Science.gov

Sample records for alpha satellite dna

  1. Locational diversity of alpha satellite DNA and intergeneric hybridization aspects in the Nomascus and Hylobates genera of small apes.

    PubMed

    Baicharoen, Sudarath; Miyabe-Nishiwaki, Takako; Arsaithamkul, Visit; Hirai, Yuriko; Duangsa-ard, Kwanruen; Siriaroonrat, Boripat; Domae, Hiroshi; Srikulnath, Kornsorn; Koga, Akihiko; Hirai, Hirohisa

    2014-01-01

    Recently, we discovered that alpha satellite DNA has unique and genus-specific localizations on the chromosomes of small apes. This study describes the details of alpha satellite localization in the genera Nomascus and Hylobates and explores their usefulness in distinguishing parental genome sets in hybrids between these genera. Fluorescence in situ hybridization was used to establish diagnostic criteria of alpha satellite DNA markers in discriminating small ape genomes. In particular we established the genus specificity of alpha satellite distribution in three species of light-cheeked gibbons (Nomascus leucogenys, N. siki, and N. gabriellae) in comparison to that of Hylobates lar. Then we determined the localization of alpha satellite DNA in a hybrid individual which resulted from a cross between these two genera. In Nomascus the alpha satellite DNA blocks were located at the centromere, telomere, and four interstitial regions. In Hylobates detectable amounts of alpha satellite DNA were seen only at centromeric regions. The differences in alpha satellite DNA locations between Nomascus and Hylobates allowed us to easily distinguish the parental chromosomal sets in the genome of intergeneric hybrid individuals found in Thai and Japanese zoos. Our study illustrates how molecular cytogenetic markers can serve as diagnostic tools to identify the origin of individuals. These molecular tools can aid zoos, captive breeding programs and conservation efforts in managing small apes species. Discovering more information on alpha satellite distribution is also an opportunity to examine phylogenetic and evolutionary questions that are still controversial in small apes. PMID:25290445

  2. Marker chromosomes lacking {alpha}-satellite DNA: A new intriguing class of abnormalities

    SciTech Connect

    Becker, L.A.; Zinn, A.B.; Stallard, J.R.

    1994-09-01

    Recent studies have implicated {alpha}-satellite DNA as an integral part of the centromere and important for the normal segregation of chromosomes. We analyzed four supernumerary marker chromosomes in which fluorescence in situ hybridization (FISH) could detect neither pancentromeric or chromosome specific {alpha}-satellite DNA. Mosaicism of the markers existed, but each was present in the majority of cells indicating that they segregated normally. FISH with chromosome-specific libraries identified the origins of these markers as chromosomes 13 (1 case) and 15 (3 cases). High resolution analysis, combined with hybridization of a series of cosmid probes, revealed that each marker was a symmetrical duplication of the terminal long arm of the parent chromosome. Telomeric sequences were detected by FISH indicating linear structures. Breakpoint heterogeneity, as defined by cosmid probes, was demonstrated in the three cases involving chromosome 15. No pericentromeric satellite III DNA could be detected on three markers. Studies with anti-centromere antibodies are in progress to assay for centromeric antigens on the markers, as expected at functional centromeric sites. Our results demonstrate that the precise structural identification and heterogeneity of these markers can be easily elucidated using FISH with unique sequence cosmid probes. We conclude from our studies and others in the literature: (1) there is a newly defined class of markers lacking {alpha}-satellite DNA and containing duplications of terminal sequences; (2)neither {alpha}-satellite nor satellite III DNA at levels detectable by FISH is necessary for fidelity in the normal segregation of chromosomes; and (3) these markers were most likely formed by recombination of the long arms during meiosis.

  3. Genomic organization of alpha satellite DNA on human chromosome 7: evidence for two distinct alphoid domains on a single chromosome.

    PubMed Central

    Waye, J S; England, S B; Willard, H F

    1987-01-01

    A complete understanding of chromosomal disjunction during mitosis and meiosis in complex genomes such as the human genome awaits detailed characterization of both the molecular structure and genetic behavior of the centromeric regions of chromosomes. Such analyses in turn require knowledge of the organization and nature of DNA sequences associated with centromeres. The most prominent class of centromeric DNA sequences in the human genome is the alpha satellite family of tandemly repeated DNA, which is organized as distinct chromosomal subsets. Each subset is characterized by a particular multimeric higher-order repeat unit consisting of tandemly reiterated, diverged alpha satellite monomers of approximately 171 base pairs. The higher-order repeat units are themselves tandemly reiterated and represent the most recently amplified or fixed alphoid sequences. We present evidence that there are at least two independent domains of alpha satellite DNA on chromosome 7, each characterized by their own distinct higher-order repeat structure. We determined the complete nucleotide sequences of a 6-monomer higher-order repeat unit, which is present in approximately 500 copies per chromosome 7, as well as those of a less-abundant (approximately 10 copies) 16-monomer higher-order repeat unit. Sequence analysis indicated that these repeats are evolutionarily distinct. Genomic hybridization experiments established that each is maintained in relatively homogeneous tandem arrays with no detectable interspersion. We propose mechanisms by which multiple unrelated higher-order repeat domains may be formed and maintained within a single chromosomal subset. Images PMID:3561394

  4. Nucleotide sequence heterogeneity of alpha satellite repetitive DNA: a survey of alphoid sequences from different human chromosomes.

    PubMed Central

    Waye, J S; Willard, H F

    1987-01-01

    The human alpha satellite DNA family is composed of diverse, tandemly reiterated monomer units of approximately 171 basepairs localized to the centromeric region of each chromosome. These sequences are organized in a highly chromosome-specific manner with many, if not all human chromosomes being characterized by individually distinct alphoid subsets. Here, we compare the nucleotide sequences of 153 monomer units, representing alphoid components of at least 12 different human chromosomes. Based on the analysis of sequence variation at each position within the 171 basepair monomer, we have derived a consensus sequence for the monomer unit of human alpha satellite DNA which we suggest may reflect the monomer sequence from which different chromosomal subsets have evolved. Sequence heterogeneity is evident at each position within the consensus monomer unit and there are no positions of strict nucleotide sequence conservation, although some regions are more variable than others. A substantial proportion of the overall sequence variation may be accounted for by nucleotide changes which are characteristic of monomer components of individual chromosomal subsets or groups of subsets which have a common evolutionary history. PMID:3658703

  5. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  6. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  7. Start/stop codon like trinucleotides extensions in primate alpha satellites.

    PubMed

    Rosandić, Marija; Glunčić, Matko; Paar, Vladimir

    2013-01-21

    The centromeres remain "the final frontier" in unexplored segments of genome landscape in primate genomes, characterized by 2-5 Mb arrays of evolutionary rapidly evolving alpha satellite (AS) higher order repeats (HORs). Alpha satellites as specific noncoding sequences may be also significant in light of regulatory role of noncoding sequences. Using the Global Repeat Map (GRM) algorithm we identify in NCBI assemblies of chromosome 5 the species-specific alpha satellite HORs: 13mer in human, 5mer in chimpanzee, 14mer in orangutan and 3mers in macaque. The suprachromosomal family (SF) classification of alpha satellite HORs and surrounding monomeric alpha satellites is performed and specific segmental structure was found for major alpha satellite arrays in chromosome 5 of primates. In the framework of our novel concept of start/stop Codon Like Trinucleotides (CLTs) as a "new DNA language in noncoding sequences", we find characteristics and differences of these species in CLT extensions, in particular the extensions of stop-TGA CLT. We hypothesize that these are regulators in noncoding sequences, acting at a distance, and that they can amplify or weaken the activity of start/stop codons in coding sequences in protein genesis, increasing the richness of regulatory phenomena. PMID:23026763

  8. Isolation and characterization of an alpha-satellite repeated sequence from human chromosome 22.

    PubMed

    McDermid, H E; Duncan, A M; Higgins, M J; Hamerton, J L; Rector, E; Brasch, K R; White, B N

    1986-01-01

    We constructed a library in lambda L47.1 with DNA isolated from flow-sorted human chromosome 22. Over 50% of the recombinants contained the same highly repetitive sequence. When this sequence was used to probe Southern blots of EcoRI-digested genomic DNA, a ladder of bands with increments of about 170 bp was observed. This sequence comigrates with satellite III in Ag+/Cs2SO4 gradients and may account for at least part of the 170 bp Hae III ladder seen in isolated satellite III DNA. Partial sequence analysis revealed homology to the 171 bp monomeric repeat unit of alpha-R1-DNA and the X specific alpha-satellite consensus sequence. After low stringency in situ hybridization, silver grains were found over the centromeres of a number of chromosomes. Under high stringency conditions, however, the labeling was concentrated over the centromeric region of chromosome 22. This localization was confirmed using DNA from a panel of human/hamster cell lines which showed that the homologous 2.1 and 2.8 kb EcoR1 restriction fragments were chromosome 22 specific. These clones therefore contain chromosome 22 derived alpha-satellite sequences analogous to other chromosome-specific satellite sequences described previously. PMID:3769652

  9. Physical Interactions between Mcm10, DNA, and DNA Polymerase [alpha

    SciTech Connect

    Warren, Eric M.; Huang, Hao; Fanning, Ellen; Chazin, Walter J.; Eichman, Brandt F.

    2009-10-21

    Mcm10 is an essential eukaryotic protein required for the initiation and elongation phases of chromosomal replication. Specifically, Mcm10 is required for the association of several replication proteins, including DNA polymerase {alpha} (pol {alpha}), with chromatin. We showed previously that the internal (ID) and C-terminal (CTD) domains of Mcm10 physically interact with both single-stranded (ss) DNA and the catalytic p180 subunit of pol {alpha}. However, the mechanism by which Mcm10 interacts with pol {alpha} on and off DNA is unclear. As a first step toward understanding the structural details for these critical intermolecular interactions, x-ray crystallography and NMR spectroscopy were used to map the binary interfaces between Mcm10-ID, ssDNA, and p180. The crystal structure of an Mcm10-ID {center_dot} ssDNA complex confirmed and extended our previous evidence that ssDNA binds within the oligonucleotide/oligosaccharide binding-fold cleft of Mcm10-ID. We show using NMR chemical shift perturbation and fluorescence spectroscopy that p180 also binds to the OB-fold and that ssDNA and p180 compete for binding to this motif. In addition, we map a minimal Mcm10 binding site on p180 to a small region within the p180 N-terminal domain (residues 286-310). These findings, together with data for DNA and p180 binding to an Mcm10 construct that contains both the ID and CTD, provide the first mechanistic insight into how Mcm10 might use a handoff mechanism to load and stabilize pol {alpha} within the replication fork.

  10. Epigenetic profiling of heterochromatic satellite DNA.

    PubMed

    Zakrzewski, Falk; Weisshaar, Bernd; Fuchs, Jörg; Bannack, Ekaterina; Minoche, André E; Dohm, Juliane C; Himmelbauer, Heinz; Schmidt, Thomas

    2011-08-01

    Sugar beet (Beta vulgaris) chromosomes consist of large heterochromatic blocks in pericentromeric, centromeric, and intercalary regions comprised of two different highly abundant DNA satellite families. To investigate DNA methylation at single base resolution at heterochromatic regions, we applied a method for strand-specific bisulfite sequencing of more than 1,000 satellite monomers followed by statistical analyses. As a result, we uncovered diversity in the distribution of different methylation patterns in both satellite families. Heavily methylated CG and CHG (H=A, T, or C) sites occur more frequently in intercalary heterochromatin, while CHH sites, with the exception of CAA, are only sparsely methylated, in both intercalary and pericentromeric/centromeric heterochromatin. We show that the difference in DNA methylation intensity is correlated to unequal distribution of heterochromatic histone H3 methylation marks. While clusters of H3K9me2 were absent from pericentromeric heterochromatin and restricted only to intercalary heterochromatic regions, H3K9me1 and H3K27me1 were observed in all types of heterochromatin. By sequencing of a small RNA library consisting of 6.76 million small RNAs, we identified small interfering RNAs (siRNAs) of 24 nucleotides in size which originated from both strands of the satellite DNAs. We hypothesize an involvement of these siRNAs in the regulation of DNA and histone methylation for maintaining heterochromatin. PMID:21594600

  11. The Orbital Design of Alpha Centauri Exoplanet Satellite (ACESat)

    NASA Technical Reports Server (NTRS)

    Weston, Sasha; Belikov, Rus; Bendek, Eduardo

    2015-01-01

    Exoplanet candidates discovered by Kepler are too distant for biomarkers to be detected with foreseeable technology. Alpha Centauri has high separation from other stars and is of close proximity to Earth, which makes the binary star system 'low hanging fruit' for scientists. Alpha Centauri Exoplanet Satellite (ACESat) is a mission proposed to Small Explorer Program (SMEX) that will use a coronagraph to search for an orbiting planet around one of the stars of Alpha Centauri. The trajectory design for this mission is presented here where three different trajectories are considered: Low Earth Orbit (LEO), Geosynchronous Orbit (GEO) and a Heliocentric Orbit. Uninterrupted stare time to Alpha Centauri is desirable for meeting science requirements, or an orbit that provides 90% stare time to the science target. The instrument thermal stability also has stringent requirements for proper function, influencing trajectory design.

  12. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    SciTech Connect

    Warburton, P.E.; Gosden, J.; Lawson, D.

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  13. Phosphorylation-independent stimulation of DNA topoisomerase II alpha activity.

    PubMed

    Kimura, K; Saijo, M; Tanaka, M; Enomoto, T

    1996-05-01

    It has been suggested that casein kinase II phosphorylates DNA topoisomerase II alpha (topo II alpha) in mouse FM3A cells, by comparison of phosphopeptide maps of topo II alpha labeled in intact cells and of topo II alpha phosphorylated by various kinases in vitro. The phosphorylation of purified topo II alpha by casein kinase II, which attached a maximum of two phosphate groups per topo II alpha molecule, had no effect on the activity of topo II alpha. Dephosphorylation of purified topo II alpha by potato acid phosphatase, which almost completely dephosphorylated the topo II alpha, did not reduce the activity of topo II alpha. The incubation itself, regardless of phosphorylation or dephosphorylation status, stimulated the enzyme activity in both reactions. Topo II alpha activity was stimulated by incubation in a medium containing low concentrations of glycerol but not in that containing high concentrations of glycerol, such as the 50% in which purified topo II alpha is stored. The stimulation of topo II alpha activity by incubation was dependent on the concentration of topo II alpha, requiring a relatively high concentration of topo II alpha. PMID:8631919

  14. [Non-radioactive in situ hybridization of alpha-satellite sequences in cytogenetic diagnosis].

    PubMed

    Perfumo, C; Arslanian, A; Zara, F; Piombo, G; Pierluigi, M

    1992-01-01

    Non isotopic in situ hybridization with alpha-satellite DNA probes in the cytogenetic diagnosis. Standard banding cytogenetic techniques do not always allow to define the structure and the origin of chromosome rearrangements involving the centromere region. Non-isotopic in situ hybridization of alphoid sequences has allowed to determine the origin of the centromeres in the metaphases of 5 patients referred to us for: 2 structural rearrangements involving chromosome 21, 2 structural rearrangements involving chromosome Y and 1 reciprocal translocation involving on chromosome 20 and one chromosome 15. PMID:1465321

  15. Organization and Molecular Evolution of CENP-A–Associated Satellite DNA Families in a Basal Primate Genome

    PubMed Central

    Lee, Hye-Ran; Hayden, Karen E.; Willard, Huntington F.

    2011-01-01

    Centromeric regions in many complex eukaryotic species contain highly repetitive satellite DNAs. Despite the diversity of centromeric DNA sequences among species, the functional centromeres in all species studied to date are marked by CENP-A, a centromere-specific histone H3 variant. Although it is well established that families of multimeric higher-order alpha satellite are conserved at the centromeres of human and great ape chromosomes and that diverged monomeric alpha satellite is found in old and new world monkey genomes, little is known about the organization, function, and evolution of centromeric sequences in more distant primates, including lemurs. Aye-Aye (Daubentonia madagascariensis) is a basal primate and is located at a key position in the evolutionary tree to study centromeric satellite transitions in primate genomes. Using the approach of chromatin immunoprecipitation with antibodies directed to CENP-A, we have identified two satellite families, Daubentonia madagascariensis Aye-Aye 1 (DMA1) and Daubentonia madagascariensis Aye-Aye 2 (DMA2), related to each other but unrelated in sequence to alpha satellite or any other previously described primate or mammalian satellite DNA families. Here, we describe the initial genomic and phylogenetic organization of DMA1 and DMA2 and present evidence of higher-order repeats in Aye-Aye centromeric domains, providing an opportunity to study the emergence of chromosome-specific modes of satellite DNA evolution in primate genomes. PMID:21828373

  16. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  17. T-antigen-DNA polymerase alpha complex implicated in simian virus 40 DNA replication.

    PubMed Central

    Smale, S T; Tjian, R

    1986-01-01

    We have combined in vitro DNA replication reactions and immunological techniques to analyze biochemical interactions between simian virus (SV40) large T antigen and components of the cellular replication apparatus. First, in vitro SV40 DNA replication was characterized with specific origin mutants. Next, monoclonal antibodies were used to demonstrate that a specific domain of T antigen formed a complex with cellular DNA polymerase alpha. Several antibodies were identified that coprecipitated T antigen and DNA polymerase alpha, while others were found to selectively prevent this interaction and concomitantly inhibit DNA replication. DNA polymerase alpha also bound efficiently to a T-antigen affinity column, confirming the immunoprecipitation results and providing a useful method for purification of the complete protein complex. Taken together, these results suggest that the T-antigen-polymerase association may be a key step in the initiation of SV40 DNA replication. Images PMID:3025630

  18. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: activation of a latent centromere?

    PubMed Central

    Voullaire, L E; Slater, H R; Petrovic, V; Choo, K H

    1993-01-01

    We report the investigation of an unusual human supernumerary marker chromosome 10 designated "mar del(10)." This marker is present together with two other marker chromosomes in the karyotype of a boy with mild developmental delay. It has a functional centromere at a primary constriction and is mitotically stable. Fluorescence in situ hybridization (FISH) using alpha-satellite and satellite III DNA as probes failed to detect any signal at the primary constriction site. CENP-B protein could not be demonstrated, although the presence of at least some centromeric proteins was confirmed using a CREST antiserum. Consideration of these and other cytogenetic and FISH results supports a mechanism of formation of the mar del(10) chromosome involving the activation of a latent intercalary centromere at 10q25. Images Figure 5 Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 PMID:7684888

  19. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: Activation of a latent centromere

    SciTech Connect

    Voullaire, L.E.; Slater, H.R.; Petrovic, V.; Choo, K.H.A. )

    1993-06-01

    The authors report the investigation of an unusual human supernumerary marker chromosome 10 designated [open quotes]mar del(10)[close quotes]. This marker is present together with two other marker chromosomes in the karyotype of a boy with mild developmental delay. It has a functional centromere at a primary constriction and is mitotically stable. Fluorescence in situ hybridization (FISH) using alpha-satellite and satellite III DNA as probes failed to detect any signal at the primary constriction site. CENP-B protein could not be demonstrated, although the presence of at least some centromeric proteins was confirmed using a CREST antiserum. Consideration of these and other cytogenetic and Fish results supports a mechanism of formation of the mar del(10) chromosome involving the activation of a latent intercalary centromere at 10q25. 33 refs., 6 figs.

  20. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  1. Detection of alpha particles using DNA/Al Schottky junctions

    NASA Astrophysics Data System (ADS)

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-09-01

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current-voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  2. Detection of alpha particles using DNA/Al Schottky junctions

    SciTech Connect

    Al-Ta'ii, Hassan Maktuff Jaber E-mail: vengadeshp@um.edu.my; Periasamy, Vengadesh E-mail: vengadeshp@um.edu.my; Amin, Yusoff Mohd

    2015-09-21

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current–voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  3. Mutation and recombination in cattle satellite DNA: a feedback model for the evolution of satellite DNA repeats.

    PubMed

    Nijman, I J; Lenstra, J A

    2001-04-01

    The cattle genome contains several distinct centromeric satellites with interrelated evolutionary histories. We compared these satellites in Bovini species that diverged 0.2 to about 5 Myr ago. Quantification of hybridization signals by phosphor imaging revealed a large variation in the relative amounts of the major satellites. In the genome of water buffalo this has led to the complete deletion of satellite III. Comparative sequencing and PCR-RFLP analysis of satellites IV, 1.711a, and 1.711b from the related Bos and Bison species revealed heterogeneities in 0.5 to 2% of the positions, again with variations in the relative amounts of sequence variants. Restriction patterns generated by double digestions suggested a recombination of sequence variants. Our results are compatible with a model of the life history of satellites during which homogeneity of interacting repeat units is both cause and consequence of the rapid turnover of satellite DNA. Initially, a positive feedback loop leads to a rapid saltatory amplification of homogeneous repeat units. In the second phase, mutations inhibit the interaction of repeat units and coexisting sequence variants amplify independently. Homogenization by the spreading of one of the variants is prevented by recombination and the satellite is eventually outcompeted by another, more homogeneous tandem repeat sequence. PMID:11343132

  4. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    SciTech Connect

    Kuzuhara, T. Suganuma, M.; Oka, K.; Fujiki, H.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.

  5. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  6. Human DNA polymerase. alpha. : Predicted functional domains and relationships with viral DNA polymerases

    SciTech Connect

    Wang, T.S.F.; Wong, S.W.; Korn, D. )

    1989-01-01

    The primary sequence of human DNA polymerase {alpha} deduced from the full-length cDNA contains regions of striking similarity to sequences in replicative DNA polymerases from Escherichia coli phages PRD1 and T4, Bacillus phage {phi}19, yeast DNA polymerase I, yeast linear plasmid pGKL1, maize S1 mitochondrial DNA, herpes family viruses, vaccinia virus, and adenovirus. The conservation of these homologous regions across this vast phylogenetic expanse indicates that these prokaryotic and eukaryotic DNA polymerases may all have evolved from a common primordial gene. Based on the sequence analysis and genetic results from yeast and herpes simplex virus studies, these consensus sequences are suggested to define potential sites that subserve essential roles in the DNA polymerase reaction. Two of these conserved regions appear to participate directly in the active site required for substrate deoxynucleotide interaction. One region toward the carboxyl-terminus has the potential to be the DNA interacting domain is predicted toward the amino-terminus. The provisional assignment of these domains can be used to identify unique or dissimilar features of functionally homologous catalytic sites in viral DBA polymerases of pathogenetic significance and thereby serve to guide more rational antiviral drug design.

  7. Cleavage patterns of Drosophila melanogaster satellite DNA by restriction enzymes.

    PubMed Central

    Shen, C J; Wiesehahn, G; Hearst, J E

    1976-01-01

    The five satellite DNAs of Drosophila melanogaster have been isolated by the combined use of different equilibrium density gradients and hydrolyzed by seven different restriction enzymes; Hae III, Hind II + Hind III, Hinf, Hpa II, EcoR I and EcoR II. The 1.705 satellite is not hydrolyzed by any of the enzymes tested. Hae III is the only restriction enzyme that cuts the 1.672 and 1.686 satellites. The cleavage products from either of these reactions has a heterogeneous size distribution. Part of the 1.688 satellite is cut by Hae III and by Hinf into three discrete fragments with M.W. that are multiples of 2.3 X 10(5) daltons (approximately 350 base pairs). In addition, two minor bands are detected in the 1.688-Hinf products. The mole ratios of the trimer, dimer and monomer are: 1:6.30 : 63.6 for 1.688-Hae III and 1 : 22.0 : 403 for 1.688-Hinf. Circular mitochondrial DNA (rho = 1.680) is cut into discrete fragments by all of the enzymes tested and molecular weights of these fragments have been determined. Images PMID:818625

  8. DNA polymorphisms and mutations of the tumor necrosis factor-alpha (TNF-alpha) promoter in Langerhans cell histiocytosis (LCH).

    PubMed

    Wu, W S; McClain, K L

    1997-10-01

    Langerhans cell histiocytosis (LCH) is a clonal proliferation of dendritic histiocytes expressing elevated levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1 (IL-1), and leukemia inhibitory factor (LIF). The cause of the increased cytokine levels is unknown, but DNA sequence changes in promoters could alter expression. The TNF-alpha and IFN-gamma promoter DNA sequences of 12 LCH patients were studied and compared with normal individuals by dideoxy fingerprinting and DNA sequencing. Functional consequences of polymorphic or mutated sequences were assessed by cloning altered and control promoter sequences into a luciferase reporter gene vector. Electrophoretic mobility shifts (EMSA) after binding of nuclear extracts from a macrophage cell line (U-937) by mutated promoters were compared with controls. Five of 12 LCH patients had alterations in the TNF-alpha promoter DNA sequence. None were found in the IFN-gamma gene promoter. Of the 5 with TNF-alpha DNA alterations, 2 were at position -308, which has been described as a G-A polymorphism associated with upregulation of TNF-alpha in some patients with infections or immune-mediated diseases. The polymorphism at -308 but not the other TNF-alpha promoter mutations caused a 3-fold to 7-fold increased production of the luciferase reporter gene. EMSA showed that the -308 mutant promoters bound fewer nuclear proteins than normals. Polymorphisms of the TNF-alpha promoter in LCH patients could increase the production of that cytokine. PMID:9355965

  9. Involvement of DNA polymerase alpha in host cell reactivation of UV-irradiated herpes simplex virus

    SciTech Connect

    Nishiyama, Y.; Yoshida, S.; Maeno, K.

    1984-02-01

    Aphidicolin is a potent inhibitor of both host cell DNA polymerase alpha and herpes simplex virus (HSV)-induced DNA polymerase but has no effect on DNA polymerases beta and gamma of host cells. By using an aphidicolin-resistant mutant (Aphr) of HSV, a possible involvement of DNA polymerase alpha in host cell reactivation of UV-damaged HSV was studied. Plaque formation by UV-irradiated Aphr was markedly inhibited by 1 microgram of aphidicolin per ml, which did not affect the plating efficiency of nonirradiated Aphr. Aphidicolin added before 12 h postinfection inhibited plaque formation by irradiated Aphr, which became aphidicolin insensitive after 36 h postinfection. The results strongly suggest that host cell DNA polymerase alpha is involved in the repair of UV-irradiated HSV DNA.

  10. Characterization and chromosome location of satellite DNA in the leaf beetle Chrysolina americana (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, P; Palomeque, T; Garnería, I; Petitpierre, E

    2000-01-01

    This paper is the first record of the satellite DNA of the specialized phytophagous genus Chrysolina. The satellite DNA of Chrysolina americana is organized in a tandem repeat of monomers 189 bp long, has a A + T content of 59.6% and presents direct and inverted internal repeats. Restriction analysis of the total DNA with methylation sensitive enzymes suggests that this repetitive DNA is undermethylated. In siti hybridization with a biotinylated probe of the satellite DNA showed the pericentromeric localization of these sequences in all meiotic bivalents. The presence of this repetitive DNA in other species of the genus was also tested by Southern analysis. The results showed that this satellite DNA sequence is specific to the C. americana genome and has not been found in three other species of Chrysolina with a different choice of host plants than in the former. PMID:11678504

  11. Molecular analysis of a deletion polymorphism in alpha satellite of human chromosome 17: evidence for homologous unequal crossing-over and subsequent fixation.

    PubMed Central

    Waye, J S; Willard, H F

    1986-01-01

    The human alpha satellite DNA family is organized into chromosome-specific subsets characterized by distinct higher-order repeats based on a approximately 171 basepair monomer unit. On human chromosome 17, the predominant form of alpha satellite is a 16-monomer (16-mer) higher-order repeat present in 500-1000 copies per chromosome 17. In addition, less abundant 15-monomer and 14-monomer repeats are also found constitutively on chromosome 17. Polymorphisms in the form of different higher-order repeat lengths have been described for this subset, the most prominent polymorphism being a 13-monomer (13-mer) higher-order repeat present on approximately 35% of all chromosomes 17. To investigate the nature of this polymorphism, we have cloned, sequenced and compared the relevant regions of the 13-mer to the previously characterized 16-mer repeat. The results show that the repeats are virtually identical, with the principal difference being the exclusion of three monomers from the 13-mer repeat. We propose that the 13-mer is the product of an isolated homologous recombination event between two monomers of the 16-mer repeat. Sequence comparisons reveal the approximate site of recombination and flanking regions of homology. This recombination site corresponds to a position within the alphoid monomer which has been previously implicated in an independent homologous recombination event, suggesting that there may exist a preferred register for recombination in alphoid DNA. We suggest that these events are representative of an ongoing process capable of reorganizing the satellite subset of a given chromosome, thereby contributing to the establishment of chromosome-specific alpha satellite subsets. Images PMID:3763396

  12. DNA polymerases alpha and gamma during pre-emergence and early larval development of Artemia.

    PubMed

    Slater, J M; McLennan, A G

    1982-12-15

    DNA polymerases alpha and gamma have been studied in cryptobiotic cysts and developing embryos and larvae of the brine shrimp Artemia. The two enzymes readily separate on Cibacron blue 3-GA Matrex gel. Assay requirements with activated DNA as primer-template are pH 8.0, 1 mM Mg2+, 50 mM K+ for DNA polymerase alpha and pH 8.4, 10 mM Mg2+, 80 mM K+ for DNA polymerase gamma. DNA polymerase alpha is inhibited by N-ethylmaleimide (94% and 100% at 1 mM and 10 mM respectively) and aphidicolin (96% at 60 microM). DNA polymerase gamma is also sensitive to N-ethylmaleimide (83% and 100% inhibition at 1 mM and 10 mM respectively) but is resistant to aphidicolin. 2',3'-Dideoxythymidine 5'-triphosphate (ddTTP) inhibits the gamma polymerase by 88% when in fivefold excess over dTTP whereas the alpha polymerase is unaffected by this compound. DNA polymerase alpha has a sedimentation coefficient of 7.6 S which is reduced to 6.2 S by a phenylmethylsulphonyl fluoride-sensitive proteinase. The gamma polymerase sediments at 8.3 S. No DNA polymerase beta activity could be detected. After the reinitiation of development both activities increased twofold up to 8 h (gamma polymerase) and 16 h (alpha polymerase), then declined before the onset of nuclear DNA replication after hatching. Thymidine kinase activity increased over 200-fold up to the time of replication. Analysis on Percoll density gradients of the intracellular distribution of both polymerases during development suggests that the changes in their activities may be due to migration from storage sites to replication complexes in the nuclei and mitochondria. The content of the mitochondrial DNA polymerase gamma in different batches of cysts may reflect the relative viabilities of the cysts. PMID:7151804

  13. Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

    PubMed Central

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa. PMID:23372772

  14. cDNA cloning and sequencing of rat alpha sub 1 -macroglobulin

    SciTech Connect

    Waermegaard, B.; Martin, N.; Johansson, S. )

    1992-03-03

    cDNA clones coding for the plasma protease inhibitor {alpha}{sub 1}-macroglobulin were isolated from a rat liver library. The obtained cDNA sequence contained 4701 nucleotides and had an open reading frame coding for a 1500 amino acid long protein, including a 24 amino acid signal peptide. The identity of the deduced protein sequence as {alpha}{sub 1}-macroglobulin was established by comparison with published peptide sequences of the protein. The mature protein shares 53% and 57% overall amino acid identity with the two other identified members of the rat {alpha}-macroglobulin family, {alpha}{sub 1}-inhibitor 3 and {alpha}{sub 2}-macroglobulin. A sequence typical for an internal thiol ester was identified. Of the 24 cysteines, 23 are conserved with {alpha}{sub 2}-macroglobulin. However, instead of the two most C-terminal cysteines in {alpha}{sub 2}-macroglobulin, which forms a disulfide bridge in the receptor binding domain, {alpha}{sub 1}-macroglobulin contains phenylalanine. One MRNA species hybridizing with the {alpha}{sub 1}-macroglobulin probe was observed in rat and mouse liver RNA ({approximately} 6.2 kb), whereas no corresponding transcript was detected in RNA from human liver.

  15. A novel nanometric DNA thin film as a sensor for alpha radiation

    NASA Astrophysics Data System (ADS)

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-06-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors.

  16. Organisation of nucleosomal arrays reconstituted with repetitive African green monkey α-satellite DNA as analysed by atomic force microscopy

    PubMed Central

    Bussiek, Malte; Müller, Gabriele; Waldeck, Waldemar; Diekmann, Stephan

    2007-01-01

    Alpha-satellite DNA (AS) is part of centromeric DNA and could be relevant for centromeric chromatin structure: its repetitive character may generate a specifically ordered nucleosomal arrangement and thereby facilitate kinetochore protein binding and chromatin condensation. Although nucleosomal positioning on some satellite sequences had been shown, including AS from African green monkey (AGM), the sequence-dependent nucleosomal organisation of repetitive AS of this species has so far not been analysed. We therefore studied the positioning of reconstituted nucleosomes on AGM AS tandemly repeated DNA. Enzymatic analysis of nucleosome arrays formed on an AS heptamer as well as the localisation of mononucleosomes on an AS dimer by atomic force microscopy (AFM) showed one major positioning frame, in agreement with earlier results. The occupancy of this site was in the range of 45–50%, in quite good agreement with published in vivo observations. AFM measurements of internucleosomal distances formed on the heptamer indicated that the nucleosomal arrangement is governed by sequence-specific DNA-histone interactions yielding defined internucleosomal distances, which, nevertheless, are not compatible with a uniform phasing of the nucleosomes with the AGM AS repeats. PMID:17503032

  17. Satellite DNA as a Driver of Population Divergence in the Red Flour Beetle Tribolium castaneum

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Brajković, Josip; Zlatar, Ivo; Ugarković, Đurđica

    2015-01-01

    Tandemly repeated satellite DNAs are among most rapidly evolving sequences in eukaryotic genome, usually differing significantly among closely related species. By inducing changes in heterochromatin and/or centromere, satellite DNAs are expected to drive population and species divergence. However, despite high evolutionary dynamics, divergence of satellite DNA profiles at the level of natural population which precedes and possibly triggers speciation process is not readily detected. Here, we characterize minor TCAST2 satellite DNA of the red flour beetle Tribolium castaneum and follow its dynamics among wild-type strains originating from diverse geographic locations. The investigation revealed presence of three distinct subfamilies of TCAST2 satellite DNA which differ in monomer size, genome organization, and subfamily specific mutations. Subfamilies Tcast2a and Tcast2b are tandemly arranged within pericentromeric heterochromatin whereas Tcast2c is preferentially dispersed within euchromatin of all chromosomes. Among strains, TCAST2 subfamilies are conserved in sequence but exhibit a significant content variability. This results in overrepresentation or almost complete absence of particular subfamily in some strains and enables discrimination between strains. It is proposed that homologous recombination, probably stimulated by environmental stress, is responsible for the emergence of TCAST2 satellite subfamilies, their copy number variation and dispersion within genome. The results represent the first evidence for the existence of population-specific satellite DNA profiles. Partial organization of TCAST2 satellite DNA in the form of single repeats dispersed within euchromatin additionally contributes to the genome divergence at the population level. PMID:25527837

  18. The p38alpha/beta MAPK functions as a molecular switch to activate the quiescent satellite cell.

    PubMed

    Jones, Nathan C; Tyner, Kristina J; Nibarger, Lisa; Stanley, Heather M; Cornelison, Dawn D W; Fedorov, Yuri V; Olwin, Bradley B

    2005-04-11

    Somatic stem cells cycle slowly or remain quiescent until required for tissue repair and maintenance. Upon muscle injury, stem cells that lie between the muscle fiber and basal lamina (satellite cells) are activated, proliferate, and eventually differentiate to repair the damaged muscle. Satellite cells in healthy muscle are quiescent, do not express MyoD family transcription factors or cell cycle regulatory genes and are insulated from the surrounding environment. Here, we report that the p38alpha/beta family of mitogen-activated protein kinases (MAPKs) reversibly regulates the quiescent state of the skeletal muscle satellite cell. Inhibition of p38alpha/beta MAPKs (a) promotes exit from the cell cycle, (b) prevents differentiation, and (c) insulates the cell from most external stimuli allowing the satellite cell to maintain a quiescent state. Activation of satellite cells and p38alpha/beta MAPKs occurs concomitantly, providing further support that these MAPKs function as a molecular switch for satellite cell activation. PMID:15824134

  19. Active heterodimers are formed from human DNA topoisomerase II alpha and II beta isoforms.

    PubMed Central

    Biersack, H; Jensen, S; Gromova, I; Nielsen, I S; Westergaard, O; Andersen, A H

    1996-01-01

    DNA topoisomerase II is a nuclear enzyme essential for chromosome dynamics and DNA metabolism. In mammalian cells, two genetically and biochemically distinct topoisomerase II forms exist, which are designated topoisomerase II alpha and topoisomerase II beta. In our studies of human topoisomerase II, we have found that a substantial fraction of the enzyme exists as alpha/beta heterodimers in HeLa cells. The ability to form heterodimers was verified when human topoisomerases II alpha and II beta were coexpressed in yeast and investigated in a dimerization assay. Analysis of purified heterodimers shows that these enzymes maintain topoisomerase II specific catalytic activities. The natural existence of an active heterodimeric subclass of topoisomerase II merits attention whenever topoisomerases II alpha and II beta function, localization, and cell cycle regulation are investigated. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8710863

  20. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  1. Activation of an Mg2+-dependent DNA endonuclease of avian myeloblastosis virus alpha beta DNA polymerase by in vitro proteolytic cleavage.

    PubMed Central

    Grandgenett, D P; Golomb, M; Vora, A C

    1980-01-01

    Partial chymotryptic digestion of purified avian myeloblastosis virus alpha beta DNA polymerase resulted in the activation of a Mg2+-dependent DNA endonuclease activity. Incubation of the polymerase-protease mixture in the presence of super-coiled DNA and Mg2+ permitted detection of the cleaved polymerase fragment possessing DNA nicking activity. Protease digestion conditions were established permitting selective cleavage of beta to alpha, which contained DNA polymerase and RNase H activity and to a family of polypeptides ranging in size from 30,000 to 34,000 daltons. These latter beta-unique fragments were purified by polyuridylate-Sepharose 4B chromatography and were shown to contain both DNA binding and DNA endonuclease activities. We have demonstrated that this group of polymerase fragments derived by chymotryptic digestion of alpha beta DNA polymerase is similar to the in vivo-isolated avian myeloblastosis virus p32pol in size, sequence, and DNA endonuclease activity. Images PMID:6154149

  2. Expression of human. alpha. sub 2 -macroglobulin cDNA in baby hamster kidney fibroblasts: Secretion of high levels of active. alpha. sub 2 -macroglobulin

    SciTech Connect

    Boel, E.; Mortensen, S.B. ); Kristensen, T.; Sottrup-Jensen, L. ); Petersen, C.M. )

    1990-05-01

    Human {alpha}{sub 2}-macroglobulin ({alpha}{sub 2}M) is a unique 720-kDa proteinase inhibitor with a broad specificity. Unlike most other proteinase inhibitors, it does not inhibit proteolytic activity by blocking the active site of the proteinase. During complex formation with a proteinase {alpha}{sub 2}M entraps the proteinase molecule in a reaction that involves large conformational changes in {alpha}{sub 2}M. The authors describe the molecular cloning of {alpha}{sub 2}M cDNA from the human hepatoblastoma cell line HepG2. The cDNA was subcloned under control of the adenovirus major late promoter in a mammalian expression vector and introduced into the baby hamster kidney (BHK) cell line. Transformed clones were isolated and tested for production of human {alpha}{sub 2}M with a specific enzyme-linked immunosorbent assay. Human recombinant {alpha}{sub 2}M (r{alpha}{sub 2}M), secreted and purified form isolated transfected BHK cell lines, was structurally and functionally compared to {alpha}{sub 2}M purified from human serum. The results show that r{alpha}{sub 2}M was secreted from the BHK cells as an active proteinase-binding tetramer with functional thiol esters. Cleavage reactions of r{alpha}{sub 2}M with methylamine and trypsin showed that the recombinant product, which was correctly processed at the N-terminus, exhibited molecular characteristics similar to those of the human serum derived reference.

  3. The CHH motif in sugar beet satellite DNA: a modulator for cytosine methylation.

    PubMed

    Zakrzewski, Falk; Schubert, Veit; Viehoever, Prisca; Minoche, André E; Dohm, Juliane C; Himmelbauer, Heinz; Weisshaar, Bernd; Schmidt, Thomas

    2014-06-01

    Methylation of DNA is important for the epigenetic silencing of repetitive DNA in plant genomes. Knowledge about the cytosine methylation status of satellite DNAs, a major class of repetitive DNA, is scarce. One reason for this is that arrays of tandemly arranged sequences are usually collapsed in next-generation sequencing assemblies. We applied strategies to overcome this limitation and quantified the level of cytosine methylation and its pattern in three satellite families of sugar beet (Beta vulgaris) which differ in their abundance, chromosomal localization and monomer size. We visualized methylation levels along pachytene chromosomes with respect to small satellite loci at maximum resolution using chromosome-wide fluorescent in situ hybridization complemented with immunostaining and super-resolution microscopy. Only reduced methylation of many satellite arrays was obtained. To investigate methylation at the nucleotide level we performed bisulfite sequencing of 1569 satellite sequences. We found that the level of methylation of cytosine strongly depends on the sequence context: cytosines in the CHH motif show lower methylation (44-52%), while CG and CHG motifs are more strongly methylated. This affects the overall methylation of satellite sequences because CHH occurs frequently while CG and CHG are rare or even absent in the satellite arrays investigated. Evidently, CHH is the major target for modulation of the cytosine methylation level of adjacent monomers within individual arrays and contributes to their epigenetic function. This strongly indicates that asymmetric cytosine methylation plays a role in the epigenetic modification of satellite repeats in plant genomes. PMID:24661787

  4. Isolation and characterization of human cDNA clones encoding the. alpha. and the. alpha. prime subunits of casein kinase II

    SciTech Connect

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs E.G. )

    1990-09-11

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two {alpha} or {alpha}{prime} subunits (or one of each) and two {beta} subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell {lambda}gt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5{prime} untranslated region) and followed by 871 bp (3{prime} untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5{prime} untranslated region) and followed by 550 bp (3{prime} untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of {alpha} and {alpha}{prime} subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the {alpha} and {alpha}{prime} subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II ({alpha} and {alpha}{prime}) and that the sequence of these subunits is largely conserved between the bovine and the human.

  5. A role for DNA polymerase alpha in epigenetic control of transcriptional silencing in fission yeast.

    PubMed

    Nakayama Ji; Allshire, R C; Klar, A J; Grewal, S I

    2001-06-01

    In the fission yeast Schizosaccharomyces pombe, transcriptional silencing at the mating-type region, centromeres and telomeres is epigenetically controlled, and results from the assembly of higher order chromatin structures. Chromatin proteins associated with these silenced loci are believed to serve as molecular bookmarks that help promote inheritance of the silenced state during cell division. Specifically, a chromodomain protein Swi6 is believed to be an important determinant of the epigenetic imprint. Here, we show that a mutation in DNA polymerase alpha (pol(alpha)) affects Swi6 localization at the mating-type region and causes a 45-fold increase in spontaneous transition from the silenced epigenetic state to the expressed state. We also demonstrate that pol(alpha) mutant cells are defective in Swi6 localization at centromeres and telomeres. Genetic analysis suggests that Polalpha and Swi6 are part of the same silencing pathway. Interestingly, we found that Swi6 directly binds to Pol(alpha) in vitro. Moreover, silencing-defective mutant Pol(alpha) displays reduced binding to Swi6 protein. This work indicates involvement of a DNA replication protein, Pol(alpha), in heterochromatin assembly and inheritance of epigenetic chromatin structures. PMID:11387218

  6. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    PubMed Central

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  7. High-throughput analysis of the satellitome illuminates satellite DNA evolution.

    PubMed

    Ruiz-Ruano, Francisco J; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term "satellitome" for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  8. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    NASA Astrophysics Data System (ADS)

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-07-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings.

