Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping
2012-01-01
Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in
Tang, Kai; Dong, Chun-Juan; Liu, Jin-Yuan
2016-01-01
In this study, 40 phospholipase D (PLD) genes were identified from allotetraploid cotton Gossypium hirsutum, and 20 PLD genes were examined in diploid cotton Gossypium raimondii. Combining with 19 previously identified Gossypium arboreum PLD genes, a comparative analysis was performed among the PLD gene families among allotetraploid and two diploid cottons. Based on the orthologous relationships, we found that almost each G. hirsutum PLD had a corresponding homolog in the G. arboreum and G. raimondii genomes, except for GhPLDβ3A, whose homolog GaPLDβ3 may have been lost during the evolution of G. arboreum after the interspecific hybridization. Phylogenetic analysis showed that all of the cotton PLDs were unevenly classified into six numbered subgroups: α, β/γ, δ, ε, ζ and φ. An N-terminal C2 domain was found in the α, β/γ, δ and ε subgroups, while phox homology (PX) and pleckstrin homology (PH) domains were identified in the ζ subgroup. The subgroup φ possessed a single peptide instead of a functional domain. In each phylogenetic subgroup, the PLDs showed high conservation in gene structure and amino acid sequences in functional domains. The expansion of GhPLD and GrPLD gene families were mainly attributed to segmental duplication and partly attributed to tandem duplication. Furthermore, purifying selection played a critical role in the evolution of PLD genes in cotton. Quantitative RT-PCR documented that allotetraploid cotton PLD genes were broadly expressed and each had a unique spatial and developmental expression pattern, indicating their functional diversification in cotton growth and development. Further analysis of cis-regulatory elements elucidated transcriptional regulations and potential functions. Our comparative analysis provided valuable information for understanding the putative functions of the PLD genes in cotton fiber. PMID:27213891
Molecular Mapping of Restriction-Site Associated DNA Markers In Allotetraploid Upland Cotton.
Wang, Yangkun; Ning, Zhiyuan; Hu, Yan; Chen, Jiedan; Zhao, Rui; Chen, Hong; Ai, Nijiang; Guo, Wangzhen; Zhang, Tianzhen
2015-01-01
Upland cotton (Gossypium hirsutum L., 2n = 52, AADD) is an allotetraploid, therefore the discovery of single nucleotide polymorphism (SNP) markers is difficult. The recent emergence of genome complexity reduction technologies based on the next-generation sequencing (NGS) platform has greatly expedited SNP discovery in crops with highly repetitive and complex genomes. Here we applied restriction-site associated DNA (RAD) sequencing technology for de novo SNP discovery in allotetraploid cotton. We identified 21,109 SNPs between the two parents and used these for genotyping of 161 recombinant inbred lines (RILs). Finally, a high dense linkage map comprising 4,153 loci over 3500-cM was developed based on the previous result. Using this map quantitative trait locus (QTLs) conferring fiber strength and Verticillium Wilt (VW) resistance were mapped to a more accurate region in comparison to the 1576-cM interval determined using the simple sequence repeat (SSR) genetic map. This suggests that the newly constructed map has more power and resolution than the previous SSR map. It will pave the way for the rapid identification of the marker-assisted selection in cotton breeding and cloning of QTL of interest traits.
2012-01-01
Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource
USDA-ARS?s Scientific Manuscript database
Genetic and genomic analyses of Upland cotton (Gossypium hirsutum) are difficult because it has a complex allotetraploid (AADD; 2n = 4x = 52) genome. Here we sequenced, assembled and analyzed the world's most important cultivated cotton genome with 246.2 gigabase (Gb) clean data obtained using whol...
Divergence and evolution of cotton bHLH proteins from diploid to allotetraploid.
Liu, Bingliang; Guan, Xueying; Liang, Wenhua; Chen, Jiedan; Fang, Lei; Hu, Yan; Guo, Wangzhen; Rong, Junkang; Xu, Guohua; Zhang, Tianzhen
2018-02-23
Polyploidy is considered a major driving force in genome expansion, yielding duplicated genes whose expression may be conserved or divergence as a consequence of polyploidization. We compared the genome sequences of tetraploid cotton (Gossypium hirsutum) and its two diploid progenitors, G. arboreum and G. raimondii, and found that the bHLH genes were conserved over the polyploidization. Oppositely, the expression of the homeolgous gene pairs was diversified. The biased homeologous proportion for bHLH family is significantly higher (64.6%) than the genome wide homeologous expression bias (40%). Compared with cacao (T. cacao), orthologous genes only accounted for a small proportion (41.7%) of whole cotton bHLHs family. The further Ks analysis indicated that bHLH genes underwent at least two distinct episodes of whole genome duplication: a recent duplication (1.0-60.0 million years ago, MYA, 0.005 < Ks < 0.312) and an old duplication (> 60.0 MYA, 0.312 < Ks < 3.0). The old duplication event might have played a key role in the expansion of the bHLH family. Both recent and old duplicated pairs (68.8%) showed a divergent expression profile, indicating specialized functions. The expression diversification of the duplicated genes suggested it might be a universal feature of the long-term evolution of cotton. Overview of cotton bHLH proteins indicated a conserved and divergent evolution from diploids to allotetraploid. Our results provided an excellent example for studying the long-term evolution of polyploidy.
Natural hybridization between Gossypium mustelinum and exotic allotetraploid cotton species.
de Menezes, I P P; da Silva, J O; Malafaia, G; Silveira, R D D; Barroso, P A V
2015-10-30
Cotton has been collected in Brazil for decades for its conservation, evaluation, and the use of its genetic resources. Gossypium mustelinum is an allotetraploid cotton species that only occurs in Brazil, and little is known about its genetic potential for improvement. However, the species is threatened by habitat fragmentation and interspecific hybridization with exotic species of cotton. In this study, we investigated the rate of natural hybridization in two populations of G. mustelinum in Bahia, Brazil, with G. hirsutum and G. barbadense using a set of microsatellite markers.
Song, Qingxin; Zhang, Tianzhen; Stelly, David M; Chen, Z Jeffrey
2017-05-31
Polyploidy is a pervasive evolutionary feature of all flowering plants and some animals, leading to genetic and epigenetic changes that affect gene expression and morphology. DNA methylation changes can produce meiotically stable epialleles, which are transmissible through selection and breeding. However, the relationship between DNA methylation and polyploid plant domestication remains elusive. We report comprehensive epigenomic and functional analyses, including ~12 million differentially methylated cytosines in domesticated allotetraploid cottons and their tetraploid and diploid relatives. Methylated genes evolve faster than unmethylated genes; DNA methylation changes between homoeologous loci are associated with homoeolog-expression bias in the allotetraploids. Significantly, methylation changes induced in the interspecific hybrids are largely maintained in the allotetraploids. Among 519 differentially methylated genes identified between wild and cultivated cottons, some contribute to domestication traits, including flowering time and seed dormancy. CONSTANS (CO) and CO-LIKE (COL) genes regulate photoperiodicity in Arabidopsis. COL2 is an epiallele in allotetraploid cottons. COL2A is hypermethylated and silenced, while COL2D is repressed in wild cottons but highly expressed due to methylation loss in all domesticated cottons tested. Inhibiting DNA methylation activates COL2 expression, and repressing COL2 in cultivated cotton delays flowering. We uncover epigenomic signatures of domestication traits during cotton evolution. Demethylation of COL2 increases its expression, inducing photoperiodic flowering, which could have contributed to the suitability of cotton for cultivation worldwide. These resources should facilitate epigenetic engineering, breeding, and improvement of polyploid crops.
Chen, Z; Nie, H; Grover, C E; Wang, Y; Li, P; Wang, M; Pei, H; Zhao, Y; Li, S; Wendel, J F; Hua, J
2017-05-01
Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and an allotetraploid genomic group, AD. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) are the putative contributors to the progenitor of G. hirsutum (AD 1 ), the economically important fibre-producing cotton species. Mitochondrial DNA from week-old etiolated seedlings was extracted from isolated organelles using discontinuous sucrose density gradient method. Mitochondrial genomes were sequenced, assembled, annotated and analysed in orderly. Gossypium raimondii (D 5 ) and G. arboreum (A 2 ) mitochondrial genomes were provided in this study. The mitochondrial genomes of two diploid species harboured circular genome of 643,914 bp (D 5 ) and 687,482 bp (A 2 ), respectively. They differ in size and number of repeat sequences, both contain illuminating triplicate sequences with 7317 and 10,246 bp, respectively, demonstrating dynamic difference and rearranged genome organisations. Comparing the D 5 and A 2 mitogenomes with mitogenomes of tetraploid Gossypium species (AD 1 , G. hirsutum; AD 2 , G. barbadense), a shared 11 kbp fragment loss was detected in allotetraploid species, three regions shared by G. arboreum (A 2 ), G. hirsutum (AD 1 ) and G. barbadense (AD 2 ), while eight regions were specific to G. raimondii (D 5 ). The presence/absence variations and gene-based phylogeny supported that A-genome is a cytoplasmic donor to the progenitor of allotetraploid species G. hirsutum and G. barbadense. The results present structure variations and phylogeny of Gossypium mitochondrial genome evolution. © 2017 The Authors. Plant Biology published by John Wiley & Sons Ltd on behalf of German Botanical Society, Royal Dutch Botanical Society.
A global assembly of cotton ESTs
Udall, Joshua A.; Swanson, Jordan M.; Haller, Karl; Rapp, Ryan A.; Sparks, Michael E.; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B.; Sickler, Brad A.; Wilkins, Thea A.; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R.; Pierce, Margaret L.; Essenberg, Margaret; Kim, HyeRan; Llewellyn, Danny J.; Dennis, Elizabeth S.; Kudrna, David; Wing, Rod; Paterson, Andrew H.; Soderlund, Cari; Wendel, Jonathan F.
2006-01-01
Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; AT and DT genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941
Dai, Baosheng; Guo, Huanle; Huang, Cong; Zhang, Xianlong; Lin, Zhongxu
2016-04-12
Hybrid breakdown has been well documented in various species. Relationships between genomic heterozygosity and traits-fitness have been extensively explored especially in the natural populations. But correlations between genomic heterozygosity and vegetative and reproductive traits in cotton interspecific populations have not been studied. In the current study, two reciprocal F2 populations were developed using Gossypium hirsutum cv. Emian 22 and G. barbadense acc. 3-79 as parents to study hybrid breakdown in cotton. A total of 125 simple sequence repeat (SSR) markers were used to genotype the two F2 interspecific populations. To guarantee mutual independence among the genotyped markers, the 125 SSR markers were checked by the linkage disequilibrium analysis. To our knowledge, this is a novel approach to evaluate the individual genomic heterozygosity. After marker checking, 83 common loci were used to assess the extent of genomic heterozygosity. Hybrid breakdown was found extensively in the two interspecific F2 populations particularly on the reproductive traits because of the infertility and the bare seeds. And then, the relationships between the genomic heterozygosity and the vegetative reproductive traits were investigated. The only relationships between hybrid breakdown and heterozygosity were observed in the (Emian22 × 3-79) F2 population for seed index (SI) and boll number per plant (BN). The maternal cytoplasmic environment may have a significant effect on genomic heterozygosity and on correlations between heterozygosity and reproductive traits. A novel approach was used to evaluate genomic heterozygosity in cotton; and hybrid breakdown was observed in reproductive traits in cotton. These findings may offer new insight into hybrid breakdown in allotetraploid cotton interspecific hybrids, and may be useful for the development of interspecific hybrids for cotton genetic improvement.
Chandnani, Rahul; Wang, Baohua; Draye, Xavier; Rainville, Lisa K; Auckland, Susan; Zhuang, Zhimin; Lubbers, Edward L; May, O Lloyd; Chee, Peng W; Paterson, Andrew H
2017-10-01
This study reports transmission genetics of chromosomal segments into Gossypium hirsutum from its most distant euploid relative, Gossypium mustelinum . Mutilocus interactions and structural rearrangements affect introgression and segregation of donor chromatin. Wild allotetraploid relatives of cotton are a rich source of genetic diversity that can be used in genetic improvement, but linkage drag and non-Mendelian transmission genetics are prevalent in interspecific crosses. These problems necessitate knowledge of transmission patterns of chromatin from wild donor species in cultivated recipient species. From an interspecific cross, Gossypium hirsutum × Gossypium mustelinum, we studied G. mustelinum (the most distant tetraploid relative of Upland cotton) allele retention in 35 BC 3 F 1 plants and segregation patterns in BC 3 F 2 populations totaling 3202 individuals, using 216 DNA marker loci. The average retention of donor alleles across BC 3 F 1 plants was higher than expected and the average frequency of G. mustelinum alleles in BC 3 F 2 segregating families was less than expected. Despite surprisingly high retention of G. mustelinum alleles in BC 3 F 1 , 46 genomic regions showed no introgression. Regions on chromosomes 3 and 15 lacking introgression were closely associated with possible small inversions previously reported. Nonlinear two-locus interactions are abundant among loci with single-locus segregation distortion, and among loci originating from one of the two subgenomes. Comparison of the present results with those of prior studies indicates different permeability of Upland cotton for donor chromatin from different allotetraploid relatives. Different contributions of subgenomes to two-locus interactions suggest different fates of subgenomes in the evolution of allotetraploid cottons. Transmission genetics of G. hirsutum × G. mustelinum crosses reveals allelic interactions, constraints on fixation and selection of donor alleles, and challenges with
Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects
Malik, Waqas; Iqbal, Muhammad Zaffar; Ali Khan, Asif; Qayyum, Abdul; Ali Abid, Muhammad; Noor, Etrat; Qadir Ahmad, Muhammad; Hasan Abbasi, Ghulam
2014-01-01
Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L.) is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS) technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS) are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i) comparative analysis of low- and high-throughput marker technologies available in cotton, (ii) genetic diversity in the available wild and improved gene pools of cotton, (iii) identification of the genomic regions within cotton genome underlying economic traits, and (iv) marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands. PMID:25401149
Dinh Thi, Vinh Ha; Coriton, Olivier; Le Clainche, Isabelle; Arnaud, Dominique; Gordon, Sean P.; Linc, Gabriella; Catalan, Pilar; Hasterok, Robert; Vogel, John P.; Jahier, Joseph; Chalhoub, Boulos
2016-01-01
Brachypodium hybridum (2n = 30) is a natural allopolyploid with highly divergent sub-genomes derived from two extant diploid species, B. distachyon (2n = 10) and B. stacei (2n = 20) that differ in chromosome evolution and number. We created synthetic B. hybridum allotetraploids by hybridizing various lines of B. distachyon and B. stacei. The initial amphihaploid F1 interspecific hybrids were obtained at low frequencies when B. distachyon was used as the maternal parent (0.15% or 0.245% depending on the line used) and were sterile. No hybrids were obtained from reciprocal crosses or when autotetraploids of the parental species were crossed. Colchicine treatment was used to double the genome of the F1 amphihaploid lines leading to allotetraploids. The genome-doubled F1 plants produced a few S1 (first selfed generation) seeds after self-pollination. S1 plants from one parental combination (Bd3-1×Bsta5) were fertile and gave rise to further generations whereas those of another parental combination (Bd21×ABR114) were sterile, illustrating the importance of the parental lineages crossed. The synthetic allotetraploids were stable and resembled the natural B. hybridum at the phenotypic, cytogenetic and genomic levels. The successful creation of synthetic B. hybridum offers the possibility to study changes in genome structure and regulation at the earliest stages of allopolyploid formation in comparison with the parental species and natural B. hybridum. PMID:27936041
Genome-wide comparative analysis of NBS-encoding genes in four Gossypium species
USDA-ARS?s Scientific Manuscript database
Nucleotide binding site (NBS) genes encode a large family of disease resistance (R) proteins in plants. The availability of genomic data of the two diploid cotton species, Gossypium arboreum and Gossypium raimondii, and the two allotetraploid cotton species, Gossypium hirsutum (TM-1) and Gossypium ...
Karyotype Stability and Unbiased Fractionation in the Paleo-Allotetraploid Cucurbita Genomes.
Sun, Honghe; Wu, Shan; Zhang, Guoyu; Jiao, Chen; Guo, Shaogui; Ren, Yi; Zhang, Jie; Zhang, Haiying; Gong, Guoyi; Jia, Zhangcai; Zhang, Fan; Tian, Jiaxing; Lucas, William J; Doyle, Jeff J; Li, Haizhen; Fei, Zhangjun; Xu, Yong
2017-10-09
The Cucurbita genus contains several economically important species in the Cucurbitaceae family. Here, we report high-quality genome sequences of C. maxima and C. moschata and provide evidence supporting an allotetraploidization event in Cucurbita. We are able to partition the genome into two homoeologous subgenomes based on different genetic distances to melon, cucumber, and watermelon in the Benincaseae tribe. We estimate that the two diploid progenitors successively diverged from Benincaseae around 31 and 26 million years ago (Mya), respectively, and the allotetraploidization happened at some point between 26 Mya and 3 Mya, the estimated date when C. maxima and C. moschata diverged. The subgenomes have largely maintained the chromosome structures of their diploid progenitors. Such long-term karyotype stability after polyploidization has not been commonly observed in plant polyploids. The two subgenomes have retained similar numbers of genes, and neither subgenome is globally dominant in gene expression. Allele-specific expression analysis in the C. maxima × C. moschata interspecific F 1 hybrid and their two parents indicates the predominance of trans-regulatory effects underlying expression divergence of the parents, and detects transgressive gene expression changes in the hybrid correlated with heterosis in important agronomic traits. Our study provides insights into polyploid genome evolution and valuable resources for genetic improvement of cucurbit crops. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.
CottonDB: A resource for cotton genome research
USDA-ARS?s Scientific Manuscript database
CottonDB (http://cottondb.org/) is a database and web resource for cotton genomic and genetic research. Created in 1995, CottonDB was among the first plant genome databases established by the USDA-ARS. Accessed through a website interface, the database aims to be a convenient, inclusive medium of ...
Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal
2016-01-01
The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939
USDA-ARS?s Scientific Manuscript database
Like many agricultural crops, the cultivated cotton genome is large and polyploid (~2.5Gb), consisting of two very similar repeat-rich subgenomes, whose size and complexity pose significant challenges for accurate genome reconstruction using whole-genome shotgun approaches. A strategy for accurately...
Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong
2015-01-01
Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818
Lu, Cairui; Zou, Changsong; Zhang, Youping; Yu, Daoqian; Cheng, Hailiang; Jiang, Pengfei; Yang, Wencui; Wang, Qiaolian; Feng, Xiaoxu; Prosper, Mtawa Andrew; Guo, Xiaoping; Song, Guoli
2015-02-06
Tetraploid cotton contains two sets of homologous chromosomes, the At- and Dt-subgenomes. Consequently, many markers in cotton were mapped to multiple positions during linkage genetic map construction, posing a challenge to anchoring linkage groups and mapping economically-important genes to particular chromosomes. Chromosome-specific markers could solve this problem. Recently, the genomes of two diploid species were sequenced whose progenitors were putative contributors of the At- and Dt-subgenomes to tetraploid cotton. These sequences provide a powerful tool for developing chromosome-specific markers given the high level of synteny among tetraploid and diploid cotton genomes. In this study, simple sequence repeats (SSRs) on each chromosome in the two diploid genomes were characterized. Chromosome-specific SSRs were developed by comparative analysis and proved to distinguish chromosomes. A total of 200,744 and 142,409 SSRs were detected on the 13 chromosomes of Gossypium arboreum L. and Gossypium raimondii Ulbrich, respectively. Chromosome-specific SSRs were obtained by comparing SSR flanking sequences from each chromosome with those from the other 25 chromosomes. The average was 7,996 per chromosome. To confirm their chromosome specificity, these SSRs were used to distinguish two homologous chromosomes in tetraploid cotton through linkage group construction. The chromosome-specific SSRs and previously-reported chromosome markers were grouped together, and no marker mapped to another homologous chromosome, proving that the chromosome-specific SSRs were unique and could distinguish homologous chromosomes in tetraploid cotton. Because longer dinucleotide AT-rich repeats were the most polymorphic in previous reports, the SSRs on each chromosome were sorted by motif type and repeat length for convenient selection. The primer sequences of all chromosome-specific SSRs were also made publicly available. Chromosome-specific SSRs are efficient tools for chromosome
The cotton centromere contains a Ty3-gypsy-like LTR retroelement.
Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto
2012-01-01
The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species.
CottonGen: a genomics, genetics and breeding database for cotton research
USDA-ARS?s Scientific Manuscript database
CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, vis...
Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang
2015-01-01
Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660
The Cotton Centromere Contains a Ty3-gypsy-like LTR Retroelement
Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto
2012-01-01
The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species. PMID:22536361
Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun
2012-01-01
Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and “fixed heterosis” in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621
Cocoa/Cotton Comparative Genomics
USDA-ARS?s Scientific Manuscript database
With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...
Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.
Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping
2016-01-01
The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.
Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species
Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo
2016-01-01
The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527
Multiple hybrid de novo genome assembly of finger millet, an orphan allotetraploid crop
Hatakeyama, Masaomi; Aluri, Sirisha; Balachadran, Mathi Thumilan; Sivarajan, Sajeevan Radha; Patrignani, Andrea; Grüter, Simon; Poveda, Lucy; Shimizu-Inatsugi, Rie; Baeten, John; Francoijs, Kees-Jan; Nataraja, Karaba N; Reddy, Yellodu A Nanja; Phadnis, Shamprasad; Ravikumar, Ramapura L; Schlapbach, Ralph; Sreeman, Sheshshayee M; Shimizu, Kentaro K
2018-01-01
Abstract Finger millet (Eleusine coracana (L.) Gaertn) is an important crop for food security because of its tolerance to drought, which is expected to be exacerbated by global climate changes. Nevertheless, it is often classified as an orphan/underutilized crop because of the paucity of scientific attention. Among several small millets, finger millet is considered as an excellent source of essential nutrient elements, such as iron and zinc; hence, it has potential as an alternate coarse cereal. However, high-quality genome sequence data of finger millet are currently not available. One of the major problems encountered in the genome assembly of this species was its polyploidy, which hampers genome assembly compared with a diploid genome. To overcome this problem, we sequenced its genome using diverse technologies with sufficient coverage and assembled it via a novel multiple hybrid assembly workflow that combines next-generation with single-molecule sequencing, followed by whole-genome optical mapping using the Bionano Irys® system. The total number of scaffolds was 1,897 with an N50 length >2.6 Mb and detection of 96% of the universal single-copy orthologs. The majority of the homeologs were assembled separately. This indicates that the proposed workflow is applicable to the assembly of other allotetraploid genomes. PMID:28985356
Jeridi, Mouna; Perrier, Xavier; Rodier-Goud, Marguerite; Ferchichi, Ali; D'Hont, Angélique; Bakry, Frédéric
2012-12-01
Edible bananas originated mainly from two wild species, Musa acuminata Colla (AA) and Musa balbisiana Colla (BB), and triploid cultivars with an AAA, AAB or ABB genome are the most widely used. In the present study, chromosome pairing affinities are investigated in a sterile AB Indian variety and in its fertile colchicine-induced allotetraploid (AABB) derivative to determine the inheritance pattern of the tetraploid genotype. The potential implications of interspecific recombination and chromosomal composition of diploid gametes for Musa improvement are presented. The pairing of different chromosome sets at diploid and tetraploid levels was investigated through a combination of conventional cytogenetic and genomic in-situ hybridization (GISH) analyses of meiotic chromosomes, leading to a likelihood model of the pairing behaviour. GISH analysis of mitotic chromosomes was also conducted to reveal the chromosome constitution of hybrids derived from crosses involving the allotetraploid genotype. Analysis of chromosome associations at both ploidy levels suggested that the newly formed allotetraploid behaves as a 'segmental allotetraploid' with three chromosome sets in a tetrasomic pattern, three sets in a likely disomic pattern and the five remaining sets in an intermediate pattern. Balanced and unbalanced diploid gametes were detected in progenies, with the chromosome constitution appearing to be more homogenous in pollen than in ovules. Colchicine-induced allotetraploids in Musa provide access to the genetic background of natural AB varieties. The segmental inheritance pattern exhibited by the AABB allotetraploid genotype implies chromosome exchanges between M. acuminata and M. balbisiana species and opens new horizons for reciprocal transfer of valuable alleles.
USDA-ARS?s Scientific Manuscript database
Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...
Multiple hybrid de novo genome assembly of finger millet, an orphan allotetraploid crop.
Hatakeyama, Masaomi; Aluri, Sirisha; Balachadran, Mathi Thumilan; Sivarajan, Sajeevan Radha; Patrignani, Andrea; Grüter, Simon; Poveda, Lucy; Shimizu-Inatsugi, Rie; Baeten, John; Francoijs, Kees-Jan; Nataraja, Karaba N; Reddy, Yellodu A Nanja; Phadnis, Shamprasad; Ravikumar, Ramapura L; Schlapbach, Ralph; Sreeman, Sheshshayee M; Shimizu, Kentaro K
2017-09-05
Finger millet (Eleusine coracana (L.) Gaertn) is an important crop for food security because of its tolerance to drought, which is expected to be exacerbated by global climate changes. Nevertheless, it is often classified as an orphan/underutilized crop because of the paucity of scientific attention. Among several small millets, finger millet is considered as an excellent source of essential nutrient elements, such as iron and zinc; hence, it has potential as an alternate coarse cereal. However, high-quality genome sequence data of finger millet are currently not available. One of the major problems encountered in the genome assembly of this species was its polyploidy, which hampers genome assembly compared with a diploid genome. To overcome this problem, we sequenced its genome using diverse technologies with sufficient coverage and assembled it via a novel multiple hybrid assembly workflow that combines next-generation with single-molecule sequencing, followed by whole-genome optical mapping using the Bionano Irys® system. The total number of scaffolds was 1,897 with an N50 length >2.6 Mb and detection of 96% of the universal single-copy orthologs. The majority of the homeologs were assembled separately. This indicates that the proposed workflow is applicable to the assembly of other allotetraploid genomes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen
2010-10-01
Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.
Jeridi, Mouna; Perrier, Xavier; Rodier-Goud, Marguerite; Ferchichi, Ali; D'Hont, Angélique; Bakry, Frédéric
2012-01-01
Background and Aims Edible bananas originated mainly from two wild species, Musa acuminata Colla (AA) and Musa balbisiana Colla (BB), and triploid cultivars with an AAA, AAB or ABB genome are the most widely used. In the present study, chromosome pairing affinities are investigated in a sterile AB Indian variety and in its fertile colchicine-induced allotetraploid (AABB) derivative to determine the inheritance pattern of the tetraploid genotype. The potential implications of interspecific recombination and chromosomal composition of diploid gametes for Musa improvement are presented. Methods The pairing of different chromosome sets at diploid and tetraploid levels was investigated through a combination of conventional cytogenetic and genomic in-situ hybridization (GISH) analyses of meiotic chromosomes, leading to a likelihood model of the pairing behaviour. GISH analysis of mitotic chromosomes was also conducted to reveal the chromosome constitution of hybrids derived from crosses involving the allotetraploid genotype. Key Results Analysis of chromosome associations at both ploidy levels suggested that the newly formed allotetraploid behaves as a ‘segmental allotetraploid’ with three chromosome sets in a tetrasomic pattern, three sets in a likely disomic pattern and the five remaining sets in an intermediate pattern. Balanced and unbalanced diploid gametes were detected in progenies, with the chromosome constitution appearing to be more homogenous in pollen than in ovules. Conclusions Colchicine-induced allotetraploids in Musa provide access to the genetic background of natural AB varieties. The segmental inheritance pattern exhibited by the AABB allotetraploid genotype implies chromosome exchanges between M. acuminata and M. balbisiana species and opens new horizons for reciprocal transfer of valuable alleles. PMID:23087127
Assessing the breeding potential of extra-long staple germplasm in an upland cotton breeding program
USDA-ARS?s Scientific Manuscript database
Fiber quality improvement of upland cotton (Gossypium hirsutum L.) is essential to increase the value and competitiveness of cotton fiber. The closely related allotetraploid species G. barbadense has long been targeted as a source of beneficial fiber quality alleles. Although interspecific hybridiza...
