protected the resultant inactivation of the NADH-cytochrome c reductase activity. Activities of succinate oxidase in rat and canine brain mitochondria were virtually unaffected by CV-2619 and its metabolites (10(-5)-10(-6) M). On the other hand, CV-2619 markedly suppressed the state 3 respiration in glutamate oxidation in a dose dependent manner without any effect on the state 4 respiration and the ADP/O ratio in intact rat brain mitochondria. The inhibitory effect of CV-2619 was also observed in NADH-cytochrome c reductase, but not in NADH-2,6-dichlorophenolindophenol (DCIP) and NADH-ubiquinone reductases in canine brain mitochondria. These facts and results of inhibitor analysis suggest that the action site of CV-2619 is NADH-linked complex I in the mitochondrial respiratory chain and is different from that of inhibitors of oxidative phosphorylation such as rotenone, oligomycin and 2,4-dinitrophenol. Finally, the above findings suggest that CV-2619 acts as an electron carrier in respiratory chains and functions as an antioxidant against membrane damage caused by lipid peroxidation in brain mitochondria. It appears
Strain hypothesis of Toxoplasma gondii infection on the outcome of human diseases
Xiao, Jianchun; Yolken, Robert H.
2015-01-01
The intracellular protozoan Toxoplasma gondii is an exceptionally successful food- and waterborne parasite that infects approximately 1 billion people worldwide. Genotyping of T. gondii isolates from all continents revealed a complex population structure. Recent research supports the notion that T. gondii genotype may be associated with disease severity. Here, we (1) discuss molecular and serological approaches for designation of T. gondii strain type, (2) overview the literatures on the association of T. gondii strain type and the outcome of human disease, and (3) explore possible mechanisms underlying these strain specific pathology and severity of human toxoplasmosis. Although no final conclusions can be drawn, it is clear that virulent strains (e. g. strains containing type I or atypical alleles) are significantly more often associated with increased frequency and severity of human toxoplasmosis. The significance of highly virulent strains can cause severe diseases in immunocompetent patients and might implicated in brain disorders such as schizophrenia should led to reconsideration of toxoplasmosis. Further studies that combine parasite strain typing and human factor analysis (e.g. immune status and genetic background) are required for better understanding of human susceptibility or resistance to toxoplasmosis. PMID:25600911
Feng, Chiguang; Ghosh, Anita; Amin, Mohammed N.; Giomarelli, Barbara; Shridhar, Surekha; Banerjee, Aditi; Fernández-Robledo, José A.; Bianchet, Mario A.; Wang, Lai-Xi; Wilson, Iain B. H.; Vasta, Gerardo R.
2013-01-01
The galectin CvGal1 from the eastern oyster (Crassostrea virginica), which possesses four tandemly arrayed carbohydrate recognition domains, was previously shown to display stronger binding to galactosamine and N-acetylgalactosamine relative to d-galactose. CvGal1 expressed by phagocytic cells is “hijacked” by the parasite Perkinsus marinus to enter the host, where it proliferates and causes systemic infection and death. In this study, a detailed glycan array analysis revealed that CvGal1 preferentially recognizes type 2 blood group A oligosaccharides. Homology modeling of the protein and its oligosaccharide ligands supported this preference over type 1 blood group A and B oligosaccharides. The CvGal ligand models were further validated by binding, inhibition, and competitive binding studies of CvGal1 and ABH-specific monoclonal antibodies with intact and deglycosylated glycoproteins, hemocyte extracts, and intact hemocytes and by surface plasmon resonance analysis. A parallel glycomic study carried out on oyster hemocytes (Kurz, S., Jin, C., Hykollari, A., Gregorich, D., Giomarelli, B., Vasta, G. R., Wilson, I. B. H., and Paschinger, K. (2013) J. Biol. Chem. 288,) determined the structures of oligosaccharides recognized by CvGal1. Proteomic analysis of the hemocyte glycoproteins identified β-integrin and dominin as CvGal1 “self”-ligands. Despite strong CvGal1 binding to P. marinus trophozoites, no binding of ABH blood group antibodies was observed. Thus, parasite glycans structurally distinct from the blood group A oligosaccharides on the hemocyte surface may function as potentially effective ligands for CvGal1. We hypothesize that carbohydrate-based mimicry resulting from the host/parasite co-evolution facilitates CvGal1-mediated cross-linking to β-integrin, located on the hemocyte surface, leading to cell activation, phagocytosis, and host infection. PMID:23824193
Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burr, T.J.; Norelli, J.L.; Katz, B.H.
1990-06-01
Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two {sup 32}P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizationsmore » were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10{sup 6} CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains.« less
de Vos, Paul; Mujagic, Zlatan; de Haan, Bart J.; Siezen, Roland J.; Bron, Peter A.; Meijerink, Marjolein; Wells, Jerry M.; Masclee, Ad A. M.; Boekschoten, Mark V.; Faas, Marijke M.; Troost, Freddy J.
2017-01-01
Orally ingested bacteria interact with intestinal mucosa and may impact immunity. However, insights in mechanisms involved are limited. In this randomized placebo-controlled cross-over trial, healthy human subjects were given Lactobacillus plantarum supplementation (strain TIFN101, CIP104448, or WCFS1) or placebo for 7 days. To determine whether L. plantarum can enhance immune response, we compared the effects of three stains on systemic and gut mucosal immunity, by among others assessing memory responses against tetanus toxoid (TT)-antigen, and mucosal gene transcription, in human volunteers during induction of mild immune stressor in the intestine, by giving a commonly used enteropathic drug, indomethacin [non-steroidal anti-inflammatory drug (NSAID)]. Systemic effects of the interventions were studies in peripheral blood samples. NSAID was found to induce a reduction in serum CD4+/Foxp3 regulatory cells, which was prevented by L. plantarum TIFN101. T-cell polarization experiments showed L. plantarum TIFN101 to enhance responses against TT-antigen, which indicates stimulation of memory responses by this strain. Cell extracts of the specific L. plantarum strains provoked responses after WCFS1 and TIFN101 consumption, indicating stimulation of immune responses against the specific bacteria. Mucosal immunomodulatory effects were studied in duodenal biopsies. In small intestinal mucosa, TIFN101 upregulated genes associated with maintenance of T- and B-cell function and antigen presentation. Furthermore, L. plantarum TIFN101 and WCFS1 downregulated immunological pathways involved in antigen presentation and shared downregulation of snoRNAs, which may suggest cellular destabilization, but may also be an indicator of tissue repair. Full sequencing of the L. plantarum strains revealed possible gene clusters that might be responsible for the differential biological effects of the bacteria on host immunity. In conclusion, the impact of oral consumption L. plantarum on
Biological and Molecular Characterization of Trypanosoma cruzi Strains from Four States of Brazil.
Ribeiro, Aline Rimoldi; Lima, Luciana; de Almeida, Larissa Aguiar; Monteiro, Joana; Moreno, Cláudia Jassica Gonçalves; Nascimento, Juliana Damieli; de Araújo, Renato Freitas; Mello, Fernanda; Martins, Luciamáre Perinetti Alves; Graminha, Márcia Aparecida Silva; Teixeira, Marta Maria Geraldes; Silva, Marcelo Sousa; Steindel, Mário; da Rosa, João Aristeu
2018-02-01
Chagas disease affects between six and seven million people. Its etiological agent, Trypanosoma cruzi , is classified into six discrete typing units (DTUs). The biological study of 11 T. cruzi strains presented here included four parameters: growth kinetics, parasitemia curves, rate of macrophage infection, and serology to evaluate IgM, total IgG, IgG1, IgG2a, and IgG3. Sequencing of small subunit of ribosomal RNA (SSU rRNA)was performed and the T. cruzi strains were classified into three DTUs. When their growth in liver infusion tryptose medium was represented in curves, differences among the strains could be noted. The parasitemia profile varied among the strains from the TcI, TcII, and TcIII groups, and the 11 T. cruzi strains produced distinct parasitemia levels in infected BALB/c. The TcI group presented the highest rate of macrophage infection by amastigotes, followed by TcII and TcIII. Reactivity to immunoglobulins was observed in the TcI, TcII, and TcIII; all the animals infected with the different strains of T. cruzi showed anti- T. cruzi antibodies. The molecular study presented here resulted in the classification of the T. cruzi strains into the TcI (Bolivia, T lenti, Tm, SC90); TcII (Famema, SC96, SI8, Y); and TcIII (QMM3, QMM5, SI5) groups. These biological and molecular results from 11 T. cruzi strains clarified the factors involved in the biology of the parasite and its hosts. The collection of triatomine (vector) species, and the study of geographic distribution, as well as biological and molecular characterization of the parasite, will contribute to the reporting and surveillance measures in Brazilian states.
NASA Technical Reports Server (NTRS)
Guimon, R. Kyle; Symes, Steven J. K.; Sears, Derek W. G.
1995-01-01
The induced thermoluminescence (TL) properties of 16 CV and CV-related chondrites, four CK chondrites and Renazzo (CR2) have been measured in order to investigate their metamorphic history. The petrographic, mineralogical and bulk compositional differences among the CV chondrites indicate that the TL sensitivity of the approximately 130 C TL peak is reflecting the abundance of ordered feldspar, especially in chondrule mesostasis, which in turn reflects parent-body metamorphism. The TL properties of 18 samples of homogenized Allende powder heated at a variety of times and temperatures, and cathodoluminescence mosaics of Axtell and Coolidge, showed results consistent with this conclusion. Five refractory inclusions from Allende, and separates from those inclusions, were also examined and yielded trends reflecting variations in mineralogy indicative of high peak temperatures (either metamorphic or igneous) and fairly rapid cooling. The CK chondrites are unique among metamorphosed chondrites in showing no detectable induced TL, which is consistent with literature data that suggests very unusual feldspar in these meteorites. Using TL sensitivity and several mineral systems and allowing for the differences in the oxidized and reduced subgroups, the CV and CV-related meteorites can be divided into petrologic types analogous to those of the ordinary and CO type 3 chondrites. Axtell, Kaba, Leoville, Bali, Arch and ALHA81003 are type 3.0-3.1, while ALH84018, Efremovka, Grosnaja, Allende and Vigarano are type 3.2-3.3 and Coolidge and Loongana 001 are type 3.8. Mokoia is probably a breccia with regions ranging in petrologic type from 3.0 to 3.2. Renazzo often plots at the end of the reduced and oxidized CV chondrite trends, even when those trends diverge, suggesting that in many respects it resembles the unmetamorphosed precursors of the CV chondrites. The low-petrographic types and low-TL peak temperatures of all samples, including the CV3.8 chondrites, indicates metamorphism
Cyclovirus CyCV-VN species distribution is not limited to Vietnam and extends to Africa.
Garigliany, Mutien-Marie; Hagen, Ralf Matthias; Frickmann, Hagen; May, Jürgen; Schwarz, Norbert Georg; Perse, Amanda; Jöst, Hanna; Börstler, Jessica; Shahhosseini, Nariman; Desmecht, Daniel; Mbunkah, Herbert Afegenwi; Daniel, Achukwi Mbunkah; Kingsley, Manchang Tanyi; Campos, Renata de Mendonca; de Paula, Vanessa Salete; Randriamampionona, Njary; Poppert, Sven; Tannich, Egbert; Rakotozandrindrainy, Raphael; Cadar, Daniel; Schmidt-Chanasit, Jonas
2014-12-18
Cycloviruses, small ssDNA viruses of the Circoviridae family, have been identified in the cerebrospinal fluid from symptomatic human patients. One of these species, cyclovirus-Vietnam (CyCV-VN), was shown to be restricted to central and southern Vietnam. Here we report the detection of CyCV-VN species in stool samples from pigs and humans from Africa, far beyond their supposed limited geographic distribution.
Reeve, Wayne; van Berkum, Peter; Ardley, Julie; ...
2017-03-04
Bradyrhizobium elkanii USDA 76 T (INSCD = ARAG00000000), the type strain for Bradyrhizobium elkanii, is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing root nodule of Glycine max (L. Merr) grown in the USA. Because of its significance as a microsymbiont of this economically important legume, B. elkanii USDA 76 T was selected as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria sequencing project. Here the symbiotic abilities of B. elkanii USDA 76 T are described, together with its genome sequence information and annotation. The 9,484,767 bpmore » high-quality draft genome is arranged in 2 scaffolds of 25 contigs, containing 9060 protein-coding genes and 91 RNA-only encoding genes. The B. elkanii USDA 76 T genome contains a low GC content region with symbiotic nod and fix genes, indicating the presence of a symbiotic island integration. A comparison of five B. elkanii genomes that formed a clique revealed that 356 of the 9060 protein coding genes of USDA 76 T were unique, including 22 genes of an intact resident prophage. A conserved set of 7556 genes were also identified for this species, including genes encoding a general secretion pathway as well as type II, III, IV and VI secretion system proteins. The type III secretion system has previously been characterized as a host determinant for Rj and/or rj soybean cultivars. Here we show that the USDA 76 T genome contains genes encoding all the type III secretion system components, including a translocon complex protein NopX required for the introduction of effector proteins into host cells. While many bradyrhizobial strains are unable to nodulate the soybean cultivar Clark (rj1), USDA 76 T was able to elicit nodules on Clark (rj1), although in reduced numbers, when plants were grown in Leonard jars containing sand or vermiculite. In these conditions, we postulate that the presence of NopX allows
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reeve, Wayne; van Berkum, Peter; Ardley, Julie
Bradyrhizobium elkanii USDA 76 T (INSCD = ARAG00000000), the type strain for Bradyrhizobium elkanii, is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing root nodule of Glycine max (L. Merr) grown in the USA. Because of its significance as a microsymbiont of this economically important legume, B. elkanii USDA 76 T was selected as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria sequencing project. Here the symbiotic abilities of B. elkanii USDA 76 T are described, together with its genome sequence information and annotation. The 9,484,767 bpmore » high-quality draft genome is arranged in 2 scaffolds of 25 contigs, containing 9060 protein-coding genes and 91 RNA-only encoding genes. The B. elkanii USDA 76 T genome contains a low GC content region with symbiotic nod and fix genes, indicating the presence of a symbiotic island integration. A comparison of five B. elkanii genomes that formed a clique revealed that 356 of the 9060 protein coding genes of USDA 76 T were unique, including 22 genes of an intact resident prophage. A conserved set of 7556 genes were also identified for this species, including genes encoding a general secretion pathway as well as type II, III, IV and VI secretion system proteins. The type III secretion system has previously been characterized as a host determinant for Rj and/or rj soybean cultivars. Here we show that the USDA 76 T genome contains genes encoding all the type III secretion system components, including a translocon complex protein NopX required for the introduction of effector proteins into host cells. While many bradyrhizobial strains are unable to nodulate the soybean cultivar Clark (rj1), USDA 76 T was able to elicit nodules on Clark (rj1), although in reduced numbers, when plants were grown in Leonard jars containing sand or vermiculite. In these conditions, we postulate that the presence of NopX allows
Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169
We report the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169T, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, though Fl-016...
Fan, Huailing; Ji, Feng; Lin, Ying; Zhang, Mulan; Qin, Wei; Zhou, Qi; Wu, Qiang
2016-03-01
The present study aimed to investigate the effect of electroacupuncture stimulation at CV4 (also termed Guanyuan) on femoral osteocalcin also termed bone gla protein (BGP), alkaline phosphatase (ALP), bone mineral density (BMD) and biomechanics, as well as the Wnt‑β‑catenin signaling pathway in rats with postmenopausal osteoporosis. Female Sprague‑Dawley rats (4.5‑months old) were randomly divided into sham, Ovx, CV4 and mock groups (n=10/group). With the exception of those in the sham group, the rats were ovariectomized to induce postmenopausal osteoporosis. The rats in the CV4 and mock groups were given electroacupuncture at CV4 and non‑acupoint, respectively. The rats in the Ovx model and sham groups underwent identical fixing procedures, but did not undergo electroacupuncture. Following treatment, hematoxylin and eosin staining was used to observe morphological changes in the left femoral trabecular bone, and a three‑point‑bending test was used to analyze femur biomechanics and determine the BMD. In addition, an enzyme‑linked immunosorbent assay was used to measure the serum levels of ALP/BGP and reverse transcription‑quantitative polymerase chain reaction was used detect the expression levels of Wnt3a, β‑catenin and Runx2. In the present study, it was demonstrated that electroacupuncture at CV4 significantly improved the osteoporotic morphological changes that occurred in the ovariectomized rats, increased serum ALP and BGP levels, enhanced the maximum and fracture loads, increased BMD (P<0.01), and activated the Wnt‑β‑catenin signaling pathway. These findings demonstrated that electroacupuncture stimulation at CV4 affected bone formation and promoted bone metabolism in rats with postmenopausal osteoporosis, possibly by activating the Wnt‑β‑catenin signaling pathway.
Announcement of CERES FM6 Edition1-CV Product Release
Atmospheric Science Data Center
2018-06-14
The Atmospheric Science Data Center (ASDC) at NASA Langley Research Center in collaboration with the CERES Science Team ... be found at the CERES data table: http://eosweb.larc.nasa.gov/project/ceres/ceres_table Edition1-CV is for instrument ...
Jiménez, Paula; García, Paula; Bustamante, Andrés; Barriga, Andrés; Robert, Paz
2017-04-15
Effect of the addition of avocado (Persea americana cv. Hass) or olive (Olea europaea cv. Arbequina) hydroalcoholic leaf extracts (AHE and OHE, respectively) on thermal stability of canola oil (CO) and high oleic sunflower oil (HOSO) during French potatoes frying at 180°C was studied. The extracts were characterized by the total phenolic content, phenol chromatographic profiles and antioxidant activity. B-type trimer procyanidins were the major phenolic compounds identified in AHE. OHE showed higher phenol content, antioxidant activity regarding AHE. CO+OHE and HOSO+OHE decreased the formation of polar compounds and showed an anti-polymeric effect with respect to oils without extracts, whereas AHE extract showed a prooxidant effect on HOSO. Therefore, OHE showed an antioxidant effect on HOSO and CO under the studied conditions. In addition, all systems (CO+AHE, HOSO+AHE, CO+OHE and HOSO+OHE) increased the retention of tocopherols. These results demonstrate the potential utility of OHE as natural antioxidant for oils. Copyright © 2016 Elsevier Ltd. All rights reserved.
Giant electric-field-induced strain in lead-free piezoelectric materials
Chen, Lan; Yang, Yurong; Meng, X. K.
2016-01-01
First-principles calculations are performed to investigate the structures, electrical, and magnetic properties of compressive BiFeO3 films under electric-field and pressure perpendicular to the films. A reversible electric-field-induced strain up 10% is achieved in the compressive BiFeO3 films. The giant strain originates from rhombohedral-tetragonal (R-T) phase transition under electric-filed, and is recoverable from tetragonal-rhombohedral (T-R) phase transition by compressive stress. Additionally, the weak ferromagnetism in BiFeO3 films is largely changed in R-T phase transition under electric-filed and T-R phase transition under pressure – reminiscent of magnetoelectric effect and magnetoelastic effect. These results suggest exciting device opportunities arising from the giant filed-induced strain, large magnetoelectric effect and magnetoelastic effect. PMID:27139526
Hahnke, Richard L.; Stackebrandt, Erko; Meier-Kolthoff, Jan P.; ...
2015-07-30
Flavobacterium rivuli Ali et al. 2009 emend. Dong et al. 2013 is one of about 100 species in the genus Flavobacterium (family Flavobacteriacae, phylum Bacteroidetes) with a validly published name, and has been isolated from the spring of a hard water rivulet in Northern Germany. Including all type strains of the genus Myroides and Flavobacterium into the 16S rRNA gene sequence phylogeny revealed a clustering of members of the genus Myroides as a monophyletic group within the genus Flavobacterium. Furthermore, F. rivuli WB 3.3-2T and its next relatives seem more closely related to the genus Myroides than to the typemore » species of the genus Flavobacterium, F. aquatile. The 4,489,248 bp long genome with its 3,391 protein-coding and 65 RNA genes is part of the G enomic E ncyclopedia of B acteria and A rchaea project. The genome of F. rivuli has almost as many genes encoding carbohydrate active enzymes (151 CAZymes) as genes encoding peptidases (177). Peptidases comprised mostly metallo (M) and serine (S) peptidases. Among CAZymes, 30 glycoside hydrolase families, 10 glycosyl transferase families, 7 carbohydrate binding module families and 7 carbohydrate esterase families were identified. Furthermore, we found four polysaccharide utilization loci (PUL) and one large CAZy rich gene cluster that might enable strain WB 3.3-2T to decompose plant and algae derived polysaccharides. In conclusion, based on these results we propose F. rivuli as an interesting candidate for further physiological studies and the role of Bacteroidetes in the decomposition of complex polymers in the environment.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hahnke, Richard L.; Stackebrandt, Erko; Meier-Kolthoff, Jan P.
Flavobacterium rivuli Ali et al. 2009 emend. Dong et al. 2013 is one of about 100 species in the genus Flavobacterium (family Flavobacteriacae, phylum Bacteroidetes) with a validly published name, and has been isolated from the spring of a hard water rivulet in Northern Germany. Including all type strains of the genus Myroides and Flavobacterium into the 16S rRNA gene sequence phylogeny revealed a clustering of members of the genus Myroides as a monophyletic group within the genus Flavobacterium. Furthermore, F. rivuli WB 3.3-2T and its next relatives seem more closely related to the genus Myroides than to the typemore » species of the genus Flavobacterium, F. aquatile. The 4,489,248 bp long genome with its 3,391 protein-coding and 65 RNA genes is part of the G enomic E ncyclopedia of B acteria and A rchaea project. The genome of F. rivuli has almost as many genes encoding carbohydrate active enzymes (151 CAZymes) as genes encoding peptidases (177). Peptidases comprised mostly metallo (M) and serine (S) peptidases. Among CAZymes, 30 glycoside hydrolase families, 10 glycosyl transferase families, 7 carbohydrate binding module families and 7 carbohydrate esterase families were identified. Furthermore, we found four polysaccharide utilization loci (PUL) and one large CAZy rich gene cluster that might enable strain WB 3.3-2T to decompose plant and algae derived polysaccharides. In conclusion, based on these results we propose F. rivuli as an interesting candidate for further physiological studies and the role of Bacteroidetes in the decomposition of complex polymers in the environment.« less
Moyo, Lindani; Ramesh, Shunmugiah V; Kappagantu, Madhu; Mitter, Neena; Sathuvalli, Vidyasagar; Pappu, Hanu R
2017-07-17
Potato virus Y (PVY) is one of the most economically important pathogen of potato that is present as biologically distinct strains. The virus-derived small interfering RNAs (vsiRNAs) from potato cv. Russet Burbank individually infected with PVY-N, PVY-NTN and PVY-O strains were recently characterized. Plant defense RNA-silencing mechanisms deployed against viruses produce vsiRNAs to degrade homologous viral transcripts. Based on sequence complementarity, the vsiRNAs can potentially degrade host RNA transcripts raising the prospect of vsiRNAs as pathogenicity determinants in virus-host interactions. This study investigated the global effects of PVY vsiRNAs on the host potato transcriptome. The strain-specific vsiRNAs of PVY, expressed in high copy number, were analyzed in silico for their proclivity to target potato coding and non-coding RNAs using psRobot and psRNATarget algorithms. Functional annotation of target coding transcripts was carried out to predict physiological effects of the vsiRNAs on the potato cv. Russet Burbank. The downregulation of selected target coding transcripts was further validated using qRT-PCR. The vsiRNAs derived from biologically distinct strains of PVY displayed diversity in terms of absolute number, copy number and hotspots for siRNAs on their respective genomes. The vsiRNAs populations were derived with a high frequency from 6 K1, P1 and Hc-Pro for PVY-N, P1, Hc-Pro and P3 for PVY-NTN, and P1, 3' UTR and NIa for PVY-O genomic regions. The number of vsiRNAs that displayed interaction with potato coding transcripts and number of putative coding target transcripts were comparable between PVY-N and PVY-O, and were relatively higher for PVY-NTN. The most abundant target non-coding RNA transcripts for the strain specific PVY-derived vsiRNAs were found to be MIR821, 28S rRNA,18S rRNA, snoR71, tRNA-Met and U5. Functional annotation and qRT-PCR validation suggested that the vsiRNAs target genes involved in plant hormone signaling, genetic
Atypical one-carbon metabolism of an acetogenic and hydrogenogenic Moorella thermoacetica strain.
Jiang, Bo; Henstra, Anne-Meint; Paulo, Paula L; Balk, Melike; van Doesburg, Wim; Stams, Alfons J M
2009-02-01
A thermophilic spore-forming bacterium (strain AMP) was isolated from a thermophilic methanogenic bioreactor that was fed with cobalt-deprived synthetic medium containing methanol as substrate. 16S rRNA gene analysis revealed that strain AMP was closely related to the acetogenic bacterium Moorella thermoacetica DSM 521(T) (98.3% sequence similarity). DNA-DNA hybridization showed 75.2 +/- 4.7% similarity to M. thermoacetica DSM 521(T), suggesting that strain AMP is a M. thermoacetica strain. Strain AMP has a unique one-carbon metabolism compared to other Moorella species. In media without cobalt growth of strain AMP on methanol was only sustained in coculture with a hydrogen-consuming methanogen, while in media with cobalt it grew acetogenically in the absence of the methanogen. Addition of thiosulfate led to sulfide formation and less acetate formation. Growth of strain AMP with CO resulted in the formation of hydrogen as the main product, while other CO-utilizing Moorella strains produce acetate as product. Formate supported growth only in the presence of thiosulfate or in coculture with the methanogen. Strain AMP did not grow with H(2)/CO(2), unlike M. thermoacetica (DSM 521(T)). The lack of growth with H(2)/CO(2) likely is due to the absence of cytochrome b in strain AMP.
NASA Astrophysics Data System (ADS)
Tait, Alastair W.; Fisher, Kent R.; Srinivasan, Poorna; Simon, Justin I.
2016-11-01
Carbonaceous chondrites, such as those associated with the Vigarano (CV) parent body, exhibit a diverse range of oxidative/reduced alteration mineralogy (McSween, 1977). Although fluids are often cited as the medium by which this occurs (Rubin, 2012), a mechanism to explain how this fluid migrates, and why some meteorite subtypes from the same planetary body are more oxidized than others remains elusive. In our study we examined a slab of the well-known Allende (CV3OxA) meteorite. Using several petrological techniques (e.g., Fry's and Flinn) and Computerized Tomography (CT) we discover it exhibits a strong penetrative planar fabric, resulting from strain partitioning among its major components: Calcium-Aluminum-rich Inclusions (CAIs) (64.5%CT) > matrix (21.5%Fry) > chondrules (17.6%CT). In addition to the planar fabric, we found a strong lineation defined by the alignment of the maximum elongation of flattened particles interpreted to have developed by an impact event. The existence of a lineation could either be non-coaxial deformation, or the result of a mechanically heterogeneous target material. In the later case it could have formed due to discontinuous patches of sub-surface ice and/or fabrics developed through prior impact compaction (MacPherson and Krot, 2014), which would have encouraged preferential flow within the target material immediately following the impact, compacting pore spaces. We suggest that structurally controlled movement of alteration fluids in the asteroid parent body along pressure gradients contributed to the formation of secondary minerals, which may have ultimately lead to the different oxidized subtypes.
Ferroelectric domain structure of anisotropically strained NaNbO3 epitaxial thin films
NASA Astrophysics Data System (ADS)
Schwarzkopf, J.; Braun, D.; Schmidbauer, M.; Duk, A.; Wördenweber, R.
2014-05-01
NaNbO3 thin films have been grown under anisotropic biaxial strain on several oxide substrates by liquid-delivery spin metalorganic chemical vapor deposition. Compressive lattice strain of different magnitude, induced by the deposition of NaNbO3 films with varying film thickness on NdGaO3 single crystalline substrates, leads to modifications of film orientation and phase symmetry, which are similar to the phase transitions in Pb-containing oxides near the morphotropic phase boundary. Piezoresponse force microscopy measurements exhibit large out-of-plane polarization components, but no distinctive domain structure, while C-V measurements indicate relaxor properties in these films. When tensile strain is provoked by the epitaxial growth on DyScO3, TbScO3, and GdScO3 single crystalline substrates, NaNbO3 films behave rather like a normal ferroelectric. The application of these rare-earth scandate substrates yields well-ordered ferroelectric stripe domains of the type a1/a2 with coherent domain walls aligned along the [001] substrate direction as long as the films are fully strained. With increasing plastic lattice relaxation, initially, a 2D domain pattern with still exclusively in-plane electric polarization, and finally, domains with in-plane and out-of-plane polar components evolve.
Possibility of Recombination Gain Increase in CV Ions at 4.0 nm Via Coherence
NASA Astrophysics Data System (ADS)
Luo, Y.; Morozov, A.; Gordon, D.; Sprangle, P.; Svidzinsky, A.; Xia, H.; Scully, M.; Suckewer, S.