  9. Functionalized 2'-amino-alpha-L-LNA: directed positioning of intercalators for DNA targeting.

    PubMed

    Kumar, T Santhosh; Madsen, Andreas S; Østergaard, Michael E; Sau, Sujay P; Wengel, Jesper; Hrdlicka, Patrick J

    2009-02-01

    Chemically modified oligonucleotides are increasingly applied in nucleic acid based therapeutics and diagnostics. LNA (locked nucleic acid) and its diastereomer alpha-L-LNA are two promising examples thereof that exhibit increased thermal and enzymatic stability. Herein, the synthesis, biophysical characterization, and molecular modeling of N2'-functionalized 2'-amino-alpha-L-LNA is described. Chemoselective N2'-functionalization of protected amino alcohol 1 followed by phosphitylation afforded a structurally varied set of target phosphoramidites, which were incorporated into oligodeoxyribonucleotides. Incorporation of pyrene-functionalized building blocks such as 2'-N-(pyren-1-yl)carbonyl-2'-amino-alpha-L-LNA (monomer X) led to extraordinary increases in thermal affinity of up to +19.5 degrees C per modification against DNA targets in particular. In contrast, incorporation of building blocks with small nonaromatic N2'-functionalities such as 2'-N-acetyl-2'-amino-alpha-L-LNA (monomer V) had detrimental effects on thermal affinity toward DNA/RNA complements with decreases of as much as -16.5 degrees C per modification. Extensive thermal DNA selectivity, favorable entropic contributions upon duplex formation, hybridization-induced bathochromic shifts of pyrene absorption maxima and increases in circular dichroism signal intensity, and molecular modeling studies suggest that pyrene-functionalized 2'-amino-alpha-L-LNA monomers W-Y having short linkers between the bicyclic skeleton and the pyrene moiety allow high-affinity hybridization with DNA complements and precise positioning of intercalators in nucleic acid duplexes. This rigorous positional control has been utilized for the development of probes for emerging therapeutic and diagnostic applications focusing on DNA targeting. PMID:19108636

  10. A novel subviral agent associated with a geminivirus: the first report of a DNA satellite.

    PubMed

    Dry, I B; Krake, L R; Rigden, J E; Rezaian, M A

    1997-06-24

    Numerous plant RNA viruses have associated with them satellite (sat) RNAs that have little or no nucleotide sequence similarity to either the viral or host genomes but are completely dependent on the helper virus for replication. We report here on the discovery of a 682-nt circular DNA satellite associated with tomato leaf curl geminivirus (TLCV) infection in northern Australia. This is the first demonstration that satellite molecules are not limited to RNA viral systems. The DNA satellite (TLCV sat-DNA) is strictly dependent for replication on the helper virus replication-associated protein and is encapsidated by TLCV coat protein. It has no significant open reading frames, and it shows no significant sequence similarity to the 2766-nt helper-virus genome except for two short motifs present in separate putative stem-loop structures: TAATATTAC, which is universally conserved in all geminiviruses, and AATCGGTGTC, which is identical to a putative replication-associated protein binding motif in TLCV. Replication of TLCV sat-DNA is also supported by other taxonomically distinct geminiviruses, including tomato yellow leaf curl virus, African cassava mosaic virus, and beet curly top virus. Therefore, this unique DNA satellite does not appear to strictly conform with the requirements that dictate the specificity of interaction of geminiviral replication-associated proteins with their cognate origins as predicted by the current model of geminivirus replication. PMID:9192696

  11. Organization of highly repetitive satellite DNA of two Cucurbitaceae species (Cucumis melo and Cucumis sativus).

    PubMed Central

    Hemleben, V; Leweke, B; Roth, A; Stadler, J

    1982-01-01

    The prominent satellites of the Cucurbitaceae Cucumis melo (melon) and Cucumis sativus (cucumber) have been characterized, in actinomycin/CsCl gradients where the satellite sequences can be separated from ribosomal, organelle, and main band DNA the location of the satellites is different indicating a different GC content. The purified satellite of C. melo is cut by HindIII into a repeat unit of 380 bp; AluI digestion gives rise to two bands (about 80 and 220 bp in size). The HindIII repeat unit if cloned into pBR325 exhibits new recognition sites for HpaII leaving two bands with 150 and 80 bp suggesting methylation of the C/CGG cutting site in the uncloned material. The restriction pattern indicates an internal sequence repeat within the 380 bp HindIII fragment. The C. sativus satellite is cut by AluI to a repeat unit of 180 bp showing no other recognition site for the restriction enzymes tested so far. About 10% sequence homology has been determined between the C. melo and C. sativus satellites by cross hybridization studies. A high methylation degree of cytosines has been measured for both satellites and the ribosomal DNA of C. sativus (about 30%). No transcription products of the C. melo satellite were found during seedling development. Images PMID:6278425

  12. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    PubMed Central

    Martins-Pinheiro, Marinalva; Marques, Regina CP; Menck, Carlos FM

    2007-01-01

    Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA), endonuclease III (nth), O6-methylguanine-DNA methyltransferase (ada gene), photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular aspects of the C. crescentus

  13. Inhibition of DNA topoisomerase II alpha gene expression by the p53 tumor suppressor.

    PubMed Central

    Wang, Q; Zambetti, G P; Suttle, D P

    1997-01-01

    DNA topoisomerase II (topo II) is an essential nuclear enzyme involved in major cellular functions such as DNA replication, transcription, recombination, and mitosis. While an elevated level of topo II alpha is associated with cell proliferation, wild-type (wt) p53 inhibits the expression of various growth-stimulatory genes. To determine if p53 downregulates topo II alpha gene expression, a murine cell line, (10)1val, that expresses a temperature-sensitive p53 was utilized. The (10)1val cells had significantly lower levels of topo II alpha mRNA and protein following incubation for 24 h at 32 degrees C (p53 with wt conformation) than at 39 degrees C (p53 with mutant conformation). The effect of p53 on the human topo II alpha gene promoter was determined by using luciferase reporter plasmids containing varying lengths of the topo II alpha promoter transiently cotransfected into p53-deficient (10)1 cells together with wt or mutant p53 expression plasmids. Transcription from the full-length (bp -557 to +90) topo II alpha promoter was decreased 15-fold by wt p53 in a concentration-dependent manner, whereas mutant p53 exerted much weaker inhibition. Consecutive deletion of the five inverted CCAAT elements (ICEs) from the topo II alpha promoter reduced both the basal promoter activity and wt p53-induced suppression. Transcription of the minimal promoter (-32 to +90), which contains no ICE, was slightly stimulated by wt or mutant p53 expression. When point mutations were introduced into the most proximal ICE (-68), the inhibitory effect of wt p53 was alleviated and stimulation of topo II alpha expression resulted. Our study suggests that wt p53 functions as a transcriptional repressor of topo II alpha gene expression, possibly through a functional interaction with specific ICEs. Inactivation of wt p53 may reduce normal regulatory suppression of topo II alpha and contribute to abortive cell cycle checkpoints, accelerated cell proliferation, and alterations in genomic

  14. Satellites

    SciTech Connect

    Burns, J.A.; Matthews, M.S.

    1986-01-01

    The present work is based on a conference: Natural Satellites, Colloquium 77 of the IAU, held at Cornell University from July 5 to 9, 1983. Attention is given to the background and origins of satellites, protosatellite swarms, the tectonics of icy satellites, the physical characteristics of satellite surfaces, and the interactions of planetary magnetospheres with icy satellite surfaces. Other topics include the surface composition of natural satellites, the cratering of planetary satellites, the moon, Io, and Europa. Consideration is also given to Ganymede and Callisto, the satellites of Saturn, small satellites, satellites of Uranus and Neptune, and the Pluto-Charon system.

  15. Flavonoid glycoside: a new inhibitor of eukaryotic DNA polymerase alpha and a new carrier for inhibitor-affinity chromatography.

    PubMed

    Mizushina, Yoshiyuki; Ishidoh, Tomomi; Kamisuki, Shinji; Nakazawa, Satoshi; Takemura, Masaharu; Sugawara, Fumio; Yoshida, Hiromi; Sakaguchi, Kengo

    2003-02-01

    Two flavonoid glycosides, kaempferol 3-O-(6"-acetyl)-beta-glucopyranoside (KAG) and quercetin 3-O-(6"-acetyl)-beta-glucopyranoside (QAG), were found to be inhibitors of eukaryotic DNA polymerases from a Japanese vegetable, Petasites japonicus. These compounds inhibited the activities of mammalian replicative DNA polymerases (i.e., pol alpha, delta, and epsilon), but not other pol beta, eta, kappa, and lambda activities. KAG was a stronger inhibitor and more selective to pol alpha than QAG. The IC(50) values of KAG for pol alpha, delta, and epsilon were 41, 164, and 127 microM, respectively. The pol alpha inhibition by KAG was non-competitive with respect to both the DNA template-primer and the dNTP substrate. KAG and QAG did not influence the activities of prokaryotic DNA polymerases or other mammalian DNA metabolic enzymes such as human immunodeficiency virus type 1 reverse transcriptase, human telomerase, human DNA topoisomerase I and II, T7 RNA polymerase, and bovine deoxyribonuclease I. Therefore, we concluded that these flavonoid glycosides are moderate replicative DNA polymerase inhibitors leaning more relatively to pol alpha, and could be used as chromatographic carriers to purify the DNA polymerases rather than cytotoxic agents. We then made a KAG-conjugated column such as the epoxy-activated Sepharose 6B. In the column, pol alpha was selectively adsorbed and eluted. PMID:12565887

  16. Replicating satellite RNA induces sequence-specific DNA methylation and truncated transcripts in plants.

    PubMed Central

    Wang, M B; Wesley, S V; Finnegan, E J; Smith, N A; Waterhouse, P M

    2001-01-01

    Tobacco plants were transformed with a chimeric transgene comprising sequences encoding beta-glucuronidase (GUS) and the satellite RNA (satRNA) of cereal yellow dwarf luteovirus. When transgenic plants were infected with potato leafroll luteovirus (PLRV), which replicated the transgene-derived satRNA to a high level, the satellite sequence of the GUS:Sat transgene became densely methylated. Within the satellite region, all 86 cytosines in the upper strand and 73 of the 75 cytosines in the lower strand were either partially or fully methylated. In contrast, very low levels of DNA methylation were detected in the satellite sequence of the transgene in uninfected plants and in the flanking nonsatellite sequences in both infected and uninfected plants. Substantial amounts of truncated GUS:Sat RNA accumulated in the satRNA-replicating plants, and most of the molecules terminated at nucleotides within the first 60 bp of the satellite sequence. Whereas this RNA truncation was associated with high levels of satRNA replication, it appeared to be independent of the levels of DNA methylation in the satellite sequence, suggesting that it is not caused by methylation. All the sequenced GUS:Sat DNA molecules were hypermethylated in plants with replicating satRNA despite the phloem restriction of the helper PLRV. Also, small, sense and antisense approximately 22 nt RNAs, derived from the satRNA, were associated with the replicating satellite. These results suggest that the sequence-specific DNA methylation spread into cells in which no satRNA replication occurred and that this was mediated by the spread of unamplified satRNA and/or its associated 22 nt RNA molecules. PMID:11214177

  17. An unusual polyanion from Physarum polycephalum that inhibits homologous DNA polymerase. alpha. in vitro

    SciTech Connect

    Fischer, H.; Erdmann, S.; Holler, E. )

    1989-06-13

    From extracts of microplasmodia of Physarum polycephalum and their culture medium, an unusual substance was isolated which inhibited homologous DNA polymerase {alpha} of this slime mold but not {beta}-like DNA polymerase and not heterologous DNA polymerases. Analysis, especially NMR spectroscopy, revealed the major component to be an anionic polyester of L-malic acid and the inhibition to be due to poly(L-malate) in binding reversibly to DNA polymerase {alpha}. The mode of inhibition is competitive with substrate DNA and follows an inhibition constant K{sub i} = 10 ng/mL. Inhibition is reversed in the presence of spermine, spermidine, poly(ethylene imine), and calf thymus histone H1. According to its ester nature, the inhibitor is slightly labile at neutral and instable at acid and alkaline conditions. Its largest size corresponds to a molecular mass of 40-50 kDa, but the bulk of the material after purification has lower molecular masses. The inhibitory activity depends on the polymer size and has a minimal size requirement.

  18. Characterization of two unrelated satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, Pedro; Torres, M Isabel; Palomeque, Teresa

    2013-10-01

    The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae),a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and egg plants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle’s genome,including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109bp in length, named LEDE-I and LEDE-II, respectively.Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitoticnuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes. PMID:23448367

  19. Guidelines for internal validation of the HLA-DQ alpha DNA typing system.

    PubMed

    Wilson, R B; Ferrara, J L; Baum, H J; Shaler, R C

    1994-05-25

    Validation experiments were performed to evaluate the HLA-DQ alpha DNA typing system for forensic casework. Temperature profiles for two Perkin Elmer TC-1 Thermal Cyclers were measured, and the efficiency of the instruments was tested by amplifying a control sample (DQ alpha 1.2,4) susceptible to allelic drop-out. DNA extraction using chelex was compared to non-organic extraction, and the amplification and hybridization procedures were evaluated at extremes of time and temperature. With the protocol in place, samples exposed to stresses commonly encountered in forensic casework were typed to determine the flexibility of the system. Mixed samples of two different bloods and blood mixed with saliva were typed to determine the threshold at which mixtures could be resolved using the reverse dot blot method. Different storage conditions were evaluated using a set of control bloodstrains, and a set of 12 postmortem blood samples was typed repeatedly over the course of 5 months to determine the effects of natural degradation on the DQ alpha results. Finally, casework stains on a variety of substrates were typed. These experiments demonstrate the flexibility of the HLA-DQ alpha system. Based upon these results, a comprehensive quality assurance program was developed to ensure the integrity of typing results for casework. PMID:7927091

  20. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0–20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung’s and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung’s methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  1. Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase {alpha}

    SciTech Connect

    Maeda, Naoki; Kokai, Yasuo; Ohtani, Seiji; Sahara, Hiroeki; Kuriyama, Isoko; Kamisuki, Shinji; Takahashi, Shunya; Sakaguchi, Kengo; Sugawara, Fumio; Yoshida, Hiromi; Sato, Noriyuki; Mizushina, Yoshiyuki . E-mail: mizushin@nutr.kobegakuin.ac.jp

    2007-01-12

    In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol {alpha} from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol {alpha} with IC{sub 50} value of 0.5 {mu}M, and did not influence the activities of other replicative pols such as pols {delta} and {epsilon}, but also showed no effect on pol {alpha} activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD{sub 50} values of 38.0-44.4 {mu}M. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol {alpha}-specific inhibitor, but also as a candidate drug for anti-cancer treatment.

  2. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0-20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung's and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung's methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  3. Functional association of poly(ADP-ribose) polymerase with DNA polymerase alpha-primase complex: a link between DNA strand break detection and DNA replication.

    PubMed Central

    Dantzer, F; Nasheuer, H P; Vonesch, J L; de Murcia, G; Ménissier-de Murcia, J

    1998-01-01

    Poly(ADP-ribose) polymerase (PARP) is an element of the DNA damage surveillance network evolved by eukaryotic cells to cope with numerous environmental and endogenous genotoxic agents. PARP has been found to be involved in vivo in both cell proliferation and base excision repair of DNA. In this study the interaction between PARP and the DNA polymerase alpha-primase tetramer has been examined. We provide evidence that in proliferating cells: (i) PARP is physically associated with the catalytic subunit of the DNA polymerase alpha-primase tetramer, an association confirmed by confocal microscopy, demonstrating that both enzymes are co-localized at the nuclear periphery of HeLa cells; (ii) this interaction requires the integrity of the second zinc finger of PARP and is maximal during the S and G2/M phases of the cell cycle; (iii) PARP-deficient cells derived from PARP knock-out mice exhibited reduced DNA polymerase activity, compared with the parental cells, a reduction accentuated following exposure to sublethal doses of methylmethanesulfonate. Altogether, the present results strongly suggest that PARP participates in a DNA damage survey mechanism implying its nick-sensor function as part of the control of replication fork progression when breaks are present in the template. PMID:9518481

  4. Phylogenetic relationships and the primitive X chromosome inferred from chromosomal and satellite DNA analysis in Bovidae.

    PubMed

    Chaves, Raquel; Guedes-Pinto, Henrique; Heslop-Harrison, John S

    2005-10-01

    The early phylogeny of the 137 species in the Bovidae family is difficult to resolve; knowledge of the evolution and relationships of the tribes would facilitate comparative mapping, understanding chromosomal evolution patterns and perhaps assist breeding and domestication strategies. We found that the study of the presence and organization of two repetitive DNA satellite sequences (the clone pOaKB9 from sheep, a member of the 1.714 satellite I family and the pBtKB5, a 1.715 satellite I clone from cattle) on the X and autosomal chromosomes by in situ hybridization to chromosomes from 15 species of seven tribes, was informative. The results support a consistent phylogeny, suggesting that the primitive form of the X chromosome is acrocentric, and has satellite I sequences at its centromere. Because of the distribution of the ancient satellite I sequence, the X chromosome from the extant Tragelaphini (e.g. oryx), rather than Caprini (sheep), line is most primitive. The Bovini (cow) and Tragelaphini tribes lack the 1.714 satellite present in the other tribes, and this satellite is evolutionarily younger than the 1.715 sequence, with absence of the 1.714 sequence being a marker for the Bovini and Tragelaphini tribes (the Bovinae subfamily). In the other tribes, three (Reduncini, Hippotragini and Aepycerotini) have both 1.714 and 1.715 satellite sequences present on both autosomes and the X chromosome. We suggest a parallel event in two lineages, leading to X chromosomes with the loss of 1.715 satellite from the Bovini, and the loss of both 1.714 and 1.715 satellites in a monophyletic Caprini and Alcelaphini lineage. The presence and X chromosome distribution of these satellite sequences allow the seven tribes to be distributed to four groups, which are consistent with current diversity estimates, and support one model to resolve points of separation of the tribes. PMID:16191610

  5. Fabry disease: isolation of a cDNA clone encoding human alpha-galactosidase A.

    PubMed Central

    Calhoun, D H; Bishop, D F; Bernstein, H S; Quinn, M; Hantzopoulos, P; Desnick, R J

    1985-01-01

    Fabry disease is an X-linked inborn error of metabolism resulting from the deficient activity of the lysosomal hydrolase, alpha-galactosidase A (alpha-Gal A; alpha-D-galactoside galactohydrolase, EC 3.2.1.22). To investigate the structure, organization, and expression of alpha-Gal A, as well as the nature of mutations in Fabry disease, a clone encoding human alpha-Gal A was isolated from a lambda gt11 human liver cDNA expression library. To facilitate screening, an improved affinity purification procedure was used to obtain sufficient homogeneous enzyme for production of monospecific antibodies and for amino-terminal and peptide microsequencing. On the basis of an amino-terminal sequence of 24 residues, two sets of oligonucleotide mixtures were synthesized corresponding to adjacent, but not overlapping, amino acid sequences. In addition, an oligonucleotide mixture was synthesized based on a sequence derived from an alpha-Gal A internal tryptic peptide isolated by reversed-phase HPLC. Four positive clones were initially identified by antibody screening of 1.4 X 10(7) plaques. Of these, only one clone (designated lambda AG18) demonstrated both antibody binding specificity by competition studies using homogeneous enzyme and specific hybridization to synthetic oligonucleotide mixtures corresponding to amino-terminal and internal amino acid sequences. Nucleotide sequencing of the 5' end of the 1250-base-pair EcoRI insert of clone lambda AG18 revealed an exact correspondence between the predicted and known amino-terminal amino acid sequence. The insert of clone lambda AG18 appears to contain the full-length coding region of the processed, enzymatically active alpha-Gal A, as well as sequences coding for five amino acids of the amino-terminal propeptide, which is posttranslationally cleaved during enzyme maturation. Images PMID:2997789

  6. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    PubMed Central

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  7. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison.

    PubMed

    Kato, Mikio

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  8. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    SciTech Connect

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-09-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence.

  9. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-01-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  10. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  11. Biochemical properties of the stimulatory activity of DNA polymerase alpha by the hyper-phosphorylated retinoblastoma protein.

    PubMed

    Takemura, Masaharu

    2002-06-01

    Previously, my colleagues and I have reported that the immunopurified hyper-phosphorylated retinoblastoma protein (ppRb) stimulates the activity of DNA polymerase alpha. I describe here the biochemical characteristics of this stimulatory activity. DNA polymerase alpha-stimulatory activity of ppRb was most remarkable when using activated DNA as a template-primer, rather than using poly(dT)-(rA)(10), poly(dA)-(dT)(12-18), and so on. Kinetic analysis showed that there was no significant difference in K(m) value for deoxyribonucleotides of DNA polymerase alpha in the presence of ppRb. Adding ppRb resulted in the overcoming pause site on the template, but did not affect the rate of misincorporation of incorrect deoxyribonucleotides. By adding ppRb, the optimal concentration of template-primer was shifted to a higher region, but not using M13 singly primed DNA. The ppRb seemed to assist the process that DNA polymerase alpha changed its conformation resulting in appropriate enzyme activity. These results suggest that ppRb affects both template-primer and DNA polymerase alpha and makes appropriate circumstances for the enzyme reaction. PMID:12049795

  12. Synthesis of DNA containing the simian virus 40 origin of replication by the combined action of DNA polymerases alpha and delta.

    PubMed Central

    Lee, S H; Eki, T; Hurwitz, J

    1989-01-01

    Proliferating-cell nuclear antigen (PCNA) mediates the replication of simian virus 40 (SV40) DNA by reversing the effects of a protein that inhibits the elongation reaction. Two other protein fractions, activator I and activator II, were also shown to play important roles in this process. We report that activator II isolated from HeLa cell extracts is a PCNA-dependent DNA polymerase delta that is required for efficient replication of DNA containing the SV40 origin of replication. PCNA-dependent DNA polymerase delta on a DNA singly primed phi X174 single-stranded circular DNA template required PCNA, a complex of the elongation inhibitor and activator I, and the single-stranded DNA-binding protein essential for SV40 DNA replication. DNA polymerase delta, in contrast to DNA polymerase alpha, hardly used RNA-primed DNA templates. These results indicate that both DNA polymerase alpha and delta are involved in SV40 DNA replication in vitro and their activity depends on PCNA, the elongation inhibitor, and activator I. Images PMID:2571990

  13. Satellite DNA from the brine shrimp Artemia affects the expression of a flanking gene in yeast.

    PubMed

    Maiorano, D; Cece, R; Badaracco, G

    1997-04-11

    We have previously revealed that in the brine shrimp Artemia franciscana an AluI DNA family of repeats, 113 bp in length, is the major component of the constitutive heterochromatin and that this repetitive DNA shows a stable curvature that confers a solenoidal geometry on the double helix in vitro. It was suggested that this particular structure may play a relevant role in determining the condensation of the heterochromatin. In this report we have cloned hexamers of highly-repetitive sequence (AluI-satellite DNA) in proximity to a yeast lacZ reporter gene on a plasmid. We find that the expression of the reporter gene is affected by the presence of this DNA in a dose- and orientation-dependent manner in the yeast, S. cerevisiae. We show that this effect is not dependent on under-replication or re-arrangements of the repetitive DNA in the cell but is due to decreased expression of the reporter gene. Our results indicate that the AluI-satellite DNA of Artemia per se is able to influence gene expression. PMID:9161405

  14. Insights on genome size evolution from a miniature inverted repeat transposon driving a satellite DNA.

    PubMed

    Scalvenzi, Thibault; Pollet, Nicolas

    2014-12-01

    The genome size in eukaryotes does not correlate well with the number of genes they contain. We can observe this so-called C-value paradox in amphibian species. By analyzing an amphibian genome we asked how repetitive DNA can impact genome size and architecture. We describe here our discovery of a Tc1/mariner miniature inverted-repeat transposon family present in Xenopus frogs. These transposons named miDNA4 are unique since they contain a satellite DNA motif. We found that miDNA4 measured 331 bp, contained 25 bp long inverted terminal repeat sequences and a sequence motif of 119 bp present as a unique copy or as an array of 2-47 copies. We characterized the structure, dynamics, impact and evolution of the miDNA4 family and its satellite DNA in Xenopus frog genomes. This led us to propose a model for the evolution of these two repeated sequences and how they can synergize to increase genome size. PMID:25193611

  15. Is Radon Emission in Caves Causing Deletions in Satellite DNA Sequences of Cave-Dwelling Crickets?

    PubMed Central

    Allegrucci, Giuliana; Sbordoni, Valerio; Cesaroni, Donatella

    2015-01-01

    The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae) sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA). Radon concentration in the analyzed caves ranged from 221 to 26000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration. PMID:25822625

  16. Unusual chromosomal distribution of a major satellite DNA from Discoglossus pictus (Amphibia, Anura).

    PubMed

    Amor, N; Odierna, G; Chinali, G; Said, K; Picariello, O

    2009-01-01

    A new highly abundant satellite DNA from Discoglossus pictus (Dp-sat1) was isolated and characterized. The repetitive unit (0.51 kb) has 2 HindIII sites and only one SpeI site: digestion of genomic DNA with HindIII produces 3 fragments: HA (0.17 kb), HB (0.34 kb), and HC = HA + HB (0.51 kb), while digestion with SpeI produces the whole repetitive unit (0.51 kb) that contains both HindIII sites. Sequence analysis of cloned repeats indicates an average A + T content of 71%, with many A- and T-runs. Southern blot analysis shows an arrangement of multiple bands of the 0.51 kb monomer in SpeI-digested DNA, while HindIII-digested DNA shows a ladder composed of all the possible combinations of the 3 digested fragments. Quantitative dot-blot indicates that Dp-sat1 accounts for about 6% of the D. pictus genome: this value represents about 1.5 x 10(6) copies of repetitive units per nucleus. This satellite DNA is also a major repetitive DNA in 4 other Discoglossus species, in which the repetitive unit presents the same size and restriction sites except in D. montalentii where it contains a unique HindIII site. This satellite DNA was absent in all the other tested archaeo- and neo-bratrachian species, as well as non-amphibian species. Fluorescent in situ hybridization (FISH) analysis shows that Dp-sat1 is localized only in peri- and/or para-centromeric areas of the 7 small chromosome pairs, while no labeling was observed in the 7 large chromosome pairs. Remarkably, Dp-sat1 heterochromatin is found only at one pole of the nucleus, suggesting that during interphase all 7 small chromosome pairs are located in the same nuclear region. PMID:20110657

  17. Cloning and expression of a human kidney cDNA for an /alpha//sub 2/-adrenergic receptor subtype

    SciTech Connect

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-09-01

    An /alpha//sub 2/-adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet /alpha//sub 2/-adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet /alpha//sub 2/-adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the /alpha//sub 2/-adrenergic ligand (/sup 3/H)rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the /alpha//sub 2/B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet /alpha//sub 2/-adrenergic receptor (/alpha//sub 2/A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective /alpha/-adrenergic ligands.

  18. Sanfilippo syndrome type B: cDNA and gene encoding human {alpha}-N-acetylglucosaminidase

    SciTech Connect

    Zhao, H.G.; Lopez, R.; Rennecker, J.

    1994-09-01

    Deficiency of the lysosomal enzyme {alpha}-N-acetlyglucosaminidase underlies the type B Sanfilippo syndrome (MPS III B), a mucopolysaccharide storage disease with profound neurologic deterioration. We are acquiring tools to study the molecular basis of the disorder. The enzyme was purified from bovine testis; after ConA-, DEAE- and phenyl-Sepharose chromatography, it was subjected to SDS-PAGE without preheating. Of two bands of activity detected on the gel, 170 kDa and 87 kDa, the larger one, which coincided with a well-defined Coomassie blue band, was selected for sequence analysis. Degenerate 17-base oligonucleotides, corresponding to the ends of an internal 23 amino acid sequence, were used for RT-PCR of RNA from human fibroblasts. A 41-mer was synthesized from the sequence of the RT-PCR product and used to screen a human testis cDNA library. A number of cDNA inserts were isolated, all lacking the 5{prime} end and none longer than 1.7 kb. An additional 300 bp segment has been obtained by RACE. The cDNA sequence accounts for 9 of 11 peptides, allowing for species difference. Northern analysis of fibroblast RNA with a 1.5 kb cDNA probe showed the presence of a 3 kb mRNA; marked deficiency of this mRNA in two MPS III B fibroblast lines confirmed the authenticity of the cloned cDNA. While no homologous amino acid sequence has been found in a search of GenBank, the nucleotide sequence (interrupted by 4 introns) is present in a flanking region upstream of an unrelated gene on chromosome 17q11-21 (human 17{beta}-hydroxysteroid dehydrogenase). This must therefore be the chromosomal locus of the {alpha}-N-acetylglucosaminidase gene and of MPS III B.

  19. Differential spreading of HinfI satellite DNA variants during radiation in Centaureinae

    PubMed Central

    Quesada del Bosque, María Ester; López-Flores, Inmaculada; Suárez-Santiago, Víctor N.; Garrido-Ramos, Manuel A.

    2013-01-01

    Background and Aims Subtribe Centaureinae appears to be an excellent model group in which to analyse satellite DNA and assess the influence that the biology and/or the evolution of different lineages have had on the evolution of this class of repetitive DNA. Phylogenetic analyses of Centaureinae support two main phases of radiation, leading to two major groups of genera of different ages. Furthermore, different modes of evolution are observed in different lineages, reflected by morphology and DNA sequences. Methods The sequences of 502 repeat units of the HinfI satellite DNA family from 38 species belonging to ten genera of Centaureinae were isolated and compared. A phylogenetic reconstruction was carried out by maximum likelihood and Bayesian inference. Key Results Up to eight different HinfI subfamilies were found, based on the presence of a set of diagnostic positions given by a specific mutation shared by all the sequences of one group. Subfamilies V–VIII were mostly found in older genera (first phase of radiation in the subtribe, late Oligocene–Miocene), although some copies of these types of repeats were also found in some species of the derived genera. Subfamilies I–IV spread mostly in species of the derived clade (second phase of radiation, Pliocene to Pleistocene), although repeats of these subfamilies exist in older species. Phylogenetic trees did not group the repeats by taxonomic affinity, but sequences were grouped by subfamily provenance. Concerted evolution was observed in HinfI subfamilies spread in older genera, whereas no genetic differentiation was found between species, and several subfamilies even coexist within the same species, in recently radiated groups or in groups with a history of recurrent hybridization of lineages. Conclusions The results suggest that the eight HinfI subfamilies were present in the common ancestor of Centaureinae and that each spread differentially in different genera during the two main phases of radiation

  20. A novel satellite DNA isolated in Pecten jacobaeus shows high sequence similarity among molluscs.

    PubMed

    Petraccioli, Agnese; Odierna, Gaetano; Capriglione, Teresa; Barucca, Marco; Forconi, Mariko; Olmo, Ettore; Biscotti, Maria Assunta

    2015-10-01

    The aim of this work is to investigate the sequence conservation and the evolution of repeated DNA in related species. Satellite DNA is a component of eukaryotic genomes and is made up of tandemly repeated sequences. These sequences are affected by high rates of mutation that lead to the occurrence of species-specific satellite DNAs, which are different in terms of both quantity and quality. In this work, a novel repetitive DNA family, named PjHhaI sat, is described in Pecten jacobaeus. The quantitative analyses revealed a different abundance of this element in the molluscan species investigated in agreement with the "library hypothesis" even if, in this case, at a high taxonomic level. In addition, the qualitative analysis demonstrated an astonishing sequence conservation not only among scallops but also in six other molluscan species belonging to three classes. These findings suggest that the PjHhaI sat may be considered as the most ancients of DNA described so far, which remained "frozen" during molluscan evolution. The widespread distribution of this sat DNA in molluscs as well as its long evolutionary preservation open up questions on the functional role of this element. A future challenge might be the identification of proteins or molecules which interact with the PjHhaI sat. PMID:25832354

  1. Representative and efficient cloning of satellite DNAs based on PFGE pre-fractionation of restriction digests of genomic DNA.

    PubMed

    Burgtorf, C; Bünemann, H

    1994-06-01

    Using DNA from Drosophila hydei KUN-DH-33 cells we describe an efficient method for selective and representative cloning of complex mixtures of satellite DNAs from eukaryotic genomes. Effective separation of satellite DNA from the bulk of all other sequences it obtained by fractionation of high molecular weight DNA by PFGE after treating it with '6 bp' restriction enzymes. Since extended clusters of tandemly arranged, so called simple sequence, repeats are inert to cleavage by most '6 bp' restriction enzymes the DNA fraction recovered from the gel region > 50 kb is mainly a mixture of satellites. Efficient and representative cloning of this DNA is performed by sonication to an average size of 50-500 bp and ligation of the blunt ended DNA fragments into the Bluescript vector pBS. PMID:7963251

  2. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978. PMID:27433591

  3. Characterization of Satellite DNA from Three Marine Dinoflagellates (Dinophyceae): Glenodinium sp. and Two Members of the Toxic Genus, Protogonyaulax 1

    PubMed Central

    Boczar, Barbara A.; Liston, John; Cattolico, Rose Ann

    1991-01-01

    Using CsCl-Hoechst dye or CsCl-ethidium bromide gradients, satellite and nuclear DNAs were separated and characterized in three marine dinoflagellates: Glenodinium sp., and two toxic dinoflagellates, Protogonyaulax tamarensis and Protogonyaulax catenella. In all three dinoflagellates, the lowest density fraction, satellite DNA1, hybridized to chloroplast genes derived from terrestrial plants and/or other algae. Dinoflagellate chloroplast DNAs exhibited molecular sizes of 114 to 125 kilobase pairs, which is consistent with plastid sizes determined for other chromophytic algae (120-150 kilobase pairs). Mitochondrial DNA was not resolved from nuclear DNA in this system. Two additional satellite DNAs, satellite DNA2 and satellite DNA3, recovered from P. tamarensis and P. catenella were similar to one another, both within and between species, when characterized by restriction enzyme analysis. These satellites were 85 to 95 kilobase pairs in size, and exhibited restriction fragments that hybridized to yeast nuclear ribosomal RNA genes. Restriction enzyme analyses and DNA hybridization studies of cpDNA document that the two Protogonyaulax isolates are not evolutionarily identical. ImagesFigure 1Figure 2Figure 3Figure 4 PMID:16668443

  4. A novel satellite DNA sequence in the Peromyscus genome (PMSat): Evolution via copy number fluctuation.

    PubMed

    Louzada, Sandra; Vieira-da-Silva, Ana; Mendes-da-Silva, Ana; Kubickova, Svatava; Rubes, Jiri; Adega, Filomena; Chaves, Raquel

    2015-11-01

    Satellite DNAs (satDNA) are tandemly arrayed repeated sequences largely present in eukaryotic genomes, which play important roles in genome evolution and function, and therefore, their analysis is vital. Here, we describe the isolation of a novel satellite DNA family (PMSat) from the rodent Peromyscus eremicus (Cricetidae, Rodentia), which is located in pericentromeric regions and exhibits a typical satellite DNA genome organization. Orthologous PMSat sequences were isolated and characterized from three species belonging to Cricetidae: Cricetus cricetus, Phodopus sungorus and Microtus arvalis. In these species, PMSat is highly conserved, with the absence of fixed species-specific mutations. Strikingly, different numbers of copies of this sequence were found among the species, suggesting evolution by copy number fluctuation. Repeat units of PMSat were also found in the Peromyscus maniculatus bairdii BioProject, but our results suggest that these repeat units are from genome regions outside the pericentromere. The remarkably high evolutionary sequence conservation along with the preservation of a few numbers of copies of this sequence in the analyzed genomes may suggest functional significance but a different sequence nature/organization. Our data highlight that repeats are difficult to analyze due to the limited tools available to dissect genomes and the fact that assemblies do not cover regions of constitutive heterochromatin. PMID:26103000

  5. MULTI-ELEMENT ABUNDANCE MEASUREMENTS FROM MEDIUM-RESOLUTION SPECTRA. IV. ALPHA ELEMENT DISTRIBUTIONS IN MILKY WAY SATELLITE GALAXIES

    SciTech Connect

    Kirby, Evan N.; Cohen, Judith G.; Smith, Graeme H.; Guhathakurta, Puragra; Sohn, Sangmo Tony

    2011-02-01

    We derive the star formation histories of eight dwarf spheroidal (dSph) Milky Way satellite galaxies from their alpha element abundance patterns. Nearly 3000 stars from our previously published catalog comprise our data set. The average [{alpha}/Fe] ratios for all dSphs follow roughly the same path with increasing [Fe/H]. We do not observe the predicted knees in the [{alpha}/Fe] versus [Fe/H] diagram, corresponding to the metallicity at which Type Ia supernovae begin to explode. Instead, we find that Type Ia supernova ejecta contribute to the abundances of all but the most metal-poor ([Fe/H] < -2.5) stars. We have also developed a chemical evolution model that tracks the star formation rate, Types II and Ia supernova explosions, and supernova feedback. Without metal enhancement in the supernova blowout, massive amounts of gas loss define the history of all dSphs except Fornax, the most luminous in our sample. All six of the best-fit model parameters correlate with dSph luminosity but not with velocity dispersion, half-light radius, or Galactocentric distance.

  6. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat.

    PubMed

    Koo, Dal-Hoe; Tiwari, Vijay K; Hřibová, Eva; Doležel, Jaroslav; Friebe, Bernd; Gill, Bikram S

    2016-01-01

    Fluorescence in situ hybridization (FISH) provides an efficient system for cytogenetic analysis of wild relatives of wheat for individual chromosome identification, elucidation of homoeologous relationships, and for monitoring alien gene transfers into wheat. This study is aimed at developing cytogenetic markers for chromosome identification of wheat and Aegilops geniculata (2n = 4x = 28, UgUgMgMg) using satellite DNAs obtained from flow-sorted chromosome 5Mg. FISH was performed to localize the satellite DNAs on chromosomes of wheat and selected Aegilops species. The FISH signals for satellite DNAs on chromosome 5Mg were generally associated with constitutive heterochromatin regions corresponding to C-band-positive chromatin including telomeric, pericentromeric, centromeric, and interstitial regions of all the 14 chromosome pairs of Ae. geniculata. Most satellite DNAs also generated FISH signals on wheat chromosomes and provided diagnostic chromosome arm-specific cytogenetic markers that significantly improved chromosome identification in wheat. The newly identified satellite DNA CL36 produced localized Mg genome chromosome-specific FISH signals in Ae. geniculata and in the M genome of the putative diploid donor species Ae. comosa subsp. subventricosa but not in Ae. comosa subsp. comosa, suggesting that the Mg genome of Ae. geniculata was probably derived from subsp. subventricosa. PMID:27403741

  7. Anatomy of herpes simplex virus DNA VII. alpha-RNA is homologous to noncontiguous sites in both the L and S components of viral DNA.

    PubMed Central

    Jones, P C; Hayward, G S; Roizman, B

    1977-01-01

    Previous reports from this laboratory (Honess and Roizman, 1974) have operationally defined alpha polypeptides as the viral proteins that are synthesized first in HEp-2 cells treated with cycloheximide from the time of infection with herpes simplex virus type 1 until the withdrawal of the drug 12 to 15 h after infection. It has also been shown that the viral RNA (designated alpha RNA) that accumulates in the cytoplasm during cycloheximide treatment and on polyribosomes immediately upon withdrawal of the drug is homologous to 10 to 12% of viral DNA, whereas the viral RNA accumulating in the cytoplasm of untreated cells at 8 to 14 h after infection is homologous to 43% of viral DNA (Kozak and Roizman, 1974). In the present study, alpha RNA and cytoplasmic RNA extracted from untreated cells 8 h after infection were each hybridized in liquid to in vitro labeled restriction endonuclease fragments generated by cleavage of herpes simplex virus type 1 DNA with Hsu I, with Bgl II, and with both enzymes simultaneously. The data show that only a subset of the fragments hybridized to alpha RNA, and these are scattered within both the L and S components of the DNA. There are at least five noncontiguous regions in the DNA homologous to alpha RNA; two of these are located partially within the reiterated sequences in the S component. All fragments tested hybridized more extensively with 8-h cytoplasmic RNA than with alpha RNA. Four adjacent fragments, corresponding to 30% of the DNA and mapping within the L component, hybridized exclusively with the cytoplasmic RNA extracted from cells 8 h after infection. Images PMID:189068

  8. cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

    SciTech Connect

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-05-15

    cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.

  9. Target practice: aiming at satellite repeats with DNA minor groove binders.

    PubMed

    Susbielle, Guillaume; Blattes, Roxane; Brevet, Vanessa; Monod, Caroline; Käs, Emmanuel

    2005-07-01

    Much progress has been made in recent years in developing small molecules that target the minor groove of DNA. Striking advances have led to the design of synthetic molecules that recognize specific DNA sequences with affinities comparable to those of eukaryotic transcription factors. This makes it feasible to modulate or inhibit DNA/protein interactions in vivo, a major step towards the development of general strategies of anti-gene therapy. Examples from anti-parasitic drugs also suggest that synthetic molecules can affect a variety of cellular functions crucial to cell viability by more generally targeting vast portions of genomes based on their biased base composition. This provides a rationale for developing approaches based on selective interactions with broad genomic targets such as satellite repeats that are associated with structural or architectural components of chromatin essential for cellular proliferation. Using examples drawn from the Drosophila melanogaster model system, we review here the use of synthetic polyamides or diamidines that bind the DNA minor groove and can be used as highly selective agents capable of interfering with specific protein/DNA interactions that occur in A+T-rich repeated sequences that constitute a significant portion of eukaryotic genomes. The satellite localization of cellular proteins that bind the minor groove of DNA via domains such as the AT hook motif is highly sensitive to these molecules. A major consequence of the competition between these proteins and their synthetic mimics is an alteration of the nuclear localization and function of proteins such as topoisomerase II, a major target of anti-cancer drugs. PMID:16101491

  10. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability.

    PubMed

    Lambert, Muriel W

    2016-09-01

    Non-erythroid alpha spectrin (αIISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. αIISp's interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear αIISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in maintenance of genomic stability following ICL damage to DNA. We have proposed that αIISp acts as a scaffold aiding to recruit repair proteins to sites of damage. This involvement of αIISp in ICL repair and telomere maintenance after ICL damage represents new and critical functions for αIISp. These studies have led to development of a model for the role of αIISp in DNA ICL repair. They have been aided by examination of cells from patients with Fanconi anemia (FA), a repair-deficient genetic disorder in which a deficiency in αIISp leads to defective ICL repair in genomic and telomeric DNA, telomere dysfunction, and chromosome instability following DNA ICL damage. We have shown that loss of αIISp in FA cells is due to increased breakdown by the protease, µ-calpain. Importantly, we have demonstrated that this deficiency can be corrected by knockdown of µ-calpain and restoring αIISp levels to normal. This corrects a number of the phenotypic deficiencies in FA after ICL damage. These studies suggest a new and unexplored direction for therapeutically restoring genomic stability in FA cells and for correcting numerous phenotypic deficiencies occurring after ICL damage. Developing a more in-depth understanding of the importance of the interaction of αIISp with other nuclear proteins could significantly enhance our knowledge of the consequences of loss of αIISp on critical nuclear processes. PMID:27480253

  11. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  12. Identification of cDNA encoding an additional. alpha. subunit of a human GTP-binding protein: Expression of three. alpha. sub i subtypes in human tissues and cell lines

    SciTech Connect

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J. )

    1988-06-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of {alpha}, {beta}, and {gamma} subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of {alpha}{sub i} that is different from the human {alpha}{sub i} subtypes previously reported. {alpha}{sub i} is the {alpha} subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the {alpha}{sub i-3} subtype of G proteins on the basis of its similarity to other {alpha}{sub i}-like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human {alpha}{sub i} ({alpha}{sub i-1} and {alpha}{sub i-2}) in a variety of human fetal tissues and in human cell lines. All three {alpha}{sub i} subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of {alpha}{sub i-1} expression. mRNA for {alpha}{i-1} is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of {alpha}{sub i-1} genes may permit characterization of distinct physiological roles for this {alpha}{sub i} subunit. mRNA for {alpha}{sub i-2} and {alpha}{sub i-3} was found in all the primary and transformed cell lines tested. Thus, some cells contain all three {alpha}{sub i} subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar {alpha} proteins.

  13. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH)

    PubMed Central

    Cortés-Gutiérrez, Elva I.; Ortíz-Hernández, Brenda L.; Dávila-Rodríguez, Martha I.; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2013-01-01

    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1. PMID:23429197

  14. Hyperhomocysteinemia inhibits satellite cell regenerative capacity through p38 alpha/beta MAPK signaling.

    PubMed

    Veeranki, Sudhakar; Lominadze, David; Tyagi, Suresh C

    2015-07-15

    Chronic failure in maintenance and regeneration of skeletal muscles leads to lower muscle mass (sarcopenia), muscle weakness, and poor response to injury. Evidence suggests that aberrant p38 MAPK signaling undermines the repair process after injury in aged mice. Previous studies have shown that hyperhomocysteinemia (HHcy) has been associated with muscle weakness and lower than normal body weights. However, whether or not HHcy condition also compromises skeletal muscle regenerative capabilities is not clear. In the current study, we show that CBS-/+ mice, a model for HHcy condition, exhibited compromised regenerative function and cell proliferation upon injury. However, there was no significant difference in Pax7 expression levels in the satellite cells from CBS-/+ mouse skeletal muscles. Interestingly, the satellite cells from CBS-/+ mice not only exhibited diminished in vitro proliferative capabilities, but also there was heightened oxidative stress. In addition, there was enhanced p38 MAPK activation as well as p16 and p21 expression in the CBS-/+ mouse satellite cells. Moreover, the C2C12 myoblasts also exhibited higher p38 MAPK activation and p16 expression upon treatment with homocysteine in addition to enhanced ROS presence. Tissue engraftment potential and regeneration after injury were restored to some extent upon treatment with the p38-MAPK inhibitor, SB203580, in the CBS-/+ mice. These results together suggest that HHcy-induced diminished satellite cell proliferation involves excessive oxidative stress and p38 MAPK signaling. Our study further proposes that HHcy is a potential risk factor for elderly frailty, and need to be considered as a therapeutic target while designing the alleviation interventions/postinjury rehabilitation measures for adults with HHcy. PMID:25980021

  15. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-01-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors. PMID:27160654

  16. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    NASA Astrophysics Data System (ADS)

    Al-Ta’Ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-05-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors.

  17. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-01-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors. PMID:27160654

  18. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  19. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.

    PubMed

    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  20. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae)

    PubMed Central

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E.; Breitbart, Mya

    2016-01-01

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640–750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity. PMID:26848679

  1. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae).

    PubMed

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E; Breitbart, Mya

    2016-02-01

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640-750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity. PMID:26848679

  2. A DNA polymerase alpha accessory protein, Mcl1, is required for propagation of centromere structures in fission yeast.

    PubMed

    Natsume, Toyoaki; Tsutsui, Yasuhiro; Sutani, Takashi; Dunleavy, Elaine M; Pidoux, Alison L; Iwasaki, Hiroshi; Shirahige, Katsuhiko; Allshire, Robin C; Yamao, Fumiaki

    2008-01-01

    Specialized chromatin exists at centromeres and must be precisely transmitted during DNA replication. The mechanisms involved in the propagation of these structures remain elusive. Fission yeast centromeres are composed of two chromatin domains: the central CENP-A(Cnp1) kinetochore domain and flanking heterochromatin domains. Here we show that fission yeast Mcl1, a DNA polymerase alpha (Pol alpha) accessory protein, is critical for maintenance of centromeric chromatin. In a screen for mutants that alleviate both central domain and outer repeat silencing, we isolated several cos mutants, of which cos1 is allelic to mcl1. The mcl1-101 mutation causes reduced CENP-A(Cnp1) in the central domain and an aberrant increase in histone acetylation in both domains. These phenotypes are also observed in a mutant of swi7(+), which encodes a catalytic subunit of Pol alpha. Mcl1 forms S-phase-specific nuclear foci, which colocalize with those of PCNA and Pol alpha. These results suggest that Mcl1 and Pol alpha are required for propagation of centromere chromatin structures during DNA replication. PMID:18493607

  3. Elevated DNA polymerase alpha, DNA polymerase beta, and DNA topoisomerase II in a melphalan-resistant rhabdomyosarcoma xenograft that is cross-resistant to nitrosoureas and topotecan.