A draft physical map of a D-genome cotton species (Gossypium raimondii)
2010-01-01
Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427
Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing
2014-11-06
Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved
COTIP: Cotton TILLING Platform, a Resource for Plant Improvement and Reverse Genetic Studies
Aslam, Usman; Cheema, Hafiza M. N.; Ahmad, Sheraz; Khan, Iqrar A.; Malik, Waqas; Khan, Asif A.
2016-01-01
Cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (Gossypium hirsutum L.) carrying both A and D genome. Since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. Mutation based improvement strategies provide an effective way of creating new allelic variations. Targeting Induced Local Lesions IN Genomes (TILLING) provides a mutation based reverse genetic strategy to create and evaluate induced genetic variability at DNA level. Here, we report development and testing of TILLING populations of allotetraploid cotton (G. hirsutum) for functional genomic studies and mutation based enrichment of cotton genetic resources. Seed of two cotton cultivars “PB-899 and PB-900” were mutagenized with 0.3 and 0.2% (v/v) ethyl methanesulfonate, respectively. The phenotyping of M1 and M2 populations presented numerous mutants regarding the branching pattern, leaf morphology, disease resistance, photosynthetic lesions and flower sterility. Molecular screening for point mutations was performed by TILLING PCR aided CEL1 mismatch cleavage. To estimate the mutation frequency in the mutant genomes, five gene classes were TILLed in 8000 M2 plants of each var. “PB-899” and “PB-900.” These include actin (GhACT), Pectin Methyl Esterase (GhPME), sucrose synthase (GhSUS), resistance gene analog, and defense response gene (DRGs). The var. PB-899 was harboring 47% higher mutation induction rate than PB-900. The highest rate of mutation frequency was identified for NAC-TF5 (EU706348) of DRGs class, ranging from 1/58 kb in PB-899 to 1/105 kb in PB-900. The mutation screening assay revealed the presence of significant proportion of induced mutations in cotton TILLING populations such as 1/153 kb and 1/326 kb in var. “PB-899” and “PB-900,” respectively. The establishment of a cotton TILLING platform (COTIP) and data obtained from
Genomics-enabled analysis of the emergent disease cotton bacterial blight
Phillips, Anne Z.; Burke, Jillian; Bunn, J. Imani; Allen, Tom W.; Wheeler, Terry
2017-01-01
Cotton bacterial blight (CBB), an important disease of (Gossypium hirsutum) in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm) strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars. PMID:28910288
Wang, Xiyin; Guo, Hui; Wang, Jinpeng; Lei, Tianyu; Liu, Tao; Wang, Zhenyi; Li, Yuxian; Lee, Tae-Ho; Li, Jingping; Tang, Haibao; Jin, Dianchuan; Paterson, Andrew H
2016-02-01
The 'apparently' simple genomes of many angiosperms mask complex evolutionary histories. The reference genome sequence for cotton (Gossypium spp.) revealed a ploidy change of a complexity unprecedented to date, indeed that could not be distinguished as to its exact dosage. Herein, by developing several comparative, computational and statistical approaches, we revealed a 5× multiplication in the cotton lineage of an ancestral genome common to cotton and cacao, and proposed evolutionary models to show how such a decaploid ancestor formed. The c. 70% gene loss necessary to bring the ancestral decaploid to its current gene count appears to fit an approximate geometrical model; that is, although many genes may be lost by single-gene deletion events, some may be lost in groups of consecutive genes. Gene loss following cotton decaploidy has largely just reduced gene copy numbers of some homologous groups. We designed a novel approach to deconvolute layers of chromosome homology, providing definitive information on gene orthology and paralogy across broad evolutionary distances, both of fundamental value and serving as an important platform to support further studies in and beyond cotton and genomics communities. No claim to original US government works. New Phytologist © 2015 New Phytologist Trust.
Xu, Zhanyou; Yu, Jing; Kohel, Russell J; Percy, Richard G; Beavis, William D; Main, Dorrie; Yu, John Z
2015-07-01
Cotton fiber represents the largest single cell in plants and they serve as models to study cell development. This study investigated the distribution and evolution of fiber Unigenes anchored to recombination hotspots between tetraploid cotton (Gossypium hirsutum) At and Dt subgenomes, and within a parental diploid cotton (Gossypium raimondii) D genome. Comparative analysis of At vs D and Dt vs D showed that 1) the D genome provides many fiber genes after its merger with another parental diploid cotton (Gossypium arboreum) A genome although the D genome itself does not produce any spinnable fiber; 2) similarity of fiber genes is higher between At vs D than between Dt vs D genomic hotspots. This is the first report that fiber genes have higher similarity between At and D than between Dt and D. The finding provides new insights into cotton genomic regions that would facilitate genetic improvement of natural fiber properties. Published by Elsevier Inc.
Paterson, Andrew H.; Wang, Xuelin; Xu, Yiqing; Wu, Dongyang; Qu, Yanshu; Jiang, Anna; Ye, Qiaolin
2016-01-01
Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp) genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt) DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb) in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense) than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants. PMID:27847816
Genome sequence of the cultivated cotton Gossypium arboreum
USDA-ARS?s Scientific Manuscript database
Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...
2013-01-01
Background Cotton, one of the world’s leading crops, is important to the world’s textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. Results We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome
Li, Ximei; Jin, Xin; Wang, Hantao; Zhang, Xianlong; Lin, Zhongxu
2016-01-01
A high-density linkage map was constructed using 1,885 newly obtained loci and 3,747 previously published loci, which included 5,152 loci with 4696.03 cM in total length and 0.91 cM in mean distance. Homology analysis in the cotton genome further confirmed the 13 expected homologous chromosome pairs and revealed an obvious inversion on Chr10 or Chr20 and repeated inversions on Chr07 or Chr16. In addition, two reciprocal translocations between Chr02 and Chr03 and between Chr04 and Chr05 were confirmed. Comparative genomics between the tetraploid cotton and the diploid cottons showed that no major structural changes exist between DT and D chromosomes but rather between AT and A chromosomes. Blast analysis between the tetraploid cotton genome and the mixed genome of two diploid cottons showed that most AD chromosomes, regardless of whether it is from the AT or DT genome, preferentially matched with the corresponding homologous chromosome in the diploid A genome, and then the corresponding homologous chromosome in the diploid D genome, indicating that the diploid D genome underwent converted evolution by the diploid A genome to form the DT genome during polyploidization. In addition, the results reflected that a series of chromosomal translocations occurred among Chr01/Chr15, Chr02/Chr14, Chr03/Chr17, Chr04/Chr22, and Chr05/Chr19. PMID:27084896
Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres.
Paterson, Andrew H; Wendel, Jonathan F; Gundlach, Heidrun; Guo, Hui; Jenkins, Jerry; Jin, Dianchuan; Llewellyn, Danny; Showmaker, Kurtis C; Shu, Shengqiang; Udall, Joshua; Yoo, Mi-jeong; Byers, Robert; Chen, Wei; Doron-Faigenboim, Adi; Duke, Mary V; Gong, Lei; Grimwood, Jane; Grover, Corrinne; Grupp, Kara; Hu, Guanjing; Lee, Tae-ho; Li, Jingping; Lin, Lifeng; Liu, Tao; Marler, Barry S; Page, Justin T; Roberts, Alison W; Romanel, Elisson; Sanders, William S; Szadkowski, Emmanuel; Tan, Xu; Tang, Haibao; Xu, Chunming; Wang, Jinpeng; Wang, Zining; Zhang, Dong; Zhang, Lan; Ashrafi, Hamid; Bedon, Frank; Bowers, John E; Brubaker, Curt L; Chee, Peng W; Das, Sayan; Gingle, Alan R; Haigler, Candace H; Harker, David; Hoffmann, Lucia V; Hovav, Ran; Jones, Donald C; Lemke, Cornelia; Mansoor, Shahid; ur Rahman, Mehboob; Rainville, Lisa N; Rambani, Aditi; Reddy, Umesh K; Rong, Jun-kang; Saranga, Yehoshua; Scheffler, Brian E; Scheffler, Jodi A; Stelly, David M; Triplett, Barbara A; Van Deynze, Allen; Vaslin, Maite F S; Waghmare, Vijay N; Walford, Sally A; Wright, Robert J; Zaki, Essam A; Zhang, Tianzhen; Dennis, Elizabeth S; Mayer, Klaus F X; Peterson, Daniel G; Rokhsar, Daniel S; Wang, Xiyin; Schmutz, Jeremy
2012-12-20
Polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. Here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (Myr) ago, and allopolyploidy reuniting divergent Gossypium genomes approximately 1-2 Myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (Gossypium hirsutum and Gossypium barbadense), genetic complexity equalled only by Brassica among sequenced angiosperms. Nascent fibre evolution, before allopolyploidy, is elucidated by comparison of spinnable-fibred Gossypium herbaceum A and non-spinnable Gossypium longicalyx F genomes to one another and the outgroup D genome of non-spinnable Gossypium raimondii. The sequence of a G. hirsutum A(t)D(t) (in which 't' indicates tetraploid) cultivar reveals many non-reciprocal DNA exchanges between subgenomes that may have contributed to phenotypic innovation and/or other emergent properties such as ecological adaptation by polyploids. Most DNA-level novelty in G. hirsutum recombines alleles from the D-genome progenitor native to its New World habitat and the Old World A-genome progenitor in which spinnable fibre evolved. Coordinated expression changes in proximal groups of functionally distinct genes, including a nuclear mitochondrial DNA block, may account for clusters of cotton-fibre quantitative trait loci affecting diverse traits. Opportunities abound for dissecting emergent properties of other polyploids, particularly angiosperms, by comparison to diploid progenitors and outgroups.
Karanyicz, Edina; Antunovics, Zsuzsa; Kallai, Z; Sipiczki, M
2017-06-01
Saccharomyces strains with chimerical genomes consisting of mosaics of the genomes of different species ("natural hybrids") occur quite frequently among industrial and wine strains. The most widely endorsed hypothesis is that the mosaics are introgressions acquired via hybridisation and repeated backcrosses of the hybrids with one of the parental species. However, the interspecies hybrids are sterile, unable to mate with their parents. Here, we show by analysing synthetic Saccharomyces kudriavzevii x Saccharomyces uvarum hybrids that mosaic (chimeric) genomes can arise without introgressive backcrosses. These species are biologically separated by a double sterility barrier (sterility of allodiploids and F1 sterility of allotetraploids). F1 sterility is due to the diploidisation of the tetraploid meiosis resulting in MAT a /MAT α heterozygosity which suppresses mating in the spores. This barrier can occasionally be broken down by malsegregation of autosyndetically paired chromosomes carrying the MAT loci (loss of MAT heterozygosity). Subsequent malsegregation of additional autosyndetically paired chromosomes and occasional allosyndetic interactions chimerise the hybrid genome. Chromosomes are preferentially lost from the S. kudriavzevii subgenome. The uniparental transmission of the mitochondrial DNA to the hybrids indicates that nucleo-mitochondrial interactions might affect the direction of the genomic changes. We propose the name GARMe (Genome AutoReduction in Meiosis) for this process of genome reduction and chimerisation which involves no introgressive backcrossings. It opens a way to transfer genetic information between species and thus to get one step ahead after hybridisation in the production of yeast strains with beneficial combinations of properties of different species.
Li, Ximei; Jin, Xin; Wang, Hantao; Zhang, Xianlong; Lin, Zhongxu
2016-06-01
A high-density linkage map was constructed using 1,885 newly obtained loci and 3,747 previously published loci, which included 5,152 loci with 4696.03 cM in total length and 0.91 cM in mean distance. Homology analysis in the cotton genome further confirmed the 13 expected homologous chromosome pairs and revealed an obvious inversion on Chr10 or Chr20 and repeated inversions on Chr07 or Chr16. In addition, two reciprocal translocations between Chr02 and Chr03 and between Chr04 and Chr05 were confirmed. Comparative genomics between the tetraploid cotton and the diploid cottons showed that no major structural changes exist between DT and D chromosomes but rather between AT and A chromosomes. Blast analysis between the tetraploid cotton genome and the mixed genome of two diploid cottons showed that most AD chromosomes, regardless of whether it is from the AT or DT genome, preferentially matched with the corresponding homologous chromosome in the diploid A genome, and then the corresponding homologous chromosome in the diploid D genome, indicating that the diploid D genome underwent converted evolution by the diploid A genome to form the DT genome during polyploidization. In addition, the results reflected that a series of chromosomal translocations occurred among Chr01/Chr15, Chr02/Chr14, Chr03/Chr17, Chr04/Chr22, and Chr05/Chr19. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces.
Alexander, William G; Peris, David; Pfannenstiel, Brandon T; Opulente, Dana A; Kuang, Meihua; Hittinger, Chris Todd
2016-04-01
Saccharomyces interspecies hybrids are critical biocatalysts in the fermented beverage industry, including in the production of lager beers, Belgian ales, ciders, and cold-fermented wines. Current methods for making synthetic interspecies hybrids are cumbersome and/or require genome modifications. We have developed a simple, robust, and efficient method for generating allotetraploid strains of prototrophic Saccharomyces without sporulation or nuclear genome manipulation. S. cerevisiae×S. eubayanus, S. cerevisiae×S. kudriavzevii, and S. cerevisiae×S. uvarum designer hybrid strains were created as synthetic lager, Belgian, and cider strains, respectively. The ploidy and hybrid nature of the strains were confirmed using flow cytometry and PCR-RFLP analysis, respectively. This method provides an efficient means for producing novel synthetic hybrids for beverage and biofuel production, as well as for constructing tetraploids to be used for basic research in evolutionary genetics and genome stability. Copyright © 2015 Elsevier Inc. All rights reserved.
Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban
2010-11-01
Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.
Wu, Ying; Liu, Fang; Yang, Dai-Gang; Li, Wei; Zhou, Xiao-Jian; Pei, Xiao-Yu; Liu, Yan-Gai; He, Kun-Lun; Zhang, Wen-Sheng; Ren, Zhong-Ying; Zhou, Ke-Hai; Ma, Xiong-Feng; Li, Zhong-Hu
2018-01-01
Cotton is one of the most economically important fiber crop plants worldwide. The genus Gossypium contains a single allotetraploid group (AD) and eight diploid genome groups (A–G and K). However, the evolution of repeat sequences in the chloroplast genomes and the phylogenetic relationships of Gossypium species are unclear. Thus, we determined the variations in the repeat sequences and the evolutionary relationships of 40 cotton chloroplast genomes, which represented the most diverse in the genus, including five newly sequenced diploid species, i.e., G. nandewarense (C1-n), G. armourianum (D2-1), G. lobatum (D7), G. trilobum (D8), and G. schwendimanii (D11), and an important semi-wild race of upland cotton, G. hirsutum race latifolium (AD1). The genome structure, gene order, and GC content of cotton species were similar to those of other higher plant plastid genomes. In total, 2860 long sequence repeats (>10 bp in length) were identified, where the F-genome species had the largest number of repeats (G. longicalyx F1: 108) and E-genome species had the lowest (G. stocksii E1: 53). Large-scale repeat sequences possibly enrich the genetic information and maintain genome stability in cotton species. We also identified 10 divergence hotspot regions, i.e., rpl33-rps18, psbZ-trnG (GCC), rps4-trnT (UGU), trnL (UAG)-rpl32, trnE (UUC)-trnT (GGU), atpE, ndhI, rps2, ycf1, and ndhF, which could be useful molecular genetic markers for future population genetics and phylogenetic studies. Site-specific selection analysis showed that some of the coding sites of 10 chloroplast genes (atpB, atpE, rps2, rps3, petB, petD, ccsA, cemA, ycf1, and rbcL) were under protein sequence evolution. Phylogenetic analysis based on the whole plastomes suggested that the Gossypium species grouped into six previously identified genetic clades. Interestingly, all 13 D-genome species clustered into a strong monophyletic clade. Unexpectedly, the cotton species with C, G, and K-genomes were admixed and
Andres, Ryan J; Bowman, Daryl T; Kaur, Baljinder; Kuraparthy, Vasu
2014-01-01
A major leaf shape locus (L) was mapped with molecular markers and genomically targeted to a small region in the D-genome of cotton. By using expression analysis and candidate gene mapping, two LMI1 -like genes are identified as possible candidates for leaf shape trait in cotton. Leaf shape in cotton is an important trait that influences yield, flowering rates, disease resistance, lint trash, and the efficacy of foliar chemical application. The leaves of okra leaf cotton display a significantly enhanced lobing pattern, as well as ectopic outgrowths along the lobe margins when compared with normal leaf cotton. These phenotypes are the hallmark characteristics of mutations in various known modifiers of leaf shape that culminate in the mis/over-expression of Class I KNOX genes. To better understand the molecular and genetic processes underlying leaf shape in cotton, a normal leaf accession (PI607650) was crossed to an okra leaf breeding line (NC05AZ21). An F2 population of 236 individuals confirmed the incompletely dominant single gene nature of the okra leaf shape trait in Gossypium hirsutum L. Molecular mapping with simple sequence repeat markers localized the leaf shape gene to 5.4 cM interval in the distal region of the short arm of chromosome 15. Orthologous mapping of the closely linked markers with the sequenced diploid D-genome (Gossypium raimondii) tentatively resolved the leaf shape locus to a small genomic region. RT-PCR-based expression analysis and candidate gene mapping indicated that the okra leaf shape gene (L (o) ) in cotton might be an upstream regulator of Class I KNOX genes. The linked molecular markers and delineated genomic region in the sequenced diploid D-genome will assist in the future high-resolution mapping and map-based cloning of the leaf shape gene in cotton.
Expansion and stress responses of the AP2/EREBP superfamily in cotton.
Liu, Chunxiao; Zhang, Tianzhen
2017-01-31
The allotetraploid cotton originated from one hybridization event between an extant progenitor of Gosssypium herbaceum (A 1 ) or G. arboreum (A 2 ) and another progenitor, G. raimondii Ulbrich (D 5 ) 1-1.5 million years ago (Mya). The APETALA2/ethylene-responsive element binding protein (AP2/EREBP) transcription factors constitute one of the largest and most conserved gene families in plants. They are characterized by their AP2 domain, which comprises 60-70 amino acids, and are classified into four main subfamilies: the APETALA2 (AP2), Related to ABI3/VP1 (RAV), Dehydration-Responsive Element Binding protein (DREB) and Ethylene-Responsive Factor (ERF) subfamilies. The AP2/EREBP genes play crucial roles in plant growth, development and biotic and abiotic stress responses. Hence, understanding the molecular characteristics of cotton stress tolerance and gene family expansion would undoubtedly facilitate cotton resistance breeding and evolution research. A total of 269 AP2/EREBP genes were identified in the G. raimondii (D5) cotton genome. The protein domain architecture and intron/exon structure are simple and relatively conserved within each subfamily. They are distributed throughout all chromosomes but are clustered on various chromosomes due to genomic tandem duplication. We identified 73 tandem duplicated genes and 221 segmental duplicated gene pairs which contributed to the expansion of AP2/EREBP superfamily. Of them, tandem duplication was the most important force of the expansion of the B3 group. Transcriptome analysis showed that 504 AP2/EREBP genes were expressed in at least one tested G. hirsutum TM-1 tissues. In G. hirsutum, 151 non-repeated genes of the DREB and ERF subfamily genes were responsive to different stresses: 132 genes were induced by cold, 63 genes by drought and 94 genes by heat. qRT-PCR confirmed that 13 GhDREB and 15 GhERF genes were induced by cold and/or drought. No transcripts detected for 53 of the 111 tandem duplicated genes in TM-1
Zhu, Bin; Shao, Yujiao; Pan, Qi; Ge, Xianhong; Li, Zaiyun
2015-01-01
Aneuploidy with loss of entire chromosomes from normal complement disrupts the balanced genome and is tolerable only by polyploidy plants. In this study, the monosomic and nullisomic plants losing one or two copies of C2 chromosome from allotetraploid Brassica napus L. (2n = 38, AACC) were produced and compared for their phenotype and transcriptome. The monosomics gave a plant phenotype very similar to the original donor, but the nullisomics had much smaller stature and also shorter growth period. By the comparative analyses on the global transcript profiles with the euploid donor, genome-wide alterations in gene expression were revealed in two aneuploids, and their majority of differentially expressed genes (DEGs) resulted from the trans-acting effects of the zero and one copy of C2 chromosome. The higher number of up-regulated genes than down-regulated genes on other chromosomes suggested that the genome responded to the C2 loss via enhancing the expression of certain genes. Particularly, more DEGs were detected in the monosomics than nullisomics, contrasting with their phenotypes. The gene expression of the other chromosomes was differently affected, and several dysregulated domains in which up- or downregulated genes obviously clustered were identifiable. But the mean gene expression (MGE) for homoeologous chromosome A2 reduced with the C2 loss. Some genes and their expressions on C2 were correlated with the phenotype deviations in the aneuploids. These results provided new insights into the transcriptomic perturbation of the allopolyploid genome elicited by the loss of individual chromosome. PMID:26442076
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Fang, Lei; Wang, Qiong; Hu, Yan; Jia, Yinhua; Chen, Jiedan; Liu, Bingliang; Zhang, Zhiyuan; Guan, Xueying; Chen, Shuqi; Zhou, Baoliang; Mei, Gaofu; Sun, Junling; Pan, Zhaoe; He, Shoupu; Xiao, Songhua; Shi, Weijun; Gong, Wenfang; Liu, Jianguang; Ma, Jun; Cai, Caiping; Zhu, Xiefei; Guo, Wangzhen; Du, Xiongming; Zhang, Tianzhen
2017-07-01
Upland cotton (Gossypium hirsutum) is the most important natural fiber crop in the world. The overall genetic diversity among cultivated species of cotton and the genetic changes that occurred during their improvement are poorly understood. Here we report a comprehensive genomic assessment of modern improved upland cotton based on the genome-wide resequencing of 318 landraces and modern improved cultivars or lines. We detected more associated loci for lint yield than for fiber quality, which suggests that lint yield has stronger selection signatures than other traits. We found that two ethylene-pathway-related genes were associated with increased lint yield in improved cultivars. We evaluated the population frequency of each elite allele in historically released cultivar groups and found that 54.8% of the elite genome-wide association study (GWAS) alleles detected were transferred from three founder landraces: Deltapine 15, Stoneville 2B and Uganda Mian. Our results provide a genomic basis for improving cotton cultivars and for further evolutionary analysis of polyploid crops.
USDA-ARS?s Scientific Manuscript database
Cotton fibers represent the largest single cell in the plant kingdom, and they have been used as a model to study cell function, differentiation, maturation, and cell death. The cotton fiber transcriptome can be clustered into two genomic regions: conserved and recombination hotspots. Genetic link...
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Hulse-Kemp, Amanda M.; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A.; Scheffler, Brian E.; Fang, David D.; Chen, Z. Jeffrey; Van Deynze, Allen; Stelly, David M.
2015-01-01
A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960
Hulse-Kemp, Amanda M; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A; Scheffler, Brian E; Fang, David D; Chen, Z Jeffrey; Van Deynze, Allen; Stelly, David M
2015-04-09
A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. Copyright © 2015 Hulse-Kemp et al.
Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.
The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family
Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium
Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...
2014-11-18
The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species ( G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes ( FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes ( FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family
Reddy, Umesh K.; Nimmakayala, Padma; Abburi, Venkata Lakshmi; Reddy, C. V. C. M.; Saminathan, Thangasamy; Percy, Richard G.; Yu, John Z.; Frelichowski, James; Udall, Joshua A.; Page, Justin T.; Zhang, Dong; Shehzad, Tariq; Paterson, Andrew H.
2017-01-01
Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we examined genetic diversity, haplotype distribution and linkage disequilibrium patterns in the G. hirsutum and G. barbadense genomes to clarify population demographic history. Diversity and identity-by-state analyses have revealed little sharing of alleles between the two cultivated allotetraploid genomes, with a few exceptions that indicated sporadic gene flow. We found a high number of new alleles, representing increased nucleotide diversity, on chromosomes 1 and 2 in cultivated G. hirsutum as compared with low nucleotide diversity on these chromosomes in landrace G. hirsutum. In contrast, G. barbadense chromosomes showed negative Tajima’s D on several chromosomes for both cultivated and landrace types, which indicate that speciation of G. barbadense itself, might have occurred with relatively narrow genetic diversity. The presence of conserved linkage disequilibrium (LD) blocks and haplotypes between G. hirsutum and G. barbadense provides strong evidence for comparable patterns of evolution in their domestication processes. Our study illustrates the potential use of population genetic techniques to identify genomic regions for domestication. PMID:28128280
Chen, Jie-Yin; Liu, Chun; Gui, Yue-Jing; Si, Kai-Wei; Zhang, Dan-Dan; Wang, Jie; Short, Dylan P G; Huang, Jin-Qun; Li, Nan-Yang; Liang, Yong; Zhang, Wen-Qi; Yang, Lin; Ma, Xue-Feng; Li, Ting-Gang; Zhou, Lei; Wang, Bao-Li; Bao, Yu-Ming; Subbarao, Krishna V; Zhang, Geng-Yun; Dai, Xiao-Feng
2018-01-01
Verticillium dahliae isolates are most virulent on the host from which they were originally isolated. Mechanisms underlying these dominant host adaptations are currently unknown. We sequenced the genome of V. dahliae Vd991, which is highly virulent on its original host, cotton, and performed comparisons with the reference genomes of JR2 (from tomato) and VdLs.17 (from lettuce). Pathogenicity-related factor prediction, orthology and multigene family classification, transcriptome analyses, phylogenetic analyses, and pathogenicity experiments were performed. The Vd991 genome harbored several exclusive, lineage-specific (LS) genes within LS regions (LSRs). Deletion mutants of the seven genes within one LSR (G-LSR2) in Vd991 were less virulent only on cotton. Integration of G-LSR2 genes individually into JR2 and VdLs.17 resulted in significantly enhanced virulence on cotton but did not affect virulence on tomato or lettuce. Transcription levels of the seven LS genes in Vd991 were higher during the early stages of cotton infection, as compared with other hosts. Phylogenetic analyses suggested that G-LSR2 was acquired from Fusarium oxysporum f. sp. vasinfectum through horizontal gene transfer. Our results provide evidence that horizontal gene transfer from Fusarium to Vd991 contributed significantly to its adaptation to cotton and may represent a significant mechanism in the evolution of an asexual plant pathogen. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
USDA-ARS?s Scientific Manuscript database
Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Ashfaq, Muhammad; Asif, Muhammad; Anjum, Zahid Iqbal; Zafar, Yusuf
2013-07-01
Although two plastid regions have been adopted as the standard markers for plant DNA barcoding, their limited resolution has provoked the consideration of other gene regions, especially in taxonomically diverse genera. The genus Gossypium (cotton) includes eight diploid genome groups (A-G, and K) and five allotetraploid species which are difficult to discriminate morphologically. In this study, we tested the effectiveness of three widely used markers (matK, rbcL, and ITS2) in the discrimination of 20 diploid and five tetraploid species of cotton. Sequences were analysed locus-wise and in combinations to determine the most effective strategy for species identification. Sequence recovery was high, ranging from 92% to 100% with mean pairwise interspecific distance highest for ITS2 (3.68%) and lowest for rbcL (0.43%). At a 0.5% threshold, the combination of matK+ITS2 produced the greatest number of species clusters. Based on 'best match' analysis, the combination of matK+ITS2 was best, while based on 'all species barcodes' analysis, ITS2 gave the highest percentage of correct species identifications (98.93%). The combination of sequences for all three markers produced the best resolved tree. The disparity index test based on matK+rbcL+ITS2 was significant (P < 0.05) for a higher number of species pairs than the individual gene sequences. Although all three barcodes separated the species with respect to their genome type, no single combination of barcodes could differentiate all the Gossypium species, and tetraploid species were particularly difficult. © 2013 John Wiley & Sons Ltd.
Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres
USDA-ARS?s Scientific Manuscript database
Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...
Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing
2017-10-01
Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.
USDA-ARS?s Scientific Manuscript database
New and emerging next generation sequencing technologies have been promising in reducing sequencing costs, but not significantly for complex polyploid plant genomes such as cotton. Large and highly repetitive genome of G. hirsutum (~2.5GB) is less amenable and cost-intensive with traditional BAC-by...