This paper is about the recent experimental results on amplification of the CV line in the "water window" at 4.03 nm from resonance transition to the ground level of He-like ions in recombination scheme. The indication of the amplification of the CV line has been observed when an elongated narrow plasma channel was created, where high intensity 100 fs beams, optimal for creating CV ions in high density plasma, was propagated up to 0.5-0.6 mm. Without channeling the effective plasma length was much shorter and there was no indication of amplification.The large interest in gain generation in He-like ions in the transition to ground state is due to the possibility of applying a recently developed theory of Lasing Without Inversion (LWI) in XUV and X-ray regions to largely increase the gain for such transitions. The presented results of the indication of CV line amplifications are being discussed from the point of view of using LWI as a superradiance gain increase, hence to construct a very compact soft X-ray laser in the "water window".The last part of the paper is related to the application of the ultra-intensive fs plasma laser, which is currently in the process of development by using stimulated Raman backscattering (SRBS) to create a plasma amplifier and compressor, as the pump for compact laser operating in the "water window" and also at shorter wavelengths.
Benomyl-resistant mutant strain of Trichoderma sp. with increased mycoparasitic activity.
Olejníková, P; Ondrusová, Z; Krystofová, S; Hudecová, D
2010-01-01
Application of UV radiation to the strain Trichoderma sp. T-bt (isolated from lignite) resulted in the T-brm mutant which was resistant to the systemic fungicide benomyl. The tub2 gene sequence in the T-brm mutant differed from the parent as well as the collection strain (replacing tyrosine with histidine in the TUB2 protein). Under in vitro conditions this mutant exhibited a higher mycoparasitic activity toward phytopathogenic fungi.
CV pilot deployment concept phase 1, outreach plan — ICF Wyoming.
DOT National Transportation Integrated Search
2016-06-24
The Wyoming Department of Transportations (WYDOT) Connected Vehicle (CV) Pilot Deployment Program is intended to develop a suite of applications that utilize vehicle to infrastructure (V2I) and vehicle to vehicle (V2V) communication technology to ...
In vivo replication of T4 and T7 bacteriophages in germ-free mice colonized with Escherichia coli.
Weiss, Marietta; Denou, Emmanuel; Bruttin, Anne; Serra-Moreno, Ruth; Dillmann, Marie-Lise; Brüssow, Harald
2009-10-10
The gut transit of T4 phages was studied in axenic mice mono-colonized with the non-pathogenic Escherichia coli strain K-12. Thirty minutes, 1 and 2 h after phage feeding, T4 phage had reached the jejunum, ileum and cecum, respectively. Phage was found in the lumen and was also associated with the mucosa. One day later no phage was detected in the feces. Compared to germ-free control animals, oral T4 phage led to a 300-fold higher fecal phage titer in mice mono-colonized with E. coli strain WG-5. The in vivo T4 phage replication was transient and reached peak fecal titers about 8 h after oral phage application followed by a rapid titer decrease over two days. Similar data were obtained in mice colonized with E. coli strain Nissle. In contrast, orally applied T7 phage experienced a massive and sustained in vivo replication in mice mono-colonized with E. coli strain WG-5 irrespective whether phage or E. coli host was applied first. T7 phage replication occurred mainly in the large intestine. High titers of T7 phage and high E. coli cell counts coexisted in the feces. The observation of only 20% T7 phage-resistant fecal E. coli colonies suggests a refuge model where phage-sensitive E. coli cells are physically or physiologically protected from phage infection in the gut. The difference between T7 and T4 with respect to gut replication might partly reflect their distinct in vitro capacity to replicate on slowly growing cells.
Anomalous Hall hysteresis in T m3F e5O12/Pt with strain-induced perpendicular magnetic anisotropy
NASA Astrophysics Data System (ADS)
Tang, Chi; Sellappan, Pathikumar; Liu, Yawen; Xu, Yadong; Garay, Javier E.; Shi, Jing
2016-10-01
We demonstrate robust interface strain-induced perpendicular magnetic anisotropy in atomically flat ferrimagnetic insulator T m3F e5O12 (TIG) films grown with pulsed laser deposition on a substituted G d3G a5O12 substrate which maximizes the tensile strain at the interface. In bilayers consisting of Pt and TIG, we observe large squared Hall hysteresis loops over a wide range of thicknesses of Pt at room temperature. When a thin Cu layer is inserted between Pt and TIG, the Hall hysteresis magnitude decays but stays finite as the thickness of Cu increases up to 5 nm. However, if the Cu layer is placed atop Pt instead, the Hall hysteresis magnitude is consistently larger than when the Cu layer with the same thickness is inserted in between for all Cu thicknesses. These results suggest that both the proximity-induced ferromagnetism and spin current contribute to the anomalous Hall effect.
Connected Vehicle Pilot Deployment Program, Comprehensive Installation Plan - WYDOT CV Pilot
DOT National Transportation Integrated Search
2018-02-16
The Wyoming Department of Transportation's (WYDOT) Connected Vehicle (CV) Pilot Deployment Program is intended to develop a suite of applications that utilize vehicle-to-infrastructure (V2I) and vehicle-to-vehicle (V2V) communication technology to re...
Virulence Genes and Antibiotic Susceptibilities of Uropathogenic E. coli Strains.
Uzun, Cengiz; Oncül, Oral; Gümüş, Defne; Alan, Servet; Dayioğlu, Nurten; Küçüker, Mine Anğ
2015-01-01
The aim of this study is to detect the presence of and possible relation between virulence genes and antibiotic resistance in E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (UTI). 62 E. coli strains isolated from patients with acute, uncomplicated urinary tract infections (50 strains isolated from acute uncomplicated cystitis cases (AUC); 12 strains from acute uncomplicated pyelonephritis cases (AUP)) were screened for virulence genes [pap (pyelonephritis-associated pili), sfa/foc (S and F1C fimbriae), afa (afimbrial adhesins), hly (hemolysin), cnf1 (cytotoxic necrotizing factor), aer (aerobactin), PAI (pathogenicity island marker), iroN (catecholate siderophore receptor), ompT (outer membrane protein T), usp (uropathogenic specific protein)] by PCR and for antimicrobial resistance by disk diffusion method according to CLSI criteria. It was found that 56 strains (90.3%) carried at least one virulence gene. The most common virulence genes were ompT (79%), aer (51.6%), PAI (51.6%) and usp (56.5%). 60% of the strains were resistant to at least one antibiotic. The highest resistance rates were against ampicillin (79%) and co-trimoxazole (41.9%). Fifty percent of the E. coli strains (31 strains) were found to be multiple resistant. Eight (12.9%) out of 62 strains were found to be ESBL positive. Statistically significant relationships were found between the absence of usp and AMP - SXT resistance, iroN and OFX - CIP resistance, PAI and SXT resistance, cnf1 and AMP resistance, and a significant relationship was also found between the presence of the afa and OFX resistance. No difference between E. coli strains isolated from two different clinical presentations was found in terms of virulence genes and antibiotic susceptibility.
Constitutive Model Constants for Al7075-T651 and Al7075-T6
NASA Astrophysics Data System (ADS)
Brar, Nachhatter; Joshi, Vasant; Harris, Bryan
2009-06-01
Aluminum 7075-T651 and 7075-T6 are characterized at quasi-static and high strain rates to determine Johnson-Cook (J-C) strength and fracture model constants. Constitutive model constants are required as input to computer codes to simulate projectile (fragment) impact or similar impact events on structural components made of these material. J-C strength model constants (A, B, n, C, and m) for the two alloys are determined from tension stress-strain data at room and high temperature to 250^oC. J-C strength model constants for Al7075-T651 are: A=527 MPa, B=676 MPa, n=0.71, C=0.017, and m=1.61 and for Al7075-T6: A = 546 MPa, B = 674 MPa, n = 0.72, C = 0.059, and m =1.56. J-C fracture model constants are determined form quasi-static and high strain rate/high temperature tests on notched and smooth tension specimens. J-C fracture model constants for the two alloys are: Al7075-T651; D1 = 0.110, D2 = 0.573, D3= -3.4446, D4 = 0.016, and D 5= 1.099 and Al7075-T6; D1= 0.451 D2= -0.952 D3= -.068, D4 =0.036, and D5 = 0.697.
NASA Astrophysics Data System (ADS)
Xue, Xiong-Xiong; Feng, Ye-Xin; Liao, Lei; Chen, Qin-Jun; Wang, Dan; Tang, Li-Ming; Chen, Keqiu
2018-03-01
We present a systematical study of atomic structures and electronic properties of various dimension tellurium (Te) with broken intrinsical screw symmetry by applying reasonable strain. It is demonstrated that (i) bulk trigonal Te has degenerate Weyl nodes around the H point near the Fermi energy, and this degeneracy will be broken by introducing the selenium (Se) atom through creating the inner unsymmetrical strain, instead of external shear strain. (ii) 2D structures of tetragonal Te (t-Te) and 1T-MoS2-like Te (1T-Te) show direct and indirect band gap, respectively. Under the uniform biaxial compressive (BC) strain, monolayer of t-Te shows the direct-to-indirect band gap transition, while 1T-Te monolayer has a band gap transition firstly from indirect to direct and then from direct to indirect. Their effective masses of hole and electron can be effectively tuned by BC strain. (iii) One-dimensional (1D) structures of single helix, triangular Te and hexagonal Te nanowires display the obvious quantum confinement effect on the band structure and different sensitivity to the effect of uniaxial compressive strain.
Heat Strain Evaluation of U.S. Navy Steam Suit Ensembles
2016-05-01
method for measuring the thermal insulation of clothing using a heated manikin. West Conshohocken, PA: ASTM International. 2. Castellani, J.W., Young...TECHNICAL REPORT NO. T16-13 DATE May 2016 ADA HEAT STRAIN EVALUATION OF U.S. NAVY STEAM SUIT ENSEMBLES DISCLAIMER The opinions or...USARIEM TECHNICAL REPORT T16-13 HEAT STRAIN EVALUATION OF U.S. NAVY STEAM SUIT ENSEMBLES
Draft Genome Sequence of Mycobacterium chimaera Type Strain Fl-0169.
Pfaller, Stacy; Tokarev, Vasily; Kessler, Collin; McLimans, Christopher; Gomez-Alvarez, Vicente; Wright, Justin; King, Dawn; Lamendella, Regina
2017-02-23
We report here the draft genome sequence of the type strain Mycobacterium chimaera Fl-0169, a member of the Mycobacterium avium complex (MAC). M. chimaera Fl-0169 T was isolated from a patient in Italy and is highly similar to strains of M. chimaera isolated in Ireland, although Fl-0169 T possesses unique virulence genes. Copyright © 2017 Pfaller et al.
Katzer, Frank; Canton, German; Burrells, Alison; Palarea-Albaladejo, Javier; Horton, Ben; Bartley, Paul M; Pang, Yvonne; Chianini, Francesca; Innes, Elisabeth A; Benavides, Julio
2014-09-15
This study evaluates the influence of immunizing lambs with the incomplete S48 strain of Toxoplasma gondii, on parasite dissemination following a live oral challenge with a complete strain of T. gondii (M4). Lambs were culled at 14, 28 and 42 days post challenge. Parasite DNA was detected at significantly (p<0.0001) lower levels in samples from the vaccinated/challenged group (0% in heart and 5.9% in skeletal muscles), when compared to the non-vaccinated/challenged animals (75% heart, 87.9% skeletal muscle). S48 T. gondii DNA was found in muscle or lymph nodes until 42 days post infection, suggesting that parasite DNA or tachyzoites could persist longer after immunization than previously thought. Non-vaccinated/challenged animals showed more frequent lesions in muscles and central nervous system than the vaccinated animals. These results demonstrate that vaccination of lambs with the incomplete S48 T. gondii strain, can protect against establishment of tissue cysts following challenge with a complete strain of T. gondii. Consumption of undercooked meat containing T. gondii cysts is a major route of transmission to people, therefore vaccination of food animals may improve the safety of meat for human consumption. Copyright © 2014 Elsevier B.V. All rights reserved.
Mahieux, R; Ibrahim, F; Mauclere, P; Herve, V; Michel, P; Tekaia, F; Chappey, C; Garin, B; Van Der Ryst, E; Guillemain, B; Ledru, E; Delaporte, E; de The, G; Gessain, A
1997-01-01
To gain new insights on the origin, evolution, and modes of dissemination of human T-cell leukemia virus type I (HTLV-1), we performed a molecular analysis of 58 new African HTLV-1 strains (18 from West Africa, 36 from Central Africa, and 4 from South Africa) originating from 13 countries. Of particular interest were eight strains from Pygmies of remote areas of Cameroon and the Central African Republic (CAR), considered to be the oldest inhabitants of these regions. Eight long-term activated T-cell lines producing HTLV-1 gag and env antigens were established from peripheral blood mononuclear cell cultures of HTLV-1 seropositive individuals, including three from Pygmies. A fragment of the env gene encompassing most of the gp21 transmembrane region was sequenced for the 58 new strains, while the complete long terminal repeat (LTR) region was sequenced for 9 strains, including 4 from Pygmies. Comparative sequence analyses and phylogenetic studies performed on both the env and LTR regions by the neighbor-joining and DNA parsimony methods demonstrated that all 22 strains from West and South Africa belong to the widespread cosmopolitan subtype (also called HTLV-1 subtype A). Within or alongside the previously described Zairian cluster (HTLV-1 subtype B), we discovered a number of new HTLV-1 variants forming different subgroups corresponding mainly to the geographical origins of the infected persons, Cameroon, Gabon, and Zaire. Six of the eight Pygmy strains clustered together within this Central African subtype, suggesting a common origin. Furthermore, three new strains (two originating from Pygmies from Cameroon and the CAR, respectively, and one from a Gabonese individual) were particularly divergent and formed a distinct new phylogenetic cluster, characterized by specific mutations and occupying in most analyses a unique phylogenetic position between the large Central African genotype (HTLV-1 subtype B) and the Melanesian subtype (HTLV-1 subtype C). We have
NASA Technical Reports Server (NTRS)
Zamrik, S. Y.
1972-01-01
The effect of out-of-phase strain cycling on the low cycle fatigue of biaxially loaded specimens is discussed. A method to apply phase angles between two strains imposed in two different directions was developed. The data and the proposed theoretical analysis are part of a research program on biaxial strain cycling effect on fatigue life of structural materials.
Differentiation between Trichophyton mentagrophytes and T. rubrum by sorbitol assimilation.
Rezusta, A; Rubio, M C; Alejandre, M C
1991-01-01
Trichophyton rubrum was easily differentiated from T. mentagrophytes by its ability to assimilate sorbitol with an API 20C AUX strip. One hundred percent of 36 T. rubrum strains and none of 147 T. mentagrophytes strains assimilated sorbitol. PMID:1993760
Steinbach, Elwell L.C.; Kerans, B.L.; Rasmussen, C.; Winton, J.R.
2006-01-01
Host-parasite interactions influence host population growth, host evolution and parasite success. We examined the interactions among Myxobolus cerebralis, the parasite that causes salmonid whirling disease, and resistant and susceptible strains of the oligochaete host Tubifex tubifex. Strains of T. tubifex with diverse genotypes often coexist in nature and have variable susceptibilities to M. cerebralis infection. Further, parasite proliferation differs by several orders of magnitude among T. tubifex strains. We examined total biomass produced by individual T. tubifex, including progeny production and adult growth, parasite proliferation and prevalence of infection using 2 strains of T. tubifex at 2 myxospore doses in a response-surface experimental design. Total biomass production per individual oligochaete and progeny biomass produced by an individual adult oligochaete were density-dependent for both resistant and susceptible individuals and the effects did not change with the addition of myxospores. However, both resistant and susceptible adults had highest growth when exposed to M. cerebralis. The presence of resistant oligochaetes in mixed cultures did not reduce the infection prevalence or parasite proliferation in susceptible individuals. In natural aquatic communities, resistant strains of T. tubifex may not reduce the effects of M. cerebralis on the salmonid host, particularly if sufficient numbers of susceptible T. tubifex are present. ?? Inter-Research 2006.
NASA Technical Reports Server (NTRS)
Aponte, Jose C.; Abreu, Neyda M.; Glavin, Daniel P.; Dworkin, Jason P.; Elsila, Jamie E.
2017-01-01
The analysis of water-soluble organic compounds in meteorites provides valuable insights into the prebiotic synthesis of organic matter and the processes that occurred during the formation of the solar system. We investigated the concentration of aliphatic monoamines present in hot acid water extracts of the unaltered Antarctic carbonaceous chondrites, Dominion Range (DOM) 08006 (CO3) and Miller Range (MIL) 05013 (CO3), and the thermally altered meteorites, Allende (CV3), LAP 02206 (CV3), GRA 06101 (CV3), Allan Hills (ALH) 85002 (CK4), and EET 92002 (CK5). We have also reviewed and assessed the petrologic characteristics of the meteorites studied here to evaluate the effects of asteroidal processing on the abundance and molecular distributions of monoamines. The CO3, CV3, CK4, and CK5 meteorites studied here contain total concentrations of amines ranging from 1.2 to 4.0 nmol/g of meteorite; these amounts are 1-3 orders of magnitude below those observed in carbonaceous chondrites from the CI, CM, and CR groups. The low-amine abundances for CV and CK chondrites may be related to their extensive degree of thermal metamorphism and/or to their low original amine content. Although the CO3 meteorites, DOM 08006 and MIL 05013, do not show signs of thermal and aqueous alteration, their monoamine contents are comparable to those observed in moderately/extensively thermally altered CV3, CK4, and CK5 carbonaceous chondrites. The low content of monoamines in pristine CO carbonaceous chondrites suggests that the initial amounts, and not asteroidal processes, play a dominant role in the content of monoamines in carbonaceous chondrites. The primary monoamines, methylamine, ethylamine, and n-propylamine constitute the most abundant amines in the CO3, CV3, CK4, and CK5 meteorites studied here. Contrary to the predominance of n-x-amino acid isomers in CO3 and thermally altered meteorites, there appears to be no preference for the larger n-amines.
Mumps Hoshino and Torii vaccine strains were distinguished from circulating wild strains.
Sawada, Akihito; Yamaji, Yoshiaki; Nakayama, Tetsuo
2013-06-01
Aseptic meningitis and acute parotitis have been observed after mumps vaccination. Mumps outbreaks have been reported in Japan because of low vaccine coverage, and molecular differentiation is required to determine whether these cases are vaccine associated. RT-nested PCR was performed in the small hydrophobic gene region, and viruses were differentiated by restriction fragment length polymorphism assay. A total of 584 nucleotides were amplified. The PCR product of the Hoshino strain was cut into two fragments (313 and 271 nucleotides) by MfeI; that of the Torii strain was digested with EcoT22I, resulting in 332- and 252-nucleotide fragments. Both strains were genotype B and had an XbaI site, resulting in two fragments: 299 and 285 nucleotides. Current circulating wild types were cut only by XbaI or MfeI. However, the MfeI site of the wild types was different from that of the Hoshino strain, resulting in 451- and 133-nucleotide fragments. Using three restriction enzymes, two mumps vaccine strains were distinguished from wild types, and this separation was applied to the identification of vaccine-related adverse events.
Snauwaert, Isabel; Papalexandratou, Zoi; De Vuyst, Luc; Vandamme, Peter
2013-05-01
Six facultatively anaerobic, non-motile lactic acid bacteria were isolated from spontaneous cocoa bean fermentations carried out in Brazil, Ecuador and Malaysia. Phylogenetic analysis revealed that one of these strains, designated M75(T), isolated from a Brazilian cocoa bean fermentation, had the highest 16S rRNA gene sequence similarity towards Weissella fabaria LMG 24289(T) (97.7%), W. ghanensis LMG 24286(T) (93.3%) and W. beninensis LMG 25373(T) (93.4%). The remaining lactic acid bacteria isolates, represented by strain M622, showed the highest 16S rRNA gene sequence similarity towards the type strain of Fructobacillus tropaeoli (99.9%), a recently described species isolated from a flower in South Africa. pheS gene sequence analysis indicated that the former strain represented a novel species, whereas pheS, rpoA and atpA gene sequence analysis indicated that the remaining five strains belonged to F. tropaeoli; these results were confirmed by DNA-DNA hybridization experiments towards their respective nearest phylogenetic neighbours. Additionally, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry proved successful for the identification of species of the genera Weissella and Fructobacillus and for the recognition of the novel species. We propose to classify strain M75(T) ( = LMG 26217(T) = CCUG 61472(T)) as the type strain of the novel species Weissella fabalis sp. nov.
Kim, Joonyul; Kang, Hong-Gyu; Jun, Sung-Hoon; Lee, Jinwon; Yim, Jieun; An, Gynheung
2003-01-01
To understand the molecular mechanisms that control seed formation, we selected a seed-preferential gene (CvADH1) from the ESTs of developing watermelon seeds. RNA blot analysis and in situ localization showed that CvADH1 was preferentially expressed in the nucellar tissue. The CvADH1 protein shared about 50% homology with short-chain alcohol dehydrogenase including ABA2 in Arabidopsis thaliana, stem secoisolariciresinol dehydrogenase in Forsythia intermedia, and 3beta-hydroxysterol dehydrogenase in Digitalis lanata. We investigated gene-expression levels in seeds from both normally pollinated fruits and those made parthenocarpic via N-(2-chloro-4-pyridyl)-N'-phenylurea treatment, the latter of which lack zygotic tissues. Whereas the transcripts of CvADH1 rapidly started to accumulate from about the pre-heart stage in normal seeds, they were not detectable in the parthenocarpic seeds. Treating the parthenogenic fruit with GA(3) strongly induced gene expression, up to the level accumulated in pollinated seeds. These results suggest that the CvADH1 gene is induced in maternal tissues by signals made in the zygotic tissues, and that gibberellin might be one of those signals. We also observed that CvADH1 expression was induced by sucrose in the parthenocarpic seeds. Therefore, we propose that the CvADH1 gene is inducible by gibberellin, and that sucrose plays an important role in the maternal tissues of watermelon during early seed development.
Zhang, Fei; Zhao, Qin; Quan, Keji; Zhu, Zhuang; Yang, Yusheng; Wen, Xintian; Chang, Yung-Fu; Huang, Xiaobo; Wu, Rui; Wen, Yiping; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Han, Xinfeng; Cao, Sanjie
2018-01-01
GALT is an important antigen of Actinobacillus pleuropneumoniae (APP), which was shown to provide partial protection against APP infection in a previous study in our lab. The main purpose of the present study is to investigate GALT induced cross-protection between different APP serotypes and elucidate key mechanisms of the immune response to GALT antigenic stimulation. Bioinformatic analysis demonstrated that galT is a highly conserved gene in APP, widely distributed across multiple pathogenic strains. Homologies between any two strains ranges from 78.9% to 100% regarding the galT locus. Indirect enzyme-linked immunosorbent assay (ELISA) confirmed that GALT specific antibodies could not be induced by inactivated APP L20 or MS71 whole cell bacterin preparations. A recombinant fusion GALT protein derived from APP L20, however has proven to be an effective cross-protective antigen against APP sevorar 1 MS71 (50%, 4/8) and APP sevorar 5b L20 (75%, 6/8). Histopathological examinations have confirmed that recombinant GALT vaccinated animals showed less severe pathological signs in lung tissues than negative controls after APP challenge. Immunohistochemical (IHC) analysis indicated that the infiltration of neutrophils in the negative group is significantly increased compared with that in the normal control (P<0.001) and that in surviving animals is decreased compared to the negative group. Anti-GALT antibodies were shown to mediate phagocytosis of neutrophils. After interaction with anti-GALT antibodies, survival rate of APP challenged vaccinated animals was significantly reduced (P<0.001). This study demonstrated that GALT is an effective cross-protective antigen, which could be used as a potential vaccine candidate against multiple APP serotypes.
NASA Astrophysics Data System (ADS)
Shutov, A. V.; Larichkin, A. Yu
2017-10-01
A cyclic creep damage model, previously proposed by the authors, is modified for a better description of the transient creep of D16T alloy observed in the finite strain range under rapidly changing stresses. The new model encompasses the concept of kinematic hardening, which allows us to account for the creep-induced anisotropy. The model kinematics is based on the nested multiplicative split of the deformation gradient, proposed by Lion. The damage evolution is accounted for by the classical Kachanov-Rabotnov approach. The material parameters are identified using experimental data on cyclic torsion of thick-walled samples with different holding times between load reversals. For the validation of the proposed material model, an additional experiment is analyzed. Although this additional test is not involved in the identification procedure, the proposed cyclic creep damage model describes it accurately.
Biodiversity of Lactobacillus sanfranciscensis strains isolated from five sourdoughs.
Kitahara, M; Sakata, S; Benno, Y
2005-01-01
Five different sourdoughs were investigated for the composition of lactic acid bacteria (LAB) and the biodiversity of Lactobacillus sanfranciscensis strains. A total of 57 strains were isolated from five sourdoughs. Isolated strains were all identified by the 16S rDNA sequence and species-specific primers for L. sanfranciscensis. Results of identification showed that LAB strains were L. sanfranciscensis, Lactobacillus plantarum, Lactobacillus paralimentarius, Lactobacillus fermentum, Lactobacillus pontis, Lactobacillus casei, Weisella confusa and Pediococcus pentosaceus. A total of 21 strains were identified as L. sanfranciscensis and these isolates were detected in all five sourdoughs. Ribotyping was applied to investigate the relationship between intraspecies diversity of L. sanfranciscensis and sourdough. A total of 22 strains of L. sanfranciscensis including L. sanfranciscensis JCM 5668T were compared by ribotyping. The dendrogram of 21 ribotyping patterns showed four clusters, and L. sanfranciscensis JCM 5668T was independent of the others. The different biotypes of L. sanfranciscensis were present in two sourdoughs compared with other three sourdoughs. The LAB compositions of five sourdoughs were different and the relationship between intraspecies diversity of L. sanfranciscensis strains and five sourdoughs was shown by ribotyping. This study demonstrated that ribotyping was useful for distinguishing L. sanfranciscensis strains. A further important result is that the intra-species diversity of L. sanfranciscensis strains seems to be related to the sourdough preparation.
Camera calibration method of binocular stereo vision based on OpenCV
NASA Astrophysics Data System (ADS)
Zhong, Wanzhen; Dong, Xiaona
2015-10-01
Camera calibration, an important part of the binocular stereo vision research, is the essential foundation of 3D reconstruction of the spatial object. In this paper, the camera calibration method based on OpenCV (open source computer vision library) is submitted to make the process better as a result of obtaining higher precision and efficiency. First, the camera model in OpenCV and an algorithm of camera calibration are presented, especially considering the influence of camera lens radial distortion and decentering distortion. Then, camera calibration procedure is designed to compute those parameters of camera and calculate calibration errors. High-accurate profile extraction algorithm and a checkboard with 48 corners have also been used in this part. Finally, results of calibration program are presented, demonstrating the high efficiency and accuracy of the proposed approach. The results can reach the requirement of robot binocular stereo vision.
The introduction of strain and its effects on the structure and stability of T4 lysozyme.
Liu, R; Baase, W A; Matthews, B W
2000-01-07
In order to try to better understand the role played by strain in the structure and stability of a protein a series of "small-to-large" mutations was made within the core of T4 lysozyme. Three different alanine residues, one involved in backbone contacts, one in side-chain contacts, and the third adjacent to a small cavity, were each replaced with subsets of the larger residues, Val, Leu, Ile, Met, Phe and Trp. As expected, the protein is progressively destabilized as the size of the introduced side-chain becomes larger. There does, however, seem to be a limit to the destabilization, suggesting that a protein of a given size may be capable of maintaining only a certain amount of strain. The changes in stability vary greatly from site to site. Substitution of larger residues for both Ala42 and Ala98 substantially destabilize the protein, even though the primary contacts in one case are predominantly with side-chain atoms and in the other with backbone. The results suggest that it is neither practical nor meaningful to try to separate the effects of introduced strain on side-chains from the effects on the backbone. Substitutions at Ala129 are much less destabilizing than at sites 42 or 98. This is most easily understood in terms of the pre-existing cavity, which provides partial space to accommodate the introduced side-chains. Crystal structures were obtained for a number of the mutants. These show that the changes in structure to accommodate the introduced side-chains usually consist of essentially rigid-body displacements of groups of linked atoms, achieved through relatively small changes in torsion angles. On rare occasions, a side-chain close to the site of substitution may change to a different rotamer. When such rotomer changes occur, they permit the structure to dissipate strain by a response that is plastic rather than elastic. In one case, a surface loop moves 1.2 A, not in direct response to a mutation, but in an interaction mediated via an intermolecular
Epitaxial strain-mediated spin-state transitions: can we switch off magnetism?
NASA Astrophysics Data System (ADS)
Rondinelli, James; Spaldin, Nicola
2008-03-01
We use first-principles density functional theory calculations to explore spin-state transitions in epitaxially strained LaCoO3. While high-spin to low-spin state transitions in minerals are common in geophysics, where pressures can reach over 200 GPa, we explore whether heteroepitaxial strain can achieve similar transitions with moderate strain in thin films. LaCoO3 is known to undergo a low-spin (S=0, t2g^6eg^0) to intermediate-spin (S=1, t2g^5eg^1) or high-spin (S=2, t2g^4eg^2) state transition with increasing temperature, and thus makes it a promising candidate material for strain-mediated spin transitions. Here we discuss the physics of the low-spin transition and changes in the electronic structure of LaCoO3, most notably, the metal-insulator transition that accompanies the spin-state transitions with epitaxial strain. As thin film growth techniques continue to reach atomic-level precision, we suggest this is another approach for controlling magnetism in complex oxide heterostructures.