    PubMed

    Friedman, H S; Dolan, M E; Kaufmann, S H; Colvin, O M; Griffith, O W; Moschel, R C; Schold, S C; Bigner, D D; Ali-Osman, F

    1994-07-01

    Previous investigations have revealed that the human TE-671 MR human rhabdomyosarcoma xenograft selected in vivo for melphalan resistance (M. C. Rosenberg, et al., Cancer Res., 49: 6917-6922, 1989) is cross-resistant to a wide variety of alkylating agents and to bleomycin, but is collaterally sensitive to etoposide. Although glutathione levels were noted to be elevated in TE-671 MR compared to the melphalan-sensitive parental TE-671 xenograft, treatment with buthionine sulfoximine to deplete glutathione levels did not fully restore melphalan sensitivity in the TE-671 MR xenograft. The present studies were undertaken to search for additional mechanisms of resistance in the TE-671 MR xenograft. Drug sensitivity testing performed at the dose of agents that was lethal to 10% of the animals revealed that the TE-671 MR xenograft maintained resistance to the bifunctional cross-linking agent 1,3-bis(2-chloroethyl)-1-nitrosourea and was cross-resistant to the topoisomerase I poison topotecan. Treatment with buthionine sulfoximine did not sensitize the TE-671 MR xenograft to 1,3-bis(2-chloroethyl)-1-nitrosourea. Further, even though O6-alkylguanine-DNA alkyltransferase levels were high in both the TE-671 and TE-671 MR xenografts, depletion of O6-alkylguanine-DNA alkyltransferase activity by treatment with O6-benzylguanine substantially sensitized the TE-671 xenografts but not the TE-671 MR xenografts, suggesting an additional mechanism of resistance. Measurement of additional enzyme activities that might be involved in DNA repair revealed significant elevations in DNA polymerase alpha (46 +/- 8 (SD) units/mg protein in TE-671, 69 +/- 6 units/mg protein in TE-671 MR, P < 0.05) and DNA polymerase beta (0.43 +/- 0.01 units/mg protein in TE-671, 0.78 +/- 0.12 units/mg protein in TE-671 MR, P < 0.05) but not DNA polymerase delta or total DNA ligase. Examination of topoisomerases by activity assays and Western blotting revealed a 2-fold increase in topoisomerase II and a 2-fold

  4. Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2010-01-01

    The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

  5. CHO cell repair of single-strand and double-strand DNA breaks induced by gamma- and alpha-radiations.

    PubMed

    Cole, A; Shonka, F; Corry, P; Cooper, W G

    1975-01-01

    Neutral and alkaline sucrose gradient sedimentation analysis was used to measure double- and single-strand breaks in the DNA of Chinese hamster ovary (CHO) cells exposed to either gamma- or alpha-radiation. After irradiation, cells were incubated for 15-180 min to test the ability of the cell to rejoin the DNA breaks. Essentially complete rejoining was observed for single-strand breaks induced by gamma- or alpha-doses below 20 krad and for double-strand breaks induced by gamma doses below 60 krad. Approximately 80% rejoining was observed for double-strand breaks induced by alpha doses below 40 krad. At higher doses, the repair system appeared to saturate in such a way that essentially no additional breaks were rejoined. PMID:1191188

  6. Modeling proton and alpha elastic scattering in liquid water in Geant4-DNA

    NASA Astrophysics Data System (ADS)

    Tran, H. N.; El Bitar, Z.; Champion, C.; Karamitros, M.; Bernal, M. A.; Francis, Z.; Ivantchenko, V.; Lee, S. B.; Shin, J. I.; Incerti, S.

    2015-01-01

    Elastic scattering of protons and alpha (α) particles by water molecules cannot be neglected at low incident energies. However, this physical process is currently not available in the "Geant4-DNA" extension of the Geant4 Monte Carlo simulation toolkit. In this work, we report on theoretical differential and integral cross sections of the elastic scattering process for 100 eV-1 MeV incident protons and for 100 eV-10 MeV incident α particles in liquid water. The calculations are performed within the classical framework described by Everhart et al., Ziegler et al. and by the ICRU 49 Report. Then, we propose an implementation of the corresponding classes into the Geant4-DNA toolkit for modeling the elastic scattering of protons and α particles. Stopping powers as well as ranges are also reported. Then, it clearly appears that the account of the elastic scattering process in the slowing-down of the charged particle improves the agreement with the existing data in particular with the ICRU recommendations.

  7. cDNA cloning and disruption of the major vault protein alpha gene (mvpA) in Dictyostelium discoideum.

    PubMed

    Vasu, S K; Kedersha, N L; Rome, L H

    1993-07-25

    Vaults are large cytoplasmic ribonucleoprotein particles found in nearly all eukaryotic cells. Dictyostelium vaults contain two major proteins, MVP alpha (94.2 kDa) and MVP beta (approximately 92 kDa). Using an anti-rat vault antibody, we screened a Dictyostelium cDNA expression library and isolated a 2.8-kilobase pair clone that contained a single full-length reading frame. The identity of the clone was established by the presence of a predicted 20-amino acid sequence identical to that found in a peptide sequenced from purified MVP alpha. We have disrupted the single copy gene using homologous recombination and have demonstrated a loss of MVP alpha. Although the cells still produce MVP beta, they do not contain characteristic vault particles, suggesting that MVP alpha is required for normal vault structure. These cells should be a valuable tool for elucidating the function of vaults. PMID:8340365

  8. Pericentromeric satellite repeat expansions through RNA-derived DNA intermediates in cancer

    PubMed Central

    Bersani, Francesca; Lee, Eunjung; Kharchenko, Peter V.; Xu, Andrew W.; Liu, Mingzhu; Xega, Kristina; MacKenzie, Olivia C.; Brannigan, Brian W.; Wittner, Ben S.; Jung, Hyunchul; Ramaswamy, Sridhar; Park, Peter J.; Maheswaran, Shyamala; Ting, David T.; Haber, Daniel A.

    2015-01-01

    Aberrant transcription of the pericentromeric human satellite II (HSATII) repeat is present in a wide variety of epithelial cancers. In deriving experimental systems to study its deregulation, we observed that HSATII expression is induced in colon cancer cells cultured as xenografts or under nonadherent conditions in vitro, but it is rapidly lost in standard 2D cultures. Unexpectedly, physiological induction of endogenous HSATII RNA, as well as introduction of synthetic HSATII transcripts, generated cDNA intermediates in the form of DNA/RNA hybrids. Single molecule sequencing of tumor xenografts showed that HSATII RNA-derived DNA (rdDNA) molecules are stably incorporated within pericentromeric loci. Suppression of RT activity using small molecule inhibitors reduced HSATII copy gain. Analysis of whole-genome sequencing data revealed that HSATII copy number gain is a common feature in primary human colon tumors and is associated with a lower overall survival. Together, our observations suggest that cancer-associated derepression of specific repetitive sequences can promote their RNA-driven genomic expansion, with potential implications on pericentromeric architecture. PMID:26575630

  9. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.

    PubMed

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica

    2012-08-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  10. Ocean Primary Production Estimates from Terra MODIS and Their Dependency on Satellite Chlorophyll Alpha Algorithms

    NASA Technical Reports Server (NTRS)

    Essias, Wayne E.; Abbott, Mark; Carder, Kendall; Campbell, Janet; Clark, Dennis; Evans, Robert; Brown, Otis; Kearns, Ed; Kilpatrick, Kay; Balch, W.

    2003-01-01

    Simplistic models relating global satellite ocean color, temperature, and light to ocean net primary production (ONPP) are sensitive to the accuracy and limitations of the satellite estimate of chlorophyll and other input fields, as well as the primary productivity model. The standard MODIS ONPP product uses the new semi-analytic chlorophyll algorithm as its input for two ONPP indexes. The three primary MODIS chlorophyll Q estimates from MODIS, as well as the SeaWiFS 4 chlorophyll product, were used to assess global and regional performance in estimating ONPP for the full mission, but concentrating on 2001. The two standard ONPP algorithms were examined with 8-day and 39 kilometer resolution to quantify chlorophyll algorithm dependency of ONPP. Ancillary data (MLD from FNMOC, MODIS SSTD1, and PAR from the GSFC DAO) were identical. The standard MODIS ONPP estimates for annual production in 2001 was 59 and 58 GT C for the two ONPP algorithms. Differences in ONPP using alternate chlorophylls were on the order of 10% for global annual ONPP, but ranged to 100% regionally. On all scales the differences in ONPP were smaller between MODIS and SeaWiFS than between ONPP models, or among chlorophyll algorithms within MODIS. Largest regional ONPP differences were found in the Southern Ocean (SO). In the SO, application of the semi-analytic chlorophyll resulted in not only a magnitude difference in ONPP (2x), but also a temporal shift in the time of maximum production compared to empirical algorithms when summed over standard oceanic areas. The resulting increase in global ONPP (6-7 GT) is supported by better performance of the semi-analytic chlorophyll in the SO and other high chlorophyll regions. The differences are significant in terms of understanding regional differences and dynamics of ocean carbon transformations.

  11. alpha-MSH tripeptide analogs activate the melanocortin 1 receptor and reduce UV-induced DNA damage in human melanocytes.

    PubMed

    Abdel-Malek, Zalfa A; Ruwe, Andrew; Kavanagh-Starner, Renny; Kadekaro, Ana Luisa; Swope, Viki; Haskell-Luevano, Carrie; Koikov, Leonid; Knittel, James J

    2009-10-01

    One skin cancer prevention strategy that we are developing is based on synthesizing and testing melanocortin analogs that reduce and repair DNA damage resulting from exposure to solar ultraviolet (UV) radiation, in addition to stimulating pigmentation. Previously, we reported the effects of tetrapeptide analogs of alpha-melanocortin (alpha-MSH) that were more potent and stable than the physiological alpha-MSH, and mimicked its photoprotective effects against UV-induced DNA damage in human melanocytes. Here, we report on a panel of tripeptide analogs consisting of a modified alpha-MSH core His(6)-d-Phe(7)-Arg(8), which contained different N-capping groups, C-terminal modifications, or arginine mimics. The most potent tripeptides in activating cAMP formation and tyrosinase of human melanocytes were three analogs with C-terminal modifications. The most effective C-terminal tripeptide mimicked alpha-MSH in reducing hydrogen peroxide generation and enhancing nucleotide excision repair following UV irradiation. The effects of these three analogs required functional MC1R, as they were absent in human melanocytes that expressed non-functional receptor. These results demonstrate activation of the MC1R by tripeptide melanocortin analogs. Designing small analogs for topical delivery should prove practical and efficacious for skin cancer prevention. PMID:19558415

  12. Complementary DNA cloning, messenger RNA expression, and induction of alpha-class glutathione S-transferases in mouse tissues.

    PubMed

    Buetler, T M; Eaton, D L

    1992-01-15

    Glutathione S-transferases (EC 2.5.1.18) are a multigene family of related proteins divided into four classes. Each class has multiple isoforms that exhibit tissue-specific expression, which may be an important determinant of susceptibility of that tissue to toxic injury or cancer. Recent studies have suggested that alpha-class glutathione S-transferase isoforms may play an important role in the development of cancers. Several alpha-class glutathione S-transferase isozymes have been characterized, purified, and cloned from a number of species, including rats, mice, and humans. Here we report on the cloning, sequencing, and mRNA expression of two alpha-class glutathione S-transferases from mouse liver, termed mYa and mYc. While mYa was shown to be identical to the known alpha-class glutathione S-transferase complementary DNA clone pGT41 (W. R. Pearson et al., J. Biol. Chem., 263: 13324-13332, 1988), the other clone, mYc, was demonstrated to be a novel complementary DNA clone encoding a glutathione S-transferase homologous to rat Yc (subunit 2). The mRNA for this novel complementary DNA is expressed constitutively in mouse liver. It also is the major alpha-class glutathione S-transferase isoform expressed in lung. The levels of expression of the butylated hydroxyanisole-inducible form (mYa) are highest in kidney and intestine. Treatment of mice with butylated hydroxyanisole had little effect on the expression levels of mYc but strongly induced mYa expression in liver. Butylated hydroxyanisole treatment increased expression levels for both mYa and mYc to varying degrees in kidney, lung, and intestine. The importance of the novel mouse liver alpha-class glutathione S-transferase isoform (mYc) in the metabolism of aflatoxin B1 and other carcinogens is discussed. PMID:1728405

  13. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone

    PubMed Central

    Böhm, Markus; Hill, Helene Z.

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  14. The Trypanosoma brucei DNA polymerase alpha core subunit gene is developmentally regulated and linked to a constitutively expressed open reading frame.

    PubMed Central

    Leegwater, P A; Strating, M; Murphy, N B; Kooy, R F; van der Vliet, P C; Overdulve, J P

    1991-01-01

    As an initial step towards the characterization of replicative DNA polymerases of trypanosomes, we have cloned, sequenced and examined the expression of the Trypanosoma (Trypanozoon) brucei brucei gene that encodes the DNA polymerase alpha catalytic core (pol alpha). The protein sequence contains the six conserved regions that have been recognized previously in eukaryotic and viral replicative DNA polymerases. In addition, we have identified a seventh region which appears to be conserved primarily in alpha-type DNA polymerases. The T.brucei DNA pol alpha core N-terminus is 123 and 129 amino acids smaller than that of the human and yeast homologue, respectively. The gene is separated by 386 bp from an upstream open reading frame (ORF) of 442 codons. Stable transcripts of the upstream sequence are detected in both dividing and non-dividing forms, while pol alpha transcripts are detected principally in dividing forms. Allelic copies of the T.brucei pol alpha region exhibit restriction site polymorphisms; one such sequence polymorphism affects the amino acid sequence of the T.brucei DNA pol alpha core. The T.brucei pol alpha region cross-hybridizes weakly with that of T.(Nannomonas) congolense and T.(Duttonella) vivax. Images PMID:1754381

  15. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone.

    PubMed

    Böhm, Markus; Hill, Helene Z

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  16. The severity of alpha-particle-induced DNA damage is revealed by exposure to cell-free extracts

    SciTech Connect

    Hodgkins, P.S.; O`Neill, P.; Stevens, D.; Fairman, M.P.

    1996-12-01

    The rejoining of single-strand breaks induced by {alpha}-particle and {gamma} irradiation in plasmid DNA under two scavenging conditions has been compared. At the two scavenger conditions has been compared. At the two scavenger capacities used of 1.5 {times} 10{sup 7} and 3 {times} 10{sup 8}s{sup {minus}1} using Tris-HCl as the scavenger, the ratio of single- to double-strand breaks for {alpha} particles is fivefold less than the corresponding ratios for {gamma} irradiation. The repair of such radiation-induced single-strand breaks has been examined using a cell-free system derived from human whole-cell extracts. We show that the rejoining of single-strand breaks for both {alpha}-particle- and {gamma}-irradiated plasmid is dependent upon the scavenging capacity and that the efficiency of rejoining of {alpha}-particle-induced single-strand breaks is significantly less than that observed for {gamma}-ray-induced breaks. In addition, for DNA that had been irradiated under conditions that mimic the cellular environment with respect to the radical scavenging capacity, 50 of {alpha}-particle-induced single-strand breaks are converted to double-strand breaks, in contrast with only {approximately}12% conversion of {gamma}-ray-induced single-strand breaks, indicating that the initial damage caused by {alpha} particles is more severe. These studies provide experimental evidence for increased clustering of damage which may have important implications for the induction of cancer by low-level {alpha}-particle sources such as domestic radon. 37 refs., 5 figs., 1 tab.

  17. Subspecies of DNA polymerase alpha from calf thymus with different fidelity in copying synthetic template-primers.

    PubMed Central

    Brosius, S; Grosse, F; Krauss, G

    1983-01-01

    Three different subspecies of DNA polymerase alpha from calf thymus sedimenting at 9 S, 7 S and 5.7 S have been investigated with respect to their accuracy of in vitro DNA synthesis on poly (dA) (dT)16 and poly d(AT) as template-primers. Our results indicate that the structure of DNA polymerase alpha has a strong influence on the accuracy of DNA synthesis. The 9 S enzyme shows a misincorporation frequency of about 1:100 000. An error rate of 1:15 000 is measured for the 7 S species. The 5.7 S enzyme for which an error rate of 1:3 000 is determined, has to be considered as error prone. Lowering the rate of DNA synthesis leads to a decrease in fidelity. The single stranded DNA binding protein from E.coli increases the accuracy of the 5.7 S and the 7 S enzyme by a factor of two. Mn2+ decreases the fidelity of all three subspecies in a concentration dependent manner. PMID:6866763

  18. Calculation of the Electronic Parameters of an Al/DNA/p-Si Schottky Barrier Diode Influenced by Alpha Radiation

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889–1.423 Ω for 2–8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  19. Calculation of the electronic parameters of an Al/DNA/p-Si Schottky barrier diode influenced by alpha radiation.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Mohd Amin, Yusoff; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889-1.423 Ω for 2-8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  20. Centromeric satellite DNA in the newt Triturus cristatus karelinii and related species: its distribution and transcription on lampbrush chromosomes.

    PubMed

    Baldwin, L; Macgregor, H C

    1985-01-01

    Two abundant satellite DNA sequences have been identified in and cloned from the DNA of Triturus cristatus karelinii. The smaller of these with a repeat unit of 33 base pairs (bp) is designated TkS1, the larger with 68 bp is designated TkS2. These satellites are also present in DNA from T.c. cristatus, T.c. carnifex and T. marmoratus but in substantially lower copy number. In situ hybridisations to lampbrush chromosomes of T.c. karelinii and T.c. cristatus have shown that the satellites are concentrated in the heterochromatic centromere bars of T.c. karelinii and in a region around the centromere granule in T.c. cristatus. The satellites also bind specifically to the centromere regions of mitotic metaphase chromosomes. They do not bind to the heteromorphic arms of chromosome 1, which have previously been shown to be rich in highly repeated DNA. DNA/RNA-transcript in situ hybrids to lampbrush chromosomes with TkS1 suggest that this sequence is occasionally transcribed on lampbrush loops near the centromeres. PMID:2988877

  1. DNA homologous recombination factor SFR1 physically and functionally interacts with estrogen receptor alpha.

    PubMed

    Feng, Yuxin; Singleton, David; Guo, Chun; Gardner, Amanda; Pakala, Suresh; Kumar, Rakesh; Jensen, Elwood; Zhang, Jinsong; Khan, Sohaib

    2013-01-01

    Estrogen receptor alpha (ERα), a ligand-dependent transcription factor, mediates the expression of its target genes by interacting with corepressors and coactivators. Since the first cloning of SRC1, more than 280 nuclear receptor cofactors have been identified, which orchestrate target gene transcription. Aberrant activity of ER or its accessory proteins results in a number of diseases including breast cancer. Here we identified SFR1, a protein involved in DNA homologous recombination, as a novel binding partner of ERα. Initially isolated in a yeast two-hybrid screen, the interaction of SFR1 and ERα was confirmed in vivo by immunoprecipitation and mammalian one-hybrid assays. SFR1 co-localized with ERα in the nucleus, potentiated ER's ligand-dependent and ligand-independent transcriptional activity, and occupied the ER binding sites of its target gene promoters. Knockdown of SFR1 diminished ER's transcriptional activity. Manipulating SFR1 expression by knockdown and overexpression revealed a role for SFR1 in ER-dependent and -independent cancer cell proliferation. SFR1 differs from SRC1 by the lack of an intrinsic activation function. Taken together, we propose that SFR1 is a novel transcriptional modulator for ERα and a potential target in breast cancer therapy. PMID:23874500

  2. Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of Arabidopsis thaliana centromeres.

    PubMed Central

    Nagaki, Kiyotaka; Talbert, Paul B; Zhong, Cathy Xiaoyan; Dawe, R Kelly; Henikoff, Steven; Jiang, Jiming

    2003-01-01

    The centromeres of Arabidopsis thaliana chromosomes contain megabases of complex DNA consisting of numerous types of repetitive DNA elements. We developed a chromatin immunoprecipitation (ChIP) technique using an antibody against the centromeric H3 histone, HTR12, in Arabidopsis. ChIP assays showed that the 180-bp centromeric satellite repeat was precipitated with the antibody, suggesting that this repeat is the key component of the centromere/kinetochore complex in Arabidopsis. PMID:12663558

  3. Clusters of alpha satellite on human chromosome 21 are dispersed far onto the short arm and lack ancient layers.

    PubMed

    Ziccardi, William; Zhao, Chongjian; Shepelev, Valery; Uralsky, Lev; Alexandrov, Ivan; Andreeva, Tatyana; Rogaev, Evgeny; Bun, Christopher; Miller, Emily; Putonti, Catherine; Doering, Jeffrey

    2016-09-01

    Human alpha satellite (AS) sequence domains that currently function as centromeres are typically flanked by layers of evolutionarily older AS that presumably represent the remnants of earlier primate centromeres. Studies on several human chromosomes reveal that these older AS arrays are arranged in an age gradient, with the oldest arrays farthest from the functional centromere and arrays progressively closer to the centromere being progressively younger. The organization of AS on human chromosome 21 (HC21) has not been well-characterized. We have used newly available HC21 sequence data and an HC21p YAC map to determine the size, organization, and location of the AS arrays, and compared them to AS arrays found on other chromosomes. We find that the majority of the HC21 AS sequences are present on the p-arm of the chromosome and are organized into at least five distinct isolated clusters which are distributed over a larger distance from the functional centromere than that typically seen for AS on other chromosomes. Using both phylogenetic and L1 element age estimations, we found that all of the HC21 AS clusters outside the functional centromere are of a similar relatively recent evolutionary origin. HC21 contains none of the ancient AS layers associated with early primate evolution which is present on other chromosomes, possibly due to the fact that the p-arm of HC21 and the other acrocentric chromosomes underwent substantial reorganization about 20 million years ago. PMID:27430641

  4. Murine branched chain alpha-ketoacid dehydrogenase kinase; cDNA cloning, tissue distribution, and temporal expression during embryonic development.

    PubMed

    Doering, C B; Coursey, C; Spangler, W; Danner, D J

    1998-06-01

    These studies were designed to demonstrate the structural and functional similarity of murine branched chain alpha-ketoacid dehydrogenase and its regulation by the complex-specific kinase. Nucleotide sequence and deduced amino acid sequence for the kinase cDNA demonstrate a highly conserved coding sequence between mouse and human. Tissue-specific expression in adult mice parallels that reported in other mammals. Kinase expression in female liver is influenced by circadian rhythm. Of special interest is the fluctuating expression of this kinase during embryonic development against the continuing increase in the catalytic subunits of this mitochondrial complex during development. The need for regulation of the branched chain alpha-ketoacid dehydrogenase complex by kinase expression during embryogenesis is not understood. However, the similarity of murine branched chain alpha-ketoacid dehydrogenase and its kinase to the human enzyme supports the use of this animal as a model for the human system. PMID:9611264

  5. In Silico Screening for Novel Inhibitors of DNA Polymerase III Alpha Subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv)

    PubMed Central

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N.; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents. PMID:25811866

  6. A monopartite begomovirus-associated DNA beta satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection.

    PubMed

    Saeed, Muhammad; Zafar, Yusuf; Randles, John W; Rezaian, M Ali

    2007-10-01

    DNA beta is a circular single-stranded satellite DNA which co-infects with certain monopartite helper begomoviruses to cause economically important diseases, such as cotton leaf curl disease (CLCuD). DNA beta encodes a single protein, betaC1. Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus in which both DNA A and DNA B are required for systemic infection. Inoculation of tomato plants with ToLCNDV DNA A alone induced local but not systemic infection, whereas co-inoculation with DNA A and the DNA beta associated with CLCuD resulted in systemic infection. DNA beta containing a disrupted betaC1 open reading frame (ORF) did not mobilize DNA A systemically. Co-inoculation of plants with DNA A and a construct of the betaC1 ORF, under the control of the cauliflower mosaic virus 35S promoter, resulted in the systemic movement of DNA A. In inoculated tobacco and onion epidermal cells, betaC1 fused to GFP was localized at the cell periphery in association with punctate bodies, around and within the cell nucleus and with the endoplasmic reticulum. It is concluded that heterologous betaC1 protein can replace the movement function of the DNA B of a bipartite begomovirus. Evidence is also provided that tomato leaf curl virus-encoded C4 protein confers the same movement function to ToLCNDV DNA A. The intracellular distribution of betaC1 is consistent with the hypothesis that it has a role in transporting the DNA A from the nuclear site of replication to the plasmodesmatal exit sites of the infected cell. PMID:17872543

  7. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale

    PubMed Central

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-01-01

    Abstract Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  8. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale.

    PubMed

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-12-01

    Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  9. [beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

    SciTech Connect

    Brown, C.A.; Mahuran, D.J. )

    1993-08-01

    In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

  10. Bhendi yellow vein mosaic disease in India is caused by association of a DNA Beta satellite with a begomovirus.

    PubMed

    Jose, Joyce; Usha, Ramakrishnan

    2003-01-20

    Yellow vein mosaic disease is the major limitation in the production of bhendi or okra (Abelmoschus esculentus), an important vegetable crop of India. This disease is caused by a complex consisting of the monopartite begomovirus Bhendi yellow vein mosaic virus (BYVMV, family: Geminiviridae) and a small satellite DNA beta component. BYVMV can systemically infect bhendi upon agroinoculation but produces only mild leaf curling in this host. DNA beta induces typical symptoms of bhendi yellow vein mosaic disease (BYVMD) when co-agroinoculated with the begomovirus to bhendi. The DNA beta component associated with BYVMD has a number of features in common with those reported for ageratum yellow vein disease and cotton leaf curl disease. BYVMV represents a new member of the emerging group of monopartite begomoviruses requiring a satellite component for symptom induction. PMID:12573576

  11. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  12. The B subunit of the DNA polymerase alpha-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication.

    PubMed Central

    Foiani, M; Marini, F; Gamba, D; Lucchini, G; Plevani, P

    1994-01-01

    The four-subunit DNA polymerase alpha-primase complex is unique in its ability to synthesize DNA chains de novo, and some in vitro data suggest its involvement in initiation and elongation of chromosomal DNA replication, although direct in vivo evidence for a role in the initiation reaction is still lacking. The function of the B subunit of the complex is unknown, but the Saccharomyces cerevisiae POL12 gene, which encodes this protein, is essential for cell viability. We have produced different pol12 alleles by in vitro mutagenesis of the cloned gene. The in vivo analysis of our 18 pol12 alleles indicates that the conserved carboxy-terminal two-thirds of the protein contains regions that are essential for cell viability, while the more divergent NH2-terminal portion is partially dispensable. The characterization of the temperature-sensitive pol12-T9 mutant allele demonstrates that the B subunit is required for in vivo DNA synthesis and correct progression through S phase. Moreover, reciprocal shift experiments indicate that the POL12 gene product plays an essential role at the early stage of chromosomal DNA replication, before the hydroxyurea-sensitive step. A model for the role of the B subunit in initiation of DNA replication at an origin is presented. Images PMID:8289832

  13. Human placental Na/sup +/, K/sup +/-ATPase. cap alpha. subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    SciTech Connect

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-11-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na/sup +/, K/sup +/-ATPase ..cap alpha.. subunit was cloned from human placenta and its sequence was identical to that encoding the ..cap alpha.. subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na/sup +/, K/sup +/-ATPase gene from various human tissues and cell lines revealed only one band (approx. = 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) lambdagt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the ..cap alpha.. subunit is on the short is on the short arm (band p11-p13) of chromosome 1.

  14. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  15. Sequence-specific microscopic visualization of DNA methylation status at satellite repeats in individual cell nuclei and chromosomes

    PubMed Central

    Li, Yufeng; Miyanari, Yusuke; Shirane, Kenjiro; Nitta, Hirohisa; Kubota, Takeo; Ohashi, Hirofumi; Okamoto, Akimitsu; Sasaki, Hiroyuki

    2013-01-01

    Methylation-specific fluorescence in situ hybridization (MeFISH) was developed for microscopic visualization of DNA methylation status at specific repeat sequences in individual cells. MeFISH is based on the differential reactivity of 5-methylcytosine and cytosine in target DNA for interstrand complex formation with osmium and bipyridine-containing nucleic acids (ICON). Cell nuclei and chromosomes hybridized with fluorescence-labeled ICON probes for mouse major and minor satellite repeats were treated with osmium for crosslinking. After denaturation, fluorescent signals were retained specifically at satellite repeats in wild-type, but not in DNA methyltransferase triple-knockout (negative control) mouse embryonic stem cells. Moreover, using MeFISH, we successfully detected hypomethylated satellite repeats in cells from patients with immunodeficiency, centromeric instability and facial anomalies syndrome and 5-hydroxymethylated satellite repeats in male germ cells, the latter of which had been considered to be unmethylated based on anti-5-methylcytosine antibody staining. MeFISH will be suitable for a wide range of applications in epigenetics research and medical diagnosis. PMID:23990328

  16. Sequence-specific microscopic visualization of DNA methylation status at satellite repeats in individual cell nuclei and chromosomes.

    PubMed

    Li, Yufeng; Miyanari, Yusuke; Shirane, Kenjiro; Nitta, Hirohisa; Kubota, Takeo; Ohashi, Hirofumi; Okamoto, Akimitsu; Sasaki, Hiroyuki

    2013-10-01

    Methylation-specific fluorescence in situ hybridization (MeFISH) was developed for microscopic visualization of DNA methylation status at specific repeat sequences in individual cells. MeFISH is based on the differential reactivity of 5-methylcytosine and cytosine in target DNA for interstrand complex formation with osmium and bipyridine-containing nucleic acids (ICON). Cell nuclei and chromosomes hybridized with fluorescence-labeled ICON probes for mouse major and minor satellite repeats were treated with osmium for crosslinking. After denaturation, fluorescent signals were retained specifically at satellite repeats in wild-type, but not in DNA methyltransferase triple-knockout (negative control) mouse embryonic stem cells. Moreover, using MeFISH, we successfully detected hypomethylated satellite repeats in cells from patients with immunodeficiency, centromeric instability and facial anomalies syndrome and 5-hydroxymethylated satellite repeats in male germ cells, the latter of which had been considered to be unmethylated based on anti-5-methylcytosine antibody staining. MeFISH will be suitable for a wide range of applications in epigenetics research and medical diagnosis. PMID:23990328

  17. The Structural Basis for Partitioning of the XRCC1/DNA Ligase III-alpha BRCT-mediated Dimer Complexes

    SciTech Connect

    M Cuneo; S Gabel; J Krahn; M Ricker; R London

    2011-12-31

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  18. The structural basis for partitioning of the XRCC1/DNA ligase III-[alpha] BRCT-mediated dimer complexes

    SciTech Connect

    Cuneo, Matthew J.; Gabel, Scott A.; Krahn, Joseph M.; Ricker, Melissa A.; London, Robert E.

    2011-11-17

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  19. Divergence of satellite DNA and interspersion of dispersed repeats in the genome of the wild beet Beta procumbens.

    PubMed

    Dechyeva, Daryna; Gindullis, Frank; Schmidt, Thomas

    2003-01-01

    Several repetitive sequences of the genome of Beta procumbens Chr. Sm., a wild beet species of the section Procumbentes of the genus Beta have been isolated. According to their genomic organization, the repeats were assigned to satellite DNA and families of dispersed DNA sequences. The tandem repeats are 229-246 bp long and belong to an AluI restriction satellite designated pAp11. Monomers of this satellite DNA form subfamilies which can be distinguished by the divergence or methylation of an internal restriction site. The satellite is amplified in the section Procumbentes, but is also found in species of the section Beta including cultivated beet (Beta vulgaris). The existence of the pAp11 satellite in distantly related species suggests that the AluI sequence family is an ancient component of Beta genomes and the ancestor of the diverged satellite subfamily pEV4 in B. vulgaris. Comparative fluorescent in-situ hybridization revealed remarkable differences in the chromosomal position between B. procumbens and B. vulgaris, indicating that the pAp11 and pEV4 satellites were most likely involved in the expansion or rearrangement of the intercalary B. vulgaris heterochromatin. Furthermore, we describe the molecular structure, and genomic and chromosomal organization of two repetitive DNA families which were designated pAp4 and pAp22 and are 1354 and 582 bp long, respectively. The families consist of sequence elements which are widely dispersed along B. procumbens chromosomes with local clustering and exclusion from distal euchromatic regions. FISH on meiotic chromosomes showed that both dispersed repeats are colocalized in some chromosomal regions. The interspersion of repeats of the pAp4 and pAp22 family was studied by PCR and enabled the determination of repeat flanking sequences. Sequence analysis revealed that pAp22 is either derived from or part of a long terminal repeat (LTR) of an Athila-like retrotransposon. Southern analysis and FISH with pAp4 and pAp22 showed

  20. Characterization and evolutionary dynamics of a complex family of satellite DNA in the leaf beetle Chrysolina carnifex (Coleoptera, Chrysomelidae).

    PubMed

    Palomeque, Teresa; Muñoz-López, Martín; Carrillo, José A; Lorite, Pedro

    2005-01-01

    The present study characterizes the complex satellite DNA from the specialized phytophagous beetle species Chrysolina carnifex. The satellite DNA is formed by six monomer types, partially homologous but having diverged enough to be separate on the phylogenetic trees, since each monomer type is located on a different branch, having statistically significant bootstrap values. Its analysis suggests a common evolutionary origin of all monomers from the same 211-bp sequence mainly by means of base-substitution mutations evolutionarily fixed to each monomer type and duplications and/or deletions of pre-existing segments in the 211-bp sequence. The analysis of the sequences and Southern hybridizations suggest that the monomers are organized in three types of repeats: monomers (211-bp) and higher-order repeats in the form of dimers (477-bp) or even trimers (633-bp). These repetitive units are not isolated from others, and do not present the pattern characteristic for the regular tandem arrangement of satellite DNA. In-situ hybridization with biotinylated probes corresponding to the three types of repeats showed the pericentromeric location of these sequences in all meiotic bivalents, coinciding with the heterochromatic blocks revealed by C-banding, indicating in addition that each type of repeat is neither isolated from others nor located in specific chromosomes but rather that they are intermixed in the heterochromatic regions. The presence of this repetitive DNA in C. haemoptera, C. bankii and C. americana was also tested by Southern analysis. The results show that this satellite DNA sequence is specific to the C. carnifex genome but has not been found in three other species of Chrysolina occupying similar or different host plants. PMID:16331411

  1. DNA polymerase alpha associated protein P1, a murine homolog of yeast MCM3, changes its intranuclear distribution during the DNA synthetic period.

    PubMed Central

    Kimura, H; Nozaki, N; Sugimoto, K

    1994-01-01

    We isolated a murine gene for the DNA polymerase alpha associated protein P1, which shares high homology with the budding yeast MCM3 protein, which is a member of a protein family involved in the early event of DNA replication having a putative DNA-dependent ATPase motif. Using a polyclonal anti-P1 antibody raised against a beta-galactosidase-P1 fusion protein, we identified at least two forms of P1 protein in the nucleus of a mouse cell line, an underphosphorylated form that was associated with a particular nuclear structure and a hyperphosphorylated form loosely bound to the nucleus. During progression through S phase, P1 disappeared, first from the euchromatic region, then from the heterochromatic region, apparently in parallel with temporally ordered DNA replication. Thus, it is likely that the underphosphorylated P1 is dissociated from the nuclear structure after DNA replication by cell cycle-dependent phosphorylation. This is the first direct observation of a protein whose behavior is consistent with that of a hypothetical factor which restricts the chromatin to replicate once per cell cycle in higher eukaryotes. Images PMID:7925275

  2. Distinction between mouse DNA polymerases alpha and beta by tryptic peptide mapping.

    PubMed Central

    Planck, S R; Tanabe, K; Wilson, S H

    1980-01-01

    Results presented here and in a previous paper (Tanabe et al. (1979) Biochemistry 18, 3401--3406) indicate that mouse beta-polymerase is a single polypeptide with an apparent molecular weight of 40,000. This polypeptide has now been analyzed by tryptic peptide mapping. Comparison of the results with identical analysis of mouse alpha-polymerase reveals that the tryptic peptides derived from the two enzymes are different. These results indicate that beta-polymerase is neither a subunit of alpha-polymerase nor a proteolytic degradation product of alpha-polymerase. Images PMID:7433094

  3. cDNA sequence and deduced primary structure of an alpha-amylase inhibitor from a bruchid-resistant wild common bean.

    PubMed

    Suzuki, K; Ishimoto, M; Kitamura, K

    1994-06-12

    alpha-Amylase inhibitor-2 (alpha AI-2), a seed storage protein present in a bruchid-resistant wild common bean (Phaseolus vulgaris), inhibits the growth of bruchid pests. The authors isolated and determined the sequence of an 852 nucleotide cDNA, designated as alpha ai2, and found it to contain a 720 base open reading frame (ORF). This ORF encodes a 240 amino-acid alpha AI-2 polypeptide 75.8% identical with alpha-amylase inhibitor-1 (alpha AI-1) and 50.6-55.6% with arcelin-1, phytohemagglutinin (PHA)-L and PHA-E of common bean. The high degree of sequence homology suggests that there is an evolutionary relationship among these genes. PMID:8003534

  4. Stereospecificity of human DNA polymerases alpha, beta, gamma, delta and epsilon, HIV-reverse transcriptase, HSV-1 DNA polymerase, calf thymus terminal transferase and Escherichia coli DNA polymerase I in recognizing D- and L-thymidine 5'-triphosphate as substrate.

    PubMed Central

    Focher, F; Maga, G; Bendiscioli, A; Capobianco, M; Colonna, F; Garbesi, A; Spadari, S

    1995-01-01

    L-beta-Deoxythymidine (L-dT), the optical enantiomer of D-beta-deoxythymidine (D-dT), and L-enantiomers of nucleoside analogs, such as 5-iodo-2'-deoxy-L-uridine (L-IdU) and E-5-(2-bromovinyl)-2'-deoxy-L-uridine (L-BVdU), are not recognized in vitro by human cytosolic thymidine kinase (TK), but are phosphorylated by herpes simplex virus type 1 (HSV-1) TK and inhibit HSV-1 proliferation in infected cells. Here we report that: (i) L-dT is selectively phosphorylated in vivo to L-dTMP by HSV-1 TK and L-dTMP is further phosphorylated to the di- and triphosphate forms by non-stereospecific cellular kinases; (ii) L-dTTP not only inhibits HSV-1 DNA polymerase in vitro, but also human DNA polymerase alpha, gamma, delta and epsilon, human immunodeficiency virus reverse transcriptase (HIV-1 RT), Escherichia coli DNA polymerase 1 and calf thymus terminal transferase, although DNA polymerase beta was resistant; (iii) whereas DNA polymerase beta, gamma, delta and epsilon are unable to utilize L-dTTP as a substrate, the other DNA polymerases clearly incorporate at least one L-dTMP residue, with DNA polymerase alpha and HIV-1 RT able to further elongate the DNA chain by catalyzing the formation of the phosphodiester bond between the incorporated L-dTMP and an incoming L-dTTP; (iv) incorporated L-nucleotides at the 3'-OH terminus make DNA more resistant to 3'-->5' exonucleases. In conclusion, our results suggest a possible mechanism for the inhibition of viral proliferation by L-nucleosides. Images PMID:7544886

  5. Stereospecificity of human DNA polymerases alpha, beta, gamma, delta and epsilon, HIV-reverse transcriptase, HSV-1 DNA polymerase, calf thymus terminal transferase and Escherichia coli DNA polymerase I in recognizing D- and L-thymidine 5'-triphosphate as substrate.

    PubMed

    Focher, F; Maga, G; Bendiscioli, A; Capobianco, M; Colonna, F; Garbesi, A; Spadari, S

    1995-08-11

    L-beta-Deoxythymidine (L-dT), the optical enantiomer of D-beta-deoxythymidine (D-dT), and L-enantiomers of nucleoside analogs, such as 5-iodo-2'-deoxy-L-uridine (L-IdU) and E-5-(2-bromovinyl)-2'-deoxy-L-uridine (L-BVdU), are not recognized in vitro by human cytosolic thymidine kinase (TK), but are phosphorylated by herpes simplex virus type 1 (HSV-1) TK and inhibit HSV-1 proliferation in infected cells. Here we report that: (i) L-dT is selectively phosphorylated in vivo to L-dTMP by HSV-1 TK and L-dTMP is further phosphorylated to the di- and triphosphate forms by non-stereospecific cellular kinases; (ii) L-dTTP not only inhibits HSV-1 DNA polymerase in vitro, but also human DNA polymerase alpha, gamma, delta and epsilon, human immunodeficiency virus reverse transcriptase (HIV-1 RT), Escherichia coli DNA polymerase 1 and calf thymus terminal transferase, although DNA polymerase beta was resistant; (iii) whereas DNA polymerase beta, gamma, delta and epsilon are unable to utilize L-dTTP as a substrate, the other DNA polymerases clearly incorporate at least one L-dTMP residue, with DNA polymerase alpha and HIV-1 RT able to further elongate the DNA chain by catalyzing the formation of the phosphodiester bond between the incorporated L-dTMP and an incoming L-dTTP; (iv) incorporated L-nucleotides at the 3'-OH terminus make DNA more resistant to 3'-->5' exonucleases. In conclusion, our results suggest a possible mechanism for the inhibition of viral proliferation by L-nucleosides. PMID:7544886

  6. Knockdown of {alpha}II spectrin in normal human cells by siRNA leads to chromosomal instability and decreased DNA interstrand cross-link repair

    SciTech Connect

    McMahon, Laura W.; Zhang Pan; Sridharan, Deepa M.; Lefferts, Joel A.; Lambert, Muriel W.

    2009-04-03

    Nonerythroid {alpha}-spectrin ({alpha}IISp) is a structural protein involved in repair of DNA interstrand cross-links and is deficient in cells from patients with Fanconi anemia (FA), which are defective in ability to repair cross-links. In order to further demonstrate the importance of the role that {alpha}IISp plays in normal human cells and in the repair defect in FA, {alpha}IISp was knocked down in normal cells using siRNA. Depletion of {alpha}IISp in normal cells by siRNA resulted in chromosomal instability and cellular hypersensitivity to DNA interstrand cross-linking agents. An increased number of chromosomal aberrations were observed and, following treatment with a DNA interstrand cross-linking agent, mitomycin C, cells showed decreased cell growth and survival and decreased formation of damage-induced {alpha}IISp and XPF nuclear foci. Thus depletion of {alpha}IISp in normal cells leads to a number of defects observed in FA cells, such as chromosome instability and a deficiency in cross-link repair.

  7. A histone arginine methylation localizes to nucleosomes in satellite II and III DNA sequences in the human genome

    PubMed Central

    2012-01-01

    Background Applying supervised learning/classification techniques to epigenomic data may reveal properties that differentiate histone modifications. Previous analyses sought to classify nucleosomes containing histone H2A/H4 arginine 3 symmetric dimethylation (H2A/H4R3me2s) or H2A.Z using human CD4+ T-cell chromatin immunoprecipitation sequencing (ChIP-Seq) data. However, these efforts only achieved modest accuracy with limited biological interpretation. Here, we investigate the impact of using appropriate data pre-processing —deduplication, normalization, and position- (peak-) finding to identify stable nucleosome positions — in conjunction with advanced classification algorithms, notably discriminatory motif feature selection and random forests. Performance assessments are based on accuracy and interpretative yield. Results We achieved dramatically improved accuracy using histone modification features (99.0%; previous attempts, 68.3%) and DNA sequence features (94.1%; previous attempts, <60%). Furthermore, the algorithms elicited interpretable features that withstand permutation testing, including: the histone modifications H4K20me3 and H3K9me3, which are components of heterochromatin; and the motif TCCATT, which is part of the consensus sequence of satellite II and III DNA. Downstream analysis demonstrates that satellite II and III DNA in the human genome is occupied by stable nucleosomes containing H2A/H4R3me2s, H4K20me3, and/or H3K9me3, but not 18 other histone methylations. These results are consistent with the recent biochemical finding that H4R3me2s provides a binding site for the DNA methyltransferase (Dnmt3a) that methylates satellite II and III DNA. Conclusions Classification algorithms applied to appropriately pre-processed ChIP-Seq data can accurately discriminate between histone modifications. Algorithms that facilitate interpretation, such as discriminatory motif feature selection, have the added potential to impart information about underlying

  8. Polymorphism, recombination and alternative unscrambling in the DNA polymerase alpha gene of the ciliate Stylonychia lemnae (Alveolata; class Spirotrichea).

    PubMed Central

    Ardell, David H; Lozupone, Catherine A; Landweber, Laura F

    2003-01-01

    DNA polymerase alpha is the most highly scrambled gene known in stichotrichous ciliates. In its hereditary micronuclear form, it is broken into >40 pieces on two loci at least 3 kb apart. Scrambled genes must be reassembled through developmental DNA rearrangements to yield functioning macronuclear genes, but the mechanism and accuracy of this process are unknown. We describe the first analysis of DNA polymorphism in the macronuclear version of any scrambled gene. Six functional haplotypes obtained from five Eurasian strains of Stylonychia lemnae were highly polymorphic compared to Drosophila genes. Another incompletely unscrambled haplotype was interrupted by frameshift and nonsense mutations but contained more silent mutations than expected by allelic inactivation. In our sample, nucleotide diversity and recombination signals were unexpectedly high within a region encompassing the boundary of the two micronuclear loci. From this and other evidence we infer that both members of a long repeat at the ends of the loci provide alternative substrates for unscrambling in this region. Incongruent genealogies and recombination patterns were also consistent with separation of the two loci by a large genetic distance. Our results suggest that ciliate developmental DNA rearrangements may be more probabilistic and error prone than previously appreciated and constitute a potential source of macronuclear variation. From this perspective we introduce the nonsense-suppression hypothesis for the evolution of ciliate altered genetic codes. We also introduce methods and software to calculate the likelihood of hemizygosity in ciliate haplotype samples and to correct for multiple comparisons in sliding-window analyses of Tajima's D. PMID:14704164

  9. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    PubMed

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  10. Sequence variability of the MspI satellite DNA family of the pinewood nematode Bursaphelenchus xylophilus at different geographic scales.

    PubMed

    Vieira, Paulo; Castagnone, Chantal; Mallez, Sophie; Espada, Margarida; Navas, Alfonso; Mota, Manuel; Castagnone-Sereno, Philippe

    2014-01-01

    Tandemly repeated sequences known as satellite DNA (satDNA) generally exhibit complex evolutionary patterns of concerted evolution in which mutations are homogenized and fixed in a stochastic process of molecular drive. Here, the nucleotidic variability of the MspI satDNA family of the pinewood nematode Bursaphelenchus xylophilus is analyzed in order to understand the evolutionary dynamics of satDNA at the intraspecific level. A total of 425 MspI monomer units, either PCR-amplified from isolates of local (Peninsula of Setúbal, Portugal) or worldwide origin, or retrieved from the B. xylophilus genome sequence, were characterized and compared. Whatever their origin, sliding window analysis of sequence variability patterns among monomers revealed low, moderate and highly variant domains, indicating that variable levels of evolutionary constraint may act upon the entire monomers. The phylogenetic inference based on the different sets of MspI satDNA family for this species shows a broad polymorphism of the individual monomers, which were distributed into four main clusters. However, such clustering appeared independent from the geographic origin of the nematodes, and could not discriminate isolates or groups of geographically close isolates. Rather, the formation of different phylogenetic groups within this satDNA family suggests an a priori embodying of a set of diverging repeats from a common ancestor satDNA library, which have been differently amplified along the evolutionary pathway of this species. The present work improves knowledge on the evolutionary dynamics of satDNA at the intraspecific level, and provides new information on satDNA sequence variability among natural populations sampled at a local geographic scale. PMID:24076248

  11. Induction of single- and double-strand breaks in plasmid DNA by monoenergetic alpha-particles with energies below the Bragg-maximum.