Functional Genomic Analysis of Cotton Genes with Agrobacterium-Mediated Virus-Induced Gene Silencing
Gao, Xiquan; Shan, Libo
2015-01-01
Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses. PMID:23386302
Gao, Xiquan; Shan, Libo
2013-01-01
Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses.
Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad
2018-01-05
Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Li, Wen; Li, Deng-Di; Han, Li-Hong; Tao, Miao; Hu, Qian-Qian; Wu, Wen-Ying; Zhang, Jing-Bo; Li, Xue-Bao; Huang, Geng-Qing
2017-08-31
TCP proteins are plant-specific transcription factors (TFs), and perform a variety of physiological functions in plant growth and development. In this study, 74 non-redundant TCP genes were identified in upland cotton (Gossypium hirsutum L.) genome. Cotton TCP family can be classified into two classes (class I and class II) that can be further divided into 11 types (groups) based on their motif composition. Quantitative RT-PCR analysis indicated that GhTCPs display different expression patterns in cotton tissues. The majority of these genes are preferentially or specifically expressed in cotton leaves, while some GhTCP genes are highly expressed in initiating fibers and/or elongating fibers of cotton. Yeast two-hybrid results indicated that GhTCPs can interact with each other to form homodimers or heterodimers. In addition, GhTCP14a and GhTCP22 can interact with some transcription factors which are involved in fiber development. These results lay solid foundation for further study on the functions of TCP genes during cotton fiber development.
Wang, Guixiang; He, Qunyan; Liu, Fan; Cheng, Zhukuan; Talbert, Paul B; Jin, Weiwei
2011-08-01
CENH3 is a centromere-specific histone H3 variant and has been used as a marker to identify active centromeres and DNA sequences associated with functional centromere/kinetochore complexes. In this study, up to four distinct CENH3 (BrCENH3) cDNAs were identified in individuals of each of three diploid species of Brassica. Comparison of the BrCENH3 cDNAs implied three related gene families: BrCENH3-A in Brassica rapa (AA), BrCENH3-B in B. nigra (BB), and BrCENH3-C in B. oleracea (CC). Each family encoded a histone fold domain and N-terminal histone tails that vary in length in all three families. The BrCENH3-B cDNAs have a deletion of two exons relative to BrCENH3-A and BrCENH3-C, consistent with the more ancient divergence of the BB genome. Chromatin immunoprecipitation and immunolabeling tests with anti-BrCENH3 antibodies indicated that both centromeric tandem repeats and the centromere-specific retrotransposons of Brassica are directly associated with BrCENH3 proteins. In three allotetraploid species, we find either co-transcription of the BrCENH3 genes of the ancestral diploid species or gene suppression of the BrCENH3 from one ancestor. Although B genome centromeres are occupied by BrCENH3-B in the ancestral species B. nigra, in allotetraploids both BrCENH3-A and BrCENH3-C proteins appear to assemble at these centromeres.
Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M
2016-05-01
The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.
USDA-ARS?s Scientific Manuscript database
Pantoea ananatis is a bacterium with versatile niches that vary from pathogenic to beneficial. We present the genome of strain CFH 7-1, which was recovered from a diseased greenhouse cotton boll previously caged with a field-collected cotton fleahopper (Pseudatomoscelis seriatus). These data will ...
Cotton transformation via pollen tube pathway.
Wang, Min; Zhang, Baohong; Wang, Qinglian
2013-01-01
Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.
Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi
2015-01-01
The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.
Transposable element evolution in the allotetraploid Capsella bursa-pastoris.
Ågren, J Arvid; Huang, Hui-Run; Wright, Stephen I
2016-07-01
Shifts in ploidy affect the evolutionary dynamics of genomes in a myriad of ways. Population genetic theory predicts that transposable element (TE) proliferation may follow because the genomewide efficacy of selection should be reduced and the increase in gene copies may mask the deleterious effects of TE insertions. Moreover, in allopolyploids, TEs may further accumulate because of hybrid breakdown of TE silencing. However, to date the evidence of TE proliferation following an increase in ploidy is mixed, and the relative importance of relaxed selection vs. silencing breakdown remains unclear. We used high-coverage whole-genome sequence data to evaluate the abundance, genomic distribution, and population frequencies of TEs in the self-fertilizing recent allotetraploid Capsella bursa-pastoris (Brassicaceae). We then compared the C. bursa-pastoris TE profile with that of its two parental diploid species, outcrossing C. grandiflora and self-fertilizing C. orientalis. We found no evidence that C. bursa-pastoris has experienced a large genomewide proliferation of TEs relative to its parental species. However, when centromeric regions are excluded, we found evidence of significantly higher abundance of retrotransposons in C. bursa-pastoris along the gene-rich chromosome arms compared with C. grandiflora and C. orientalis. The lack of a genomewide effect of allopolyploidy on TE abundance, combined with the increases TE abundance in gene-rich regions, suggests that relaxed selection rather than hybrid breakdown of host silencing explains the TE accumulation in C. bursa-pastoris. © 2016 Botanical Society of America.
Second, Gérard; Rouhan, Germinal
2008-01-01
Background The genus Oryza is being used as a model in plant genomic studies although there are several issues still to be resolved regarding the spatio-temporal evolution of this ancient genus. Particularly contentious is whether undated transoceanic natural dispersal or recent human interference has been the principal agent determining its present distribution and differentiation. In this context, we studied the origin and distribution history of the allotetraploid CD rice genome. It is endemic to the Neotropics but the genus is thought to have originated in the Paleotropics, and there is relatively little genetic divergence between some orthologous sequences of the C genome component and their Old World counterparts. Methodology/Principal Findings Because of its allotetraploidy, there are several potential pitfalls in trying to date the formation of the CD genome using molecular data and this could lead to erroneous estimates. Therefore, we rather chose to rely on historical evidence to determine whether or not the CD genome was present in the Neotropics before the arrival of Columbus. We searched early collections of herbarium specimens and studied the reports of explorers of the tropical Americas for references to rice. In spite of numerous collectors traveling inland and collecting Oryza, plants determined as CD genome species were not observed away from cultivated rice fields until 1869. Various arguments suggest that they only consisted of weedy forms until that time. Conclusions/Significance The spatio-temporal distribution of herbarium collections fits a simple biogeographical scenario for the emergence in cultivated rice fields followed by radiation in the wild of the CD genome in the Neotropics during the last four centuries. This probably occurred from species introduced to the Americas by humans and we found no evidence that the CD genome pre-existed in the Old World. We therefore propose a new evolutionary hypothesis for such a recent origin of the
Evolutionary dynamics of 3D genome architecture following polyploidization in cotton.
Wang, Maojun; Wang, Pengcheng; Lin, Min; Ye, Zhengxiu; Li, Guoliang; Tu, Lili; Shen, Chao; Li, Jianying; Yang, Qingyong; Zhang, Xianlong
2018-02-01
The formation of polyploids significantly increases the complexity of transcriptional regulation, which is expected to be reflected in sophisticated higher-order chromatin structures. However, knowledge of three-dimensional (3D) genome structure and its dynamics during polyploidization remains poor. Here, we characterize 3D genome architectures for diploid and tetraploid cotton, and find the existence of A/B compartments and topologically associated domains (TADs). By comparing each subgenome in tetraploids with its extant diploid progenitor, we find that genome allopolyploidization has contributed to the switching of A/B compartments and the reorganization of TADs in both subgenomes. We also show that the formation of TAD boundaries during polyploidization preferentially occurs in open chromatin, coinciding with the deposition of active chromatin modification. Furthermore, analysis of inter-subgenomic chromatin interactions has revealed the spatial proximity of homoeologous genes, possibly associated with their coordinated expression. This study advances our understanding of chromatin organization in plants and sheds new light on the relationship between 3D genome evolution and transcriptional regulation.
Liu, Zhao; Ge, Xiaoyang; Yang, Zuoren; Zhang, Chaojun; Zhao, Ge; Chen, Eryong; Liu, Ji; Zhang, Xueyan; Li, Fuguang
2017-06-12
Sucrose non-fermenting-1-related protein kinase 2 (SnRK2) is a plant-specific serine/threonine kinase family involved in the abscisic acid (ABA) signaling pathway and responds to osmotic stress. A genome-wide analysis of this protein family has been conducted previously in some plant species, but little is known about SnRK2 genes in upland cotton (Gossypium hirsutum L.). The recent release of the G. hirsutum genome sequence provides an opportunity to identify and characterize the SnRK2 kinase family in upland cotton. We identified 20 putative SnRK2 sequences in the G. hirsutum genome, designated as GhSnRK2.1 to GhSnRK2.20. All of the sequences encoded hydrophilic proteins. Phylogenetic analysis showed that the GhSnRK2 genes were classifiable into three groups. The chromosomal location and phylogenetic analysis of the cotton SnRK2 genes indicated that segmental duplication likely contributed to the diversification and evolution of the genes. The gene structure and motif composition of the cotton SnRK2 genes were analyzed. Nine exons were conserved in length among all members of the GhSnRK2 family. Although the C-terminus was divergent, seven conserved motifs were present. All GhSnRK2s genes showed expression patterns under abiotic stress based on transcriptome data. The expression profiles of five selected genes were verified in various tissues by quantitative real-time RT-PCR (qRT-PCR). Transcript levels of some family members were up-regulated in response to drought, salinity or ABA treatments, consistent with potential roles in response to abiotic stress. This study is the first comprehensive analysis of SnRK2 genes in upland cotton. Our results provide the fundamental information for the functional dissection of GhSnRK2s and vital availability for the improvement of plant stress tolerance using GhSnRK2s.
Molecular evolution of the plastid genome during diversification of the cotton genus.
Chen, Zhiwen; Grover, Corrinne E; Li, Pengbo; Wang, Yumei; Nie, Hushuai; Zhao, Yanpeng; Wang, Meiyan; Liu, Fang; Zhou, Zhongli; Wang, Xingxing; Cai, Xiaoyan; Wang, Kunbo; Wendel, Jonathan F; Hua, Jinping
2017-07-01
Cotton (Gossypium spp.) is commonly grouped into eight diploid genomic groups, designated A-G and K, and one tetraploid genomic group, namely AD. To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome duringdiversification, chloroplast genomes (cpDNA) from 6 D-genome and 2 G-genome species of Gossypium (G. armourianum D 2-1 , G. harknessii D 2-2 , G. davidsonii D 3-d , G. klotzschianum D 3-k , G. aridum D 4 , G. trilobum D 8 , and G. australe G 2 , G. nelsonii G 3 ) were newly reported here. In combination with the 26 previously released cpDNA sequences, we performed comparative phylogenetic analyses of 34 Gossypium chloroplast genomes that collectively represent most of the diversity in the genus. Gossypium chloroplasts span a small range in size that is mostly attributable to indels that occur in the large single copy (LSC) region of the genome. Phylogenetic analysis using a concatenation of all genes provides robust support for six major Gossypium clades, largely supporting earlier inferences but also revealing new information on intrageneric relationships. Using Theobroma cacao as an outgroup, diversification of the genus was dated, yielding results that are in accord with previous estimates of divergence times, but also offering new perspectives on the basal, early radiation of all major clades within the genus as well as gaps in the record indicative of extinctions. Like most higher-plant chloroplast genomes, all cotton species exhibit a conserved quadripartite structure, i.e., two large inverted repeats (IR) containing most of the ribosomal RNA genes, and two unique regions, LSC (large single sequence) and SSC (small single sequence). Within Gossypium, the IR-single copy region junctions are both variable and homoplasious among species. Two genes, accD and psaJ, exhibited greater rates of synonymous and non-synonymous substitutions than did other genes. Most genes exhibited Ka/Ks ratios suggestive of neutral
De novo genome assembly of the red silk cotton tree (Bombax ceiba).
Gao, Yong; Wang, Haibo; Liu, Chao; Chu, Honglong; Dai, Dongqin; Song, Shengnan; Yu, Long; Han, Lihong; Fu, Yi; Tian, Bin; Tang, Lizhou
2018-05-01
Bombax ceiba L. (the red silk cotton tree) is a large deciduous tree that is distributed in tropical and sub-tropical Asia as well as northern Australia. It has great economic and ecological importance, with several applications in industry and traditional medicine in many Asian countries. To facilitate further utilization of this plant resource, we present here the draft genome sequence for B. ceiba. We assembled a relatively intact genome of B. ceiba by using PacBio single-molecule sequencing and BioNano optical mapping technologies. The final draft genome is approximately 895 Mb long, with contig and scaffold N50 sizes of 1.0 Mb and 2.06 Mb, respectively. The high-quality draft genome assembly of B. ceiba will be a valuable resource enabling further genetic improvement and more effective use of this tree species.
Genome-wide recombination rate variation in a recombination map of cotton.
Shen, Chao; Li, Ximei; Zhang, Ruiting; Lin, Zhongxu
2017-01-01
Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species' genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton.
Genome-wide recombination rate variation in a recombination map of cotton
Shen, Chao; Li, Ximei; Zhang, Ruiting
2017-01-01
Recombination is crucial for genetic evolution, which not only provides new allele combinations but also influences the biological evolution and efficacy of natural selection. However, recombination variation is not well understood outside of the complex species’ genomes, and it is particularly unclear in Gossypium. Cotton is the most important natural fibre crop and the second largest oil-seed crop. Here, we found that the genetic and physical maps distances did not have a simple linear relationship. Recombination rates were unevenly distributed throughout the cotton genome, which showed marked changes along the chromosome lengths and recombination was completely suppressed in the centromeric regions. Recombination rates significantly varied between A-subgenome (At) (range = 1.60 to 3.26 centimorgan/megabase [cM/Mb]) and D-subgenome (Dt) (range = 2.17 to 4.97 cM/Mb), which explained why the genetic maps of At and Dt are similar but the physical map of Dt is only half that of At. The translocation regions between A02 and A03 and between A04 and A05, and the inversion regions on A10, D10, A07 and D07 indicated relatively high recombination rates in the distal regions of the chromosomes. Recombination rates were positively correlated with the densities of genes, markers and the distance from the centromere, and negatively correlated with transposable elements (TEs). The gene ontology (GO) categories showed that genes in high recombination regions may tend to response to environmental stimuli, and genes in low recombination regions are related to mitosis and meiosis, which suggested that they may provide the primary driving force in adaptive evolution and assure the stability of basic cell cycle in a rapidly changing environment. Global knowledge of recombination rates will facilitate genetics and breeding in cotton. PMID:29176878
Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J
2017-03-01
An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.
de Castro Nunes, Renata; Orozco-Arias, Simon; Crouzillat, Dominique; Mueller, Lukas A.; Strickler, Suzy R.; Descombes, Patrick; Fournier, Coralie; Moine, Deborah; de Kochko, Alexandre; Yuyama, Priscila M.; Vanzela, André L. L.; Guyot, Romain
2018-01-01
Centromeric regions of plants are generally composed of large array of satellites from a specific lineage of Gypsy LTR-retrotransposons, called Centromeric Retrotransposons. Repeated sequences interact with a specific H3 histone, playing a crucial function on kinetochore formation. To study the structure and composition of centromeric regions in the genus Coffea, we annotated and classified Centromeric Retrotransposons sequences from the allotetraploid C. arabica genome and its two diploid ancestors: Coffea canephora and C. eugenioides. Ten distinct CRC (Centromeric Retrotransposons in Coffea) families were found. The sequence mapping and FISH experiments of CRC Reverse Transcriptase domains in C. canephora, C. eugenioides, and C. arabica clearly indicate a strong and specific targeting mainly onto proximal chromosome regions, which can be associated also with heterochromatin. PacBio genome sequence analyses of putative centromeric regions on C. arabica and C. canephora chromosomes showed an exceptional density of one family of CRC elements, and the complete absence of satellite arrays, contrasting with usual structure of plant centromeres. Altogether, our data suggest a specific centromere organization in Coffea, contrasting with other plant genomes. PMID:29497436
Ma, Zhiying; He, Shoupu; Wang, Xingfen; Sun, Junling; Zhang, Yan; Zhang, Guiyin; Wu, Liqiang; Li, Zhikun; Liu, Zhihao; Sun, Gaofei; Yan, Yuanyuan; Jia, Yinhua; Yang, Jun; Pan, Zhaoe; Gu, Qishen; Li, Xueyuan; Sun, Zhengwen; Dai, Panhong; Liu, Zhengwen; Gong, Wenfang; Wu, Jinhua; Wang, Mi; Liu, Hengwei; Feng, Keyun; Ke, Huifeng; Wang, Junduo; Lan, Hongyu; Wang, Guoning; Peng, Jun; Wang, Nan; Wang, Liru; Pang, Baoyin; Peng, Zhen; Li, Ruiqiang; Tian, Shilin; Du, Xiongming
2018-05-07
Upland cotton is the most important natural-fiber crop. The genomic variation of diverse germplasms and alleles underpinning fiber quality and yield should be extensively explored. Here, we resequenced a core collection comprising 419 accessions with 6.55-fold coverage depth and identified approximately 3.66 million SNPs for evaluating the genomic variation. We performed phenotyping across 12 environments and conducted genome-wide association study of 13 fiber-related traits. 7,383 unique SNPs were significantly associated with these traits and were located within or near 4,820 genes; more associated loci were detected for fiber quality than fiber yield, and more fiber genes were detected in the D than the A subgenome. Several previously undescribed causal genes for days to flowering, fiber length, and fiber strength were identified. Phenotypic selection for these traits increased the frequency of elite alleles during domestication and breeding. These results provide targets for molecular selection and genetic manipulation in cotton improvement.
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Genome-wide analysis of codon usage bias in four sequenced cotton species.
Wang, Liyuan; Xing, Huixian; Yuan, Yanchao; Wang, Xianlin; Saeed, Muhammad; Tao, Jincai; Feng, Wei; Zhang, Guihua; Song, Xianliang; Sun, Xuezhen
2018-01-01
Codon usage bias (CUB) is an important evolutionary feature in a genome which provides important information for studying organism evolution, gene function and exogenous gene expression. The CUB and its shaping factors in the nuclear genomes of four sequenced cotton species, G. arboreum (A2), G. raimondii (D5), G. hirsutum (AD1) and G. barbadense (AD2) were analyzed in the present study. The effective number of codons (ENC) analysis showed the CUB was weak in these four species and the four subgenomes of the two tetraploids. Codon composition analysis revealed these four species preferred to use pyrimidine-rich codons more frequently than purine-rich codons. Correlation analysis indicated that the base content at the third position of codons affect the degree of codon preference. PR2-bias plot and ENC-plot analyses revealed that the CUB patterns in these genomes and subgenomes were influenced by combined effects of translational selection, directional mutation and other factors. The translational selection (P2) analysis results, together with the non-significant correlation between GC12 and GC3, further revealed that translational selection played the dominant role over mutation pressure in the codon usage bias. Through relative synonymous codon usage (RSCU) analysis, we detected 25 high frequency codons preferred to end with T or A, and 31 low frequency codons inclined to end with C or G in these four species and four subgenomes. Finally, 19 to 26 optimal codons with 19 common ones were determined for each species and subgenomes, which preferred to end with A or T. We concluded that the codon usage bias was weak and the translation selection was the main shaping factor in nuclear genes of these four cotton genomes and four subgenomes.
Gene copy number evolution during tetraploid cotton radiation.
Rong, J; Feltus, F A; Liu, L; Lin, L; Paterson, A H
2010-11-01
After polyploid formation, retention or loss of duplicated genes is not random. Genes with some functional domains are convergently restored to 'singleton' state after many independent genome duplications, and have been referred to as 'duplication-resistant' (DR) genes. To further explore the timeframe for their restoration to the singleton state, 27 cotton homologs of genes found to be 'DR' in Arabidopsis were selected based on diagnostic Pfam domains. Their copy numbers were studied using southern hybridization and sequence analysis in five tetraploid species and their ancestral A and D genome diploids. DR genes had significantly lower copy number than gene families hybridizing to randomly selected cotton ESTs. Three DR genes showed complete loss of D genome-derived homoeologs in some or all tetraploid species. Prior analysis has shown gene loss in polyploid cotton to be rare, and herein only one randomly selected gene showed loss of a homoeolog in only one of the five tetraploid species (Gossypium mustelinum). BAC sequencing confirmed two cases of gene loss in tetraploid cotton. Divergence among 5' sequences of DR genes amplified from G. arboreum, G. raimondii, and Gossypioides kirkii was correlated with gene copy number. These results show that genes containing Pfam domains associated with duplication resistance in Arabidopsis have also been preferentially restored to low copy number after a more recent polyploidization event in cotton. In tetraploid cotton, genes from the progenitor D genome seem to experience more gene copy number divergence than genes from the A genome. Together with D subgenome-biased alterations in gene expression, perhaps gene loss may contribute to the relatively larger portion of quantitative trait variation attributable to D than A subgenome chromosomes of tetraploid cotton.
Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).
Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F
2006-01-01
Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.
Buggs, R J A; Doust, A N; Tate, J A; Koh, J; Soltis, K; Feltus, F A; Paterson, A H; Soltis, P S; Soltis, D E
2009-07-01
Whole-genome duplication (polyploidisation) is a widespread mechanism of speciation in plants. Over time, polyploid genomes tend towards a more diploid-like state, through downsizing and loss of duplicated genes (homoeologues), but relatively little is known about the timing of gene loss during polyploid formation and stabilisation. Several studies have also shown gene transcription to be affected by polyploidisation. Here, we examine patterns of gene loss in 10 sets of homoeologues in five natural populations of the allotetraploid Tragopogon miscellus that arose within the past 80 years following independent whole-genome duplication events. We also examine 44 first-generation synthetic allopolyploids of the same species. No cases of homoeologue loss arose in the first allopolyploid generation, but after 80 years, 1.6% of homoeologues were lost in natural populations. For seven homoeologue sets we also examined transcription, finding that 3.4% of retained homoeologues had been silenced in the natural populations, but none in the synthetic plants. The homoeologue losses and silencing events found were not fixed within natural populations and did not form a predictable pattern among populations. We therefore show haphazard loss and silencing of homoeologues, occurring within decades of polyploid formation in T. miscellus, but not in the initial generation.
CMD: a Cotton Microsatellite Database resource for Gossypium genomics
Blenda, Anna; Scheffler, Jodi; Scheffler, Brian; Palmer, Michael; Lacape, Jean-Marc; Yu, John Z; Jesudurai, Christopher; Jung, Sook; Muthukumar, Sriram; Yellambalase, Preetham; Ficklin, Stephen; Staton, Margaret; Eshelman, Robert; Ulloa, Mauricio; Saha, Sukumar; Burr, Ben; Liu, Shaolin; Zhang, Tianzhen; Fang, Deqiu; Pepper, Alan; Kumpatla, Siva; Jacobs, John; Tomkins, Jeff; Cantrell, Roy; Main, Dorrie
2006-01-01
Background The Cotton Microsatellite Database (CMD) is a curated and integrated web-based relational database providing centralized access to publicly available cotton microsatellites, an invaluable resource for basic and applied research in cotton breeding. Description At present CMD contains publication, sequence, primer, mapping and homology data for nine major cotton microsatellite projects, collectively representing 5,484 microsatellites. In addition, CMD displays data for three of the microsatellite projects that have been screened against a panel of core germplasm. The standardized panel consists of 12 diverse genotypes including genetic standards, mapping parents, BAC donors, subgenome representatives, unique breeding lines, exotic introgression sources, and contemporary Upland cottons with significant acreage. A suite of online microsatellite data mining tools are accessible at CMD. These include an SSR server which identifies microsatellites, primers, open reading frames, and GC-content of uploaded sequences; BLAST and FASTA servers providing sequence similarity searches against the existing cotton SSR sequences and primers, a CAP3 server to assemble EST sequences into longer transcripts prior to mining for SSRs, and CMap, a viewer for comparing cotton SSR maps. Conclusion The collection of publicly available cotton SSR markers in a centralized, readily accessible and curated web-enabled database provides a more efficient utilization of microsatellite resources and will help accelerate basic and applied research in molecular breeding and genetic mapping in Gossypium spp. PMID:16737546
Hunt, Harriet V.; Ansell, Stephen W.; Russell, Stephen J.; Schneider, Harald; Vogel, Johannes C.
2011-01-01
Background and Aims Successful establishment of newly formed polyploid species depends on several interlinked genetic and ecological factors. These include genetic diversity within and among individuals, chromosome behaviour and fertility, novel phenotypes resulting from novel genomic make-up and expression, intercytotypic and interspecific competition, and adaptation to distinct habitats. The allotetraploid rock fern Asplenium majoricum is known from one small population in Valencia, Spain, and several larger populations on the Balearic island of Majorca. In Valencia, it occurs sympatrically with its diploid parents, A. fontanum subsp. fontanum and A. petrarchae subsp. bivalens, and their diploid hybrid A. × protomajoricum. This highly unusual situation allowed the study of polyploid genetic diversity and its relationship to the formation and establishment of nascent polyploid lineages. Methods Genetic variation for isozyme and chloroplast DNA markers was determined for A. majoricum and A. × protomajoricum sampled thoroughly from known sites in Majorca and Valencia. Results were compared with variation determined previously for the diploid parent taxa. Key Results A highly dynamic system with recurring diploid hybrid and allotetraploid formation was discovered. High diversity in the small Valencian A. majoricum population indicates multiple de novo origins from diverse parental genotypes, but most of these lineages become extinct without becoming established. The populations on Majorca most probably represent colonization(s) from Valencia rather than an in situ origin. Low genetic diversity suggests that this colonization may have occurred only once. Conclusions There is a striking contrast in success of establishment of the Majorcan and Valencian populations of A. majoricum. Chance founding of populations in a habitat where neither A. fontanum subsp. fontanum nor A. petrarchae subsp. bivalens occurs appears to have been a key factor enabling the establishment
Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping
2016-07-20
Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.
Arick, Mark A; Conover, Justin L; Thrash, Adam; Sanders, William S; Hsu, Chuan-Yu; Naqvi, Rubab Zahra; Farooq, Muhammad; Li, Xiaochong; Gong, Lei; Mudge, Joann; Ramaraj, Thiruvarangan; Udall, Joshua A; Peterson, Daniel G
2017-01-01
Abstract Long-distance insular dispersal is associated with divergence and speciation because of founder effects and strong genetic drift. The cotton tribe (Gossypieae) has experienced multiple transoceanic dispersals, generating an aggregate geographic range that encompasses much of the tropics and subtropics worldwide. Two genera in the Gossypieae, Kokia and Gossypioides, exhibit a remarkable geographic disjunction, being restricted to the Hawaiian Islands and Madagascar/East Africa, respectively. We assembled and use de novo genome sequences to address questions regarding the divergence of these two genera from each other and from their sister-group, Gossypium. In addition, we explore processes underlying the genome downsizing that characterizes Kokia and Gossypioides relative to other genera in the tribe. Using 13,000 gene orthologs and synonymous substitution rates, we show that the two disjuncts last shared a common ancestor ∼5 Ma, or half as long ago as their divergence from Gossypium. We report relative stasis in the transposable element fraction. In comparison to Gossypium, there is loss of ∼30% of the gene content in the two disjunct genera and a history of genome-wide accumulation of deletions. In both genera, there is a genome-wide bias toward deletions over insertions, and the number of gene losses exceeds the number of gains by ∼2- to 4-fold. The genomic analyses presented here elucidate genomic consequences of the demographic and biogeographic history of these closest relatives of Gossypium, and enhance their value as phylogenetic outgroups. PMID:29194487
Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J
2017-01-01
High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional
2011-01-01
Background In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases. PMID:21864377
Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S
2011-08-24
In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.
Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array.