Lee, Chin Mei; Sieo, Chin Chin; Cheah, Yoke-Kqueen; Abdullah, Norhani; Ho, Yin Wan
2012-02-01
Four repetitive element sequence-based polymerase chain reaction (rep-PCR) methods, namely repetitive extragenic palindromic PCR (REP-PCR), enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), polytrinucleotide (GTG)₅ -PCR and BOX-PCR, were evaluated for the molecular differentiation of 12 probiotic Lactobacillus strains previously isolated from the gastrointestinal tract of chickens and used as a multistrain probiotic. This study represents the first analysis of the comparative efficacy of these four rep-PCR methods and their combination (composite rep-PCR) in the molecular typing of Lactobacillus strains based on a discriminatory index (D). Species-specific and strain-specific profiles were observed from rep-PCR. From the numerical analysis of composite rep-PCR, BOX-PCR, (GTG)₅ -PCR, REP-PCR and ERIC-PCR, D values of 0.9118, 0.9044, 0.8897, 0.8750 and 0.8529 respectively were obtained. Composite rep-PCR analysis was the most discriminative method, with eight Lactobacillus strains, namely L. brevis ATCC 14869(T) , L. reuteri C 10, L. reuteri ATCC 23272(T) , L. gallinarum ATCC 33199(T) , L. salivarius ATCC 11741(T) , L. salivarius I 24, L. panis JCM 11053(T) and L. panis C 17, being differentiated at the strain level. Composite rep-PCR analysis is potentially a useful fingerprinting method to discriminate probiotic Lactobacillus strains isolated from the gastrointestinal tract of chickens. Copyright © 2011 Society of Chemical Industry.
Tashkandy, Nisreen; Sabban, Sari; Fakieh, Mohammad; ...
2016-06-16
Flavobacterium suncheonense is a member of the family Flavobacteriaceae in the phylum Bacteroidetes. Strain GH29-5 T (DSM 17707 T ) was isolated from greenhouse soil in Suncheon, South Korea. F. suncheonense GH29-5 T is part of the Genomic Encyclopedia of Bacteria and Archaea project. The 2,880,663 bp long draft genome consists of 54 scaffolds with 2739 protein-coding genes and 82 RNA genes. The genome of strain GH29-5 T has 117 genes encoding peptidases but a small number of genes encoding carbohydrate active enzymes (51 CAZymes). Metallo and serine peptidases were found most frequently. Among CAZymes, eight glycoside hydrolase families, ninemore » glycosyl transferase families, two carbohydrate binding module families and four carbohydrate esterase families were identified. Suprisingly, polysaccharides utilization loci (PULs) were not found in strain GH29-5 T . Based on the coherent physiological and genomic characteristics we suggest that F. suncheonense GH29-5 T feeds rather on proteins than saccharides and lipids.« less
Impact of a protective vest and spacer garment on exercise-heat strain.
Cheuvront, Samuel N; Goodman, Daniel A; Kenefick, Robert W; Montain, Scott J; Sawka, Michael N
2008-03-01
Protective vests worn by global security personnel, and weighted vests worn by athletes, may increase physiological strain due to added load, increased clothing insulation and vapor resistance. The impact of protective vest clothing properties on physiological strain, and the potential of a spacer garment to reduce physiological strain, was examined. Eleven men performed 3 trials of intermittent treadmill walking over 4 h in a hot, dry environment (35 degrees C, 30% rh). Volunteers wore the US Army battledress uniform (trial B), B + protective vest (trial P), and B + P + spacer garment (trial S). Biophysical clothing properties were determined and found similar to many law enforcement, industry, and sports ensembles. Physiological measurements included core (T (c)), mean skin (T (sk)) and chest (T (chest)) temperatures, heart rate (HR), and sweating rate (SR). The independent impact of clothing was determined by equating metabolic rate in all trials. In trial P, HR was +7 b/min higher after 1 h of exercise and +19 b/min by the fourth hour compared to B (P < 0.05). T (c) (+0.30 degrees C), T (sk) (+1.0 degrees C) and Physiological Strain Index were all higher in P than B (P < 0.05). S did not abate these effects except to reduce T (sk) (P > S) via a lower T (chest) (-0.40 degrees C) (P < 0.05). SR was higher (P < 0.05) in P and S versus B, but the magnitude of differences was small. A protective vest increases physiological strain independent of added load, while a spacer garment does not alter this outcome.
Production of haemolysins by strains of the Actinobacillus minor/"porcitonsillarum" complex.
Arya, Gitanjali; Niven, Donald F
2010-03-24
Actinobacillus minor and "Actinobacillus porcitonsillarum" are distinguished by their haemolytic activities, the latter organism being haemolytic and the former, non-haemolytic. Analysis of a whole genome shotgun sequence, however, revealed that A. minor strain 202, like "A. porcitonsillarum", possesses a haemolysin-encoding apxII operon. The purpose of this study was therefore to investigate haemolysin production by this organism and also by three additional members of the A. minor/"porcitonsillarum" complex, strains 33PN and 7ATS and A. minor strain NM305(T). Primers based on sequences within the apxII genes of strain 202 allowed the amplification of appropriately sized fragments from DNA from strain 33PN suggesting that this organism also possesses an apxII operon. Analysis of a whole genome shotgun sequence failed to reveal any trace of an apxII operon in strain NM305(T) and attempts to amplify apxII genes from DNA from strain 7ATS also failed. Strains 202 and 33PN, and surprisingly, the type strain of A. minor and strain 7ATS, were all found to be haemolysin-positive as growth media from cultures of these organisms could promote the lysis of erythrocytes in suspension. The erythrocyte specificities of the haemolysins produced by strains 202 and 33PN indicated that the haemolytic activities exhibited by these organisms were due to ApxII. In keeping with the apparent lack of apxII genes in strains NM305(T) and 7ATS, the haemolysins produced by these organisms were not erythrocyte-specific and with both organisms, haemolytic activity appeared to be due to a combination of heat-stable and heat-labile components. The identities of these components, however, remain unknown. Copyright 2009 Elsevier B.V. All rights reserved.
The effect of dexamethasone on immune pigeons infected with various strains of Trichomonas gallinae
Kocan, R.M.
1971-01-01
Forty-five adult feral pigeons harboring natural Trichomonas gallinae infections were divided into three groups and superinfected with the Jones' Barn strain of T. gallinae. Two weeks following superinfection all birds were treated with Enheptin? to eliminate the trichomonads and each group was then reinfected with one of three strains of T. gallinae: (1) nonvirulent; (2) oral canker;, (3) Jones' Barn. Simultaneously with reinfection, the birds were treated three times weekly with 1 ml. (2 mg) Azium? intramuscularly. Within 3 weeks some birds began showing signs of trichomoniasis, and at the end of 6 weeks, 40 percent of the birds in the two groups receiving oral canker and .Jones' Barn strains had succumbed. No disease occurred in those birds reinfected with the nonvirulent strain of T. gallinae. Although corticosteroid treatment is not as effective in avian species as it is in some mammals, this drug was sufficiently active to give support to the hypothesis that antibody is responsible for the immunity which develops in pigeons following infection with T. gallinae. An interesting phenomenon worth noting is that the oral canker strain, which ordinarily restricts itself to producing lesions in the upper digestive tract of nonimmune pigeons, produced visceral lesions in Azium?-treated birds identical to those produced by the Jones? Barn strain of T. gallinae
Vlajinac, H; Adanja, B
1982-09-01
Group and type differentiation by Griffith' method of agglutination was performed on 7514 haemolytic streptococcal strains isolated from patients with acute streptococcal infections. Thirteen different groups were found--the most frequent were groups A (63.0%), B (12.5%), C (8.1%) and G(2.5%). The group A was predominant among strains isolated from upper respiratory tract, but in later years the frequency of group A strains among streptococci causing respiratory infections was significantly lower. In every year of the study period the most prevalent group A types were T1, T2, T4, T12 and T28--only their relative distribution was changing in the course of time.
Psychological strains and depression in Chinese rural populations.
Zhang, Jie; Lv, Juncheng
2014-01-01
The aim of this study is to explore the relationship between psychological strains and depression and to further test the Strain Theory of Suicide and Mental Disorders. Data for the current study were from a large psychological autopsy (PA) study in Chinese rural populations with a case-control design to investigate the environmental and other characteristics of rural young suicides and controls. Subjects (N = 1618) for the current study were the informants in the PA interviews. The center for epidemiologic studies depression scale was used to assess the respondents' depression level. Chi-square x², t test, t' test, and general linear regression model were used to analyse the data by SPSS software. Value strain and deprivation strain are positively correlated with the depression level for both men and women of the Chinese rural population. Religion is another strong risk factor for depression and marriage is not a protective factor for depression in this sample. The study verifies that there is strong correlation between the psychological strains and depression in Chinese rural populations. It is suggested that reducing psychological strains may be a possible approach to reduce the prevalence of depression so as to help bring down the suicide risk in rural China.
Electrocardiogram of Clinically Healthy Mithun (Bos frontalis): Variation among Strains
Sanyal, Sagar; Das, Pradip Kumar; Ghosh, Probal Ranjan; Das, Kinsuk; Vupru, Kezha V.; Rajkhowa, Chandan; Mondal, Mohan
2010-01-01
A study was conducted to establish the normal electrocardiogram in four different genetic strains of mithun (Bos frontalis). Electrocardiography, cardiac electrical axis, heart rate, rectal temperature and respiration rate were recorded in a total of 32 adult male mithun of four strains (n = 8 each). It was found that the respiration and heart rates were higher (P < .05) in Manipur than other three strains. Amplitude (P < .05) and duration of P wave and QRS complex differed (P < .01) among the strains. Mizoram strain had the highest amplitude and duration of P wave and QRS complex. On the other hand, higher (P < .05) amplitude and duration of T wave were recorded in Arunachalee and Mizoram strains. The mean electrical axis of QRS complex that were recorded for Arunachalee and Manipur strains were similar to that reported for other bovine species; whereas the electrical axis of QRS for Nagamese and Mizoram strains were more close to feline and caprine species, respectively. In conclusion, electrocardiogram of mithun revealed that the amplitude and duration of P wave, QRS complex and T wave were different among four different genetic strains of mithun and the electrical axis of QRS complex for Nagamese and Mizoram mithuns are dissimilar to bovine species. PMID:20886013
Adeyemi, Oladipupo; Alvarez-Laviada, Anita; Schultz, Francisca; Ibrahim, Effendi; Trauner, Michael; Williamson, Catherine; Glukhov, Alexey V; Gorelik, Julia
2017-01-01
Increased maternal serum bile acid concentrations in intrahepatic cholestasis of pregnancy (ICP) are associated with fetal cardiac arrhythmias. Ursodeoxycholic acid (UDCA) has been shown to demonstrate anti-arrhythmic properties via preventing ICP-associated cardiac conduction slowing and development of reentrant arrhythmias, although the cellular mechanism is still being elucidated. High-resolution fluorescent optical mapping of electrical activity and electrocardiogram measurements were used to characterize effects of UDCA on one-day-old neonatal and adult female Langendorff-perfused rat hearts. ICP was modelled by perfusion of taurocholic acid (TC, 400μM). Whole-cell calcium currents were recorded from neonatal rat and human fetal cardiomyocytes. TC significantly prolonged the PR interval by 11.0±3.5% (P<0.05) and slowed ventricular conduction velocity (CV) by 38.9±5.1% (P<0.05) exclusively in neonatal and not in maternal hearts. A similar CV decline was observed with the selective T-type calcium current (ICa,T) blocker mibefradil 1μM (23.0±6.2%, P<0.05), but not with the L-type calcium current (ICa,L) blocker nifedipine 1μM (6.9±6.6%, NS). The sodium channel blocker lidocaine (30μM) reduced CV by 60.4±4.5% (P<0.05). UDCA co-treatment was protective against CV slowing induced by TC and mibefradil, but not against lidocaine. UDCA prevented the TC-induced reduction in the ICa,T density in both isolated human fetal (-10.2±1.5 versus -5.5±0.9 pA/pF, P<0.05) and neonatal rat ventricular myocytes (-22.3±1.1 versus -9.6±0.8 pA/pF, P<0.0001), whereas UDCA had limited efficacy on the ICa,L. Our findings demonstrate that ICa,T plays a significant role in ICP-associated fetal cardiac conduction slowing and arrhythmogenesis, and is an important component of the fetus-specific anti-arrhythmic activity of UDCA.
Adeyemi, Oladipupo; Alvarez-Laviada, Anita; Schultz, Francisca; Ibrahim, Effendi; Trauner, Michael; Williamson, Catherine; Glukhov, Alexey V.
2017-01-01
Background Increased maternal serum bile acid concentrations in intrahepatic cholestasis of pregnancy (ICP) are associated with fetal cardiac arrhythmias. Ursodeoxycholic acid (UDCA) has been shown to demonstrate anti-arrhythmic properties via preventing ICP-associated cardiac conduction slowing and development of reentrant arrhythmias, although the cellular mechanism is still being elucidated. Methods High-resolution fluorescent optical mapping of electrical activity and electrocardiogram measurements were used to characterize effects of UDCA on one-day-old neonatal and adult female Langendorff-perfused rat hearts. ICP was modelled by perfusion of taurocholic acid (TC, 400μM). Whole-cell calcium currents were recorded from neonatal rat and human fetal cardiomyocytes. Results TC significantly prolonged the PR interval by 11.0±3.5% (P<0.05) and slowed ventricular conduction velocity (CV) by 38.9±5.1% (P<0.05) exclusively in neonatal and not in maternal hearts. A similar CV decline was observed with the selective T-type calcium current (ICa,T) blocker mibefradil 1μM (23.0±6.2%, P<0.05), but not with the L-type calcium current (ICa,L) blocker nifedipine 1μM (6.9±6.6%, NS). The sodium channel blocker lidocaine (30μM) reduced CV by 60.4±4.5% (P<0.05). UDCA co-treatment was protective against CV slowing induced by TC and mibefradil, but not against lidocaine. UDCA prevented the TC-induced reduction in the ICa,T density in both isolated human fetal (−10.2±1.5 versus −5.5±0.9 pA/pF, P<0.05) and neonatal rat ventricular myocytes (−22.3±1.1 versus −9.6±0.8 pA/pF, P<0.0001), whereas UDCA had limited efficacy on the ICa,L. Conclusion Our findings demonstrate that ICa,T plays a significant role in ICP-associated fetal cardiac conduction slowing and arrhythmogenesis, and is an important component of the fetus-specific anti-arrhythmic activity of UDCA. PMID:28934223
Strain Gradient Solution for the Eshelby-Type Polyhedral Inclusion Problem
2012-01-01
2011 Available online 6 November 2011 Keywords: Eshelby tensor Polyhedral inclusion Size effect Eigenstrain Strain gradient a b s t r a c t The Eshelby...material containing an ellipsoidal inclusion prescribed with a uniform eigenstrain is a milestone in micromechanics. The solution for the dynamic Eshelby...strain to the prescribed uniform eigenstrain , is constant inside the inclusion. However, this property is true only for ellipsoidal inclusions (and when
Oh, Hyung Jung; Lee, Mi Jung; Kwon, Young Eun; Park, Kyoung Sook; Park, Jung Tak; Han, Seung Hyeok; Yoo, Tae-Hyun; Kim, Yong-Lim; Kim, Yon Su; Yang, Chul Woo; Kim, Nam-Ho; Kang, Shin-Wook
2015-01-01
Abstract Although numerous previous studies have explored various biomarkers for their ability to predict mortality in end-stage renal disease (ESRD) patients, these studies have been limited by retrospective analyses, mostly prevalent dialysis patients, and the measurement of only 1 or 2 biomarkers. This prospective study was aimed to evaluate the association between 3 biomarkers and mortality in incident 335 ESRD patients starting continuous ambulatory peritoneal dialysis (CAPD) in Korea. According to the baseline NT-proBNP, cTnT, and hsCRP levels, the patients were stratified into tertiles, and cardiovascular (CV) and all-cause mortalities were compared. Additionally, time-dependent ROC curves were constructed, and the net reclassification index (NRI) and integrated discrimination improvement (IDI) of the models with various biomarkers were calculated. We found the upper tertile of NT-proBNP was significantly associated with increased risk of both CV and all-cause mortalities. However, the upper tertile of hsCRP was significantly related only to the high risk of all-cause mortality even after adjustment for age, sex, and white blood cell counts. Moreover, NT-proBNP had the highest predictive power for CV mortality, whereas hsCRP was the best prognostic marker for all-cause mortality among these biomarkers. In conclusions, NT-proBNP is a more significant prognostic factor for CV mortality than cTnT and hsCRP, whereas hsCRP is a more significant predictor than NT-proBNP and cTnT for all-cause mortality in incident peritoneal dialysis patients. PMID:26554763
Understanding Strain-Induced Phase Transformations in BiFeO3 Thin Films.
Dixit, Hemant; Beekman, Christianne; Schlepütz, Christian M; Siemons, Wolter; Yang, Yongsoo; Senabulya, Nancy; Clarke, Roy; Chi, Miaofang; Christen, Hans M; Cooper, Valentino R
2015-08-01
Experiments demonstrate that under large epitaxial strain a coexisting striped phase emerges in BiFeO 3 thin films, which comprises a tetragonal-like ( T ') and an intermediate S ' polymorph. It exhibits a relatively large piezoelectric response when switching between the coexisting phase and a uniform T ' phase. This strain-induced phase transformation is investigated through a synergistic combination of first-principles theory and experiments. The results show that the S ' phase is energetically very close to the T ' phase, but is structurally similar to the bulk rhombohedral ( R ) phase. By fully characterizing the intermediate S ' polymorph, it is demonstrated that the flat energy landscape resulting in the absence of an energy barrier between the T ' and S ' phases fosters the above-mentioned reversible phase transformation. This ability to readily transform between the S ' and T ' polymorphs, which have very different octahedral rotation patterns and c / a ratios, is crucial to the enhanced piezoelectricity in strained BiFeO 3 films. Additionally, a blueshift in the band gap when moving from R to S ' to T ' is observed. These results emphasize the importance of strain engineering for tuning electromechanical responses or, creating unique energy harvesting photonic structures, in oxide thin film architectures.
Afouda, Pamela; Durand, Guillaume A; Lagier, Jean-Christophe; Labas, Noémie; Cadoret, Fréderic; Armstrong, Nicholas; Raoult, Didier; Dubourg, Grégory
2018-04-14
Intestinimonas massiliensis sp. nov strain GD2 T is a new species of the genus Intestinimonas (the second, following Intestinimonas butyriciproducens gen. nov., sp. nov). First isolated from the gut microbiota of a healthy subject of French origin using a culturomics approach combined with taxono-genomics, it is strictly anaerobic, nonspore-forming, rod-shaped, with catalase- and oxidase-negative reactions. Its growth was observed after preincubation in an anaerobic blood culture enriched with sheep blood (5%) and rumen fluid (5%), incubated at 37°C. Its phenotypic and genotypic descriptions are presented in this paper with a full annotation of its genome sequence. This genome consists of 3,104,261 bp in length and contains 3,074 predicted genes, including 3,012 protein-coding genes and 62 RNA-coding genes. Strain GD2 T significantly produces butyrate and is frequently found among available 16S rRNA gene amplicon datasets, which leads consideration of Intestinimonas massiliensis as an important human gut commensal. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Fancelli, Marilene; Dias, Alex Batista; Delalibera, Italo; de Jesus, Sandra Cerqueira; do Nascimento, Antonio Souza; Silva, Sebastião de Oliveira e; Caldas, Ranulfo Correa; Ledo, Carlos Alberto da Silva
2013-01-01
The objective of this study was to select strains of Beauveria bassiana for controlling Cosmopolites sordidus (Germ.) in plantain farms (cv. Terra) of the "Recôncavo" and southern regions in the state of Bahia, Brazil. The virulence of 32 B. bassiana isolates against C. sordidus was determined under laboratory conditions. Three isolates (CNPMF 407, CNPMF 218, and CNPMF 416) were selected for evaluation under field conditions in plantations located in the counties of Mutuípe and Wenceslau Guimarães. Population of C. sordidus was estimated every 15 days by using pseudostem traps. The efficiency of the three strains of B. bassiana was compared to chemical control (carbofuran, 4 g/trap) and absence of control. Carbofuran caused around 90% of adult mortality after 12 months, with a reduction in the population of C. sordidus since the first evaluation. A low number of trapped insects was observed in the fungus-treated plots, suggesting the efficiency of the isolates in controlling the C. sordidus population. The strain CNPMF 218 was the most efficient in controlling C. sordidus adults in both locations, causing around 20% mortality, leading to 40% population size reduction after 12 months.
Dias, Alex Batista; Delalibera Júnior, Italo; de Jesus, Sandra Cerqueira; do Nascimento, Antonio Souza; Silva, Sebastião de Oliveira e; Caldas, Ranulfo Correa; Ledo, Carlos Alberto da Silva
2013-01-01
The objective of this study was to select strains of Beauveria bassiana for controlling Cosmopolites sordidus (Germ.) in plantain farms (cv. Terra) of the “Recôncavo” and southern regions in the state of Bahia, Brazil. The virulence of 32 B. bassiana isolates against C. sordidus was determined under laboratory conditions. Three isolates (CNPMF 407, CNPMF 218, and CNPMF 416) were selected for evaluation under field conditions in plantations located in the counties of Mutuípe and Wenceslau Guimarães. Population of C. sordidus was estimated every 15 days by using pseudostem traps. The efficiency of the three strains of B. bassiana was compared to chemical control (carbofuran, 4g/trap) and absence of control. Carbofuran caused around 90% of adult mortality after 12 months, with a reduction in the population of C. sordidus since the first evaluation. A low number of trapped insects was observed in the fungus-treated plots, suggesting the efficiency of the isolates in controlling the C. sordidus population. The strain CNPMF 218 was the most efficient in controlling C. sordidus adults in both locations, causing around 20% mortality, leading to 40% population size reduction after 12 months. PMID:24187659
Namwong, Sirilak; Tanasupawat, Somboon; Smitinont, Thitapha; Visessanguan, Wonnop; Kudo, Takuji; Itoh, Takashi
2005-01-01
Eight strains of aerobic, spore-forming, Gram-positive, moderately halophilic bacteria were isolated from sauce (nam-pla and bu-du) produced in Thailand by the fermentation of fish. They grew optimally in the presence of 10 % NaCl, at 37 degrees C and pH 7.0. A diagnostic diamino acid, meso-diaminopimelic acid, was present in the cell-wall peptidoglycan. The predominant menaquinone was MK-7. The major cellular fatty acids were anteiso-C(15 : 0) and iso-C(16 : 0). Phosphatidylglycerol, diphosphatidylglycerol and an unidentified glycolipid were found to be the major polar lipid components. The DNA G+C content was 42-43 mol%. These bacteria were further divided into two groups based on phenotypic characteristics and DNA-DNA similarities. Three strains of Group I were highly affiliated to the type strain of Lentibacillus salicampi in terms of phenotypic characterization and DNA-DNA similarities (96-102 %); accordingly, they were identified as strains of L. salicampi. A representative strain of Group II, strain IS40-3T, was most closely related to L. salicampi in terms of 16S rRNA-based phylogenetic analysis, although five strains of Group II could be distinguished from L. salicampi by means of several phenotypic properties, low 16S rRNA gene sequence similarity (95.2 %) and low DNA-DNA similarities (12-32 %). Therefore, the Group II strains should be included in a novel species of the genus Lentibacillus, for which the name Lentibacillus juripiscarius sp. nov. is proposed. The type strain is IS40-3T (=JCM 12147T=PCU 229T=TISTR 1535T).
Liu, Bingxuan; Liu, Haiquan; Pan, Yingjie; Xie, Jing; Zhao, Yong
2016-01-01
Microbial growth variability plays an important role on food safety risk assessment. In this study, the growth kinetic characteristics corresponding to maximum specific growth rate (μmax) of 50 V. parahaemolyticus isolates from different sources and genotypes were evaluated at different temperatures (10, 20, 30, and 37°C) and salinity (0.5, 3, 5, 7, and 9%) using the automated turbidimetric system Bioscreen C. The results demonstrated that strain growth variability increased as the growth conditions became more stressful both in terms of temperature and salinity. The coefficient of variation (CV) of μmax for temperature was larger than that for salinity, indicating that the impact of temperature on strain growth variability was greater than that of salinity. The strains isolated from freshwater aquatic products had more conspicuous growth variations than those from seawater. Moreover, the strains with tlh (+) /tdh (+) /trh (-) exhibited higher growth variability than tlh (+) /tdh (-) /trh (-) or tlh (+) /tdh (-) /trh (+), revealing that gene heterogeneity might have possible relations with the growth variability. This research illustrates that the growth environments, strain sources as well as genotypes have impacts on strain growth variability of V. parahaemolyticus, which can be helpful for incorporating strain variability in predictive microbiology and microbial risk assessment.
Liu, Bingxuan; Liu, Haiquan; Pan, Yingjie; Xie, Jing; Zhao, Yong
2016-01-01
Microbial growth variability plays an important role on food safety risk assessment. In this study, the growth kinetic characteristics corresponding to maximum specific growth rate (μmax) of 50 V. parahaemolyticus isolates from different sources and genotypes were evaluated at different temperatures (10, 20, 30, and 37°C) and salinity (0.5, 3, 5, 7, and 9%) using the automated turbidimetric system Bioscreen C. The results demonstrated that strain growth variability increased as the growth conditions became more stressful both in terms of temperature and salinity. The coefficient of variation (CV) of μmax for temperature was larger than that for salinity, indicating that the impact of temperature on strain growth variability was greater than that of salinity. The strains isolated from freshwater aquatic products had more conspicuous growth variations than those from seawater. Moreover, the strains with tlh+/tdh+/trh− exhibited higher growth variability than tlh+/tdh−/trh− or tlh+/tdh−/trh+, revealing that gene heterogeneity might have possible relations with the growth variability. This research illustrates that the growth environments, strain sources as well as genotypes have impacts on strain growth variability of V. parahaemolyticus, which can be helpful for incorporating strain variability in predictive microbiology and microbial risk assessment. PMID:27446034
Champoiseau, P; Daugrois, J-H; Pieretti, I; Cociancich, S; Royer, M; Rott, P
2006-10-01
ABSTRACT Pathogenicity of 75 strains of Xanthomonas albilineans from Guadeloupe was assessed by inoculation of sugarcane cv. B69566, which is susceptible to leaf scald, and 19 of the strains were selected as representative of the variation in pathogenicity observed based on stalk colonization. In vitro production of albicidin varied among these 19 strains, but the restriction fragment length polymorphism pattern of their albicidin biosynthesis genes was identical. Similarly, no genomic variation was found among strains by pulsed-field gel electrophoresis. Some variation among strains was found by amplified fragment length polymorphism, but no relationship between this genetic variation and variation in pathogenicity was found. Only 3 (pilB, rpfA, and xpsE) of 40 genes involved in pathogenicity of bacterial species closely related to X. albilineans could be amplified by polymerase chain reaction from total genomic DNA of all nine strains tested of X. albilineans differing in pathogenicity in Guadeloupe. Nucleotide sequences of these genes were 100% identical among strains, and a phylogenetic study with these genes and housekeeping genes efp and ihfA suggested that X. albilineans is on an evolutionary road between the X. campestris group and Xylella fastidiosa, another vascular plant pathogen. Sequencing of the complete genome of Xanthomonas albilineans could be the next step in deciphering molecular mechanisms involved in pathogenicity of X. albilineans.
Measures of Bulk and Grain Strain in Deformation Processes(PREPRINT)
2007-04-01
the process and a similar measure of the flow stress of the material. The effective , or equivalent, strain, based on an analogous definition for...The conjugate effective stress in this case is the uniaxial tensile stress . Based on equations (12) and (13), expressions for effective bulk strains...t |L(t)| in the reference state deformed to an image, x′ = t′ | L′(t′)|, in the deformed state . In both cases an equation of the form of
Genome Sequence of the Marine Janibacter Sp. Strain HTCC2649 ▿
Thrash, J. Cameron; Cho, Jang-Cheon; Bertagnolli, Anthony D.; Ferriera, Steve; Johnson, Justin; Vergin, Kevin L.; Giovannoni, Stephen J.
2011-01-01
Janibacter sp. strain HTCC2649 is a novel marine member of the Actinobacteria, family Intrasporangiaceae, and is closely related to Janibacter melonis CM2104T and Knoellia sinensis HKI 0119T. The organism was isolated from a sample collected at Hydrostation S south of Bermuda by using high-throughput culturing techniques. Here we present the genome sequence of Janibacter sp. strain HTCC2649. PMID:21075932
Köhrer, Caroline; Mandal, Debabrata; Gaston, Kirk W.; Grosjean, Henri; Limbach, Patrick A.; RajBhandary, Uttam L.