    PubMed

    Scholz, V; Weidner, J; Köhnlein, W; Frekers, D; Wörtche, H J

    1997-01-01

    The yield of single-strand breaks (ssb) and double-strand breaks (dsb) produced by alpha-particles at the end of their track in DNA-films was determined experimentally. Helium nuclei were accelerated to 600 keV in the 400 kV ion accelerator and scattered at a carbon target. The elastically scattered alpha-particles with energies of 344 keV and 485 keV were used to irradiate supercircular plasmid DNA in vacuo. For the dosimetry of the alpha-particles a surface barrier detector was used and the energy distribution of the alpha-particles determined. The energy loss of the particles in the DNA-layer was calculated. DNA samples were separated into the three conformational isomers using agarose gel electrophoresis. After fluorochromation the number of ssb and dsb per plasmid DNA molecule was established from the band intensities assuming the validity of Poisson statistics. Linear dose effect correlations were found for ssb and dsb per plasmid molecule. In the case of 344 keV-alpha-particles the yield of dsb was (8.6 +/- 0.9) x 10(-11) breaks/Gy x dalton. The ratio of ssb/dsb was 0.5 +/- 0.2. This is at least a factor of six larger than the ratio found in experiments with higher energy alpha-particles and from model calculations. Similar experiments with protons yielded a relative biological effectiveness (rbe) value of 2.8 for the induction of double-strand breaks by track end alpha-particles. PMID:9232893

  12. Non-linearity issues and multiple ionization satellites in the PIXE portion of spectra from the Mars alpha particle X-ray spectrometer

    NASA Astrophysics Data System (ADS)

    Campbell, John L.; Heirwegh, Christopher M.; Ganly, Brianna

    2016-09-01

    Spectra from the laboratory and flight versions of the Curiosity rover's alpha particle X-ray spectrometer were fitted with an in-house version of GUPIX, revealing departures from linear behavior of the energy-channel relationships in the low X-ray energy region where alpha particle PIXE is the dominant excitation mechanism. The apparent energy shifts for the lightest elements present were attributed in part to multiple ionization satellites and in part to issues within the detector and/or the pulse processing chain. No specific issue was identified, but the second of these options was considered to be the more probable. Approximate corrections were derived and then applied within the GUAPX code which is designed specifically for quantitative evaluation of APXS spectra. The quality of fit was significantly improved. The peak areas of the light elements Na, Mg, Al and Si were changed by only a few percent in most spectra. The changes for elements with higher atomic number were generally smaller, with a few exceptions. Overall, the percentage peak area changes are much smaller than the overall uncertainties in derived concentrations, which are largely attributable to the effects of rock heterogeneity. The magnitude of the satellite contributions suggests the need to incorporate these routinely in accelerator-based PIXE using helium beams.

  13. A recombinant DNA vaccine protects mice deficient in the alpha/beta interferon receptor against lethal challenge with Usutu virus.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Cañas-Arranz, Rodrigo; Vázquez-Calvo, Ángela; Merino-Ramos, Teresa; Escribano-Romero, Estela; Sobrino, Francisco; Saiz, Juan-Carlos

    2016-04-19

    Usutu virus (USUV) is a mosquito-borne flavivirus whose circulation had been confined to Africa since it was first detected in 1959. However, in the last decade USUV has emerged in Europe causing episodes of avian mortality and sporadic severe neuroinvasive infections in humans. Remarkably, adult laboratory mice exhibit limited susceptibility to USUV infection, which has impaired the analysis of the immune responses, thus complicating the evaluation of virus-host interactions and of vaccine candidates against this pathogen. In this work, we showed that mice deficient in the alpha/beta interferon receptor (IFNAR (-/-) mice) were highly susceptible to USUV infection and provided a lethal challenge model for vaccine testing. To validate this infection model, a plasmid DNA vaccine candidate encoding the precursor of membrane (prM) and envelope (E) proteins of USUV was engineered. Transfection of cultured cells with this plasmid resulted in expression of USUV antigens and the assembly and secretion of small virus-like particles also known as recombinant subviral particles (RSPs). A single intramuscular immunization with this plasmid was sufficient to elicit a significant level of protection against challenge with USUV in IFNAR (-/-) mice. The characterization of the humoral response induced revealed that DNA vaccination primed anti-USUV antibodies, including neutralizing antibodies. Overall, these results probe the suitability of IFNAR (-/-) mice as an amenable small animal model for the study of USUV host virus interactions and vaccine testing, as well as the feasibility of DNA-based vaccine strategies for the control of this pathogen. PMID:26993334

  14. Molecular cloning of the. alpha. -subunit of human prolyl 4-hydroxylase: The complete cDNA-derived amino acid sequence and evidence for alternative splicing of RNA transcripts

    SciTech Connect

    Helaakoski, T.; Vuori, K.; Myllylae, R.; Kivirikko, K.I.; Pihlajaniemi, T. )

    1989-06-01

    Prolyl 4-hydroxylase an {alpha}{sub 2}{beta}{sub 2} tetramer, catalyzes the formation of 4-hydroxyproline in collagens by the hydroxylation of proline residues in peptide linkages. The authors report here on the isolation of cDNA clones encoding the {alpha}-subunit of the enzyme from human tumor HT-1080, placenta, and fibroblast cDNA libraries. Eight overlapping clones covering almost all of the corresponding 3,000-nucleotide mRNA, including all the coding sequences, were characterized. These clones encode a polypeptide of 517 amino acid residues and a signal peptide of 17 amino acids. Previous characterization of cDNA clones for the {beta}-subunit of prolyl 4-hydroxylase has indicated that its C terminus has the amino acid sequence Lys-Asp-Gly-Leu, which, it has been suggested, is necessary for the retention of a polypeptide within the lumen of the endoplasmic reticulum. The {alpha}-subunit does not have this C-terminal sequence, and thus one function of the {beta}-subunit in the prolyl 4-hydroxylase tetramer appears to be to retain the enzyme within this cell organelle. Southern blot analyses of human genomic DNA with a cDNA probe for the {alpha}-subunit suggested the presence of only one gene encoding the two types of mRNA, which appear to result from mutually exclusive alternative splicing of primary transcripts of one gene.

  15. Satellite DNA as a target for TaqMan real-time PCR detection of the pinewood nematode, Bursaphelenchus xylophilus.

    PubMed

    François, Cecile; Castagnone, Chantal; Boonham, Neil; Tomlinson, Jenny; Lawson, Rebecca; Hockland, Sue; Quill, James; Vieira, Paulo; Mota, Manuel; Castagnone-Sereno, Philippe

    2007-11-01

    SUMMARY The pinewood nematode (PWN), Bursaphelenchus xylophilus, is a major pathogen of conifers, which impacts on forest health, natural ecosystem stability and international trade. As a consequence, it has been listed as a quarantine organism in Europe. A real-time PCR approach based on TaqMan chemistry was developed to detect this organism. Specific probe and primers were designed based on the sequence of the MspI satellite DNA family previously characterized in the genome of the nematode. The method proved to be specific in tests with target DNA from PWN isolates from worldwide origin. From a practical point of view, detection limit was 1 pg of target DNA or one individual nematode. In addition, PWN genomic DNA or single individuals were positively detected in mixed samples in which B. xylophilius was associated with the closely related non-pathogenic species B. mucronatus, up to the limit of 0.01% or 1% of the mixture, respectively. The real-time PCR assay was also used in conjunction with a simple DNA extraction method to detect PWN directly in artificially infested wood samples. These results demonstrate the potential of this assay to provide rapid, accurate and sensitive molecular identification of the PWN in relation to pest risk assessment in the field and quarantine regulation. PMID:20507540

  16. Molecular mechanisms of DNA damage initiated by alpha, beta-unsaturated carbonyl compounds as criteria for genotoxicity and mutagenicity.

    PubMed Central

    Eder, E; Hoffman, C; Bastian, H; Deininger, C; Scheckenbach, S

    1990-01-01

    alpha, beta-Unsaturated carbonyl compounds are important not only from a theoretical but also a practical standpoint. These ubiquitous compounds can interact with DNA through various mechanisms. The predominant interaction is the formation of cyclic 1,N2-deoxyguanosine adducts; 7,8-cyclic guanine adducts are also found. We have synthesized and characterized the stereoisomers of adducts formed by about 20 alpha, beta-unsaturated carbonyl compounds. The different types of adducts and the mutagenic and genotoxic response can be explained by the molecular structures of the agents. Compounds forming saturated cyclic adducts are mutagenic in S. typhimurium strain TA100 and to a lesser extent in TA1535. Substances with a leaving group at the C-3 position form unsaturated conjugated cyclic adducts and are mutagenic only in the His D3052 frameshift strains with an intact excision repair system (no urvA mutation). Metabolic epoxidation of the double bond and other metabolic activation, e.g., activation of the nitrogroups via nitroreductases, were also found to contribute to genotoxic and mutagenic activities. Our results have further elucidated the genotoxic mechanisms of these compounds; however, additional investigations are required for a complete understanding of the genotoxic activity of this class of compounds. PMID:2272339

  17. DNA methylation profiles in the human genes for tumor necrosis factors alpha and beta in subpopulations of leukocytes and in leukemias.

    PubMed Central

    Kochanek, S; Radbruch, A; Tesch, H; Renz, D; Doerfler, W

    1991-01-01

    The genomic sequencing technique has been applied to assess the state of methylation in the DNA from human leukocyte subpopulations from healthy individuals and in the DNA from several individuals with myeloid or lymphatic leukemias or non-Hodgkin lymphomas. Leukocyte populations were purified by the high-gradient magnetic cell sorting technique. In the human tumor necrosis factor alpha (TNF-alpha) gene segment between nucleotides 300 and 1150, the specific methylation profile in the DNA from human granulocytes and monocytes is maintained in three cases of myeloid leukemia. In one such case, all 5-methyl-2'-deoxycytidine residues have been replaced by cytidine. In a chronic lymphatic T-cell leukemia, all 5-methyl-2'-deoxycytidine residues have been substituted by cytidine. In normal B lymphocytes, in two cases of chronic lymphatic B-cell leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences in this gene segment are devoid of methylation. In the TNF-beta gene, DNA methylation is decreased in several examples of acute or chronic myeloid leukemias in comparison to normal human granulocytes or monocytes, whose DNA is almost completely methylated between nucleotides 700 and 900. In human T and B lymphocytes, the main producers of TNF-beta, in three instances of chronic lymphatic leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences are unmethylated in this region. The DNA from the human HeLa cell line is highly methylated at all 5'-CG-3' sequences in the TNF-alpha and -beta genes. The TNF-alpha gene is transcribed in the cells of one case of acute myeloid leukemia in which the analyzed region of the TNF-alpha gene is completely unmethylated. The TNF-beta gene is not transcribed in any of the malignant cells tested. Images PMID:2062856

  18. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  19. Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX

    PubMed Central

    Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong

    2015-01-01

    Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223

  20. A Novel Sandwich Electrochemical Immunosensor Based on the DNA-Derived Magnetic Nanochain Probes for Alpha-Fetoprotein

    PubMed Central

    Gan, Ning; Jia, Liyong; Zheng, Lei

    2011-01-01

    One novel electrochemical immunosensor was constructed by immobilizing capture antibody of alpha-fetoprotein (AFP Ab1) on a nafion/nanogold-particle modified glassy carbon electrode. With a sandwich immunoassay, one DNA-derived magnetic nanoprobe, simplified as DNA/(ZMPs—HRP-AFP Ab2)n, was employed for the detection of AFP. The fabricated procedure of the proposed biosensor was characterized by cyclic voltammetry and electrochemical impedance spectroscopy. The performance and factors influencing the performance of the biosensor were also evaluated. Under optimal conditions, the developed biosensor exhibited a well-defined electrochemical behavior toward the reduction of AFP ranging from 0.01 to 200 ng/mL with a detection limit of 4 pg/mL (S/N = 3). The biosensor was applied to the determination of AFP in serum with satisfactory results. It is important to note that the sandwich nanochainmodified electro-immunosensor provided an alternative substrate for the immobilization of other tumor markers. PMID:22013390

  1. cDNA cloning and complete primary structure of the alpha subunit of a leukocyte adhesion glycoprotein, p150,95.

    PubMed Central

    Corbi, A L; Miller, L J; O'Connor, K; Larson, R S; Springer, T A

    1987-01-01

    The leukocyte adhesion receptors, p150,95, Mac-1 and LFA-1 are integral membrane glycoproteins which contain distinct alpha subunits of 180,000-150,000 Mr associated with identical beta subunits of 95,000 Mr in alpha beta complexes. p150,95 alpha subunit tryptic peptides were used to specify oligonucleotide probes and a cDNA clone of 4.7 kb containing the entire coding sequence was isolated from a size-selected myeloid cell cDNA library. The 4.7-kb cDNA clone encodes a signal sequence, an extracellular domain of 1081 amino acids containing 10 potential glycosylation sites, a transmembrane domain of 26 amino acids, and a C-terminal cytoplasmic tail of 29 residues. The extracellular domain contains three tandem homologous repeats of approximately 60 amino acids with putative divalent cation-binding sites, and four weaker repeats which lack such binding sites. The cDNA clone hybridizes with a mRNA of 4.7 kb which is induced during in vitro differentiation of myeloid cell lines. The p150,95 alpha subunit is homologous to the alpha subunits of receptors which recognize the RGD sequence in extracellular matrix components, as has previously been shown for the beta subunits, supporting the concept that receptors involved in both cell-cell and cell-matrix interactions belong to a single gene superfamily termed the integrins. Distinctive features of the p150,95 alpha subunit include an insertion of 126 residues N-terminal to the putative metal binding region and a deletion of the region in which the matrix receptors are proteolytically cleaved during processing. Images Fig. 2. PMID:3327687

  2. Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates DNA-binding and transcriptional activities of NF-kappa B.

    PubMed Central

    Arenzana-Seisdedos, F; Thompson, J; Rodriguez, M S; Bachelerie, F; Thomas, D; Hay, R T

    1995-01-01

    The transcription factor NF-kappa B is exploited by many viruses, including the human immunodeficiency virus, for expression of viral genes, but its primary role appears to be in the rapid induction of cellular genes during immune and inflammatory responses. The inhibitor protein I kappa B alpha maintains NF-kappa B in an inactive form in the cytoplasms of unstimulated cells, but upon cell activation, I kappa B alpha is rapidly degraded, leading to nuclear translocation of free NF-kappa B. However, NF-kappa B-dependent transcription of the I kappa B alpha gene leads to rapid resynthesis of the I kappa B alpha protein and inhibition of NF-kappa B-dependent transcription. Here we demonstrate a new regulatory function of I kappa B alpha exerted on NF-kappa B in the nuclear compartment. Although normally found in the cytoplasm, I kappa B alpha, newly synthesized in response to tumor necrosis factor or interleukin I, is transported to the nucleus. In the nucleus I kappa B alpha associates with the p50 and p65 subunits of NF-kappa B, inhibiting DNA binding of the transcription factor. Furthermore, nuclear expression of I kappa B alpha correlates with transcription termination of transfected NF-kappa B-dependent luciferase genes. Following the appearance of I kappa B alpha in the nuclei of activated cells, a dramatic reduction in the amount of nuclear p50 occurs, suggesting that NF-kappa B-I kappa B alpha complexes are cleared from the nucleus. PMID:7739549

  3. Characterization of a cDNA encoding a novel human Golgi alpha 1, 2-mannosidase (IC) involved in N-glycan biosynthesis.

    PubMed

    Tremblay, L O; Herscovics, A

    2000-10-13

    A human cDNA encoding a 70.9-kDa type II membrane protein with sequence similarity to class I alpha1,2-mannosidases was isolated. The enzymatic properties of the novel alpha1,2-mannosidase IC were studied by expressing its catalytic domain in Pichia pastoris as a secreted glycoprotein. alpha1,2-Mannosidase IC sequentially hydrolyzes the alpha1,2-linked mannose residues of [(3)H]mannose-labeled Man(9)GlcNAc to form [(3)H]Man(6)GlcNAc and a small amount of [(3)H]Man(5)GlcNAc. The enzyme requires calcium for activity and is inhibited by both 1-deoxymannojirimycin and kifunensine. The order of mannose removal was determined by separating oligosaccharide isomers formed from pyridylaminated Man(9)GlcNAc(2) by high performance liquid chromatography. The terminal alpha1,2-linked mannose residue from the middle branch is the last mannose removed by the enzyme. This residue is the mannose cleaved from Man(9)GlcNAc(2) by the endoplasmic reticulum alpha1, 2-mannosidase I to form Man(8)GlcNAc(2) isomer B. The order of mannose hydrolysis from either pyridylaminated Man(9)GlcNAc(2) or Man(8)GlcNAc(2) isomer B differs from that previously reported for mammalian Golgi alpha1,2-mannosidases IA and IB. The full-length alpha1,2-mannosidase IC was localized to the Golgi of MDBK and MDCK cells by indirect immunofluorescence. Northern blot analysis showed tissue-specific expression of a major transcript of 3.8 kilobase pairs. The expression pattern is different from that of human Golgi alpha1,2-mannosidases IA and IB. Therefore, the human genome contains at least three differentially regulated Golgi alpha1, 2-mannosidase genes encoding enzymes with similar, but not identical specificities. PMID:10915796

  4. DNA topoisomerase II-alpha as a proliferation marker in astrocytic neoplasms of the central nervous system: correlation with MIB1 expression and patient survival.

    PubMed

    Holden, J A; Townsend, J J

    1999-12-01

    DNA topoisomerase II-alpha (topo II-alpha) is the target of a variety of clinically used anticancer drugs such as etoposide, teniposide, and doxorubicin. The enzyme has also been used as a cell proliferation marker. Because proliferation measurements in central nervous system (CNS) astrocytic neoplasms have been shown to have prognostic importance and because drugs targeting topo II-alpha may be useful in treating these tumors, we determined topo II-alpha expression in 26 patients with CNS astrocytomas. In these tumors, topo II-alpha expression correlated well with the known proliferation marker, MIB1 (correlation coefficient = 0.94). Topo II-alpha expression also correlated with the histologic classification of the tumor. Grade 1 lesions had an average topo II-alpha index of 2.1 (range, 0 to 3.4); grade 2 lesions, 4.0 (range, 0 to 11.4); grade 3 lesions, 17.3 (range, 3.8 to 69.8); and grade 4 lesions (glioblastoma multiforme), 39.5 (range, 14.8 to 84.0). The average topo II-alpha and MIB1 index of patients alive two years after diagnosis was 8.8 (range, 0 to 45.6) and 11.8 (range, 0.2 to 44.0), respectively. In contrast, the average topo II-alpha and MIB1 index of 30.5 (range, 2.8 to 69.8) and 33.8 (range, 2.2 to 84.6), respectively, was observed in tumors from patients who were dead from disease by two years. The topo II-alpha index between patients alive and dead at two years was statistically different at the 95% confidence level. The MIB1 differences between these two groups of patients was not found to be statistically different. PMID:10619260

  5. Alphoid satellite DNA is tightly associated with centromere antigens in human chromosomes throughout the cell cycle

    SciTech Connect

    Masumoto, Hiroshi; Sugimoto, Kenji; Okazaki, Tuneko )

    1989-03-01

    In this study, the authors have examined a DNA element specific to the centromere domain of human chromosomes. Purified HeLa chromosomes were digested with the restriction enzyme Sau3AI and fractionated by sedimentation through a sucrose gradient. Fractions showing antigenicity to anticentromere (kinetochore) serum obtained from a scleroderma CREST patient were used to construct a DNA library. From this library they found one clone which has specifically hybridized to the centromere domain of metaphase chromosomes using a biotinylated probe DNA and FITC-conjugated avidin. The clone contained a stretch of alphoid DNA dimer. To determine precisely the relative location of the alphoid DNA stretch and the centromere antigen, a method was developed to carry out in situ hybridization of DNA and indirect immunofluorescent staining of antigen on the same cell preparation. Using this method, they have found perfect overlapping of the alphoid DNA sites with the centromere antigen in both metaphase chromosomes and nuclei at various stages in the cell cycle. They have also observed this exact correlation at the attachment sites of artificially extended sister chromatids. These results suggest the possibility that alphoid DNA repeats are a key component of kinetochore structure.

  6. Alpha-DNA. IV: Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked to intercalating oxazolopyridocarbazole. Synthesis, physicochemical properties and poly (rA) binding.

    PubMed Central

    Gautier, C; Morvan, F; Rayner, B; Huynh-Dinh, T; Igolen, J; Imbach, J L; Paoletti, C; Paoletti, J

    1987-01-01

    A new set of molecules made of an intercalating agent (oxazolopyridocarbazole, OPC) covalently linked through a polymethylene chain of various length to the 3' end of alpha-anomeric or beta-anomeric tetradeoxynucleotides (alpha- or beta-T4) have been synthesized. The beta-thymidylate modified compound (beta-T4C5OPC) is able to interact with the complementary sequence, beta-poly (rA); this interaction is strongly stabilized compared to the parent compound, beta-oligo(dT)4 and is specific for poly (rA). The molecule synthesized from the unnatural alpha-anomer, alpha-T4C5OPC, is also able to interact with poly (rA) leading to the formation of an alpha-beta hybrid stabilized by the energy provided by the OPC moiety. The stoechiometry of the binding reaction shows that an A-T pairing occurs in the alpha-beta heterohybrids. Tm studies reveal that the alpha-beta heterohybrids are more stable than their beta-beta counterparts. PMID:3628001

  7. Evolutionary dynamics of two satellite DNA families in rock lizards of the genus Iberolacerta (Squamata, Lacertidae): different histories but common traits.

    PubMed

    Rojo, Verónica; Martínez-Lage, Andrés; Giovannotti, Massimo; González-Tizón, Ana M; Nisi Cerioni, Paola; Caputo Barucchi, Vincenzo; Galán, Pedro; Olmo, Ettore; Naveira, Horacio

    2015-09-01

    Satellite DNAs compose a large portion of all higher eukaryotic genomes. The turnover of these highly repetitive sequences is an important element in genome organization and evolution. However, information about the structure and dynamics of reptilian satellite DNA is still scarce. Two satellite DNA families, HindIII and TaqI, have been previously characterized in four species of the genus Iberolacerta. These families showed different chromosomal locations, abundances, and evolutionary rates. Here, we extend the study of both satellite DNAs (satDNAs) to the remaining Iberolacerta species, with the aim to investigate the patterns of variability and factors influencing the evolution of these repetitive sequences. Our results revealed disparate patterns but also common traits in the evolutionary histories of these satellite families: (i) each satellite DNA is made up of a library of monomer variants or subfamilies shared by related species; (ii) species-specific profiles of satellite repeats are shaped by expansions and/or contractions of different variants from the library; (iii) different turnover rates, even among closely related species, result in great differences in overall sequence homogeneity and in concerted or non-concerted evolution patterns, which may not reflect the phylogenetic relationships among taxa. Contrasting turnover rates are possibly related to genomic constraints such as karyotype architecture and the interspersed organization of diverging repeat variants in satellite arrays. Moreover, rapid changes in copy number, especially in the centromeric HindIII satDNA, may have been associated with chromosomal rearrangements and even contributed to speciation within Iberolacerta. PMID:26384818

  8. RECQL5 cooperates with Topoisomerase II alpha in DNA decatenation and cell cycle progression

    PubMed Central

    Ramamoorthy, Mahesh; Tadokoro, Takashi; Rybanska, Ivana; Ghosh, Avik K.; Wersto, Robert; May, Alfred; Kulikowicz, Tomasz; Sykora, Peter; Croteau, Deborah L.; Bohr, Vilhelm A.

    2012-01-01

    DNA decatenation mediated by Topoisomerase II is required to separate the interlinked sister chromatids post-replication. SGS1, a yeast homolog of the human RecQ family of helicases interacts with Topoisomerase II and plays a role in chromosome segregation, but this functional interaction has yet to be identified in higher organisms. Here, we report a physical and functional interaction of Topoisomerase IIα with RECQL5, one of five mammalian RecQ helicases, during DNA replication. Direct interaction of RECQL5 with Topoisomerase IIα stimulates the decatenation activity of Topoisomerase IIα. Consistent with these observations, RECQL5 co-localizes with Topoisomerase IIα during S-phase of the cell cycle. Moreover, cells with stable depletions of RECQL5 display a slow proliferation rate, a G2/M cell cycle arrest and late S-phase cycling defects. Metaphase spreads generated from RECQL5-depleted cells exhibit undercondensed and entangled chromosomes. Further, RECQL5-depleted cells activate a G2/M checkpoint and undergo apoptosis. These phenotypes are similar to those observed when Topoisomerase II catalytic activity is inhibited. These results reveal an important role for RECQL5 in the maintenance of genomic stability and a new insight into the decatenation process. PMID:22013166

  9. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  10. [DNA bend sites in the promoter region of the human estrogen receptor alpha gene].

    PubMed

    Kuwabara, K; Sakuma, Y

    1998-12-01

    DNA bend sites in the promoter region of the human estrogen receptor a gene were determined by the circular permutation assay. Among a total of five sites (ERB -4 to -1, and ERB + 1) mapped in the 3 kb region, three matched with the positions of the predicted periodicity while the other two did not. Most of the sites were accompanied by the short poly (dA)-poly (dT) tracts including the potential bend core sequence A2N8A2N8A2 (A/A/A). Fine mapping of the ERB-2 site indicated that this A/A/A and the immediate franking sequences contained motifs for the estrogen response element. This region had a higher affinity for the nuclear scaffold and was included in the core region of the nucleosome structure. However, binding of the nuclear factor(s) to the motifs and disruption of nucleosome structure occurred without ATP. These results suggest that a class of periodic bent DNA could act as a site of multiple interactions among the nuclear scaffold, core histones and nuclear factors. PMID:9893449

  11. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin

    PubMed Central

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N.; Henriques, João A. P.; Brendel, Martin; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as “mangosteen fruit,” originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  12. Intracellular localization of human ZBP1: Differential regulation by the Z-DNA binding domain, Z{alpha}, in splice variants

    SciTech Connect

    Hong Thanh Pham; Park, Mi-Young; Kim, Kyeong Kyu; Kim, Yang-Gyun; Ahn, Jin-Hyun . E-mail: jahn@med.skku.ac.kr

    2006-09-15

    We investigated the subcellular distribution of human ZBP1, which harbors the N-terminal Z-DNA binding domains, Z{alpha} and Z{beta}. ZBP1 was distributed primarily in the cytoplasm and occasionally as nuclear foci in interferon (IFN)-treated primary hepatocellular carcinoma cells, and in several other transfected cell types. In leptomycin B (LMB)-treated cells, endogenous ZBP1 efficiently accumulated in nuclear foci, which overlapped PML oncogenic domains (PODs) or nuclear bodies (NBs). In transfection assays, the unique C-terminal region of ZBP1 was necessary for its typical cytoplasmic localization. Interestingly, the Z{alpha}-deleted form displayed an increased association with PODs compared to wild-type and, unlike wild-type, perfectly accumulated in PODs in LMB-treated cells, implying that the presence of Z{alpha} domain also facilitates the cytoplasmic localization. Our results demonstrate that ZBP1 is localized primarily in the cytoplasm but also associated with nuclear PODs in IFN or LMB-treated cells. Given that about half of ZBP1 mRNA lacks exon 2 encoding the Z{alpha} domain, our data also suggest that the localization of ZBP1 may be differentially regulated by the Z-DNA binding domain, Z{alpha}, in splice variants.

  13. Cloning of the cDNA of the heme-regulated eukaryotic initiation factor 2. alpha. (eIF-2. alpha. ) kinase of rabbit reticulocytes: Homology to yeast GCN2 protein kinase and human double-stranded-RNA-dependent eIF-2. alpha. kinase

    SciTech Connect

    Chen, J.J.; Throop, M.S.; Kuo, I.; Pal, J.K.; Brodsky, M.; London, I.M. ); Gehrke, L. Harvard Medical School, Boston, MA )

    1991-09-01

    The authors have cloned the cDNA of the heme-regulated eIF-2{alpha} kinase (HRI) of rabbit reticulocytes. In vitro translation of mRNA transcribed from the HRI cDNA yields a 90-kDa polypeptide that exhibits eIF-2{alpha} kinase activity and is recognized by a monoclonal antibody directed against authentic HRI. The open reading frame sequence of the HRI cDNA contains all 11 catalytic domains of protein kinases with consensus sequences of protein-serine/threonine kinases in conserved catalytic domains VI and VIII. The HRI cDNA also contains an insert of {approx} 140 amino acids between catalytic domains V and VI. The HRI cDNA coding sequence has extensive homology to GCN2 protein kinase of Saccharomyces cerevisiae and to human double-stranded-RNA-dependent eIF-2{alpha} kinase. This observation suggests that GCN2 protein kinase may be an eIF-2{alpha} kinase in yeast. In addition, HRI has an unusually high degree of homology to three protein kinases (NimA, Wee1, and CDC2) that are involved in the regulation of the cell cycle.

  14. Microtubule-associated protein MAP2 preferentially binds to a dA/dT sequence present in mouse satellite DNA.

    PubMed Central

    Avila, J; Montejo de Garcini, E; Wandosell, F; Villasante, A; Sogo, J M; Villanueva, N

    1983-01-01

    Microtubule-associated protein MAP2 binds to the Sau96.1 restriction monomer fragment of mouse satellite DNA. This fragment is also present in a lower proportion in bulk DNA. The digestion of MAP2-Sau96.1 fragment complex by DNase results in the protection of certain nucleotide sequences. The sequence poly(dA)4/poly(dT)4 is mainly protected against DNase digestion. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. PMID:10872313

  15. [DNA content in the organs of animals in space flight on the Kosmos-690 satellite].

    PubMed

    Guseĭnov, F T; Komolova, G S; Egorov, I A; Tigranian, R A; Serova, L V

    1978-01-01

    The DNA content in the liver, spleen and bone marrow of white rats exposed to a prolonged gamma-irradiation at a dose of 220 and 800 rad on the 10th day of the 20.5-day space flight and the ground-based synchronous experiment was measured. Space flight factors produced a modifying effect on the postradiation changes in the DNA content. This modifying influence was detected in all organs tested, although in a different degree, and involved an enhancement of the radiation effect which was associated with retardation of postradiation regenerative processes. PMID:713477

  16. Targeting Aberrant DNA double strand break repair in triple negative breast cancer with alpha particle emitter radiolabeled anti-EGFR antibody

    PubMed Central

    Song, Hong; Hedayati, Mohammad; Hobbs, Robert F.; Shao, Chunbo; Bruchertseifer, Frank; Morgenstern, Alfred; DeWeese, Theodore L.; Sgouros, George

    2013-01-01

    The higher potential efficacy of alpha-particle radiopharmaceutical therapy lies in the 3 to 8-fold greater biological effectiveness (RBE) of alpha particles relative to photon or beta-particle radiation. This greater RBE, however, also applies to normal tissue, thereby reducing the potential advantage of high RBE. Since alpha particles typically cause DNA double strand breaks (DSBs), targeting tumors that are defective in DSB repair effectively increases the RBE, yielding a secondary, RBE-based differentiation between tumor and normal tissue that is complementary to conventional, receptor-mediated tumor targeting. In some triple negative breast cancers (TNBC, ER−/PR−/HER-2−), germline mutation in BRCA-1, a key gene in homologous recombination (HR) DSB repair, predisposes patients to early onset of breast cancer. These patients have few treatment options once the cancer has metastasized. In this study, we investigated the efficacy of alpha particle emitter, 213Bi labeled anti-EGFR antibody, Cetuximab, in BRCA-1 defective TNBC. 213Bi-Cetuximab was found to be significantly more effective in the BRCA-1 mutated TNBC cell line HCC1937 than BRCA-1 competent TNBC cell MDA-MB-231. siRNA knockdown of BRCA-1 or DNA-PKcs, a key gene in non-homologous end joining (NHEJ) DSB repair pathway, also sensitized TNBC cells to 213Bi-Cetuximab. Furthermore, the small molecule inhibitor of DNA-PKcs, NU7441, sensitized BRCA-1 competent TNBC cells to alpha particle radiation. Immunofluorescent staining of γH2AX foci and comet assay confirmed that enhanced RBE is caused by impaired DSB repair. These data offer a novel strategy for enhancing conventional receptor-mediated targeting with an additional, potentially synergistic radiobiological targeting that could be applied to TNBC. PMID:23873849

  17. Purification, cDNA cloning, and expression of GDP-L-Fuc:Asn-linked GlcNAc alpha1,3-fucosyltransferase from mung beans.

    PubMed

    Leiter, H; Mucha, J; Staudacher, E; Grimm, R; Glössl, J; Altmann, F

    1999-07-30

    Substitution of the asparagine-linked GlcNAc by alpha1,3-linked fucose is a widespread feature of plant as well as of insect glycoproteins, which renders the N-glycan immunogenic. We have purified from mung bean seedlings the GDP-L-Fuc:Asn-linked GlcNAc alpha1,3-fucosyltransferase (core alpha1,3-fucosyltransferase) that is responsible for the synthesis of this linkage. The major isoform had an apparent mass of 54 kDa and isoelectric points ranging from 6. 8 to 8.2. From that protein, four tryptic peptides were isolated and sequenced. Based on an approach involving reverse transcriptase-polymerase chain reaction with degenerate primers and rapid amplification of cDNA ends, core alpha1,3-fucosyltransferase cDNA was cloned from mung bean mRNA. The 2200-base pair cDNA contained an open reading frame of 1530 base pairs that encoded a 510-amino acid protein with a predicted molecular mass of 56.8 kDa. Analysis of cDNA derived from genomic DNA revealed the presence of three introns within the open reading frame. Remarkably, from the four exons, only exon II exhibited significant homology to animal and bacterial alpha1,3/4-fucosyltransferases which, though, are responsible for the biosynthesis of Lewis determinants. The recombinant fucosyltransferase was expressed in Sf21 insect cells using a baculovirus vector. The enzyme acted on glycopeptides having the glycan structures GlcNAcbeta1-2Manalpha1-3(GlcNAcbeta1-2Manalpha1- 6)Manbeta1-4GlcNAcbet a1-4GlcNAcbeta1-Asn, GlcNAcbeta1-2Manalpha1-3(GlcNAcbeta1-2Manalpha1- 6)Manbeta1-4GlcNAcbet a1-4(Fucalpha1-6)GlcNAcbeta1-Asn, and GlcNAcbeta1-2Manalpha1-3[Manalpha1-3(Manalpha1-6 )Manalpha1-6]Manbeta1 -4GlcNAcbeta1-4GlcNAcbeta1-Asn but not on, e.g. N-acetyllactosamine. The structure of the core alpha1,3-fucosylated product was verified by high performance liquid chromatography of the pyridylaminated glycan and by its insensitivity to N-glycosidase F as revealed by matrix-assisted laser desorption/ionization time of flight mass

  18. cDNA cloning, characterization, and developmental expression of the 20S proteasome alpha5 subunit in the Mediterranean fruit fly Ceratitis capitata.

    PubMed

    Verras, Meletios; Gourzi, Polyxeni; Kalosaka, Katerina; Zacharopoulou, Antigone; Mintzas, Anastassios C

    2008-03-01

    In the present study, we report the cDNA cloning, characterization, and developmental expression of the 20S proteasome alpha5 subunit from the Mediterranean fruit fly Ceratitis capitata (medfly). Using an RT-PCR fragment that corresponds to the amino-terminal region of the Drosophila melanogaster 20S proteasome alpha5 subunit, we isolated a 987-bp cDNA that encodes the complete coding region of the medfly ortholog, which was named CcPSMA5. CcPSMA5 consists of 241 amino acids and has a predicted molecular weight of 26.4 kDa and pI 4.75. Comparison of the CcPSMA5 amino acid sequence with the sequences of all known 20S proteasome alpha5 subunits from different organisms indicated that the medfly 20S proteasome alpha5 subunit has the strongest homology to that of Drosophila. In situ hybridization showed that the CcPSMA5 gene is mapped in the region 44B of chromosome 4. Northern blot hybridization analysis showed that the CcPSMA5 mRNA has a size of approximately 1.2 kb. High levels of the CcPSMA5 mRNA were detected in freshly laid eggs, indicating that they were maternally deposited. The mRNA expression pattern during medfly development suggests that the CcPSMA5 gene is upregulated before mid-embryogenesis and at the onset of metamorphosis. PMID:18163525

  19. cDNA cloning, biochemical characterization and inhibition by plant inhibitors of the alpha-amylases of the Western corn rootworm, Diabrotica virgifera virgifera.

    PubMed

    Titarenko, E; Chrispeels, M J

    2000-10-01

    We report the characterization and cDNA cloning of two alpha-amylase isozymes from larvae of the Western corn rootworm (Diabrotica virgifera virgifera LeConte). Larvae raised on artificial media have very low levels of amylase activity, and much higher levels are found in larvae raised on maize seedlings. At pH 5.7, the optimum pH for enzyme activity, the alpha-amylases are substantially but not completely inhibited by amylase inhibitors from the common bean (Phaseolus vulgaris) and from wheat (Triticum aestivum). Using the reverse transcriptase polymerase chain reaction (RT-PCR), we cloned two cDNAs with 83% amino acid identity that encode alpha-amylase-like polypeptides. Expression of one of the two cDNAs in insect cells with a baculovirus vector shows that this cDNA encodes an active amylase with a mobility that corresponds to that of one of the two isozymes present in larval extracts. The expressed enzyme is substantially inhibited by the same two inhibitors. We also show that expression in Arabidopsis of the cDNA that encodes the amylase inhibitor AI-1 of the common bean results in the accumulation of active inhibitor in the roots, and the results are discussed with reference to the possibility of using amylase inhibitors as a strategy to genetically engineer maize plants that are resistant to Western corn rootworm larvae. PMID:10899464

  20. Tetris Is a Foldback Transposon that Provided the Building Blocks for an Emerging Satellite DNA of Drosophila virilis

    PubMed Central

    Dias, Guilherme B.; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C.S.

    2014-01-01

    Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. PMID:24858539

  1. Effect of 4-quinolones and novobiocin on calf thymus DNA polymerase alpha primase complex, topoisomerases I and II, and growth of mammalian lymphoblasts.

    PubMed

    Hussy, P; Maass, G; Tümmler, B; Grosse, F; Schomburg, U

    1986-06-01

    The influence of ciprofloxacin, nalidixic acid, norfloxacin, novobiocin, and ofloxacin on elements of eucaryotic DNA replication was investigated in vitro. Each of the 4-quinolones, when present in amounts of more than 100 micrograms/ml, reversibly inhibited the DNA synthesis performed by the 95 DNA polymerase alpha primase complex from calf thymus. Novobiocin at 500 micrograms/ml or at higher concentrations irreversibly inactivated DNA polymerase alpha primase complex. The accuracy of in vitro DNA synthesis in the absence of repair mechanisms was determined from amber-revertant assays with phi X174am16(+) DNA as template. The antimicrobial agents did not significantly increase the frequencies of base pairing mismatches during the course of replication, indicating that the basal mutation rate is not affected by novobiocin and the 4-quinolones. The Ki values of 50% inhibition of DNA topoisomerases from calf thymus by ciprofloxacin, norfloxacin, novobiocin, nalidixic acid, and ofloxacin were 300, 400, 1,000 or more, 1,000 or more, and 1,500 or more micrograms/ml, respectively, in the case of topoisomerase I, and the Ki values were 150, 300, 500, 1,000, and 1,300 micrograms/ml, respectively, in the case of topoisomerase II. The procaryotic topoisomerase II is approximately 100-fold more sensitive to inhibition by ciprofloxacin, norfloxacin, and ofloxacin than is its eucaryotic counterpart. Growth curves of lymphoblasts were recorded in the presence of ofloxacin and ciprofloxacin. Neither 1 nor 10 micrograms of ciprofloxacin or of ofloxacin per ml affected cell proliferation. Ofloxacin and ciprofloxacin at 100 micrograms/ml inhibited cell growth; 1,000 micrograms/ml led to cell death. No correlation exists between the antimicrobial and cytotoxic activities of the 4-quinolones. PMID:3015015

  2. DNA bending is induced by a transcription factor that interacts with the human c-FOS and alpha-actin promoters.

    PubMed Central

    Gustafson, T A; Taylor, A; Kedes, L

    1989-01-01

    Conserved sequence elements in the human cardiac and skeletal alpha-actin promoters that contain the CC(A + T-rich)6GG motif have been shown to regulate transcription of these genes. A similar sequence is found in the serum response element of the human c-FOS gene. In this study, we demonstrate that indistinguishable proteins bind to each of five CC(A + T-rich)6GG elements examined in the human cardiac and skeletal alpha-actin promoters and the c-FOS serum response element. Using electrophoretic techniques, we show that these factors induce a stable bend in the DNA upon binding, and the bend center is shown to coincide with the CC(A + T-rich)6GG element. In addition, the ability to bend DNA is retained by a small proteolytic fragment of the protein, suggesting that the DNA-binding domain of the protein is resistant to proteases and is sufficient to bend DNA. Images PMID:2494661

  3. Lipid peroxidation and etheno DNA adducts in white blood cells of liver fluke-infected patients: protection by plasma alpha-tocopherol and praziquantel.

    PubMed

    Dechakhamphu, Somkid; Pinlaor, Somchai; Sitthithaworn, Paiboon; Nair, Jagadeesan; Bartsch, Helmut; Yongvanit, Puangrat

    2010-01-01

    Chronic infection by the liver fluke Opisthorchis viverrini is a strong risk factor for cholangiocarcinoma. To clarify the involvement of oxidative stress and lipid peroxidation-derived DNA damage, etheno (epsilon)-DNA adducts (epsilondA, epsilondC) in WBC and plasma alpha-tocopherol were measured in samples collected from O. viverrini-infected Thai patients (n = 50) and healthy noninfected volunteers (n = 20). epsilondA and epsilondC levels were three to five times higher (P < 0.001) in infected patients than in controls; O. viverrini infection also increased two to three times in the plasma inflammatory indicators, 8-isoprostane, malondialdehyde, and nitrate/nitrite. Mean plasma alpha-tocopherol levels were two times lower in patients than in healthy controls (P < 0.001). Two months after a single dose to infected patients of the antiparasitic drug praziquantel, epsilondA and epsilondC levels in WBC were decreased to control level (P < 0.03); plasma 8-isoprostane, malondialdehyde, nitrate/nitrite, and alkaline phosphatase (ALP) were concomitantly lowered. epsilondA and epsilondC levels in WBC were positively correlated with plasma 8-isoprostane, malondialdehyde, and nitrate/nitrite levels and ALP activity, whereas plasma alpha-tocopherol levels showed inverse correlations. We conclude that chronic O.viverrini infection induces an accumulation of lipid peroxidation-derived DNA damage through oxidative/nitrative stress, which is lowered by the plasma alpha-tocopherol and by antiparasitic drug therapy. Etheno adducts in WBC and urine should be explored as a risk marker for opisthorchiasis-related cholangiocarcinoma, and to assess the efficacy of preventive and therapeutic interventions. PMID:20056652

  4. Dynamic changes in the distribution of a satellite homologous to intergenic 26-18S rDNA spacer in the evolution of Nicotiana.

    PubMed Central

    Lim, K Y; Skalicka, K; Koukalova, B; Volkov, R A; Matyasek, R; Hemleben, V; Leitch, A R; Kovarik, A

    2004-01-01

    An approximately 135-bp sequence called the A1/A2 repeat was isolated from the transcribed region of the 26-18S rDNA intergenic spacer (IGS) of Nicotiana tomentosiformis. Fluorescence in situ hybridization (FISH) and Southern blot analysis revealed its occurrence as an independent satellite (termed an A1/A2 satellite) outside of rDNA loci in species of Nicotiana section Tomentosae. The chromosomal location, patterns of genomic dispersion, and copy numbers of its tandemly arranged units varied between the species. In more distantly related Nicotiana species the A1/A2 repeats were found only at the nucleolar organizer regions (NOR). There was a trend toward the elimination of the A1/A2 satellite in N. tabacum (tobacco), an allotetraploid with parents closely related to the diploids N. sylvestris and N. tomentosiformis. This process may have already commenced in an S(3) generation of synthetic tobacco. Cytosine residues in the IGS were significantly hypomethylated compared with the A1/A2 satellite. There was no clear separation between the IGS and satellite fractions in sequence analysis of individual clones and we found no evidence for CG suppression. Taken together the data indicate a dynamic nature of the A1/A2 repeats in Nicotiana genomes, with evidence for recurrent integration, copy number expansions, and contractions. PMID:15126410

  5. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    SciTech Connect

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. ); Kalsheker, N. )

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  6. Physical organization of the 1.709 satellite IV DNA family in Bovini and Tragelaphini tribes of the Bovidae: sequence and chromosomal evolution.

    PubMed

    Adega, F; Chaves, R; Guedes-Pinto, H; Heslop-Harrison, J S

    2006-01-01

    Repetitive DNA in the mammalian genome is a valuable record and marker for evolution, providing information about the order and driving forces related to evolutionary events. The evolutionarily young 1.709 satellite IV DNA family is present near the centromeres of many chromosomes in the Bovidae. Here, we isolated 1.709 satellite DNA sequences from five Bovidae species belonging to Bovini: Bos taurus (BTA, cattle), Bos indicus (BIN, zebu), Bubalus bubalis (BBU, water buffalo) and Tragelaphini tribes: Taurotragus oryx (TOR, eland) and Tragelaphus euryceros (TEU, bongo). Its presence in both tribes shows the sequence predates the evolutionary separation of the two tribes (more than 10 million years ago), and primary sequence shows increasing divergence with evolutionary distance. Genome organization (Southern hybridization) and physical distribution (in situ hybridization) revealed differences in the molecular organization of these satellite DNA sequences. The data suggest that the sequences on the sex chromosomes and the autosomes evolve as relatively independent groups, with the repetitive sequences suggesting that Bovini autosomes and the Tragelaphini sex chromosomes represent the more primitive chromosome forms. PMID:16825766

  7. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  8. Structural and functional analysis of the control region of the human DNA topoisomerase II alpha gene in drug-resistant cells.