Hinze, Lori L; Hulse-Kemp, Amanda M; Wilson, Iain W; Zhu, Qian-Hao; Llewellyn, Danny J; Taylor, Jen M; Spriggs, Andrew; Fang, David D; Ulloa, Mauricio; Burke, John J; Giband, Marc; Lacape, Jean-Marc; Van Deynze, Allen; Udall, Joshua A; Scheffler, Jodi A; Hague, Steve; Wendel, Jonathan F; Pepper, Alan E; Frelichowski, James; Lawley, Cindy T; Jones, Don C; Percy, Richard G; Stelly, David M
2017-02-03
Cotton germplasm resources contain beneficial alleles that can be exploited to develop germplasm adapted to emerging environmental and climate conditions. Accessions and lines have traditionally been characterized based on phenotypes, but phenotypic profiles are limited by the cost, time, and space required to make visual observations and measurements. With advances in molecular genetic methods, genotypic profiles are increasingly able to identify differences among accessions due to the larger number of genetic markers that can be measured. A combination of both methods would greatly enhance our ability to characterize germplasm resources. Recent efforts have culminated in the identification of sufficient SNP markers to establish high-throughput genotyping systems, such as the CottonSNP63K array, which enables a researcher to efficiently analyze large numbers of SNP markers and obtain highly repeatable results. In the current investigation, we have utilized the SNP array for analyzing genetic diversity primarily among cotton cultivars, making comparisons to SSR-based phylogenetic analyses, and identifying loci associated with seed nutritional traits. The SNP markers distinctly separated G. hirsutum from other Gossypium species and distinguished the wild from cultivated types of G. hirsutum. The markers also efficiently discerned differences among cultivars, which was the primary goal when designing the CottonSNP63K array. Population structure within the genus compared favorably with previous results obtained using SSR markers, and an association study identified loci linked to factors that affect cottonseed protein content. Our results provide a large genome-wide variation data set for primarily cultivated cotton. Thousands of SNPs in representative cotton genotypes provide an opportunity to finely discriminate among cultivated cotton from around the world. The SNPs will be relevant as dense markers of genome variation for association mapping approaches aimed at
Lu, X K; Shu, N; Wang, J J; Chen, X G; Wang, D L; Wang, S; Fan, W L; Guo, X N; Guo, L X; Ye, W W
2017-06-29
Cytosine DNA methylation is a significant form of DNA modification closely associated with gene expression in eukaryotes, fungi, animals, and plants. Although the reference genomes of cotton (Gossypium hirsutum L.) have been publically available, the salinity-stress-induced DNA methylome alterations in cotton are not well understood. Here, we constructed a map of genome-wide DNA methylation characteristics of cotton leaves under salt stress using the methylated DNA immunoprecipitation sequencing method. The results showed that the methylation reads on chromosome 9 were most comparable with those on the other chromosomes, but the greatest changes occurred on chromosome 8 under salt stress. The DNA methylation pattern analysis indicated that a relatively higher methylation density was found in the upstream2k and downstream2k elements of the CDS region and CG-islands. Almost 94% of the reads belonged to LTR-gspsy and LTR-copia, and the number of methylation reads in LTR-gypsy was four times greater than that in LTR-copia in both control and stressed samples. The analysis of differentially methylated regions (DMRs) showed that the gene elements upstream2k, intron, and downstream2k were hypomethylated, but the CDS regions were hypermethylated. The GO (Gene Ontology) analysis suggested that the methylated genes were most enriched in cellular processes, metabolic processes, cell parts and catalytic activities, which might be closely correlated with response to NaCl stress. In this study, we completed a genomic DNA methylation profile and conducted a DMR analysis under salt stress, which provided valuable information for the better understanding of epigenetics in response to salt stress in cotton.
CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).
Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S
2017-07-01
The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-03-13
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H + -pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6-81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome.
Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system
Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei
2017-01-01
The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154
Agrobacterium-mediated virus-induced gene silencing assay in cotton.
Gao, Xiquan; Britt, Robert C; Shan, Libo; He, Ping
2011-08-20
Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation(1). To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation(2,3). Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies(3,4). As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development(6), and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves(7), providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration
Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton
Gao, Xiquan; Britt Jr., Robert C.; Shan, Libo; He, Ping
2011-01-01
Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties. The large-scale gene functional analysis in cotton has been lagged behind most of the modern plant species, likely due to its large size of genome, gene duplication and polyploidy, long growth cycle and recalcitrance to genetic transformation1. To facilitate high throughput functional genetic/genomic study in cotton, we attempt to develop rapid and efficient transient assays to assess cotton gene functions. Virus-Induced Gene Silencing (VIGS) is a powerful technique that was developed based on the host Post-Transcriptional Gene Silencing (PTGS) to repress viral proliferation2,3. Agrobacterium-mediated VIGS has been successfully applied in a wide range of dicots species such as Solanaceae, Arabidopsis and legume species, and monocots species including barley, wheat and maize, for various functional genomic studies3,4. As this rapid and efficient approach avoids plant transformation and overcomes functional redundancy, it is particularly attractive and suitable for functional genomic study in crop species like cotton not amenable for transformation. In this study, we report the detailed protocol of Agrobacterium-mediated VIGS system in cotton. Among the several viral VIGS vectors, the tobacco rattle virus (TRV) invades a wide range of hosts and is able to spread vigorously throughout the entire plant yet produce mild symptoms on the hosts5. To monitor the silencing efficiency, GrCLA1, a homolog gene of Arabidopsis Cloroplastos alterados 1 gene (AtCLA1) in cotton, has been cloned and inserted into the VIGS binary vector pYL156. CLA1 gene is involved in chloroplast development6, and previous studies have shown that loss-of-function of AtCLA1 resulted in an albino phenotype on true leaves7, providing an excellent visual marker for silencing efficiency. At approximately two weeks post Agrobacterium infiltration, the albino
Silencing GhNDR1 and GhMKK2 compromised cotton resistance to Verticillium wilt
Gao, Xiquan; Wheeler, Terry; Li, Zhaohu; Kenerley, Charles M.; He, Ping; Shan, Libo
2011-01-01
SUMMARY Cotton is an important cash crop worldwide and serves as a significant source of fiber, feed, foodstuff, oil and biofuel products. Considerable effort in genetics and genomics has been expended to increase sustainable yield and quality through molecular breeding and genetic engineering of new cotton cultivars. With the effort of whole genome sequencing of cotton, it is essential to develop molecular tools and resources for large-scale analysis of gene functions at the genome-wide level. We have successfully established an Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in several cotton cultivars with different genetic backgrounds. The genes of interest were potently and readily silenced within 2 weeks after inoculation at the seedling stage. Importantly, we showed that silencing GhNDR1 and GhMKK2 compromised cotton resistance to the infection by Verticillium dahliae, a fungal pathogen causing Verticillium wilt. Furthermore, we established a cotton protoplast system for transient gene expression to study gene functions by a gain-of-function approach. The viable protoplasts were isolated from green cotyledons, etiolated cotyledons, and true leaves, and responded to a wide range of pathogen elicitors and phytohormones. Remarkably, cotton plants possess conserved, but also distinct MAP kinase activation with Arabidopsis upon bacterial elicitor flagellin perception. Thus, we demonstrated that GhNDR1 and GhMKK2 are required for Verticillium resistance in cotton using gene silencing assays, and established the high throughput loss-of-function and gain-of-function assays for functional genomic studies in cotton. PMID:21219508
Wild emmer genome architecture and diversity elucidate wheat evolution and domestication
USDA-ARS?s Scientific Manuscript database
Wheat (Triticum spp.) is one of the founder crops that likely drove the Neolithic transition to sedentary agrarian societies in the Fertile Crescent over 10,000 years ago. Identifying genetic modifications underlying wheat's domestication requires knowledge of the genome of its allo-tetraploid proge...
Comparative phenotypic analysis of Gossypium raimondii with Upland cotton
USDA-ARS?s Scientific Manuscript database
Gossypium raimondii Ulbr., a wild species with a diploid genome, has been sequenced due to its small genome size and sequence similarity with the polyploidy cultivated Gossypium species. Accessibility of the G. raimondii genome has made the species a reference used extensively in cotton genomic and...
Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia
2015-01-01
RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control. PMID:26435695
Wu, Jianyong; Zhang, Meng; Zhang, Bingbing; Zhang, Xuexian; Guo, Liping; Qi, Tingxiang; Wang, Hailin; Zhang, Jinfa; Xing, Chaozhu
2017-06-08
Cytoplasmic male sterility (CMS) conferred by the cytoplasm from Gossypium harknessii (D2) is an important system for hybrid seed production in Upland cotton (G. hirsutum). The male sterility of CMS-D2 (i.e., A line) can be restored to fertility by a restorer (i.e., R line) carrying the restorer gene Rf1 transferred from the D2 nuclear genome. However, the molecular mechanisms of CMS-D2 and its restoration are poorly understood. In this study, a genome-wide comparative transcriptome analysis was performed to identify differentially expressed genes (DEGs) in flower buds among the isogenic fertile R line and sterile A line derived from a backcross population (BC 8 F 1 ) and the recurrent parent, i.e., the maintainer (B line). A total of 1464 DEGs were identified among the three isogenic lines, and the Rf1-carrying Chr_D05 and its homeologous Chr_A05 had more DEGs than other chromosomes. The results of GO and KEGG enrichment analysis showed differences in circadian rhythm between the fertile and sterile lines. Eleven DEGs were selected for validation using qRT-PCR, confirming the accuracy of the RNA-seq results. Through genome-wide comparative transcriptome analysis, the differential expression profiles of CMS-D2 and its maintainer and restorer lines in Upland cotton were identified. Our results provide an important foundation for further studies into the molecular mechanisms of the interactions between the restorer gene Rf1 and the CMS-D2 cytoplasm.
Liu, Qing; Triplett, Jimmy K; Wen, Jun; Peterson, Paul M
2011-11-01
Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica-E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana-E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its allotetraploid lineage.
Liu, Qing; Triplett, Jimmy K.; Wen, Jun; Peterson, Paul M.
2011-01-01
Background and Aims Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Methods Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. Key Results The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica–E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. Conclusions The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana–E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its
Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun
2018-06-01
Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation
Reinisch, A. J.; Dong, J. M.; Brubaker, C. L.; Stelly, D. M.; Wendel, J. F.; Paterson, A. H.
1994-01-01
We employ a detailed restriction fragment length polymorphism (RFLP) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. About 46.2% of nuclear DNA probes detect RFLPs distinguishing Gossypium hirsutum and Gossypium barbadense; and 705 RFLP loci are assembled into 41 linkage groups and 4675 cM. The subgenomic origin (A vs. D) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. The A and D subgenomes show similar recombinational length, suggesting that repetitive DNA in the physically larger A subgenome is recombinationally inert. RFLPs are somewhat more abundant in the D subgenome. Linkage among duplicated RFLPs reveals 11 pairs of homoeologous chromosomal regions-two appear homosequential, most differ by inversions, and at least one differs by a translocation. Most homoeologies involve chromosomes from different subgenomes, putatively reflecting the n = 13 to n = 26 polyploidization event of 1.1-1.9 million years ago. Several observations suggest that another, earlier, polyploidization event spawned n = 13 cottons, at least 25 million years ago. The cotton genome contains about 400-kb DNA per cM, hence map-based gene cloning is feasible. The cotton map affords new opportunities to study chromosome evolution, and to exploit Gossypium genetic resources for improvement of the world's leading natural fiber. PMID:7851778
USDA-ARS?s Scientific Manuscript database
An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...
Evolutionary Conservation and Divergence of Gene Coexpression Networks in Gossypium (Cotton) Seeds.
Hu, Guanjing; Hovav, Ran; Grover, Corrinne E; Faigenboim-Doron, Adi; Kadmon, Noa; Page, Justin T; Udall, Joshua A; Wendel, Jonathan F
2016-12-01
The cotton genus (Gossypium) provides a superior system for the study of diversification, genome evolution, polyploidization, and human-mediated selection. To gain insight into phenotypic diversification in cotton seeds, we conducted coexpression network analysis of developing seeds from diploid and allopolyploid cotton species and explored network properties. Key network modules and functional associations were identified related to seed oil content and seed weight. We compared species-specific networks to reveal topological changes, including rewired edges and differentially coexpressed genes, associated with speciation, polyploidy, and cotton domestication. Network comparisons among species indicate that topologies are altered in addition to gene expression profiles, indicating that changes in transcriptomic coexpression relationships play a role in the developmental architecture of cotton seed development. The global network topology of allopolyploids, especially for domesticated G. hirsutum, resembles the network of the A-genome diploid more than that of the D-genome parent, despite its D-like phenotype in oil content. Expression modifications associated with allopolyploidy include coexpression level dominance and transgressive expression, suggesting that the transcriptomic architecture in polyploids is to some extent a modular combination of that of its progenitor genomes. Among allopolyploids, intermodular relationships are more preserved between two different wild allopolyploid species than they are between wild and domesticated forms of a cultivated cotton, and regulatory connections of oil synthesis-related pathways are denser and more closely clustered in domesticated vs. wild G. hirsutum. These results demonstrate substantial modification of genic coexpression under domestication. Our work demonstrates how network inference informs our understanding of the transcriptomic architecture of phenotypic variation associated with temporal scales ranging from
Ye, Yuzhen; Wang, Zhongwei; Zhou, Jianfeng; Wu, Qingjiang
2009-08-01
Microsatellite markers and D-loop sequences of mtDNA from a female allotetraploid parent carp and her progenies of generations 1 and 2 induced by sperm of five distant fish species were analyzed. Eleven microsatellite markers were used to identify 48 alleles from the allotetraploid female. The same number of alleles (48) appeared in the first and second generations of the gynogenetic offspring, regardless of the source of the sperm used as an activator. The mtDNA D-loop analysis was performed on the female tetraploid parent, 25 gynogenetic offspring, and 5 sperm-donor species. Fourteen variable sites from the 1,018 bp sequences were observed in the offspring as compared to the female tetraploid parent. Results from D-loop sequence and microsatellite marker analysis showed exclusive maternal transmission, and no genetic information was derived from the father. Our study suggests that progenies of artificial tetraploid carp are genetically stable, which is important for genetic breeding of this tetraploid fish.
Genomic landscape of fiber genes in fibered and non-fibered cottons
USDA-ARS?s Scientific Manuscript database
Cotton fiber is the largest single cell in the plant kingdom. It is the best model to study cell function, differentiation, maturation, and cell death. Cotton fiber transcriptome can be clustered into two types of regions: conservative areas and recombination hotspots. This study was to investig...
Li, Tinggang; Ma, Xuefeng; Li, Nanyang; Zhou, Lei; Liu, Zheng; Han, Huanyong; Gui, Yuejing; Bao, Yuming; Chen, Jieyin; Dai, Xiaofeng
2017-12-01
Verticillium wilt (VW), caused by infection by Verticillium dahliae, is considered one of the most yield-limiting diseases in cotton. To examine the genetic architecture of cotton VW resistance, we performed a genome-wide association study (GWAS) using a panel of 299 accessions and 85 630 single nucleotide polymorphisms (SNPs) detected using the specific-locus amplified fragment sequencing (SLAF-seq) approach. Trait-SNP association analysis detected a total of 17 significant SNPs at P < 1.17 × 10 -5 (P = 1/85 630, -log 10 P = 4.93); the peaks of SNPs associated with VW resistance on A10 were continuous and common in three environments (RDIG2015, RDIF2015 and RDIF2016). Haplotype block structure analysis predicted 22 candidate genes for VW resistance based on A10_99672586 with a minimum P-value (-log 10 P = 6.21). One of these genes (CG02) was near the significant SNP A10_99672586 (0.26 Mb), located in a 372-kb haplotype block, and its Arabidopsis AT3G25510 homologues contain TIR-NBS-LRR domains that may be involved in disease resistance response. Real-time quantitative PCR and virus-induced gene silencing (VIGS) analysis showed that CG02 was specific to up-regulation in the resistant (R) genotype Zhongzhimian2 (ZZM2) and that silenced plants were more susceptible to V. dahliae. These results indicate that CG02 is likely the candidate gene for resistance against V. dahliae in cotton. The identified locus or gene may serve as a promising target for genetic engineering and selection for improving resistance to VW in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan
2015-01-01
Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Bowman, Megan J.; Park, Wonkeun; Bauer, Philip J.; Udall, Joshua A.; Page, Justin T.; Raney, Joshua; Scheffler, Brian E.; Jones, Don. C.; Campbell, B. Todd
2013-01-01
An RNA-Seq experiment was performed using field grown well-watered and naturally rain fed cotton plants to identify differentially expressed transcripts under water-deficit stress. Our work constitutes the first application of the newly published diploid D5 Gossypium raimondii sequence in the study of tetraploid AD1 upland cotton RNA-seq transcriptome analysis. A total of 1,530 transcripts were differentially expressed between well-watered and water-deficit stressed root tissues, in patterns that confirm the accuracy of this technique for future studies in cotton genomics. Additionally, putative sequence based genome localization of differentially expressed transcripts detected A2 genome specific gene expression under water-deficit stress. These data will facilitate efforts to understand the complex responses governing transcriptomic regulatory mechanisms and to identify candidate genes that may benefit applied plant breeding programs. PMID:24324815
Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin
2016-06-01
Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. Copyright © 2016 Thyssen et al.
TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton
USDA-ARS?s Scientific Manuscript database
Bacterial blight of cotton (BBC), caused by Xanthomonas citri subsp. malvacearum (Xcm), is among the most destructive diseases in cotton (Gossypium spp.). Transcription activator-like (TAL) effectors from Xcm are essential for BBC disease progression. Here, we carried out whole-genome PacBio-seque...
Černá, Lucie; Münzbergová, Zuzana
2015-01-01
Due to increased levels of heterozygosity, polyploids are expected to have a greater ability to adapt to different environments than their diploid ancestors. While this theoretical pattern has been suggested repeatedly, studies comparing adaptability to changing conditions in diploids and polyploids are rare. The aim of the study was to determine the importance of environmental conditions of origin as well as target conditions on performance of two Anthericum species, allotetraploid A. liliago and diploid A. ramosum and to explore whether the two species differ in the ability to adapt to these environmental conditions. Specifically, we performed a common garden experiment using soil from 6 localities within the species’ natural range, and we simulated the forest and open environments in which they might occur. We compared the performance of diploid A. ramosum and allotetraploid A. liliago originating from different locations in the different soils. The performance of the two species was not affected by simulated shading but differed strongly between the different target soils. Growth of the tetraploids was not affected by the origin of the plants. In contrast, diploids from the most nutrient poor soil performed best in the richest soil, indicating that diploids from deprived environments have an increased ability to acquire nutrients when available. They are thus able to profit from transfer to novel nutrient rich environments. Therefore, the results of the study did not support the general expectation that the polyploids should have a greater ability than the diploids to adapt to a wide range of conditions. In contrast, the results are in line with the observation that diploids occupy a wider range of environments than the allotetraploids in our system. PMID:25607545
Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing
2010-02-01
To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.
Zhu, Shuijin; Zhang, Lufei; Li, Lingjiao
2017-01-01
The diploid species G. herbaceum (A1) and G. raimondii (D5) are the progenitors of allotetraploid cotton, respectively. However, hybrids between G. herbaceum and G. raimondii haven’t been reported. In the present study, hybridization between G. herbaceum and G. raimondii was explored. Morphological, cytogenetic and molecular analyses were used to assess the hybridity. The interspecific hybrid plants were successfully obtained. Most of the morphological characteristics of the hybrids were intermediate between G. herbaceum and G. raimondii. However, the color of glands, anther cases, pollen and corolla, and the state of bracteoles in hybrids were associated with the G. herbaceum. The color of staminal columns and filaments in hybrids were associated with G. raimondii. Cytogenetic analysis confirmed abnormal meiotic behavior existed in hybrids. The hybrids couldn’t produce boll-set. Simple sequence repeat results found that besides the fragments inherited from the two parents, some novel bands were amplified in hybrids, indicating that potential mutations and chromosomal recombination occurred between parental genomes during hybridization. These results may provide some novel insights in speciation, genome interaction, and evolution of the tetraploid cotton species. PMID:28187145
Corrêa, R L; Silva, T F; Simões-Araújo, J L; Barroso, P A V; Vidal, M S; Vaslin, M F S
2005-07-01
Cotton blue disease is an aphid-transmitted cotton disease described in Brazil in 1962 as Vein Mosaic "var. Ribeirão Bonito". At present it causes economically important losses in cotton crops if control measures are not implemented. The observed symptoms and mode of transmission have prompted researchers to speculate that cotton blue disease could be attributed to a member of the family Luteoviridae, but there was no molecular evidence supporting this hypothesis. We have amplified part of the genome of a virus associated with this disease using degenerate primers for members of the family Luteoviridae. Sequence analysis of the entire capsid and a partial RdRp revealed a virus probably belonging to the genus Polerovirus. Based on our results we propose that cotton blue disease is associated with a virus with the putative name Cotton leafroll dwarf virus (CLRDV).
Hinze, Lori L; Fang, David D; Gore, Michael A; Scheffler, Brian E; Yu, John Z; Frelichowski, James; Percy, Richard G
2015-02-01
A core marker set containing markers developed to be informative within a single commercial cotton species can elucidate diversity structure within a multi-species subset of the Gossypium germplasm collection. An understanding of the genetic diversity of cotton (Gossypium spp.) as represented in the US National Cotton Germplasm Collection is essential to develop strategies for collecting, conserving, and utilizing these germplasm resources. The US collection is one of the largest world collections and includes not only accessions with improved yield and fiber quality within cultivated species, but also accessions possessing sources of abiotic and biotic stress resistance often found in wild species. We evaluated the genetic diversity of a subset of 272 diploid and 1,984 tetraploid accessions in the collection (designated the Gossypium Diversity Reference Set) using a core set of 105 microsatellite markers. Utility of the core set of markers in differentiating intra-genome variation was much greater in commercial tetraploid genomes (99.7 % polymorphic bands) than in wild diploid genomes (72.7 % polymorphic bands), and may have been influenced by pre-selection of markers for effectiveness in the commercial species. Principal coordinate analyses revealed that the marker set differentiated interspecific variation among tetraploid species, but was only capable of partially differentiating among species and genomes of the wild diploids. Putative species-specific marker bands in G. hirsutum (73) and G. barbadense (81) were identified that could be used for qualitative identification of misclassifications, redundancies, and introgression within commercial tetraploid species. The results of this broad-scale molecular characterization are essential to the management and conservation of the collection and provide insight and guidance in the use of the collection by the cotton research community in their cotton improvement efforts.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium).
Stipanovic, Robert; Puckhaber, Lorraine; Frelichowski, James; Esquivel, Jesus; Westbrook, John; O'Neil, Mike; Bell, Alois; Dowd, Michael; Hake, Kater; Duke, Sara
2016-02-01
The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their leaves that contain the dimeric sesquiterpenoid gossypol as well as other biosynthetically related terpenoids. In addition to gossypol, a previously unknown dimeric sesquiterpenoid, gossypolhemiquinone (GHQ), was identified in trace amounts in G. thurberi, a member of the D genome. Other members of the D genome of Gossypium were subsequently found to contain this compound, but GHQ was not detected in commercial cotton cultivars. When fed to Helicoverpa zea in an artificial diet, GHQ delayed days-to-pupation, reduced pupal weights, and survival to adulthood to a lesser or equal extent than gossypol in comparison to the control diet. However, GHQ had a synergistic effect on survival and days-to-pupation when combined with gossypol at the highest dosage tested (0.18%; 15.5:84.5 GHQ:gossypol). Because gossypol exhibits anti-cancer activity, GHQ was also evaluated for its anti-cancer activity against the National Cancer Institute's 60-Human Tumor Cell Line Screen. Significant inhibitory activity against most of these cell lines was not observed, but the results may offer some promise against leukemia cancer cell lines. Published by Elsevier Ltd.
Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu
2017-11-01
Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton-producing and cotton-consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nationwide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into three subpopulations based on 11 975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among three genetic subpopulations, seven geographic distributions and four breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the three subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multieffects in QTLs and interassociations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S
2012-11-01
Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.
Wild emmer genome architecture and diversity elucidate wheat evolution and domestication.
Avni, Raz; Nave, Moran; Barad, Omer; Baruch, Kobi; Twardziok, Sven O; Gundlach, Heidrun; Hale, Iago; Mascher, Martin; Spannagl, Manuel; Wiebe, Krystalee; Jordan, Katherine W; Golan, Guy; Deek, Jasline; Ben-Zvi, Batsheva; Ben-Zvi, Gil; Himmelbach, Axel; MacLachlan, Ron P; Sharpe, Andrew G; Fritz, Allan; Ben-David, Roi; Budak, Hikmet; Fahima, Tzion; Korol, Abraham; Faris, Justin D; Hernandez, Alvaro; Mikel, Mark A; Levy, Avraham A; Steffenson, Brian; Maccaferri, Marco; Tuberosa, Roberto; Cattivelli, Luigi; Faccioli, Primetta; Ceriotti, Aldo; Kashkush, Khalil; Pourkheirandish, Mohammad; Komatsuda, Takao; Eilam, Tamar; Sela, Hanan; Sharon, Amir; Ohad, Nir; Chamovitz, Daniel A; Mayer, Klaus F X; Stein, Nils; Ronen, Gil; Peleg, Zvi; Pozniak, Curtis J; Akhunov, Eduard D; Distelfeld, Assaf
2017-07-07
Wheat ( Triticum spp.) is one of the founder crops that likely drove the Neolithic transition to sedentary agrarian societies in the Fertile Crescent more than 10,000 years ago. Identifying genetic modifications underlying wheat's domestication requires knowledge about the genome of its allo-tetraploid progenitor, wild emmer ( T. turgidum ssp. dicoccoides ). We report a 10.1-gigabase assembly of the 14 chromosomes of wild tetraploid wheat, as well as analyses of gene content, genome architecture, and genetic diversity. With this fully assembled polyploid wheat genome, we identified the causal mutations in Brittle Rachis 1 ( TtBtr1 ) genes controlling shattering, a key domestication trait. A study of genomic diversity among wild and domesticated accessions revealed genomic regions bearing the signature of selection under domestication. This reference assembly will serve as a resource for accelerating the genome-assisted improvement of modern wheat varieties. Copyright © 2017, American Association for the Advancement of Science.
He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming
2011-01-01
The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.
Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos
2008-01-01
Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation
Transcriptome analysis of cytoplasmic male sterility and restoration in CMS-D8 cotton.
Suzuki, Hideaki; Rodriguez-Uribe, Laura; Xu, Jiannong; Zhang, Jinfa
2013-10-01
A global view of differential expression of genes in CMS-D8 of cotton was presented in this study which will facilitate the understanding of cytoplasmic male sterility in cotton. Cytoplasmic male sterility (CMS) is a maternally inherited trait in higher plants which is incapable of producing functional pollen. However, the male fertility can be restored by one or more nuclear-encoded restorer genes. A genome-wide transcriptome analysis of CMS and restoration in cotton is currently lacking. In this study, Affymetrix GeneChips© Cotton Genome Array containing 24,132 transcripts was used to compare differentially expressed (DE) genes of flower buds at the meiosis stage between CMS and its restorer cotton plants conditioned by the D8 cytoplasm. A total of 458 (1.9 %) of DE genes including 127 up-regulated and 331 down-regulated ones were identified in the CMS-D8 line. Quantitative RT-PCR was used to validate 10 DE genes selected from seven functional categories. The most frequent DE gene group was found to encode putative proteins involved in cell wall expansion, such as pectinesterase, pectate lyase, pectin methylesterase, glyoxal oxidase, polygalacturonase, indole-3-acetic acid-amino synthetase, and xyloglucan endo-transglycosylase. Genes in cytoskeleton category including actin, which plays a key role in cell wall expansion, cell elongation and cell division, were also highly differentially expressed between the fertile and CMS plants. This work represents the first study in utilizing microarray to identify CMS-related genes by comparing overall DE genes between fertile and CMS plants in cotton. The results provide evidence that many CMS-associated genes are mainly involved in cell wall expansion. Further analysis will be required to elucidate the molecular mechanisms of male sterility which will facilitate the development of new hybrid cultivars in cotton.
Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc
2012-01-01
A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214
Nardeli, Sarah Muniz; Artico, Sinara; Aoyagi, Gustavo Mitsunori; de Moura, Stéfanie Menezes; da Franca Silva, Tatiane; Grossi-de-Sa, Maria Fatima; Romanel, Elisson; Alves-Ferreira, Marcio
2018-06-01
The MADS-box gene family encodes transcription factors that share a highly conserved domain known to bind to DNA. Members of this family control various processes of development in plants, from root formation to fruit ripening. In this work, a survey of diploid (Gossypium raimondii and Gossypium arboreum) and tetraploid (Gossypium hirsutum) cotton genomes found a total of 147, 133 and 207 MADS-box genes, respectively, distributed in the MIKC, Mα, Mβ, Mγ, and Mδ subclades. A comparative phylogenetic analysis among cotton species, Arabidopsis, poplar and grapevine MADS-box homologous genes allowed us to evaluate the evolution of each MADS-box lineage in cotton plants and identify sequences within well-established subfamilies. Chromosomal localization and phylogenetic analysis revealed that G. raimondii and G. arboreum showed a conserved evolution of the MIKC subclade and a distinct pattern of duplication events in the Mα, Mγ and Mδ subclades. Additionally, G. hirsutum showed a combination of its parental subgenomes followed by a distinct evolutionary history including gene gain and loss in each subclade. qPCR analysis revealed the expression patterns of putative homologs in the AP1, AP3, AGL6, SEP4, AGL15, AG, AGL17, TM8, SVP, SOC and TT16 subfamilies of G. hirsutum. The identification of putative cotton orthologs is discussed in the light of evolution and gene expression data from other plants. This analysis of the MADS-box genes in Gossypium species opens an avenue to understanding the origin and evolution of each gene subfamily within diploid and polyploid species and paves the way for functional studies in cotton species. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel
2002-01-01
Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...
The B73 maize genome: complexity, diversity, and dynamics.
Schnable, Patrick S; Ware, Doreen; Fulton, Robert S; Stein, Joshua C; Wei, Fusheng; Pasternak, Shiran; Liang, Chengzhi; Zhang, Jianwei; Fulton, Lucinda; Graves, Tina A; Minx, Patrick; Reily, Amy Denise; Courtney, Laura; Kruchowski, Scott S; Tomlinson, Chad; Strong, Cindy; Delehaunty, Kim; Fronick, Catrina; Courtney, Bill; Rock, Susan M; Belter, Eddie; Du, Feiyu; Kim, Kyung; Abbott, Rachel M; Cotton, Marc; Levy, Andy; Marchetto, Pamela; Ochoa, Kerri; Jackson, Stephanie M; Gillam, Barbara; Chen, Weizu; Yan, Le; Higginbotham, Jamey; Cardenas, Marco; Waligorski, Jason; Applebaum, Elizabeth; Phelps, Lindsey; Falcone, Jason; Kanchi, Krishna; Thane, Thynn; Scimone, Adam; Thane, Nay; Henke, Jessica; Wang, Tom; Ruppert, Jessica; Shah, Neha; Rotter, Kelsi; Hodges, Jennifer; Ingenthron, Elizabeth; Cordes, Matt; Kohlberg, Sara; Sgro, Jennifer; Delgado, Brandon; Mead, Kelly; Chinwalla, Asif; Leonard, Shawn; Crouse, Kevin; Collura, Kristi; Kudrna, Dave; Currie, Jennifer; He, Ruifeng; Angelova, Angelina; Rajasekar, Shanmugam; Mueller, Teri; Lomeli, Rene; Scara, Gabriel; Ko, Ara; Delaney, Krista; Wissotski, Marina; Lopez, Georgina; Campos, David; Braidotti, Michele; Ashley, Elizabeth; Golser, Wolfgang; Kim, HyeRan; Lee, Seunghee; Lin, Jinke; Dujmic, Zeljko; Kim, Woojin; Talag, Jayson; Zuccolo, Andrea; Fan, Chuanzhu; Sebastian, Aswathy; Kramer, Melissa; Spiegel, Lori; Nascimento, Lidia; Zutavern, Theresa; Miller, Beth; Ambroise, Claude; Muller, Stephanie; Spooner, Will; Narechania, Apurva; Ren, Liya; Wei, Sharon; Kumari, Sunita; Faga, Ben; Levy, Michael J; McMahan, Linda; Van Buren, Peter; Vaughn, Matthew W; Ying, Kai; Yeh, Cheng-Ting; Emrich, Scott J; Jia, Yi; Kalyanaraman, Ananth; Hsia, An-Ping; Barbazuk, W Brad; Baucom, Regina S; Brutnell, Thomas P; Carpita, Nicholas C; Chaparro, Cristian; Chia, Jer-Ming; Deragon, Jean-Marc; Estill, James C; Fu, Yan; Jeddeloh, Jeffrey A; Han, Yujun; Lee, Hyeran; Li, Pinghua; Lisch, Damon R; Liu, Sanzhen; Liu, Zhijie; Nagel, Dawn Holligan; McCann, Maureen C; SanMiguel, Phillip; Myers, Alan M; Nettleton, Dan; Nguyen, John; Penning, Bryan W; Ponnala, Lalit; Schneider, Kevin L; Schwartz, David C; Sharma, Anupma; Soderlund, Carol; Springer, Nathan M; Sun, Qi; Wang, Hao; Waterman, Michael; Westerman, Richard; Wolfgruber, Thomas K; Yang, Lixing; Yu, Yeisoo; Zhang, Lifang; Zhou, Shiguo; Zhu, Qihui; Bennetzen, Jeffrey L; Dawe, R Kelly; Jiang, Jiming; Jiang, Ning; Presting, Gernot G; Wessler, Susan R; Aluru, Srinivas; Martienssen, Robert A; Clifton, Sandra W; McCombie, W Richard; Wing, Rod A; Wilson, Richard K
2009-11-20
We report an improved draft nucleotide sequence of the 2.3-gigabase genome of maize, an important crop plant and model for biological research. Over 32,000 genes were predicted, of which 99.8% were placed on reference chromosomes. Nearly 85% of the genome is composed of hundreds of families of transposable elements, dispersed nonuniformly across the genome. These were responsible for the capture and amplification of numerous gene fragments and affect the composition, sizes, and positions of centromeres. We also report on the correlation of methylation-poor regions with Mu transposon insertions and recombination, and copy number variants with insertions and/or deletions, as well as how uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. These analyses inform and set the stage for further investigations to improve our understanding of the domestication and agricultural improvements of maize.
Hulse-Kemp, Amanda M.; Lemm, Jana; Plieske, Joerg; Ashrafi, Hamid; Buyyarapu, Ramesh; Fang, David D.; Frelichowski, James; Giband, Marc; Hague, Steve; Hinze, Lori L.; Kochan, Kelli J.; Riggs, Penny K.; Scheffler, Jodi A.; Udall, Joshua A.; Ulloa, Mauricio; Wang, Shirley S.; Zhu, Qian-Hao; Bag, Sumit K.; Bhardwaj, Archana; Burke, John J.; Byers, Robert L.; Claverie, Michel; Gore, Michael A.; Harker, David B.; Islam, Md S.; Jenkins, Johnie N.; Jones, Don C.; Lacape, Jean-Marc; Llewellyn, Danny J.; Percy, Richard G.; Pepper, Alan E.; Poland, Jesse A.; Mohan Rai, Krishan; Sawant, Samir V.; Singh, Sunil Kumar; Spriggs, Andrew; Taylor, Jen M.; Wang, Fei; Yourstone, Scott M.; Zheng, Xiuting; Lawley, Cindy T.; Ganal, Martin W.; Van Deynze, Allen; Wilson, Iain W.; Stelly, David M.
2015-01-01
High-throughput genotyping arrays provide a standardized resource for plant breeding communities that are useful for a breadth of applications including high-density genetic mapping, genome-wide association studies (GWAS), genomic selection (GS), complex trait dissection, and studying patterns of genomic diversity among cultivars and wild accessions. We have developed the CottonSNP63K, an Illumina Infinium array containing assays for 45,104 putative intraspecific single nucleotide polymorphism (SNP) markers for use within the cultivated cotton species Gossypium hirsutum L. and 17,954 putative interspecific SNP markers for use with crosses of other cotton species with G. hirsutum. The SNPs on the array were developed from 13 different discovery sets that represent a diverse range of G. hirsutum germplasm and five other species: G. barbadense L., G. tomentosum Nuttal × Seemann, G. mustelinum Miers × Watt, G. armourianum Kearny, and G. longicalyx J.B. Hutchinson and Lee. The array was validated with 1,156 samples to generate cluster positions to facilitate automated analysis of 38,822 polymorphic markers. Two high-density genetic maps containing a total of 22,829 SNPs were generated for two F2 mapping populations, one intraspecific and one interspecific, and 3,533 SNP markers were co-occurring in both maps. The produced intraspecific genetic map is the first saturated map that associates into 26 linkage groups corresponding to the number of cotton chromosomes for a cross between two G. hirsutum lines. The linkage maps were shown to have high levels of collinearity to the JGI G. raimondii Ulbrich reference genome sequence. The CottonSNP63K array, cluster file and associated marker sequences constitute a major new resource for the global cotton research community. PMID:25908569
76 FR 80278 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-23
...-0066] RIN 0581-AD19 Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade... Pima cotton. The leaf grade is a part of the official classification which denotes cotton fiber quality used in cotton marketing and manufacturing of cotton products. Currently, the leaf grade is determined...
Allotetraploid hybrids between citrus and seven related genera produced by somatic hybridization.
Grosser, J W; Mourao-Fo, F A; Gmitter, F G; Louzada, E S; Jiang, J; Baergen, K; Quiros, A; Cabasson, C; Schell, J L; Chandler, J L
1996-04-01
We have developed an efficient protoplast-fusion method to produce somatic hybrid allopolyploid plants that combine Citrus with seven related genera, including four that are sexually incompatible. In this paper we report the creation of 18 new allotetraploid hybrids of Citrus, including ten among sexually incompatible related genera, that may have direct cultivar potential as improved citrus rootstocks. All hybrids were confirmed by cytological and RAPD analyses. If fertile, the attributes of these hybrids may be amenable to further genetic manipulation by breeding at the tetraploid level. Wide somatic hybridization of Citrus via protoplast fusion bypasses biological barriers to the natural allopolyploidization of Citrus, and creates new evolutionary opportunities that would be difficult or impossible to achieve by natural or conventional hybridization.
Mu, Min; Lu, Xu-Ke; Wang, Jun-Juan; Wang, De-Long; Yin, Zu-Jun; Wang, Shuai; Fan, Wei-Li; Ye, Wu-Wei
2016-03-18
Trehalose (a-D-glucopyranosyl a-D-glucopyranoside) is a nonreducing disaccharide and is widely distributed in bacteria, fungi, algae, plants and invertebrates. In the study, the identification of trehalose-6-phosphate synthase (TPS) genes stress-related in cotton, and the genetic structure analysis and molecular evolution analysis of TPSs were conducted with bioinformatics methods, which could lay a foundation for further research of TPS functions in cotton. The genome information of Gossypium raimondii (group D), G. arboreum L. (group A), and G. hirsutum L. (group AD) was used in the study. Fifty-three TPSs were identified comprising 15 genes in group D, 14 in group A, and 24 in group AD. Bioinformatics methods were used to analyze the genetic structure and molecular evolution of TPSs. Real-time PCR analysis was performed to investigate the expression patterns of gene family members. All TPS family members in cotton can be divided into two subfamilies: Class I and Class II. The similarity of the TPS sequence is high within the same species and close within their family relatives. The genetic structures of two TPS subfamily members are different, with more introns and a more complicated gene structure in Class I. There is a TPS domain(Glyco transf_20) at the N-terminal in all TPS family members and a TPP domain(Trehalose_PPase) at the C-terminal in all except GrTPS6, GhTPS4, and GhTPS9. All Class II members contain a UDP-forming domain. The responses to environmental stresses showed that stresses could induce the expression of TPSs but the expression patterns vary with different stresses. The distribution of TPSs varies with different species but is relatively uniform on chromosomes. Genetic structure varies with different gene members, and expression levels vary with different stresses and exhibit tissue specificity. The upregulated genes in upland cotton TM-1 is significantly more than that in G. raimondii and G. arboreum L. Shixiya 1.
Baker, Robert L; Yarkhunova, Yulia; Vidal, Katherine; Ewers, Brent E; Weinig, Cynthia
2017-01-05
Polyploidy is well studied from a genetic and genomic perspective, but the morphological, anatomical, and physiological consequences of polyploidy remain relatively uncharacterized. Whether these potential changes bear on functional integration or are idiosyncratic remains an open question. Repeated allotetraploid events and multiple genomic combinations as well as overlapping targets of artificial selection make the Brassica triangle an excellent system for exploring variation in the connection between plant structure (anatomy and morphology) and function (physiology). We examine phenotypic integration among structural aspects of leaves including external morphology and internal anatomy with leaf-level physiology among several species of Brassica. We compare diploid and allotetraploid species to ascertain patterns of phenotypic correlations among structural and functional traits and test the hypothesis that allotetraploidy results in trait disintegration allowing for transgressive phenotypes and additional evolutionary and crop improvement potential. Among six Brassica species, we found significant effects of species and ploidy level for morphological, anatomical and physiological traits. We identified three suites of intercorrelated traits in both diploid parents and allotetraploids: Morphological traits (such as leaf area and perimeter) anatomic traits (including ab- and ad- axial epidermis) and aspects of physiology. In general, there were more correlations between structural and functional traits for allotetraploid hybrids than diploid parents. Parents and hybrids did not have any significant structure-function correlations in common. Of particular note, there were no significant correlations between morphological structure and physiological function in the diploid parents. Increased phenotypic integration in the allotetraploid hybrids may be due, in part, to increased trait ranges or simply different structure-function relationships. Genomic and chromosomal
Lee, Seung-Bum; Kaittanis, Charalambos; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-01-01
Background Cotton (Gossypium hirsutum) is the most important fiber crop grown in 90 countries. In 2004–2005, US farmers planted 79% of the 5.7-million hectares of nuclear transgenic cotton. Unfortunately, genetically modified cotton has the potential to hybridize with other cultivated and wild relatives, resulting in geographical restrictions to cultivation. However, chloroplast genetic engineering offers the possibility of containment because of maternal inheritance of transgenes. The complete chloroplast genome of cotton provides essential information required for genetic engineering. In addition, the sequence data were used to assess phylogenetic relationships among the major clades of rosids using cotton and 25 other completely sequenced angiosperm chloroplast genomes. Results The complete cotton chloroplast genome is 160,301 bp in length, with 112 unique genes and 19 duplicated genes within the IR, containing a total of 131 genes. There are four ribosomal RNAs, 30 distinct tRNA genes and 17 intron-containing genes. The gene order in cotton is identical to that of tobacco but lacks rpl22 and infA. There are 30 direct and 24 inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Most of the direct repeats are within intergenic spacer regions, introns and a 72 bp-long direct repeat is within the psaA and psaB genes. Comparison of protein coding sequences with expressed sequence tags (ESTs) revealed nucleotide substitutions resulting in amino acid changes in ndhC, rpl23, rpl20, rps3 and clpP. Phylogenetic analysis of a data set including 61 protein-coding genes using both maximum likelihood and maximum parsimony were performed for 28 taxa, including cotton and five other angiosperm chloroplast genomes that were not included in any previous phylogenies. Conclusion Cotton chloroplast genome lacks rpl22 and infA and contains a number of dispersed direct and inverted repeats. RNA editing resulted in amino acid changes with significant impact on their
Cheng, Xi; Wang, Yanan; Abdullah, Muhammad; Li, Manli; Li, Dahui; Gao, Junshan
2017-01-01
Plant type III polyketide synthase (PKS) can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum) and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV). The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C) of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs) in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber. PMID:29104824
Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A
2017-12-10
Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected
Long noncoding RNAs and their proposed functions in fibre development of cotton (Gossypium spp.).
Wang, Maojun; Yuan, Daojun; Tu, Lili; Gao, Wenhui; He, Yonghui; Hu, Haiyan; Wang, Pengcheng; Liu, Nian; Lindsey, Keith; Zhang, Xianlong
2015-09-01
Long noncoding RNAs (lncRNAs) are transcripts of at least 200 bp in length, possess no apparent coding capacity and are involved in various biological regulatory processes. Until now, no systematic identification of lncRNAs has been reported in cotton (Gossypium spp.). Here, we describe the identification of 30 550 long intergenic noncoding RNA (lincRNA) loci (50 566 transcripts) and 4718 long noncoding natural antisense transcript (lncNAT) loci (5826 transcripts). LncRNAs are rich in repetitive sequences and preferentially expressed in a tissue-specific manner. The detection of abundant genome-specific and/or lineage-specific lncRNAs indicated their weak evolutionary conservation. Approximately 76% of homoeologous lncRNAs exhibit biased expression patterns towards the At or Dt subgenomes. Compared with protein-coding genes, lncRNAs showed overall higher methylation levels and their expression was less affected by gene body methylation. Expression validation in different cotton accessions and coexpression network construction helped to identify several functional lncRNA candidates involved in cotton fibre initiation and elongation. Analysis of integrated expression from the subgenomes of lncRNAs generating miR397 and its targets as a result of genome polyploidization indicated their pivotal functions in regulating lignin metabolism in domesticated tetraploid cotton fibres. This study provides the first comprehensive identification of lncRNAs in Gossypium. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
USDA-ARS?s Scientific Manuscript database
The cotton fleahopper (CFH), Pseudatomoscelis seriatus (Reuter, 1876) (Hemiptera: Miridae), is a pest of commercial cotton (Gossypium hirsutum L.) with over 100 known host plants across its range. Both adults and nymphs attack small, developing squares, leading to abscission of the square. A new t...
75 FR 24373 - Cotton Research and Promotion Program: Designation of Cotton-Producing States
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-05
... 0581-AC84 Cotton Research and Promotion Program: Designation of Cotton- Producing States AGENCY... amending the Cotton Research and Promotion Order (Cotton Order) following a referendum held October 13 through November 10, 2009, in which Upland cotton producers and importers favored the adoption of two...
77 FR 20503 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-05
...-AD19 Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade AGENCY... amending the procedures for determining the official leaf grade for Upland and Pima cotton. The leaf grade is a part of the official classification which denotes cotton fiber quality used in cotton marketing...
USDA-ARS?s Scientific Manuscript database
Next generation sequencing offers new ways to identify the genetic mechanisms that underlie mutant phenotypes. The release of a reference diploid Gossypium raimondii (D5) genome and bioinformatics tools to sort tetraploid reads into subgenomes has brought cotton genetic mapping into the genomics er...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton harvested...
Silva, TF; Corrêa, RL; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, MFS
2008-01-01
Background Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus. PMID:18937850
Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S
2008-10-20
Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.
Mining cotton germplasm resources to fight Cotton Leaf Curl Virus
USDA-ARS?s Scientific Manuscript database
CLCuV (Cotton Leaf Curl Virus) is a major threat to cotton production in Pakistan and parts of India and has been reported in cotton producing countries in Africa, as well as China and Uzbekistan. Identifying sources of resistance to CLCuV helps not only countries such as Pakistan where the virus is...
Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping
2013-01-01
Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.
USDA-ARS?s Scientific Manuscript database
The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...
Shang, Xiaoguang; Cheng, Chaoze; Ding, Jian; Guo, Wangzhen
2017-02-01
Cotton is an economically important crop grown for natural fiber and seed oil production. Cottonseed oil ranks third after soybean oil and colza oil in terms of edible oilseed tonnage worldwide. The fatty acid composition of cottonseed oil determines its industrial application and nutritional values. However, little progress has been made in understanding cottonseed oil biogenesis. Stearoyl-acyl carrier protein desaturase (SAD), the only known enzyme to convert saturated fatty acids into unsaturated fatty acids in plants, plays key roles in determining the fatty acid composition of cottonseed oil. In this study, we identified 9, 9, 18 and 19 SAD genes in the genomes of four sequenced cotton species: diploid Gossypium raimondii (D 5 ), G. arboreum (A 2 ), tetraploid G. hirsutum acc. TM-1 (AD 1 ) and G. barbadense cv. Xinhai21 (AD 2 ), respectively. Bioinformatic and phylogenetic analyses revealed that cotton SADs can be classified into two classes. Expression patterns showed developmental and spatial regulation of SADs in cotton. GhSAD2 and GhSAD4 were preferentially expressed in developing ovules 20-35 days post-anthesis, and significantly different expression patterns were found between high-oil and low-oil cotton cultivars, implying these two genes could be involved in cottonseed oil biogenesis. Association analysis further confirmed that GhSAD4-At expression was closely related to the oleic acid (O) content, linoleic acid (L) content and O/L value in cottonseed, implying GhSAD4 plays an important role in cottonseed oil composition. This study brings new perspectives for integrated genome-wide identification of SADs in cotton and provides references for the genetic improvement of cottonseed oil.
Dynamic nucleolar activity in wheat × Aegilops hybrids: evidence of C-genome dominance.
Mirzaghaderi, Ghader; Abdolmalaki, Zinat; Zohouri, Mohsen; Moradi, Zeinab; Mason, Annaliese S
2017-08-01
NOR loci of C-subgenome are dominant in wheat × Aegilops interspecific hybrids, which may have evolutionary implications for wheat group genome dynamics and evolution. After interspecific hybridisation, some genes are often expressed from only one of the progenitor species, shaping subsequent allopolyploid genome evolution processes. A well-known example is nucleolar dominance, i.e. the formation of cell nucleoli from chromosomes of only one parental species. We studied nucleolar organizing regions (NORs) in diploid Aegilops markgrafii (syn: Ae. caudata; CC), Ae. umbellulata (UU), allotetraploids Aegilops cylindrica (C c C c D c D c ) and Ae. triuncialis (C t C t U t U t ), synthetic interspecific F 1 hybrids between these two allotetraploids and bread wheat (Triticum aestivum, AABBDD) and in F 3 generation hybrids with genome composition AABBDDC t C t U t U t using silver staining and fluorescence in situ hybridization (FISH). In Ae. markgrafii (CC), NORs of both 1C and 5C or only 5C chromosome pairs were active in different individual cells, while only NORs on 1U chromosomes were active in Ae. umbellulata (UU). Although all 35S rDNA loci of the C t subgenome (located on 1C t and 5C t ) were active in Ae. triuncialis, only one pair (occupying either 1C c or 5C c ) was active in Ae. cylindrica, depending on the genotype studied. These C-genome expression patterns were transmitted to the F 1 and F 3 generations. Wheat chromosome NOR activity was variable in Ae. triuncialis × T. aestivum F 1 seeds, but silenced by the F 3 generation. No effect of maternal or paternal cross direction was observed. These results indicate that C-subgenome NOR loci are dominant in wheat × Aegilops interspecific hybrids, which may have evolutionary implications for wheat group genome dynamics and allopolyploid evolution.
Liu, Guoyuan; Li, Xue; Guo, Liping; Zhang, Xuexian; Qi, Tingxiang; Wang, Hailin; Tang, Huini; Qiao, Xiuqin; Zhang, Jinfa; Xing, Chaozhu; Wu, Jianyong
2017-01-01
The RNA editing occurring in plant organellar genomes mainly involves the change of cytidine to uridine. This process involves a deamination reaction, with cytidine deaminase as the catalyst. Pentatricopeptide repeat (PPR) proteins with a C-terminal DYW domain are reportedly associated with cytidine deamination, similar to members of the deaminase superfamily. PPR genes are involved in many cellular functions and biological processes including fertility restoration to cytoplasmic male sterility (CMS) in plants. In this study, we identified 227 and 211 DYW deaminase-coding PPR genes for the cultivated tetraploid cotton species G. hirsutum and G. barbadense (2n = 4x = 52), respectively, as well as 126 and 97 DYW deaminase-coding PPR genes in the ancestral diploid species G. raimondii and G. arboreum (2n = 26), respectively. The 227 G. hirsutum PPR genes were predicted to encode 52–2016 amino acids, 203 of which were mapped onto 26 chromosomes. Most DYW deaminase genes lacked introns, and their proteins were predicted to target the mitochondria or chloroplasts. Additionally, the DYW domain differed from the complete DYW deaminase domain, which contained part of the E domain and the entire E+ domain. The types and number of DYW tripeptides may have been influenced by evolutionary processes, with some tripeptides being lost. Furthermore, a gene ontology analysis revealed that DYW deaminase functions were mainly related to binding as well as hydrolase and transferase activities. The G. hirsutum DYW deaminase expression profiles varied among different cotton tissues and developmental stages, and no differentially expressed DYW deaminase-coding PPRs were directly associated with the male sterility and restoration in the CMS-D2 system. Our current study provides an important piece of information regarding the structural and evolutionary characteristics of Gossypium DYW-containing PPR genes coding for deaminases and will be useful for characterizing the DYW deaminase gene
Wide-cross whole-genome radiation hybrid mapping of cotton (Gossypium hirsutum L.).
Gao, Wenxiang; Chen, Z Jeffrey; Yu, John Z; Raska, Dwaine; Kohel, Russell J; Womack, James E; Stelly, David M
2004-01-01
We report the development and characterization of a "wide-cross whole-genome radiation hybrid" (WWRH) panel from cotton (Gossypium hirsutum L.). Chromosomes were segmented by gamma-irradiation of G. hirsutum (n = 26) pollen, and segmented chromosomes were rescued after in vivo fertilization of G. barbadense egg cells (n = 26). A 5-krad gamma-ray WWRH mapping panel (N = 93) was constructed and genotyped at 102 SSR loci. SSR marker retention frequencies were higher than those for animal systems and marker retention patterns were informative. Using the program RHMAP, 52 of 102 SSR markers were mapped into 16 syntenic groups. Linkage group 9 (LG 9) SSR markers BNL0625 and BNL2805 had been colocalized by linkage analysis, but their order was resolved by differential retention among WWRH plants. Two linkage groups, LG 13 and LG 9, were combined into one syntenic group, and the chromosome 1 linkage group marker BNL4053 was reassigned to chromosome 9. Analyses of cytogenetic stocks supported synteny of LG 9 and LG 13 and localized them to the short arm of chromosome 17. They also supported reassignment of marker BNL4053 to the long arm of chromosome 9. A WWRH map of the syntenic group composed of linkage groups 9 and 13 was constructed by maximum-likelihood analysis under the general retention model. The results demonstrate not only the feasibility of WWRH panel construction and mapping, but also complementarity to traditional linkage mapping and cytogenetic methods. PMID:15280245
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry...
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry...
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Substances migrating from cotton and cotton... Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are generally...
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry...
Feast and famine in plant genomes.
Jonathan F. Wendel; Richard C. Cronn; J. Spencer Jonhston; H. James Price
2002-01-01
Plant genomes vary over several orders of magnitude in size, even among closely related species, yet the origin, genesis and significance of this variation are not clear. Because DNA content varies over a sevenfold range among diploid species in the cotton genus (Gossypium) and its allies, this group offers opportunities for exploring patterns and mechanisms of genome...
Chen, Wen; Si, Guo-Yang; Zhao, Gang; Abdullah, Muhammad; Guo, Ning; Li, Da-Hui; Sun, Xu; Cai, Yong-Ping; Lin, Yi; Gao, Jun-Shan
2018-05-05
Plant P-type H⁺-ATPase (P-ATPase) is a membrane protein existing in the plasma membrane that plays an important role in the transmembrane transport of plant cells. To understand the variety and quantity of P-ATPase proteins in different cotton species, we combined four databases from two diploid cotton species ( Gossypium raimondii and G. arboreum ) and two tetraploid cotton species ( G. hirsutum and G. barbadense ) to screen the P-ATPase gene family and resolved the evolutionary relationships between the former cotton species. We identified 53, 51, 99 and 98 P-ATPase genes from G. arboretum, G. raimondii , G. barbadense and G. hirsutum , respectively. The structural and phylogenetic analyses revealed that the gene structure was consistent between P-ATPase genes, with a close evolutionary relationship. The expression analysis of P-ATPase genes showed that many P-ATPase genes were highly expressed in various tissues and at different fiber developmental stages in G. hirsutum , suggesting that they have potential functions during growth and fiber development in cotton.
21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Substances migrating from cotton and cotton fabrics... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry...