2014-01-01
Translation of the isoleucine codon AUA in most prokaryotes requires a modified C (lysidine or agmatidine) at the wobble position of tRNA2Ile to base pair specifically with the A of the AUA codon but not with the G of AUG. Recently, a Bacillus subtilis strain was isolated in which the essential gene encoding tRNAIle-lysidine synthetase was deleted for the first time. In such a strain, C34 at the wobble position of tRNA2Ile is expected to remain unmodified and cells depend on a mutant suppressor tRNA derived from tRNA1Ile, in which G34 has been changed to U34. An important question, therefore, is how U34 base pairs with A without also base pairing with G. Here, we show (i) that unlike U34 at the wobble position of all B. subtilis tRNAs of known sequence, U34 in the mutant tRNA is not modified, and (ii) that the mutant tRNA binds strongly to the AUA codon on B. subtilis ribosomes but only weakly to AUG. These in vitro data explain why the suppressor strain displays only a low level of misreading AUG codons in vivo and, as shown here, grows at a rate comparable to that of the wild-type strain. PMID:24194599
Choi, Dong Han; Ahn, Chisang; Jang, Gwang Il; ...
2015-11-11
Gracilimonas tropica Choi et al. 2009 is a member of order Sphingobacteriales, class Sphingobacteriia. Three species of the genus Gracilimonas have been isolated from marine seawater or a salt mine and showed extremely halotolerant and mesophilic features, although close relatives are extremely halophilic or thermophilic. The type strain of the type species of Gracilimonas, G. tropica DSM19535 T, was isolated from a Synechococcus culture which was established from the tropical sea-surface water of the Pacific Ocean. The genome of the strain DSM19535 T was sequenced through the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes project.more » Here, we describe the genomic features of the strain. The 3,831,242 bp long draft genome consists of 48 contigs with 3373 protein-coding and 53 RNA genes. Finally, the strain seems to adapt to phosphate limitation and requires amino acids from external environment. In addition, genomic analyses and pasteurization experiment suggested that G. tropica DSM19535 T did not form spore.« less
Zhang, Yong; Sun, Qiang; Cui, Hui; Yan, Dongmei; Fan, Qin; Song, Yang; Zhu, Shuangli; Li, Xiaolei; Huang, Guohong; Ji, Tianjiao; Hu, Lan; Wang, Dongyan; Yang, Qian; Xu, Wenbo
2016-01-01
Poliomyelitis associated with circulating vaccine-derived polioviruses (cVDPVs) is a serious public health issue in the post-eradication era, and the occurrence of recombinant cVDPVs emphasizes the need to elucidate enterovirus C (EV-C) epidemiology. Stool samples were collected from 826 healthy children in Southern Xinjiang in 2011 to investigate EV-C circulation and epidemiology. Thirty-six EV-Cs were isolated and assigned to eight EV-C serotypes by molecular serotyping, suggesting the circulation of diverse EV-Cs in Xinjiang. Phylogenetic analysis showed that the Xinjiang EV-C strains had larger variation compared to the prototype and other modern strains. Additionally, the results showed unique characteristics of Xinjiang EV-Cs, such as the cytopathicity of CV-A1 strains to RD cells; the high divergence in CV-A11, CV-A13, CV-A17, and CV-A20 strains; the divergence of Xinjiang CV-A24 from AHC-related CV-A24 variant stains distributed worldwide; and the circulation of two novel EV-C serotypes (EV-C96 and EV-C99). Evaluations of this dense and diverse EV-C ecosystem will help elucidate the processes shaping enteroviral biodiversity. This study will improve our understanding of the evolution of enteroviruses and the recombination potential between polioviruses and other EV-Cs. PMID:27642136
Byrd, Allyson L; Deming, Clay; Cassidy, Sara K B; Harrison, Oliver J; Ng, Weng-Ian; Conlan, Sean; Belkaid, Yasmine; Segre, Julia A; Kong, Heidi H
2017-07-05
The heterogeneous course, severity, and treatment responses among patients with atopic dermatitis (AD; eczema) highlight the complexity of this multifactorial disease. Prior studies have used traditional typing methods on cultivated isolates or sequenced a bacterial marker gene to study the skin microbial communities of AD patients. Shotgun metagenomic sequence analysis provides much greater resolution, elucidating multiple levels of microbial community assembly ranging from kingdom to species and strain-level diversification. We analyzed microbial temporal dynamics from a cohort of pediatric AD patients sampled throughout the disease course. Species-level investigation of AD flares showed greater Staphylococcus aureus predominance in patients with more severe disease and Staphylococcus epidermidis predominance in patients with less severe disease. At the strain level, metagenomic sequencing analyses demonstrated clonal S. aureus strains in more severe patients and heterogeneous S. epidermidis strain communities in all patients. To investigate strain-level biological effects of S. aureus , we topically colonized mice with human strains isolated from AD patients and controls. This cutaneous colonization model demonstrated S. aureus strain-specific differences in eliciting skin inflammation and immune signatures characteristic of AD patients. Specifically, S. aureus isolates from AD patients with more severe flares induced epidermal thickening and expansion of cutaneous T helper 2 (T H 2) and T H 17 cells. Integrating high-resolution sequencing, culturing, and animal models demonstrated how functional differences of staphylococcal strains may contribute to the complexity of AD disease. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Heterogeneous compute in computer vision: OpenCL in OpenCV
NASA Astrophysics Data System (ADS)
Gasparakis, Harris
2014-02-01
We explore the relevance of Heterogeneous System Architecture (HSA) in Computer Vision, both as a long term vision, and as a near term emerging reality via the recently ratified OpenCL 2.0 Khronos standard. After a brief review of OpenCL 1.2 and 2.0, including HSA features such as Shared Virtual Memory (SVM) and platform atomics, we identify what genres of Computer Vision workloads stand to benefit by leveraging those features, and we suggest a new mental framework that replaces GPU compute with hybrid HSA APU compute. As a case in point, we discuss, in some detail, popular object recognition algorithms (part-based models), emphasizing the interplay and concurrent collaboration between the GPU and CPU. We conclude by describing how OpenCL has been incorporated in OpenCV, a popular open source computer vision library, emphasizing recent work on the Transparent API, to appear in OpenCV 3.0, which unifies the native CPU and OpenCL execution paths under a single API, allowing the same code to execute either on CPU or on a OpenCL enabled device, without even recompiling.
Intra, Bungonsiri; Greule, Anja; Bechthold, Andreas; Euanorasetr, Jirayut; Paululat, Thomas; Panbangred, Watanalai
2016-06-29
Two new polyene macrolactone antibiotics, thailandins A, 1, and B, 2, were isolated from the fermentation broth of rhizosphere soil-associated Actinokineospora bangkokensis strain 44EHW(T). The new compounds from this strain were purified using semipreparative HPLC and Sephadex LH-20 gel filtration while following an antifungal activity guided fractionation. Their structures were elucidated through spectroscopic techniques including UV, HR-ESI-MS, and NMR. These compounds demonstrated broad spectrum antifungal activity against fungi causing anthracnose disease (Colletotrichum gloeosporioides DoA d0762, Colletotrichum gloeosporiodes DoA c1060, and Colletotrichum capsici DoA c1511) as well as pathogenic yeasts (Candida albicans MT 2013/1, Candida parasilopsis DKMU 434, and Cryptococcus neoformans MT 2013/2) with minimum inhibitory concentrations ranging between 16 and 32 μg/mL. This is the first report of polyene antibiotics produced by Actinokineospora species as bioactive compounds against anthracnose fungi and pathogenic yeast strains.
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
[Salmonella spp. strains resistant to drugs].
Białucha, Agata; Kozuszko, Sylwia; Gospodarek, Eugenia
2010-01-01
The aim of the study was retrospective analysis of Salmonella spp. strains isolated from patients of State Infectious Diseases Observatory Hospital of T. Browicz in Bydgoszcz (SZAK) and University of dr. A. Jurasz in Bydgoszcz (SU CM UMK) in 2006-2009. The percentages of Salmonella spp. strains resistant to at least one drug were: 19,0% in 2006, 12,5% in 2007, 50,6% in 2008 and 43,8% in the first half of 2009 year. The highest number of Salmonella spp. strains resistant to drugs were isolated from stool (96,7%) and from patients of SZAK (83,3%). Among all isolated Salmonella spp. strains resistant to drugs the highest percentage were S. enterica serovar Enteritidis (56,7%). Among S. enterica bacilli predominated resitant phenotypes to ampicillin, amoxicillin, chloramphenicol and nalidixic acid. The increasing number of strains resistant to ciprofloxacin (0,0 - 26,7%) and high percentage of strains resistant to nalidixic acid (97,3%) were noted. Decreasing resistance to chloramphenicol was observed in our study (54,5 - 14,3%).
Klenk, Hans-Peter; Lapidus, Alla; Chertkov, Olga; Copeland, Alex; Del Rio, Tijana Glavina; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Han, Cliff; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Daum, Chris; Chen, Amy; Palaniappan, Krishna; Chang, Yun-Juan; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D; Detter, John C; Rohde, Manfred; Abt, Birte; Pukall, Rüdiger; Göker, Markus; Bristow, James; Markowitz, Victor; Hugenholtz, Philip; Eisen, Jonathan A
2011-10-15
Bacillus tusciae Bonjour & Aragno 1994 is a hydrogen-oxidizing, thermoacidophilic spore former that lives as a facultative chemolithoautotroph in solfataras. Although 16S rRNA gene sequencing was well established at the time of the initial description of the organism, 16S sequence data were not available and the strain was placed into the genus Bacillus based on limited chemotaxonomic information. Despite the now obvious misplacement of strain T2 as a member of the genus Bacillus in 16S rRNA-based phylogenetic trees, the misclassification remained uncorrected for many years, which was likely due to the extremely difficult, analysis-hampering cultivation conditions and poor growth rate of the strain. Here we provide a taxonomic re-evaluation of strain T2T (= DSM 2912 = NBRC 15312) and propose its reclassification as the type strain of a new species, Kyrpidia tusciae, and the type species of the new genus Kyrpidia, which is a sister-group of Alicyclobacillus. The family Alicyclobacillaceae da Costa and Rainey, 2010 is emended. The 3,384,766 bp genome with its 3,323 protein-coding and 78 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Endophytic colonization of olive roots by the biocontrol strain Pseudomonas fluorescens PICF7.
Prieto, Pilar; Mercado-Blanco, Jesús
2008-05-01
Confocal microscopy combined with three-dimensional olive root tissue sectioning was used to provide evidence of the endophytic behaviour of Pseudomonas fluorescens PICF7, an effective biocontrol strain against Verticillium wilt of olive. Two derivatives of the green fluorescent protein (GFP), the enhanced green and the red fluorescent proteins, have been used to visualize simultaneously two differently fluorescently tagged populations of P. fluorescens PICF7 within olive root tissues at the single cell level. The time-course of colonization events of olive roots cv. Arbequina by strain PICF7 and the localization of tagged bacteria within olive root tissues are described. First, bacteria rapidly colonized root surfaces and were predominantly found in the differentiation zone. Thereafter, microscopy observations showed that PICF7-tagged populations eventually disappeared from the root surface, and increasingly colonized inner root tissues. Localized and limited endophytic colonization by the introduced bacteria was observed over time. Fluorescent-tagged bacteria were always visualized in the intercellular spaces of the cortex region, and no colonization of the root xylem vessels was detected at any time. To the best of our knowledge, this is the first time this approach has been used to demonstrate endophytism of a biocontrol Pseudomonas spp. strain in a woody host such as olive using a nongnotobiotic system.
Pathoadaptive Conditional Regulation of the Type VI Secretion System in Vibrio cholerae O1 Strains
Ishikawa, Takahiko; Sabharwal, Dharmesh; Bröms, Jeanette; Milton, Debra L.; Sjöstedt, Anders; Uhlin, Bernt Eric
2012-01-01
The most recently discovered secretion pathway in Gram-negative bacteria, the type VI secretion system (T6SS), is present in many species and is considered important for the survival of non-O1 non-O139 Vibrio cholerae in aquatic environments. Until now, it was not known whether there is a functionally active T6SS in wild-type V. cholerae O1 strains, the cause of cholera disease in humans. Here, we demonstrate the presence of a functionally active T6SS in wild-type V. cholerae O1 strains, as evidenced by the secretion of the T6SS substrate Hcp, which required several gene products encoded within the putative vas gene cluster. Our analyses showed that the T6SS of wild-type V. cholerae O1 strain A1552 was functionally activated when the bacteria were grown under high-osmolarity conditions. The T6SS was also active when the bacteria were grown under low temperature (23°C), suggesting that the system may be important for the survival of the bacterium in the environment. A test of the interbacterial virulence of V. cholerae strain A1552 against an Escherichia coli K-12 strain showed that it was strongly enhanced under high osmolarity and that it depended on the hcp genes. Interestingly, we found that the newly recognized osmoregulatory protein OscR plays a role in the regulation of T6SS gene expression and secretion of Hcp from V. cholerae O1 strains. PMID:22083711
2014-05-01
CAPE CANAVERAL, Fla. -- At NASA's Kennedy Space Center in Florida, Bill Martin, a URS Federal Technical Services helicopter pilot in the agency's Aircraft Operations, is interviewed near the Shuttle Landing Facility. He discussed working with spaceport Fire Rescue personnel to develop procedures for using agency helicopters to transport injured patients to a local hospital. The training activity took place in Kennedy's Launch Complex 39 turn-basin parking lot. It was part of a new training program developed by Kennedy's Fire Rescue department along with NASA Aircraft Operations to sharpen the skills needed to help rescue personnel learn how to collaborate with helicopter pilots in taking injured patients to hospitals as quickly as possible. Photo credit: NASA/Dimitri Gerondidakis
2013-06-15
MOJAVE DESERT, Calif. – In the Mojave Desert in California, students and engineers participate in a pre-launch briefing before the lift off of the Garvey Spacecraft Corporation's Prospector P-18D rocket. The rocket is scheduled to launch the RUBICS-1 payload on a high-altitude, suborbital flight. The rocket will carry four satellites made from four-inch cube sections. The rocket reached a peak altitude of about 9,000 feet, however the parachute deployed prematurely and the vehicle continued on its trajectory, coasting and tumbling to a hard landing on its side. In spite of the rough ride, all four CubeSats were recovered. PhoneSat and RUBICS received data in flight, but sustained structural damage. CP-9 and StangSat fared better, and their teams are working to recover as much information as possible. Collectively known as CubeSats, the satellites were designed to record shock, vibrations and heat inside the rocket. The results will be used to prove or strengthen their designs before they are carried into orbit in 2014 on a much larger rocket. Built by several different organizations, including a university, a NASA field center and a high school, the spacecraft are four-inch cubes designed to fly on their own eventually, but will remain firmly attached to the rocket during the upcoming mission. For more information, visit http://www.nasa.gov/mission_pages/smallsats/elana/cubesatlaunchpreview.html Photo credit: NASA/Dimitri Gerondidakis
Komaki, Hisayuki; Sakurai, Kenta; Hosoyama, Akira; Kimura, Akane; Igarashi, Yasuhiro; Tamura, Tomohiko
2018-05-02
To identify the species of butyrolactol-producing Streptomyces strain TP-A0882, whole genome-sequencing of three type strains in a close taxonomic relationship was performed. In silico DNA-DNA hybridization using the genome sequences suggested that Streptomyces sp. TP-A0882 is classified as Streptomyces diastaticus subsp. ardesiacus. Strain TP-A0882, S. diastaticus subsp. ardesiacus NBRC 15402 T , Streptomyces coelicoflavus NBRC 15399 T , and Streptomyces rubrogriseus NBRC 15455 T harbor at least 14, 14, 10, and 12 biosynthetic gene clusters (BGCs), respectively, coding for nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs). All 14 gene clusters were shared by S. diastaticus subsp. ardesiacus strains TP-A0882 and NBRC 15402 T , while only four gene clusters were shared by the three distinct species. Although BGCs for bacteriocin, ectoine, indole, melanine, siderophores such as deferrioxamine, terpenes such as albaflavenone, hopene, carotenoid and geosmin are shared by the three species, many BGCs for secondary metabolites such as butyrolactone, lantipeptides, oligosaccharide, some terpenes are species-specific. These results indicate the possibility that strains belonging to the same species possess the same set of secondary metabolite-biosynthetic pathways, whereas strains belonging to distinct species have species-specific pathways, in addition to some common pathways, even if the strains are taxonomically close.
Nodulation of Lupinus albus by Strains of Ochrobactrum lupini sp. nov.
Trujillo, Martha E.; Willems, Anne; Abril, Adriana; Planchuelo, Ana-María; Rivas, Raúl; Ludeña, Dolores; Mateos, Pedro F.; Martínez-Molina, Eustoquio; Velázquez, Encarna
2005-01-01
The nodulation of legumes has for more than a century been considered an exclusive capacity of a group of microorganisms commonly known as rhizobia and belonging to the α-Proteobacteria. However, in the last 3 years four nonrhizobial species, belonging to α and β subclasses of the Proteobacteria, have been described as legume-nodulating bacteria. In the present study, two fast-growing strains, LUP21 and LUP23, were isolated from nodules of Lupinus honoratus. The phylogenetic analysis based on the 16S and 23S rRNA gene sequences showed that the isolates belong to the genus Ochrobactrum. The strains were able to reinfect Lupinus plants. A plasmid profile analysis showed the presence of three plasmids. The nodD and nifH genes were located on these plasmids, and their sequences were obtained. These sequences showed a close resemblance to the nodD and nifH genes of rhizobial species, suggesting that the nodD and nifH genes carried by strain LUP21T were acquired by horizontal gene transfer. A polyphasic study including phenotypic, chemotaxonomic, and molecular features of the strains isolated in this study showed that they belong to a new species of the genus Ochrobactrum for which we propose the name Ochrobactrum lupini sp. nov. Strain LUP21T (LMG 20667T) is the type strain. PMID:15746334
Whole Genome Analysis of a Wine Yeast Strain
Hauser, Nicole C.; Fellenberg, Kurt; Gil, Rosario; Bastuck, Sonja; Hoheisel, Jörg D.
2001-01-01
Saccharomyces cerevisiae strains frequently exhibit rather specific phenotypic features needed for adaptation to a special environment. Wine yeast strains are able to ferment musts, for example, while other industrial or laboratory strains fail to do so. The genetic differences that characterize wine yeast strains are poorly understood, however. As a first search of genetic differences between wine and laboratory strains, we performed DNA-array analyses on the typical wine yeast strain T73 and the standard laboratory background in S288c. Our analysis shows that even under normal conditions, logarithmic growth in YPD medium, the two strains have expression patterns that differ significantly in more than 40 genes. Subsequent studies indicated that these differences correlate with small changes in promoter regions or variations in gene copy number. Blotting copy numbers vs. transcript levels produced patterns, which were specific for the individual strains and could be used for a characterization of unknown samples. PMID:18628902
Genetic analysis of duck circovirus in Pekin ducks from South Korea.
Cha, S-Y; Kang, M; Cho, J-G; Jang, H-K
2013-11-01
The genetic organization of the 24 duck circovirus (DuCV) strains detected in commercial Pekin ducks from South Korea between 2011 and 2012 is described in this study. Multiple sequence alignment and phylogenetic analyses were performed on the 24 viral genome sequences as well as on 45 genome sequences available from the GenBank database. Phylogenetic analyses based on the genomic and open reading frame 2/cap sequences demonstrated that all DuCV strains belonged to genotype 1 and were designated in a subcluster under genotype 1. Analysis of the capsid protein amino acid sequences of the 24 Korean DuCV strains showed 10 substitutions compared with that of other genotype 1 strains. Our analysis showed that genotype 1 is predominant and circulating in South Korea. These present results serve as incentive to add more data to the DuCV database and provide insight to conduct further intensive study on the geographic relationships among these virus strains.
A T3 and T7 Recombinant Phage Acquires Efficient Adsorption and a Broader Host Range
Lin, Tiao-Yin; Lo, Yi-Haw; Tseng, Pin-Wei; Chang, Shun-Fu; Lin, Yann-Tsyr; Chen, Ton-Seng
2012-01-01
It is usually thought that bacteriophage T7 is female specific, while phage T3 can propagate on male and female Escherichia coli. We found that the growth patterns of phages T7M and T3 do not match the above characteristics, instead showing strain dependent male exclusion. Furthermore, a T3/7 hybrid phage exhibits a broader host range relative to that of T3, T7, as well as T7M, and is able to overcome the male exclusion. The T7M sequence closely resembles that of T3. T3/7 is essentially T3 based, but a DNA fragment containing part of the tail fiber gene 17 is replaced by the T7 sequence. T3 displays inferior adsorption to strains tested herein compared to T7. The T3 and T7 recombinant phage carries altered tail fibers and acquires better adsorption efficiency than T3. How phages T3 and T7 recombine was previously unclear. This study is the first to show that recombination can occur accurately within only 8 base-pair homology, where four-way junction structures are identified. Genomic recombination models based on endonuclease I cleavages at equivalent and nonequivalent sites followed by strand annealing are proposed. Retention of pseudo-palindromes can increase recombination frequency for reviving under stress. PMID:22347414
A T3 and T7 recombinant phage acquires efficient adsorption and a broader host range.
Lin, Tiao-Yin; Lo, Yi-Haw; Tseng, Pin-Wei; Chang, Shun-Fu; Lin, Yann-Tsyr; Chen, Ton-Seng
2012-01-01
It is usually thought that bacteriophage T7 is female specific, while phage T3 can propagate on male and female Escherichia coli. We found that the growth patterns of phages T7M and T3 do not match the above characteristics, instead showing strain dependent male exclusion. Furthermore, a T3/7 hybrid phage exhibits a broader host range relative to that of T3, T7, as well as T7M, and is able to overcome the male exclusion. The T7M sequence closely resembles that of T3. T3/7 is essentially T3 based, but a DNA fragment containing part of the tail fiber gene 17 is replaced by the T7 sequence. T3 displays inferior adsorption to strains tested herein compared to T7. The T3 and T7 recombinant phage carries altered tail fibers and acquires better adsorption efficiency than T3. How phages T3 and T7 recombine was previously unclear. This study is the first to show that recombination can occur accurately within only 8 base-pair homology, where four-way junction structures are identified. Genomic recombination models based on endonuclease I cleavages at equivalent and nonequivalent sites followed by strand annealing are proposed. Retention of pseudo-palindromes can increase recombination frequency for reviving under stress.
Fikru, Regassa; Matetovici, Irina; Rogé, Stijn; Merga, Bekana; Goddeeris, Bruno Maria; Büscher, Philippe; Van Reet, Nick
2016-04-15
Animal trypanosomosis caused by Trypanosoma vivax (T. vivax) is a devastating disease causing serious economic losses. Most molecular diagnostics for T. vivax infection target the ribosomal DNA locus (rDNA) but are challenged by the heterogeneity among T. vivax strains. In this study, we investigated the rDNA heterogeneity of Ethiopian T. vivax strains in relation to their presence in tsetse-infested and tsetse-free areas and its effect on molecular diagnosis. We sequenced the rDNA loci of six Ethiopian (three from tsetse-infested and three from tsetse-free areas) and one Nigerian T. vivax strain. We analysed the obtained sequences in silico for primer-mismatches of some commonly used diagnostic PCR assays and for GC content. With these data, we selected some rDNA diagnostic PCR assays for evaluation of their diagnostic accuracy. Furthermore we constructed two phylogenetic networks based on sequences within the smaller subunit (SSU) of 18S and within the 5.8S and internal transcribed spacer 2 (ITS2) to assess the relatedness of Ethiopian T. vivax strains to strains from other African countries and from South America. In silico analysis of the rDNA sequence showed important mismatches of some published diagnostic PCR primers and high GC content of T. vivax rDNA. The evaluation of selected diagnostic PCR assays with specimens from cattle under natural T. vivax challenge showed that this high GC content interferes with the diagnostic accuracy of PCR, especially in cases of mixed infections with T. congolense. Adding betain to the PCR reaction mixture can enhance the amplification of T. vivax rDNA but decreases the sensitivity for T. congolense and Trypanozoon. The networks illustrated that Ethiopian T. vivax strains are considerably heterogeneous and two strains (one from tsetse-infested and one from tsetse-free area) are more related to the West African and South American strains than to the East African strains. The rDNA locus sequence of six Ethiopian T. vivax
Visual acuity, endothelial cell density and polymegathism after iris-fixated lens implantation.
Nassiri, Nader; Ghorbanhosseini, Saeedeh; Jafarzadehpur, Ebrahim; Kavousnezhad, Sara; Nassiri, Nariman; Sheibani, Kourosh
2018-01-01
The purpose of this study was to evaluate the visual acuity as well as endothelial cell density (ECD) and polymegathism after iris-fixated lens (Artiflex ® AC 401) implantation for correction of moderate to high myopia. In this retrospective cross-sectional study, 55 eyes from 29 patients undergoing iris-fixated lens implantation for correction of myopia (-5.00 to -15.00 D) from 2007 to 2014 were evaluated. Uncorrected visual acuity, best spectacle-corrected visual acuity, refraction, ECD and polymegathism (coefficient of variation [CV] in the sizes of endothelial cells) were measured preoperatively and 6 months postoperatively. In the sixth month of follow-up, the uncorrected vision acuity was 20/25 or better in 81.5% of the eyes. The best-corrected visual acuity was 20/30 or better in 96.3% of the eyes, and more than 92% of the eyes had a refraction score of ±1 D from the target refraction. The mean corneal ECD of patients before surgery was 2,803±339 cells/mm 2 , which changed to 2,744±369 cells/mm 2 six months after surgery ( p =0.142). CV in the sizes of endothelial cells before the surgery was 25.7%±7.1% and six months after surgery it was 25.9%±5.4% ( p =0.857). Artiflex iris-fixated lens implantation is a suitable and predictable method for correction of moderate to high myopia. There was no statistically significant change in ECD and polymegathism (CV in the sizes of endothelial cells) after 6 months of follow-up.
Paul-Victor, Cloé; Dalle Vacche, Sara; Sordo, Federica; Fink, Siegfried; Speck, Thomas; Michaud, Véronique; Speck, Olga
2017-01-01
As plant fibres are increasingly used in technical textiles and their composites, underlying principles of wound healing in living plant fibres are relevant to product quality, and provide inspiration for biomimetic healing in synthetic materials. In this work, two Linum usitatissimum cultivars differing in their stem mechanical properties, cv. Eden (stems resistant to lodging) and cv. Drakkar (with more flexible stems), were grown without wound or with stems previously wounded with a cut parallel or transversal to the stem. To investigate wound healing efficiency, growth traits, stem biomechanics with Dynamic Mechanical Analysis and anatomy were analysed after 25-day recovery. Longitudinal incisions formed open wounds while transversal incisions generated stem growth restoring the whole cross-section but not the original stem organisation. In the case of transversal wound healing, all the bast fibre bundles in the perturbed area became lignified and pulled apart by parenchyma cells growth. Both Linum cultivars showed a healing efficiency from 79% to 95% with higher scores for transversal healing. Morphological and anatomical modifications of Linum were related to mechanical properties and healing ability. Alongside with an increased understanding of wound healing in plants, our results highlight their possible impact on textile quality and fibre yield.
Paul-Victor, Cloé; Dalle Vacche, Sara; Sordo, Federica; Fink, Siegfried; Speck, Thomas; Michaud, Véronique
2017-01-01
As plant fibres are increasingly used in technical textiles and their composites, underlying principles of wound healing in living plant fibres are relevant to product quality, and provide inspiration for biomimetic healing in synthetic materials. In this work, two Linum usitatissimum cultivars differing in their stem mechanical properties, cv. Eden (stems resistant to lodging) and cv. Drakkar (with more flexible stems), were grown without wound or with stems previously wounded with a cut parallel or transversal to the stem. To investigate wound healing efficiency, growth traits, stem biomechanics with Dynamic Mechanical Analysis and anatomy were analysed after 25-day recovery. Longitudinal incisions formed open wounds while transversal incisions generated stem growth restoring the whole cross-section but not the original stem organisation. In the case of transversal wound healing, all the bast fibre bundles in the perturbed area became lignified and pulled apart by parenchyma cells growth. Both Linum cultivars showed a healing efficiency from 79% to 95% with higher scores for transversal healing. Morphological and anatomical modifications of Linum were related to mechanical properties and healing ability. Alongside with an increased understanding of wound healing in plants, our results highlight their possible impact on textile quality and fibre yield. PMID:28982196
Kennedy, R S; Hettinger, L J; Harm, D L; Ordy, J M; Dunlap, W P
1996-01-01
Vection (V) refers to the compelling visual illusion of self-motion experienced by stationary individuals when viewing moving visual surrounds. The phenomenon is of theoretical interest because of its relevance for understanding the neural basis of ordinary self-motion perception, and of practical importance because it is the experience that makes simulation, virtual reality displays, and entertainment devices more vicarious. This experiment was performed to address whether an optokinetically induced vection illusion exhibits monotonic and stable psychometric properties and whether individuals differ reliably in these (V) perceptions. Subjects were exposed to varying velocities of the circular vection (CV) display in an optokinetic (OKN) drum 2 meters in diameter in 5 one-hour daily sessions extending over a 1 week period. For grouped data, psychophysical scalings of velocity estimates showed that exponents in a Stevens' type power function were essentially linear (slope = 0.95) and largely stable over sessions. Latencies were slightly longer for the slowest and fastest induction stimuli, and the trend over sessions for average latency was longer as a function of practice implying time course adaptation effects. Test-retest reliabilities for individual slope and intercept measures were moderately strong (r = 0.45) and showed no evidence of superdiagonal form. This implies stability of the individual circularvection (CV) sensitivities. Because the individual CV scores were stable, reliabilities were improved by averaging 4 sessions in order to provide a stronger retest reliability (r = 0.80). Individual latency responses were highly reliable (r = 0.80). Mean CV latency and motion sickness symptoms were greater in males than in females. These individual differences in CV could be predictive of other outcomes, such as susceptibility to disorientation or motion sickness, and for CNS localization of visual-vestibular interactions in the experience of self-motion.