    PubMed

    Takano, H; Ise, T; Nomoto, M; Kato, K; Murakami, T; Ohmori, H; Imamura, T; Nagatani, G; Okamoto, T; Ohta, R; Furukawa, M; Shibao, K; Izumi, H; Kuwano, M; Kohno, K

    1999-04-01

    We have previously shown that the DNA topoisomerase II alpha (topo II alpha) gene is down-regulated in VP16/VM26-resistant cells at the transcriptional level. To determine the DNA elements responsible for down-regulation, the transcriptional activities of luciferase reporter constructs containing various lengths of the promoter sequences were investigated by transient transfection of two resistant cell lines, KB/VP2 and KB/VM4. The transcriptional activities of the full-length promoter (-295 to +85) and of three deletion constructs (-197, -154 and -74 to +85) were significantly down-regulated in resistant cells. In contrast, the transcriptional activity of the minimal promoter (-20 to +85) in resistant cells was similar to that in parental KB cells. Furthermore, introduction of a mutation in ICE1 abolished the down-regulation of the topo II alpha promoter activity in drug-resistant cells. In vivo footprinting analysis of topo II alpha gene promoter revealed several specific protein-binding sites, a GC box, ICE1, ICE2 and ICE3. In vivo footprinting analysis also identified a cluster of hypersensitive sites. However, there was no marked difference in protein-binding sites between parental and resistant cells. To confirm our previous results, we have established the VP16-resistant cell lines T12-VP1 and T12-VP2 from T12 cells derived from human bladder cancer T24 cells stably transfected with the chloramphenicol acetyltransferase reporter gene driven by the topo II alpha gene promoter. The expression to topo II alpha was down-regulated in both cell lines. We also found that CAT gene expression was significantly decreased to one-fifth of that in T12 parental cells. These results suggest that the expression of the topo II alpha gene requires the binding of multiple factors to the core promoter and is down-regulated at the transcriptional level, probably through binding of a negative factor to ICE1 in drug-resistant cells. PMID:10405635

  9. Purification and characterization of alpha-glucosidase I from Japanese honeybee (Apis cerana japonica) and molecular cloning of its cDNA.

    PubMed

    Wongchawalit, Jintanart; Yamamoto, Takeshi; Nakai, Hiroyuki; Kim, Young-Min; Sato, Natsuko; Nishimoto, Mamoru; Okuyama, Masayuki; Mori, Haruhide; Saji, Osamu; Chanchao, Chanpen; Wongsiri, Siriwat; Surarit, Rudee; Svasti, Jisnuson; Chiba, Seiya; Kimura, Atsuo

    2006-12-01

    alpha-Glucosidase (JHGase I) was purified from a Japanese subspecies of eastern honeybee (Apis cerana japonica) as an electrophoretically homogeneous protein. Enzyme activity of the crude extract was mainly separated into two fractions (component I and II) by salting-out chromatography. JHGase I was isolated from component I by further purification procedure using CM-Toyopearl 650M and Sephacryl S-100. JHGase I was a monomeric glycoprotein (containing 15% carbohydrate), of which the molecular weight was 82,000. Enzyme displayed the highest activity at pH 5.0, and was stable up to 40 degrees C and in a pH-range of 4.5-10.5. JHGase I showed unusual kinetic features: the negative cooperative behavior on the intrinsic reaction on cleavage of sucrose, maltose, and p-nitrophenyl alpha-glucoside, and the positive cooperative behavior on turanose. We isolated cDNA (1,930 bp) of JHGase I, of which the deduced amino-acid sequence (577 residues) confirmed that JHGase I was a member of alpha-amylase family enzymes. Western honeybees (Apis mellifera) had three alpha-glucosidase isoenzymes (WHGase I, II, and III), in which JHGase I was considered to correspond to WHGase I. PMID:17151473

  10. Molecular cloning, sequence, and expression of a human GDP-L-fucose:. beta. -D-galactoside 2-. alpha. -L-fucosyltransferase cDNA that can form the H blood group antigen

    SciTech Connect

    Larsen, R.D.; Ernst, L.K.; Nair, R.P.; Lowe, J.B. )

    1990-09-01

    The authors have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:{beta}D-galactoside 2-{alpha}-L-fucosyltransferase. Although this fragment determined expression of an {alpha}(1,2)FT whose kinetic properties mirror those of the human H blood group {alpha}(1,2)FT, their precise nature remained undefined. They describe here the molecular cloning, sequence, and expression of a human of cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, the cDNA directs expression of cell surface H structures and a cognate {alpha}(1,2)FT activity with properties analogous to the human H blood group {alpha}(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an {alpha}(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identified DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned {alpha}(1,2)FT cDNA represents the product of the human H blood group locus.

  11. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    PubMed

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  12. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  13. The Saccharomyces cerevisiae DNA polymerase alpha catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein.

    PubMed Central

    Wittmeyer, J; Formosa, T

    1997-01-01

    We have used DNA polymerase alpha affinity chromatography to identify factors involved in eukaryotic DNA replication in the yeast Saccharomyces cerevisiae. Two proteins that bound to the catalytic subunit of DNA polymerase alpha (Pol1 protein) are encoded by the essential genes CDC68/SPT16 and POB3. The binding of both proteins was enhanced when extracts lacking a previously characterized polymerase binding protein, Ctf4, were used. This finding suggests that Cdc68 and Pob3 may compete with Ctf4 for binding to Pol1. Pol1 and Pob3 were coimmunoprecipitated from whole-cell extracts with antiserum directed against Cdc68, and Pol1 was immunoprecipitated from whole-cell extracts with antiserum directed against the amino terminus of Pob3, suggesting that these proteins may form a complex in vivo. CDC68 also interacted genetically with POL1 and CTF4 mutations; the maximum permissive temperature of double mutants was lower than for any single mutant. Overexpression of Cdc68 in a pol1 mutant strain dramatically decreased cell viability, consistent with the formation or modulation of an essential complex by these proteins in vivo. A mutation in CDC68/SPT16 had previously been shown to cause pleiotropic effects on the regulation of transcription (J. A. Prendergrast et al., Genetics 124:81-90, 1990; E. A. Malone et al., Mol. Cell. Biol. 11:5710-5717, 1991; A. Rowley et al., Mol. Cell. Biol. 11:5718-5726, 1991), with a spectrum of phenotypes similar to those caused by mutations in the genes encoding histone proteins H2A and H2B (Malone et al., Mol. Cell. Biol. 11:5710-5717, 1991). We show that at the nonpermissive temperature, cdc68-1 mutants arrest as unbudded cells with a 1C DNA content, consistent with a possible role for Cdc68 in the prereplicative stage of the cell cycle. The cdc68-1 mutation caused elevated rates of chromosome fragment loss, a phenotype characteristic of genes whose native products are required for normal DNA metabolism. However, this mutation did not

  14. Exploring the Diversity of Plant DNA Viruses and Their Satellites Using Vector-Enabled Metagenomics on Whiteflies

    PubMed Central

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E.; Bixby, Elise; Vallad, Gary E.; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed “vector-enabled metagenomics” (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral

  15. Exploring the diversity of plant DNA viruses and their satellites using vector-enabled metagenomics on whiteflies.

    PubMed

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E; Bixby, Elise; Vallad, Gary E; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed "vector-enabled metagenomics" (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral diseases

  16. Sealing of chromosomal DNA nicks during nucleotide excision repair requires XRCC1 and DNA ligase III alpha in a cell-cycle-specific manner.

    PubMed

    Moser, Jill; Kool, Hanneke; Giakzidis, Ioannis; Caldecott, Keith; Mullenders, Leon H F; Fousteri, Maria I

    2007-07-20

    Impaired gap filling and sealing of chromosomal DNA in nucleotide excision repair (NER) leads to genome instability. XRCC1-DNA ligase IIIalpha (XRCC1-Lig3) plays a central role in the repair of DNA single-strand breaks but has never been implicated in NER. Here we show that XRCC1-Lig3 is indispensable for ligation of NER-induced breaks and repair of UV lesions in quiescent cells. Furthermore, our results demonstrate that two distinct complexes differentially carry out gap filling in NER. XRCC1-Lig3 and DNA polymerase delta colocalize and interact with NER components in a UV- and incision-dependent manner throughout the cell cycle. In contrast, DNA ligase I and DNA polymerase epsilon are recruited to UV-damage sites only in proliferating cells. This study reveals an unexpected and key role for XRCC1-Lig3 in maintenance of genomic integrity by NER in both dividing and nondividing cells and provides evidence for cell-cycle regulation of NER-mediated repair synthesis in vivo. PMID:17643379

  17. The G115S mutation associated with maturity-onset diabetes of the young impairs hepatocyte nuclear factor 4alpha activities and introduces a PKA phosphorylation site in its DNA-binding domain.

    PubMed

    Oxombre, Bénédicte; Kouach, Mostafa; Moerman, Ericka; Formstecher, Pierre; Laine, Bernard

    2004-11-01

    HNF4alpha (hepatocyte nuclear factor 4alpha) belongs to a complex transcription factor network that is crucial for the function of hepatocytes and pancreatic beta-cells. In these cells, it activates the expression of a very large number of genes, including genes involved in the transport and metabolism of glucose and lipids. Mutations in the HNF4alpha gene correlate with MODY1 (maturity-onset diabetes of the young 1), a form of type II diabetes characterized by an impaired glucose-induced insulin secretion. The MODY1 G115S (Gly115-->Ser) HNF4alpha mutation is located in the DNA-binding domain of this nuclear receptor. We show here that the G115S mutation failed to affect HNF4alpha-mediated transcription on apolipoprotein promoters in HepG2 cells. Conversely, in pancreatic beta-cell lines, this mutation resulted in strong impairments of HNF4alpha transcriptional activity on the promoters of LPK (liver pyruvate kinase) and HNF1alpha, with this transcription factor playing a key role in endocrine pancreas. We show as well that the G115S mutation creates a PKA (protein kinase A) phosphorylation site, and that PKA-mediated phosphorylation results in a decreased transcriptional activity of the mutant. Moreover, the G115E (Gly115-->Glu) mutation mimicking phosphorylation reduced HNF4alpha DNA-binding and transcriptional activities. Our results may account for the 100% penetrance of diabetes in human carriers of this mutation. In addition, they suggest that introduction of a phosphorylation site in the DNA-binding domain may represent a new mechanism by which a MODY1 mutation leads to loss of HNF4alpha function. PMID:15233628

  18. DNA cleavage by new oxovanadium(IV) complexes of N-salicylidene alpha-amino acids and phenanthroline bases in the photodynamic therapy window.

    PubMed

    Sasmal, Pijus K; Patra, Ashis K; Nethaji, Munirathinam; Chakravarty, Akhil R

    2007-12-24

    Oxovanadium(IV) complexes [VO(salmet)(B)] (1-3) and [VO(saltrp)(B)] (4-6), where salmet and saltrp are N-salicylidene-l-methionate and N-salicylidene-l-tryptophanate, respectively, and B is a N,N-donor heterocyclic base (viz. 1,10-phenanthroline (phen, 1, 4), dipyrido[3,2-d:2',3'-f]quinoxaline (dpq, 2, 5), and dipyrido[3,2-a:2',3'-c]phenazine (dppz, 3, 6)) are prepared and characterized and their DNA binding and photoinduced DNA cleavage activity studied. Complexes 1, 2, and 4 are structurally characterized by single-crystal X-ray crystallography. The molecular structure shows the presence of a vanadyl group in the VO3N3 coordination geometry. The dianionic alpha-amino acid Schiff base acts as a tridentate O,N,O-donor ligand in a meridional binding mode. The N,N-donor heterocyclic base displays a chelating mode of bonding with a N-donor site trans to the oxo group. The complexes show a d-d band in the range of 680-710 nm in DMF with a shoulder near 840 nm. They exhibit an irreversible oxidative cyclic voltammetric response near 0.8 V assignable to the V(V)/V(IV) couple and a quasi-reversible V(IV)/V(III) redox couple near -1.1 V vs SCE in DMF-0.1 M TBAP. The complexes show good binding propensity to calf thymus DNA giving binding constant values in the range from 5.2 x 10(4) to 7.2 x 10(5) M(-1). The binding site size, thermal melting, and viscosity data suggest DNA surface and/or groove binding nature of the complexes. The complexes show poor "chemical nuclease" activity in the dark in the presence of 3-mercaptopropionic acid or hydrogen peroxide. The dpq and dppz complexes show efficient DNA cleavage activity on irradiation with UV-A light of 365 nm via a mechanistic pathway involving formation of singlet oxygen as the reactive species. They also show significant DNA cleavage activity on photoexcitation in red light (>750 nm) by (1)O2 species. Observation of red-light-induced cleavage of DNA is unprecedented in the vanadium chemistry. The DNA cleavage activity is

  19. Albumin and alpha-fetoprotein gene transcription in rat hepatoma cell lines is correlated with specific DNA hypomethylation and altered chromatin structure in the 5' region.

    PubMed Central

    Tratner, I; Nahon, J L; Sala-Trepat, J M; Venetianer, A

    1987-01-01

    We examined DNA methylation and DNase I hypersensitivity of the alpha-fetoprotein (AFP) and albumin gene region in hepatoma cell lines which showed drastic differences in the level of expression of these genes. We assayed for methylation of the CCGG sequences by using the restriction enzyme isoschizomers HpaII and MspI. We found two methylation sites located in the 5' region of the AFP gene and one in exon 1 of the albumin gene for which hypomethylation is correlated with gene expression. Another such site, located about 4,000 base pairs upstream from the AFP gene, seems to be correlated with the tissue specificity of the cells. DNase I-hypersensitive sites were mapped by using the indirect end-labeling technique with cloned genomic DNA probes. Three tissue-specific DNase I-hypersensitive sites were mapped in the 5' flanking region of the AFP gene when this gene was transcribed. Similarly, three tissue-specific DNase I-hypersensitive sites were detected upstream from the albumin gene in producing cell lines. In both cases, the most distal sites were maintained after cessation of gene activity and appear to be correlated with the potential expression of the gene. Interestingly, specific methylation sites are localized in the same DNA region as DNase I hypersensitive sites. This suggests that specific alterations of chromatin structure and changes in methylation pattern occur in specific critical regulatory regions upstream from the albumin and AFP genes in rat hepatoma cell lines. Images PMID:2439898

  20. A sensitive amperometric immunosensor for alpha-fetoprotein based on carbon nanotube/DNA/Thi/nano-Au modified glassy carbon electrode.

    PubMed

    Ran, Xiao-Qi; Yuan, Ruo; Chai, Ya-Qin; Hong, Cheng-Lin; Qian, Xiao-Qing

    2010-09-01

    A novel amperometric immunosensor for the determination of alpha-fetoprotein (AFP) was constructed using films of multi-wall carbon nanotubes/DNA/thionine/gold nanoparticles (nano-Au). Firstly, multiwall carbon nanotubes (MWCNT) dispersed in poly(diallydimethlammonium chloride) (PDDA) were immobilized on the nano-Au film which was electrochemically deposited on the surface of glassy carbon electrode. Then a negatively charged DNA film was absorbed on the positively charged PDDA. Subsequently, thionine was attached to the electrode via the electrostatic interaction between thionine and the DNA. Finally, the nano-Au was retained on the thionine film for immobilization of AFP antibody (anti-AFP). The modification process was characterized by cyclic voltammetry (CV) and scanning electron microscope (SEM). The factors possibly influenced the performance of the proposed immunosensors were studied in detail. Under optimal conditions, the proposed immunosensor exhibited good electrochemical behavior to AFP in a two concentration ranges: 0.01-10.0 and 10.0-200.0 ng/mL with a relatively low detection limit of 0.04 ng/mL at three times the background noise. Moreover, the selectivity, repeatability and stability of the proposed immunosensor were acceptable. PMID:20627666

  1. The Structure of DNA-Bound Human Topoisomerase II Alpha: Conformational Mechanisms for Coordinating Inter-Subunit Interactions with DNA Cleavage

    PubMed Central

    Wendorff, Timothy J.; Schmidt, Bryan H.; Heslop, Pauline; Austin, Caroline A.; Berger, James M.

    2012-01-01

    Type II topoisomerases are required for the management of DNA superhelicity and chromosome segregation, and serve as frontline targets for a variety of small-molecule therapeutics. To better understand how these enzymes act in both contexts, we determined the 2.9-Å-resolution structure of the DNA cleavage core of human topoisomerase IIα (TOP2A) bound to a doubly nicked, 30-bp duplex oligonucleotide. In accord with prior biochemical and structural studies, TOP2A significantly bends its DNA substrate using a bipartite, nucleolytic center formed at an N-terminal dimerization interface of the cleavage core. However, the protein also adopts a global conformation in which the second of its two inter-protomer contact points, one at the C-terminus, has separated. This finding, together with comparative structural analyses, reveals that the principal site of DNA engagement undergoes highly quantized conformational transitions between distinct binding, cleavage, and drug-inhibited states that correlate with the control of subunit–subunit interactions. Additional consideration of our TOP2A model in light of an etoposide-inhibited complex of human topoisomerase IIβ (TOP2B) suggests possible modification points for developing paralog-specific inhibitors to overcome the tendency of topoisomerase II-targeting chemotherapeutics to generate secondary malignancies. PMID:22841979

  2. Identification of a novel alpha-amylase by expression of a newly cloned human amy3 cDNA in yeast.

    PubMed

    Shiosaki, K; Takata, K; Omichi, K; Tomita, N; Horii, A; Ogawa, M; Matsubara, K

    1990-05-14

    A novel amylase gene (amy3) that differs in nucleotide sequence from salivary amylase gene (amy1) and pancreatic amylase gene (amy2) has been described [Tomita et al., Gene 76 (1989) 11-18], but whether this gene can ever code for an active enzyme has not been shown. We prepared cDNA of this gene from an mRNA obtained from lung carcinoid tissue, and expressed it in Saccharomyces cerevisiae under the control of an acid phosphatase promoter. The product was secreted into culture media, and showed enzymatic activity, demonstrating that this novel alpha-amylase gene (amy3) can code for a functional isozyme. We purified this enzyme, and compared its biological properties with those of salivary and pancreatic human amylases similarly expressed in yeast. We observed that the novel amylase isozyme is more heat-sensitive than others, and that its substrate specificity is different from the other two isozymes. PMID:2197187

  3. Relationship between maternal environment and DNA methylation patterns of estrogen receptor alpha in wild Eastern Bluebird (Sialia sialis) nestlings: a pilot study.

    PubMed

    Bentz, Alexandra B; Sirman, Aubrey E; Wada, Haruka; Navara, Kristen J; Hood, Wendy R

    2016-07-01

    There is mounting evidence that, across taxa, females breeding in competitive environments tend to allocate more testosterone to their offspring prenatally and these offspring typically have more aggressive and faster-growing phenotypes. To date, no study has determined the mechanisms mediating this maternal effect's influence on offspring phenotype. However, levels of estrogen receptor alpha (ER α) gene expression are linked to differences in early growth and aggression; thus, maternal hormones may alter gene regulation, perhaps via DNA methylation, of ER α in offspring during prenatal development. We performed a pilot study to examine natural variation in testosterone allocation to offspring through egg yolks in wild Eastern Bluebirds (Sialia sialis) in varying breeding densities and percent DNA methylation of CG dinucleotides in the ER α promoter in offspring brain regions associated with growth and behavior. We hypothesized that breeding density would be positively correlated with yolk testosterone, and prenatal exposure to maternal-derived yolk testosterone would be associated with greater offspring growth and decreased ER α promoter methylation. Yolk testosterone concentration was positively correlated with breeding density, nestling growth rate, and percent DNA methylation of one out of five investigated CpG sites (site 3) in the diencephalon ER α promoter, but none in the telencephalon (n = 10). Percent DNA methylation of diencephalon CpG site 3 was positively correlated with growth rate. These data suggest a possible role for epigenetics in mediating the effects of the maternal environment on offspring phenotype. Experimentally examining this mechanism with a larger sample size in future studies may help elucidate a prominent way in which animals respond to their environment. Further, by determining the mechanisms that mediate maternal effects, we can begin to understand the potential for the heritability of these mechanisms and the impact that

  4. The highly conserved amino acid sequence motif Tyr-Gly-Asp-Thr-Asp-Ser in alpha-like DNA polymerases is required by phage phi 29 DNA polymerase for protein-primed initiation and polymerization.

    PubMed Central

    Bernad, A; Lázaro, J M; Salas, M; Blanco, L

    1990-01-01

    The alpha-like DNA polymerases from bacteriophage phi 29 and other viruses, prokaryotes and eukaryotes contain an amino acid consensus sequence that has been proposed to form part of the dNTP binding site. We have used site-directed mutants to study five of the six highly conserved consecutive amino acids corresponding to the most conserved C-terminal segment (Tyr-Gly-Asp-Thr-Asp-Ser). Our results indicate that in phi 29 DNA polymerase this consensus sequence, although irrelevant for the 3'----5' exonuclease activity, is essential for initiation and elongation. Based on these results and on its homology with known or putative metal-binding amino acid sequences, we propose that in phi 29 DNA polymerase the Tyr-Gly-Asp-Thr-Asp-Ser consensus motif is part of the dNTP binding site, involved in the synthetic activities of the polymerase (i.e., initiation and polymerization), and that it is involved particularly in the metal binding associated with the dNTP site. Images PMID:2191296

  5. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  6. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  7. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    PubMed

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes. PMID:26205503

  8. Alpha-CENTAURI: assessing novel centromeric repeat sequence variation with long read sequencing

    PubMed Central

    Sevim, Volkan; Bashir, Ali; Chin, Chen-Shan; Miga, Karen H.

    2016-01-01

    Motivation: Long arrays of near-identical tandem repeats are a common feature of centromeric and subtelomeric regions in complex genomes. These sequences present a source of repeat structure diversity that is commonly ignored by standard genomic tools. Unlike reads shorter than the underlying repeat structure that rely on indirect inference methods, e.g. assembly, long reads allow direct inference of satellite higher order repeat structure. To automate characterization of local centromeric tandem repeat sequence variation we have designed Alpha-CENTAURI (ALPHA satellite CENTromeric AUtomated Repeat Identification), that takes advantage of Pacific Bioscience long-reads from whole-genome sequencing datasets. By operating on reads prior to assembly, our approach provides a more comprehensive set of repeat-structure variants and is not impacted by rearrangements or sequence underrepresentation due to misassembly. Results: We demonstrate the utility of Alpha-CENTAURI in characterizing repeat structure for alpha satellite containing reads in the hydatidiform mole (CHM1, haploid-like) genome. The pipeline is designed to report local repeat organization summaries for each read, thereby monitoring rearrangements in repeat units, shifts in repeat orientation and sites of array transition into non-satellite DNA, typically defined by transposable element insertion. We validate the method by showing consistency with existing centromere high order repeat references. Alpha-CENTAURI can, in principle, run on any sequence data, offering a method to generate a sequence repeat resolution that could be readily performed using consensus sequences available for other satellite families in genomes without high-quality reference assemblies. Availability and implementation: Documentation and source code for Alpha-CENTAURI are freely available at http://github.com/volkansevim/alpha-CENTAURI. Contact: ali.bashir@mssm.edu Supplementary information: Supplementary data are available at

  9. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central

    2010-01-01

    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  10. Centriolar Satellites

    PubMed Central

    Kubo, Akiharu; Sasaki, Hiroyuki; Yuba-Kubo, Akiko; Tsukita, Shoichiro; Shiina, Nobuyuki

    1999-01-01

    We identified Xenopus pericentriolar material-1 (PCM-1), which had been reported to constitute pericentriolar material, cloned its cDNA, and generated a specific pAb against this molecule. Immunolabeling revealed that PCM-1 was not a pericentriolar material protein, but a specific component of centriolar satellites, morphologically characterized as electron-dense granules, ∼70–100 nm in diameter, scattered around centrosomes. Using a GFP fusion protein with PCM-1, we found that PCM-1–containing centriolar satellites moved along microtubules toward their minus ends, i.e., toward centrosomes, in live cells, as well as in vitro reconstituted asters. These findings defined centriolar satellites at the molecular level, and explained their pericentriolar localization. Next, to understand the relationship between centriolar satellites and centriolar replication, we examined the expression and subcellular localization of PCM-1 in ciliated epithelial cells during ciliogenesis. When ciliogenesis was induced in mouse nasal respiratory epithelial cells, PCM-1 immunofluorescence was markedly elevated at the apical cytoplasm. At the electron microscopic level, anti–PCM-1 pAb exclusively labeled fibrous granules, but not deuterosomes, both of which have been suggested to play central roles in centriolar replication in ciliogenesis. These findings suggested that centriolar satellites and fibrous granules are identical novel nonmembranous organelles containing PCM-1, which may play some important role(s) in centriolar replication. PMID:10579718

  11. Alpha taxonomy of the genus Kessleria Nowicki, 1864, revisited in light of DNA-barcoding (Lepidoptera, Yponomeutidae)

    PubMed Central

    Huemer, Peter; Mutanen, Marko

    2015-01-01

    Abstract The taxonomy of Kessleria, a highly specialized montane genus of Yponomeutidae with larval host restriction to Saxifragaceae and Celastraceae (Saxifraga spp. – subgenus Kessleria; Saxifraga spp. and Parnassia spp. – subgenus Hofmannia), is revised based on external morphology, genitalia and DNA barcodes. An integrative taxonomic approach supports the existence of 29 species in Europe (the two known species from Asia and North America are not treated herein). A full 658 bp fragment of COI was obtained from 135 specimens representing 24 species, a further seven sequences are >560 bp. Five new species are described: Kessleria cottiensis sp. n. (Prov. Torino, Italy; Dep. Hautes Alpes, France), Kessleria dimorpha sp. n. (Dep. Alpes-de-Haute-Provence, France), Kessleria alpmaritimae sp. n. (Dep. Alpes-Maritimes, France), Kessleria apenninica sp. n. (Prov. Rieti, Prov. L´Aquila, Italy), and Kessleria orobiae sp. n. (Prov. Bergamo, Italy). PMID:26019672

  12. Hepatic global DNA and peroxisome proliferator-activated receptor alpha promoter methylation are altered in peripartal dairy cows fed rumen-protected methionine.

    PubMed

    Osorio, J S; Jacometo, C B; Zhou, Z; Luchini, D; Cardoso, F C; Loor, J J

    2016-01-01

    The availability of Met in metabolizable protein (MP) of a wide range of diets for dairy cows is low. During late pregnancy and early lactation, in particular, suboptimal Met in MP limits its use for mammary and liver metabolism and also for the synthesis of S-adenosylmethionine, which is essential for many biological processes, including DNA methylation. The latter is an epigenetic modification involved in the regulation of gene expression, hence, tissue function. Thirty-nine Holstein cows were fed throughout the peripartal period (-21 d to 30 d in milk) a basal control (CON) diet (n=14) with no Met supplementation, CON plus MetaSmart (MS; Adisseo NA, Alpharetta, GA; n=12), or CON plus Smartamine M (SM; Adisseo NA; n=13). The total mixed ration dry matter for the close-up and lactation diets was measured weekly, then the Met supplements were adjusted daily and top-dressed over the total mixed ration at a rate of 0.19 (MS) or 0.07% (SM) on a dry matter basis. Liver tissue was collected on -10, 7, and 21 d for global DNA and peroxisome proliferator-activated receptor alpha (PPARα) promoter region-specific methylation. Several PPARα target and putative target genes associated with carnitine synthesis and uptake, fatty acid metabolism, hepatokines, and carbohydrate metabolism were also studied. Data were analyzed using PROC MIXED of SAS (SAS Institute Inc., Cary, NC) with the preplanned contrast CON versus SM + MS. Global hepatic DNA methylation on d 21 postpartum was lower in Met-supplemented cows than CON. However, of 2 primers used encompassing 4 to 12 CpG sites in the promoter region of bovine PPARA, greater methylation occurred in the region encompassing -1,538 to -1,418 from the transcription start site in cows supplemented with Met. Overall expression of PPARA was greater in Met-supplemented cows than CON. Concomitantly, PPARA-target genes, such as ANGPTL4, FGF21, and PCK1, were also upregulated overall by Met supplementation. The upregulation of PPAR

  13. A Naturally Occurring Defective DNA Satellite Associated with a Monopartite Begomovirus: Evidence for Recombination between Alphasatellite and Betasatellite

    PubMed Central

    Huang, Changjun; Xie, Yan; Zhao, Liling; Ren, He; Li, Zhenghe

    2013-01-01

    Monopartite begomoviruses and their associated satellites form unique disease complexes that have emerged as a serious threat to agriculture worldwide. It is well known that frequent recombination contributes to the diversification and evolution of geminiviruses. In this study, we identified a novel defective satellite molecule (RecSat) in association with Tobacco leaf curl Yunnan virus (TbLCYNV) in a naturally infected tobacco plant. Sequence analysis showed that Recsat comprises 754 nucleotides in size and is a chimera involving alphasatellite and betasatellite sequences, containing both betasatellite-conserved region and alphasatellite stem-loop structure. Recombination analysis revealed that RecSat has arisen from three independent recombination events likely involving Tomato yellow leaf curl China betasatellite, Ageratum yellow vein China betasatellite and Tobacco curly shoot alphasatellite. Co-inoculation of RecSat with TbLCYNV induced symptoms indistinguishable from those induced by TbLCYNV alone in Nicotiana benthamiana. Southern blot hybridization showed that RecSat could be trans-replicated stably in N. benthamiana plants by TbLCYNV, and impaired the accumulation of helper virus and co-inoculated alphasatellite. Our results provide the first evidence for recombination between two distinct types of satellites among geminivirus complex and highlight recombination as a driving force for geminivirus evolution. PMID:24018984

  14. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  15. Cloning and characterization of the 5'-upstream sequence governing the cell cycle-dependent transcription of mouse DNA polymerase alpha 68 kDa subunit gene.

    PubMed

    Nishikawa, N S; Izumi, M; Uchida, H; Yokoi, M; Miyazawa, H; Hanaoka, F

    2000-04-01

    We have isolated the genomic DNA fragment spanning the 5-end and the first four exons encoding the 68 kDa subunit (p68) of the mouse DNA polymerase alpha-primase complex [corrected]. The p68 promoter region lacks TATA and CAAT boxes, but contains a GC-rich sequence, two palindrome sequences and two putative E2F-binding sites [corrected]. A series of transient expression assays using a luciferase reporter gene indicated that a region from nucleotide position -89 to -30 (-89/-30) with respect to the transcription initiation site is crucial for basal transcription of the p68 gene in proliferating NIH 3T3 cells. In particular, part of the GC-rich sequence (-57/-46) and the palindrome (-81/-62) elements were necessary for promoter activity, both of which share homology with the E-box sequence. Gel mobility shift assays using NIH 3T3 nuclear extracts revealed that the upstream stimulatory factor, known as an E-box-binding protein, binds to these sites. Moreover, we observed binding of E2F to two sites near the transcription initiation site (-11/-3 and +9/+16). A transient luciferase expression assay using synchronized NIH 3T3 cells in G(0)phase revealed that these E2F sites are essential for transcription induction of the p68 gene after serum stimulation, but are dispensable for basal transcription. These results indicate that growth-dependent regulation of transcription of the mouse p68 and p180 genes is mediated by a common factor, E2F; however, basal transcription of the genes, interestingly, is regulated by different transcription factors. PMID:10710418

  16. Genome-wide analysis of tandem repeats in Tribolium castaneum genome reveals abundant and highly dynamic tandem repeat families with satellite DNA features in euchromatic chromosomal arms

    PubMed Central

    Pavlek, Martina; Gelfand, Yevgeniy; Plohl, Miroslav; Meštrović, Nevenka

    2015-01-01

    Although satellite DNAs are well-explored components of heterochromatin and centromeres, little is known about emergence, dispersal and possible impact of comparably structured tandem repeats (TRs) on the genome-wide scale. Our bioinformatics analysis of assembled Tribolium castaneum genome disclosed significant contribution of TRs in euchromatic chromosomal arms and clear predominance of satellite DNA-typical 170 bp monomers in arrays of ≥5 repeats. By applying different experimental approaches, we revealed that the nine most prominent TR families Cast1–Cast9 extracted from the assembly comprise ∼4.3% of the entire genome and reside almost exclusively in euchromatic regions. Among them, seven families that build ∼3.9% of the genome are based on ∼170 and ∼340 bp long monomers. Results of phylogenetic analyses of 2500 monomers originating from these families show high-sequence dynamics, evident by extensive exchanges between arrays on non-homologous chromosomes. In addition, our analysis shows that concerted evolution acts more efficiently on longer than on shorter arrays. Efficient genome-wide distribution of nine TR families implies the role of transposition only in expansion of the most dispersed family, and involvement of other mechanisms is anticipated. Despite similarities in sequence features, FISH experiments indicate high-level compartmentalization of centromeric and euchromatic tandem repeats. PMID:26428853

  17. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  18. Structural bases of dimerization of yeast telomere protein Cdc13 and its interaction with the catalytic subunit of DNA polymerase [alpha

    SciTech Connect

    Sun, Jia; Yang, Yuting; Wan, Ke; Mao, Ninghui; Yu, Tai-Yuan; Lin, Yi-Chien; DeZwaan, Diane C.; Freeman, Brian C.; Lin, Jing-Jer; Lue, Neal F.; Lei, Ming

    2011-08-24

    Budding yeast Cdc13-Stn1-Ten1 (CST) complex plays an essential role in telomere protection and maintenance, and has been proposed to be a telomere-specific replication protein A (RPA)-like complex. Previous genetic and structural studies revealed a close resemblance between Stn1-Ten1 and RPA32-RPA14. However, the relationship between Cdc13 and RPA70, the largest subunit of RPA, has remained unclear. Here, we report the crystal structure of the N-terminal OB (oligonucleotide/oligosaccharide binding) fold of Cdc13. Although Cdc13 has an RPA70-like domain organization, the structures of Cdc13 OB folds are significantly different from their counterparts in RPA70, suggesting that they have distinct evolutionary origins. Furthermore, our structural and biochemical analyses revealed unexpected dimerization by the N-terminal OB fold and showed that homodimerization is probably a conserved feature of all Cdc13 proteins. We also uncovered the structural basis of the interaction between the Cdc13 N-terminal OB fold and the catalytic subunit of DNA polymerase {alpha} (Pol1), and demonstrated a role for Cdc13 dimerization in Pol1 binding. Analysis of the phenotypes of mutants defective in Cdc13 dimerization and Cdc13-Pol1 interaction revealed multiple mechanisms by which dimerization regulates telomere lengths in vivo. Collectively, our findings provide novel insights into the mechanisms and evolution of Cdc13.

  19. Stable transfection of protein kinase C alpha cDNA in hormone-dependent breast cancer cell lines

    PubMed Central

    Tonetti, D A; Chisamore, M J; Grdina, W; Schurz, H; Jordan, V C

    2000-01-01

    An inverse relationship between protein kinase C (PKC) activity and oestrogen receptor (ER) expression in human breast cell lines and tumours has been firmly established over the past 10 years. To determine whether specific alterations in PKC expression accompany hormone-independence, we examined the expression of PKC isozymes in the hormone-independent human breast cancer cell clones MCF-7 5C and T47D:C42 compared with their hormone-dependent counterparts, MCF-7 A4, MCF-7 WS8 and T47D:A18 respectively. Both hormone-independent cell clones exhibit elevated PKCα expression and increased basal AP-1 activity compared with the hormone-dependent cell clones. To determine whether PKCα overexpression is sufficient to mediate the hormone-independent phenotype, we stably transfected an expression plasmid containing PKCα cDNA to the T47D:A18 and MCF-7 A4 cell lines. This is the first report of PKCα transfection in T47D cells. In contrast to MCF-7 cells, T47D has the propensity to lose the ER and more readily forms tamoxifen-stimulated tumours in athymic mice. We find that in T47D:A18/PKCα clones, there is concomitant up-regulation of PKC βI and δ, whereas in the MCF-7 A4/PKCα transfectants PKC ɛ is up-regulated. In T47D:A18, but not in MCF-7 A4, PKCα stable transfection is accompanied by down-regulation of ER function whilst basal AP-1 activity is elevated. Our results suggest PKCα overexpression may play a role in growth signalling during the shift from hormone dependent to hormone-independent breast cancers. © 2000 Cancer Research Campaign PMID:10952784

  20. Complementary DNA and derived amino acid sequence of the. beta. subunit of human complement protein C8: identification of a close structural and ancestral relationship to the. cap alpha. subunit and C9

    SciTech Connect

    Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.

    1987-06-16

    A cDNA clone encoding the ..beta.. subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire ..beta.. sequence (1608 base pairs (bp)). Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for ..beta.. to be approx. 2.5 kb. This is similar to the message size for the ..cap alpha.. subunit of C8 and confirms the existence of different mRNAs for ..cap alpha.. and ..beta... This finding supports genetic evidence that ..cap alpha.. and ..beta.. are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate ..beta.. interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the ..beta.. sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For ..beta.. and ..cap alpha.., the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For ..beta.. and C9, the values are 26% and 47/sup 5/, respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that ..cap alpha.., ..beta.. and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association.

  1. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.

    PubMed

    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P

    2003-11-01

    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  2. DNA Double Strand Breaks as Predictor of Efficacy of the Alpha-Particle Emitter Ac-225 and the Electron Emitter Lu-177 for Somatostatin Receptor Targeted Radiotherapy

    PubMed Central

    Graf, Franziska; Fahrer, Jörg; Maus, Stephan; Morgenstern, Alfred; Bruchertseifer, Frank; Venkatachalam, Senthil; Fottner, Christian; Weber, Matthias M.; Huelsenbeck, Johannes; Schreckenberger, Mathias; Kaina, Bernd; Miederer, Matthias

    2014-01-01

    Rationale Key biologic effects of the alpha-particle emitter Actinium-225 in comparison to the beta-particle emitter Lutetium-177 labeled somatostatin-analogue DOTATOC in vitro and in vivo were studied to evaluate the significance of γH2AX-foci formation. Methods To determine the relative biological effectiveness (RBE) between the two isotopes (as - biological consequence of different ionisation-densities along a particle-track), somatostatin expressing AR42J cells were incubated with Ac-225-DOTATOC and Lu-177-DOTATOC up to 48 h and viability was analyzed using the MTT assay. DNA double strand breaks (DSB) were quantified by immunofluorescence staining of γH2AX-foci. Cell cycle was analyzed by flow cytometry. In vivo uptake of both radiolabeled somatostatin-analogues into subcutaneously growing AR42J tumors and the number of cells displaying γH2AX-foci were measured. Therapeutic efficacy was assayed by monitoring tumor growth after treatment with activities estimated from in vitro cytotoxicity. Results Ac-225-DOTATOC resulted in ED50 values of 14 kBq/ml after 48 h, whereas Lu-177-DOTATOC displayed ED50 values of 10 MBq/ml. The number of DSB grew with increasing concentration of Ac-225-DOTATOC and similarly with Lu-177-DOTATOC when applying a factor of 700-fold higher activity compared to Ac-225. Already 24 h after incubation with 2.5–10 kBq/ml, Ac-225-DOTATOC cell-cycle studies showed up to a 60% increase in the percentage of tumor cells in G2/M phase. After 72 h an apoptotic subG1 peak was also detectable. Tumor uptake for both radio peptides at 48 h was identical (7.5%ID/g), though the overall number of cells with γH2AX-foci was higher in tumors treated with 48 kBq Ac-225-DOTATOC compared to tumors treated with 30 MBq Lu-177-DOTATOC (35% vs. 21%). Tumors with a volume of 0.34 ml reached delayed exponential tumor growth after 25 days (44 kBq Ac-225-DOTATOC) and after 21 days (34 MBq Lu-177-DOTATOC). Conclusion γH2AX-foci formation, triggered by beta- and

  3. Expression of ATP synthase CF1 alpha subunit gene (CTL-spn) as screened by the cDNA-SRAP approach is correlated with spininess in Carthamus tinctorius L.

    PubMed

    Guo, Dan-dan; Guo, Qing-hua; Gao, Yue; Guo, Mei-li

    2015-08-01

    The safflower floret is a traditional Chinese medicine used to promote blood circulation and remove obstruction in the channels. The spines on its bracts are considered a handicap when manual harvest is involved. In this study, cDNA-SRAP was used to systematically investigate which genes are associated with the spines. Sixty pairs of possible primer combinations were used on two cDNA pools representing spininess and spinelessness. Six transcript-derived fragments were identified, of which two with low recombination were sequenced successfully and named as GPY-1 and GPY-2. By using the RACE method, the full-length cDNA of GPY-2 is cloned and named as CTL-spn. The full-length cDNA of CTL-spn was 1 679 bp long with a 1 524 bp ORF encoding a 508 aminoacid protein. The deduced amino acid sequence of the CTL-spn gene shared a high homology (97%) with other known ATP synthase CF1 alpha subunits. Semiquantitative RT-PCR analysis revealed that the mRNA of GPY-1 and GPY-2 accumulated in only spiny lines. Considering the important role of ATP synthase CF1 alpha subunit in plants, it may directly take part in the formation process of spininess and enhancing resistance reaction of spiny safflower. Also, our results provide the important insights for breeding spineless cultivars of safflower. PMID:26669008

  4. Alpha Particle

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  5. Replication pattern of human repeated DNA sequences.

    PubMed

    Meneveri, R; Agresti, A; Breviario, D; Ginelli, E

    1984-10-01

    Either aphidicolin- or thymidine-synchronized human HL-60 cells were used to study the replication pattern of a family of human repetitive DNA sequences, the Eco RI 340 bp family (alpha RI-DNA), and of the ladders of fragments generated in total human DNA after digestion with XbaI and HaeIII (alpha satellite sequences). DNAs replicated in early, middle-early, middle-late and late S periods were labelled with BUdR or with [3H]thymidine. The efficiency of the cell synchronization procedure was confirmed by the transition from a high-GC to a high-AT average base composition of the DNA synthesized going from early to late S periods. By hybridizing EcoRI 340 bp repetitive fragments to BUdR-DNAs it was found that this family of sequences is replicated throughout the entire S period. Comparing fluorograph densitometric scans of [3H]DNAs to the scans of ethidium bromide patterns of total HL-60 DNA digested with XbaI and HaeIII, it was observed that DNA synthesized in different S periods is characterized by approximately the same ladder of fragments, while the intensity of each band may vary through the S phase; in particular, the XbaI 2.4 kb fragment becomes undetectable in late S. PMID:6089891

  6. An improved DNA-based test for detection of the codon 616 mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi.

    PubMed

    Petersen-Jones, Simon M; Entz, David D

    2002-06-01

    The aim of the study was to develop an improved test to detect the codon 616 gene mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi. We studied 10 control dogs of known genotype at codon 616 of the alpha cyclic GMP phosphodiesterase gene and 80 Cardigan Welsh Corgis of unknown genotype. A polymerase chain reaction (PCR) utilizing a mismatched primer was designed so that it introduced a HinfI restriction enzyme digestion site into the PCR product only if the normal gene sequence was present, the restriction site was not introduced if the codon 616 mutation was present. An additional HinfI site present in the amplified section from both normal and mutant alleles acted as a positive control for restriction enzyme digestion. The PCR reliably amplified a portion of the alpha cyclic GMP phosphodiesterase gene spanning the codon 616 mutation site. Restriction enzyme digestion with HinfI and analysis on a suitable agarose gel reliably ascertained the genotype of the control dogs and was used to identify the genotype of a further 80 test dogs. An improved DNA-based test for detection of the codon 616 mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi has been designed. This overcomes potential problems that could be associated with allele-specific PCR tests such as that used previously in a diagnostic test for this gene mutation. PMID:12071867

  7. Satellite Communication.

    ERIC Educational Resources Information Center

    Technology Teacher, 1985

    1985-01-01

    Presents a discussion of communication satellites: explains the principles of satellite communication, describes examples of how governments and industries are currently applying communication satellites, analyzes issues confronting satellite communication, links mathematics and science to the study of satellite communication, and applies…

  8. Helitrons shaping the genomic architecture of Drosophila: enrichment of DINE-TR1 in α- and β-heterochromatin, satellite DNA emergence, and piRNA expression.

    PubMed

    Dias, Guilherme B; Heringer, Pedro; Svartman, Marta; Kuhn, Gustavo C S

    2015-09-01

    Drosophila INterspersed Elements (DINEs) constitute an abundant but poorly understood group of Helitrons present in several Drosophila species. The general structure of DINEs includes two conserved blocks that may or not contain a region with tandem repeats in between. These central tandem repeats (CTRs) are similar within species but highly divergent between species. It has been assumed that CTRs have independent origins. Herein, we identify a subset of DINEs, termed DINE-TR1, which contain homologous CTRs of approximately 150 bp. We found DINE-TR1 in the sequenced genomes of several Drosophila species and in Bactrocera tryoni (Acalyptratae, Diptera). However, interspecific high sequence identity (∼ 88 %) is limited to the first ∼ 30 bp of each tandem repeat, implying that evolutionary constraints operate differently over the monomer length. DINE-TR1 is unevenly distributed across the Drosophila phylogeny. Nevertheless, sequence analysis suggests vertical transmission. We found that CTRs within DINE-TR1 have independently expanded into satellite DNA-like arrays at least twice within Drosophila. By analyzing the genome of Drosophila virilis and Drosophila americana, we show that DINE-TR1 is highly abundant in pericentromeric heterochromatin boundaries, some telomeric regions and in the Y chromosome. It is also present in the centromeric region of one autosome from D. virilis and dispersed throughout several euchromatic sites in both species. We further found that DINE-TR1 is abundant at piRNA clusters, and small DINE-TR1-derived RNA transcripts (∼25 nt) are predominantly expressed in the testes and the ovaries, suggesting active targeting by the piRNA machinery. These features suggest potential piRNA-mediated regulatory roles for DINEs at local and genome-wide scales in Drosophila. PMID:26408292

  9. Detection of alpha- and epsilon-toxigenic Clostridium perfringens type D in sheep and goats using a DNA amplification technique (PCR).