Su, Aiguo; Geng, Jianing; Grover, Corrinne E.; Hu, Songnian; Hua, Jinping
2013-01-01
Background Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. Methodology/Principal Findings We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. Conclusion The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species. PMID:23940520
Williams, Warren M; Ellison, Nicholas W; Ansari, Helal A; Verry, Isabelle M; Hussain, S Wajid
2012-04-24
White clover (Trifolium repens) is a ubiquitous weed of the temperate world that through use of improved cultivars has also become the most important legume of grazed pastures world-wide. It has long been suspected to be allotetraploid, but the diploid ancestral species have remained elusive. Putative diploid ancestors were indicated by DNA sequence phylogeny to be T. pallescens and T. occidentale. Here, we use further DNA evidence as well as a combination of molecular cytogenetics (FISH and GISH) and experimental hybridization to test the hypothesis that white clover originated as a hybrid between T. pallescens and T. occidentale. T. pallescens plants were identified with chloroplast trnL intron DNA sequences identical to those of white clover. Similarly, T. occidentale plants with nuclear ITS sequences identical to white clover were also identified. Reciprocal GISH experiments, alternately using labeled genomic DNA probes from each of the putative ancestral species on the same white clover cells, showed that half of the chromosomes hybridized with each probe. F1 hybrids were generated by embryo rescue and these showed strong interspecific chromosome pairing and produced a significant frequency of unreduced gametes, indicating the likely mode of polyploidization. The F1 hybrids are inter-fertile with white clover and function as synthetic white clovers, a valuable new resource for the re-incorporation of ancestral genomes into modern white clover for future plant breeding. Evidence from DNA sequence analyses, molecular cytogenetics, interspecific hybridization and breeding experiments supports the hypothesis that a diploid alpine species (T. pallescens) hybridized with a diploid coastal species (T. occidentale) to generate tetraploid T. repens. The coming together of these two narrowly adapted species (one alpine and the other maritime), along with allotetraploidy, has led to a transgressive hybrid with a broad adaptive range.
Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.
Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang
2012-01-01
Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.
Cotton 2K-Management tools for irrigated cotton
USDA-ARS?s Scientific Manuscript database
The use of simulation models to manage crops was a concept introduced in the 1980’s. For example, the cotton simulation model known as GOSSYM was made available in 1989 and was used by both producers and consultants to manage cotton in real time. More recently, Dr. Avi Marani, Professor Emeritus, Sc...
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
USDA-ARS?s Scientific Manuscript database
A bacterial artificial chromosome (BAC) library and BAC-end sequences for Gossypium hirsutum L. have recently been developed. Here we report on genomic-based genome-wide SNP mining utilizing re-sequencing data with a BAC-end sequence reference for twelve G. hirsutum L. lines, one G. barbadense L. li...
Sequencing and comparative analyses of the genomes of zoysiagrasses
Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei
2016-01-01
Zoysia is a warm-season turfgrass, which comprises 11 allotetraploid species (2n = 4x = 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession ‘Nagirizaki’ (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella ‘Wakaba’ and Z. pacifica ‘Zanpa’ were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica ‘Kyoto’, Z. japonica ‘Miyagi’ and Z. matrella ‘Chiba Fair Green’, were accumulated, and aligned against the reference genome of ‘Nagirizaki’ along with those from ‘Wakaba’ and ‘Zanpa’. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the ‘Zoysia Genome Database’ at http://zoysia.kazusa.or.jp. PMID:26975196
Sequencing and comparative analyses of the genomes of zoysiagrasses.
Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei
2016-04-01
Zoysiais a warm-season turfgrass, which comprises 11 allotetraploid species (2n= 4x= 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession 'Nagirizaki' (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella 'Wakaba' and Z. pacifica 'Zanpa' were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica'Kyoto', Z. japonica'Miyagi' and Z. matrella'Chiba Fair Green', were accumulated, and aligned against the reference genome of 'Nagirizaki' along with those from 'Wakaba' and 'Zanpa'. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the 'Zoysia Genome Database' at http://zoysia.kazusa.or.jp. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong
2016-01-01
TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372
Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong
2016-02-09
TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all Upland...
Efect of tri-species chromosome shuffling on agronomic and fiber traits in Upland cotton
USDA-ARS?s Scientific Manuscript database
Gossypium barbadense (L.), G. tomentosum (Seem.), G. mustelinum (Watt.) and G. darwinii (Watt.) are in the primary gene pool of Upland cotton (G. hirsutum). They share a common chromosome number (2n=52), similar AD-genome architecture, and form reasonably fertile F1 hybrids. However, reduced transm...
7 CFR 1205.308 - Cotton Board.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the administrative...
7 CFR 1205.305 - Upland cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...
7 CFR 1205.308 - Cotton Board.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the administrative...
7 CFR 1205.308 - Cotton Board.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the administrative...
7 CFR 1205.305 - Upland cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...
7 CFR 1205.308 - Cotton Board.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the administrative...
7 CFR 1205.305 - Upland cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...
7 CFR 1205.305 - Upland cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...
7 CFR 1205.305 - Upland cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all cultivated...
7 CFR 1205.308 - Cotton Board.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the administrative...
Global gene expression in cotton (Gossypium hirsutum L.) leaves to waterlogging stress.
Zhang, Yanjun; Kong, Xiangqiang; Dai, Jianlong; Luo, Zhen; Li, Zhenhuai; Lu, Hequan; Xu, Shizhen; Tang, Wei; Zhang, Dongmei; Li, Weijiang; Xin, Chengsong; Dong, Hezhong
2017-01-01
Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control)-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH), but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.
Global gene expression in cotton (Gossypium hirsutum L.) leaves to waterlogging stress
Zhang, Yanjun; Kong, Xiangqiang; Dai, Jianlong; Luo, Zhen; Li, Zhenhuai; Lu, Hequan; Xu, Shizhen; Tang, Wei; Zhang, Dongmei; Li, Weijiang; Xin, Chengsong
2017-01-01
Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control)-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH), but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress. PMID:28953908
Linkage Map Construction and QTL Analysis of Agronomic and Fiber Quality Traits in Cotton.
USDA-ARS?s Scientific Manuscript database
The superior fiber properties of Gossypium barbadense L. serve as a source of novel variation for improving fiber quality in Upland cotton (G. hirsutum L.), but introgression from G. barbadense has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an e...
Dictionary of cotton: Picking & ginning
USDA-ARS?s Scientific Manuscript database
Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...
Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng
2018-01-01
The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506
New technologies for managing cotton modules
USDA-ARS?s Scientific Manuscript database
New cotton harvesters with the ability to form seed cotton modules have changed the way that cotton is stored and handled before ginning. Cylindrical or “round” modules formed by John Deere cotton pickers and strippers are wrapped in three layers of plastic material to protect the cotton and mainta...
Cell Suspension Culture-Mediated Incorporation of the Rice Bel Gene into Transgenic Cotton
Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang
2012-01-01
Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops. PMID:22768325
NASA Astrophysics Data System (ADS)
Huang, Jian; Hao, HongFei
2018-05-01
Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.
Huang, Jian; Hao, HongFei
2018-05-11
Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.
Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin
2013-04-11
The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The
2013-01-01
Background The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. Results GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Conclusions Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC’C’. Qing 9 is a B genome species indigenous to China and is hypothesized to be
7 CFR 28.106 - Universal cotton standards.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official cotton...
7 CFR 28.106 - Universal cotton standards.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official cotton...
7 CFR 28.106 - Universal cotton standards.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official cotton...
7 CFR 28.106 - Universal cotton standards.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official cotton...
7 CFR 28.106 - Universal cotton standards.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official cotton...
Evidence for recombination of mitochondrial DNA in triploid crucian carp.
Guo, Xinhong; Liu, Shaojun; Liu, Yun
2006-03-01
In this study, we report the complete mitochondrial DNA (mtDNA) sequences of the allotetraploid and triploid crucian carp and compare the complete mtDNA sequences between the triploid crucian carp and its female parent Japanese crucian carp and between the triploid crucian carp and its male parent allotetraploid. Our results indicate that the complete mtDNA nucleotide identity (98%) between the triploid crucian carp and its male parent allotetraploid was higher than that (93%) between the triploid crucian carp and its female parent Japanese crucian carp. Moreover, the presence of a pattern of identity and difference at synonymous sites of mitochondrial genomes between the triploid crucian carp and its parents provides direct evidence that triploid crucian carp possessed the recombination mtDNA fragment (12,759 bp) derived from the paternal fish. These results suggest that mtDNA recombination was derived from the fusion of the maternal and paternal mtDNAs. Compared with the haploid egg with one set of genome from the Japanese crucian carp, the diploid sperm with two sets of genomes from the allotetraploid could more easily make its mtDNA fuse with the mtDNA of the haploid egg. In addition, the triple hybrid nature of the triploid crucian carp probably allowed its better mtDNA recombination. In summary, our results provide the first evidence of mtDNA combination in polyploid fish.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-18
... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... previous final rule that implemented the 2008 Farm Bill provisions for the cotton program. The correction removes definitions that are no longer used concerning Northern Europe prices for cotton. CCC is also...
Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing
2005-08-10
As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM
Cotton and Sustainability: Impacting Student Learning through Sustainable Cotton Summit
ERIC Educational Resources Information Center
Ha-Brookshire, Jung; Norum, Pamela
2011-01-01
Purpose: The purpose of this paper is to examine the effect of intensive extra-curricular learning opportunities on students' knowledge, skills, and attitudes regarding cotton and sustainability. Design/methodology/approach: A three-phase extra-curricular learning opportunity was designed to include a Sustainable Cotton Summit; pre-summit and…
The effect of varieties on cotton wax as it relates to cotton quality parameters
USDA-ARS?s Scientific Manuscript database
Cotton wax is one of the non-cellulosic components found on the surfaces of cotton. It is important in dyeing and processing quality. This investigation was carried out to study the yield of wax on the surface of cottons by performing two methods: Soxhlet extractions and accelerated solvent extracti...
7 CFR 1205.13 - Upland cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...
7 CFR 1205.13 - Upland cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...
7 CFR 1205.13 - Upland cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...
7 CFR 1205.13 - Upland cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...
7 CFR 1205.13 - Upland cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton means...
Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A
2016-08-01
Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.
Qi, Peng; Gimode, Davis; Saha, Dipnarayan; Schröder, Stephan; Chakraborty, Debkanta; Wang, Xuewen; Dida, Mathews M; Malmberg, Russell L; Devos, Katrien M
2018-06-15
Research on orphan crops is often hindered by a lack of genomic resources. With the advent of affordable sequencing technologies, genotyping an entire genome or, for large-genome species, a representative fraction of the genome has become feasible for any crop. Nevertheless, most genotyping-by-sequencing (GBS) methods are geared towards obtaining large numbers of markers at low sequence depth, which excludes their application in heterozygous individuals. Furthermore, bioinformatics pipelines often lack the flexibility to deal with paired-end reads or to be applied in polyploid species. UGbS-Flex combines publicly available software with in-house python and perl scripts to efficiently call SNPs from genotyping-by-sequencing reads irrespective of the species' ploidy level, breeding system and availability of a reference genome. Noteworthy features of the UGbS-Flex pipeline are an ability to use paired-end reads as input, an effective approach to cluster reads across samples with enhanced outputs, and maximization of SNP calling. We demonstrate use of the pipeline for the identification of several thousand high-confidence SNPs with high representation across samples in an F 3 -derived F 2 population in the allotetraploid finger millet. Robust high-density genetic maps were constructed using the time-tested mapping program MAPMAKER which we upgraded to run efficiently and in a semi-automated manner in a Windows Command Prompt Environment. We exploited comparative GBS with one of the diploid ancestors of finger millet to assign linkage groups to subgenomes and demonstrate the presence of chromosomal rearrangements. The paper combines GBS protocol modifications, a novel flexible GBS analysis pipeline, UGbS-Flex, recommendations to maximize SNP identification, updated genetic mapping software, and the first high-density maps of finger millet. The modules used in the UGbS-Flex pipeline and for genetic mapping were applied to finger millet, an allotetraploid selfing species
Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.
Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F
2013-10-01
Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.
7 CFR 1205.319 - Cotton-producing region.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing...
7 CFR 1205.314 - Cotton-producing State.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing State...
7 CFR 1205.314 - Cotton-producing State
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing State 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State Cotton-producing State...
7 CFR 1205.319 - Cotton-producing region.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing...
7 CFR 1205.319 - Cotton-producing region.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing...
7 CFR 1205.314 - Cotton-producing State.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing State...
7 CFR 1205.314 - Cotton-producing State.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing State...
7 CFR 1205.319 - Cotton-producing region.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing...
7 CFR 1205.314 - Cotton-producing State.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing State...
7 CFR 1205.319 - Cotton-producing region.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing...
Advancements in Cotton Harvesting Research
USDA-ARS?s Scientific Manuscript database
Cotton harvesting research within USDA ARS is focused on improving harvest productivity, cotton quality, and producer profitability. In recent years, our work has encompassed efforts to improve both spindle picker and brush-roll stripper harvesting systems. Specifically, work with cotton pickers i...
USDA-ARS?s Scientific Manuscript database
The Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV), a pathogen of the Egyptian cotton leaf worm Spodoptera littoralis, was subjected to sequencing of its entire DNA genome and bioassay analysis comparing its virulence to that of other baculoviruses. The annotated SpliMNPV genome of...
Tillage and Irrigation Management of Cotton in a Corn/Cotton Rotation
USDA-ARS?s Scientific Manuscript database
A research study was undertaken to evaluate the yield of cotton in a corn-cotton rotation under two tillage treatments, conventional and minimum/conservation, and two irrigation treatments, irrigated and non-irrigated. Crops were grown under four treatments, irrigated-conventional tillage, irrigate...
Evaluation of modern cotton harvest systems on irrigated cotton: harvester performance
USDA-ARS?s Scientific Manuscript database
Picker and stripper harvest systems were evaluated on production-scale irrigated cotton on the High Plains of Texas over three harvest seasons. Observations on harvester performance, including time-in-motion, harvest loss, seed cotton composition, and turnout, were conducted at seven locations with...
7 CFR 1427.9 - Classification of cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan deficiency...
7 CFR 1427.9 - Classification of cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan deficiency...
7 CFR 1427.9 - Classification of cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan deficiency...
7 CFR 1427.9 - Classification of cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan deficiency...
7 CFR 1427.9 - Classification of cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan deficiency...
Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.
Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-08-01
Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
7 CFR 1427.165 - Eligible seed cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by an...
7 CFR 1427.165 - Eligible seed cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by an...
7 CFR 1427.165 - Eligible seed cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by an...
7 CFR 1427.165 - Eligible seed cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by an...
7 CFR 1427.165 - Eligible seed cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by an...
Satya, Pratik; Paswan, Pramod Kumar; Ghosh, Swagata; Majumdar, Snehalata; Ali, Nasim
2016-06-01
Cross-species transferability is a quick and economic method to enrich SSR database, particularly for minor crops where little genomic information is available. However, transferability of SSR markers varies greatly between species, genera and families of plant species. We assessed confamiliar transferability of SSR markers from cotton (Gossypium hirsutum) and jute (Corchorus olitorius) to 22 species distributed in different taxonomic groups of Malvaceae. All the species selected were potential industrial crop species having little or no genomic resources or SSR database. Of the 14 cotton SSR loci tested, 13 (92.86 %) amplified in G. arboreum and 71.43 % exhibited cross-genera transferability. Nine out of 11 jute SSRs (81.81 %) showed cross-transferability across genera. SSRs from both the species exhibited high polymorphism and resolving power in other species. The correlation between transferability of cotton and jute SSRs were highly significant (r = 0.813). The difference in transferability among species was also significant for both the marker groups. High transferability was observed at genus, tribe and subfamily level. At tribe level, transferability of jute SSRs (41.04 %) was higher than that of cotton SSRs (33.74 %). The tribe Byttnerieae exhibited highest SSR transferability (48.7 %). The high level of cross-genera transferability (>50 %) in ten species of Malvaceae, where no SSR resource is available, calls for large scale transferability testing from the enriched SSR databases of cotton and jute.
QTL mapping for flowering-time and photoperiod insensitivity of cotton Gossypium darwinii Watt.
Kushanov, Fakhriddin N; Buriev, Zabardast T; Shermatov, Shukhrat E; Turaev, Ozod S; Norov, Tokhir M; Pepper, Alan E; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Jenkins, Johnie N; Abdukarimov, Abdusattor; Abdurakhmonov, Ibrokhim Y
2017-01-01
Most wild and semi-wild species of the genus Gossypium are exhibit photoperiod-sensitive flowering. The wild germplasm cotton is a valuable source of genes for genetic improvement of modern cotton cultivars. A bi-parental cotton population segregating for photoperiodic flowering was developed by crossing a photoperiod insensitive irradiation mutant line with its pre-mutagenesis photoperiodic wild-type G. darwinii Watt genotype. Individuals from the F2 and F3 generations were grown with their parental lines and F1 hybrid progeny in the long day and short night summer condition (natural day-length) of Uzbekistan to evaluate photoperiod sensitivity, i.e., flowering-time during the seasons 2008-2009. Through genotyping the individuals of this bi-parental population segregating for flowering-time, linkage maps were constructed using 212 simple-sequence repeat (SSR) and three cleaved amplified polymorphic sequence (CAPS) markers. Six QTLs directly associated with flowering-time and photoperiodic flowering were discovered in the F2 population, whereas eight QTLs were identified in the F3 population. Two QTLs controlling photoperiodic flowering and duration of flowering were common in both populations. In silico annotations of the flanking DNA sequences of mapped SSRs from sequenced cotton (G. hirsutum L.) genome database has identified several potential 'candidate' genes that are known to be associated with regulation of flowering characteristics of plants. The outcome of this research will expand our understanding of the genetic and molecular mechanisms of photoperiodic flowering. Identified markers should be useful for marker-assisted selection in cotton breeding to improve early flowering characteristics.
7 CFR 28.451 - Below Color Grade Cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...
7 CFR 28.471 - Below Leaf Grade Cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...
7 CFR 28.471 - Below Leaf Grade Cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...
7 CFR 28.451 - Below Color Grade Cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...
7 CFR 28.451 - Below Color Grade Cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...
7 CFR 28.471 - Below Leaf Grade Cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...
7 CFR 28.471 - Below Leaf Grade Cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...
7 CFR 28.471 - Below Leaf Grade Cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than Leaf...
7 CFR 28.451 - Below Color Grade Cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...
7 CFR 28.451 - Below Color Grade Cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than Good...
Transgenic cotton: from biotransformation methods to agricultural application.
Zhang, Baohong
2013-01-01
Transgenic cotton is among the first transgenic plants commercially adopted around the world. Since it was first introduced into the field in the middle of 1990s, transgenic cotton has been quickly adopted by cotton farmers in many developed and developing countries. Transgenic cotton has offered many important environmental, social, and economic benefits, including reduced usage of pesticides, indirect increase of yield, minimizing environmental pollution, and reducing labor and cost. Agrobacterium-mediated genetic transformation method is the major method for obtaining transgenic cotton. However, pollen tube pathway-mediated method is also used, particularly by scientists in China, to breed commercial transgenic cotton. Although transgenic cotton plants with disease-resistance, abiotic stress tolerance, and improved fiber quality have been developed in the past decades, insect-resistant and herbicide-tolerant cotton are the two dominant transgenic cottons in the transgenic cotton market.
7 CFR 1205.316 - Cotton-Producer organization.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-Producer organization. 1205.316 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.316 Cotton-Producer...
7 CFR 1205.317 - Cotton-Importer organization.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-Importer organization. 1205.317 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.317 Cotton-Importer...
7 CFR 1205.317 - Cotton-Importer organization.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-Importer organization. 1205.317 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.317 Cotton-Importer...
7 CFR 1205.317 - Cotton-Importer organization.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-Importer organization. 1205.317 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.317 Cotton-Importer...
7 CFR 1205.317 - Cotton-Importer organization.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-Importer organization. 1205.317 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.317 Cotton-Importer...
7 CFR 1205.316 - Cotton-Producer organization.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-Producer organization. 1205.316 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.316 Cotton-Producer...
7 CFR 1205.316 - Cotton-Producer organization.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-Producer organization. 1205.316 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.316 Cotton-Producer...
7 CFR 1205.316 - Cotton-Producer organization.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-Producer organization. 1205.316 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.316 Cotton-Producer...
7 CFR 1205.316 - Cotton-Producer organization.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-Producer organization. 1205.316 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.316 Cotton-Producer...
7 CFR 1205.317 - Cotton-Importer organization.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-Importer organization. 1205.317 Section 1205... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.317 Cotton-Importer...
7 CFR 27.43 - Validity of cotton class certificates.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton classified...
7 CFR 27.43 - Validity of cotton class certificates.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton classified...
7 CFR 27.43 - Validity of cotton class certificates.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton classified...
7 CFR 27.43 - Validity of cotton class certificates.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton classified...
7 CFR 27.43 - Validity of cotton class certificates.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton classified...
Genome regions' putative association with Fusarium wilt or root-knot nematode resistance in cotton.
USDA-ARS?s Scientific Manuscript database
Around 1,300 microsatellite or SSR markers [named MUSB001 – MUSB1316 (600 informative)] were developed at the USDA-ARS, WICSRU Shafter, CA with the support of cooperators and Cotton Incorporated. These MUSB markers were developed from BAC-end DNA sequence information from a previously developed BAC ...
Liu, Xia; Zhao, Bo; Zheng, Hua-Jun; Hu, Yan; Lu, Gang; Yang, Chang-Qing; Chen, Jie-Dan; Chen, Jun-Jian; Chen, Dian-Yang; Zhang, Liang; Zhou, Yan; Wang, Ling-Jian; Guo, Wang-Zhen; Bai, Yu-Lin; Ruan, Ju-Xin; Shangguan, Xiao-Xia; Mao, Ying-Bo; Shan, Chun-Min; Jiang, Jian-Ping; Zhu, Yong-Qiang; Jin, Lei; Kang, Hui; Chen, Shu-Ting; He, Xu-Lin; Wang, Rui; Wang, Yue-Zhu; Chen, Jie; Wang, Li-Jun; Yu, Shu-Ting; Wang, Bi-Yun; Wei, Jia; Song, Si-Chao; Lu, Xin-Yan; Gao, Zheng-Chao; Gu, Wen-Yi; Deng, Xiao; Ma, Dan; Wang, Sen; Liang, Wen-Hua; Fang, Lei; Cai, Cai-Ping; Zhu, Xie-Fei; Zhou, Bao-Liang; Jeffrey Chen, Z; Xu, Shu-Hua; Zhang, Yu-Gao; Wang, Sheng-Yue; Zhang, Tian-Zhen; Zhao, Guo-Ping; Chen, Xiao-Ya
2015-09-30
Of the two cultivated species of allopolyploid cotton, Gossypium barbadense produces extra-long fibers for the production of superior textiles. We sequenced its genome (AD)2 and performed a comparative analysis. We identified three bursts of retrotransposons from 20 million years ago (Mya) and a genome-wide uneven pseudogenization peak at 11-20 Mya, which likely contributed to genomic divergences. Among the 2,483 genes preferentially expressed in fiber, a cell elongation regulator, PRE1, is strikingly At biased and fiber specific, echoing the A-genome origin of spinnable fiber. The expansion of the PRE members implies a genetic factor that underlies fiber elongation. Mature cotton fiber consists of nearly pure cellulose. G. barbadense and G. hirsutum contain 29 and 30 cellulose synthase (CesA) genes, respectively; whereas most of these genes (>25) are expressed in fiber, genes for secondary cell wall biosynthesis exhibited a delayed and higher degree of up-regulation in G. barbadense compared with G. hirsutum, conferring an extended elongation stage and highly active secondary wall deposition during extra-long fiber development. The rapid diversification of sesquiterpene synthase genes in the gossypol pathway exemplifies the chemical diversity of lineage-specific secondary metabolites. The G. barbadense genome advances our understanding of allopolyploidy, which will help improve cotton fiber quality.
Cotton and Protein Interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goheen, Steven C.; Edwards, J. V.; Rayburn, Alfred R.
The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid components with cotton fibers. In the chronic non-healing wound, elastase appears to be over-expressed, and it digests tissue and growth factors, interfering with the normal healing process. Albumin is the most prevalent protein in wound fluid, and in highly to moderately exudative wounds, itmore » may bind significantly to the fibers of wound dressings. Thus, the relative binding properties of both elastase and albumin to wound dressing fibers are of interest in the design of more effective wound dressings. The present work examines the binding of albumin to two different derivatives of cotton, and quantifies the elastase binding to the same derivatives following exposure of albumin to the fiber surface. An HPLC adsorption technique was employed coupled with a colorimetric enzyme assay to quantify the relative binding properties of albumin and elastase to cotton. The results of wound protein binding are discussed in relation to the porosity and surface chemistry interactions of cotton and wound proteins. Studies are directed to understanding the implications of protein adsorption phenomena in terms of fiber-protein models that have implications for rationally designing dressings for chronic wounds.« less
Cotton moisture – its importance, measurements and impacts
USDA-ARS?s Scientific Manuscript database
Cotton moisture impacts cotton from field to fabric. The proper control, and measurement to allow for control, of cotton moisture is essential to maintaining and preserving fiber quality. Cotton color, length and strength; as well as other properties, are all impacted by cotton moisture content. ...
7 CFR 27.31 - Classification of Cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the Act...
7 CFR 27.31 - Classification of Cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the Act...
7 CFR 27.31 - Classification of Cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the Act...
7 CFR 27.46 - Cotton withdrawn from storage.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control of...
7 CFR 27.46 - Cotton withdrawn from storage.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control of...
7 CFR 27.46 - Cotton withdrawn from storage.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control of...
7 CFR 27.46 - Cotton withdrawn from storage.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control of...
7 CFR 27.46 - Cotton withdrawn from storage.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control of...
Yao, Yong-Sheng; Han, Peng; Niu, Chang-Ying; Dong, Yong-Cheng; Gao, Xi-Wu; Cui, Jin-Jie; Desneux, Nicolas
2016-01-01
Top-down force is referred to arthropod pest management delivered by the organisms from higher trophic levels. In the context of prevalent adoption of transgenic Bt crops that produce insecticidal Cry proteins derived from Bacillus thuringiensis (Bt), it still remains elusive whether the top-down forces are affected by the insect-resistant traits that introduced into the Bt crops. We explored how Bt cotton affect the strength of top-down forces via arthropod natural enemies in regulating a non-target pest species, the cotton aphid Aphis gossypii Glover, using a comparative approach (i.e. Bt cotton vs. conventional cotton) under field conditions. To determine top-down forces, we manipulated predation/parasitism exposure of the aphid to their natural enemies using exclusion cages. We found that the aphid population growth was strongly suppressed by the dominant natural enemies including Coccinellids, spiders and Aphidiines parasitoids. Coccinellids, spiders and the assemblage of other arthropod natural enemies (mainly lacewings and Hemipteran bugs) are similarly abundant in both plots, but with the parasitoid mummies less abundant in Bt cotton plots compared to the conventional cotton plots. However, the lower abundance of parasitoids in Bt cotton plots alone did not translate into differential top-down control on A. gossypii populations compared to conventional ones. Overall, the top-down forces were equally strong in both plots. We conclude that transgenic Bt cotton does not disrupt the top-down forces regulating the cotton aphid in central China. PMID:27870914
7 CFR 1427.101 - Eligible upland cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...
7 CFR 1427.101 - Eligible upland cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...
7 CFR 1427.1203 - Eligible ELS cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart, eligible...
7 CFR 1427.101 - Eligible upland cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...
7 CFR 1427.101 - Eligible upland cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...
7 CFR 1427.1203 - Eligible ELS cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart, eligible...
7 CFR 27.31 - Classification of cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification of...
7 CFR 1427.101 - Eligible upland cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible upland...
7 CFR 1427.1203 - Eligible ELS cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart, eligible...
7 CFR 1427.1203 - Eligible ELS cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart, eligible...
7 CFR 1427.1203 - Eligible ELS cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart, eligible...
7 CFR 27.31 - Classification of cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification of...
Wang, Nuohan; Ma, Jianjiang; Pei, Wenfeng; Wu, Man; Li, Haijing; Li, Xingli; Yu, Shuxun; Zhang, Jinfa; Yu, Jiwen
2017-03-01
Lysophosphatidic acid acyltransferase (LPAAT) encoded by a multigene family is a rate-limiting enzyme in the Kennedy pathway in higher plants. Cotton is the most important natural fiber crop and one of the most important oilseed crops. However, little is known on genes coding for LPAATs involved in oil biosynthesis with regard to its genome organization, diversity, expression, natural genetic variation, and association with fiber development and oil content in cotton. In this study, a comprehensive genome-wide analysis in four Gossypium species with genome sequences, i.e., tetraploid G. hirsutum- AD 1 and G. barbadense- AD 2 and its possible ancestral diploids G. raimondii- D 5 and G. arboreum- A 2 , identified 13, 10, 8, and 9 LPAAT genes, respectively, that were divided into four subfamilies. RNA-seq analyses of the LPAAT genes in the widely grown G. hirsutum suggest their differential expression at the transcriptional level in developing cottonseeds and fibers. Although 10 LPAAT genes were co-localised with quantitative trait loci (QTL) for cottonseed oil or protein content within a 25-cM region, only one single strand conformation polymorphic (SSCP) marker developed from a synonymous single nucleotide polymorphism (SNP) of the At-Gh13LPAAT5 gene was significantly correlated with cottonseed oil and protein contents in one of the three field tests. Moreover, transformed yeasts using the At-Gh13LPAAT5 gene with the two sequences for the SNP led to similar results, i.e., a 25-31% increase in palmitic acid and oleic acid, and a 16-29% increase in total triacylglycerol (TAG). The results in this study demonstrated that the natural variation in the LPAAT genes to improving cottonseed oil content and fiber quality is limited; therefore, traditional cross breeding should not expect much progress in improving cottonseed oil content or fiber quality through a marker-assisted selection for the LPAAT genes. However, enhancing the expression of one of the LPAAT genes such
7 CFR 28.178 - Submission of cotton samples.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification and/or...
7 CFR 28.40 - Terms defined; cotton classification.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton or...
7 CFR 28.40 - Terms defined; cotton classification.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton or...
7 CFR 28.40 - Terms defined; cotton classification.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton or...
7 CFR 28.40 - Terms defined; cotton classification.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton or...
7 CFR 28.178 - Submission of cotton samples.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification and/or...
7 CFR 28.178 - Submission of cotton samples.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification and/or...
7 CFR 28.178 - Submission of cotton samples.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification and/or...
7 CFR 28.40 - Terms defined; cotton classification.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton or...
7 CFR 28.178 - Submission of cotton samples.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification and/or...
Dielectric permitivity measurement of cotton lint
USDA-ARS?s Scientific Manuscript database
A technique was developed for making broad band measurements of cotton lint electrical permitivity. The fundamental electrical permitivity value of cotton lint at various densities and moisture contents; is beneficial for the future development of cotton moisture sensors as it provides a...