Kim, Jeong Do; Jeon, Byeong Jun; Han, Jae Woo; Park, Min Young; Kang, Sin Ae; Kim, Beom Seok
2016-08-01
Endophytic bacteria are viewed as a potential new source of biofungicides because they have beneficial characteristics as control agents for plant disease. This study was performed to examine the endophytic feature and disease control efficacy of Bacillus amyloliquefaciens strain GYL4 and to identify the antifungal compounds produced by this strain. B. amyloliquefaciens strain GYL4 was isolated from leaf tissue of pepper plants (Capsicum annuum L.). Anthracnose symptoms were markedly reduced in the leaves of pepper plants colonised by GYL4. An egfp-expressing strain of GYL4 (GYL4-egfp) was constructed and reintroduced into pepper plants, which confirmed its ability to colonise the internal tissues of pepper plants. GYL4-egfp was observed in the root and stem tissues 4 days after treatment and abundantly found in the internal leaf tissue 9 days after treatment. Bacillomycin derivatives purified from the culture extract of GYL4 displayed control efficacy on anthracnose development in cucumber (Cucumis sativus L. cv. Chunsim). The present study is the first report on evaluation of the endophytic and systemic nature of B. amyloliquefaciens strain GYL4 and its potential as a biocontrol agent for anthracnose management. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Paranjpye, Rohinee; Hamel, Owen S; Stojanovski, Asta; Liermann, Martin
2012-12-01
Since 1997, cases of Vibrio parahaemolyticus-related gastroenteritis from the consumption of raw oysters harvested in Washington State have been higher than historical levels. These cases have shown little or no correlation with concentrations of potentially pathogenic V. parahaemolyticus (positive for the thermostable direct hemolysin gene, tdh) in oysters, although significant concentrations of tdh(+) V. parahaemolyticus strains were isolated from shellfish-growing areas in the Pacific Northwest (PNW). We compared clinical and environmental strains isolated from the PNW to those from other geographic regions within the United States and Asia for the presence of virulence-associated genes, including the thermostable direct hemolysin (tdh), the thermostable-related hemolysin (trh), urease (ureR), the pandemic group specific markers orf8 and toxRS, and genes encoding both type 3 secretion systems (T3SS1 and T3SS2). The majority of clinical strains from the PNW were positive for tdh, trh, and ureR genes, while a significant proportion of environmental isolates were tdh(+) but trh negative. Hierarchical clustering grouped the majority of these clinical isolates into a cluster distinct from that including the pandemic strain RIMD2210633, clinical isolates from other geographical regions, and tdh(+), trh-negative environmental isolates from the PNW. We detected T3SS2-related genes (T3SS2β) in environmental strains that were tdh and trh negative. The presence of significant concentrations of tdh(+), trh-negative environmental strains in the PNW that have not been responsible for illness and T3SS2β in tdh- and trh-negative strains emphasizes the diversity in this species and the need to identify additional virulence markers for this bacterium to improve risk assessment tools for the detection of this pathogen.
Dynamic Response of AA2519 Aluminum Alloy under High Strain Rates
NASA Astrophysics Data System (ADS)
Olasumboye, Adewale Taiwo
Like others in the AA2000 series, AA2519 is a heat-treatable Al-Cu alloy. Its excellent ballistic properties and stress corrosion cracking resistance, combined with other properties, qualify it as a prime candidate for armored vehicle and aircraft applications. However, available data on its high strain-rate response remains limited. In this study, AA2519 aluminum alloy was investigated in three different temper conditions: T4, T6, and T8, to determine the effects of heat treatment on the microstructure and dynamic deformation behavior of the material at high strain rates ranging within 1000 ≤ epsilon ≤ 4000 s-1. Split Hopkinson pressure bar integrated with digital image correlation system was used for mechanical response characterization. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. Results showed heterogeneous deformation in the three temper conditions. It was observed that dynamic behavior in each condition was dependent on strength properties due to the aging type controlling the strengthening precipitates produced and initial microstructure. At 1500 s -1, AA2519-T6 exhibited peak dynamic yield strength and flow stress of 509 and 667 MPa respectively, which are comparable with what were observed in T8 condition at higher rate of 3500 s-1 but AA2519-T4 showed the least strength and flow stress properties. Early stress collapse, dynamic strain aging, and higher susceptibility to shear band formation and fracture were observed in the T6 condition within the selected range of high strain rates. The alloy's general mode of damage evolution was by dispersoid particle nucleation, shearing and cracking.
Cole, Rebecca A.; Lindsay, D.S.; Howe, D.K.; Roderick, Constance L.; Dubey, J.P.; Thomas, N.J.; Baeten, L.A.
2000-01-01
Toxoplasma gondii was isolated from brain or heart tissue from 15 southern sea otters (Enhydra lutris nereis) in cell cultures. These strains were used to infect mice that developed antibodies to T. gondii as detected in the modified direct agglutination test and had T. gondii tissue cysts in their brains at necropsy. Mouse brains containing tissue cysts from 4 of the strains were fed to 4 cats. Two of the cats excreted T. gondii oocysts in their feces that were infectious for mice. Molecular analyses of 13 strains indicated that they were all type II strains, but that they were genetically distinct from one another.
Trypanosoma cruzi strains from triatomine collected in Bahia and Rio Grande do Sul, Brazil.
Ribeiro, Aline Rimoldi; Mendonça, Vagner José; Alves, Renata Tomé; Martinez, Isabel; Araújo, Renato Freitas de; Mello, Fernanda; da Rosa, João Aristeu
2014-04-01
Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship.
Trypanosoma cruzi strains from triatomine collected in Bahia and Rio Grande do Sul, Brazil
Ribeiro, Aline Rimoldi; Mendonça, Vagner José; Alves, Renata Tomé; Martinez, Isabel; de Araújo, Renato Freitas; Mello, Fernanda; da Rosa, João Aristeu
2014-01-01
OBJECTIVE Collection of triatomines in domestic, peridomestic and sylvatic environments in states of Bahia and Rio Grande do Sul, Northeastern and Southern Brazil respectively, and isolation of Trypanosoma cruzi strains. METHODS First, the captured triatomines were identified using insect identification keys, then their intestinal content was examined by abdominal compression, and the samples containing trypanosomatid forms were inoculated in LIT medium and Swiss mice. RESULTS Six triatomine species were collected in cities in Bahia, namely Panstrongylus geniculatus (01), Triatoma melanocephala (11), T. lenti (94), T. pseudomaculata (02), T. sherlocki (26) and T. sordida (460), and two in cities in Rio Grande do Sul, namely T. circummaculata (11) and T. rubrovaria (115). Out of the specimens examined, T. cruzi was isolated from 28 triatomine divided into four different species: T. melanocephala (one), T. lenti (one), T. rubrovaria (16) and T. sordida (10). Their index of natural infection by T. cruzi was 6.4%. CONCLUSIONS The isolation of T. cruzi strains from triatomines found in domestic and peridomestic areas shows the potential risk of transmission of Chagas disease in the studied cities. The maintenance of those T. cruzi strains in laboratory is intended to promote studies that facilitate the understanding of the parasite-vector-host relationship. PMID:24897051
Toxoplasma gondii strain-dependent effects on mouse behaviour.
Kannan, Geetha; Moldovan, Krisztina; Xiao, Jian-Chun; Yolken, Robert H; Jones-Brando, Lorraine; Pletnikov, Mikhail V
2010-06-01
Toxoplasma gondii reportedly manipulates rodent behaviour to increase transmission to its definitive feline host. We compared the effects of mouse infection by two Type II strains of T. gondii, Prugniaud (PRU) and ME49, on attraction to cat odour, locomotor activity, anxiety, sensorimotor gating, and spatial working and recognition memory 2 months post-infection (mpi). Attraction to cat odour was reassessed 7 mpi. At 2 mpi, mice infected with either strain exhibited significantly more attraction to cat odour than uninfected animals did, but only PRU-infected mice exhibited this behaviour 7 mpi. PRU-infected mice had significantly greater body weights and hyperactivity, while ME49-infected mice exhibited impaired spatial working memory. No differences in parasite antibody titres were seen between PRU- and ME49-infected mice. The present data suggest the effect of T. gondii infection on mouse behaviour is parasite strain-dependent.
Characterization of trh2 Harbouring Vibrio parahaemolyticus Strains Isolated in Germany
Bechlars, Silke; Jäckel, Claudia; Diescher, Susanne; Wüstenhagen, Doreen A.; Kubick, Stefan; Dieckmann, Ralf; Strauch, Eckhard
2015-01-01
Background Vibrio parahaemolyticus is a recognized human enteropathogen. Thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) as well as the type III secretion system 2 (T3SS2) are considered as major virulence factors. As tdh positive strains are not detected in coastal waters of Germany, we focused on the characterization of trh positive strains, which were isolated from mussels, seawater and patients in Germany. Results Ten trh harbouring V. parahaemolyticus strains from Germany were compared to twenty-one trh positive strains from other countries. The complete trh sequences revealed clustering into three different types: trh1 and trh2 genes and a pseudogene Ψtrh. All German isolates possessed alleles of the trh2 gene. MLST analysis indicated a close relationship to Norwegian isolates suggesting that these strains belong to the autochthonous microflora of Northern Europe seawaters. Strains carrying the pseudogene Ψtrh were negative for T3SS2β effector vopC. Transcription of trh and vopC genes was analyzed under different growth conditions. Trh2 gene expression was not altered by bile while trh1 genes were inducible. VopC could be induced by urea in trh2 bearing strains. Most trh1 carrying strains were hemolytic against sheep erythrocytes while all trh2 positive strains did not show any hemolytic activity. TRH variants were synthesized in a prokaryotic cell-free system and their hemolytic activity was analyzed. TRH1 was active against sheep erythrocytes while TRH2 variants were not active at all. Conclusion Our study reveals a high diversity among trh positive V. parahaemolyticus strains. The function of TRH2 hemolysins and the role of the pseudogene Ψtrh as pathogenicity factors are questionable. To assess the pathogenic potential of V. parahaemolyticus strains a differentiation of trh variants and the detection of T3SS2β components like vopC would improve the V. parahaemolyticus diagnostics and could lead to a refinement of the risk
Characterization of trh2 harbouring Vibrio parahaemolyticus strains isolated in Germany.
Bechlars, Silke; Jäckel, Claudia; Diescher, Susanne; Wüstenhagen, Doreen A; Kubick, Stefan; Dieckmann, Ralf; Strauch, Eckhard
2015-01-01
Vibrio parahaemolyticus is a recognized human enteropathogen. Thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) as well as the type III secretion system 2 (T3SS2) are considered as major virulence factors. As tdh positive strains are not detected in coastal waters of Germany, we focused on the characterization of trh positive strains, which were isolated from mussels, seawater and patients in Germany. Ten trh harbouring V. parahaemolyticus strains from Germany were compared to twenty-one trh positive strains from other countries. The complete trh sequences revealed clustering into three different types: trh1 and trh2 genes and a pseudogene Ψtrh. All German isolates possessed alleles of the trh2 gene. MLST analysis indicated a close relationship to Norwegian isolates suggesting that these strains belong to the autochthonous microflora of Northern Europe seawaters. Strains carrying the pseudogene Ψtrh were negative for T3SS2β effector vopC. Transcription of trh and vopC genes was analyzed under different growth conditions. Trh2 gene expression was not altered by bile while trh1 genes were inducible. VopC could be induced by urea in trh2 bearing strains. Most trh1 carrying strains were hemolytic against sheep erythrocytes while all trh2 positive strains did not show any hemolytic activity. TRH variants were synthesized in a prokaryotic cell-free system and their hemolytic activity was analyzed. TRH1 was active against sheep erythrocytes while TRH2 variants were not active at all. Our study reveals a high diversity among trh positive V. parahaemolyticus strains. The function of TRH2 hemolysins and the role of the pseudogene Ψtrh as pathogenicity factors are questionable. To assess the pathogenic potential of V. parahaemolyticus strains a differentiation of trh variants and the detection of T3SS2β components like vopC would improve the V. parahaemolyticus diagnostics and could lead to a refinement of the risk assessment in food analyses and
Drira, Ines; Hadrich, Ines; Neji, Sourour; Mahfouth, Nedia; Trabelsi, Houaida; Sellami, Hayet; Makni, Fattouma
2014-01-01
Trichophyton interdigitale is the second most frequent cause of superficial fungal infections of various parts of the human body. Studying the population structure and genotype differentiation of T. interdigitale strains may lead to significant improvements in clinical practice. The present study aimed to develop and select suitable variable-number tandem-repeat (VNTR) markers for 92 clinical strains of T. interdigitale. On the basis of an analysis of four VNTR markers, four to eight distinct alleles were detected for each marker. The marker with the highest discriminatory power had eight alleles and a D value of 0.802. The combination of all four markers yielded a D value of 0.969 with 29 distinct multilocus genotypes. VNTR typing revealed the genetic diversity of the strains, identifying three populations according to their colonization sites. A correlation between phenotypic characteristics and multilocus genotypes was observed. Seven patients harbored T. interdigitale strains with different genotypes. Typing of clinical T. interdigitale samples by VNTR markers displayed excellent discriminatory power and 100% reproducibility. PMID:24989614
[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].
Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang
2015-09-01
To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.
Nishimura, Yasumitsu; Hosokawa, Tomohide; Hosono, Masamichi; Baba, Mitsuo; Hosokawa, Masanori
2002-01-01
We examined the proliferative and cytokine-producing activities of CD4+ T cells from young mice of the senescence-accelerated mouse strain SAMP1, which had shown markedly low T-dependent antibody-producing responses. When splenic T cells were cultured with concanavalin A (Con A), the percentage of CD4+ cells decreased earlier in SAMP1 than in C3H/He mice. At 40 hr of culture, the percentage of BrdU-labelled proliferating CD4+ cells increased strongly in C3H/He, but only slightly in SAMP1. When purified CD4+ T cells were cultured with Con A, the percentage of 5-bromo-2′-deoxyuridine (BrdU)-labelled cells peaked at around 48 hr of culture in both strains, but decreased significantly at 64 hr in SAMP1. The production of interleukin (IL)-2 but not IL-4 or interferon-γ (IFN-γ) was significantly lower in SAMP1 than in C3H/He at 48 hr of culture. IL-2 production was also markedly low in SAMP1, even under the stimulation of anti-CD3 with anti-CD28 antibodies. The frequency of cells producing IL-2 was significantly lower in SAMP1 than in C3H/He at 6–24 hr of culture with Con A. The percentage of annexin-positive and propidium iodide (PI)-negative apoptotic cells was significantly higher in SAMP1 than in C3H/He at 96 hr of culture. Exogenous IL-2 prevented the decrease in BrdU-labelled cells and the increase in apoptotic cells in the SAMP1 cell culture. These results indicate that SAMP1 CD4+ T cells cannot produce IL-2 at levels sufficient to support cell proliferation and survival. This may account for the weak T-dependent antibody response in SAMP1 mice. PMID:12383198
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
A real-time camera calibration system based on OpenCV
NASA Astrophysics Data System (ADS)
Zhang, Hui; Wang, Hua; Guo, Huinan; Ren, Long; Zhou, Zuofeng
2015-07-01
Camera calibration is one of the essential steps in the computer vision research. This paper describes a real-time OpenCV based camera calibration system, and developed and implemented in the VS2008 environment. Experimental results prove that the system to achieve a simple and fast camera calibration, compared with MATLAB, higher precision and does not need manual intervention, and can be widely used in various computer vision system.
CV-990 Landing Systems Research Aircraft (LSRA) during Space Shuttle tire test
1995-08-02
A NASA CV-990, modified as a Landing Systems Research Aircraft (LSRA), lands on the Edwards AFB main runway in test of the space shuttle landing gear system. In this case, the shuttle tire failed, bursting into flame during the rollout. The space shuttle landing gear test unit, operated by a high-pressure hydraulic system, allowed engineers to assess and document the performance of space shuttle main and nose landing gear systems, tires and wheel assemblies, plus braking and nose wheel steering performance. The series of 155 test missions for the space shuttle program provided extensive data about the life and endurance of the shuttle tire systems and helped raise the shuttle crosswind landing limits at Kennedy. The CV-990 used as the LSRA was built in 1962 by the Convair Division of General Dynamics Corp., Ft. Worth, Texas, served as a research aircraft at Ames Research Center, Moffett Field, California, before it came to Dryden.
CV2/CRMP5-antibody-related Paraneoplastic Optic Neuropathy Associated with Small-cell Lung Cancer.
Nakajima, Masanori; Uchibori, Ayumi; Ogawa, Yuki; Miyazaki, Tai; Ichikawa, Yaeko; Kaneko, Kimihiko; Takahashi, Toshiyuki; Nakashima, Ichiro; Shiraishi, Hirokazu; Motomura, Masakatsu; Chiba, Atsuro
2018-06-01
A 61-year-old woman who had smoked for 41 years developed subacute dizziness, ataxic gait, opsoclonus, and right visual impairment. She had right optic disc swelling and optic nerve gadolinium enhancement on magnetic resonance imaging. She had small-cell lung cancer (SCLC), with CV2/collapsin response mediator protein (CRMP) 5 and HuD antibodies in her serum and cerebrospinal fluid. She was diagnosed with paraneoplastic optic neuropathy (PON) accompanied by paraneoplastic opsoclonus-ataxia syndrome. Her symptoms improved after removing the SCLC. Classical PON is rare in Japan. We recommend assaying for CV2/CRMP5 antibodies and searching for cancer in elderly patients with subacute painless visual impairment.
Kim, Hyun-Sook; Park, Hyunjin; Cho, In-Young; Paik, Hyun-Dong; Park, Eunju
2006-01-01
A probiotic is a viable microbial dietary supplement that has beneficial effects such as prevention and treatment of specific gastrointestinal disorders, including counteracting gut barrier dysfunction associated with inflammation and infection. Probiotic Bacillus polyfermenticus, which is commonly called Bispan strain, has been appropriately used for the treatment of long-term intestinal disorders. The use of B. polyfermenticus for immune-related chronic intestinal disease may be appropriate considering that about 80% of the body's immune system is localized in the gastrointestinal tract. The current study aimed to evaluate the effect of probiotic B. polyfermenticus on the immune response of human subjects through the quantification of immune cell population and serum levels of immunoglobulins (Igs). Twenty-five male subjects, 20-35 years of age, were randomly assigned to either a control group (n =12) supplemented with a placebo or the experimental group (n = 13) supplemented with B. polyfermenticus tablets at a dose of 3.1 x 10(8) colony-forming units/day for 8 weeks. Dietary intake analyses from 3-day dietary records from three consecutive days including one weekend day and two weekdays revealed no significant differences in total energy and nutrient intakes between the two groups. The humoral immune response was monitored by the number of total B lymphocytes and serum concentrations of IgG, IgA, and IgM. To investigate the changes in immune cell populations, percentages of total T lymphocytes, CD4+ helper T cells, CD8+ cytotoxic T cells, and CD56+ natural killer (NK) cells were quantified. The concentration of IgG in the experimental group was 12% higher than in the placebo group after 8 weeks of Bispan supplementation. Also, the percentages of CD4+ helper T cells, CD8+cytotoxic T cells, and CD56+ NK cells in the Bispan strain-supplemented group were 32%, 28%, and 35% higher, respectively, compared with the control group. Because of a higher increment of the
Cottingham, Matthew G; van Maurik, Andre; Zago, Manola; Newton, Angela T; Anderson, Richard J; Howard, M Keith; Schneider, Jörg; Skinner, Michael A
2006-07-01
The FP9 strain of F has been described as a more immunogenic recombinant vaccine vector than the Webster FPV-M (FPW) strain (R. J. Anderson et al., J. Immunol. 172:3094-3100, 2004). This study expands the comparison to include two separate recombinant antigens and multiple, rather than single, independent viral clones derived from the two strains. Dual-poxvirus heterologous prime-boost vaccination regimens using individual clones of recombinant FP9 or FPW in combination with recombinant modified V Ankara expressing the same antigen were evaluated for their ability to elicit T-cell responses against recombinant antigens from Plasmodium berghei (circumsporozoite protein) or human immunodeficiency virus type 1 (a Gag-Pol-Nef fusion protein). Gamma interferon enzyme-linked immunospot assay and fluorescence-activated cell sorting assays of the responses to specific epitopes confirmed the approximately twofold-greater cellular immunogenicity of FP9 compared to FPW, when given as the priming or boosting immunization. Equality of transgene expression in mouse cells infected with the two strains in vitro was verified by Western blotting. Directed partial sequence analysis and PCR analysis of FPW and comparison to available whole-genome sequences revealed that many loci that are mutated in the highly attenuated and culture-adapted FP9 strain are wild type in FPW, including the seven multikilobase deletions. These "passage-specific" alterations are hypothesized to be involved in determining the immunogenicity of fowlpox virus as a recombinant vaccine vector.
Dewe, Joshua M; Whipple, Joseph M; Chernyakov, Irina; Jaramillo, Laura N; Phizicky, Eric M
2012-10-01
The structural and functional integrity of tRNA is crucial for translation. In the yeast Saccharomyces cerevisiae, certain aberrant pre-tRNA species are subject to nuclear surveillance, leading to 3' exonucleolytic degradation, and certain mature tRNA species are subject to rapid tRNA decay (RTD) if they are appropriately hypomodified or bear specific destabilizing mutations, leading to 5'-3' exonucleolytic degradation by Rat1 and Xrn1. Thus, trm8-Δ trm4-Δ strains are temperature sensitive due to lack of m(7)G(46) and m(5)C and the consequent RTD of tRNA(Val(AAC)), and tan1-Δ trm44-Δ strains are temperature sensitive due to lack of ac(4)C(12) and Um(44) and the consequent RTD of tRNA(Ser(CGA)) and tRNA(Ser(UGA)). It is unknown how the RTD pathway interacts with translation and other cellular processes, and how generally this pathway acts on hypomodified tRNAs. We provide evidence here that elongation factor 1A (EF-1A) competes with the RTD pathway for substrate tRNAs, since its overexpression suppresses the tRNA degradation and the growth defect of strains subject to RTD, whereas reduced levels of EF-1A have the opposite effect. We also provide evidence that RTD acts on a variety of tRNAs lacking one or more different modifications, since trm1-Δ trm4-Δ mutants are subject to RTD of tRNA(Ser(CGA)) and tRNA(Ser(UGA)) due to lack of m(2,2)G(26) and m(5)C, and since trm8-Δ, tan1-Δ, and trm1-Δ single mutants are each subject to RTD. These results demonstrate that RTD interacts with the translation machinery and acts widely on hypomodified tRNAs.
Berry, M J; Grieco, D; Taylor, B A; Maia, A L; Kieffer, J D; Beamer, W; Glover, E; Poland, A; Larsen, P R
1993-09-01
Inbred mouse strains differ in their capacity to deiodinate iododioxin and iodothyronines, with strains segregating into high or low activity groups. Metabolism of iododioxin occurs via the type I iodothyronine 5'deiodinase (5'DI), one of two enzymes that metabolize thyroxine (T4) to 3,5,3'-triiodothyronine (T3). Recombinant inbred strains derived from crosses between high and low activity strains exhibit segregation characteristic of a single allele difference. Hepatic and renal 5'DI mRNA in a high (C57BL/6J) and low (C3H/HeJ) strain paralleled enzyme activity and concentration, in agreement with a recent report. 5'DI-deficient mice had twofold higher serum free T4 but normal free T3 and thyrotropin. Brown adipose tissue 5'DII was invariant between the two strains. Southern analyses using a 5'DI probe identified a restriction fragment length variant that segregated with 5'DI activity in 33 of 35 recombinant inbred strains derived from four different pairs of high and low activity parental strains. Recombination frequencies using previously mapped loci allowed assignment of the 5'DI gene to mouse chromosome 4 and identified its approximate chromosomal position. We propose the symbol Dio1 to denote the mouse 5'DI gene. Conserved linkage between this segment of mouse chromosome 4 and human HSA1p predicts this location for human Dio1.
Riedel, Thomas; Spring, Stefan; Fiebig, Anne; Petersen, Jörn; Kyrpides, Nikos C; Göker, Markus; Klenk, Hans-Peter
2014-06-15
Salipiger mucosus Martínez-Cànovas et al. 2004 is the type species of the genus Salipiger, a moderately halophilic and exopolysaccharide-producing representative of the Roseobacter lineage within the alphaproteobacterial family Rhodobacteraceae. Members of this family were shown to be the most abundant bacteria especially in coastal and polar waters, but were also found in microbial mats and sediments. Here we describe the features of the S. mucosus strain DSM 16094(T) together with its genome sequence and annotation. The 5,689,389-bp genome sequence consists of one chromosome and several extrachromosomal elements. It contains 5,650 protein-coding genes and 95 RNA genes. The genome of S. mucosus DSM 16094(T) was sequenced as part of the activities of the Transregional Collaborative Research Center 51 (TRR51) funded by the German Research Foundation (DFG).
Genome sequence of Thalassospira profundimaris type strain WP0211.
Lai, Qiliang; Shao, Zongze
2012-12-01
Thalassospira profundimaris WP0211(T) was isolated from a pyrene-degrading consortium, enriched from deep-sea sediment collected from the West Pacific Ocean. Here, we present the draft genome of strain WP0211(T), which contains 4,380,232 bp with a G+C content of 55.19% and contains 4,040 protein-coding genes and 45 tRNAs.
CERES BiDirectional Scans (BDS) data in HDF (CER_BDS_Terra-FM1_Edition1-CV)
NASA Technical Reports Server (NTRS)
Wielicki, Bruce A. (Principal Investigator)
Each BiDirectional Scans (BDS) data product contains twenty-four hours of Level-1b data for each CERES scanner instrument mounted on each spacecraft. The BDS includes samples taken in normal and short Earth scan elevation profiles in both fixed and rotating azimuth scan modes (including space, internal calibration, and solar calibration views). The BDS contains Level-0 raw (unconverted) science and instrument data as well as the geolocated converted science and instrument data. The BDS contains additional data not found in the Level-0 input file, including converted satellite position and velocity data, celestial data, converted digital status data, and parameters used in the radiance count conversion equations. The following CERES BDS data sets are currently available: CER_BDS_TRMM-PFM_Edition1 CER_BDS_Terra-FM1_Edition1 CER_BDS_Terra-FM2_Edition1 CER_BDS_Terra-FM1_Edition2 CER_BDS_Terra-FM2_Edition2 CER_BDS_Aqua-FM3_Edition1 CER_BDS_Aqua-FM4_Edition1 CER_BDS_Aqua-FM3_Edition2 CER_BDS_Aqua-FM4_Edition2 CER_BDS_Aqua-FM3_Edition1-CV CER_BDS_Aqua-FM4_Edition1-CV CER_BDS_Terra-FM1_Edition1-CV CER_BDS_Terra-FM2_Edition1-CV. [Location=GLOBAL] [Temporal_Coverage: Start_Date=1997-12-27; Stop_Date=2006-11-02] [Spatial_Coverage: Southernmost_Latitude=-90; Northernmost_Latitude=90; Westernmost_Longitude=-180; Easternmost_Longitude=180] [Data_Resolution: Temporal_Resolution=1 day; Temporal_Resolution_Range=Daily - < Weekly].
Ivanova, Anastasia A.; Naumoff, Daniil G.; Miroshnikov, Kirill K.; Liesack, Werner; Dedysh, Svetlana N.
2017-01-01
The family Isosphaeraceae accommodates stalk-free planctomycetes with spherical cells, which can be assembled in short chains, long filaments, or aggregates. These bacteria inhabit a wide variety of terrestrial environments, among those the recently described Paludisphaera borealis PX4T that was isolated from acidic boreal wetlands. Here, we analyzed its finished genome in comparison to those of three other members of the Isosphaeraceae: Isosphaera pallida IS1BT, Singulisphaera acidiphila DSM 18658T, and the uncharacterized planctomycete strain SH-PL62. The complete genome of P. borealis PX4T consists of a 7.5 Mb chromosome and two plasmids, 112 and 43 kb in size. Annotation of the genome sequence revealed 5802 potential protein-coding genes of which 2775 could be functionally assigned. The genes encoding metabolic pathways common for chemo-organotrophic bacteria, such as glycolysis, citrate cycle, pentose-phosphate pathway, and oxidative phosphorylation were identified. Several genes involved in the synthesis of peptidoglycan as well as N-methylated ornithine lipids were present in the genome of P. borealis PX4T. A total of 26 giant genes with a size >5 kb were detected. The genome encodes a wide repertoire of carbohydrate-active enzymes (CAZymes) including 44 glycoside hydrolases (GH) and 83 glycosyltransferases (GT) affiliated with 21 and 13 CAZy families, respectively. The most-represented families are GH5, GH13, GH57, GT2, GT4, and GT83. The experimentally determined carbohydrate utilization pattern agrees well with the genome-predicted capabilities. The CAZyme repertoire in P. borealis PX4T is highly similar to that in the uncharacterized planctomycete SH-PL62 and S. acidiphila DSM 18658T, but different to that in the thermophile I. pallida IS1BT. The latter strain has a strongly reduced CAZyme content. In P. borealis PX4T, many of its CAZyme genes are organized in clusters. Contrary to most other members of the order Planctomycetales, all four analyzed
Draft Genome Sequence of Lactobacillus pobuzihii E100301T.