    PubMed

    Miserez, R; Frey, J; Buogo, C; Capaul, S; Tontis, A; Burnens, A; Nicolet, J

    1998-05-01

    Clostridium perfringens isolated from sheep and goat with enterotoxaemia at necropsy and from healthy animals at slaughter were typed using specific PCR assays for the detection of the alpha-, beta- and epsilon-toxin genes. Clostridium perfringens isolated from all 52 animals with pathological signs of enterotoxaemia showed the presence of the alpha- and epsilon-toxin genes but were devoid of the beta-toxin gene. These strains could therefore be identified as type D, characteristic for clostridial enterotoxaemia of sheep, lambs and goats. In contrast, Cl. perfringens isolated from 11 of 13 healthy animals only contained the alpha-toxin gene which is typical for type A. Two of the healthy animals contained Cl. perfringens with the alpha- and epsilon-toxin genes. However, when several individual Cl. perfringens colonies were analysed from each of these two animals, only a small percentage was found to contain the epsilon-toxin gene, whereas the majority of the colonies were of type A with the alpha-toxin gene only. This is in contrast to the findings from the diseased animals which contained practically only type D Cl. perfringens. The beta-toxin gene was not found in any Cl. perfringens isolate from goat and sheep. Comparison of the PCR data with results obtained by the classical biological toxin assay using the mouse model showed a good correlation. PMID:9674169

  10. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    PubMed Central

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  11. The All-Alpha Domains of Coupling Proteins from the Agrobacterium tumefaciens VirB/VirD4 and Enterococcus faecalis pCF10-Encoded Type IV Secretion Systems Confer Specificity to Binding of Cognate DNA Substrates

    PubMed Central

    Whitaker, Neal; Chen, Yuqing; Jakubowski, Simon J.; Sarkar, Mayukh K.; Li, Feng

    2015-01-01

    ABSTRACT Bacterial type IV coupling proteins (T4CPs) bind and mediate the delivery of DNA substrates through associated type IV secretion systems (T4SSs). T4CPs consist of a transmembrane domain, a conserved nucleotide-binding domain (NBD), and a sequence-variable helical bundle called the all-alpha domain (AAD). In the T4CP structural prototype, plasmid R388-encoded TrwB, the NBD assembles as a homohexamer resembling RecA and DNA ring helicases, and the AAD, which sits at the channel entrance of the homohexamer, is structurally similar to N-terminal domain 1 of recombinase XerD. Here, we defined the contributions of AADs from the Agrobacterium tumefaciens VirD4 and Enterococcus faecalis PcfC T4CPs to DNA substrate binding. AAD deletions abolished DNA transfer, whereas production of the AAD in otherwise wild-type donor strains diminished the transfer of cognate but not heterologous substrates. Reciprocal swaps of AADs between PcfC and VirD4 abolished the transfer of cognate DNA substrates, although strikingly, the VirD4-AADPcfC chimera (VirD4 with the PcfC AAD) supported the transfer of a mobilizable plasmid. Purified AADs from both T4CPs bound DNA substrates without sequence preference but specifically bound cognate processing proteins required for cleavage at origin-of-transfer sequences. The soluble domains of VirD4 and PcfC lacking their AADs neither exerted negative dominance in vivo nor specifically bound cognate processing proteins in vitro. Our findings support a model in which the T4CP AADs contribute to DNA substrate selection through binding of associated processing proteins. Furthermore, MOBQ plasmids have evolved a docking mechanism that bypasses the AAD substrate discrimination checkpoint, which might account for their capacity to promiscuously transfer through many different T4SSs. IMPORTANCE For conjugative transfer of mobile DNA elements, members of the VirD4/TraG/TrwB receptor superfamily bind cognate DNA substrates through mechanisms that are

  12. Satellite communications

    NASA Astrophysics Data System (ADS)

    Rubin, Philip A.

    A review of the economic and technological status of the satellite communications industry is presented. The history of satellite communications is outlined, focusing on the launching of Syncom III in 1963. The basic operation of communication satellites is explained. The differences between C and Ku frequency bands are examined. Economic issues related to satellite communications are discussed in detail.

  13. Satellite communications

    NASA Astrophysics Data System (ADS)

    Saha, M. K.

    1982-11-01

    The paper describes the basic principles and the historial development of satellite communications. Various satellite systems for global communications are discused and compared. Some typical operational communication satellite systems summary including geostationary systems are presented. Considerations leading to the system design including the link design for various multiple access techniques and the future trends in satellite communications systems are also discussed.

  14. Virophages or satellite viruses?

    PubMed

    Krupovic, Mart; Cvirkaite-Krupovic, Virginija

    2011-11-01

    It has been argued that the smaller viruses associated with giant DNA viruses are a new biological entity. However, Mart Krupovic and Virginija Cvirkaite-Krupovic argue here that these smaller viruses should be classified with the satellite viruses. PMID:22016897

  15. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  16. Suppression of RNA Silencing by a Plant DNA Virus Satellite Requires a Host Calmodulin-Like Protein to Repress RDR6 Expression

    PubMed Central

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-01-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  17. Suppression of RNA silencing by a plant DNA virus satellite requires a host calmodulin-like protein to repress RDR6 expression.

    PubMed

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-02-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  18. FISH analysis of the arrangement of chromosomes in interphase nuclei using telomeric, centromeric, and DNA painting probes

    NASA Astrophysics Data System (ADS)

    Monajembashi, Shamci; Schmitt, Eberhard; Dittmar, Heike; Greulich, Karl-Otto

    1999-01-01

    Fluorescence in situ hybridization is used to study the arrangement of chromosomes in interphase nuclei of unsynchronized human lymphocytes. DNA probes specific for telomeric DNA, centromeric (alpha) -satellite DNA and whole chromosomes 2, 7, 9 and X are employed. It is demonstrated that the shape of the chromosome territories is variable in cycling cells, for example, close to the metaphase chromosome homologues are arranged pairwise. Furthermore, the relative arrangement of chromosome homologues to each other is not spatially defined. Also, the relative orientation of centromeres and telomeres within a chromosome domain is variable.

  19. Tau protein binds to pericentromeric DNA: a putative role for nuclear tau in nucleolar organization.

    PubMed

    Sjöberg, Marcela K; Shestakova, Elena; Mansuroglu, Zeyni; Maccioni, Ricardo B; Bonnefoy, Eliette

    2006-05-15

    The microtubule-associated tau protein participates in the organization and integrity of the neuronal cytoskeleton. A nuclear form of tau has been described in neuronal and non-neuronal cells, which displays a nucleolar localization during interphase but is associated with nucleolar-organizing regions in mitotic cells. In the present study, based on immunofluorescence, immuno-FISH and confocal microscopy, we show that nuclear tau is mainly present at the internal periphery of nucleoli, partially colocalizing with the nucleolar protein nucleolin and human AT-rich alpha-satellite DNA sequences organized as constitutive heterochromatin. By using gel retardation, we demonstrate that tau not only colocalizes with, but also specifically binds to, AT-rich satellite DNA sequences apparently through the recognition of AT-rich DNA stretches. Here we propose a functional role for nuclear tau in relation to the nucleolar organization and/or heterochromatinization of a portion of RNA genes. Since nuclear tau has also been found in neurons from patients with Alzheimer's disease (AD), aberrant nuclear tau could affect the nucleolar organization during the course of AD. We discuss nucleolar tau associated with AT-rich alpha-satellite DNA sequences as a potential molecular link between trisomy 21 and AD. PMID:16638814

  20. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  1. Satellite RNAs and Satellite Viruses.

    PubMed

    Palukaitis, Peter

    2016-03-01

    Satellite RNAs and satellite viruses are extraviral components that can affect either the pathogenicity, the accumulation, or both of their associated viruses while themselves being dependent on the associated viruses as helper viruses for their infection. Most of these satellite RNAs are noncoding RNAs, and in many cases, have been shown to alter the interaction of their helper viruses with their hosts. In only a few cases have the functions of these satellite RNAs in such interactions been studied in detail. In particular, work on the satellite RNAs of Cucumber mosaic virus and Turnip crinkle virus have provided novel insights into RNAs functioning as noncoding RNAs. These effects are described and potential roles for satellite RNAs in the processes involved in symptom intensification or attenuation are discussed. In most cases, models describing these roles involve some aspect of RNA silencing or its suppression, either directly or indirectly involving the particular satellite RNA. PMID:26551994

  2. RADIATION SENSITIVITY & PROCESSING OF DNA DAMAGE FOLLOWING LOW DOSES OF GAMMA-RAY ALPHA PARTICLES & HZE IRRADIATION OF NORMAL DSB REPAIR DEFICIENT CELLS

    SciTech Connect

    O'Neil, Peter

    2009-05-15

    Non-homologous end joining (NHEJ) predominates in the repair of DNA double strand breaks (DSB) over homologous recombination (HR). NHEJ occurs throughout the cell cycle whereas HR occurs in late S/G2 due to the requirement of a sister chromatid (Rothkamm et al, Mol Cell Biol 23 5706-15 [2003]). To date evidence obtained with DSB repair deficient cells using pulsed-field gel electrophoresis has revealed the major pathway throughout all phases of the cell cycle for processing high dose induced DSBs is NHEJ (Wang et al, Oncogene 20 2212-24 (2001); Pluth et al, Cancer Res. 61 2649-55 [2001]). These findings however were obtained at high doses when on average >> 20-30 DSBs are formed per cell. The contribution of the repair pathways (NHEJ and HR) induced in response to DNA damage during the various phases of the cell cycle may depend upon the dose (the level of initial DSBs) especially since low levels of DSBs are induced at low dose. To date, low dose studies using NHEJ and HR deficient mutants have not been carried out to address this important question with radiations of different quality. The work presented here leads us to suggest that HR plays a relatively minor role in the repair of radiation-induced prompt DSBs. SSBs lead to the induction of DSBs which are associated specifically with S-phase cells consistent with the idea that they are formed at stalled replication forks in which HR plays a major role in repair. That DNA-PKcs is in some way involved in the repair of the precursors to replication-induced DSB remains an open question. Persistent non-DSB oxidative damage also leads to an increase in RAD51 positive DSBs. Both simple and complex non-DSB DNA damage may therefore contribute to indirect DSBs induced by ionising radiation at replication forks.

  3. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  4. Effect of DNA interaction involving antioxidative 4-aminoantipyrine incorporating mixed ligand complexes having alpha-amino acid as co-ligand

    NASA Astrophysics Data System (ADS)

    Raman, Natarajan; Sakthivel, Arunagiri; Selvaganapathy, Muthusamy; Mitu, Liviu

    2014-02-01

    Few new mixed ligand transition metal complexes of the stoichiometry [ML(A)2], where M = Co(II), Ni(II), Cu(II) and Zn(II), L = FFAP (furfurylidene-4-aminoantipyrine) and A = amino acid (glycine/alanine/valine), have been designed, synthesized and characterized. The molar conductivity of the complexes in DMF at 10-3 M concentration shows that they are non-electrolytes. The interaction of these complexes with CT-DNA indicates that the valine mixed ligand complexes are having higher binding constant than alanine and glycine mixed ligand complexes. This analysis reveals that binding constant depends on the size of the alkyl group present in the amino acid. The binding constants of valine mixed ligand complexes are in the order of 104 to 105 M-1 revealing that the complexes interact with DNA through moderate intercalation mode. The metal complexes exhibit effective cleavage of pUC19 DNA but it is not preceded via radical cleavage and superoxide anion radical. They are good antimicrobial agents than the free ligand. On comparing the IC50 values, [Ni(L)(Gly)2] is considered as a potential drug to eliminate the hydroxyl radical.

  5. The solar Ly-alpha line profile

    NASA Technical Reports Server (NTRS)

    Woods, Thomas N.; Rottman, Gary J.; White, O. R.; Fontenla, Juan; Avrett, E. H.

    1995-01-01

    Solar Ly-alpha irradiance measurements from the SOLar STellar Irradiance Comparison Experiment (SOLSTICE) on the Upper Atmosphere Research Satellite (UARS) have been made since 1991 October with a spectral resolution of 0.1 nm. The uniqueness of the small molecular oxygen cross section near Ly-alpha permits the Ly-alpha radiation to penetrate much deeper into the atmosphere than the other emissions near Ly-alpha. We have taken advantage of this phenomenon by performing solar occultation experiments near the Ly-alpha to evaluate precisely the instrument scattered light contribution. After correcting for scattered light, the broad wings of the solar Ly-alpha line can be extracted out to 5 nm from line center with a typical accuracy of +/-20%. The variability in the Ly-alpha wings near 2 nm from line center is about one-half that of the Ly-alpha core emission, defined within 0.1 nm from line center. These Ly-alpha profile measurements are found to be consistent with the Skylab radiance measurements and theoretical models of the Ly-alpha line profiles computed using partial redistribution of photons in the source function.

  6. Comparison of barley malt alpha-amylase isozymes 1 and 2: construction of cDNA hybrids by in vivo recombination and their expression in yeast.

    PubMed

    Juge, N; Søgaard, M; Chaix, J C; Martin-Eauclaire, M F; Svensson, B; Marchis-Mouren, G; Guo, X J

    1993-08-25

    Germinating barley produces two alpha-amylase isozymes, AMY1 and AMY2, having 80% amino acid (aa) sequence identity and differing with respect to a number of functional properties. Recombinant AMY1 (re-AMY1) and AMY2 (re-AMY2) are produced in yeast, but whereas all re-AMY1 is secreted, re-AMY2 accumulates within the cell and only traces are secreted. Expression of AMY1::AMY2 hybrid cDNAs may provide a means of understanding the difference in secretion efficiency between the two isozymes. Here, the efficient homologous recombination system of the yeast, Saccharomyces cerevisiae, was used to generate hybrids of barley AMY with the N-terminal portion derived from AMY1, including the signal peptide (SP), and the C-terminal portion from AMY2. Hybrid cDNAs were thus generated that encode either the SP alone, or the SP followed by the N-terminal 21, 26, 53, 67 or 90 aa from AMY1 and the complementary C-terminal sequences from AMY2. Larger amounts of re-AMY are secreted by hybrids containing, in addition to the SP, 53 or more aa of AMY1. In contrast, only traces of re-AMY are secreted for hybrids having 26 or fewer aa of AMY1. In this case, re-AMY hybrid accumulates intracellularly. Transformants secreting hybrid enzymes also accumulated some re-AMY within the cell. The AMY1 SP, therefore, does not ensure re-AMY2 secretion and a certain portion of the N-terminal sequence of AMY1 is required for secretion of a re-AMY1::AMY2 hybrid. PMID:8359683

  7. Microtubule depolymerization potentiates alpha-synuclein oligomerization.

    PubMed

    Esteves, A Raquel; Arduíno, Daniela M; Swerdlow, Russell H; Oliveira, Catarina R; Cardoso, Sandra M

    2010-01-01

    Parkinson's disease (PD) is associated with perturbed mitochondria function and alpha-synuclein fibrillization. We evaluated potential mechanistic links between mitochondrial dysfunction and alpha-synuclein aggregation. We studied a PD cytoplasmic hybrid (cybrid) cell line in which platelet mitochondria from a PD subject were transferred to NT2 neuronal cells previously depleted of endogenous mitochondrial DNA. Compared to a control cybrid cell line, the PD line showed reduced ATP levels, an increased free/polymerized tubulin ratio, and alpha-synuclein oligomer accumulation. Taxol (which stabilizes microtubules) normalized the PD tubulin ratio and reduced alpha-synuclein oligomerization. A nexus exists between mitochondrial function, cytoskeleton homeostasis, and alpha-synuclein oligomerization. In our model, mitochondrial dysfunction triggers an increased free tubulin, which destabilizes the microtubular network and promotes alpha-synuclein oligomerization. PMID:20552056

  8. Satellite Videoconferences

    NASA Technical Reports Server (NTRS)

    1990-01-01

    NASA is helping thousands of teachers to learn more about aerospace matters, improve their classroom skills, and expand significantly the content of their aerospace education curricula by means of live educational satellite videoconferences. The 1 1/2 hour 'Update for Teachers' programs originate at Oklahoma State University (OSU) Telecommunications Center. The television signals are transmitted to the WESTAR IV communications satellite, which remits them to participating schools across the U.S. and in parts of Mexico and Canada. The schools are equipped with small home style satellite reception dishes. Education Satellite Videoconference programs are conducted four times yearly, covering a variety of aerospace subjects. Teachers can call toll-free and have questions answered after the speaker's presentations. Information about NASA educational resources and how to obtain them will be provided.

  9. Satellite observations

    NASA Astrophysics Data System (ADS)

    1984-05-01

    In 1982 and 1983, six scientific satellites were operated successfully. Two of them, JIKIKEN and ISS-b, performed observations of the Earth's plasma environment. HINOTORI, the solar maximum satellite, observed a number of solar flares. HAKUCHO and newly launched TENMA conducted various observations of cosmic X-ray sources. HIMAWARI-2 is a meteorological satellite but its payload includes a solar particle monitor. EXOS-C was successfully launched in February, 1983, and participants in the MAP (Middle Atmosphere Program). Following these missions, the PLANET-A project comprising two missions, MS-T5 and PLANET-A, is under preparation for the participation in the international cooperative exploration of Comet P/Halley. The third X-ray astronomy satellite ASTRO-C is currently scheduled for 1987 launch.

  10. Satellite myths

    NASA Astrophysics Data System (ADS)

    Easton, Roger L.; Hall, David

    2008-01-01

    Richard Corfield's article “Sputnik's legacy” (October 2007 pp23-27) states that the satellite on board the US Vanguard rocket, which exploded during launch on 6 December 1957 two months after Sputnik's successful take-off, was “a hastily put together contraption of wires and circuitry designed only to send a radio signal back to Earth”. In fact, the Vanguard satellite was developed over a period of several years and put together carefully using the best techniques and equipment available at the time - such as transistors from Bell Laboratories/Western Electric. The satellite contained not one but two transmitters, in which the crystal-controlled oscillators had been designed to measure both the temperature of the satellite shell and of the internal package.

  11. Molecular analysis of the human laminin alpha3a chain gene (LAMA3a): a strategy for mutation identification and DNA-based prenatal diagnosis in Herlitz junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Cserhalmi-Friedman, P B; Tang, M; Ryan, M C; Uitto, J; Christiano, A M

    1998-09-01

    Mutations in the genes (LAMA3, LAMB3, and LAMC2) encoding the subunit polypeptides of the cutaneous basement membrane zone protein laminin 5 have been reported in different forms of junctional epidermolysis bullosa (JEB), an inherited blistering skin disease. In this study, we present the complete exon-intron organization of the "a" transcript of the laminin alpha3 chain gene, LAMA3a, which is expressed primarily in the skin. We have performed fine-resolution mapping of this gene on chromosome 18q11.2 using a human-hamster radiation hybrid panel. We have also developed a mutation-detection strategy based on the exon-intron structure of LAMA3a. This strategy, based on PCR amplification of genomic sequences, followed by heteroduplex scanning and automated nucleotide sequencing, was used for successful mutation screening in a family with the lethal (Herlitz) type of JEB, and two novel LAMA3 mutations were identified in the proband. The mutations consisted of a single-base pair deletion in LAMA3a exon A11 on the paternal allele, designated 1239delC, and a two-base pair deletion in LAMA3a exon A23 on the maternal allele, designated 2959delGG. This information was also used for DNA-based prenatal testing in a subsequent pregnancy in this family. Collectively, these results attest to our expanding capability to elucidate the genetic basis of various forms of epidermolysis bullosa using molecular techniques. PMID:9759651

  12. alpha-Thalassaemia in Tunisia: some epidemiological and molecular data.

    PubMed

    Siala, H; Ouali, F; Messaoud, T; Bibi, A; Fattoum, S

    2008-12-01

    Unlike the other haemoglobinopathies, few researches have been published concerning alpha-thalassaemia in Tunisia. The aim of the present work is to acquire further data concerning alpha-thalassaemia prevalence and molecular defects spectrum in Tunisia, by collecting and studying several kinds of samples carrying alpha-thalassaemia. The first survey conducted on 529 cord blood samples using cellulose acetate electrophoresis, have displayed the prevalence of 7.38% Hb Bart's carriers at birth. Molecular analyses were conducted by PCR and DNA sequencing on 20 families' cases from the above survey carrying the Hb Bart's at birth and on 10 Hb H diseased patients. The results showed six alpha-globin gene molecular defects and were responsible for alpha-thalassaemia: -alpha(3.7), - -(MedI), alpha(TSaudi), alpha(2)(cd23GAG->Stop), Hb Greone Hart: alpha(1)(119CCT->TCT) corresponding to 11 genotypes out of which two are responsible for Hb H disease (- -(Med)/-alpha(3.7)) and (alpha(TSaudi)alpha/alpha(TSaudi)alpha) and a newly described polymorphism: alpha+6C->G. The geographical repartition of alpha-thal carriers showed that the -alpha3.7 deletion is distributed all over the country, respectively the alpha(HphI) and alpha(TSaudi) seem to be more frequent in the central region of the northeast region. The haematological and clinical data showed a moderate phenotype with a late age of diagnosis for Hb H disease. This work had permitted, in addition to an overview on alpha-thalassaemia in the country, the optimization of protocols for alpha-thalassaemia detection in our lab, allowing further investigations concerning phenotype-genotype correlation in sickle cell disease or beta-thalassaemia. PMID:19147907

  13. Association of Satellites with a Mastrevirus in Natural Infection: Complexity of Wheat Dwarf India Virus Disease

    PubMed Central

    Kumar, Jitendra; Kumar, Jitesh; Singh, Sudhir P.

    2014-01-01

    ABSTRACT In contrast to begomoviruses, mastreviruses have not previously been shown to interact with satellites. This study reports the first identification of the association of satellites with a mastrevirus in field-grown plants. Two alphasatellite species were detected in different field samples of wheat infected with Wheat Dwarf India Virus (WDIV), a Cotton leaf curl Multan alphasatellite (CLCuMA) and a Guar leaf curl alphasatellite (GLCuA). In addition to the alphasatellites, a betasatellite, Ageratum yellow leaf curl betasatellite (AYLCB), was also identified in the wheat samples. No begomovirus was detected in the wheat samples, thus establishing association of the above-named satellites with WDIV. Agrobacterium-mediated inoculation of WDIV in wheat, in the presence of either of the alphasatellites or the betasatellite, resulted in infections inducing more severe symptoms. WDIV efficiently maintained each of the alphasatellites and the betasatellite in wheat. The satellites enhanced the level of WDIV DNA in wheat. Inoculation of the satellites isolated from wheat with various begomoviruses into Nicotiana tabacum demonstrated that these remain capable of interacting with the viruses with which they were first identified. Virus-specific small RNAs accumulated in wheat upon infection with WDIV but were lower in abundance in plants coinfected with the satellites, suggesting that both the alphasatellites and the betasatellite suppress RNA silencing. These results suggest that the selective advantage for the maintenance of the alphasatellites and the betasatellite by WDIV in the field is in overcoming RNA silencing-mediated host defense. IMPORTANCE Wheat is the most widely cultivated cereal crop in the world. A number of viruses are important pathogens of wheat, including the viruses of the genus Mastrevirus, family Geminiviridae. This study reports the association of subgenomic components, called satellites (alpha- and betasatellites), with a mastrevirus, Wheat

  14. Chromosome-specific DNA Repeat Probes

    SciTech Connect

    Baumgartner, Adolf; Weier, Jingly Fung; Weier, Heinz-Ulrich G.

    2006-03-16

    In research as well as in clinical applications, fluorescence in situ hybridization (FISH) has gained increasing popularity as a highly sensitive technique to study cytogenetic changes. Today, hundreds of commercially available DNA probes serve the basic needs of the biomedical research community. Widespread applications, however, are often limited by the lack of appropriately labeled, specific nucleic acid probes. We describe two approaches for an expeditious preparation of chromosome-specific DNAs and the subsequent probe labeling with reporter molecules of choice. The described techniques allow the preparation of highly specific DNA repeat probes suitable for enumeration of chromosomes in interphase cell nuclei or tissue sections. In addition, there is no need for chromosome enrichment by flow cytometry and sorting or molecular cloning. Our PCR-based method uses either bacterial artificial chromosomes or human genomic DNA as templates with {alpha}-satellite-specific primers. Here we demonstrate the production of fluorochrome-labeled DNA repeat probes specific for human chromosomes 17 and 18 in just a few days without the need for highly specialized equipment and without the limitation to only a few fluorochrome labels.

  15. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  16. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  17. Small satellites

    NASA Technical Reports Server (NTRS)

    Thomas, P.; Veverka, J.; Dermott, S.

    1986-01-01

    Satellites smaller than Mimas (r = 195 km) are distinguished by irregular overall shapes and by rough limb topography. Material properties and impact cratering dominate the shaping of these objects. Long fragmentation histories can produce a variety of internal structures, but so far there is no direct evidence that any small satellite is an equilibrium ellipsoid made up of noncohesive gravitationally bound rubble. One many bodies that orbit close to their primary the tidal and rotational components of surface gravity strongly affect the directions of local g and thereby affect the redistribution of regolith by mass wasting. Downslope movement of regolith is extensive on Deimos, and is probably effective on many other small satellites. It is shown that in some cases observed patterns of downslope mass wasting cold produce useful constraints on the satellite's mean density. The diversity of features seen in the few high-resolution images of small satellites currently available suggests that these objects have undergone complex histories of cratering, fragmentation, and regolith evolution.

  18. Satellite broadcasting

    NASA Astrophysics Data System (ADS)

    Gregory, D.; Rainger, P.; Harvey, R. V.; Jennings, A.

    Questions related to direct broadcasting satellites are addressed with attention given to celestial mechanics, synchronous orbits, propagation, international plans, domestic installation, related laws and system costs. The role of the World Administrative Planning Conference (WARC) organization is discussed and contrasted with that of the regional administrative radio conference. Topics related to the field of law include coverage and overspill, regulation and control, copyrights and international organizations. Alternative ways of estimating direct broadcasting system costs are presented with consideration given to satellite costs as a function of mass, launch costs and system costs as a function of power.

  19. Some background about satellites

    NASA Technical Reports Server (NTRS)

    Burns, Joseph A.

    1986-01-01

    Four tables of planetary and satellite data are presented which list satellite discoveries, planetary parameters, satellite orbits, and satellite physical properties respectively. A scheme for classifying the satellites is provided and it is noted that most known moons fall into three general classes: regular satellites, collisional shards, and irregular satellites. Satellite processes are outlined with attention given to origins, dynamical and thermal evolution, surface processes, and composition and cratering. Background material is provided for each family of satellites.

  20. The molecular biology and biochemistry of rice endosperm. alpha. -globulin

    SciTech Connect

    Shorrosh, B.S.

    1989-01-01

    The author's first objective was to isolate a cDNA clone that encodes the rice endosperm {alpha}-globulin. Purified antibodies against a rice storage protein, {alpha}-globulin, were used to screen a {lambda}gt11 cDNA expression library constructed from immature rice seed endosperm. The cDNA insert of clone 4A1 (identified by antibody screening) was used as a probe to identify long cDNA inserts in the library. The deduced amino acid sequence of clone A3-12 cDNA insert (identified by cDNA screening) contained the amino acid sequences of three cyanogen bromide peptides fragment of {alpha}-globulin. The calculated molecular weight and amino acid composition of the deduced amino acid sequence were similar to the {alpha}-globulin protein. Northern blot analysis indicated that mRNA of one size, approximately 1.0 kb, is expressed. Southern genomic blot analysis revealed one band with EcoRI or Hind III digestion. Cell-free translation and immunoprecipitation showed that the initial translation product is approximately 2,000 daltons larger than the mature protein. The amino acid sequence of {alpha}-globulin revealed limited regions of similarities with wheat storage proteins. The author concludes that the cDNA insert in clone A3-12 contained the entire coding region of {alpha}-globulin protein and that {alpha}-globulin is encoded by a single gene. My second objective was to inhibit the degradation of {alpha}-globulin in the salt extract of rice flour. The salt extract of rice flour contained an acid protease whose optimal pH was 3 for {sup 3}H-casein hydrolysis. A polypeptide with molecular weight of 20,000 was immunologically reactive with {alpha}-globulin antibodies and is produced by limited proteolysis in the extract. Pepstatin inhibited the proteolysis of 3H-casein and slowed the proteolysis of {alpha}-globulin.

  1. Satellite description

    NASA Astrophysics Data System (ADS)

    Gillett, F. C.; Clegg, P. E.; Neugebauer, G.; Langford, D.; Pouw, A.; Irace, W.; Houck, J.

    The onboard computers and their associated software, the attitude control system, and data recording and the communication links of the infrared astronomy satellite (TRAS) are discussed. The IRAS telescope system is considered in detail. Attention is directed towards the cryogenics, thermal control, optics, focal plane assembly, and electronics associated with the telescope system.

  2. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  3. Virtual Satellite

    NASA Technical Reports Server (NTRS)

    Hammrs, Stephan R.

    2008-01-01

    Virtual Satellite (VirtualSat) is a computer program that creates an environment that facilitates the development, verification, and validation of flight software for a single spacecraft or for multiple spacecraft flying in formation. In this environment, enhanced functionality and autonomy of navigation, guidance, and control systems of a spacecraft are provided by a virtual satellite that is, a computational model that simulates the dynamic behavior of the spacecraft. Within this environment, it is possible to execute any associated software, the development of which could benefit from knowledge of, and possible interaction (typically, exchange of data) with, the virtual satellite. Examples of associated software include programs for simulating spacecraft power and thermal- management systems. This environment is independent of the flight hardware that will eventually host the flight software, making it possible to develop the software simultaneously with, or even before, the hardware is delivered. Optionally, by use of interfaces included in VirtualSat, hardware can be used instead of simulated. The flight software, coded in the C or C++ programming language, is compilable and loadable into VirtualSat without any special modifications. Thus, VirtualSat can serve as a relatively inexpensive software test-bed for development test, integration, and post-launch maintenance of spacecraft flight software.

  4. Ab initio alpha-alpha scattering

    NASA Astrophysics Data System (ADS)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.

    2015-12-01

    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  5. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  6. Alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes.

    PubMed

    Melis, M A; Galanello, R; Cao, A

    1983-04-01

    This paper reports the results of alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes. The propositus, who was identified in a newborn survey as he had 26.0% Hb Bart's and 74.0% Hb F, successively developed the clinical and haematological picture of a transfusion-dependent thalassaemia major. According to the haemoglobin pattern, restriction endonuclease analysis of the DNA from this patient showed the deletion of three of the four alpha-globin structural genes. Thus beta 0-thalassaemia homozygotes with the delection of three alpha-structural genes seem to have a severe clinical phenotype similar to that of patients with a full complement of four alpha-globin structural genes. PMID:6299325

  7. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  8. Hb Chad or alpha 223(B4)Glu----Lys beta 2 observed in members of a Surinam family in association with alpha-thalassemia-2 and with Hb S.

    PubMed

    Codrington, J F; Codrington, F A; Wisse, J H; Wilson, J B; Webber, B B; Wong, S C; Huisman, T H

    1989-01-01

    Three different hemoglobinopathies, i.e. Hb S, Hb Chad [alpha 23 (B4)Glu----Lys], and alpha-thalassemia-2 (-3.7) have been observed in eight members of a family from Surinam. The proposita had all three abnormalities, while her mother and four of her half-brothers had Hb Chad together with an alpha-thalassemia-2 heterozygosity or homozygosity. Gene mapping and dot-blot analysis of amplified DNA identified a G----A mutation in codon 23 of the alpha 2 alpha 1 hybrid gene resulting in the Glu----Lys substitution. The quantity of the alpha-Chad chain averaged 31.5% in its carriers with an additional alpha-thalassemia-2 heterozygosity [-alpha Chad(-3.7 kb)/alpha alpha], and 43% in the two carriers with an additional alpha-thalassemia-2 homozygosity [-alpha Chad (-3.7 kb)/-alpha (3.7 kb)]. These quantities are considerably higher than those reported for families from Chad, China, and Japan; the low levels of 14.5-24% Hb Chad in members of previously reported cases suggest a mutation on a chromosome with two alpha-globin genes [alpha alpha Chad/alpha alpha or alpha Chad alpha/alpha alpha]. PMID:2606723

  9. GDP-L-fucose: .beta.-D-galactoside 2-.alpha.-L-fucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    DOEpatents

    Lowe, John B.; Lennon, Gregory; Rouquier, Sylvie; Giorgi, Dominique; Kelly, Robert J.

    1998-01-01

    The gene encoding GDP-L-fucose: .beta.-D-Galactoside 2-.alpha.-L-fucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor.

  10. GDP-L-fucose: {beta}-D-galactoside 2-{alpha}-Lfucosyltransferases, DNA sequences encoding the same, method for producing the same and a method of genotyping a person

    DOEpatents

    Lowe, J.B.; Lennon, G.; Rouquier, S.; Giorgi, D.; Kelly, R.J.

    1998-09-15

    The gene encoding GDP-L-fucose: {beta}-D-Galactoside 2-{alpha}-Lfucosyltransferase has been cloned, and a mutation in this gene has been found to be responsible for an individual being a non-secretor. 30 figs.

  11. Dosimetry and radiobiological studies of automated alpha-particle irradiator.

    PubMed

    M V, Jyothish Babu; Shinde, Sanjay G; S, Sunil Kumar; Ali, Manjoor; Vasumathy, R; Kumar, Amit; Kolekar, R; Kumar, Manish; Nema, P; Bhagwat, P V; Pandey, Badri N

    2013-01-01

    Understanding the effect of alpha radiation on biological systems is an important component of radiation risk assessment and associated health consequences. However, due to the short path length of alpha radiation in the atmosphere, in vitro radiobiological experiments cannot be performed with accuracy in terms of dose and specified exposure time. The present paper describes the design and dosimetry of an automated alpha-particle irradiator named 'BARC BioAlpha', which is suitable for in vitro radiobiological studies. Compared to alpha irradiators developed in other laboratories, BARC BioAlpha has integrated computer-controlled movement of the alpha-particle source, collimator, and electronic shutter. The diaphragm blades of the electronic shutter can control the area (diameter) of irradiation without any additional shielding, which is suitable for radiobiological bystander studies. To avoid irradiation with incorrect parameters, a software interlock is provided to prevent shutter opening, unless the user-specified speed of the source and collimator are achieved. The dosimetry of the alpha irradiator using CR-39 and silicon surface barrier detectors showed that ~4 MeV energy of the alpha particle reached the cells on the irradiation dish. The alpha irradiation was also demonstrated by the evaluation of DNA double-strand breaks in human cells. In conclusion, 'BARC BioAlpha' provides a user-friendly alpha irradiation system for radiobiological experiments with a novel automation mechanism for better accuracy of dose and exposure time. PMID:24266413

  12. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  13. The distribution of alpha elements in Andromeda dwarf galaxies

    SciTech Connect

    Vargas, Luis C.; Geha, Marla C.; Tollerud, Erik J.

    2014-07-20

    We present alpha to iron abundance ratios for 226 individual red giant branch stars in nine dwarf galaxies of the Andromeda (M31) satellite system. The abundances are measured from the combined signal of Mg, Si, Ca, and Ti lines in Keck/DEIMOS medium-resolution spectra. This constitutes the first large sample of alpha abundance ratios measured in the M31 satellite system. The dwarf galaxies in our sample exhibit a variety of alpha abundance ratios, with the average values in each galaxy ranging from approximately solar ([α/Fe] ∼ + 0.0) to alpha-enhanced ([α/Fe] ∼ + 0.5). These variations do not show a correlation with internal kinematics, environment, or stellar density. We confirm radial gradients in the iron abundance of two galaxies out of the five with sufficient data (NGC 185 and And II). There is only tentative evidence for an alpha abundance radial gradient in NGC 185. We homogeneously compare our results to the Milky Way classical dwarf spheroidals, finding evidence for wider variation in average alpha abundance. In the absence of chemical abundances for the M31 stellar halo, we compare to the Milky Way stellar halo. A stellar halo comprised of disrupted M31 satellites is too metal-rich and inconsistent with the Milky Way halo alpha abundance distribution even if considering only satellites with predominantly old stellar populations. The M31 satellite population provides a second system in which to study chemical abundances of dwarf galaxies and reveals a wider variety of abundance patterns than the Milky Way.

  14. Satellite Bioclimatology.

    NASA Astrophysics Data System (ADS)

    Goward, Samuel N.

    1989-07-01

    Satellite-acquired, remotely sensed observations of the earth's land areas are substatially advancing knowledge of global vegetation patterns. Recognition that combined visible/near infrared spectral reflectance observations are a general indicator of the presence, condition and magnitude of vegetation foliage provides a basis for explanation. This information is of considerable value in climatic research because of the links between climate variables and vegetation foliage. Presence of vegetation foliage is predominantly determined by a combination of local beat and moisture conditions. In turn, foliar presence determines local rates of photosynthesis, affects surface albedo, and influences local rates of evapotranspiration as well as other elements of surface energy/mass balance. Availability of these remotely sensed data provides, for the first time, a consistent, global means to directly study interactions between climate and vegetation. This understanding is now being incorporated in climatological research and should improve understanding of macroscale bioclimatology. Remote sensing technology and understanding of this technology are continuing to develop rapidly and further major advances in this new field of `satellite bioclimatology' can be expected in the near future.

  15. Meteorological satellites

    NASA Astrophysics Data System (ADS)

    1981-10-01

    Meteor-2 (second generation meteorological satellite) and an experimental satellite on which instruments are being tested and modified for the requirements of hydrometeorology and a determination of natural resources are presently operational in the U.S.S.R. Television devices with a 1-10 km terrain image resolution operating in the visible and infrared region are used to determine the space system, velocity and direction of cloud movements and provide information about the snow and ice cover, cyclones, storms, vortices in the atmosphere, and velocity and direction of wind. Images with a 50-1000 m resolution make possible geological and hydrological surveys, an evaluation of the state of vegetation and crops, detection of forest fires, determination of pollution of the atmosphere and sea and determination of optimal fishing regions in the ocean. Measurement of the intensity of atmospheric radiation in narrow infrared regions and very high frequencies allows remote evaluation of the temperature and humidity distribution in the vertical cross section of the Earth's atmosphere.

  16. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  17. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  18. Identification of core alpha 1,3-fucosylated glycans and cloning of the requisite fucosyltransferase cDNA from Drosophila melanogaster. Potential basis of the neural anti-horseadish peroxidase epitope.

    PubMed

    Fabini, G; Freilinger, A; Altmann, F; Wilson, I B

    2001-07-27

    For many years, polyclonal antibodies raised against the plant glycoprotein horseradish peroxidase have been used to specifically stain the neural and male reproductive tissue of Drosophila melanogaster. This epitope is considered to be of carbohydrate origin, but no glycan structure from Drosophila has yet been isolated that could account for this cross-reactivity. Here we report that N-glycan core alpha1,3-linked fucose is, as judged by preabsorption experiments, indispensable for recognition of Drosophila embryonic nervous system by anti-horseradish peroxidase antibody. Further, we describe the identification by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry and high performance liquid chromatography of two Drosophila N-glycans that, as already detected in other insects, carry both alpha1,3- and alpha1,6-linked fucose residues on the proximal core GlcNAc. Moreover, we have isolated three cDNAs encoding alpha1,3-fucosyltransferase homologues from Drosophila. One of the cDNAs, when transformed into Pichia pastoris, was found to direct expression of core alpha1,3-fucosyltransferase activity. This recombinant enzyme preferred as substrate a biantennary core alpha1,6-fucosylated N-glycan carrying two non-reducing N-acetylglucosamine residues (GnGnF6; Km 11 microm) over the same structure lacking a core fucose residue (GnGn; Km 46 microm). The Drosophila core alpha1,3-fucosyltransferase enzyme was also shown to be able to fucosylate N-glycan structures of human transferrin in vitro, this modification correlating with the acquisition of binding to anti-horseradish peroxidase antibody. PMID:11382750

  19. Human hTM. cap alpha. gene: Expression in muscle and nonmuscle tissue

    SciTech Connect

    MacLeod, A.R.; Gooding, C.

    1988-01-01

    The authors isolated a cDNA clone from a human skeletal muscle library which contains the complete protein-coding sequence of a skeletal muscle ..cap alpha..-tropomyosin. This cDNA sequence defines a fourth human tropomyosin gene, the hTM..cap alpha.. gene, which is distinct from the hTM/sub nm/ gene encoding a closely related isoform of skeletal muscle ..cap alpha..-tropomyosin. In cultured human fibroblasts, the hTM..cap alpha.. gene encodes both skeletal-muscle- and smooth-muscle-type ..cap alpha..-tropomyosins by using an alternative mRNA-splicing mechanism.

  20. Molecular characterization of an. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Harrison, J.K.; Dewan Zeng; D'Angelo, D.D.; Tucker, A.L.; Zhihong Lu; Barber, C.M.; Lynch, K.R. )

    1990-02-26

    {alpha}{sub 2}-Adrenergic receptors comprise a heterogeneous population based on pharmacologic and molecular evidence. The authors have isolated a cDNA clone (pRNG{alpha}2) encoding a previously undescribed third subtype of an {alpha}{sub 2}-adrenergic receptor from a rat kidney cDNA library. The library was screened with an oligonucleotide encoding a highly conserved region found in all biogenic amine receptors described to date. The deduced amino acid sequence displays many features of G-protein coupled receptors with exception of the absence of the consensus N-linked glycosylation site at the amino terminus. Membranes prepared from COS-1 cells transfected with pRNG{alpha}2 display high affinity and saturable binding to {sup 3}H-rauwolscine (K{sub d}=2 nM).Competition curve data analysis shows that pRNG{alpha}2 protein binds to a variety of adrenergic drugs with the following rank order of potency: yohimbine {ge} cholorpromazine > prazosin {ge} clonidine > norepinephrine {ge} oxymetazoline. pRNG{alpha}2 RNA accumulates in both adult rat kidney and rat neonatal lung (predominant species is 4.0 kb). They conclude that pRNG{alpha}2 likely represents a cDNA for the {alpha}{sub 2B}-adrenergic receptor.

  1. Satellite altimetry

    NASA Technical Reports Server (NTRS)

    Cheney, Robert E.

    1992-01-01

    Since altimetry data are not really old enough to use the term data archaeology, Mr. Cheney referred to the stewardship of these data. He noted that it is very important to document the basis for an altimetry data set as the algorithms and corrections used to arrive at the Geophysical Data Record (GDR) have been improving and are continuing to improve the precision of sea level data derived from altimetry. He noted that the GEOSAT Exact Repeat Mission (ERM) data set has recently been reprocessed by his organization in the National Ocean Service of NOAA and made available to the scientific community on CD/ROM disks by the National Oceanographic Data Center of the U.S. (NODC). The new data set contains a satellite orbit more precise by an order of magnitude together with an improved water vapor correction. A new, comprehensive GDR Handbook has also been prepared.

  2. Satellites in Education.

    ERIC Educational Resources Information Center

    Jones, David

    1988-01-01

    Describes the methods and materials used to obtain satellite pictures from weather satellites. Discusses possible physics lessons which can be done using this equipment including orbital mechanics, and how the satellite works. (CW)

  3. cap alpha. -skeletal and. cap alpha. -cardiac actin genes are coexpressed in adult human skeletal muscle and heart

    SciTech Connect

    Gunning, P.; Ponte, P.; Blau, H.; Kedes, L.

    1983-11-01

    The authors determined the actin isotypes encoded by 30 actin cDNA clones previously isolated from an adult human muscle cDNA library. Using 3' untranslated region probes, derived from ..cap alpha.. skeletal, ..beta..- and ..gamma..-actin cDNAs and from an ..cap alpha..-cardiac actin genomic clone, they showed that 28 of the cDNAs correspond to ..cap alpha..-skeletal actin transcripts. Unexpectedly, however, the remaining two cDNA clones proved to derive from ..cap alpha..-cardiac actin mRNA. Sequence analysis confirmed that the two skeletal muscle ..cap alpha..-cardiac actin cDNAs are derived from transcripts of the cloned ..cap alpha..-cardiac actin gene. Comparison of total actin mRNA levels in adult skeletal muscle and adult heart revealed that the steady-state levels in skeletal muscle are about twofold greater, per microgram of total cellular RNA, than those in heart. Thus, in skeletal muscle and in heart, both of the sarcomeric actin mRNA isotypes are quite abundant transcripts. They conclude that ..cap alpha..-skeletal and ..cap alpha..-cardiac actin genes are coexpressed as an actin pair in human adult striated muscles. Since the smooth-muscle actins (aortic and stomach) and the cytoplasmic actins (..beta.. and ..gamma..) are known to be coexpressed in smooth muscle and nonmuscle cells, respectively, they postulate that coexpression of actin pairs may be a common feature of mammalian actin gene expression in all tissues.

  4. Alpha-thalassemia mutations in Gilan Province, North Iran.

    PubMed

    Hadavi, Valeh; Jafroodi, Maryam; Hafezi-Nejad, Nima; Moghadam, Sousan Dehnadi; Eskandari, Fatemeh; Tarashohi, Shahin; Pourfahim, Hamideh; Oberkanins, Christian; Law, Hai-Yang; Najmabadi, Hossein

    2009-01-01

    One hundred and three patients from Gilan Province, Iran, presenting with hypochromic and microcytic anemia parameters without iron deficiency were included in this study. Using gap-polymerase chain reaction (gap-PCR), reverse hybridization StripAssay and DNA sequencing, we detected a total of 113 alpha-globin mutations in 94 (91.3%) of these patients. Most prevalent of the 16 different alpha-thalassemia (alpha-thal) alleles was -alpha(3.7) (42.5%), followed by the polyadenylation signal (poly A2) (AATAAA>AATGAA) (12.4%), Hb Constant Spring [Hb CS, alpha142, Term-->Gln (TAA>CAA in alpha2] (10.6%), --(MED) (8.8%), IVS-I donor site [GAG GTG AGG>GAG G-----, alpha(-5 nt) (-TGAGG)] (7.1%), -alpha(4.2) (4.4%) and poly A1 (AATAAA>AATAAG) (3.5%). An additional nine mutations were observed at frequencies below 2%. We also found two novel alpha1 gene mutations: alpha(-9) (HBA1: c.-9 G>C) and alpha(IVS-I-4) (HBA1: c.95+4 A>G). Our new findings will be valuable for improving targeted thalassemia screening and prevention strategies in this area. PMID:19657838

  5. Calibration issues in delta alpha /alpha .

    NASA Astrophysics Data System (ADS)

    Molaro, Paolo; Centurión, Miriam; Levshakov, Sergei

    Laser Comb Wavelength calibration shows that the ThAr one is locally unreliable with possible deviations of up to 100 {m s}-1 within one order range, while delivering an overall 1 {m s}-1 accuracy (Wilken et al 2009). Such deviation corresponds to delta alpha /alpha ≈ 7* 10-6 for a Fe II-Mg II pair. Comparison of line shifts among the 5 Fe II lines, with almost identical sensitivity to fine structure constant changes, offers a clean way to directly test the presence of possible local wavelength calibration errors of whatever origin. We analyzed 5 absorption systems, with zabs ranging from 1.15 to 2.19 towards 3 bright QSOs. The results show that while some lines are aligned within 20 {m s}-1, others reveal large deviations reaching 200 {m s}-1 or higher and corresponding to a delta alpha /alpha > 10-5 level. The origin of these deviations is not clearly identified but could be related to the adaptation of wavelength calibration to CCD manufacturing irregularities. These results suggest that to draw conclusions from delta alpha /alpha analysis based on one or only few lines must be done with extreme care.