Global view of cotton germplasm resources
USDA-ARS?s Scientific Manuscript database
This paper reports the status of several large cotton germplasm collections present across the world. Cotton germplasm collections discussed include those from the US, India, France, China, Australia, Uzbekistan, and Brazil. These collections represent a large portion of the curated cotton germpla...
Ginning efficiency in upland cotton - a value-added trait in cotton improvement
USDA-ARS?s Scientific Manuscript database
In the past few years, there has been some consorted effort between cotton geneticists and ginning engineers to understand "ginning efficiency" in upland cotton. Ginning efficiency includes ginning rate (measured in gm lint sec -1) and net gin stand energy (measured in Wh kg -1 lint). Improved ginn...
7 CFR 27.37 - Cotton reduced in grade.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 27.37 - Cotton reduced in grade.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 27.37 - Cotton reduced in grade.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 27.37 - Cotton reduced in grade.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 27.37 - Cotton reduced in grade.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 1205.341 - Certification of cotton producer organization.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization within...
7 CFR 1205.341 - Certification of cotton producer organization.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization within...
7 CFR 1205.341 - Certification of cotton producer organization.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization within...
7 CFR 1205.341 - Certification of cotton producer organization.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization within...
7 CFR 1205.341 - Certification of cotton producer organization.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization within...
Aerial Identification of Individual Cotton Plants
USDA-ARS?s Scientific Manuscript database
Boll weevils can infest individual cotton plants as well as cotton fields. However, volunteer and regrowth plants may grow where seed has scattered along roadsides and waterways, and in fields following rotation from cotton production. Timely areawide detection of these potential host plants is cr...
7 CFR 28.39 - Cotton reduced in grade.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 28.39 - Cotton reduced in grade.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 28.39 - Cotton reduced in grade.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 28.39 - Cotton reduced in grade.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 28.39 - Cotton reduced in grade.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence of...
7 CFR 27.44 - Invalidity of cotton class certificates.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become invalid...
7 CFR 27.44 - Invalidity of cotton class certificates.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become invalid...
7 CFR 27.44 - Invalidity of cotton class certificates.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become invalid...
7 CFR 27.44 - Invalidity of cotton class certificates.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become invalid...
7 CFR 27.44 - Invalidity of cotton class certificates.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become invalid...
USDA-ARS?s Scientific Manuscript database
The length of cotton fiber is an important agronomic trait characteristic that directly affects the quality of yarn and fabric. Cotton fiber mutants have been useful tools to study the molecular processes of fiber development. In this work we describe a chemically-induced short fiber mutant Ligon-li...
Predicting cotton yield of small field plots in a cotton breeding program using UAV imagery data
NASA Astrophysics Data System (ADS)
Maja, Joe Mari J.; Campbell, Todd; Camargo Neto, Joao; Astillo, Philip
2016-05-01
One of the major criteria used for advancing experimental lines in a breeding program is yield performance. Obtaining yield performance data requires machine picking each plot with a cotton picker, modified to weigh individual plots. Harvesting thousands of small field plots requires a great deal of time and resources. The efficiency of cotton breeding could be increased significantly while the cost could be decreased with the availability of accurate methods to predict yield performance. This work is investigating the feasibility of using an image processing technique using a commercial off-the-shelf (COTS) camera mounted on a small Unmanned Aerial Vehicle (sUAV) to collect normal RGB images in predicting cotton yield on small plot. An orthonormal image was generated from multiple images and used to process multiple, segmented plots. A Gaussian blur was used to eliminate the high frequency component of the images, which corresponds to the cotton pixels, and used image subtraction technique to generate high frequency pixel images. The cotton pixels were then separated using k-means cluster with 5 classes. Based on the current work, the calculated percentage cotton area was computed using the generated high frequency image (cotton pixels) divided by the total area of the plot. Preliminary results showed (five flights, 3 altitudes) that cotton cover on multiple pre-selected 227 sq. m. plots produce an average of 8% which translate to approximately 22.3 kgs. of cotton. The yield prediction equation generated from the test site was then use on a separate validation site and produced a prediction error of less than 10%. In summary, the results indicate that a COTS camera with an appropriate image processing technique can produce results that are comparable to expensive sensors.
7 CFR 27.73 - Supervision of transfers of cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for classification...
7 CFR 27.73 - Supervision of transfers of cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for classification...
7 CFR 27.73 - Supervision of transfers of cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for classification...
Graphene oxide nanostructures modified multifunctional cotton fabrics
NASA Astrophysics Data System (ADS)
Krishnamoorthy, Karthikeyan; Navaneethaiyer, Umasuthan; Mohan, Rajneesh; Lee, Jehee; Kim, Sang-Jae
2012-06-01
Surface modification of cotton fabrics using graphene oxide (GO) nanostructures was reported. Scanning electron microscopic (SEM) investigations revealed that the GO nanostructure was coated onto the cotton fabric. The molecular level interaction between the graphene oxide and the cotton fabric is studied in detail using the Fourier transform infra-red (FTIR) spectra. Thermogravimetric analysis (TGA) showed that GO loaded cotton fabrics have enhanced thermal stability compared to the bare cotton fabrics. The photocatalytic activity of the GO-coated cotton fabrics was investigated by measuring the photoreduction of resazurin (RZ) into resorufin (RF) under UV light irradiation. The antibacterial activity was evaluated against both Gram-negative and Gram-positive bacteria and the results indicated that the GO-coated cotton fabrics are more toxic towards the Gram-positive ones. Our results provide a way to develop graphene oxide-based devices for the biomedical applications for improving health care.
A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome
Moretzsohn, Márcio C; Barbosa, Andrea VG; Alves-Freitas, Dione MT; Teixeira, Cristiane; Leal-Bertioli, Soraya CM; Guimarães, Patrícia M; Pereira, Rinaldo W; Lopes, Catalina R; Cavallari, Marcelo M; Valls, José FM; Bertioli, David J; Gimenes, Marcos A
2009-01-01
Background Arachis hypogaea (peanut) is an important crop worldwide, being mostly used for edible oil production, direct consumption and animal feed. Cultivated peanut is an allotetraploid species with two different genome components, A and B. Genetic linkage maps can greatly assist molecular breeding and genomic studies. However, the development of linkage maps for A. hypogaea is difficult because it has very low levels of polymorphism. This can be overcome by the utilization of wild species of Arachis, which present the A- and B-genomes in the diploid state, and show high levels of genetic variability. Results In this work, we constructed a B-genome linkage map, which will complement the previously published map for the A-genome of Arachis, and produced an entire framework for the tetraploid genome. This map is based on an F2 population of 93 individuals obtained from the cross between the diploid A. ipaënsis (K30076) and the closely related A. magna (K30097), the former species being the most probable B genome donor to cultivated peanut. In spite of being classified as different species, the parents showed high crossability and relatively low polymorphism (22.3%), compared to other interspecific crosses. The map has 10 linkage groups, with 149 loci spanning a total map distance of 1,294 cM. The microsatellite markers utilized, developed for other Arachis species, showed high transferability (81.7%). Segregation distortion was 21.5%. This B-genome map was compared to the A-genome map using 51 common markers, revealing a high degree of synteny between both genomes. Conclusion The development of genetic maps for Arachis diploid wild species with A- and B-genomes effectively provides a genetic map for the tetraploid cultivated peanut in two separate diploid components and is a significant advance towards the construction of a transferable reference map for Arachis. Additionally, we were able to identify affinities of some Arachis linkage groups with Medicago
Changes in cotton quality during ginning
USDA-ARS?s Scientific Manuscript database
Upland cotton gins across the cotton belt were sampled during the 2005-06 and 2006-07 ginning seasons to assess the changes in upland cotton quality during the ginning process and throughout the ginning season. Samples were taken at the module, feeder apron, and before and after lint cleaning at re...
29 CFR 1910.1043 - Cotton dust.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 6 2012-07-01 2012-07-01 false Cotton dust. 1910.1043 Section 1910.1043 Labor Regulations...) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances § 1910.1043 Cotton dust. (a... cotton dust in all workplaces where employees engage in yarn manufacturing, engage in slashing and...
29 CFR 1910.1043 - Cotton dust.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 29 Labor 6 2011-07-01 2011-07-01 false Cotton dust. 1910.1043 Section 1910.1043 Labor Regulations...) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances § 1910.1043 Cotton dust. (a... cotton dust in all workplaces where employees engage in yarn manufacturing, engage in slashing and...
29 CFR 1910.1043 - Cotton dust.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 29 Labor 6 2014-07-01 2013-07-01 true Cotton dust. 1910.1043 Section 1910.1043 Labor Regulations...) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances § 1910.1043 Cotton dust. (a... cotton dust in all workplaces where employees engage in yarn manufacturing, engage in slashing and...
29 CFR 1910.1043 - Cotton dust.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 29 Labor 6 2013-07-01 2013-07-01 false Cotton dust. 1910.1043 Section 1910.1043 Labor Regulations...) OCCUPATIONAL SAFETY AND HEALTH STANDARDS (CONTINUED) Toxic and Hazardous Substances § 1910.1043 Cotton dust. (a... cotton dust in all workplaces where employees engage in yarn manufacturing, engage in slashing and...
Endotoxins in cotton: washing effects and size distribution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olenchock, S.A.; Mull, J.C.; Jones, W.G.
1983-01-01
Endotoxin contamination was measured in washed and unwashed cottons from three distinct growing areas, California, Mississippi, and Texas. The data show differences in endotoxin contamination based upon the geographic source of the cotton. It is also shown that washing bulk cotton before the carding process results in lower endotoxin in the cotton dust. Washing conditions can affect the endotoxin levels, and all size fractions of the airborne dust contain quantifiable endotoxin contamination. Endotoxin analyses provide a simple and reliable method for monitoring the cleanliness of cotton or airborne cotton dusts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Preuss, Mary L.; Delmar, Deborah P.; Liu, Bo
Microtubules in interphase plant cells form a cortical array, which is critical for plant cell morphogenesis. Genetic studies imply that the minus end-directed microtubule motor kinesin-like calmodulin-binding protein (KCBP) plays a role in trichome morphogenesis in Arabidopsis. However, it was not clear whether this motor interacted with interphase microtubules. In cotton (Gossypium hirsutum) fibers, cortical microtubules undergo dramatic reorganization during fiber development. In this study, cDNA clones of the cotton KCBP homolog GhKCBP were isolated from a cotton fiber-specific cDNA library. During cotton fiber development from 10 to 21 DPA, the GhKCBP protein level gradually decreases. By immunofluorescence, GhKCBP wasmore » detected as puncta along cortical microtubules in fiber cells of different developmental stages. Thus the results provide evidence that GhKCBP plays a role in interphase cell growth likely by interacting with cortical microtubules. In contrast to fibers, in dividing cells of cotton, GhKCBP localized to the nucleus, the microtubule preprophase band, mitotic spindle, and the phragmoplast. Therefore KCBP likely exerts multiple roles in cell division and cell growth in flowering plants.« less
ARS labs update to California Cotton Ginners and Growers
USDA-ARS?s Scientific Manuscript database
There are four USDA-ARS labs involved in cotton harvesting, processing & fiber quality research; The Southwestern Cotton Ginning Research Laboratory (Mesilla Park, NM); The Cotton Production and Processing Unit (Lubbock, TX); The Cotton Ginning Research Unit (Stoneville, MS); and The Cotton Structur...
7 CFR 1205.342 - Certification of cotton importer organizations.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may request...
7 CFR 1205.342 - Certification of cotton importer organizations.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may request...
7 CFR 1205.342 - Certification of cotton importer organizations.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may request...
7 CFR 1205.342 - Certification of cotton importer organizations.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may request...
7 CFR 1205.342 - Certification of cotton importer organizations.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may request...
Evaluations of Fusarium wilt resistance in Upland cotton from Uzbek cotton germplasm resources.
USDA-ARS?s Scientific Manuscript database
Fusarium oxysporum f. sp. vasinfectum Atk. Sny & Hans (FOV), in combination with Verticillium dahliae Kleb, causes a wilt disease complex in cotton that significantly reduces yield. A highly virulent strain of FOV, No. 316, was isolated that caused up to 80% plant death in commercial cotton in Uzbe...
7 CFR 28.8 - Classification of cotton; determination.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of...
7 CFR 28.8 - Classification of cotton; determination.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of...
7 CFR 28.8 - Classification of cotton; determination.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of...
7 CFR 28.8 - Classification of cotton; determination.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of...
7 CFR 28.8 - Classification of cotton; determination.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes of...
Pollen genotyping in cotton for genetic linkage analysis
USDA-ARS?s Scientific Manuscript database
Cotton is an important fiber and oil crop and thus makes very important contributions to US agricultural security and sustainable agriculture. Two species are vital for American cotton industry, i.e., Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) that are prized for high yields...
7 CFR 27.73 - Supervision of transfers of cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...
7 CFR 27.73 - Supervision of transfers of cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...
Li, Ruijuan; Rashotte, Aaron M; Singh, Narendra K; Lawrence, Kathy S; Weaver, David B; Locy, Robert D
2015-01-01
Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.). An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747), resistant (BARBREN-713), and hypersensitive (LONREN-1) genotypes of cotton (Gossypium hirsutum L.) with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.
7 CFR 28.181 - Review of cotton classification.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this subpart...
7 CFR 28.181 - Review of cotton classification.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this subpart...
7 CFR 28.181 - Review of cotton classification.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this subpart...
7 CFR 28.181 - Review of cotton classification.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this subpart...
7 CFR 28.181 - Review of cotton classification.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this subpart...
Diversity of arthropod community in transgenic poplar-cotton ecosystems.
Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S
2015-12-02
Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.
Ergonomic Evaluation of Battery Powered Portable Cotton Picker
NASA Astrophysics Data System (ADS)
Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.
2012-09-01
Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.
Tracking of wild allele introgressions in a peanut chromosome segment substitution line population
USDA-ARS?s Scientific Manuscript database
Cultivated peanut arose from the hybridization of the diploids Arachis duranensis (A genome progenitor) and Arachis ipaensis (B genome progenitor), followed by spontaneous chromosome doubling to yield the current allotetraploid state (AABB; 2n=4x=40). This genetic heritage, short period since polyp...
7 CFR 28.105 - Practical forms of cotton standards.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of the...
7 CFR 1205.402 - Determination of Cotton Board membership.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than one...
7 CFR 1205.402 - Determination of Cotton Board membership.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than one...
7 CFR 1205.402 - Determination of Cotton Board membership.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than one...
7 CFR 28.105 - Practical forms of cotton standards.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of the...
7 CFR 28.105 - Practical forms of cotton standards.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of the...
7 CFR 28.105 - Practical forms of cotton standards.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of the...
7 CFR 28.105 - Practical forms of cotton standards.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of the...
7 CFR 1205.402 - Determination of Cotton Board membership.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than one...
7 CFR 1205.402 - Determination of Cotton Board membership.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than one...
USDA-ARS?s Scientific Manuscript database
Cotton is an economically important crop affected by a number of abiotic and biotic stresses. Cotton leaf curl disease (CLCuD) is caused by virus in the genus Begomovirus (family Geminiviridae), collectively called cotton leaf curl viruses (CLCuVs). It is one of the most devastating virual diseases ...
7 CFR 1427.23 - Cotton loan deficiency payments.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive such...
7 CFR 1427.23 - Cotton loan deficiency payments.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive such...
7 CFR 1427.23 - Cotton loan deficiency payments.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive such...
7 CFR 1427.23 - Cotton loan deficiency payments.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive such...
7 CFR 1427.23 - Cotton loan deficiency payments.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive such...
7 CFR 1427.174 - Maturity of seed cotton loans.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
7 CFR 1427.174 - Maturity of seed cotton loans.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
7 CFR 1427.174 - Maturity of seed cotton loans.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
7 CFR 1427.174 - Maturity of seed cotton loans.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
7 CFR 1427.174 - Maturity of seed cotton loans.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...
Characterization of reniform nematode genome through shotgun sequencing
USDA-ARS?s Scientific Manuscript database
The reniform nematode (RN), a major agricultural pest particularly on cotton in the United States(U.S.), is among the major plant parasitic nematodes for which limited genomic information exists. In this study, over 380 Mb of sequence data were generated from four pooled adult female RN and assembl...
Multispeed genome diploidization and diversification after an ancient allopolyploidization.
Mandáková, Terezie; Pouch, Milan; Harmanová, Klára; Zhan, Shing Hei; Mayrose, Itay; Lysak, Martin A
2017-11-01
Hybridization and genome doubling (allopolyploidy) have led to evolutionary novelties as well as to the origin of new clades and species. Despite the importance of allopolyploidization, the dynamics of postpolyploid diploidization (PPD) at the genome level has been only sparsely studied. The Microlepidieae (MICR) is a crucifer tribe of 17 genera and c. 56 species endemic to Australia and New Zealand. Our phylogenetic and cytogenomic analyses revealed that MICR originated via an intertribal hybridization between ancestors of Crucihimalayeae (n = 8; maternal genome) and Smelowskieae (n = 7; paternal genome), both native to the Northern Hemisphere. The reconstructed ancestral allopolyploid genome (n = 15) originated probably in northeastern Asia or western North America during the Late Miocene (c. 10.6-7 million years ago) and reached the Australian mainland via long-distance dispersal. In Australia, the allotetraploid genome diverged into at least three main subclades exhibiting different levels of PPD and diversity: 1.25-fold descending dysploidy (DD) of n = 15 → n = 12 (autopolyploidy → 24) in perennial Arabidella (3 species), 1.5-fold DD of n = 15 → n = 10 in the perennial Pachycladon (11 spp.) and 2.1-3.75-fold DD of n = 15 → n = 7-4 in the largely annual crown-group genera (42 spp. in 15 genera). These results are among the first to demonstrate multispeed genome evolution in taxa descending from a common allopolyploid ancestor. It is suggested that clade-specific PPD can operate at different rates and efficacies and can be tentatively linked to life histories and the extent of taxonomic diversity. © 2017 John Wiley & Sons Ltd.
Cotton-based nonwovens and their potential scope
USDA-ARS?s Scientific Manuscript database
Although the overall use of cotton fiber in modern nonwovens has been limited, certain recent commercial and research developments make the use of cotton and its derivatives more attractive in nonwovens. The commercial developments include the availability of pre-cleaned greige cotton, purified (ble...
Zhan, Zongxiang; Nwafor, Chinedu Charles; Hou, Zhaoke; Gong, Jianfang; Zhu, Bin; Jiang, Yingfen; Zhou, Yongming; Wu, Jiangsheng; Piao, Zhongyun; Tong, Yue; Liu, Chao; Zhang, Chunyu
2017-01-01
Interspecific hybridization is a powerful tool for improvement of crop species, it has the potential to broaden the genetic base and create new plant forms for breeding programs. Synthetic allopolyploid is a widely-used model for the study of genetic recombination and fixed heterosis in Brassica. In Brassica napus breeding, identification and introgression of new sources of clubroot resistance trait from wild or related species into it by hybridization is a long-term crop management strategy for clubroot disease. Radish (Raphanus sativus L.) is a close relative of the Brassica and most radish accessions are immune to the clubroot disease. A synthesized allotetraploid Brassicoraphanus (RRCC, 2n = 36) between R. sativus cv. HQ-04 (2n = 18, RR) and Brassica oleracea var. alboglabra (L.H Bailey) (2n = 18, CC) proved resistant of multiple clubroot disease pathogen P. brassicae. To predict the possibility to transfer the clubroot resistance trait from the RR subgenome of allotetraploid Brassicoraphanus (RRCC, 2n = 36) into Brassica napus (AACC, 2n = 38), we analyzed the frequency of chromosome pairings in the F1 hybrids produced from a cross between B. napus cv. HS5 and the allotetraploid, characterize the genomic composition of some backcrossed progeny (BC1) using GISH, BAC-FISH and AFLP techniques. The level of intergenomic pairing between A and R genomes in the F1 hybrid was high, allosyndetic bivalents formed in 73.53% PMCs indicative of significant level of homeologous recombination between two genomes and high probability of incorporating chromosomal segments/genes from R-genome into A/C-genomes. The BC1 plants inherited variant extra R chromosomes or fragments from allotetraploid as revealed by GISH and AFLP analysis. 13.51% BC2 individuals were resistant to clubroot disease, and several resistance lines had high pollen fertility, Overall, the genetic material presented in this work represents a potential new genetic resource for practical use in breeding B. napus
Abney, Mark R; Ruberson, John R; Herzog, Gary A; Kring, Timothy J; Steinkraus, Donald C; Roberts, Phillip M
2008-02-01
The impact of natural enemies on cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae), populations in cotton, Gossypium hirsutum L., production systems in the southeastern United States was evaluated over 3 yr in irrigated commercial cotton fields. Fungal epizootics caused by the entomopathogen Neozygites fresenii (Nowakowski) Batko reduced aphid numbers to subthreshold levels in 1999, 2000, and 2001 and occurred consistently in early to mid-July in all 3 yr. Scymnus spp. were the most abundant aphidophagous predators, although other coccinellid species and generalist predators such as spiders, fire ants, heteropterans, and neuropterans also were present. Studies using arthropod exclusion cages demonstrated little impact of predators or parasitoids on aphid populations before fungal epizootics. Arthropod natural enemies were most abundant after epizootics and may have suppressed aphid populations late in the season. Seed cotton yield, and lint quality were not affected by aphicide applications in any year of the study. Implications of these findings for aphid management in the southeastern United States are discussed.
Airborne multispectral detection of regrowth cotton fields
NASA Astrophysics Data System (ADS)
Westbrook, John K.; Suh, Charles P.-C.; Yang, Chenghai; Lan, Yubin; Eyster, Ritchie S.
2015-01-01
Effective methods are needed for timely areawide detection of regrowth cotton plants because boll weevils (a quarantine pest) can feed and reproduce on these plants beyond the cotton production season. Airborne multispectral images of regrowth cotton plots were acquired on several dates after three shredding (i.e., stalk destruction) dates. Linear spectral unmixing (LSU) classification was applied to high-resolution airborne multispectral images of regrowth cotton plots to estimate the minimum detectable size and subsequent growth of plants. We found that regrowth cotton fields can be identified when the mean plant width is ˜0.2 m for an image resolution of 0.1 m. LSU estimates of canopy cover of regrowth cotton plots correlated well (r2=0.81) with the ratio of mean plant width to row spacing, a surrogate measure of plant canopy cover. The height and width of regrowth plants were both well correlated (r2=0.94) with accumulated degree-days after shredding. The results will help boll weevil eradication program managers use airborne multispectral images to detect and monitor the regrowth of cotton plants after stalk destruction, and identify fields that may require further inspection and mitigation of boll weevil infestations.
Trash particle distribution measurements in ginned cotton
USDA-ARS?s Scientific Manuscript database
A beltwide commercial cotton gin sampling project was initiated for the 2005-06 and 2006-07 ginning seasons to assess the changes in upland cotton quality during the ginning process and throughout the ginning season. The Cotton Trash Identification System (CTIS) developed at the USDA-ARS Southwester...
Status of the global cotton germplasm resources
USDA-ARS?s Scientific Manuscript database
The cultivated Gossypium spp. (cotton) represents the single most important, natural fiber crop in the world. In addition to its fiber, the oil and protein portion of the cottonseed also represents significant economic value. To protect the world-wide economic value of cotton fiber and cotton byprod...
Magalhães, D M; Borges, M; Laumann, R A; Sujii, E R; Mayon, P; Caulfield, J C; Midega, C A O; Khan, Z R; Pickett, J A; Birkett, M A; Blassioli-Moraes, M C
2012-12-01
The boll weevil, Anthonomus grandis, has been monitored through deployment of traps baited with aggregation pheromone components. However, field studies have shown that the number of insects caught in these traps is significantly reduced during cotton squaring, suggesting that volatiles produced by plants at this phenological stage may be involved in attraction. Here, we evaluated the chemical profile of volatile organic compounds (VOCs) emitted by undamaged or damaged cotton plants at different phenological stages, under different infestation conditions, and determined the attractiveness of these VOCs to adults of A. grandis. In addition, we investigated whether or not VOCs released by cotton plants enhanced the attractiveness of the aggregation pheromone emitted by male boll weevils. Behavioral responses of A. grandis to VOCs from conspecific-damaged, heterospecific-damaged (Spodoptera frugiperda and Euschistus heros) and undamaged cotton plants, at different phenological stages, were assessed in Y-tube olfactometers. The results showed that volatiles emitted from reproductive cotton plants damaged by conspecifics were attractive to adults boll weevils, whereas volatiles induced by heterospecific herbivores were not as attractive. Additionally, addition of boll weevil-induced volatiles from reproductive cotton plants to aggregation pheromone gave increased attraction, relative to the pheromone alone. The VOC profiles of undamaged and mechanically damaged cotton plants, in both phenological stages, were not different. Chemical analysis showed that cotton plants produced qualitatively similar volatile profiles regardless of damage type, but the quantities produced differed according to the plant's phenological stage and the herbivore species. Notably, vegetative cotton plants released higher amounts of VOCs compared to reproductive plants. At both stages, the highest rate of VOC release was observed in A. grandis-damaged plants. Results show that A. grandis uses
Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning; Yu, Shuxun
2018-01-01
WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant's susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton.
Gu, Lijiao; Li, Libei; Wei, Hengling; Wang, Hantao; Su, Junji; Guo, Yaning
2018-01-01
WRKY transcription factors play important roles in plant defense, stress response, leaf senescence, and plant growth and development. Previous studies have revealed the important roles of the group IIa GhWRKY genes in cotton. To comprehensively analyze the group IIa GhWRKY genes in upland cotton, we identified 15 candidate group IIa GhWRKY genes in the Gossypium hirsutum genome. The phylogenetic tree, intron-exon structure, motif prediction and Ka/Ks analyses indicated that most group IIa GhWRKY genes shared high similarity and conservation and underwent purifying selection during evolution. In addition, we detected the expression patterns of several group IIa GhWRKY genes in individual tissues as well as during leaf senescence using public RNA sequencing data and real-time quantitative PCR. To better understand the functions of group IIa GhWRKYs in cotton, GhWRKY17 (KF669857) was isolated from upland cotton, and its sequence alignment, promoter cis-acting elements and subcellular localization were characterized. Moreover, the over-expression of GhWRKY17 in Arabidopsis up-regulated the senescence-associated genes AtWRKY53, AtSAG12 and AtSAG13, enhancing the plant’s susceptibility to leaf senescence. These findings lay the foundation for further analysis and study of the functions of WRKY genes in cotton. PMID:29370286
Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts
USDA-ARS?s Scientific Manuscript database
The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...