Chiu, Chi-Ming; Chang, Chi-Huan; Pan, Shwu-Fen; Wu, Hui-Chung; Li, Shiao-Wen; Chang, Chuan-Hsiung; Lee, Yun-Shien; Chiang, Chih-Ming; Chen, Yi-Sheng
2013-05-09
Lactobacillus pobuzihii E100301(T) is a novel Lactobacillus species previously isolated from pobuzihi (fermented cummingcordia) in Taiwan. Phylogenetically, this strain is closest to Lactobacillus acidipiscis, but its phenotypic characteristics can be clearly distinguished from those of L. acidipiscis. We present the draft genome sequence of strain L. pobuzihii E100301(T).
Thaiwong, T; Wise, A G; Maes, R K; Mullaney, T; Kiupel, M
2016-11-01
Recurrent outbreaks of sudden death and bloody diarrhea were reported in March 2013 and February 2014 in a breeding colony of Papillon dogs. During the first outbreak, 1 adult dog and 2 eight-month-old puppies died. During the second outbreak, 2 ten-week-old puppies died. One puppy from the first outbreak and 2 puppies from the second outbreak were examined at necropsy. Histologically, all 3 puppies had severe segmental crypt necrosis of the small intestine and marked lymphoid follicle depletion in the spleen and Peyer's patches. Real-time (RT) polymerase chain reaction (PCR) demonstrated abundant canine parvovirus (CPV-2) DNA (Ct<15) in the affected small intestine, and immunohistochemistry detected large amounts of CPV-2 antigen in intestinal crypt epithelium and Kupffer cells but few positive macrophages in lymphoid organs. All puppies had marked sinusoidal histiocytosis and multifocal granulomatous inflammation in mesenteric lymph nodes and spleen, prompting additional RT-PCR testing for canine circovirus 1 (CaCV-1). Very high levels of CaCV-1 DNA (Ct<13) were detected in small intestine, lymph nodes, and spleen. In situ hybridization for CaCV-1 detected rare positive nuclei of regenerating crypt epithelium but abundant amounts of CaCV-1 nucleic acid in the cytoplasm and nuclei of histiocytes in all lymphoid tissues, including granulomatous inflammatory foci and hepatic Kupffer cells. Significant levels of CaCV-1 DNA were detected in blood and serum (Ct as low as 13) but not feces from 3 surviving dogs at 2 months or 1 year after the outbreak, respectively. We hypothesize that CPV-2 infection predisposed dogs to CaCV-1 infection and ultimately resulted in more severe clinical disease. © The Author(s) 2016.
Odusanya, Olumuyiwa O; Kuyinu, Yetunde A; Kehinde, Omolara A; Shafi, Fakrudeen; François, Nancy; Yarzabal, Juan Pablo; Dobbelaere, Kurt; Rüggeberg, Jens U; Borys, Dorota; Schuerman, Lode
2014-01-01
In a previous study, 3-dose primary vaccination of Nigerian infants with the 10-valent pneumococcal nontypeable Haemophilus influenzae protein D conjugate vaccine (PHiD-CV) was immunogenic for vaccine pneumococcal serotypes, with comparable tolerability between PHiD-CV and control groups. In an open-label study (ClinicalTrials.gov, NCT01153893), 68 primed children received a PHiD-CV booster dose co-administered with a diphtheria-tetanus-acellular pertussis (DTPa) booster dose at 15–21 months and 36 children unprimed for pneumococcal vaccination received two PHiD-CV catch-up doses (first dose co-administered with DTPa booster dose) at 15–21 and 17–23 months. Adverse events were recorded and immune responses were measured before and one month after vaccination. In both groups, pain was the most frequent solicited local symptom and fever was the most frequent solicited general symptom after the booster dose and each catch-up dose. Few grade 3 solicited symptoms and no vaccine-related serious adverse events were reported. After booster vaccination, for each vaccine serotype, at least 98.5% of children had an antibody concentration ≥0.2 µg/ml and at least 94.0% had an opsonophagocytic activity (OPA) titer ≥8. After 2-dose catch-up, for each vaccine serotype, at least 97.1% had an antibody concentration ≥0.2 µg/ml, except for serotypes 6B (82.9%) and 23F (88.6%), and at least 91.4% had an OPA titer ≥8, except for serotypes 6B (77.4%) and 19F (85.3%). PHiD-CV induced antibody responses against protein D in both groups. In conclusion, PHiD-CV administered to Nigerian toddlers as a booster dose or 2-dose catch-up was well tolerated and immunogenic for vaccine pneumococcal serotypes and protein D. PMID:24356787
Tokuyama, Tatsuaki; Mine, Atsusi; Kamiyama, Kaoru; Yabe, Ryuichi; Satoh, Kazuo; Matsumoto, Hirotoshi; Takahashi, Reiji; Itonaga, Koji
2004-01-01
An ammonia-oxidizing bacterium (strain YNSRA) was isolated from the rhizoplane of the reed (Phragmites communis) used in an aquaponics plant which is a wastewater treatment plant. Strain YNSRA was identified as Nitrosomonas communis by taxonomic studies. The hydroxylamine-cytochrome c reductase (HCR) of strain YNSRA was found to have a higher activity (25.60 u/mg) than that of Nitrosomonas europaea ATCC25978T (8.94 u/mg). Ribulose-1,5-bisphosphate carboxylase (RubisCO) activity was detected at very low levels in strain YNSRA, whereas strain ATCC25978T had definite activity.
Cui, Zhisong; Shao, Zongze
2009-07-01
In order to identify the predominant strains of polycyclic aromatic hydrocarbon (PAH)-degrading consortia harboring in sea water and surface sediment collected from deep sea of the Middle Atlantic Ridge. We employed enrichment method and spread-plate method to isolate cultivable bacteria and PAHs degraders from deep sea samples. Phylogenetic analysis was conducted by 16S rRNA gene sequencing of the bacteria. Then we analyzed the dominant bacteria in the PAHs-degrading consortia by denaturing gradient gel electrophoresis (DGGE) combined with DNA sequencing. Altogether 16 cultivable bacteria were obtained, including one PAHs degrader Novosphingobium sp. 4D. Phylogenetic analysis showed that strains closely related to Alcanivorax dieselolei NO1A (5/16) and Tistrella mobilis TISTR 1108T (5/16) constituted two biggest groups among the cultivable bacteria. DGGE analysis showed that strain 4L (also 4M and 4N, Alcanivorax dieselolei NO1A, 99.21%), 4D (Novosphingobium pentaromativorans US6-1(T), 97.07%) and 4B (also 4E, 4H and 4K, Tistrella mobilis TISTR 1108T, > 99%) dominated the consortium MC2D. While in consortium MC3CO, the predominant strains were strain 5C (also 5H, Alcanivorax dieselolei NO1A, > 99%), uncultivable strain represented by band 5-8 (Novosphingobium aromaticivorans DSM 12444T, 99.41%), 5J (Tistrella mobilis TISTR 1108T, 99.52%) and 5F (also 5G, Thalassospira lucentensis DSM 14000T, < 97%). We found that strains of genus Alcanivorax, Novosphingobium, Tistrella and Thalassospira were predominant bacteria of PAHs-degrading consortia in sea water and surface sediment of Middle Atlantic Ridge deep sea, with Novosphingobium spp. as their main PAHs degraders.
Draft Genome Sequence of Lactobacillus pobuzihii E100301T
Chiu, Chi-ming; Chang, Chi-huan; Pan, Shwu-fen; Wu, Hui-chung; Li, Shiao-wen; Chang, Chuan-hsiung; Lee, Yun-shien; Chiang, Chih-ming
2013-01-01
Lactobacillus pobuzihii E100301T is a novel Lactobacillus species previously isolated from pobuzihi (fermented cummingcordia) in Taiwan. Phylogenetically, this strain is closest to Lactobacillus acidipiscis, but its phenotypic characteristics can be clearly distinguished from those of L. acidipiscis. We present the draft genome sequence of strain L. pobuzihii E100301T. PMID:23661478
Nautiyal, C. S.; Hegde, S. V.; van Berkum, P.
1988-01-01
The pigeon pea strains of Bradyrhizobium CC-1, CC-8, UASGR(S), and F4 were evaluated for nodulation, effectiveness for N2 fixation, and H2 oxidation with homologous and nonhomologous host plants. Strain CC-1 nodulated Macroptilium atropurpureum, Vigna unguiculata, Glycine max, and G. soja but did not nodulate Pisum sativum, Phaseolus vulgaris, Trigonella foenum-graecum, and Trifolium repens. Strain F4 nodulated G. max cv. Peking and PI 434937 (Malayan), but the symbioses formed were poor. Similarly, G. max cv. Peking, cv. Bragg, PI 434937, PR 13-28-2-8-7, and HM-1 were nodulated by strain CC-1, and symbioses were also poor. G. max cv. Williams and cv. Clark were not nodulated. H2 uptake activity was expressed with pigeon pea and cowpea, but not with soybean. G. max cv. Bragg grown in Bangalore, India, in local soil not previously exposed to Bradyrhizobium japonicum formed nodules with indigenous Bradyrhizobium spp. Six randomly chosen isolates, each originating from a different nodule, formed effective symbioses with pigeon pea host ICPL-407, nodulated PR 13-28-2-8-7 soybean forming moderately effective symbioses, and did not nodulate Williams soybean. These results indicate the six isolates to be pigeon pea strains although they originated from soybean nodules. Host-determined nodulation of soybean by pigeon pea Bradyrhizobium spp. may depend upon the ancestral backgrounds of the cultivars. The poor symbioses formed by the pigeon pea strains with soybean indicate that this crop should be inoculated with B. japonicum for its cultivation in soils containing only pigeon pea Bradyrhizobium spp. PMID:16347542
Local magnetic fields, uplift, gravity, and dilational strain changes in Southern California ( USA).
Johnston, M.J.S.
1986-01-01
Measurements of regional magnetic field near the San Andreas fault at Cajon, Palmdale and Tejon are strongly correlated with changes in gravity, areal strain, and uplift in these regions during the period 1977-1984. Because the inferred relationships between these parameters are in approximate agreement with those obtained from simple deformation models, the preferred explanation appeals to short-term strain episodes independently detected in each data set. Transfer functions from magnetic to strain, gravity, and uplift perturbations, obtained by least-square linear fits to the data, are -0.98 nT/ppm, -0.03 nT/mu Gal, and 9.1 nT/m respectively. Tectonomagnetic model calculations underestimate the observed changes and those reported previously for dam loading and volcano-magnetic observations. A less likely alternative explanation of the observed data appeals to a common source of meteorologically generated crustal or instrumental noise in the strain, gravity, magnetic, and uplift data.-from Author
NASA/ESA CV-990 spacelab simulation
NASA Technical Reports Server (NTRS)
1975-01-01
Due to interest in the application of simplified techniques used to conduct airborne science missions at NASA's Ames Research Center, a joint NASA/ESA endeavor was established to conduct an extensive Spacelab simulation using the NASA CV-990 airborne laboratory. The scientific payload was selected to perform studies in upper atmospheric physics and infrared astronomy with principal investigators from France, the Netherlands, England, and several groups from the United States. Communication links between the 'Spacelab' and a ground based mission operations center were limited consistent with Spacelab plans. The mission was successful and provided extensive data relevant to Spacelab objectives on overall management of a complex international payload; experiment preparation, testing, and integration; training for proxy operation in space; data handling; multiexperimenter use of common experimenter facilities (telescopes); multiexperiment operation by experiment operators; selection criteria for Spacelab experiment operators; and schedule requirements to prepare for such a Spacelab mission.
Wang, Xiao Jun; Saha, Ashwini; Zhang, Xu-Hao
2017-01-01
Currently, two pediatric pneumococcal conjugate vaccines are available in the private market of Malaysia-13-valent pneumococcal conjugate vaccine (PCV13) and pneumococcal polysaccharide and non-typeable Haemophilus influenzae protein D conjugate vaccine (PHiD-CV). This study aimed to evaluate the cost-effectiveness of a universal mass vaccination program with a PHiD-CV 2+1 schedule versus no vaccination or with a PCV13 2+1 schedule in Malaysia. A published Markov cohort model was adapted to evaluate the epidemiological and economic consequences of programs with no vaccination, a PHiD-CV 2+1 schedule or a PCV13 2+1 schedule over a 10-year time horizon. Disease cases, deaths, direct medical costs, quality-adjusted life-years (QALYs) and incremental cost-effectiveness ratios (ICERs) were estimated. Locally published epidemiology and cost data were used whenever possible. Vaccine effectiveness and disutility data were based on the best available published data. All data inputs and assumptions were validated by local clinical and health economics experts. Analyses were conducted from the perspective of the Malaysian government for a birth cohort of 508,774. Costs and QALYs were discounted at 3% per annum. One-way and probabilistic sensitivity analyses were performed. Compared with no vaccination, a PHiD-CV 2+1 program was projected to prevent 1109 invasive pneumococcal disease (IPD), 24,679 pneumonia and 72,940 acute otitis media (AOM) cases and 103 IPD/pneumonia deaths over 10 years, with additional costs and QALYs of United States dollars (USD) 30.9 million and 1084 QALYs, respectively, at an ICER of USD 28,497/QALY. Compared with a PCV13 2+1 program, PHiD-CV 2+1 was projected to result in similar reductions in IPD cases (40 cases more) but significantly fewer AOM cases (30,001 cases less), with cost savings and additional QALYs gained of USD 5.2 million and 116 QALYs, respectively, demonstrating dominance over PCV13. Results were robust to variations in one-way and
N'tcha, Christine; Sina, Haziz; Kayodé, Adéchola Pierre Polycarpe; Gbenou, Joachim D; Baba-Moussa, Lamine
2017-01-01
The aim of this study was to investigate the antibacterial effect of the crude starter " kpètè-kpètè " and lactic acid bacteria used during the production of "tchoukoutou." To achieve this, a total of 11 lactic acid bacteria and 40 starter samples were collected from four communes. The samples were tested on 29 gram + and - strains by disk diffusion method. The minimum inhibitory and bactericidal concentrations of starter and lactic acid bacteria were determined by conventional methods. Organic acids, sugar, and volatile compounds were determined using the HPLC method. The "kpètè-kpètè" displays a high antibacterial activity against the tested strains. The most sensitive strain was S. epidermidis (12.5 mm) whereas the resistance strain was Proteus mirabilis (8 mm). All the tested ferment has not any inhibitory effect on Enterococcus faecalis . The lactic acid bacteria isolates of Parakou showed the highest (17.48 mm) antibacterial activity whereas the smallest diameter was obtained with the ferment collected from Boukoumbé (9.80 mm). The starters' chemical screening revealed the presence of tannins, anthocyanin flavonoids, triterpenes, steroids, reducing compounds, and mucilage O-glycosides. These compounds are probably the source of recorded inhibition effect. The lactic acid bacteria of the "kpètè-kpètè" could be used to develop a food ingredient with probiotic property.
High Temperature - Thin Film Strain Gages Based on Alloys of Indium Tin Oxide
NASA Technical Reports Server (NTRS)
Gregory, Otto J.; Cooke, James D.; Bienkiewicz, Joseph M.
1998-01-01
A stable, high temperature strain gage based on reactively sputtered indium tin oxide (ITO) was demonstrated at temperatures up to 1050 C. These strain sensors exhibited relatively large, negative gage factors at room temperature and their piezoresistive response was both linear and reproducible when strained up to 700 micro-in/in. When cycled between compression and tension, these sensors also showed very little hysteresis, indicating excellent mechanical stability. Thin film strain gages based on selected ITO alloys withstood more than 50,000 strain cycles of +/- 500 micro-in/in during 180 hours of testing in air at 1000 C, with minimal drift at temperature. Drift rates as low as 0.0009%/hr at 1000 C were observed for ITO films that were annealed in nitrogen at 700 C prior to strain testing. These results compare favorably with state of the art 10 micro-m thick PdCr films deposited by NASA, where drift rates of 0.047%/hr at 1050 C were observed. Nitrogen annealing not only produced the lowest drift rates to date, but also produce the largest dynamic gage factors (G = 23.5). These wide bandgap, semiconductor strain sensors also exhibited moderately low temperature coefficients of resistance (TCR) at temperatures up to 1100 C, when tested in a nitrogen ambient. A TCR of +230 ppm/C over the temperature range 200 C < T < 500 C and a TCR of -469 ppm/C over the temperature range 600 C < T < 1100 C was observed for the films tested in nitrogen. However, the resistivity behavior changed considerably when the same films were tested in oxygen ambients. A TCR of -1560 ppm/C was obtained over the temperature range of 200 C < T < 1100 C. When similar films were protected with an overcoat or when ITO films were prepared with higher oxygen contents in the plasma, two distinct TCR's were observed. At T < 800 C, a linear TCR of -210 ppm/C was observed and at T > 800 C, a linear TCR of -2170 DDm/C was observed. The combination of a moderately low TCR and a relatively large gage
Genome Sequence of Thalassospira profundimaris Type Strain WP0211
Lai, Qiliang
2012-01-01
Thalassospira profundimaris WP0211T was isolated from a pyrene-degrading consortium, enriched from deep-sea sediment collected from the West Pacific Ocean. Here, we present the draft genome of strain WP0211T, which contains 4,380,232 bp with a G+C content of 55.19% and contains 4,040 protein-coding genes and 45 tRNAs. PMID:23209215
Hatvani, Lóránt; Manczinger, László; Kredics, László; Szekeres, András; Antal, Zsuzsanna; Vágvölgyi, Csaba
2006-01-01
The sensitivity of two cold-tolerant Trichoderma strains belonging to the species T. harzianum and T. atroviride was determined to a series of pesticides widely used in agriculture. From the 16 pesticides tested, seven fungicides: copper sulfate, carbendazim, mancozeb, tebuconazole, imazalil, captan and thiram inhibited colony growth of the test strains significantly with minimal inhibitory concentrations of 300, 0.4, 50, 100, 100, 100 and 50 microg/ml, respectively. Mutants resistant to carbendazim and tebuconazole were produced from both wild type strains by means of UV-mutagenesis. The cross-resistance capabilities and in vitro antagonistic properties of the mutants were determined. Carbendazim-resistant mutants showed total cross-resistance to benomyl and thiabendazole at a concentration of 20 microg/ml. Intraspecific protoplast fusion was carried out between carbendazim- and tebuconazole-resistant mutants of both parental strains, and putative haploid recombinants with stable resistance to both pesticides were produced in the case of T. atroviride. These pesticide-polyresistant progenies are potential candidates for application in an integrated pest management system.
Complete genome sequence of the hippuricase-positive Campylobacter avium type strain LMG 24591
USDA-ARS?s Scientific Manuscript database
Campylobacter avium is a hippurate-positive, thermotolerant campylobacter that has been isolated from poultry. Here we present the genome sequences of two C. avium strains isolated from broiler chickens: strains LMG 24591T (complete genome) and LMG 24592 (draft genome). The C. avium type strain geno...
Gamete ripening and hormonal correlates in three strains of lake trout
Foster, N.R.; O'Connor, D.V.; Schreck, C.B.
1993-01-01
In our 2-year laboratory study of hatchery-reared adult lake trout Salvelinus namaycush of the Seneca Lake, Marquette (Lake Superior Lean), and Jenny Lake strains, we compared gamete ripening times and changes in plasma concentrations of seven hormones. If interstrain differences in these traits were found, such differences might help explain the apparent failure of stocked fish of these strains to develop large, naturally reproducing populations in the Great Lakes. The complex temporal changes in plasma hormone levels that occur during sexual maturation in lake trout have not been previously described. We detected little evidence of temporal isolation that would prevent interbreeding among the three strains. Strain had no effect on ovulation date (OD) in either year. Strain did not affect spermiation onset date (SOD) in year 1 but did in year 2, when the mean SOD of Jenny Lake males was earlier than that of Seneca Lake males but not different from that of Marquette males. Hormonal data were normalized around ODs for individual females and SODs for individual males. In females, estradiol-17β (E2) was highest 8 weeks before the OD; the highest testosterone (T) level occurred 6 weeks before the OD, and the next highest level occurred simultaneously with the highest level of 11-ketotestosterone (11-KT) 2 weeks before the OD. Plasma levels of 17∝-hydroxy-20β-dihydroprogesterone (DHP) peaked 1 week before the OD, then abruptly declined immediately after. Cortisol (F), triiodothyronine (T3), and thyroxine (T4) were highly variable, but F was the only hormone that showed no trend with week in either year. In males, plasma E2 levels were highest 3 weeks before the SOD, highest levels of T and of 11-KT occurred simultaneously 2 weeks after the SOD, and DHP peaked 5 weeks after the SOD and 3 weeks after the highest levels of T and 11-KT. As in females, plasma levels of F, T3, and T4 were highly variable, and F was the only hormone that showed no trend with week in
Bulbovas, Patricia; Camargo, Carla Z S; Domingos, Marisa
2015-08-01
The risks posed by nutrient deposition due to air pollution on ecosystems and their respective services to human beings can be appropriately estimated by bioindicator plants when they are well acclimated to the study region environmental conditions. This assumption encouraged us to comparatively evaluate the accumulation potential of ryegrass cv. Lema and guava cv. Paluma macro and micronutrients. We also indicated the most appropriate species for biomonitoring nutrient contamination risks in tropical areas of Southeastern Brazil, which are characterized by marked dry and wet seasons and complex mixtures of air pollutants from different sources (industries, vehicle traffic and agriculture). The study was conducted in 14 sites with different neighboring land uses, within the Metropolitan Region of Campinas, central-eastern region of São Paulo State. The exposure experiments with ryegrass and guava were consecutively repeated 40 (28 days each) and 12 (84 days each) times, respectively, from Oct/2010 to Sept/2013. Macro and micronutrients were analyzed and background concentrations and enrichment ratios (ER) were estimated to classify the contamination risk within the study region. Significantly higher ER suggested that ryegrass were the most appropriate accumulator species for N, S, Mg, Fe, Mn, Cu and Zn deposition and guava for K, Ca, P and B deposition. Based on these biomonitoring adjustments, we concluded that the nutrient deposition was spatially homogeneous in the study area, but clear seasonality in the contamination risk by nutritional inputs was evidenced. Significantly higher contamination risk by S, Fe, K and B occurred during the dry season and enhanced contamination risk by Mn, Cu and Zn were highlighted during the wet season. Distinctly high contamination risk was estimated for S, Fe and Mn in several exposure experiments. Copyright © 2015 Elsevier Inc. All rights reserved.
Canonico, Laura; Comitini, Francesca; Ciani, Maurizio
2017-10-16
In recent years, there has been growing demand for distinctive high quality beer. Fermentation management has a fundamental role in beer quality and the levels of aroma compounds. Use of non-conventional yeast has been proposed to enhance beer bioflavor. In the present work we investigated mixed fermentations using three commercial Saccharomyces cerevisiae strains, without and with addition of a selected Torulaspora delbrueckii strain evaluating their interactions, as well as the aroma profiles. At the S. cerevisiae/T. delbrueckii co-inoculation ratio of 1:20, viable cell counts indicated that T. delbrueckii dominated all of the three combinations. In the mixed fermentations, T. delbrueckii provided higher levels of higher alcohols (excepting of β-phenyl ethanol), in contrast to data obtained in winemaking, where higher alcohols had lower levels. Moreover, mixed fermentations showed significantly higher ethyl acetate (from 5 to 16mg/L) and isoamyl acetate (from 0.019 to 0.128mg/L), and were generally lower in ethyl hexanoate and ethyl octanoate. Therefore, irrespective of S. cerevisiae strain, T. delbrueckii influenced on all mixed fermentations. On the other hand, the mixed fermentations were also affected by each of the three S. cerevisiae strains, which resulted in beers with distinctive flavors. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Yi-Guang; Li, Wen-Jun; Cui, Xiao-Long; Jiang, Cheng-Lin; Xu, Li-Hua
2006-10-01
One facultative alkaliphilic actinomycete strain YIM 90022 was isolated from hypersaline alkaline soil in Qinghai province, China. An almost-complete 16S rRNA gene sequence (1500 bp) for strain YIM 90022 was obtained. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 90022 was closely related to four members of the genus Nocardiopsis with 16S rRNA gene sequence similarity values of 98.8% (N. exhalans DSM 44407T), 98.5% (N. prasina DSM 43845T), 98.4% (N. metallicus DSM 44598T) and 97.8% (N. listeri DSM 40297T), but represented a distinct phylogenetic lineage. Repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting was evaluated on strain YIM 90022 and its closest relatives to investigate their genetic relatedness. The analysis of the rep-PCR genomic fingerprints showed that strain YIM 90022 was distinguishable from its closest relatives. The polyphasic taxonomic data presented in this study, including its morphology, physiological and biochemical characteristics, chemotaxonomy, 16S rRNA gene sequence-based phylogenetic analysis and rep-PCR genomic fingerprinting, supported the view that strain YIM 90022 represented a potential new species of the genus Nocardiopsis. The fermentation broth of strain YIM 90022 strongly inhibited growth of cell series of gastric cancer, lung cancer, mammary cancer, melanoma cancer, renal cancer and uterus cancer. Strain YIM 90022 grew well on most tested media, producing exuberant vegetative hyphae and aerial hyphae. The vegetative hyphae are long and fragmented. Light yellow to deep brown diffusible pigments were produced on ISP 2, ISP 3 and ISP 6. Growth of the strain occurred in the pH range 6.0-12.0, with optimal pH8.5. The NaCl tolerate range was 0-15% (W/V). Cell walls contain meso-diaminopimelic acid and have no diagnostic sugars. Polar lipids are phosphatidylcholine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmethylethanolamine. Major menaquinones are MK-10 (H4, H6). The
High-Redundancy Draft Sequencing of 15 Clinical and Environmental Burkholderia Strains
2010-12-01
Environmental Burkholderia Strains 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f...Environmental Burkholderia Strains v Sanghamitra Mukhopadhyay, 1t Maureen K. Thomason, 1t Shannon Lentz, 1 Nichok Nolan, 1 Kristin Willner, 1§ Jay E. Gee...PathWest Laboratory Medicine WA, Ned/and~, WA 6009, Australia:< Received 20 Au~,rust 2010/Accepted 30 August 2010 The Gram-negative Burkholderia genus
First-principles study of strain-induced ferromagnetism in LaCoO3
NASA Astrophysics Data System (ADS)
Seo, Hosung; Demkov, Alexander
2011-03-01
We study theoretically the effect of biaxial strain on magnetic properties of LaCo O3 (LCO) using density functional theory combined with the Hubbard U method. LCO is normally a non-magnetic insulator with trivalent cobalt ions in low-spin state (t 2g 6) . Owing to close interplay between orbital, spin, and lattice degrees of freedom, it shows rich magnetic behavior such as temperature-induced spin state transition. Recently, the ferromagnetic tensile-strained LCO films have been reported. The underlying physics of the ferromagnetic state is, however, unclear. Using a large tetragonal cell we calculate full structural response of the system to applied strain for non-magnetic and magnetic solutions. We show that beyond tensile strain of 3.8% the ferromagnetic solution with Co ions in intermediate-spin state (t 2g 5 e g 1) is stabilized accompanied by partial untilting of Co O6 octahedral network. We also perform the calculation for compressive-strained structures and the difference between these and the tensile strained structures will be presented.
Exploring the SDSS Data Set with Linked Scatter Plots. I. EMP, CEMP, and CV Stars
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbon, Duane F.; Henze, Christopher; Nelson, Bron C., E-mail: Duane.F.Carbon@nasa.gov
We present the results of a search for extremely metal-poor (EMP), carbon-enhanced metal-poor (CEMP), and cataclysmic variable (CV) stars using a new exploration tool based on linked scatter plots (LSPs). Our approach is especially designed to work with very large spectrum data sets such as the SDSS, LAMOST, RAVE, and Gaia data sets, and it can be applied to stellar, galaxy, and quasar spectra. As a demonstration, we conduct our search using the SDSS DR10 data set. We first created a 3326-dimensional phase space containing nearly 2 billion measures of the strengths of over 1600 spectral features in 569,738 SDSSmore » stars. These measures capture essentially all the stellar atomic and molecular species visible at the resolution of SDSS spectra. We show how LSPs can be used to quickly isolate and examine interesting portions of this phase space. To illustrate, we use LSPs coupled with cuts in selected portions of phase space to extract EMP stars, CEMP stars, and CV stars. We present identifications for 59 previously unrecognized candidate EMP stars and 11 previously unrecognized candidate CEMP stars. We also call attention to 2 candidate He ii emission CV stars found by the LSP approach that have not yet been discussed in the literature.« less
Exploring the SDSS Data Set with Linked Scatter Plots. I. EMP, CEMP, and CV Stars
NASA Astrophysics Data System (ADS)
Carbon, Duane F.; Henze, Christopher; Nelson, Bron C.