  6. Locus assignment of alpha-globin structural mutations by hybrid-selected translation.

    PubMed Central

    Liebhaber, S A; Cash, F E

    1985-01-01

    The two human alpha-globin genes, alpha 1 and alpha 2 located 3.4 kilobases apart on chromosome 16, encode identical alpha-globin proteins. A mutation in either gene could result in a structural hemoglobinopathy. It has only recently become possible to assign an alpha-chain mutant to one of these two loci by using recombinant DNA technology. While definitive, this approach has necessitated the cloning and sequencing of the specific gene in question. We present an alternative approach which results in rapid and definitive assignment of an alpha-globin mutation to its encoding genetic locus. This approach uses the technique of hybrid-selected translation. Reticulocyte RNA from individuals with alpha-globin mutations can be fractionated into beta-, alpha 9 (total)-, alpha 1-, and alpha 2-globin mRNA by selective hybridization of each mRNA species to its respective complementary DNA (cDNA) immobilized on nitrocellulose paper. Each mRNA purified in this way can be translated in vitro, and the mRNA species (and hence gene locus) encoding the globin mutant can then be directly identified by gel analysis of the radiolabeled translation products. This procedure can be used to identify globin mutants as alpha or beta and to localize alpha-globin mutants to the alpha 1 or alpha 2 gene. We have used this technique to localize the two alpha-globin mutants, alpha 125Pro (Hb Quong Sze) and alpha 47HIS (Hb Hasharon), to the alpha 2 locus. This approach could potentially be expanded to serve as an alternative to peptide analysis for the initial characterization of all globin structural mutants. Images PMID:2981252

  7. [Alpha1-adrenoceptor subtypes and alpha1-adrenoceptor antagonists].

    PubMed

    Muramatsu, Ikunobu; Suzuki, Fumiko; Tanaka, Takashi; Yamamoto, Hatsumi; Morishima, Shigeru

    2006-03-01

    Alpha(1)-adrenoceptors are widely distributed in the human body and play important physiologic roles. Three alpha(1)-adrenoceptor subtypes (alpha(1A), alpha(1B) and alpha(1D)) have been cloned and show different pharmacologic profiles. In addition, a putative alpha(1)-adrenoceptor (alpha(1L) subtype) has also been proposed. Recently, three drugs (tamsulosin, naftopidil, and silodosin) have been developed in Japan for the treatment of urinary obstruction in patients with benign prostatic hyperplasia. In this review, we describe recent alpha(1)-adrenoceptor subclassifications and the pharmacologic characteristics (subtype selectivity and clinical relevance) of alpha(1)-adrenoceptor antagonists. PMID:16518082

  8. Iodine Satellite

    NASA Technical Reports Server (NTRS)

    Kamhawi, Hani; Dankanich, John; Martinez, Andres; Petro, Andrew

    2015-01-01

    The Iodine Satellite (iSat) spacecraft will be the first CubeSat to demonstrate high change in velocity from a primary propulsion system by using Hall thruster technology and iodine as a propellant. The mission will demonstrate CubeSat maneuverability, including plane change, altitude change and change in its closest approach to Earth to ensure atmospheric reentry in less than 90 days. The mission is planned for launch in fall 2017. Hall thruster technology is a type of electric propulsion. Electric propulsion uses electricity, typically from solar panels, to accelerate the propellant. Electric propulsion can accelerate propellant to 10 times higher velocities than traditional chemical propulsion systems, which significantly increases fuel efficiency. To enable the success of the propulsion subsystem, iSat will also demonstrate power management and thermal control capabilities well beyond the current state-of-the-art for spacecraft of its size. This technology is a viable primary propulsion system that can be used on small satellites ranging from about 22 pounds (10 kilograms) to more than 1,000 pounds (450 kilograms). iSat's fuel efficiency is ten times greater and its propulsion per volume is 100 times greater than current cold-gas systems and three times better than the same system operating on xenon. iSat's iodine propulsion system consists of a 200 watt (W) Hall thruster, a cathode, a tank to store solid iodine, a power processing unit (PPU) and the feed system to supply the iodine. This propulsion system is based on a 200 W Hall thruster developed by Busek Co. Inc., which was previously flown using xenon as the propellant. Several improvements have been made to the original system to include a compact PPU, targeting greater than 80 percent reduction in mass and volume of conventional PPU designs. The cathode technology is planned to enable heaterless cathode conditioning, significantly increasing total system efficiency. The feed system has been designed to

  9. Renal deposition of alpha interferon in systemic lupus erythematosus.

    PubMed Central

    Panem, S; Ordóñez, N; Vilcek, J

    1983-01-01

    Earlier studies from several laboratories showed that interferon-alpha (IFN-alpha) is present in the sera of a large percentage of patients with systemic lupus erythematosus (SLE). We now report the detection of IFN-alpha by indirect immunofluorescence in renal sections of three patients with SLE but not in six control kidneys. The immunofluorescence reaction was mediated by three hyperimmune antisera to IFN-alpha raised in three different species, but not by any preimmune serum. The reaction was specifically blocked by absorption of the anti-IFN-alpha sera with purified IFN-alpha made by recombinant DNA techniques or with IFN-alpha isolated from the serum of an SLE patient, but not by bovine serum albumin or human immunoglobulin G. In contrast, antisera to IFN-beta or IFN-gamma did not mediate immunofluorescence. The pattern of IFN-alpha deposition resembled that seen with anti-human immunoglobulin G, suggesting association with immune complexes. Immune complexes were then preparatively eluted from the homogenate of an SLE kidney by treatment with buffer at pH 2.8. Biologically active IFN was found in this eluate and was demonstrated to be IFN-alpha by specific neutralization with IFN antisera. These results extend the specific association of IFN-alpha with SLE. Images PMID:6413415

  10. A search for Lyman-alpha emission in beta Lyrae from Copernicus

    NASA Technical Reports Server (NTRS)

    Kondo, Y.; Mccluskey, G. E., Jr.

    1974-01-01

    High-resolution (0.2 A) spectrophotometric observations of the complex eclipsing binary beta Lyrae were obtained with the Princeton Telescope Spectrometer on the Copernicus satellite. We discuss the search for L-alpha emission in beta Lyrae and compare the Copernicus results with the OAO-2 observations of the same binary system. The possible L-alpha emission features observed from OAO-2 are identified as blends of the emission lines of other elements in the vicinity of L-alpha.

  11. Asteroid Satellites

    NASA Astrophysics Data System (ADS)

    Merline, W. J.

    2001-11-01

    Discovery and study of small satellites of asteroids or double asteroids can yield valuable information about the intrinsic properties of asteroids themselves and about their history and evolution. Determination of the orbits of these moons can provide precise masses of the primaries, and hence reliable estimates of the fundamental property of bulk density. This reveals much about the composition and structure of the primary and will allow us to make comparisons between, for example, asteroid taxonomic type and our inventory of meteorites. The nature and prevalence of these systems will also give clues as to the collisional environment in which they formed, and have further implications for the role of collisions in shaping our solar system. A decade ago, binary asteroids were more of a theoretical curiosity. In 1993, the Galileo spacecraft allowed the first undeniable detection of an asteroid moon, with the discovery of Dactyl, a small moon of Ida. Since that time, and particularly in the last year, the number of known binaries has risen dramatically. Previously odd-shaped and lobate near-Earth asteroids, observed by radar, have given way to signatures indicating, almost certainly, that at least four NEAs are binary systems. The tell-tale lightcurves of several other NEAs reveal a high likelihood of being double. Indications are that among the NEAs, there may be a binary frequency of several tens of percent. Among the main-belt asteroids, we now know of 6 confirmed binary systems, although their overall frequency is likely to be low, perhaps a few percent. The detections have largely come about because of significant advances in adaptive optics systems on large telescopes, which can now reduce the blurring of the Earth's atmosphere to compete with the spatial resolution of space-based imaging (which itself, via HST, is now contributing valuable observations). Most of these binary systems have similarities, but there are important exceptions. Searches among other

  12. Outer planet satellites

    SciTech Connect

    Schenk, P.M. )

    1991-01-01

    Recent findings on the outer-planet satellites are presented, with special consideration given to data on the rheologic properties of ice on icy satellites, the satellite surfaces and exogenic processes, cratering on dead cratered satellites, volcanism, and the interiors of outer-planet satellites. Particular attention is given to the state of Titan's surface and the properties of Triton, Pluto, and Charon. 210 refs.

  13. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  14. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  15. Alpha-particle diagnostics

    SciTech Connect

    Young, K.M.

    1991-01-01

    This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

  16. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  17. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  18. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  19. alpha 11beta 1 integrin recognizes the GFOGER sequence in interstitial collagens.

    PubMed

    Zhang, Wan-Ming; Kapyla, Jarmo; Puranen, J Santeri; Knight, C Graham; Tiger, Carl-Fredrik; Pentikainen, Olli T; Johnson, Mark S; Farndale, Richard W; Heino, Jyrki; Gullberg, Donald

    2003-02-28

    The integrins alpha(1)beta(1), alpha(2)beta(1), alpha(10)beta(1), and alpha(11)beta(1) are referred to as a collagen receptor subgroup of the integrin family. Recently, both alpha(1)beta(1) and alpha(2)beta(1) integrins have been shown to recognize triple-helical GFOGER (where single letter amino acid nomenclature is used, O = hydroxyproline) or GFOGER-like motifs found in collagens, despite their distinct binding specificity for various collagen subtypes. In the present study we have investigated the mechanism whereby the latest member in the integrin family, alpha(11)beta(1), recognizes collagens using C2C12 cells transfected with alpha(11) cDNA and the bacterially expressed recombinant alpha(11) I domain. The ligand binding properties of alpha(11)beta(1) were compared with those of alpha(2)beta(1). Mg(2+)-dependent alpha(11)beta(1) binding to type I collagen required micromolar Ca(2+) but was inhibited by 1 mm Ca(2+), whereas alpha(2)beta(1)-mediated binding was refractory to millimolar concentrations of Ca(2+). The bacterially expressed recombinant alpha(11) I domain preference for fibrillar collagens over collagens IV and VI was the same as the alpha(2) I domain. Despite the difference in Ca(2+) sensitivity, alpha(11)beta(1)-expressing cells and the alpha(11) I domain bound to helical GFOGER sequences in a manner similar to alpha(2)beta(1)-expressing cells and the alpha(2) I domain. Modeling of the alpha I domain-collagen peptide complexes could partially explain the observed preference of different I domains for certain GFOGER sequence variations. In summary, our data indicate that the GFOGER sequence in fibrillar collagens is a common recognition motif used by alpha(1)beta(1), alpha(2)beta(1), and also alpha(11)beta(1) integrins. Although alpha(10) and alpha(11) chains show the highest sequence identity, alpha(2) and alpha(11) are more similar with regard to collagen specificity. Future studies will reveal whether alpha(2)beta(1) and alpha(11)beta(1

  20. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    PubMed Central

    Rey, Marie E. C.; Ndunguru, Joseph; Berrie, Leigh C.; Paximadis, Maria; Berry, Shaun; Cossa, Nurbibi; Nuaila, Valter N.; Mabasa, Ken G.; Abraham, Natasha; Rybicki, Edward P.; Martin, Darren; Pietersen, Gerhard; Esterhuizen, Lindy L.

    2012-01-01

    The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component) or bipartite (two circular ssDNA components called DNA-A and DNA-B), many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-αs) or betasatellites (DNA-βs). Additionally, subgenomic molecules, also known as defective interfering (DIs) DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world. PMID:23170182

  1. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  2. China's satellite communications discussed

    NASA Astrophysics Data System (ADS)

    Ruhou, Z.

    1986-04-01

    In 1972, China began to enter the age of satellite comunications, and it was realized that satellites could play a large role in television transmission in China. The experimental broadcasting of satellite television programs was begun in 1978, and satisfactory results were obtained. The success of the television transmission demonstration has led to important decisions regarding development of a domestic satellite communications system. Before specialized communications satellites are launched, the decision was made to lease an international communications satellite transmitter. The responsibility of the ground stations were discussed.

  3. Satellite orbit predictor

    NASA Technical Reports Server (NTRS)

    Friedman, Morton l.; Garrett, James, Major

    An analog aid to determine satellite coverage of Emergency Locator Transmitters Emergency Position Indicating Radio Beacon (ELT/EPIRB) distress incidence is discussed. The satellite orbit predictor is a graphical aid for determining the relationship between the satellite orbit, antenna coverage of the spacecraft and coverage of the Local User Terminal. The predictor allows the user to quickly visualize if a selected position will probably be detected and is composed of a base map and a satellite track overlay for each satellite.A table of equator crossings for each satellite is included.

  4. Replication bypass and mutagenic effect of alpha-deoxyadenosine site-specifically incorporated into single-stranded vectors.

    PubMed Central

    Shimizu, H; Yagi, R; Kimura, Y; Makino, K; Terato, H; Ohyama, Y; Ide, H

    1997-01-01

    alpha-2'-Deoxyadenosine (alpha) is a major adenine lesion produced by gamma-ray irradiation of DNA under anoxic conditions. In this study, single-stranded recombinant M13 vectors containing alpha were constructed and transfected into Escherichia coli to assess lethal and mutagenic effects of this lesion. The data for alpha were further compared with those obtained with M13 vectors containing normal A or a model abasic site (F) at the same site. The transfection assay revealed that alpha constituted a moderate block to DNA replication. The in vivo replication capacity to pass through alpha was approximately 20% relative to normal A, but 20-fold higher than that of F constituting an almost absolute replication block. Similar data were obtained by in vitro replication of oligonucleotide templates containing alpha or F by E.coli DNA polymerase I. The mutagenic consequence of replicating M13 DNA containing alpha was analyzed by direct DNA sequencing of progeny phage. Mutagenesis was totally targeted at the site of alpha introduced into the vector. Mutation was exclusively a single nucleotide deletion and no base substitutions were detected. The deletion frequency associated alpha was dependent on the 3'-nearest neighbor base: with the 3'-nearest neighbor base T mutation (deletion) frequency was 26%, whereas 1% with the 3'-nearest neighbor base G. A possible mechanism of the single nucleotide deletion associated with alpha is discussed on the basis of the misinsertion-strand slippage model. PMID:9016601

  5. alpha-thalassemia mutations in Khuzestan Province, Southwest Iran.

    PubMed

    Zandian, Khodamorad; Nateghi, Jamal; Keikhaie, Bijan; Pedram, Mohammad; Hafezi-Nejad, Nima; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Law, Hai-Yang; Najmabadi, Hossein

    2008-01-01

    Although alpha-thalassemia (alpha-thal) is the most common hereditary hemoglobin (Hb) disorder in Iran, no comprehensive data are so far available on the prevalence of the disease in the province of Khuzestan in Southwest Iran. This study investigates the spectrum of alpha-thal mutations in this region. One hundred and twenty-one subjects from Khuzestan Province, Iran, were initially tested for the three most common Iranian alpha-thal mutations (- alpha3.7, -alpha4.2, and --MED) by gap-polymerase chain reaction (gap-PCR). Reverse hybridization test strips and DNA sequencing were used to identify additional alpha-globin mutations. A total of 131 mutated alpha-globin alleles were identified in these patients. Of the 13 mutations that were detected in Khuzestan Province, Iran, the - alpha3.7 single gene deletion was the most frequently identified variant, representing 62.6% of the total; we also observed significant numbers of individuals with compound heterozygous mutations. On the basis of our results, we strongly recommend screening for the most common mutations to improve the molecular diagnosis of anemia in this region. PMID:19065332

  6. Alpha One Foundation

    MedlinePlus

    ... ATS-ERS Standards Research Research Registry DNA & Tissue Bank Other Research Programs Scientific Meetings & Conferences Education CME- ... Programs Funding Sources Resources Research Registry DNA & Tissue Bank Biomaterials Exchange NIH Lung Tissue Research Consortium National- ...

  7. Alpha-thalassaemia.

    PubMed

    Harteveld, Cornelis L; Higgs, Douglas R

    2010-01-01

    Alpha-thalassaemia is inherited as an autosomal recessive disorder characterised by a microcytic hypochromic anaemia, and a clinical phenotype varying from almost asymptomatic to a lethal haemolytic anaemia.It is probably the most common monogenic gene disorder in the world and is especially frequent in Mediterranean countries, South-East Asia, Africa, the Middle East and in the Indian subcontinent. During the last few decades the incidence of alpha thalassaemia in North-European countries and Northern America has increased because of demographic changes. Compound heterozygotes and some homozygotes have a moderate to severe form of alpha thalassaemia called HbH disease. Hb Bart's hydrops foetalis is a lethal form in which no alpha-globin is synthesized. Alpha thalassaemia most frequently results from deletion of one or both alpha genes from the chromosome and can be classified according to its genotype/phenotype correlation. The normal complement of four functional alpha-globin genes may be decreased by 1, 2, 3 or all 4 copies of the genes, explaining the clinical variation and increasing severity of the disease. All affected individuals have a variable degree of anaemia (low Hb), reduced mean corpuscular haemoglobin (MCH/pg), reduced mean corpuscular volume (MCV/fl) and a normal/slightly reduced level of HbA2. Molecular analysis is usually required to confirm the haematological observations (especially in silent alpha-thalassaemia and alpha-thalassaemia trait). The predominant features in HbH disease are anaemia with variable amounts of HbH (0.8-40%). The type of mutation influences the clinical severity of HbH disease. The distinguishing features of the haemoglobin Bart's hydrops foetalis syndrome are the presence of Hb Bart's and the total absence of HbF. The mode of transmission of alpha thalassaemia is autosomal recessive. Genetic counselling is offered to couples at risk for HbH disease or haemoglobin Bart's Hydrops Foetalis Syndrome. Carriers of alpha+- or

  8. Potential use of buccal smears for rapid diagnosis of autosomal trisomy or chromosomal sex in newborn infants using DNA probes

    SciTech Connect

    Harris, C.; Clark, K.; Lazarski, K.; Wilkerson, C.; Meisner, L. |

    1994-12-01

    Buccal smears from 3 women and 1 man were probed with alpha satellite DNA probes for chromosomes 8, 18, X, and Y. Buccal smears were also collected from an adolescent phenotypic female with uterine agenesis, as well as from newborn infants with suspected trisomy 18 and trisomy 21. The clinical cases were confirmed with conventional cytogenetic studies of peripheral lymphocytes. Overall probe efficiency at detecting expected chromosome number in interphase cells was found to be 71% {+-} 6.8%. Higher than expected n-1 signal numbers may be due to karyopyknotic intermediate epithelial cells present in all collected samples. Overall probe efficiency was found to be consistent using alpha satellite and cosmid probes, both of which accurately reflected the modal copy number of the target chromosomes. False trisomy was less than 1%. This study suggests DNA probes can be used in buccal smears for rapid diagnosis of trisomies and chromosomal sex in newborns, but because of high rates of false hydropoploid signals, probed buccal smear specimens may not be accurate at diagnosing mosaicism. 9 refs., 2 figs., 1 tab.

  9. Galileo satellite antenna modeling

    NASA Astrophysics Data System (ADS)

    Steigenberger, Peter; Dach, Rolf; Prange, Lars; Montenbruck, Oliver

    2015-04-01

    The space segment of the European satellite navigation system Galileo currently consists of six satellites. Four of them belong to the first generation of In-Orbit Validation (IOV) satellites whereas the other two are Full Operational Capability (FOC) satellites. High-precision geodetic applications require detailed knowledge about the actual phase center of the satellite and receiver antenna. The deviation of this actual phase center from a well-defined reference point is described by phase center offsets (PCOs) and phase center variations (PCVs). Unfortunately, no public information is available about the Galileo satellite antenna PCOs and PCVs, neither for the IOV, nor the FOC satellites. Therefore, conventional values for the IOV satellite antenna PCOs have been adopted for the Multi-GNSS experiment (MGEX) of the International GNSS Service (IGS). The effect of the PCVs is currently neglected and no PCOs for the FOC satellites are available yet. To overcome this deficiency in GNSS observation modeling, satellite antenna PCOs and PCVs are estimated for the Galileo IOV satellites based on global GNSS tracking data of the MGEX network and additional stations of the legacy IGS network. Two completely independent solutions are computed with the Bernese and Napeos software packages. The PCO and PCV values of the individual satellites are analyzed and the availability of two different solutions allows for an accuracy assessment. The FOC satellites are built by a different manufacturer and are also equipped with another type of antenna panel compared to the IOV satellites. Signal transmission of the first FOC satellite has started in December 2014 and activation of the second satellite is expected for early 2015. Based on the available observations PCO estimates and, optionally PCVs of the FOC satellites will be presented as well. Finally, the impact of the new antenna model on the precision and accuracy of the Galileo orbit determination is analyzed.

  10. Satellite broadcasting in Europe

    NASA Astrophysics Data System (ADS)

    Bartholome, P.

    1984-05-01

    Three main communications services are recognized by the International Telecommunications Union: the Fixed Service, the Mobile Service and the Broadcasting Service. In Europe, EUTELSAT has just begun to exploit the first ECS satellite. The ESA-launched satellite was originally designed to provide an international public telecommunication service, however, the satellite will be used now almost exclusively for TV program distribution, while a second ECS satellite will be used for telephony. Despite plans for the launch of a third, countries in Europe are looking to other organizations such as INTELSAT for greater satellite capacity. Other organizations include Unisat, DFS/Copernicus, GDL, and Videosat. Both satellite and cable networks will increase the program-viewing audience, thus encouraging plans for a pan-European television service intended for an international audience. Although the combination of cable networks and distribution satellites looks promising, high-power broadcasting satellites will play an important role because of flexibility and additional program distribution.

  11. Stereo Measurements from Satellites

    NASA Technical Reports Server (NTRS)

    Adler, R.

    1982-01-01

    The papers in this presentation include: 1) 'Stereographic Observations from Geosynchronous Satellites: An Important New Tool for the Atmospheric Sciences'; 2) 'Thunderstorm Cloud Top Ascent Rates Determined from Stereoscopic Satellite Observations'; 3) 'Artificial Stereo Presentation of Meteorological Data Fields'.

  12. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  13. Evidence for a temperature rise in the outer layers of alpha Lyrae, from Copernicus observations of Lyman-alpha

    NASA Technical Reports Server (NTRS)

    Praderie, F.; Simonneau, E.; Snow, T. P., Jr.

    1975-01-01

    Copernicus satellite observations of the Ly-alpha profiles in alpha Lyrae (Vega) are used to determine whether classical radiative-equilibrium LTE model atmospheres can fit the thermal structure in the outer layers of that star. Two plane-parallel LTE model photospheres of alpha Lyrae are considered: a line-blanketed radiative-equilibrium model with an effective temperature of 9650 K and log g of 4.05, and the same model with a temperature of 9500 K and log g of 4.0. The profiles of the Ly-alpha wings are computed, and it is found that classical LTE models are unable to predict either the observed violet wing or the red wing longwards of 1239 A, regardless of the line source function. It is concluded that the electron temperature must increase outwards over the surface value reached in radiative equilibrium.

  14. Magnetospheres: Jupiter, Satellite Interactions

    NASA Astrophysics Data System (ADS)

    Neubauer, F.; Murdin, P.

    2000-11-01

    Most of the satellites of Jupiter, notably the large Galilean satellites Io, Europa, Ganymede and Callisto (see JUPITER: SATELLITES), orbit deep inside the magnetosphere of Jupiter (see JUPITER: MAGNETOSPHERE) and are therefore immersed in the flow of magnetospheric plasma (made of a mixture of electrons and ions) and subjected to an interaction with the strong Jovian magnetic field. These intera...

  15. [Theme Issue: Communications Satellites.

    ERIC Educational Resources Information Center

    Howkins, John, Ed.

    1976-01-01

    One section of this journal is devoted to issues involving broadcast satellites. Separate articles discuss the need for international planning of satellite broadcasting, decisions made at the 1971 World Administrative Radio Conference for Space Telecommunications, potential problems in satellite broadcasting, a series of proposals drawn up by the…

  16. A tumour necrosis factor alpha polymorphism is not associated with rheumatoid arthritis.

    PubMed Central

    Wilson, A G; de Vries, N; van de Putte, L B; Duff, G W

    1995-01-01

    OBJECTIVE--To determine whether a polymorphism within the tumour necrosis factor alpha (TNF alpha) gene is associated with susceptibility to, or severity of, rheumatoid arthritis (RA). METHODS--Consecutive patients with recent onset RA were enrolled in a prospective trial. DNA was collected, disease activity was measured at presentation, and radiographic progression at three years was assessed. Typing of TNF alpha was by polymerase chain reaction and single stranded conformation polymorphism analysis. RESULTS--No association of TNF alpha alleles and susceptibility to, or severity of, RA was demonstrated. CONCLUSIONS--These results indicate that this TNF alpha polymorphism does not play a part in the genetic background of RA. PMID:7668906

  17. [The identification of mouse cloned SFA DNA].

    PubMed

    Yi, Ning; Wu, Weng Qing; Ni, Zu Mei; Shi, Lu Ji

    2002-12-01

    For some basic investigation and the construction of artificial chromosomes, cloned centromeric DNAs identified on a firm ground are required. Thus, in the present work a preliminary screened clone of 13.5 kb DNA, 6# clone, form a mouse centromeric library contructed previously in our library was futher investigated by FISH and PCR. It was found that mouse 6# cloned SFA DNA, as shown by FISH is a fragment of mouse centromeric DNA. Evidence was also observed that 6# cloned SFA DNA consists of mouse minor satellite DNA and other DNA sequences. PMID:15346991

  18. Molecular characterization of hemoglobin alpha-D chains from Geochelone carbonaria and Geochelone denticulata land turtles.

    PubMed

    Melo, Mônica B; Bordin, Silvana; Duarte, Adriana S S; Ogo, Satie H; Torsoni, Márcio A; Saad, Sara T O; Costa, Fernando F

    2003-02-01

    In order to help elucidate the evolution of alpha-globins, the complete cDNA and amino acid sequences of Geochelone carbonaria and Geochelone denticulata land turtles alpha-D chains have been described. In G. carbonaria, the cDNA is 539 bp with ATG start codon located at position 46, TGA stop codon at position 469 and AATAAA polyadenylation signal at position 520. In G. denticulata, the cDNA is 536 bp with ATG start codon located at position 46, TGA stop codon at position 469 and AATAAA polyadenylation signal at position 517. Both cDNAs codify 141 amino acid residues, differing from each other in only four amino acid residues. When comparing with human Hb alpha-chain, alterations in important regions can be noted: alpha110 Ala-Gly, alpha114 Pro-Gly, alpha117 Phe-Tyr and alpha122 His-Gln. There is a high homology between the amino acids of these turtles when compared with chicken alpha-D chains, progressively decreasing when compared with human, crocodile, snake, frog and fish alpha-chains. Phylogenetic analysis of alpha-D chains shows that those of turtles are closer to those of birds than to snakes and lizards. PMID:12568815

  19. Impaired coactivator activity of the Gly{sub 482} variant of peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) on mitochondrial transcription factor A (Tfam) promoter

    SciTech Connect

    Choi, Yon-Sik; Hong, Jung-Man; Lim, Sunny; Ko, Kyung Soo; Pak, Youngmi Kim . E-mail: ymkimpak@amc.seoul.kr

    2006-06-09

    Mitochondrial dysfunction may cause diabetes or insulin resistance. Peroxisome proliferation-activated receptor-{gamma} (PPAR-{gamma}) coactivator-1 {alpha} (PGC-1{alpha}) increases mitochondrial transcription factor A (Tfam) resulting in mitochondrial DNA content increase. An association between a single nucleotide polymorphism (SNP), G1444A(Gly482Ser), of PGC-1{alpha} coding region and insulin resistance has been reported in some ethnic groups. In this study, we investigated whether a change of glycine to serine at codon 482 of PGC-1{alpha} affected the Tfam promoter activity. The cDNA of PGC-1{alpha} variant bearing either glycine or serine at 482 codon was transfected into Chang human hepatocyte cells. The PGC-1{alpha} protein bearing glycine had impaired coactivator activity on Tfam promoter-mediated luciferase. We analyzed the PGC-1{alpha} genotype G1444A and mitochondrial DNA (mtDNA) copy number from 229 Korean leukocyte genomic DNAs. Subjects with Gly/Gly had a 20% lower amount of peripheral blood mtDNA than did subjects with Gly/Ser and Ser/Ser (p < 0.05). No correlation was observed between diabetic parameters and PGC-1{alpha} genotypes in Koreans. These results suggest that PGC-1{alpha} variants with Gly/Gly at 482nd amino acid may impair the Tfam transcription, a regulatory function of mitochondrial biogenesis, resulting in dysfunctional mtDNA replication.

  20. Survey: National Environmental Satellite Service

    NASA Technical Reports Server (NTRS)

    1977-01-01

    The national Environmental Satellite Service (NESS) receives data at periodic intervals from satellites of the Synchronous Meteorological Satellite/Geostationary Operational Environmental Satellite series and from the Improved TIROS (Television Infrared Observational Satellite) Operational Satellite. Within the conterminous United States, direct readout and processed products are distributed to users over facsimile networks from a central processing and data distribution facility. In addition, the NESS Satellite Field Stations analyze, interpret, and distribute processed geostationary satellite products to regional weather service activities.

  1. Digital satellite communications

    NASA Astrophysics Data System (ADS)

    Ha, T. T.

    1986-06-01

    The use of satellite communications in point-to-multipoint transmission of data is studied. The theory, systems, and equipment for satellite communications are described. The topics of satellite orbits, satellite construction, earth station equipment, and the analysis of the satellite link are discussed. Different types of digital modulation for carrier transmission, and techniques for enhancing the transmission capacity, such as digital speech interpolation and demand assignment, are examined. Techniques and equipment for performing the multiple access-broadcasting functions including FDMA, TDMA, DAMA, CDMA, and random access are considered.

  2. Fundamentals of satellite navigation

    NASA Astrophysics Data System (ADS)

    Stiller, A. H.

    The basic operating principles and capabilities of conventional and satellite-based navigation systems for air, sea, and land vehicles are reviewed and illustrated with diagrams. Consideration is given to autonomous onboard systems; systems based on visible or radio beacons; the Transit, Cicada, Navstar-GPS, and Glonass satellite systems; the physical laws and parameters of satellite motion; the definition of time in satellite systems; and the content of the demodulated GPS data signal. The GPS and Glonass data format frames are presented graphically, and tables listing the GPS and Glonass satellites, their technical characteristics, and the (past or scheduled) launch dates are provided.

  3. TSS Satellite Overview

    NASA Technical Reports Server (NTRS)

    Manarini, G.

    1985-01-01

    The responsibilities of NASA and PSN/CNR in the tethered satellite system cooperative program are listed and PSN/CNR-AIT system support and technologies studies are summarized. Results are given for investigations of active vs. passive satellite trade offs; analysis of alternative maneuvers; satellite attitude and position determination analysis failure modes analysis; moveable boom dynamic analysis; double tethered satellite system; and thermo/dynamic analysis for 100 km to 120 km altitude range. Objectives for the space plasma science mission and its applications are outlined and the TSS satellite configuration is highlighted. Programmatic aspects are included.

  4. Binding of receptor-recognized forms of alpha2-macroglobulin to the alpha2-macroglobulin signaling receptor activates phosphatidylinositol 3-kinase.

    PubMed

    Misra, U K; Pizzo, S V

    1998-05-29

    Ligation of the alpha2-macroglobulin (alpha2M) signaling receptor by receptor-recognized forms of alpha2M (alpha2M*) initiates mitogenesis secondary to increased intracellular Ca2+. We report here that ligation of the alpha2M signaling receptor also causes a 1. 5-2.5-fold increase in wortmannin-sensitive phosphatidylinositol 3-kinase (PI3K) activity as measured by the quantitation of phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 formation was alpha2M* concentration-dependent with a maximal response at approximately 50 pM ligand concentration. The peak formation of PIP3 occurred at 10 min of incubation. The alpha2M receptor binding fragment mutant K1370R which binds to the alpha2M signaling receptor activating the signaling cascade, increased PIP3 formation by 2-fold. The mutant K1374A, which binds very poorly to the alpha2M signaling receptor, did not cause any increase in PIP3 formation. alpha2M*-induced DNA synthesis was inhibited by wortmannin. 1, 2Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acetoxymethylester a chelator of intracellular Ca2+, drastically reduced alpha2M*-induced increases in PIP3 formation. We conclude that PI3K is involved in alpha2M*-induced mitogenesis in macrophages and intracellular Ca2+ plays a role in PI3K activation. PMID:9593670

  5. Satellite altitude determination uncertainties

    NASA Technical Reports Server (NTRS)

    Siry, J. W.

    1971-01-01

    Satellite altitude determination uncertainties are discussed from the standpoint of the GEOS-C satellite. GEOS-C will be tracked by a number of the conventional satellite tracking systems, as well as by two advanced systems; a satellite-to-satellite tracking system and lasers capable of decimeter accuracies which are being developed in connection with the Goddard Earth and Ocean Dynamics Applications program. The discussion is organized in terms of a specific type of GEOS-C orbit which would satisfy a number of scientific objectives including the study of the gravitational field by means of both the altimeter and the satellite-to-satellite tracking system, studies of tides, and the Gulf Stream meanders.

  6. Transforming growth factor alpha may be a physiological regulator of liver regeneration by means of an autocrine mechanism.

    PubMed Central

    Mead, J E; Fausto, N

    1989-01-01

    We investigated whether transforming growth factor alpha (TGF-alpha) is involved in hepatocyte growth responses both in vivo and in culture. During liver regeneration after partial hepatectomy in rats, TGF-alpha mRNA increased; it reached a maximum (approximately 9-fold higher than normal) at the peak of DNA synthesis. The message and the peptide were localized in hepatocytes and found in higher amounts in hepatocytes obtained from regenerating liver. TGF-alpha caused a 13-fold elevation of DNA synthesis in hepatocytes in primary culture and was slightly more effective than epidermal growth factor. TGF-beta blocked TGF-alpha stimulation when added either simultaneously with TGF-alpha or a day later. TGF-alpha message increased in hepatocytes stimulated to undergo DNA synthesis by TGF-alpha or epidermal growth factor, and the peptide was detected in the culture medium by RIA. In the regenerating liver, the increase in TGF-alpha mRNA during the first day after partial hepatectomy coincided with an increase in epidermal growth factor/TGF-alpha receptor mRNA and a decrease (already reported) in the number of these receptors. We conclude that TGF-alpha may function as a physiological inducer of hepatocyte DNA synthesis during liver regeneration by means of an autocrine mechanism and that its stimulatory effects in this growth process are balanced by the inhibitory action of TGF-beta 1. Images PMID:2922399

  7. Molecular characterization of a bean alpha-amylase inhibitor that inhibits the alpha-amylase of the mexican bean weevil Zabrotes subfasciatus.

    PubMed

    Grossi de Sa, M F; Mirkov, T E; Ishimoto, M; Colucci, G; Bateman, K S; Chrispeels, M J

    1997-01-01

    Cultivated varieties of the common bean (Phaseolus vulgaris L.) contain an alpha-amylase inhibitor (alpha AI-1) that inhibits porcine pancreatic alpha-amylase (PPA; EC 3.2.1.1) and the amylases of certain seed weevils, but not that of the Mexican bean weevil, Zabrotes subfasciatus. A variant of alpha AI-1, called alpha AI-2, is found in certain arcelin-containing wild accessions of the common bean. The variant alpha AI-2 inhibits Z. subfasciatus alpha-amylase (ZSA), but not PPA. We purified alpha AI-2 and studied its interaction with ZSA. The formation of the alpha AI-2-ZSA complex is time-dependent and occurs maximally at pH 5.0 or below. When a previously isolated cDNA assumed to encode alpha AI-2 was expressed in transgenic tobacco seeds, the seeds contained inhibitory activity toward ZSA but not toward PPA, confirming that the cDNA encodes alpha AI-2. The inhibitors alpha AI-1 and alpha AI-2 share 78% sequence identity at the amino acid level and they differ in an important region that is part of the site where the enzyme binds the inhibitor. The swap of a tripeptide in this region was not sufficient to change the specificity of the two inhibitors towards their respective enzymes. The three-dimensional structure of the alpha AI-1/PPA complex has just been solved and we recently obtained the derived amino acid sequence of ZSA. This additional information allows us to discuss the results described here in the framework of the amino acid residues of both proteins involved in the formation of the enzyme-inhibitor complex and to pinpoint the amino acids responsible for the specificity of the interaction. PMID:9431678

  8. Analysis of the largest tandemly repeated DNA families in the human genome

    PubMed Central

    Warburton, Peter E; Hasson, Dan; Guillem, Flavia; Lescale, Chloe; Jin, Xiaoping; Abrusan, Gyorgy

    2008-01-01

    Background Tandemly Repeated DNA represents a large portion of the human genome, and accounts for a significant amount of copy number variation. Here we present a genome wide analysis of the largest tandem repeats found in the human genome sequence. Results Using Tandem Repeats Finder (TRF), tandem repeat arrays greater than 10 kb in total size were identified, and classified into simple sequence e.g. GAATG, classical satellites e.g. alpha satellite DNA, and locus specific VNTR arrays. Analysis of these large sequenced regions revealed that several "simple sequence" arrays actually showed complex domain and/or higher order repeat organization. Using additional methods, we further identified a total of 96 additional arrays with tandem repeat units greater than 2 kb (the detection limit of TRF), 53 of which contained genes or repeated exons. The overall size of an array of tandem 12 kb repeats which spanned a gap on chromosome 8 was found to be 600 kb to 1.7 Mbp in size, representing one of the largest non-centromeric arrays characterized. Several novel megasatellite tandem DNA families were observed that are characterized by repeating patterns of interspersed transposable elements that have expanded presumably by unequal crossing over. One of these families is found on 11 different chromosomes in >25 arrays, and represents one of the largest most widespread megasatellite DNA families. Conclusion This study represents the most comprehensive genome wide analysis of large tandem repeats in the human genome, and will serve as an important resource towards understanding the organization and copy number variation of these complex DNA families. PMID:18992157

  9. [Forced Oscillations of DNA Bases].

    PubMed

    Yakushevich, L V; Krasnobaeva, L A

    2016-01-01

    This paper presents the results of the studying of forced angular oscillations of the DNA bases with the help of the mathematical model consisting of two coupled nonlinear differential equations that take into account the effects of dissipation and the influence of an external periodic field. The calculation results are illustrated for sequence of gene encoding interferon alpha 17 (IFNA 17). PMID:27192830

  10. Cleaving DNA with DNA

    NASA Astrophysics Data System (ADS)

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-03-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

  11. Observations of interstellar hydrogen and deuterium toward Alpha Centauri A

    NASA Technical Reports Server (NTRS)

    Landsman, W. B.; Henry, R. C.; Moos, H. W.; Linsky, J. L.

    1984-01-01

    A composite profile is presented of the Ly-alpha emission line of Alpha Cen A, obtained from 10 individual spectra with the high-resolution spectrograph aboard the International Ultraviolet Explorer (IUE) satellite. There is excellent overall agreement with two previous Copernicus observations. Interstellar deuterium is detected, and a lower limit is set on the deuterium to hydrogen ratio of nDI/nHI greater than 8 x 10 to the -6th. In addition, the deuterium bulk velocity appears blueshifted by 8 + or - 2 km/s with respect to interstellar hydrogen, suggesting a nonuniform medium along the line of sight.

  12. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  13. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  14. Protein structures of common bean (Phaseolus vulgaris) alpha-amylase inhibitors.

    PubMed

    Lee, Shih-Chieh; Gepts, Paul L; Whitaker, John R

    2002-10-23

    Two nucleotide sequences for genes that encode alpha-amylase inhibitor 4 (alphaAI-4) from white kidney bean (WKB) cv. 858, designated gene alphaAI-4 (Accession No. ), and alpha-amylase inhibitor 5 (alphaAI-5) from black bean (BB), designated gene alphaAI-5 (Accession No. ), were determined. Genes alphaAI-4 and alphaAI-5 encode 244 amino acid prepro-alphaAI-4 and prepro-alphaAI-5 polypeptides that are 93 and 95% identical with alpha-amylase inhibitor l (alphaAI-l; Hoffman, L. M.; Ma, Y.; Barker, R. F. Nucleic Acids Res. 1982, 10, 7819-7828), 40 and 43% identical with red kidney bean lectin, and 52 and 55% identical with arcelin l of wild-type bean. The high degree of sequence similarity indicates the evolutionary relationship among these genes. PCR analysis of genomic DNA purified from six genotypes of Phaseolus vulgaris showed very similar band patterns in 2% agarose gel, another indication of the conserved size homology among these genes. Proteolytic processing sites were located between Asn77 and Ser78 for pro-alphaAI-4 and pro-alphaAI-5. A bend next to Asn77 in three-dimensional model structures of alphaAI-4 and alphaAI-5 proinhibitors indicates that the proteolytic cleavage is necessary to remove the conformational constraint for activation to the mature protein. Mature WKB alphaAI-4 was composed of four subunits (2alpha2beta) and had a molecular weight of 50000 determined by multiangle laser light scattering and 56714 determined by laser-assisted time-of-flight mass spectrometry. PMID:12381161

  15. DNA replication defect in Salmonella typhimurium mutants lacking the editing (epsilon) subunit of DNA polymerase III.

    PubMed Central

    Lifsics, M R; Lancy, E D; Maurer, R

    1992-01-01

    In Salmonella typhimurium, dnaQ null mutants (encoding the epsilon editing subunit of DNA polymerase III [Pol III]) exhibit a severe growth defect when the genetic background is otherwise wild type. Suppression of the growth defect requires both a mutation affecting the alpha (polymerase) subunit of DNA polymerase III and adequate levels of DNA polymerase I. In the present paper, we report on studies that clarify the nature of the physiological defect imposed by the loss of epsilon and the mechanism of its suppression. Unsuppressed dnaQ mutants exhibited chronic SOS induction, indicating exposure of single-stranded DNA in vivo, most likely as gaps in double-stranded DNA. Suppression of the growth defect was associated with suppression of SOS induction. Thus, Pol I and the mutant Pol III combined to reduce the formation of single-stranded DNA or accelerate its maturation to double-stranded DNA. Studies with mutants in major DNA repair pathways supported the view that the defect in DNA metabolism in dnaQ mutants was at the level of DNA replication rather than of repair. The requirement for Pol I was satisfied by alleles of the gene for Pol I encoding polymerase activity or by rat DNA polymerase beta (which exhibits polymerase activity only). Consequently, normal growth is restored to dnaQ mutants when sufficient polymerase activity is provided and this compensatory polymerase activity can function independently of Pol III. The high level of Pol I polymerase activity may be required to satisfy the increased demand for residual DNA synthesis at regions of single-stranded DNA generated by epsilon-minus pol III. The emphasis on adequate polymerase activity in dnaQ mutants is also observed in the purified alpha subunit containing the suppressor mutation, which exhibits a modestly elevated intrinsic polymerase activity relative to that of wild-type alpha. Images PMID:1400246

  16. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  17. Far-Infrared and Millimeter Continuum Studies of K-Giants: Alpha Boo and Alpha Tau

    NASA Technical Reports Server (NTRS)

    Cohen, Martin; Carbon, Duane F.; Welch, William J.; Lim, Tanya; Forster, James R.; Goorvitch, David; Thigpen, William (Technical Monitor)

    2002-01-01

    We have imaged two normal, non-coronal, infrared-bright K-giants, alpha Boo and alpha Tau, in the 1.4-millimeter and 2.8-millimeter continuum using BIMA. These stars have been used as important absolute calibrators for several infrared satellites. Our goals are: (1) to probe the structure of their upper photospheres; (2) to establish whether these stars radiate as simple photospheres or possess long-wavelength chromospheres; and (3) to make a connection between millimeter-wave and far-infrared absolute flux calibrations. To accomplish these goals we also present ISO Long Wavelength Spectrometer (LWS) measurements of both these K-giants. The far-infrared and millimeter continuum radiation is produced in the vicinity of the temperature minimum in a Boo and a Tau, offering a direct test of the model photospheres and chromospheres for these two cool giants. We find that current photospheric models predict fluxes in reasonable agreement with those observed for those wavelengths which sample the upper photosphere, namely less than or equal to 170 micrometers in alpha Tau and less than or equal to 125 micrometers in alpha Boo. It is possible that alpha Tau is still radiative as far as 0.9 - 1.4 millimeters. We detect chromospheric radiation from both stars by 2.8 millimeters (by 1.4 millimeters in alpha Boo), and are able to establish useful bounds on the location of the temperature minimum. An attempt to interpret the chromospheric fluxes using the two-component "bifurcation model" proposed by Wiedemann et al. (1994) appears to lead to a significant contradiction.

  18. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  19. The Lyman alpha coronagraph

    NASA Technical Reports Server (NTRS)

    Kohl, J. L.; Reeves, E. M.; Kirkham, B.

    1977-01-01

    The rocket-borne Lyman alpha coronagraph (RLAC) is to be used in the absence of a natural solar eclipse to determine coronal temperatures from measurements of the line width of Lyman-alpha and to determine neutral hydrogen densities of coronal material from the absolute intensity. The coronagraph consists of a 75-cm Fastie-Ebert scanning spectrometer with an AMR 641 photoelectric detection system, an off-axis parabolic primary mirror, and an occulting system. A special optical arrangement achieves rejection of radiation from the solar disk.

  20. Alpha-amylase gene transcription in tissues of normal dog.

    PubMed

    Mocharla, H; Mocharla, R; Hodes, M E

    1990-02-25

    We studied the distribution of alpha-amylase mRNA in normal dog tissues by northern blotting (NB) and reverse transcription-polymerase chain reaction (RT-PCR) with human pancreatic (AMY2) and salivary (AMY1) alpha-amylase cDNA-specific primers. Analysis of poly(A+) RNA from various normal tissues by NB indicated the presence of detectable levels of alpha-amylase mRNA transcripts only in pancreas. Dot-blot analysis of DNA amplified with primers common to both (human) isoamylase mRNAs showed presence of alpha-amylase gene transcripts not only in pancreas but also in liver, small intestine, large intestine and fallopian tube. Traces of amylase gene transcripts were also observed in ovary, uterus and lung. Interestingly, amylase transcripts were not detectable in the parotid gland by NB or RT-PCR. We have also localized alpha-amylase mRNA transcripts to dog pancreas by in situ transcription and in situ hybridization. Our results suggest that there is high degree of homology between the alpha-amylase mRNA sequences in dog and human at least in the exon 3-4 regions of the human gene. PMID:2315015

  1. Characterization of Cxorf5 (71-7A), a novel human cDNA mapping to Xp22 and encoding a protein containing coiled-coil alpha-helical domains.