Cotton breeding-challenges and opportunities
USDA-ARS?s Scientific Manuscript database
Competition with synthetic fibers is one of the greatest challenges facing today’s cotton industry. Improved fiber quality is essential to increase US cotton’s competitiveness in the global market place. Enhanced fiber quality also offers an opportunity to capture more value from cotton production. ...
Estimation of ovular fiber production in cotton
Van`t Hof, J.
1998-09-01
The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means. 4 figs.
Estimation of ovular fiber production in cotton
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van`t Hof, J.
The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means. 4 figs.
Estimation of ovular fiber production in cotton
Van't Hof, Jack
1998-09-01
The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means.
7 CFR 28.180 - Issuance of cotton classification memoranda.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification or...
7 CFR 27.25 - Additional samples of cotton; drawing.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed...
7 CFR 27.25 - Additional samples of cotton; drawing.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed...
7 CFR 28.180 - Issuance of cotton classification memoranda.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification or...
7 CFR 27.25 - Additional samples of cotton; drawing.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed...
7 CFR 28.180 - Issuance of cotton classification memoranda.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification or...
7 CFR 28.180 - Issuance of cotton classification memoranda.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification or...
7 CFR 27.25 - Additional samples of cotton; drawing.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed...
7 CFR 28.180 - Issuance of cotton classification memoranda.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification or...
7 CFR 27.25 - Additional samples of cotton; drawing.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed...
Islam, Md S; Zeng, Linghe; Thyssen, Gregory N; Delhom, Christopher D; Kim, Hee Jin; Li, Ping; Fang, David D
2016-06-01
Three QTL regions controlling three fiber quality traits were validated and further fine-mapped with 27 new single nucleotide polymorphism (SNP) markers. Transcriptome analysis suggests that receptor-like kinases found within the validated QTLs are potential candidate genes responsible for superior fiber strength in cotton line MD52ne. Fiber strength, length, maturity and fineness determine the market value of cotton fibers and the quality of spun yarn. Cotton fiber strength has been recognized as a critical quality attribute in the modern textile industry. Fine mapping along with quantitative trait loci (QTL) validation and candidate gene prediction can uncover the genetic and molecular basis of fiber quality traits. Four previously-identified QTLs (qFBS-c3, qSFI-c14, qUHML-c14 and qUHML-c24) related to fiber bundle strength, short fiber index and fiber length, respectively, were validated using an F3 population that originated from a cross of MD90ne × MD52ne. A group of 27 new SNP markers generated from mapping-by-sequencing (MBS) were placed in QTL regions to improve and validate earlier maps. Our refined QTL regions spanned 4.4, 1.8 and 3.7 Mb of physical distance in the Gossypium raimondii reference genome. We performed RNA sequencing (RNA-seq) of 15 and 20 days post-anthesis fiber cells from MD52ne and MD90ne and aligned reads to the G. raimondii genome. The QTL regions contained 21 significantly differentially expressed genes (DEGs) between the two near-isogenic parental lines. SNPs that result in non-synonymous substitutions to amino acid sequences of annotated genes were identified within these DEGs, and mapped. Taken together, transcriptome and amino acid mutation analysis indicate that receptor-like kinase pathway genes are likely candidates for superior fiber strength and length in MD52ne. MBS along with RNA-seq demonstrated a powerful strategy to elucidate candidate genes for the QTLs that control complex traits in a complex genome like tetraploid
7 CFR 28.160 - Cotton examiners on foreign exchanges.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever any...
7 CFR 28.160 - Cotton examiners on foreign exchanges.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever any...
78 FR 54970 - Cotton Futures Classification: Optional Classification Procedure
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-09
... Service 7 CFR Part 27 [AMS-CN-13-0043] RIN 0581-AD33 Cotton Futures Classification: Optional... optional cotton futures classification procedure--identified and known as ``registration'' by the U.S. cotton industry and the Intercontinental Exchange (ICE). In response to requests from the U.S. cotton...
7 CFR 1427.103 - Upland cotton Domestic User Agreement.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...
7 CFR 28.160 - Cotton examiners on foreign exchanges.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever any...
7 CFR 1427.103 - Upland cotton Domestic User Agreement.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...
7 CFR 28.160 - Cotton examiners on foreign exchanges.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever any...
7 CFR 1427.103 - Upland cotton Domestic User Agreement.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...
7 CFR 1427.103 - Upland cotton Domestic User Agreement.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...
7 CFR 1427.103 - Upland cotton Domestic User Agreement.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments specified...
7 CFR 28.160 - Cotton examiners on foreign exchanges.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever any...
Microbial contamination of water-soaked cotton gauze and its cause.
Oie, S; Yoshida, H; Kamiya, A
2001-01-01
Seven in-use cotton gauze samples and three cotton balls soaked in sterile distilled water in canisters were investigated 7 days after they were prepared in hospital. All samples were contaminated with bacteria including 10(6) to 10(7) colony forming units/ml of Pseudomonas aeruginosa. In vitro viability tests using cotton gauze and cotton balls soaked in sterile distilled water revealed rapid proliferation of P. aeruginosa, Serratia marcescens and Candida albicans. Since the cotton gauze and the cotton balls were soaked in water containing nutrients, such as protein and glucose, these materials may be readily contaminated with bacteria including P. aeruginosa. Thus, when using cotton gauze and cotton balls containing water, microbial contamination should be expected.
USDA-ARS?s Scientific Manuscript database
A DArT marker platform is developed for the cotton genome to evaluate the use of DArT markers compared to AFLPs in mapping, and transferability across the mapping populations. We used a reference genetic map of tetraploid Gossypium that already contained ~5000 loci which coalesced into 26 chromosom...
7 CFR 28.107 - Original cotton standards and reserve sets.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Original cotton standards and reserve sets. 28.107... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a...
7 CFR 28.107 - Original cotton standards and reserve sets.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Original cotton standards and reserve sets. 28.107... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a...
7 CFR 28.107 - Original cotton standards and reserve sets.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Original cotton standards and reserve sets. 28.107... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a...
7 CFR 28.107 - Original cotton standards and reserve sets.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Original cotton standards and reserve sets. 28.107... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a...
7 CFR 28.107 - Original cotton standards and reserve sets.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Original cotton standards and reserve sets. 28.107... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a...
Exploring biomedical applications of cotton
USDA-ARS?s Scientific Manuscript database
The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent ...
Cotton-Fiber-Filled Rubber Insulation
NASA Technical Reports Server (NTRS)
Anderson, Floyd A.
1987-01-01
Carbonization of fibers at high temperatures improves strength and erosion resistance. Cotton linters tested as replacement for asbestos filler currently used in rubber insulation in solid rocket motors. Cotton-filled rubber insulation has industrial uses; in some kinds of chemical- or metal-processing equipment, hoses, and protective clothing.
Exploring biomedical ppplications of cotton
USDA-ARS?s Scientific Manuscript database
The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent y...
USDA-ARS?s Scientific Manuscript database
Pantoea ananatis (Serano) representatives are known to have a broad host range including both humans and plants. The cotton fleahopper (Pseudatomoscelis seriatus, Reuter) is a significant pest that causes cotton bud damage that may result in significant yield losses. In this study, cotton fleahopp...
7 CFR 27.47 - Tender or delivery of cotton; conditions.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Tender or delivery of cotton; conditions. 27.47... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.47 Tender or delivery of cotton; conditions. Subject to the provisions of §§ 27.52 through 27...
7 CFR 27.47 - Tender or delivery of cotton; conditions.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Tender or delivery of cotton; conditions. 27.47... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.47 Tender or delivery of cotton; conditions. Subject to the provisions of §§ 27.52 through 27...
7 CFR 27.47 - Tender or delivery of cotton; conditions.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Tender or delivery of cotton; conditions. 27.47... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.47 Tender or delivery of cotton; conditions. Subject to the provisions of §§ 27.52 through 27...
7 CFR 27.47 - Tender or delivery of cotton; conditions.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Tender or delivery of cotton; conditions. 27.47... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.47 Tender or delivery of cotton; conditions. Subject to the provisions of §§ 27.52 through 27...
7 CFR 27.47 - Tender or delivery of cotton; conditions.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Tender or delivery of cotton; conditions. 27.47... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.47 Tender or delivery of cotton; conditions. Subject to the provisions of §§ 27.52 through 27...
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
Acoustical evaluation of carbonized and activated cotton nonwovens.
Jiang, N; Chen, J Y; Parikh, D V
2009-12-01
An activated carbon fiber nonwoven (ACF) was manufactured from a cotton nonwoven fabric. For the ACF acoustic application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glassfiber nonwoven, and the cotton nonwoven base layer with a layer of cotton fiber nonwoven. Their noise absorption coefficients and sound transmission loss were measured using the Brüel and Kjaer impedance tube instrument. Statistical significance of the differences between the composites was tested using the method of Duncan's grouping. The study concluded that the ACF composite exhibited a greater ability to absorb normal incidence sound waves than the composites with either glassfiber or cotton fiber. The analysis of sound transmission loss revealed that the three composites still obeyed the mass law of transmission loss. The composite with the surface layer of cotton fiber nonwoven possessed a higher fabric density and therefore showed a better sound insulation than the composites with glassfiber and ACF.
Cannarozzi, Gina; Plaza-Wüthrich, Sonia; Esfeld, Korinna; Larti, Stéphanie; Wilson, Yi Song; Girma, Dejene; de Castro, Edouard; Chanyalew, Solomon; Blösch, Regula; Farinelli, Laurent; Lyons, Eric; Schneider, Michel; Falquet, Laurent; Kuhlemeier, Cris; Assefa, Kebebew; Tadele, Zerihun
2014-07-09
Tef (Eragrostis tef), an indigenous cereal critical to food security in the Horn of Africa, is rich in minerals and protein, resistant to many biotic and abiotic stresses and safe for diabetics as well as sufferers of immune reactions to wheat gluten. We present the genome of tef, the first species in the grass subfamily Chloridoideae and the first allotetraploid assembled de novo. We sequenced the tef genome for marker-assisted breeding, to shed light on the molecular mechanisms conferring tef's desirable nutritional and agronomic properties, and to make its genome publicly available as a community resource. The draft genome contains 672 Mbp representing 87% of the genome size estimated from flow cytometry. We also sequenced two transcriptomes, one from a normalized RNA library and another from unnormalized RNASeq data. The normalized RNA library revealed around 38000 transcripts that were then annotated by the SwissProt group. The CoGe comparative genomics platform was used to compare the tef genome to other genomes, notably sorghum. Scaffolds comprising approximately half of the genome size were ordered by syntenic alignment to sorghum producing tef pseudo-chromosomes, which were sorted into A and B genomes as well as compared to the genetic map of tef. The draft genome was used to identify novel SSR markers, investigate target genes for abiotic stress resistance studies, and understand the evolution of the prolamin family of proteins that are responsible for the immune response to gluten. It is highly plausible that breeding targets previously identified in other cereal crops will also be valuable breeding targets in tef. The draft genome and transcriptome will be of great use for identifying these targets for genetic improvement of this orphan crop that is vital for feeding 50 million people in the Horn of Africa.
ERIC Educational Resources Information Center
Starbird, Irving R.; And Others
This report identifies and describes the structure and performance of the cotton industry, emphasizing the production and marketing of raw cotton. The underlying economic and political forces causing change in the various segments of the industry are also explored. The report provides a single source of economic and statistical information on…
de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio
2017-03-01
Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum
Cotton and its interaction with cotton morphology
USDA-ARS?s Scientific Manuscript database
The morphological plasticity of the cotton plant enables it to be produced in a wide variety of agro-ecological regions (Oosterhuis and Jernstedt 1999). This plasticity essentially translates to the lengthening, shortening, or interruption of its effective flowering period in response to season leng...
7 CFR 27.24 - Delivery of samples of cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered to...
7 CFR 27.24 - Delivery of samples of cotton.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered to...
7 CFR 27.24 - Delivery of samples of cotton.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered to...
7 CFR 27.21 - Preparation of samples of cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...
7 CFR 27.24 - Delivery of samples of cotton.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered to...
7 CFR 27.24 - Delivery of samples of cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered to...
7 CFR 27.21 - Preparation of samples of cotton.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...
7 CFR 27.21 - Preparation of samples of cotton.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...
Climate change and cotton production in modern farming systems
USDA-ARS?s Scientific Manuscript database
Cotton is used every day in the form of clothing made from cotton fiber and products made from cotton-seed oil. Wild ancestors of cotton are found in arid regions, often with high daytime temperatures and cool nights, and are naturally adapted to surviving long periods of hot dry weather. Modern cul...
Test of pressure transducer for measuring cotton-mass flow
USDA-ARS?s Scientific Manuscript database
In this study, a cotton harvester yield monitor was developed based on the relationship between air pressure and the mass of seed cotton conveyed. The sensor theory was verified by laboratory tests. The sensor was tested on a cotton picker with seed cotton at two moisture contents, 5.9% and 8.5% we...
Population Dynamics of Belonolaimus longicaudatusin a Cotton Production System
Crow, W. T.; Weingartner, D. P.; McSorley, R.; Dickson, D. W.
2000-01-01
Belonolaimus longicaudatus is a recognized pathogen of cotton (Gossypium hirsutum), but insufficient information is available on the population dynamics and economic thresholds of B. longicaudatus in cotton production. In this study, data collected from a field in Florida were used to develop models predicting population increases of B. longicaudatus on cotton and population declines under clean fallow. Population densities of B. longicaudatus increased on cotton, reaching a carrying capacity of 139 nematodes/130 cm³ of soil, but decreased exponentially during periods of bare fallow. The model indicated that population densities should decrease each year of monocropped cotton, if an alternate host is not present between sequential cotton crops. Economic thresholds derived from published damage functions and current prices for cotton and nematicides varied from 2 to 5 B. longicaudatus/130 cm³ of soil, depending on the nematicide used. PMID:19270968
Efe, Lale; Killi, Fatih; Mustafayev, Sefer A
2009-10-15
In the study carried out in 2002-2003 in the East Mediterranean region of Turkey (in Kahramanmaras Province), four different naturally coloured cotton (Gossypium hirsutum L.) (dark brown, light brown, cream and green) lines from Azerbaijan and two white linted cotton varieties (Maras-92 and Sayar-314 (G. hirsutum L.)) of the region were used as material. The aim of this study was to determine seed cotton yield and yield components and major lint quality traits of investigated coloured cotton lines comprising white linted local standard cotton varieties. Field trials were established in randomized block design with four blocks. According to two year's results, it was determined that naturally coloured cottons were found similar to both white linted standard cotton varieties for sympodia number and seed cotton yield. For boll number per plant, except green cotton line all coloured cotton lines were similar to standard varieties or even some of them were better than standards. For ginning outturn, dark brown, cream and green cotton lines were found statistically similar to standard Maras-92. But all naturally coloured cotton lines had lower seed cotton weight per boll and generally lower fiber quality than white linted standard varieties. For fiber length and fiber strength cream cotton line was the best coloured cotton. And for fiber fineness only green cotton line was better than both standards. It can be said that naturally coloured cotton lines need to be improved especially for fiber quality characters in the East Mediterranean region of Turkey.
7 CFR 28.482 - United States Cotton Futures Act.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 2 2011-01-01 2011-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective for...
7 CFR 28.482 - United States Cotton Futures Act.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 2 2014-01-01 2014-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective for...
7 CFR 28.482 - United States Cotton Futures Act.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective for...
7 CFR 28.482 - United States Cotton Futures Act.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 2 2012-01-01 2012-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective for...
7 CFR 28.482 - United States Cotton Futures Act.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 2 2013-01-01 2013-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective for...
Ademe, Mulugeta Seyoum; He, Shoupu; Pan, Zhaoe; Sun, Junling; Wang, Qinglian; Qin, Hongde; Liu, Jinhai; Liu, Hui; Yang, Jun; Xu, Dongyong; Yang, Jinlong; Ma, Zhiying; Zhang, Jinbiao; Li, Zhikun; Cai, Zhongmin; Zhang, Xuelin; Zhang, Xin; Huang, Aifen; Yi, Xianda; Zhou, Guanyin; Li, Lin; Zhu, Haiyong; Pang, Baoyin; Wang, Liru; Jia, Yinhua; Du, Xiongming
2017-12-01
Fiber yield and quality are the most important traits for Upland cotton (Gossypium hirsutum L.). Identifying high yield and good fiber quality genes are the prime concern of researchers in cotton breeding. Association mapping offers an alternative and powerful method for detecting those complex agronomic traits. In this study, 198 simple sequence repeats (SSRs) were used to screen markers associated with fiber yield and quality traits with 302 elite Upland cotton accessions that were evaluated in 12 locations representing the Yellow River and Yangtze River cotton growing regions of China. Three subpopulations were found after the estimation of population structure. The pair-wise kinship values varied from 0 to 0.867. Only 1.59% of the total marker locus pairs showed significant linkage disequilibrium (LD, p < 0.001). The genome-wide LD decayed within the genetic distance of ~30 to 32 cM at r 2 = 0.1, and decreased to ~1 to 2 cM at r 2 = 0.2, indicating the potential for association mapping. Analysis based on a mixed linear model detected 57 significant (p < 0.01) marker-trait associations, including seven associations for fiber length, ten for fiber micronaire, nine for fiber strength, eight for fiber elongation, five for fiber uniformity index, five for fiber uniformity ratio, six for boll weight and seven for lint percent, for a total of 35 SSR markers, of which 11 markers were associated with more than one trait. Among marker-trait associations, 24 associations coincided with the previously reported quantitative trait loci (QTLs), the remainder were newly identified QTLs/genes. The QTLs identified in this study will potentially facilitate improvement of fiber yield and quality in the future cotton molecular breeding programs.
Cotton Fever: Does the Patient Know Best?
Xie, Yingda; Pope, Bailey A; Hunter, Alan J
2016-04-01
Fever and leukocytosis have many possible etiologies in injection drug users. We present a case of a 22-year-old woman with fever and leukocytosis that were presumed secondary to cotton fever, a rarely recognized complication of injection drug use, after an extensive workup. Cotton fever is a benign, self-limited febrile syndrome characterized by fevers, leukocytosis, myalgias, nausea and vomiting, occurring in injection drug users who filter their drug suspensions through cotton balls. While this syndrome is commonly recognized amongst the injection drug user population, there is a paucity of data in the medical literature. We review the case presentation and available literature related to cotton fever.
Lu, Quanwei; Shi, Yuzhen; Xiao, Xianghui; Li, Pengtao; Gong, Juwu; Gong, Wankui; Liu, Aiying; Shang, Haihong; Li, Junwen; Ge, Qun; Song, Weiwu; Li, Shaoqi; Zhang, Zhen; Rashid, Md Harun Or; Peng, Renhai; Yuan, Youlu; Huang, Jinling
2017-10-05
As high-strength cotton fibers are critical components of high quality cotton, developing cotton cultivars with high-strength fibers as well as high yield is a top priority for cotton development. Recently, chromosome segment substitution lines (CSSLs) have been developed from high-yield Upland cotton ( Gossypium hirsutum ) crossed with high-quality Sea Island cotton ( G. barbadense ). Here, we constructed a CSSL population by crossing CCRI45, a high-yield Upland cotton cultivar, with Hai1, a Sea Island cotton cultivar with superior fiber quality. We then selected two CSSLs with significantly higher fiber strength than CCRI45 (MBI7747 and MBI7561), and one CSSL with lower fiber strength than CCRI45 (MBI7285), for further analysis. We sequenced all four transcriptomes at four different time points postanthesis, and clustered the 44,678 identified genes by function. We identified 2200 common differentially-expressed genes (DEGs): those that were found in both high quality CSSLs (MBI7747 and MBI7561), but not in the low quality CSSL (MBI7285). Many of these genes were associated with various metabolic pathways that affect fiber strength. Upregulated DEGs were associated with polysaccharide metabolic regulation, single-organism localization, cell wall organization, and biogenesis, while the downregulated DEGs were associated with microtubule regulation, the cellular response to stress, and the cell cycle. Further analyses indicated that three genes, XLOC_036333 [mannosyl-oligosaccharide-α-mannosidase ( MNS1 )], XLOC_029945 ( FLA8 ), and XLOC_075372 ( snakin-1 ), were potentially important for the regulation of cotton fiber strength. Our results suggest that these genes may be good candidates for future investigation of the molecular mechanisms of fiber strength formation and for the improvement of cotton fiber quality through molecular breeding. Copyright © 2017 Lu et al.
A Solution to the C-Value Paradox and the Function of Junk DNA: The Genome Balance Hypothesis.
Freeling, Michael; Xu, Jie; Woodhouse, Margaret; Lisch, Damon
2015-06-01
The Genome Balance Hypothesis originated from a recent study that provided a mechanism for the phenomenon of genome dominance in ancient polyploids: unique 24nt RNA coverage near genes is greater in genes on the recessive subgenome irrespective of differences in gene expression. 24nt RNAs target transposons. Transposon position effects are now hypothesized to balance the expression of networked genes and provide spring-like tension between pericentromeric heterochromatin and microtubules. The balance (coordination) of gene expression and centromere movement is under selection. Our hypothesis states that this balance can be maintained by many or few transposons about equally well. We explain known balanced distributions of junk DNA within genomes and between subgenomes in allopolyploids (and our hypothesis passes "the onion test" for any so-called solution to the C-value paradox). Importantly, when the allotetraploid maize chromosomes delete redundant genes, their nearby transposons are also lost; this result is explained if transposons near genes function. The Genome Balance Hypothesis is hypothetical because the position effect mechanisms implicated are not proved to apply to all junk DNA, and the continuous nature of the centromeric and gene position effects have not yet been studied as a single phenomenon. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
Genetic diversity of sea-island cotton (Gossypium barbadense) revealed by mapped SSRs.
Wang, X Q; Feng, C H; Lin, Z X; Zhang, X L
2011-12-08
In order to evaluate the genetic diversity of sea-island cotton (Gossypium barbadense), 237 commonly mapped SSR markers covering the cotton genome were used to genotype 56 sea-island cotton accessions. A total of 218 polymorphic primer pairs (91.98%) amplified 361 loci, with a mean of 1.66 loci. Polymorphism information content values of the SSR primers ranged from 0.035 to 0.862, with a mean of 0.320. The highest mean polymorphism information content value for the SSR motifs was from a compound motif (0.402), and for the chromosomes it was Chr10 (0.589); the highest ratio of polymorphic primers in Xinjiang accessions was from Chr21 (83.33%). Genetic diversity was high in Xinjiang accessions. AMOVA showed that variation was 8 and 92% among populations and within populations, respectively. The 56 sea-island accessions were divided into three groups in the UPGMA dendrogram: Xinhai5 was in the first group; accessions from Xinjiang, except the five main ones, were in the second group, and the other 34 accessions were in the third group. Accessions from the former Soviet Union and Xinjiang main accessions were closely related. Both PCA and UPGMA confirmed that Xinhai5 was distinct from the other accessions, and accessions from Xinjiang were in an independent group. Given the differences between principal components analysis and UPGMA results, it is necessary to combine molecular markers and pedigree information so that genetic diversity can be objectively analyzed.
Naoumkina, Marina; Bechere, Efrem; Fang, David D; Thyssen, Gregory N; Florane, Christopher B
2017-07-01
In this work we describe a chemically-induced short fiber mutant cotton line, Ligon-lintless-y (li y ), which is controlled by a single recessive locus and affects multiple traits, including height of the plant, and length and maturity of fiber. An RNAseq analysis was used to evaluate global transcriptional changes during cotton fiber development at 3, 8 and 16days post anthesis. We found that 613, 2629 and 3397 genes were significantly down-regulated, while 2700, 477 and 3260 were significantly up-regulated in li y at 3, 8 and 16 DPA. Gene set enrichment analysis revealed that many metabolic pathways, including carbohydrate, cell wall, hormone metabolism and transport were substantially altered in li y developing fibers. We discuss perturbed expression of genes involved in signal transduction and biosynthesis of phytohormones, such as auxin, abscisic acid, gibberellin and ethylene. The results of this study provide new insights into transcriptional regulation of cotton fiber development. Published by Elsevier Inc.
Pressure effects on extraction of cotton using ASE
USDA-ARS?s Scientific Manuscript database
Cotton wax is one of the non-cellulosic components found on the surfaces of cotton. It is important in dyeing and processing quality. This investigation was carried out to study the yield of wax on the surface of cottons by performing two methods: Soxhlet extractions and accelerated solvent extracti...
7 CFR 457.104 - Cotton crop insurance provisions.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 6 2014-01-01 2014-01-01 false Cotton crop insurance provisions. 457.104 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.104 Cotton crop insurance provisions. The cotton crop insurance provisions for the 2011 and succeeding crop years are as follows...
7 CFR 457.104 - Cotton crop insurance provisions.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 6 2012-01-01 2012-01-01 false Cotton crop insurance provisions. 457.104 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.104 Cotton crop insurance provisions. The cotton crop insurance provisions for the 2011 and succeeding crop years are as follows...
7 CFR 457.104 - Cotton crop insurance provisions.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 6 2013-01-01 2013-01-01 false Cotton crop insurance provisions. 457.104 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.104 Cotton crop insurance provisions. The cotton crop insurance provisions for the 2011 and succeeding crop years are as follows...
Fourier transform infrared imaging of Cotton trash mixtures
USDA-ARS?s Scientific Manuscript database
There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...
Acoustical Evaluation of Carbonized and Activated Cotton Nonwovens
USDA-ARS?s Scientific Manuscript database
An activated carbon fiber nonwoven (ACF) was manufactured from cotton nonowoven fabric. For the ACF acoustical application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glass fiber ...
Thyssen, Gregory N; Song, Xianliang; Naoumkina, Marina; Kim, Hee-Jin; Fang, David D
2014-07-01
The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary independently between different cell types and developmental stages. Our objective was to determine the relationship between mitochondrial gene copy number and transcript abundance in the elongating fiber cells of Upland cotton (Gossypium hirsutum L.). We compared RNA and DNA from cotton fiber cells at five developmental time points from early elongation through secondary cell wall thickening from the Ligon-lintless 2 (Li2) short fiber mutant and its wild type near isogenic line (NIL) DP5690. Mitochondrial gene copy number decreased from 3 to 8-DPA in the developing cotton fiber cells while transcript levels remained low. As secondary cell wall biosynthesis began in developing fibers, the expression levels and copy numbers of mitochondrial genes involved in energy production and respiration were up-regulated in wild type cotton DP5690. However, the short fiber mutant Li2, failed to increase expression of these genes, which include three subunits of ATP synthase, atp1, atp8 and atp9 and two cytochrome genes cox1 and cob. At the same time, Li2 failed to increase the copy numbers of these highly expressed genes. Surprisingly, we found that when mitochondrial genes were highly transcribed, they also had very high copy numbers. This observation suggests that in developing cotton fibers, increased mitochondrial sublimon replication may support increases in gene transcription. Published by Elsevier B.V.
7 CFR 457.105 - Extra long staple cotton crop insurance provisions.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 6 2014-01-01 2014-01-01 false Extra long staple cotton crop insurance provisions... long staple cotton crop insurance provisions. The extra long staple cotton crop insurance provisions... Crop Insurance Corporation ELS Cotton Crop Provisions 1. Definitions Cotton. Varieties identified as...
7 CFR 457.105 - Extra long staple cotton crop insurance provisions.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 6 2012-01-01 2012-01-01 false Extra long staple cotton crop insurance provisions... long staple cotton crop insurance provisions. The extra long staple cotton crop insurance provisions... Crop Insurance Corporation ELS Cotton Crop Provisions 1. Definitions Cotton. Varieties identified as...