2017-02-01
We present the results of a search for extremely metal-poor (EMP), carbon-enhanced metal-poor (CEMP), and cataclysmic variable (CV) stars using a new exploration tool based on linked scatter plots (LSPs). Our approach is especially designed to work with very large spectrum data sets such as the SDSS, LAMOST, RAVE, and Gaia data sets, and it can be applied to stellar, galaxy, and quasar spectra. As a demonstration, we conduct our search using the SDSS DR10 data set. We first created a 3326-dimensional phase space containing nearly 2 billion measures of the strengths of over 1600 spectral features in 569,738 SDSS stars. These measures capture essentially all the stellar atomic and molecular species visible at the resolution of SDSS spectra. We show how LSPs can be used to quickly isolate and examine interesting portions of this phase space. To illustrate, we use LSPs coupled with cuts in selected portions of phase space to extract EMP stars, CEMP stars, and CV stars. We present identifications for 59 previously unrecognized candidate EMP stars and 11 previously unrecognized candidate CEMP stars. We also call attention to 2 candidate He II emission CV stars found by the LSP approach that have not yet been discussed in the literature.
Molecular identification of enteroviruses associated with aseptic meningitis in children from India.
Kumar, Arvind; Shukla, Deepti; Kumar, Rashmi; Idris, Mohammad Z; Jauhari, Prashant; Srivastava, Shalini; Dhole, Tapan N
2013-01-01
We identified and characterized enteroviruses associated with aseptic meningitis in children between April 2009 and March 2010. Enterovirus RNA was detected in 51 (45.5 %) of 112 CSF samples. Molecular typing by RT-PCR and sequencing of a partial VP1 region revealed the predominance of echovirus (ECV) 32 (n = 20), followed by ECV 11 (n = 10), ECV 13 and ECV 14 (n = 5 each), coxsackievirus (CV) B3 and CV B6 (n = 3 each), CV A2, CV A10 and ECV 30 (n = 1 each). Phylogenetic analysis of ECV 32 showed 0 to 4 % sequence divergence among strains of the present study and 20-23 % from the prototype Puerto Rico strain at the nucleotide level. This is the first report of ECV 32 associated with an aseptic meningitis epidemic and identification of seven different enterovirus serotypes (CV A2, CV A10, CV B3, CV B6, ECV 13, ECV 14 and ECV 32) in meningitis cases from India.
Sun, Jie; Zhao, Ji-meng; Ji, Rong; Liu, Hui-rong; Shi, Yin; Jin, Chun-lan
2013-12-01
To observe the effect of electroacupuncture (EA) on ovarian P 450 arom and P 450 c 17 alpha (aromatases) expression and related sex hormone levels in polycystic ovary syndrome (PCOS) rats. Thirty SD rats were randomly divided into normal control group, model group and EA group (10 rats/group). PCOS model was made by intragastric administration of letrozole at 1 mg/kg per day for consecutive 21 days. "Guanyuan" (CV 4) and "Zhongji" (CV 3) acupoints were stimulated 20 min by EA (2 mA, 2 Hz), once daily for consecutive 14 days. The damp ovarian weight was weighed and the pathological changes of the ovarian tissue were observed after H. E. staining. Ultrastructural changes of the ovarian tissue were observed by transmission electron microscope. Immunohistochemical staining was adopted to detect ovarian follicle granulosa cell P 450 arom and follicle membrane cell P 450 c 17 alpha expression. The contents of estradiol (E 2), estrone (E 1), androstenedione (ASD), testosterone (T), follicle-stimulating hormone (FSH) and luteinizing hormone (LH) in the ovarian tissue were measured by ELISA. Compared with the normal group, there was a significant increase in the damp weight of both left and right ovarian tissues in the model group (P < 0.01). After EA, the ovarian weight was remarkably reduced (P < 0.01). Pathological changes of the ovarian tissue such as thickening of the superficial albugineous coat of the ovary, thinning of the granular cell layer, and disappearance of the intraovular oocytes and coronaradiata under light microscope, and mitochondrion swelling, fracture or disappearance of mitochondrial cristae, and enlargement of the endoplasmic reticulum, etc. after modeling were obviously improved in the EA group. In comparison to the control group, the expression of the follicle granulosa cell P450 arom was significantly down-regulated and that of follicle membrane cell P 450 c 17 alpha was significantly upregulated in the model group (P < 0.01). After EA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dinara, Syed Mukulika, E-mail: smdinara.iit@gmail.com; Jana, Sanjay Kr.; Ghosh, Saptarsi
2015-04-15
Enhancement of two dimensional electron gas (2DEG) concentrations at Al{sub 0.3}Ga{sub 0.7}N/GaN hetero interface after a-Si{sub 3}N{sub 4} (SiN) passivation has been investigated from non-destructive High Resolution X-ray Diffraction (HRXRD) analysis, depletion depth and capacitance-voltage (C-V) profile measurement. The crystalline quality and strained in-plane lattice parameters of Al{sub 0.3}Ga{sub 0.7}N and GaN were evaluated from double axis (002) symmetric (ω-2θ) diffraction scan and double axis (105) asymmetric reciprocal space mapping (DA RSM) which revealed that the tensile strain of the Al{sub 0.3}Ga{sub 0.7}N layer increased by 15.6% after SiN passivation. In accordance with the predictions from theoretical solution of Schrödinger-Poisson’smore » equations, both electrochemical capacitance voltage (ECV) depletion depth profile and C-V characteristics analyses were performed which implied effective 9.5% increase in 2DEG carrier density after passivation. The enhancement of polarization charges results from increased tensile strain in the Al{sub 0.3}Ga{sub 0.7}N layer and also due to the decreased surface states at the interface of SiN/Al{sub 0.3}Ga{sub 0.7}N layer, effectively improving the carrier confinement at the interface.« less
Sabaté, Daniela C; Brandan, Carolina Pérez; Petroselli, Gabriela; Erra-Balsells, Rosa; Audisio, M Carina
2018-06-01
Bacillus sp. B19, Bacillus sp. P12 and B. amyloliquefaciens B14 were isolated from soils of Salta province, and PGPR properties on the common bean (Phaseolus vulgaris L.) cv. Alubia and antagonistic activity against Sclerotinia sclerotiorum were studied. It was determined that B19 and P12 increased crop germination potential (GP) from the common bean by 14.5% compared to control seeds; these strains also increased root length (10.4 and 15%, respectively) and stem length (20.2 and 30%, respectively) compared to the control; however, as for the B14 strain, no increases in growth parameters were detected. In addition, all the treatments that combined two bacilli: B14 + B19, B14 + P12 and B19 + P12, generated beneficial effects on GP and seedling growth compared to control seeds, but not compared to a single inoculant. B19 and P12 strains synthesized auxins at concentrations of 5.71 and 4.90 mg/mL, respectively, and it was qualitatively determined that they synthesize siderophores. In addition, previous studies have determined that B14 produces auxins in a concentration of 10.10 mg/mL, and qualitatively synthesizes siderophores. The phytosanitary state of the white bean cv. Alubia control seeds revealed bacterial contamination in 87% of all the evaluated seeds and different fungi such as Cladosporium sp., Fusarium sp., and Rhizopus sp. Bean seeds treated with B14, B19 or P12 showed no growth of contaminating bacteria or of pathogenic fungi; in fact, bacilli inoculum development was observed in all seeds. Additionally, B19, P12 and B14 strains inhibited in vitro the development of 9 native S. sclerotiorum strains isolated from the Salta region, with FI ranging between 60 and 100%. The three Bacillus strains synthesized different isoforms of the lipopeptides: surfactin, iturin, and fengycin in the presence of S. sclerotiorum, as determined by MALDI-TOF. In the in vivo trials, when common bean seeds were grown in soils contaminated with S. sclerotiorum, an
Baggen, Jim; Hurdiss, Daniel L; Zocher, Georg; Mistry, Nitesh; Roberts, Richard W; Slager, Jasper J; Guo, Hongbo; van Vliet, Arno L W; Wahedi, Maryam; Benschop, Kimberley; Duizer, Erwin; de Haan, Cornelis A M; de Vries, Erik; Casasnovas, José M; de Groot, Raoul J; Arnberg, Niklas; Stehle, Thilo; Ranson, Neil A; Thibaut, Hendrik Jan; van Kuppeveld, Frank J M
2018-01-09
Acute hemorrhagic conjunctivitis (AHC) is a painful, contagious eye disease, with millions of cases in the last decades. Coxsackievirus A24 (CV-A24) was not originally associated with human disease, but in 1970 a pathogenic "variant" (CV-A24v) emerged, which is now the main cause of AHC. Initially, this variant circulated only in Southeast Asia, but it later spread worldwide, accounting for numerous AHC outbreaks and two pandemics. While both CV-A24 variant and nonvariant strains still circulate in humans, only variant strains cause AHC for reasons that are yet unknown. Since receptors are important determinants of viral tropism, we set out to map the CV-A24 receptor repertoire and establish whether changes in receptor preference have led to the increased pathogenicity and rapid spread of CV-A24v. Here, we identify ICAM-1 as an essential receptor for both AHC-causing and non-AHC strains. We provide a high-resolution cryo-EM structure of a virus-ICAM-1 complex, which revealed critical ICAM-1-binding residues. These data could help identify a possible conserved mode of receptor engagement among ICAM-1-binding enteroviruses and rhinoviruses. Moreover, we identify a single capsid substitution that has been adopted by all pandemic CV-A24v strains and we reveal that this adaptation enhances the capacity of CV-A24v to bind sialic acid. Our data elucidate the CV-A24v receptor repertoire and point to a role of enhanced receptor engagement in the adaptation to the eye, possibly enabling pandemic spread.
Kiss, Hajnalka; Nett, Markus; Domin, Nicole; Martin, Karin; Maresca, Julia A.; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Berry, Kerrie W.; Glavina Del Rio, Tijana; Dalin, Eileen; Tice, Hope; Pitluck, Sam; Richardson, Paul; Bruce, David; Goodwin, Lynne; Han, Cliff; Detter, John C.; Schmutz, Jeremy; Brettin, Thomas; Land, Miriam; Hauser, Loren; Kyrpides, Nikos C.; Ivanova, Natalia; Göker, Markus; Woyke, Tanja; Klenk, Hans-Peter; Bryant, Donald A.
2011-01-01
Herpetosiphon aurantiacus Holt and Lewin 1968 is the type species of the genus Herpetosiphon, which in turn is the type genus of the family Herpetosiphonaceae, type family of the order Herpetosiphonales in the phylum Chloroflexi. H. aurantiacus cells are organized in filaments which can rapidly glide. The species is of interest not only because of its rather isolated position in the tree of life, but also because Herpetosiphon ssp. were identified as predators capable of facultative predation by a wolf pack strategy and of degrading the prey organisms by excreted hydrolytic enzymes. The genome of H. aurantiacus strain 114-95T is the first completely sequenced genome of a member of the family Herpetosiphonaceae. The 6,346,587 bp long chromosome and the two 339,639 bp and 99,204 bp long plasmids with a total of 5,577 protein-coding and 77 RNA genes was sequenced as part of the DOE Joint Genome Institute Program DOEM 2005. PMID:22675585
Ahmed, Zaheer; Wang, Yanping; Anjum, Nomana; Ahmad, Hajra; Ahmad, Asif; Raza, Mohsin
2013-08-01
This project was designed to study the coculturing affect of exopolysaccharide (EPS) producing strains Lactobacillus kefiranofaciens (L.k) ZW3, with non EPS producing strains L. bulgaricus (L.b) and Streptococcus thermophilus (S.t) in three different combinations: L.k+L.b, L.k+S.t, and L.k+L.b+S.t. FTIR analysis revealed presence of strong stretch in regions of 3400, 2900 and 1647cm(-1) which is characteristic of a typical polysaccharide. Co-cultured EPSs were composed of glucose, galactose, arabinose and xylose; and their sugar compositions were different from ZW3 polysaccharide that was mainly composed of gluco-galactan. Peak temperature for L.k+L.b, L.k+S.t, L.k+S.t+L.b and ZW3 polymers were 90.59, 87.61, 95.18 and 97.38°C, respectively. Thermal analysis revealed degradation temperature of 326.44, 294.6, 296.7 and 299.62°C for L.k+L.b, L.k+S.t, L.k+S.t+L.b and ZW3 polymers, respectively. SEM and AFM analysis divulged that three cocultured EPSs had different surface morphology than ZW3 polymer. Since co-cultured polymers have different structure than the polymer produced exclusively by EPS producing strain, it can be safely concluded from the study that co-culturing can be one way to change the structure of polymers. Coculturing of L. kefiranofaciens with non-EPS producing strains resulted in yoghurt with increased viscosity and delayed syneresis. Copyright © 2013 Elsevier B.V. All rights reserved.
TST from geofinder traverse data on HP41CV programmable calculator
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carman, G.J.
Using program subroutines designed for the HP41CV programmable calculator and the geometric data recorded from Geofinder traversing or other pace-and-compass-type methods, the true stratigraphic thickness (TST) of dipping or gently folded strata is calculated at a rate of about 30 seconds per station. TST information is therefore readily available for reviewing stratigraphic and structure data and for post survey graphical plots.
Alli, John Adeolu; Iwalokun, Bamidele A; Oluwadun, Afolabi; Okonko, Iheanyi Omezuruike
2015-01-01
Yogurt and starter culture producers are still searching strains of Lactobacillus acidophilus to produce healthier yogurt with a longer shelf life and better texture, taste, and quality. This study determined the genotyping of bacteriocin producing Lactobacillus acidophilus strains recovered from Nigerian yogurts. Yogurt samples were collected from four different states of South West regions of Nigeria. Isolates were obtained from MRS Medium and biochemically characterized. This was further confirmed by API50CH. The bacteriocin positivity and activity was determined. Genomic characterization of our Lactobacillus acidophilus strains was done with randomly amplified polymorphic DNA-PCR. All yogurt samples containing Lactobacillus acidophilus strains meet the probiotic requirement of ≥10(6) cfu/mL. The gel picture revealed 6 RAPD clonal types of Lactobacillus acidophilus strains with RAPD type C observed to be more common. Significant differences existed in the mean growth inhibition zone (t = -7.32, P < 0.05 for E. coli ATCC; t = -6.19, P < 0.05 for E. coli clinical isolates; t = -6.16, P < 0.05 for Enterobacter sp; t = -11.92, P < 0.05 for Salmonella typhi, t = -1.10, P > 0.05 Staphylococcus aureus). No correlation between the bacteriocin production, activity, and their RAPD clonal division (X(2) = 7.49, P = 0.1610, df = 5). In conclusion, L. acidophilus isolated in Nigeria samples met the probiotic requirements of ≥10(6) cfu/mL and produce bacteriocins with good spectrum of activity.
González, Sara S; Alcoba-Flórez, Julia; Laich, Federico
2013-01-01
During the characterization of the microbiota biodiversity associated with grapes and wineries in different bioclimatic conditions of the Canary Islands (Spain), a novel yeast species was isolated from Lanzarote, the driest wine-producing region of the archipelago. Seven strains isolated from grapes, microvinifications and wineries are described. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolates were phylogenetically a member of the genus Lachancea and are closely related to Lachancea meyersii NRRL Y-27269(T) and Lachancea nothofagi NRRL Y-48670(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analysis, a novel ascosporogenous yeast species, Lachancea lanzarotensis sp. nov., is proposed. The type strain is L2C-15(T) ( = CBS 12615(T) = CECT 13066(T)) which was isolated from grape berries of Vitis vinifera L. cv. Listán Negro red grape variety in Tinajo, Lanzarote. The MycoBank no. is MB 801390.
Shen, Xia; Li, Yu; Zhao, Zhe; Han, Yi-Fan; Zhang, Wen-Wu; Yu, Xiao-Yun; Zhang, Chong-Ya; Sun, Cong; Wu, Min
2018-04-01
A Gram-stain negative, aerobic, motile and ovoid- to rod-shaped bacteria strain, designated XC0140 T , was isolated from soil samples near the sewage treatment tank of a chemical factory in Zhejiang Province, China, and subjected to polyphasic taxonomic investigation. Strain XC0140 T grew at 10-37 °C and pH 6.0-9.0 (optimum, 35 °C and pH 7.5) and with 0-17% (w/v) NaCl (optimum, 1%). According to phylogenetic analysis based on 16S rRNA gene sequences, strain XC0140 T was assigned to the genus Pararhizobium with high 16S rRNA gene sequence similarity of 95.97% to "Pararhizobium helanshanense CCNWQTX14 T" , followed by Pararhizobium sphaerophysae CCNWGS0238 T (95.95%). Chemotaxonomic analysis showed that strain XC0140 T contains ubiquinone-10 as the predominant respiratory quinone and possessed summed feature 8 (comprising C 18: 1 ω7c and/or ω6c), 11-methyl C 18:1 ω7c, C 18: 0 and C 16: 0 as predominant forms of fatty acids. The polar lipids of strain XC0140 T consisted of seven phospholipids (PL), two aminolipids (AL), one glycolipid (GL) and three unidentified lipids (L1, L2 and L3). The DNA G+C content was 62.7 mol%. Based on the polyphasic taxonomic characterization, strain XC0140 T is considered to represent a novel species of the genus Pararhizobium, for which the name Pararhizobium haloflavum sp. nov. is proposed. (type strain XC0140 T = MCCC 1K03228 T = KCTC 52582 T ).
Dynamic Response and Microstructure Evolution of AA2219-T4 and AA2219-T6 Aluminum Alloys
NASA Astrophysics Data System (ADS)
Olasumboye, A.; Owolabi, G.; Odeshi, A.; Zeytinci, A.; Yilmaz, N.
2018-02-01
In this study, the dynamic deformation behavior of AA2219 aluminum alloy was investigated in two different temper conditions: T4 and T6, with a view to determining the effect of heat treatment on the microstructure and flow behavior of the material under high strain rates. Split Hopkinson pressure bar experiment was used in determining the dynamic response of the alloy while a digital image correlation system was employed in visualizing and tracking the surface deformation of the specimens. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. The results obtained showed heterogeneous deformation of the alloy in the two temper conditions. It was observed that the dynamic mechanical behavior of each sample preparation was dependent on its strength properties due to aging type, which in turn controls the metamorphosis of the strengthening precipitates and the initial microstructure. At the maximum strain rate of 3500 s-1, transformed bands leading to crack nucleation was observed in the AA2219-T4 aluminum alloy while AA2219-T6 had fractured at the same strain rate. The modes of crack formation and growth in the two alloys were found to be similar: nucleation, growth and coalescence of voids. However, shear band bifurcation phenomenon was observed only in the AA2219-T6 alloy.
Dynamic Response and Microstructure Evolution of AA2219-T4 and AA2219-T6 Aluminum Alloys
NASA Astrophysics Data System (ADS)
Olasumboye, A.; Owolabi, G.; Odeshi, A.; Zeytinci, A.; Yilmaz, N.
2018-06-01
In this study, the dynamic deformation behavior of AA2219 aluminum alloy was investigated in two different temper conditions: T4 and T6, with a view to determining the effect of heat treatment on the microstructure and flow behavior of the material under high strain rates. Split Hopkinson pressure bar experiment was used in determining the dynamic response of the alloy while a digital image correlation system was employed in visualizing and tracking the surface deformation of the specimens. Optical microscopy and scanning electron microscopy were used to assess the microstructure of the material after following standard metallographic specimen preparation techniques. The results obtained showed heterogeneous deformation of the alloy in the two temper conditions. It was observed that the dynamic mechanical behavior of each sample preparation was dependent on its strength properties due to aging type, which in turn controls the metamorphosis of the strengthening precipitates and the initial microstructure. At the maximum strain rate of 3500 s-1, transformed bands leading to crack nucleation was observed in the AA2219-T4 aluminum alloy while AA2219-T6 had fractured at the same strain rate. The modes of crack formation and growth in the two alloys were found to be similar: nucleation, growth and coalescence of voids. However, shear band bifurcation phenomenon was observed only in the AA2219-T6 alloy.
Yu, Yuanshan; Xiao, Gengsheng; Xu, Yujuan; Wu, Jijun; Fu, Manqin; Wen, Jing
2015-11-01
The aim of this study was to evaluate the hypothesis that fermentation with Lactobacillus fermentium, which can metabolize citric acid, could be applied in improving the taste (sugar:acid ratio) of citrus juice. During fermentation, the strain of L. fermentium can preferentially utilize citric acid of citrus (Citrus reticulata cv. Chachiensis) juice to support the growth without the consumption of sugar. After 6 h of fermentation with L. fermentium at 30 °C, the sugar:acid ratio of citrus juice increased to 22:1 from 12:1, which resulted in that the hedonic scores of sweetness, acidity and overall acceptability of fermented-pasteurized citrus juice were higher than the unfermented-pasteurized citrus juice. Compared with unfermented-pasteurized citrus juice, the ORAC value and total amino acid showed a reduction, and no significant change (P > 0.05) in the L*, a*, b*, total soluble phenolics and ascorbic acid (Vc) content in the fermented-pasteurized citrus juice was observed as compared with unfermented-pasteurized citrus juice. Hence, slight fermentation with L. fermentium can be used for improving the taste (sugar:acid ratio) of citrus juice with the well retaining of quality. © 2015 Institute of Food Technologists®
Genome sequence of Thalassospira xiamenensis type strain M-5.
Lai, Qiliang; Shao, Zongze
2012-12-01
Thalassospira xiamenensis M-5(T) was isolated from the surface water of a waste oil pool at the oil storage dock in the city of Xiamen, Fujian Province, China. Here, we present the draft genome of strain M-5(T), which contains 4,705,237 bp with a G+C content of 54.65% and contains 4,343 protein-coding genes and 46 tRNA genes.
Constantinoiu, Constantin; Gardiner, Christopher; Warner, Jeffrey
2015-01-01
Burkholderia pseudomallei is a saprophytic bacterium that causes melioidosis and is often isolated from rice fields in Southeast Asia, where the infection incidence is high among rice field workers. The aim of this study was to investigate the relationship between this bacterium and rice through growth experiments where the effect of colonization of domestic rice (Oryza sativa L. cv Amaroo) roots by B. pseudomallei could be observed. When B. pseudomallei was exposed to surface-sterilized seeds, the growth of both the root and the aerosphere was retarded compared to that in controls. The organism was found to localize in the root hairs and endodermis of the plant. A biofilm formed around the root and root structures that were colonized. Growth experiments with a wild rice species (Oryza meridionalis) produced similar retardation of growth, while another domestic cultivar (O. sativa L. cv Koshihikari) did not show retarded growth. Here we report B. pseudomallei infection and inhibition of O. sativa L. cv Amaroo, which might provide insights into plant interactions with this important human pathogen. PMID:25911477
Non-perturbative determination of cV, ZV and ZS/ZP in Nf = 3 lattice QCD
NASA Astrophysics Data System (ADS)
Heitger, Jochen; Joswig, Fabian; Vladikas, Anastassios; Wittemeier, Christian
2018-03-01
We report on non-perturbative computations of the improvement coefficient cV and the renormalization factor ZV of the vector current in three-flavour O(a) improved lattice QCD with Wilson quarks and tree-level Symanzik improved gauge action. To reduce finite quark mass effects, our improvement and normalization conditions exploit massive chiral Ward identities formulated in the Schrödinger functional setup, which also allow deriving a new method to extract the ratio ZS/ZP of scalar to pseudoscalar renormalization constants. We present preliminary results of a numerical evaluation of ZV and cV along a line of constant physics with gauge couplings corresponding to lattice spacings of about 0:09 fm and below, relevant for phenomenological applications.
Automatic tracking of red blood cells in micro channels using OpenCV
NASA Astrophysics Data System (ADS)
Rodrigues, Vânia; Rodrigues, Pedro J.; Pereira, Ana I.; Lima, Rui
2013-10-01
The present study aims to developan automatic method able to track red blood cells (RBCs) trajectories flowing through a microchannel using the Open Source Computer Vision (OpenCV). The developed method is based on optical flux calculation assisted by the maximization of the template-matching product. The experimental results show a good functional performance of this method.
Martínez, Ignacio; Nogueda, Benjamín; Martínez-Hernández, Fernando; Espinoza, Bertha
2013-03-01
Chagas disease is caused by the protozoan parasite Trypanosoma cruzi, and it affects as many as 10 million people in North and South America, where it represents a major public health problem. T. cruzi is a parasite with high genetic diversity, and it has been grouped into 6 discrete typing units (DTUs), designated as T. cruzi I (TcI) to T. cruzi VI (TcVI). Mexican isolates from humans and from vector insects have been primarily found to be TcI, and these isolates are likely to be the strains that cause the clinical manifestations observed in Mexico. However, genetic characterization and drug susceptibility assays are limited in Mexican TcI strains. In this work, 24 Mexican T. cruzi strains, obtained primarily from humans, were studied with 7 locus microsatellites and mini-exon gene by PCR. Also, drug susceptibility was evaluated by growth and mobility assays. All of the human strains belonged to TcI, and they could be further grouped through microsatellite analysis into 2 subgroups (microsatellite genotypes 1 and 2), which were not related to the host clinical status or biological origin of the strain. Two strains, both from wild mammals, belonged to the TcII-TcVI groups; these strains and the CL Brener strain constituted microsatellite genotype 3. The number of alleles in each locus was lower than reported for South American strains, and a departure from the Hardy-Weinberg equilibrium was observed. The susceptibility of these strains to nifurtimox and benznidazole was heterogeneous. T. cruzi strains characterized as microsatellite genotypes 2 and 3 were significantly more susceptible to benznidazole than strains of microsatellite genotype 1. Only 1 Mexican strain resistant to both drugs was found in this study.
Castillo, Daniel; Pérez-Reytor, Diliana; Plaza, Nicolás; Ramírez-Araya, Sebastián; Blondel, Carlos J.; Corsini, Gino; Bastías, Roberto; Loyola, David E.; Jaña, Víctor; Pavez, Leonardo; García, Katherine
2018-01-01
Vibrio parahaemolyticus is the leading cause of seafood-borne gastroenteritis worldwide. As reported in other countries, after the rise and fall of the pandemic strain in Chile, other post-pandemic strains have been associated with clinical cases, including strains lacking the major toxins TDH and TRH. Since the presence or absence of tdh and trh genes has been used for diagnostic purposes and as a proxy of the virulence of V. parahaemolyticus isolates, the understanding of virulence in V. parahaemolyticus strains lacking toxins is essential to detect these strains present in water and marine products to avoid possible food-borne infection. In this study, we characterized the genome of four environmental and two clinical non-toxigenic strains (tdh-, trh-, and T3SS2-). Using whole-genome sequencing, phylogenetic, and comparative genome analysis, we identified the core and pan-genome of V. parahaemolyticus of strains of southern Chile. The phylogenetic tree based on the core genome showed low genetic diversity but the analysis of the pan-genome revealed that all strains harbored genomic islands carrying diverse virulence and fitness factors or prophage-like elements that encode toxins like Zot and RTX. Interestingly, the three strains carrying Zot-like toxin have a different sequence, although the alignment showed some conserved areas with the zot sequence found in V. cholerae. In addition, we identified an unexpected diversity in the genetic architecture of the T3SS1 gene cluster and the presence of the T3SS2 gene cluster in a non-pandemic environmental strain. Our study sheds light on the diversity of V. parahaemolyticus strains from the southern Pacific which increases our current knowledge regarding the global diversity of this organism. PMID:29472910
Complete genome sequence of Rhodospirillum rubrum type strain (S1).
Munk, A Christine; Copeland, Alex; Lucas, Susan; Lapidus, Alla; Del Rio, Tijana Glavina; Barry, Kerrie; Detter, John C; Hammon, Nancy; Israni, Sanjay; Pitluck, Sam; Brettin, Thomas; Bruce, David; Han, Cliff; Tapia, Roxanne; Gilna, Paul; Schmutz, Jeremy; Larimer, Frank; Land, Miriam; Kyrpides, Nikos C; Mavromatis, Konstantinos; Richardson, Paul; Rohde, Manfred; Göker, Markus; Klenk, Hans-Peter; Zhang, Yaoping; Roberts, Gary P; Reslewic, Susan; Schwartz, David C
2011-07-01
Rhodospirillum rubrum (Esmarch 1887) Molisch 1907 is the type species of the genus Rhodospirillum, which is the type genus of the family Rhodospirillaceae in the class Alphaproteobacteria. The species is of special interest because it is an anoxygenic phototroph that produces extracellular elemental sulfur (instead of oxygen) while harvesting light. It contains one of the most simple photosynthetic systems currently known, lacking light harvesting complex 2. Strain S1(T) can grow on carbon monoxide as sole energy source. With currently over 1,750 PubMed entries, R. rubrum is one of the most intensively studied microbial species, in particular for physiological and genetic studies. Next to R. centenum strain SW, the genome sequence of strain S1(T) is only the second genome of a member of the genus Rhodospirillum to be published, but the first type strain genome from the genus. The 4,352,825 bp long chromosome and 53,732 bp plasmid with a total of 3,850 protein-coding and 83 RNA genes were sequenced as part of the DOE Joint Genome Institute Program DOEM 2002.
Camandaroba, Edson; Thé, Torriceli S; Pessina, Daniel Huber; Andrade, Sonia G
2006-01-01
Clonal histotropism and biological characters of five clones isolated during the early acute phase of the infection of Swiss mice with the Colombian strain of Trypanosoma cruzi (T. cruzi I), Biodeme Type III, were investigated. Clones were isolated from mice at the 10th and the 30th day of infection with the Colombian strain. Isolation was performed by micromanipulation and injection of one trypomatigote blood form into newborn mice, followed by passages into suckling mice for obtaining the inocula for the experimental groups. Mice infected with parental strain were also studied. All the clones have shown the basic characteristics of Biodeme Type III, with the same patterns of parasitemia, tissue tropism, morphological characters and isoenzymic profiles, such as the parental strain. Histotropism was most intense to myocardium and skeletal muscles, with intense lesions found in the advanced phase (20th to 30th day of infection). Both parental strain and the clones were seen to parasitize several organs and tissues; amastigote nests were identified in the cytoplasm of macrophages, adipose cells, smooth muscle of intestinal wall and Auerbach's neuronal plexus. The findings of the present study confirm the homology of the clones isolated from the Colombian strain, with predominance of a ‘principal clone’ and an ubiquitous distribution of parasites belonging to a same clone. PMID:16709229
de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Avila, Carla Cristi; Teixeira, Marta M. G.; Larsen, Martin R.
2018-01-01
Background Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. Methods/Principal findings The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. Conclusions and significance This is the first study that develops a MS
de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Mule, Simon Ngao; Avila, Carla Cristi; Teixeira, Marta M G; Larsen, Martin R; Palmisano, Giuseppe
2018-04-01
Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. This is the first study that develops a MS-based platform for T. cruzi strain typing. Indeed, the Tc-STAMS2 method
Genome Sequence of Thalassospira xiamenensis Type Strain M-5
Lai, Qiliang
2012-01-01
Thalassospira xiamenensis M-5T was isolated from the surface water of a waste oil pool at the oil storage dock in the city of Xiamen, Fujian Province, China. Here, we present the draft genome of strain M-5T, which contains 4,705,237 bp with a G+C content of 54.65% and contains 4,343 protein-coding genes and 46 tRNA genes. PMID:23209216
N'tcha, Christine; Sina, Haziz; Kayodé, Adéchola Pierre Polycarpe; Gbenou, Joachim D.
2017-01-01
The aim of this study was to investigate the antibacterial effect of the crude starter “kpètè-kpètè” and lactic acid bacteria used during the production of “tchoukoutou.” To achieve this, a total of 11 lactic acid bacteria and 40 starter samples were collected from four communes. The samples were tested on 29 gram + and − strains by disk diffusion method. The minimum inhibitory and bactericidal concentrations of starter and lactic acid bacteria were determined by conventional methods. Organic acids, sugar, and volatile compounds were determined using the HPLC method. The “kpètè-kpètè” displays a high antibacterial activity against the tested strains. The most sensitive strain was S. epidermidis (12.5 mm) whereas the resistance strain was Proteus mirabilis (8 mm). All the tested ferment has not any inhibitory effect on Enterococcus faecalis. The lactic acid bacteria isolates of Parakou showed the highest (17.48 mm) antibacterial activity whereas the smallest diameter was obtained with the ferment collected from Boukoumbé (9.80 mm). The starters' chemical screening revealed the presence of tannins, anthocyanin flavonoids, triterpenes, steroids, reducing compounds, and mucilage O-glycosides. These compounds are probably the source of recorded inhibition effect. The lactic acid bacteria of the “kpètè-kpètè” could be used to develop a food ingredient with probiotic property. PMID:28367445
Strain-induced metal-insulator transitions in d1 perovskites within DFT+DMFT
NASA Astrophysics Data System (ADS)
Dymkowski, Krzysztof; Ederer, Claude
2014-03-01
We present results of combined density functional theory plus dynamical mean-field theory (DFT+DMFT) calculations, assessing the effect of epitaxial strain on the electronic properties of the Mott insulator LaTiO3 and the correlated metal SrVO3. In particular, we take into account the effect of strain on the collective tilts and rotations of the oxygen octahedra in the orthorhombically distorted Pbnm perovskite structure of LaTiO3. We find that LaTiO3 undergoes an insulator-to-metal transition under a compressive strain of about - 2 %, consistent with recent experimental observations. We show that this transition is driven mainly by strain-induced changes in the crystal-field splitting between the Ti t2 g orbitals, which in turn are related to changes in the octahedral tilt distortion. We compare this with the case of SrVO3, without octahedral tilts, where we find a metal-to-insulator transition under tensile epitaxial strain. Similar to LaTiO3, this metal-insulator transition is linked to the strain-induced change in the crystal-field splitting within the t2 g orbitals.
Gene Deletions in Mycobacterium bovis BCG Stimulate Increased CD8+ T Cell Responses
Panas, Michael W.; Sixsmith, Jaimie D.; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T.; Moy, Brian T.; Lee, Sunhee; Schmitz, Joern E.; Jacobs, William R.; Porcelli, Steven A.; Haynes, Barton F.; Letvin, Norman L.
2014-01-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8+ T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8+ T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8+ T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8+ T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. PMID:25287928
Gene deletions in Mycobacterium bovis BCG stimulate increased CD8+ T cell responses.
Panas, Michael W; Sixsmith, Jaimie D; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T; Moy, Brian T; Lee, Sunhee; Schmitz, Joern E; Jacobs, William R; Porcelli, Steven A; Haynes, Barton F; Letvin, Norman L; Gillard, Geoffrey O
2014-12-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8(+) T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8(+) T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8(+) T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8(+) T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Peterson, Jennifer K.; Graham, Andrea L.; Dobson, Andrew P.; Chávez, Omar Triana
2015-01-01
The effect of a parasite on the life history of its vector is important for understanding and predicting disease transmission. Chagas disease agent Trypanosoma cruzi is a generalist parasite that is diverse across scales from its genetic diversity to the 100s of mammal and vector species it infects. Its vertebrate hosts show quite variable responses to infection, however, to date there are no studies looking at how T. cruzi variability might result in variable outcomes in its invertebrate host. Therefore, we investigated the effect of different T. cruzi I strains on Rhodnius prolixus survival and development. We found significant variation between insects infected with different strains, with some strains having no effect, as compared with uninfected insects, and others with significantly lower survival and development. We also found that different variables had varying importance between strains, with the effect of time postinfection and the blood:weight ratio of the infective meal significantly affecting the survival of insects infected with some strains, but not others. Our results suggest that T. cruzi can be pathogenic not only to its vertebrate hosts but also to its invertebrate hosts. PMID:26078316
Van Reet, Nick; Van de Vyver, Hélène; Pyana, Patient Pati; Van der Linden, Anne Marie; Büscher, Philippe
2014-08-01
Genetic engineering with luciferase reporter genes allows monitoring Trypanosoma brucei (T.b.) infections in mice by in vivo bioluminescence imaging (BLI). Until recently, luminescent T.b. models were based on Renilla luciferase (RLuc) activity. Our study aimed at evaluating red-shifted luciferases for in vivo BLI in a set of diverse T.b. strains of all three subspecies, including some recently isolated from human patients. We transfected T.b. brucei, T.b. rhodesiense and T.b. gambiense strains with either RLuc, click beetle red (CBR) or Photinus pyralis RE9 (PpyRE9) luciferase and characterised their in vitro luciferase activity, growth profile and drug sensitivity, and their potential for in vivo BLI. Compared to RLuc, the red-shifted luciferases, CBR and PpyRE9, allow tracking of T.b. brucei AnTaR 1 trypanosomes with higher details on tissue distribution, and PpyRE9 allows detection of the parasites with a sensitivity of at least one order of magnitude higher than CBR luciferase. With CBR-tagged T.b. gambiense LiTaR1, T.b. rhodesiense RUMPHI and T.b. gambiense 348 BT in an acute, subacute and chronic infection model respectively, we observed differences in parasite tropism for murine tissues during in vivo BLI. Ex vivo BLI on the brain confirmed central nervous system infection by all luminescent strains of T.b. brucei AnTaR 1, T.b. rhodesiense RUMPHI and T.b. gambiense 348 BT. We established a genetically and phenotypically diverse collection of bioluminescent T.b. brucei, T.b. gambiense and T.b. rhodesiense strains, including drug resistant strains. For in vivo BLI monitoring of murine infections, we recommend trypanosome strains transfected with red-shifted luciferase reporter genes, such as CBR and PpyRE9. Red-shifted luciferases can be detected with a higher sensitivity in vivo and at the same time they improve the spatial resolution of the parasites in the entire body due to the better kinetics of their substrate D-luciferin.
Van Reet, Nick; Van de Vyver, Hélène; Pyana, Patient Pati; Van der Linden, Anne Marie; Büscher, Philippe
2014-01-01
Background Genetic engineering with luciferase reporter genes allows monitoring Trypanosoma brucei (T.b.) infections in mice by in vivo bioluminescence imaging (BLI). Until recently, luminescent T.b. models were based on Renilla luciferase (RLuc) activity. Our study aimed at evaluating red-shifted luciferases for in vivo BLI in a set of diverse T.b. strains of all three subspecies, including some recently isolated from human patients. Methodology/Principal findings We transfected T.b. brucei, T.b. rhodesiense and T.b. gambiense strains with either RLuc, click beetle red (CBR) or Photinus pyralis RE9 (PpyRE9) luciferase and characterised their in vitro luciferase activity, growth profile and drug sensitivity, and their potential for in vivo BLI. Compared to RLuc, the red-shifted luciferases, CBR and PpyRE9, allow tracking of T.b. brucei AnTaR 1 trypanosomes with higher details on tissue distribution, and PpyRE9 allows detection of the parasites with a sensitivity of at least one order of magnitude higher than CBR luciferase. With CBR-tagged T.b. gambiense LiTaR1, T.b. rhodesiense RUMPHI and T.b. gambiense 348 BT in an acute, subacute and chronic infection model respectively, we observed differences in parasite tropism for murine tissues during in vivo BLI. Ex vivo BLI on the brain confirmed central nervous system infection by all luminescent strains of T.b. brucei AnTaR 1, T.b. rhodesiense RUMPHI and T.b. gambiense 348 BT. Conclusions/Significance We established a genetically and phenotypically diverse collection of bioluminescent T.b. brucei, T.b. gambiense and T.b. rhodesiense strains, including drug resistant strains. For in vivo BLI monitoring of murine infections, we recommend trypanosome strains transfected with red-shifted luciferase reporter genes, such as CBR and PpyRE9. Red-shifted luciferases can be detected with a higher sensitivity in vivo and at the same time they improve the spatial resolution of the parasites in the entire body due to the better
Strain-induced phase transition and electron spin-polarization in graphene spirals.
Zhang, Xiaoming; Zhao, Mingwen
2014-07-16
Spin-polarized triangular graphene nanoflakes (t-GNFs) serve as ideal building blocks for the long-desired ferromagnetic graphene superlattices, but they are always assembled to planar structures which reduce its mechanical properties. Here, by joining t-GNFs in a spiral way, we propose one-dimensional graphene spirals (GSs) with superior mechanical properties and tunable electronic structures. We demonstrate theoretically the unique features of electron motion in the spiral lattice by means of first-principles calculations combined with a simple Hubbard model. Within a linear elastic deformation range, the GSs are nonmagnetic metals. When the axial tensile strain exceeds an ultimate strain, however, they convert to magnetic semiconductors with stable ferromagnetic ordering along the edges. Such strain-induced phase transition and tunable electron spin-polarization revealed in the GSs open a new avenue for spintronics devices.
Szabo, R; Samson, A L; Lawrence, D A; Medcalf, R L; Bugge, T H
2016-08-01
Essentials C57BL/6J-tissue plasminogen activator (tPA)-deficient mice are widely used to study tPA function. Congenic C57BL/6J-tPA-deficient mice harbor large 129-derived chromosomal segments. The 129-derived chromosomal segments contain gene mutations that may confound data interpretation. Passenger mutation-free isogenic tPA-deficient mice were generated for study of tPA function. Background The ability to generate defined null mutations in mice revolutionized the analysis of gene function in mammals. However, gene-deficient mice generated by using 129-derived embryonic stem cells may carry large segments of 129 DNA, even when extensively backcrossed to reference strains, such as C57BL/6J, and this may confound interpretation of experiments performed in these mice. Tissue plasminogen activator (tPA), encoded by the PLAT gene, is a fibrinolytic serine protease that is widely expressed in the brain. A number of neurological abnormalities have been reported in tPA-deficient mice. Objectives To study genetic contamination of tPA-deficient mice. Materials and methods Whole genome expression array analysis, RNAseq expression profiling, low- and high-density single nucleotide polymorphism (SNP) analysis, bioinformatics and genome editing were used to analyze gene expression in tPA-deficient mouse brains. Results and conclusions Genes differentially expressed in the brain of Plat(-/-) mice from two independent colonies highly backcrossed onto the C57BL/6J strain clustered near Plat on chromosome 8. SNP analysis attributed this anomaly to about 20 Mbp of DNA flanking Plat being of 129 origin in both strains. Bioinformatic analysis of these 129-derived chromosomal segments identified a significant number of mutations in genes co-segregating with the targeted Plat allele, including several potential null mutations. Using zinc finger nuclease technology, we generated novel 'passenger mutation'-free isogenic C57BL/6J-Plat(-/-) and FVB/NJ-Plat(-/-) mouse strains by introducing
Morrison, W I
2007-08-19
The evolution of antigenically distinct pathogen strains that fail to cross-protect is well documented for pathogens controlled primarily by humoral immune responses. Unlike antibodies, which recognise native proteins, protective T cells can potentially recognise epitopes in a variety of proteins that are not necessarily displayed on the pathogen surface. Moreover, individual hosts of different MHC genotypes generally respond to different sets of epitopes. It is therefore less easy to envisage how strain restricted immunity can arise for pathogens controlled by T cell responses, particularly in antigenically complex parasites. Nevertheless, strain restricted immunity is clearly a feature of a number of parasitic infections, where immunity is known to be mediated by T cell responses. One such parasite is Theileria parva which induces potent CD8 T cell responses that play an important role in immunity. CD8 T cells specific for parasitized lymphoblasts exhibit strain specificity, which appears to correlate with the ability of parasite strains to cross-protect. Studies using recently identified T. parva antigens recognised by CD8 T cells have shown that the strain restricted nature of immunity is a consequence of the CD8 T cell response in individual animals being focused on a limited number of dominant polymorphic antigenic determinants. Responses in animals of different MHC genotypes are often directed to different parasite antigens, indicating that, at the host population level, a larger number of parasite proteins can serve as targets for the protective T cell response. Nevertheless, the finding that parasite strains show overlapping antigenic profiles, probably as a consequence of sexual recombination, suggests that induction of responses to an extended but limited set of antigens in individual animals may overcome the strain restricted nature of immunity.
Mavinkurve-Groothuis, Annelies M C; Marcus, Karen A; Pourier, Milanthy; Loonen, Jacqueline; Feuth, Ton; Hoogerbrugge, Peter M; de Korte, Chris L; Kapusta, Livia
2013-06-01
The aim of this study was to investigate myocardial 2D strain echocardiography and cardiac biomarkers in the assessment of cardiac function in children with acute lymphoblastic leukaemia (ALL) during and shortly after treatment with anthracyclines. Cardiac function of 60 children with ALL was prospectively studied with measurements of cardiac troponin T (cTnT) and N-terminal-pro-brain natriuretic peptide (NT-pro-BNP) and conventional and myocardial 2D strain echocardiography before start (T = 0), after 3 months (T = 1), and after 1 year (T = 2), and were compared with 60 healthy age-matched controls. None of the patients showed clinical signs of cardiac failure or abnormal fractional shortening. Cardiac function decreased significantly during treatment and was significantly decreased compared with normal controls. Cardiac troponin T levels were abnormal in 11% of the patients at T = 1 and were significantly related to increased time to global peak systolic longitudinal strain at T = 2 (P = 0.003). N-terminal-pro-brain natriuretic peptide levels were abnormal in 13% of patients at T = 1 and in 20% at T = 2, absolute values increased throughout treatment in 59%. Predictors for abnormal NT-pro-BNP at T = 2 were abnormal NT-pro-BNP at T = 0 and T = 1, for abnormal myocardial 2D strain parameters at T = 2 cumulative anthracycline dose and z-score of the diastolic left ventricular internal diameter at baseline. Children with newly diagnosed ALL showed decline of systolic and diastolic function during treatment with anthracyclines using cardiac biomarkers and myocardial 2D strain echocardiography. N-terminal-pro-brain natriuretic peptide levels were not related to echocardiographic strain parameters and cTnT was not a predictor for abnormal strain at T = 2.Therefore, the combination of cardiac biomarkers and myocardial 2D strain echocardiography is important in the assessment of cardiac function of children with ALL treated with anthracyclines.
NASA Technical Reports Server (NTRS)
Yew, Calinda; Whitehouse, Paul; Lui, Yan; Banks, Kimberly
2016-01-01
JWST Integrated Science Instruments Module (ISIM) has completed its system-level testing program at the NASA Goddard Space Flight Center (GSFC). In March 2016, ISIM was successfully delivered for integration with the Optical Telescope Element (OTE) after the successful verification of the system through a series of three cryo-vacuum (CV) tests. The first test served as a risk reduction test; the second test provided the initial verification of the fully-integrated flight instruments; and the third test verified the system in its final flight configuration. The complexity of the mission has generated challenging requirements that demand highly reliable system performance and capabilities from the Space Environment Simulator (SES) vacuum chamber. As JWST progressed through its CV testing campaign, deficiencies in the test configuration and support equipment were uncovered from one test to the next. Subsequent upgrades and modifications were implemented to improve the facility support capabilities required to achieve test requirements. This paper: (1) provides an overview of the integrated mechanical and thermal facility systems required to achieve the objectives of JWST ISIM testing, (2) compares the overall facility performance and instrumentation results from the three ISIM CV tests, and (3) summarizes lessons learned from the ISIM testing campaign.
Martínez-González, Agustín E.; Rodríguez-Jiménez, Tíscar; Piqueras, José A.; Vera-Villarroel, Pablo; Godoy, Antonio
2015-01-01
In recent years, there has been a considerable increase in the development of assessment tools for obsessive-compulsive symptomatology in children and adolescents. The Obsessive Compulsive Inventory-Child Version (OCI-CV) is a well-established assessment self-report, with special interest for the assessment of dimensions of Obsessive Compulsive Disorder (OCD). This instrument has shown to be useful for clinical and non-clinical populations in two languages (English and European Spanish). Thus, the aim of this study was to analyze the psychometric properties of the OCI-CV in a Chilean community sample. The sample consisted of 816 children and adolescents with a mean age of 14.54 years (SD = 2.21; range = 10–18 years). Factor structure, internal consistency, test-retest reliability, convergent/divergent validity, and gender/age differences were examined. Confirmatory factor analysis showed a 6-factor structure (Doubting/Checking, Obsessing, Hoarding, Washing, Ordering, and Neutralizing) with one second-order factor. Good estimates of reliability (including internal consistency and test-retest), evidence supporting the validity, and small age and gender differences (higher levels of OCD symptomatology among older participants and women, respectively) are found. The OCI-CV is also an adequate scale for the assessment of obsessions and compulsions in a general population of Chilean children and adolescents. PMID:26317404
VizieR Online Data Catalog: Exploring the SDSS data set. I. EMP & CV stars (Carbon+, 2017)
NASA Astrophysics Data System (ADS)
Carbon, D. F.; Henze, C.; Nelson, B. C.
2017-08-01
We present the results of a search for extremely metal-poor (EMP), carbon-enhanced metal-poor (CEMP), and cataclysmic variable (CV) stars using a new exploration tool based on linked scatter plots (LSPs). Our approach is especially designed to work with very large spectrum data sets such as the SDSS, LAMOST, RAVE, and Gaia data sets, and it can be applied to stellar, galaxy, and quasar spectra. As a demonstration, we conduct our search using the SDSS DR10 data set. We first created a 3326-dimensional phase space containing nearly 2 billion measures of the strengths of over 1600 spectral features in 569738 SDSS stars. These measures capture essentially all the stellar atomic and molecular species visible at the resolution of SDSS spectra. We show how LSPs can be used to quickly isolate and examine interesting portions of this phase space. To illustrate, we use LSPs coupled with cuts in selected portions of phase space to extract EMP stars, CEMP stars, and CV stars. We present identifications for 59 previously unrecognized candidate EMP stars and 11 previously unrecognized candidate CEMP stars. We also call attention to 2 candidate He II emission CV stars found by the LSP approach that have not yet been discussed in the literature. (3 data files).
Wiens, Andrew D; Prahalad, Sampath; Inan, Omer T
2016-08-01
Vibroarthrography, a method for interpreting the sounds emitted by a knee during movement, has been studied for several joint disorders since 1902. However, to our knowledge, the usefulness of this method for management of Juvenile Idiopathic Arthritis (JIA) has not been investigated. To study joint sounds as a possible new biomarker for pediatric cases of JIA we designed and built VibroCV, a platform to capture vibroarthrograms from four accelerometers; electromyograms (EMG) and inertial measurements from four wireless EMG modules; and joint angles from two Sony Eye cameras and six light-emitting diodes with commercially-available off-the-shelf parts and computer vision via OpenCV. This article explains the design of this turn-key platform in detail, and provides a sample recording captured from a pediatric subject.
Skrzypczak, Katarzyna W; Gustaw, Waldemar Z; Jabłońska-Ryś, Ewa D; Michalak-Majewska, Monika; Sławińska, Aneta; Radzki, Wojciech P; Gustaw, Klaudia M; Waśko, Adam D
2017-01-01
The increasing significance of food products containing substances with antioxidative activi- ties is currently being observed. This is mainly due to the fact that pathogenic changes underlying some diseases are related to the carcinogenic effects of free radicals. Antioxidative compounds play an important role in supporting and enhancing the body’s defense mechanisms, which is useful in preventing some civili- zation diseases. Unfortunately, it has been already proved that some synthetic antioxidants pose a potential risk in vivo. Therefore, antioxidant compounds derived from a natural source are extremely valuable. Milk is a source of biologically active precursors, which when enclosed in structural protein sequences are inactive. The hydrolysis process, involving bacterial proteolytic enzymes, might release biopeptides that act in various ways, including having antioxidant properties. The objective of this study was to determine the antioxidant properties of milk protein preparations fermented by Polish strains of L. helveticus. The research also focused on evaluating the dynamics of milk acidification by these strains and analyzing the textural properties of the skim milk fermented products obtained. The research studied Polish strains of L. helveticus: B734, 141, T80 and T105, which have not yet been used industrially. The antioxidant properties of 1% (w/v) solutions of milk protein preparations (skim milk powder, caseinoglycomacropeptide and α-lactoalbumin) fermented by these strains were determined by neutralizing the free radicals with 2,2-diphenyl-1-picrylhydrazyl (DPPH˙). Moreover, solutions of skim milk powder (SMP) fermented by the microorganisms being tested were analyzed on gel electrophoresis (SDS-PAGE). The dynamics of milk acidification by these microorganisms was also analyzed L. helveticus strains were used to prepare fermented regenerated skim milk products that were subjected to texture profile analysis (TPA) performed using a TA
Real-time detecting and tracking ball with OpenCV and Kinect
NASA Astrophysics Data System (ADS)
Osiecki, Tomasz; Jankowski, Stanislaw
2016-09-01
This paper presents a way to detect and track ball with using the OpenCV and Kinect. Object and people recognition, tracking are more and more popular topics nowadays. Described solution makes it possible to detect ball based on the range, which is set by the user and capture information about ball position in three dimensions. It can be store in the computer and use for example to display trajectory of the ball.
James, J S
1998-04-17
Trimeris, Inc. is developing a new class of HIV treatment, T-20 (pentafuside), known as a fusion inhibitor. Using a viral sequence from the actual HIV virus, researchers developed T-20 (a 36-amino acid portion of gp41) to inhibit the virus from binding to, entering, and infecting healthy cells. T-20 also blocks infected cells from fusing with uninfected cells. T-20 shows a high degree of antiviral activity, no toxicity, and a low chance of developing cross resistance. It is effective against all known strains of HIV-1 and the technology may lead to development of drugs effective against other enveloped viruses. Viral resistance is not likely to develop because T-20 was produced from a segment of the HIV virus that is constant from one strain to another. Additionally, the T-20 sequence in gp41 has to bind to a complementary sequence in gp41, ruling out most mutations that cause resistance because they are unlikely to occur in matched pairs. T-20 is targeted to be dispensed continuously by a portable infusion pump, reducing how much T-20 is needed. A phase I trial of four patients showed increased CD4 counts for larger doses, 30 mg and 100mg doses, but not at smaller doses. A larger trial of forty patients who have failed at least one protease inhibitor is planned. Further trials are proposed for children, treatment-naive adults, and adults with high viral loads. T-20 can also be used for short-term treatment to reduce drug side effects or to prevent maternal/fetal transmission early in gestation. Trimeris will apply for marketing approval early in 2000.
Velázquez, Encarna; del Villar, María; Grondona, Isabel; Monte, Enrique; González-Villa, Tomás
2006-09-01
Cryptococcus adeliensis was initially described as a psycrophilic species containing a single strain CBS 8351(T) isolated from decayed algae in Terre Adelie (Antartida). Later, a second strain of this species was isolated from an immunosuppressed patient affected by leukaemia in Germany and recently several strains from this species have been found in human patients and pigeon droppings of the same country. In this study, we isolated from sheep droppings in Spain a xylanolytic strain named LEVX01 that was phenotypically related to the strain CBS 8351(T) and showed a 100% similarity in the D1/D2 domain and 5.8S-ITS region sequences with respect to the remaining described strains of C. adeliensis. These findings suggest that this species has a wide geographical distribution and that the animal faeces are a common habitat for C. adeliensis. The chemotaxonomic analyses showed the absence of detectable amounts of xylose in the cell walls of the strains LEVX01 and CBS8351(T) in contrast to other Cryptococcus species. Interestingly, the ultrastructural study showed the presence of fimbriae in these two strains that could be involved in the attachment to the host cells and, as occurs in Candida albicans, they could also be a pathogenicity factor for the man.
Poon, Vickie Wan-kei; Lam, Linda Chiu-wa; Wong, Samuel Yeung-shan
2008-09-01
With the rapid growth of the older population, early detection of cognitive deficits is crucial in slowing down functional deterioration of the elderly persons. To examine the validity and reliability of the Chinese (Cantonese) version of the Hierarchic Dementia Scale (CV-HDS) for Chinese older persons in Hong Kong. The HDS was translated into Cantonese Chinese. The content and cultural validity were evaluated by six expert panel members. Sixty-two participants with diagnosis of dementia were recruited for evaluation. Inter-rater reliability, test-retest reliability, internal consistency and concurrent validity were examined. The CV-HDS demonstrated satisfactory psychometric properties. inter-rater reliability and test-retest reliability were high (alpha=0.89 and alpha=0.94 respectively). High value of Cronbach's alpha (alpha=0.94) demonstrated good internal consistency. The concurrent validity of CV-HDS, through correlation with its scores with that of the Chinese version of Mini Mental Status Examination, was established (ranged from r=0.58 to r=0.78, p<0.01). The CV-HDS is a reliable and valid instrument for assessing severity of cognitive impairment in Cantonese speaking Chinese people with dementia. It facilitates treatment planning to optimize the effects of functional training and rehabilitation.
Genome Sequences for Multiple Clavibacter Strains from Different Subspecies
Yuan, Xiaoli (Kat)
2017-01-01
ABSTRACT The Gram-positive genus Clavibacter harbors economically important plant pathogens infecting a variety of agricultural crops, such as potato, tomato, corn, barley, etc. Here, we report five new genome sequences, those of strains CFIA-Cs3N, CFIA-CsR14, LMG 3663T, LMG 7333T, and ATCC 33566T, from different subspecies of Clavibacter michiganensis. All these genomic data will be used for reclassification and niche-adapted feature comparisons. PMID:28935724
Genome Sequences for Multiple Clavibacter Strains from Different Subspecies.
Li, Xiang Sean; Yuan, Xiaoli Kat
2017-09-21
The Gram-positive genus Clavibacter harbors economically important plant pathogens infecting a variety of agricultural crops, such as potato, tomato, corn, barley, etc. Here, we report five new genome sequences, those of strains CFIA-Cs3N, CFIA-CsR14, LMG 3663 T , LMG 7333 T , and ATCC 33566 T , from different subspecies of Clavibacter michiganensis All these genomic data will be used for reclassification and niche-adapted feature comparisons. © Crown copyright 2017.