    PubMed

    de Conciliis, L; Marchitiello, A; Wapenaar, M C; Borsani, G; Giglio, S; Mariani, M; Consalez, G G; Zuffardi, O; Franco, B; Ballabio, A; Banfi, S

    1998-07-15

    The human X chromosome is known to contain several disease genes yet to be cloned. In the course of a project aimed at the construction of a transcription map of the Xp22 region, we fully characterized a novel cDNA, Cxorf5 (HGMW-approved symbol, alias 71-7A), previously mapped to this region but for which no sequence information was available. We isolated and sequenced the full-length transcript, which encodes a predicted protein of unknown function containing a large number of coiled-coild domains, typically presented in a variety of different molecules, from fibrous proteins to transcription factors. We showed that the Cxorf5 cDNA is ubiquitously expressed, undergoes alternative splicing, and escapes X inactivation. Furthermore, we precisely mapped two additional Cxorf5-related loci on the Y chromosome and on chromosome 5. By virtue of its mapping assignment to the Xp22 region, Cxorf5 represents a candidate gene for at least four human diseases, namely spondyloepiphiseal dysplasia late, oral-facial-digital syndrome type 1, craniofrontonasal syndrome, and a nonsyndromic sensorineural deafness. PMID:9722947

  2. Characterization of the bovine C alpha gene.

    PubMed Central

    Brown, W R; Rabbani, H; Butler, J E; Hammarström, L

    1997-01-01

    The complete genomic sequence of a bovine C alpha gene is reported here. The genomic sequence was obtained from a C alpha phage clone that had been cloned from a genomic EMBL4 phage vector library. The C alpha sequence had previously been expressed as a chimeric antibody and identified as IgA using IgA-specific antibodies. Intron/exon boundaries were determined by comparison of the genomic sequence with an expressed bovine C alpha sequence obtained from spleen by reverse transcription-polymerase chain reaction (RT-PCR). Analysis of 50 Swedish bovine genomic DNA samples using genomic blots and five different restriction enzymes failed to detect evidence of polymorphism. However, PstI digests of Brown Swiss DNA showed a restriction fragment length polymorphism (RFLP), suggesting that at least two allelic variants of bovine IgA exist. Comparison of the deduced amino acid sequence of bovine IgA with sequences available for other species indicated that the highest homology was with that of swine, another artiodactyl. This was the highest homology observed for all mammalian IgA compared except for that between IgA1 and IgA2 in humans. Bovine IgA shares with rabbit IgA3 and IgA4, an additional N-linked glycosylation site at position 282. However, the collective data indicate that cattle are like swine and rodents and unlike rabbits in having a single locus of the gene encoding IgA of this species. Images Figure 4 PMID:9203958

  3. Nanoparticle bridge DNA biosensor

    NASA Astrophysics Data System (ADS)

    Huang, Hong-Wen

    A new DNA sensing method is demonstrated in which DNA hybridization events lead to the formation of nanoparticle satellites that bridge two electrodes and are detected electrically. The hybridization events are exclusively carried out only on specific locations, the surfaces of C-ssDNA modified 50 nm GNPs. The uniqueness of this work is that only a small number of T-ccDNA molecules (<10) is required to form the nanoparticle satellites, allowing ultra-sensitive DNA sensing. The principle of this new DNA sensing technique has been demonstrated using target DNA and three-base-pair-mismatched DNA in 20nM concentrations. Three single-stranded DNA (ssDNA) system is used in our experiment which includes Capture-ssDNA (C-ssDNA), Target-ssDNA (T-ssDNA) and Probe-ssDNA (P-ssDNA). Both C-ssDNA and P-ssDNA are modified by a thiol group and can hybridize with different portions of T-ssDNA. T-ssDNA requires no modification in three ssDNA system, which is beneficial in many applications. C-ssDNA modified 50nm gold nanoparticle (C-50au) and P-ssDNA modified 30nm gold nanoparticle (P-30au) are prepared through the reaction of thiol-gold chemical bonding between thiolated ssDNA and gold nanoparticle (GNP) (C-ssDNA with 50nm GNP, P-ssDNA with 30nm GNP). We controllably place the C-50au only on the SiO2 band surface (˜ 90nm width) between two gold electrodes (source and drain electrodes) by forming positively- and negatively-charged self-assembled monolayers (SAMs) on SiO2 and gold surface, respectively. DNA modified GNP is negatively charged due to ionization of phosphate group on DNA back bone. C-50au therefore is negatively charged and can only be attracted toward SiO2 area (repelled by negatively charged gold electrode surface). The amine group of positively-charged SAMs on SiO2 surface is then passivated by converting to non-polar methyl functional group after C-50au placement. P-30au is first hybridized with T-ssDNA in the solution phase (T-P- 30au formed) and is introduced

  4. Atmosphere Explorer observations of the geocoronal H Balmer alpha nightglow

    NASA Technical Reports Server (NTRS)

    Burrage, M. D.; Yee, J. H.; Abreu, V. J.

    1989-01-01

    The Balmer alpha nightglow emission of geocoronal atomic hydrogen has been investigated using photometric data obtained by the Visible Airglow Experiment on board the Atmosphere Explorer E satellite. The measured H Balmer alpha intensities are presented as a function of solar depression angle, observation zenith angle, and azimuth relative to the sun for solar minimum conditions. The results are at variance with the earlier D2A satellite observations but in better agreement with previous ground-based studies. As a result of comparison with theoretical predictions, the present observations reaffirm the findings of the ground-based investigations in implying that values for the Lyman beta line center flux are a factor of 2 greater than those derived from direct measurements.

  5. Communication satellite applications

    NASA Astrophysics Data System (ADS)

    Pelton, Joseph N.

    The status and future of the technologies, numbers and services provided by communications satellites worldwide are explored. The evolution of Intelsat satellites and the associated earth terminals toward high-rate all-digital telephony, data, facsimile, videophone, videoconferencing and DBS capabilities are described. The capabilities, services and usage of the Intersputnik, Eutelsat, Arabsat and Palapa systems are also outlined. Domestic satellite communications by means of the Molniya, ANIK, Olympus, Intelsat and Palapa spacecraft are outlined, noting the fast growth of the market and the growing number of different satellite manufacturers. The technical, economic and service definition issues surrounding DBS systems are discussed, along with presently operating and planned maritime and aeronautical communications and positioning systems. Features of search and rescue and tracking, data, and relay satellite systems are summarized, and services offered or which will be offered by every existing or planned communication satellite worldwide are tabulated.

  6. DNA repair

    SciTech Connect

    Friedberg, E.C.; Hanawalt, P.C. )

    1988-01-01

    Topics covered in this book included: Eukaryote model systems for DNA repair study; Sensitive detection of DNA lesions and their repair; and Defined DNA sequence probes for analysis of mutagenesis and repair.

  7. Distorted DNA structures induced by HMGB2 possess a high affinity for HMGB2.

    PubMed

    Nakamura, Yasuyuki; Shimizu, Mitsuhiro; Yoshida, Michiteru

    2002-01-01

    HMGB2 (HMG2) protein binds with DNA duplex in a sequence-nonspecific manner, then bends and unwinds the DNA. In DNA cyclization analyses for the bending activity of HMGB2, two unidentified bands, denoted alpha and beta, were observed in addition to monomer circular DNA (1C) on the gel. Re-electrophoresis and proteinase K digestion revealed that alpha and beta are complexes of circularized probe DNA (seeming 1C) with HMGB2 (K(d) approximately 10(-10) M). The DNA components of alpha and beta (alpha- and beta-DNA) showed higher affinities to HMGB2 than did the linear probe DNA (K(d) approximately 10(-7) M). The DNAs have distorted structures containing partial single-stranded regions. Nicked circular molecules presumably due to severe DNA distortion by HMGB2 were observed in alpha- and beta-DNA, in addition to closed circular double-stranded molecules. The alpha and beta bands were not formed in the presence of sole DNA binding regions which are necessary for DNA bending, indicating that the acidic C-tail in the HMGB2 molecule is necessary for inducing the peculiar distorted structures of higher affinity to HMGB2. HMGB2 binds with linker DNA and/or the entry and exit of nucleosomes fixed at both ends likewise mini-circles similar to alpha-DNA and beta-DNA. Thus, the distorted structures present in alpha-DNA and beta-DNA should be important in considering the functional mechanisms in which HMGB2 participates. PMID:11754747

  8. Satellite services system overview

    NASA Technical Reports Server (NTRS)

    Rysavy, G.

    1982-01-01

    The benefits of a satellite services system and the basic needs of the Space Transportation System to have improved satellite service capability are identified. Specific required servicing equipment are discussed in terms of their technology development status and their operative functions. Concepts include maneuverable television systems, extravehicular maneuvering unit, orbiter exterior lighting, satellite holding and positioning aid, fluid transfer equipment, end effectors for the remote manipulator system, teleoperator maneuvering system, and hand and power tools.

  9. Characterization of cDNAs encoding human pyruvate dehydrogenase alpha subunit.

    PubMed Central

    Ho, L; Wexler, I D; Liu, T C; Thekkumkara, T J; Patel, M S

    1989-01-01

    A cDNA clone (1423 base pairs) comprising the entire coding region of the precursor form of the alpha subunit of pyruvate dehydrogenase (E1 alpha) has been isolated from a human liver cDNA library in phage lambda gt11. The first 29 amino acids deduced from the open reading frame correspond to a typical mitochondrial targeting leader sequence. The remaining 361 amino acids, starting at the N terminus with phenylalanine, represent the mature mitochondrial E1 alpha peptide. The cDNA has 43 base pairs in the 5' untranslated region and 210 base pairs in the 3' untranslated region, including a polyadenylylation signal and a short poly(A) tract. The nucleotide sequence of human liver E1 alpha cDNA was confirmed by the nucleotide sequences of three overlapping fragments generated from human liver and fibroblast RNA by reverse transcription and DNA amplification by the polymerase chain reaction. This consensus nucleotide sequence of human liver E1 alpha cDNA resolves existing discrepancies among three previously reported human E1 alpha cDNAs and provides the unambiguous reference sequence needed for the characterization of genetic mutations in pyruvate dehydrogenase-deficient patients. Images PMID:2748588

  10. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  11. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  12. Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

    SciTech Connect

    Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.

    2009-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  13. Satellite networks for education

    NASA Technical Reports Server (NTRS)

    Singh, J. P.; Morgan, R. P.; Rosenbaum, F. J.

    1972-01-01

    Satellite based educational networking is discussed with particular attention given to the potential uses of communications satellites to help meet educational needs in the United states. Four major subject areas were covered; (1) characteristics and structure of networks, (2) definition of pressures within educational establishment that provide motivation for various types of networks, (3) examination of current educational networking status for educational radio and television, instructional television fixed services, inter- and intra-state educational communication networks, computer networks, and cable television for education, and (4) identification of possible satellite based educational telecommunication services and three alternatives for implementing educational satellite systems.

  14. Satellite communication antenna technology

    NASA Technical Reports Server (NTRS)

    Mittra, R. (Editor); Imbriale, W. A. (Editor); Maanders, E. J. (Editor)

    1983-01-01

    A general overview of current technology in the field of communication satellite antennas is presented. Among the topics discussed are: the design of multiple beam systems; frequency reuse; and polarization control of antenna measurements. Consideration is also given to: contour beam synthesis; dual shaped reflector synthesis; beam shaping; and offset reflector design. The applications of the above technologies to present and future generations of communications satellites is considered, with emphasis given to such systems as: the Intelsats; the Defense Satellite Communications System, (DSCS-III); Satellite Business System (SBS), and Comstar.

  15. Satellite Antenna Systems

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Through the Technology Affiliates Program at the Jet Propulsion Laboratory, the ACTS antenna system was transferred from experimental testing status to commercial development with KVH Industries, Inc. The ACTS design enables mobile satellite antennas to remain pointed at the satellite, regardless of the motion or vibration on which it is mounted. KVH's first product based on the ACTS design is a land-mobile satellite antenna system that will enable direct broadcast satellite television aboard moving trucks, recreational vehicles, trains, and buses. Future products could include use in broadcasting, emergency medical and military vehicles.

  16. Methods of satellite oceanography

    NASA Technical Reports Server (NTRS)

    Stewart, R. H.

    1985-01-01

    The theoretical basis for remote sensing measurements of climate and ocean dynamics is examined. Consideration is given to: the absorption of electromagnetic radiation in the atmosphere; scattering in the atmosphere; and satellite observations using visible light. Consideration is also given to: the theory of radio scatter from the sea; scatter of centimeter waves from the sea; and the theory of operation of synthetic aperture radars. Additional topics include: the coordinate systems of satellite orbits for oceanographic remote sensing applications; the operating features of the major U.S. satellite systems for viewing the ocean; and satellite altimetry.

  17. Satellite Tracking System

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Researchers at the Center for Aerospace Sciences of the University of North Dakota (UND), Grand Forks, used three NASA Computer programs (SANDTRACKS, ODG, NORAD) to develop a Satellite Tracking System for real time utilization of TIROS weather/environment satellite information. SANDTRACKS computes the satellite's position relative to the Earth. ODG allows plotting a view of Earth as seen by the satellite. NORAD computes sight direction, visibility times and maximum elevation angle during each orbit. With the system, UND's Earth System Science Institute will be able to routinely monitor agricultural and environmental conditions of the Northern Plains.

  18. Circular DNA Molecules in the Genus Drosophila

    PubMed Central

    Travaglini, E. C.; Schultz, J.

    1972-01-01

    The satellite DNA's from the embryos of five species of Drosophila (D. melanogaster, D. simulans, D. nasuta, D. virilis and D. hydei) have been analyzed for the presence of closed circular duplex DNA molecules, as determined by CsCl-EBr gradients. Circular DNA molecules were found in every species but D. melanogaster. Analyses of cell fractions from adult Drosophila and organ fractions from Drosophila larvae show that fractions containing mitochondria are highly enriched in these molecules. PMID:4643820

  19. Genotoxic effects of alpha-hexachlorocyclohexane in primary cultures of rodent and human hepatocytes.

    PubMed

    Mattioli, F; Robbiano, L; Adamo, D; Federa, R; Martelli, A; Brambilla, G

    1996-01-01

    The genotoxicity of alpha-hexachlorocyclohexane (alpha-HCH) was evaluated in primary cultures of mouse, rat and human hepatocytes. DNA fragmentation was measured by the alkaline elution technique and DNA repair synthesis by quantitative autoradiography. A 20 h exposure to subtoxic concentrations ranging from 0.056 to 0.32 mM produced a dose-dependent frequency of DNA breaks in rat hepatocytes and in hepatocytes from four of five human donors, but not in mouse hepatocytes, DNA repair induction was absent in hepatocytes from all three species. The reduction in the frequency of DNA breaks observed in rat hepatocytes simultaneously exposed to metyrapone suggests that alpha-HCH is transformed into reactive species by a cytochrome P450-dependent reaction. The detection of DNA fragmentation but not of DNA repair synthesis may be tentatively explained by assuming that alpha-HCH behaves as a chemical eliciting short patch DNA repair, which is more easily revealed as genotoxic by the occurrence of DNA single-strand breaks. PMID:8671720

  20. 5-Azacytidine treatment of HA-A melanoma cells induces Sp1 activity and concomitant transforming growth factor alpha expression.

    PubMed Central

    Shin, T H; Paterson, A J; Grant, J H; Meluch, A A; Kudlow, J E

    1992-01-01

    Evidence indicates DNA methylation as a part of the regulatory machinery controlling mammalian gene expression. The human melanoma cell line HA-A expresses low levels of transforming growth factor alpha (TGF-alpha). TGF-alpha mRNA accumulated, however, in response to DNA demethylation induced by a nucleoside analog, 5-azacytidine (5-azaC). The importance of DNA methylation in the TGF-alpha promoter region was examined by a transient transfection assay with luciferase reporter plasmids containing a portion of the TGF-alpha promoter. 5-azaC treatment of HA-A cells before the transfection caused a significant increase in the luciferase activity. Since input plasmids were confirmed to remain unmethylated, DNA demethylation of the TGF-alpha promoter itself does not account for the observed increase in TGF-alpha mRNA. Using an electrophoretic mobility shift assay, enhanced formation of protein-TGF-alpha promoter complex was detected in response to 5-azaC treatment. This 5-azaC-induced complex was shown to contain the transcription factor Sp1 by the following criteria: the protein-DNA complex formed on the TGF-alpha promoter contained immunoreactive Sp1; the mobility of the complex in an electrophoretic mobility shift assay was similar to that formed by recombinant Sp1; and DNase I footprinting analysis demonstrated that the 5-azaC-induced complex produced a footprint on the TGF-alpha promoter identical to that of authentic Sp1. These observations suggest that 5-azaC induces TGF-alpha expression by augmenting the Sp1 activity. However, neither the Sp1 mRNA nor its protein was induced by 5-azaC. These results suggest that in HA-A cells, TGF-alpha expression is down-modulated by DNA methylation. In addition, this process may involve the specific regulation of Sp1 activity without altering the amount of the transcription factor. Images PMID:1380648

  1. Diagnostic value of zinc protoporphyrin in a screening strategy for alpha-thalassemia.

    PubMed

    Sardón Estévez, Nadia; Herruer, Martinus H; Jansen, Ruud; Bergkamp, Ferry J M; Gorgels, Jozef P M C

    2009-05-01

    The definitive diagnosis of alpha-thalassemia involves detection of a deletion of one or more alpha-globin that encode the alpha-chains of Hb (hemoglobin). To determine whether DNA analysis is indicated, screening tests such as mean corpuscular volume (MCV) and Hb typing are employed. alpha-Thalassemia often correlates with normal or low HbA2 values. Zinc protoporphyrin (ZPP) is usually high in ferropenic anemia or lead-poisoning and is normal or slightly raised in beta-thalassemia. Therefore, ZPP is currently used as a marker to discriminate between ferropenic anemia and beta-thalassemia. We investigated the diagnostic potential of ZPP < 150 micromol/mol heme in a screening strategy for alpha-thalassemia. We measured ZPP and performed DNA analysis for detecting the seven most prevalent alpha-thalassemia deletions, namely, alpha3.7, SEA, alpha20.5, alpha4.2, MED, FIL, and THAI, in the blood samples of 200 patients with MCV < 70 fL and HbA2 < or = 3.5%. Deletions were detected in 9% subjects in the ZPP > or = 150 group (n = 175) and 56% subjects in the ZPP < 150 group (n = 29); this difference was statistically significant (chi-square test, P < 0.001). We conclude that ZPP < 150 micromol/mol heme can be used in a new screening strategy for alpha-thalassemia. PMID:19187279

  2. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    SciTech Connect

    Goodyer, P.R.; Torban, E.; Dehbi, M.

    1994-09-01

    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-length WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.

  3. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  4. Alpha Condensates in Atomic Nuclei

    SciTech Connect

    Suzuki, Y.; Matsumura, H.

    2005-11-21

    Recent issues on Bose-Einstein condensation (BEC) of {alpha}-particles in nuclei are reviewed. A candidate of condensates is discussed for some states in 12C and 16O by defining the amount of {alpha} condensation.

  5. Variability of the Lyman alpha flux with solar activity

    SciTech Connect

    Lean, J.L.; Skumanich, A.

    1983-07-01

    A three-component model of the solar chromosphere, developed from ground based observations of the Ca II K chromospheric emission, is used to calculate the variability of the Lyman alpha flux between 1969 and 1980. The Lyman alpha flux at solar minimum is required in the model and is taken as 2.32 x 10/sup 11/ photons/cm/sup 2//s. This value occurred during 1975 as well as in 1976 near the commencement of solar cycle 21. The model predicts that the Lyman alpha flux increases to as much as 5 x 10/sup 11/ photons/cm/sup 2//s at the maximum of the solar cycle. The ratio of the average fluxes for December 1979 (cycle maximum) and July 1976 (cycle minimum) is 1.9. During solar maximum the 27-day solar rotation is shown to cause the Lyman alpha flux to vary by as much as 40% or as little as 5%. The model also shows that the Lyman alpha flux varies over intermediate time periods of 2 to 3 years, as well as over the 11-year sunspot cycle. We conclude that, unlike the sunspot number and the 10.7-cm radio flux, the Lyman alpha flux had a variability that was approximately the same during each of the past three cycles. Lyman alpha fluxes calculated by the model are consistent with measurements of the Lyman alpha flux made by 11 of a total of 14 rocket experiments conducted during the period 1969--1980. The model explains satisfactorily the absolute magnitude, long-term trends, and the cycle variability seen in the Lyman alpha irradiances by the OSO 5 satellite experiment. The 27-day variability observed by the AE-E satellite experiment is well reproduced. However, the magntidue of the AE-E 1 Lyman alpha irradiances are higher than the model calculations by between 40% and 80%. We suggest that the assumed calibration of the AE-E irradiances is in error.

  6. Classification and evolution of alpha-amylase genes in plants.

    PubMed

    Huang, N; Stebbins, G L; Rodriguez, R L

    1992-08-15

    The DNA sequences for 17 plant genes for alpha-amylase (EC 3.2.1.1) were analyzed to determine their phylogenetic relationship. A phylogeny for these genes was obtained using two separate approaches, one based on molecular clock assumptions and the other based on a comparison of sequence polymorphisms (i.e., small and localized insertions) in the alpha-amylase genes. These polymorphisms are called "alpha-amylase signatures" because they are diagnostic of the gene subfamily to which a particular alpha-amylase gene belongs. Results indicate that the cereal alpha-amylase genes fall into two major classes: AmyA and AmyB. The AmyA class is subdivided into the Amy1 and Amy2 subfamilies previously used to classify alpha-amylase genes in barley and wheat. The AmyB class includes the Amy3 subfamily to which most of the alpha-amylase genes of rice belong. Using polymerase chain reaction and oligonucleotide primers that flank one of the two signature regions, we show that the AmyA and AmyB gene classes are present in approximately equal amounts in all grass species examined except barley. The AmyB (Amy3 subfamily) genes in the latter case are comparatively underrepresented. Additional evidence suggests that the AmyA genes appeared recently and may be confined to the grass family. PMID:1502164

  7. Amino-acid substitution in alpha-spectrin commonly coinherited with nondominant hereditary spherocytosis.

    PubMed

    Tse, W T; Gallagher, P G; Jenkins, P B; Wang, Y; Benoit, L; Speicher, D; Winkelmann, J C; Agre, P; Forget, B G; Marchesi, S L

    1997-03-01

    Nondominant hereditary spherocytosis (ndHS) is a disorder characterized in some patients by severe hemolytic anemia and marked deficiency of erythrocyte spectrin. This report describes the identification of a variant spectrin chain, alpha-spectrin Bughill or alpha(BH), that is associated with this disorder in a number of patients. Tryptic maps of spectrin from affected individuals revealed an acidic shift in isoelectric point of the alphaII domain peptides at 46 kD and 35 kD. A point mutation at codon 970 of the alpha-spectrin gene (GCT-->GAT), that changes the encoded amino acid from an alanine to an aspartic acid, was identified in genomic DNA of affected patients. The alpha(BH) variant was present in 8 patients with ndHS from five different kindreds but was absent in 4 patients from two other kindreds. The 8 ndHS patients with the alpha(BH) variant appeared to be homozygous for the alpha(BH) variant by analysis of peptide maps of limited tryptic digests of erythrocyte spectrin. However, following genomic DNA analysis, only 2 of these patients were true homozygotes, whereas 6 were found to be doubly heterozygous for the alpha(BH) allele and a second, presumably abnormal, alpha-spectrin gene. These results suggest that, in these 6 patients, the second alpha-spectrin allele is in fact associated with one or more genetic defect(s), causing decreased accumulation of alpha-spectrin. The pattern of transmission of the alpha(BH) allele in certain families suggests that the alpha(BH) amino-acid substitution is not itself responsible for ndHS but is more likely a polymorphic variant that, in some but not all cases, is in linkage disequilibrium with another uncharacterized alpha-spectrin gene defect that itself is a cause of ndHS. PMID:9067503

  8. Processing of satellite imagery at the National Environmental Satellite Service

    NASA Technical Reports Server (NTRS)

    Crowe, M.

    1977-01-01

    The National Environmental Satellite Service (NESS) image product processing system is described. Other topics discussed include: (1) image processing of polar-orbiter satellite data; (2) image processing of geostationary satellite data; and (3) quality assurance and product monitoring.

  9. Development and identification of monoclonal antibodies against meso-Tetra (alpha,alpha,alpha,alpha,-O-phenylacetamide benzene) porphyrin.

    PubMed

    Wang, Fengyang; Huang, Xueying; Du, Li; Li, Weiguo; Qi, Chao

    2007-04-01

    The small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin was synthesized through the condensation of o-nitrobenzaldehyde and pyrrole followed by reduction of the meso-tetra (o-nitrophenyl) porphyrin. The small molecule, without carrier, was used as complete antigen to immunize BALB/ C mice. Spleen cells producing high titer antibody were removed and fused with myeloma cells of SP2/0 origin. Using a conventional immunization protocol, stable murine monoclonal antibodies (MAbs) producing cell lines to meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin 1F2 were obtained. Subclass determination showed that the clones produce IgG2a types of MAbs. The analytical results of HPLC and MALDI/TOFMS suggest that the purity of MAb 1F2 is 100%, and MAb 1F2 has a relative molecular weight of 156678.8 Da. Our results demonstrated that small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin, as semiantigen without carrier, can elicit the formation of MAbs. PMID:17451352

  10. Z-DNA binding protein from chicken blood nuclei

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Spitzner, J. R.; Lowenhaupt, K.; Rich, A.

    1993-01-01

    A protein (Z alpha) that appears to be highly specific for the left-handed Z-DNA conformer has been identified in chicken blood nuclear extracts. Z alpha activity is measured in a band-shift assay by using a radioactive probe consisting of a (dC-dG)35 oligomer that has 50% of the deoxycytosines replaced with 5-bromodeoxycytosine. In the presence of 10 mM Mg2+, the probe converts to the Z-DNA conformation and is bound by Z alpha. The binding of Z alpha to the radioactive probe is specifically blocked by competition with linear poly(dC-dG) stabilized in the Z-DNA form by chemical bromination but not by B-form poly(dC-dG) or boiled salmon-sperm DNA. In addition, the binding activity of Z alpha is competitively blocked by supercoiled plasmids containing a Z-DNA insert but not by either the linearized plasmid or by an equivalent amount of the parental supercoiled plasmid without the Z-DNA-forming insert. Z alpha can be crosslinked to the 32P-labeled brominated probe with UV light, allowing us to estimate that the minimal molecular mass of Z alpha is 39 kDa.

  11. Resolution of the discrepancy between Balmer alpha emission rates, the solar Lyman beta flux, and models of geocoronal hydrogen concentration

    NASA Technical Reports Server (NTRS)

    Levasseur, A.-C.; Meier, R. R.; Tinsley, B. A.

    1976-01-01

    New satellite Balmer alpha measurements and solar Lyman beta flux and line profile measurements, together with new measurements of the zodiacal light intensity used in correcting both ground and satellite Balmer alpha measurements for the effects of the Fraunhofer line in the zodiacal light, have been used in a reevaluation of the long-standing discrepancy between ground-based Balmer alpha emission rates and other geocoronal hydrogen parameters. The solar Lyman beta line center flux is found to be (4.1 plus or minus 1.3) billion photons per sq cm per sec per angstrom at S(10.7) equals 110 and, together with a current hydrogen model which has 92,000 atoms per cu cm at 650 km for T(inf) equals 950 K, gives good agreement between calculated Balmer alpha emission rates and the ground-based and satellite measurements.

  12. Communication satellite technology trends

    NASA Technical Reports Server (NTRS)

    Cuccia, Louis

    1986-01-01

    A chronology of space-Earth interconnectivity is presented. The Advanced Communications Technology Satellite (ACTS) system, Land Mobile Satellite, space-Earth antennas, impact of antenna size on coverage, intersatellite links are outlined. This presentation is represented by graphs and charts only.

  13. Communications technology satellite

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A description of the Communications Technology Satellite (CTS), its planned orbit, its experiments, and associated ground facilities was given. The communication experiments, to be carried out by a variety of groups in both the United States and Canada, include tele-education, tele-medicine, community interaction, data communications and broadcasting. A historical summary of communications satellite development was also included.

  14. Amateur Radio Satellite Communications.

    ERIC Educational Resources Information Center

    Koch, David P.

    The Amateur Radio Satellite Communications project had, as its goal, the assembly of an amateur radio satellite station in a high school physics classroom. Specific objectives were to provide: (1) a special source of interest as a motivator for attracting students and building public relations; (2) a center of interest as a motivator for the study…

  15. Satellite Teleconference Final Report.

    ERIC Educational Resources Information Center

    Elgin Community Coll., IL.

    The vocational education satellite teleconference project accomplished two goals: (1) identified, acquired, copied, and distributed to the Illinois Vocational Curriculum Center 100 marketing or training videotapes for staff development and classroom use; and (2) provided from 15-25 variable time (1- to 3-hour) satellite teleconferences in four…

  16. Audio direct broadcast satellites

    NASA Technical Reports Server (NTRS)

    Miller, J. E.

    1983-01-01

    Satellite sound broadcasting is, as the name implies, the use of satellite techniques and technology to broadcast directly from space to low-cost, consumer-quality receivers the types of sound programs commonly received in the AM and FM broadcast bands. It would be a ubiquitous service available to the general public in the home, in the car, and out in the open.

  17. Advanced communications satellites

    NASA Technical Reports Server (NTRS)

    Sivo, J. N.

    1980-01-01

    The increase in demand for satellite communications services brought about shortages in available transponder capacity, especially at C-band. Interest shifted to the Ku-band frequency and currently carriers are rapidly moving to secure orbital slots for future satellite development. Projections of communications service demands over the next decade indiate growth in voice, data, and video services such that saturation of both C-band and Ku-band will occur by 1990. Emphasis must and will shift to Ka-band (20/30 GHz) frequency for fixed-satellite service. Advanced technologies such as multibeam antennas coupled with on-board satellite switching to allow implementation in this band of very high capacity satellite systems will be applied to meet the demand. Satellite system concepts that are likely in the 1990's and are likely to bring a new dimension to satellite delivered communication service are presented. The NASA 30/20 GHz communications satellite system demonstration program is discussed with emphasis on the related technology development.

  18. Laser Geodynamics Satellite I

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The LAGEOS I (Laser Geodynamics Satellite) was developed and launched by the Marshall Space Flight Center on May 4, 1976 from Vandenberg Air Force Base, California . The two-foot diameter satellite orbited the Earth from pole to pole and measured the movements of the Earth's surface.

  19. Telecommunications satellite systems

    NASA Astrophysics Data System (ADS)

    Ramat, Pierre

    1992-12-01

    A survey of the telecommunications satellite field is presented. After a review of the historical and regulatory background, the main technical features of satellite networks are analyzed, and existing international and national systems are considered. Particular attention is given to Intelsat, Inmarsat, Eutelsat, and Telecom 1 and 2. Future technical and economic trends are then projected.

  20. Satellites in Schools.

    ERIC Educational Resources Information Center

    Underwood, C. I.; And Others

    1987-01-01

    Discusses the use of satellite data in physics classrooms. Describes the apparatus that can be used to collect and analyze data. Provides examples of how telemetry data transmitted by the satellite UoSAT-2 can be used not only in teaching physics, but also in geography, mathematics, and information technology. (TW)

  1. Outer planets satellites

    NASA Technical Reports Server (NTRS)

    Morrison, D.

    1983-01-01

    The present investigation takes into account the published literature on outer planet satellites for 1979-1982. It is pointed out that all but three (the moon and the two Martian satellites) of the known planetary satellites are found in the outer solar system. Most of these are associated with the three regular satellite systems of Jupiter, Saturn, and Uranus. The largest satellites are Titan in the Saturn system and Ganymede and Callisto in the Jupiter system. Intermediate in size between Mercury and Mars, each has a diameter of about 5000 km. Presumably each has an internal composition about 60 percent rock and 40 ice, and each is differentiated with a dense core extending out about 75 percent of the distance to the surface, with a mantle of high-pressure ice and a crust of ordinary ice perhaps 100 km thick. Attention is also given to Io, Europa, the icy satellites of Saturn, the satellites of Uranus, the small satellites of Jupiter and Saturn, Triton and the Pluto system, and plans for future studies.

  2. Signals from Communications Satellites.

    ERIC Educational Resources Information Center

    Thomsen, Volker

    1996-01-01

    Discusses the Doppler effect for relative motion between a source of waves and an observer and the orbital dynamics of communications satellites. Presents preliminary calculations of the satellite's altitude and linear velocity using only the concepts of the Doppler shift and the mechanics of motion in a circular path. (JRH)

  3. Recurrent Turnover of Chromosome-Specific Satellites in Drosophila

    PubMed Central

    Gallach, Miguel

    2014-01-01

    Repetitive DNA are DNA sequences that are repeated multiple times in the genome and normally considered nonfunctional. Several studies predict that the rapid evolution of chromosome-specific satellites led to hybrid incompatibilities and speciation. Interestingly, in Drosophila, the X and dot chromosomes share a unique and noteworthy property: They are identified by chromosome-specific binding proteins and they are particularly involved in genetic incompatibilities between closely related species. Here, I show that the X and dot chromosomes are overpopulated by certain repetitive elements that undergo recurrent turnover in Drosophila species. The portion of the X and dot chromosomes covered by such satellites is up to 52 times and 44 times higher than in other chromosomes, respectively. In addition, the newly evolved X chromosome in D. pseudoobscura (the chromosomal arm XR) has been invaded by the same satellite that colonized the ancestral X chromosome (chromosomal arm XL), whereas the autosomal homologs in other species remain mostly devoid of satellites. Contrarily, the Müller element F in D. ananassae, homolog to the dot chromosome in D. melanogaster, has no overrepresented DNA sequences compared with any other chromosome. The biology and evolutionary patterns of the characterized satellites suggest that they provide both chromosomes with some kind of structural identity and are exposed to natural selection. The rapid satellite turnover fits some speciation models and may explain why these two chromosomes are typically involved in hybrid incompatibilities. PMID:24846631

  4. PEBP2 alpha B/mouse AML1 consists of multiple isoforms that possess differential transactivation potentials.

    PubMed

    Bae, S C; Ogawa, E; Maruyama, M; Oka, H; Satake, M; Shigesada, K; Jenkins, N A; Gilbert, D J; Copeland, N G; Ito, Y

    1994-05-01

    A murine transcription factor, PEBP2, is composed of two subunits, alpha and beta. There are two genes in the mouse genome, PEBP2 alpha A and PEBP2 alpha B, which encode the alpha subunit. Two types of the alpha B cDNA clones, alpha B1 and alpha B2, were isolated from mouse fibroblasts and characterized. They were found to represent 3.8- and 7.9-kb transcripts, respectively. The 3.8-kb RNA encodes the previously described alpha B protein referred to as alpha B1, while the 7.9-kb RNA encodes a 387-amino-acid protein, termed alpha B2, which is identical to alpha B1 except that it has an internal deletion of 64 amino acid residues. Both alpha B1 and alpha B2 associate with PEBP2 beta and form a heterodimer. The alpha B2/beta complex binds to the PEBP2 binding site two- to threefold more strongly than the alpha B1/beta complex does. alpha B1 stimulates transcription through the PEBP2 site about 40-fold, while alpha B2 is only about 25 to 45% as active as alpha B1. Transactivation domain is located downstream of the 128-amino-acid runt homology region, referred to as the Runt domain. Mouse chromosome mapping studies revealed that alpha A, alpha B, and beta genes are mapped to chromosomes 17, 16, and 8, respectively. The last two genes are syntenic with the human AML1 on chromosome 21q22 and PEBP2 beta/CBF beta on 16q22 detected at the breakpoints of characteristic chromosome translocations of the two different subtypes of acute myeloid leukemia. These results suggest that previously described chimeric gene products, AML1/MTG8(ETO) and AML1-EAP generated by t(8;21) and t(3;21), respectively, lack the transactivation domain of AML1. PMID:8164679

  5. Alpha particles in solar cosmic rays over the last 80,000 years.

    NASA Technical Reports Server (NTRS)

    Lanzerotti, L. J.; Reedy, R. C.; Arnold, J. R.

    1973-01-01

    Present-day (1967 to 1969) fluxes of alpha particles from solar cosmic rays, determined from satellite measurements, were used to calculate the production rates of cobalt-57, cobalt-58, and nickel-59 in lunar surface samples. Comparisons with the activities of nickel-59 (half-life, 80,000 years) measured in lunar samples indicate that the long-term and present-day fluxes of solar alpha particles are comparable within a factor of approximately 4.

  6. Cloning and expression of a rat brain. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Flordellis, C.S.; Handy, D.E.; Bresnahan, M.R.; Zannis, V.I.; Gavras, H. )

    1991-02-01

    The authors isolated a cDNA clone (RB{alpha}{sub 2B}) and its homologous gene (GR{alpha}{sub 2B}) encoding an {alpha}{sub 2B}-adrenergic receptor subtype by screening a rat brain cDNA and a rat genomic library. Nucleotide sequence analysis showed that both clones code for a protein of 458 amino acids, which is 87% homologous to the human kidney glycosylated adrenergic receptor ({alpha}{sub 2}-C4) and divergent from the rat kidney nonglycosylated {alpha}{sub 2B} subtype (RNG{alpha}{sub 2}). Transient expression of RB{alpha}{sub 2B} in COS-7 cells resulted in high-affinity saturable binding for ({sup 3}H)rauwolscine and a high receptor number in the membranes of transfected COS-7 cells. Pharmacological analysis demonstrated that the expressed receptor bound adrenergic ligands with the following order of potency: rauwolscine {gt} yohimbine {gt} prazosin {gt} oxymetazoline, with a prazosin-to-oxymetazoline K{sub i} ratio of 0.34. This profile is characteristic of the {alpha}{sub 2B}-adrenergic receptor subtype. Blotting analysis of rat brain mRNA gave one major and two minor mRNA species, and hybridization with strand-specific probes showed that both DNA strands of GR{alpha}{sub 2B} may be transcriptionally active. These findings show that rat brain expresses an {alpha}{sub 2B}-adrenergic receptor subtype that is structurally different from the rat kidney nonglycosylated {alpha}{sub 2B} subtype. Thus the rat expresses at least two divergent {alpha}{sub 2B}-adrenergic receptors.

  7. The Satellite Situation Center

    NASA Technical Reports Server (NTRS)

    Teague, M. J.; Sawyer, D. M.; Vette, J. I.

    1982-01-01

    Considerations related to the early planning for the International Magnetospheric Study (IMS) took into account the desirability of an establishment of specific entities for generating and disseminating coordination information for both retrospective and predictive periods. The organizations established include the IMS/Satellite Situation Center (IMS/SSC) operated by NASA. The activities of the SSC are related to the preparation of reports on predicted and actually achieved satellite positions, the response to inquiries, the compilation of information on satellite experiments, and the issue of periodic status summaries. Attention is given to high-altitude satellite services, other correlative satellite services, non-IMS activities of the SSC, a summary of the SSC request activity, and post-IMS and future activities.

  8. Satellite networks for education.

    NASA Technical Reports Server (NTRS)

    Singh, J. P.; Morgan, R. P.; Rosenbaum, F. J.

    1972-01-01

    Consideration of satellite-based educational networking. The characteristics and structure of networks are reviewed, and pressures within the educational establishment that are providing motivation for various types of networks are discussed. A number of studies are cited in which networking needs for educational sectors and services are defined. The current status of educational networking for educational radio and television, instructional television fixed services, inter- and intrastate educational communication networks, computer networks, cable television for education, and continuing and proposed educational experiments using NASA's Applications Technology Satellites is reviewed. Possible satellite-based educational telecommunication services and three alternatives for implementing educational satellite systems are described. Some remarks are made concerning public policy aspects of future educational satellite system development.

  9. Cloning and expression of canine interferon-alpha genes in Escherichia coli.

    PubMed

    Taira, Osamu; Watanugi, Itsuki; Hagiwara, Yuko; Takahashi, Masaki; Arai, Setsuo; Sato, Hisaaki; Maehara, Nobutoshi

    2005-10-01

    We cloned five new subtypes of cDNA encoding canine interferon-alpha (CaIFN-alpha) from a canine epithelial cell line. CaIFN-alphas were divided into two groups by amino acid sequences and a molecular phylogenic tree. Two subtypes of them were expressed in Escherichia coli, and IFN proteins were purified. Recombinant CaIFN-alphas were highly species-specific and showed antiviral activity against Vesicular stomatitis New Jersey virus and canine adenovirus-1 , but not against canine herpesvirus-1. PMID:16276065

  10. Localization of a highly divergent mammalian testicular alpha tubulin that is not detectable in brain.

    PubMed Central

    Hecht, N B; Distel, R J; Yelick, P C; Tanhauser, S M; Driscoll, C E; Goldberg, E; Tung, K S

    1988-01-01

    Sequence analysis of a mouse testicular alpha-tubulin partial cDNA, pRD alpha TT1, reveals an isotype that differs from both the somatic and the predominant testicular alpha tubulins at approximately 30% of the 212 amino acid residues determined. Although this mouse testicular cDNA retains the highly conserved sequence, Glu-Gly-Glu-Glu, found in the carboxyl termini of many alpha tubulins, the protein extends substantially beyond this sequence and does not terminate with a C-terminal tyrosine. Using rabbit antiserum prepared to a novel synthetic peptide predicted from this mouse testis alpha-tubulin cDNA, we have have detected by immunoblot and indirect immunofluorescence an antigenic epitope present in testicular alpha tubulin that is not detectable in brain alpha tubulins. We find that the antiserum specifically binds to the manchettes and meiotic spindles of the mouse testis but not with neural fibers or tubulin extracts of the adult mouse brain. These results demonstrate that at least one of the multiple alpha-tubulin isotypes of the mammalian testis is expressed and used in male germ cells but not in the brain. Images PMID:3352610

  11. Hepatic expression of tumour necrosis factor-alpha in chronic hepatitis B virus infection.

    PubMed Central

    Hussain, M J; Lau, J Y; Williams, R; Vergani, D

    1994-01-01

    AIM--To determine the hepatic expression of tumour necrosis factor-alpha (TNF alpha) in patients with chronic hepatitis B virus (HBV) infection. METHODS--Frozen liver biopsy sections from 19 patients with chronic HBV infection were studied, 12 of whom were HBeAg positive and 10 serum HBV DNA positive. Hepatic expression of TNF alpha was determined using immunohistochemistry. RESULTS--Only infiltrating mononuclear cells showed immunoreactive staining for TNF alpha (median 2, range 0-3; n = 19) which appeared as diffuse positive staining material in the cytoplasm. Patients with active liver disease, assessed histologically and biochemically, had a higher level of expression, both in the number of TNF alpha positive cells and the proportion of TNF alpha positive infiltrating mononuclear cells. There was no correlation between the expression of TNF alpha and serological parameters of viral infection (HBeAg and HBV DNA status and HBV DNA concentrations). CONCLUSION--Hepatic expression of TNF alpha is increased in chronic HBV infection and is related to the activity of liver disease and not to the level of HBV replication. Images PMID:7876386

  12. Molecular cloning and phylogenetic analysis of Clonorchis sinensis elongation factor-1alpha.

    PubMed

    Kim, Tae Yun; Cho, Pyo Yun; Na, Jong Won; Hong, Sung-Jong

    2007-11-01

    Elongation factor-1 (EF-1) plays a primary role in protein synthesis, e.g., in the regulation of cell growth, aging, motility, embryogenesis, and signal transduction. The authors identified a clone CsIH23 by immunoscreening a Clonorchis sinensis cDNA library. The cDNA of CsIH23 was found to have a putative open reading frame containing 461 amino acids with a predicted molecular mass of 50.5 kDa. Its polypeptide sequence was highly homologous with EF-1alpha of parasites and vertebrate animals. CsIH23 polypeptide contained three GTP/GDP-binding sites, one ribosome-binding domain, one actin-binding domain, one tRNA-binding domain, and two glyceryl-phosphoryl-ethanolamine attachment sites. Based on these primary and secondary structural similarities, it was concluded that CsIH23 cDNA encodes C. sinensis EF-1alpha (CsEF-1alpha). In a molecular phylogenic tree, CsEF-1alpha clustered with the EF-1alpha of helminthic parasites. Subsequently, CsEF-1alpha recombinant protein was bacterially overexpressed and purified by Ni-NTA affinity column chromatography. Immunoblotting using CsEF-1alpha recombinant protein produced positive signals for all serum samples tested from clonorchiasis, opisthorchiasis viverinii, and paragonimiasis westermani patients and normal healthy controls. These findings suggest that recombinant CsEF-1alpha is of limited usefulness as serodiagnostic antigen for clonorchiasis. PMID:17674047

  13. Sequence homology between RNAs encoding rat alpha-fetoprotein and rat serum albumin.

    PubMed Central

    Jagodzinski, L L; Sargent, T D; Yang, M; Glackin, C; Bonner, J

    1981-01-01

    We have determined the sequences of the recombinant DNA inserts of three bacterial plasmid cDNA clones containing most of the rat alpha a-fetoprotein mRNA. The resultant nucleotide sequence of alpha-fetoprotein was exhaustively compared to the nucleotide sequence of the mRNA encoding rat serum albumin. These two mRNAs have extensive homology (50%) throughout and the same intron locations. The amino acid sequence of rat alpha-fetoprotein has been deduced from the nucleotide sequence, and its comparison to rat serum albumin's amino acid sequence reveals a 34% homology. The regularly spaced positions of the cysteines found in serum albumin are conserved in rat alpha-fetoprotein, indicating that these two proteins may have a similar secondary folding structure. These homologies indicate that alpha-fetoprotein and serum albumin were derived by duplication of a common ancestral gene and constitute a gene family. PMID:6167988

  14. Extended atmospheres of outer planet satellites and comets

    NASA Technical Reports Server (NTRS)

    Smyth, W. H.; Combi, M. R.

    1985-01-01

    Model analysis of the extended atmospheres of outer planet satellites and comets are discussed. Understanding the neutral hydrogen distribution in the Saturn system concentrated on assessing the spatial dependence of the lifetime of hydrogen atoms and on obtaining appropriately sorted Lyman ALPHA data from the Voyager 1 UVS instrument. Progress in the area of the extended cometary atmospheres included analysis of Pioneer Venus Layman alpha observations of Comet P/Encke with the fully refined hydrogen cloud model, development of the basic carbon and oxygen models, and planning for the Pioneer Venus UVS observations of Comets P/Giacobini-Zinner and P/Halley.

  15. Characterization of the human rod transducin alpha-subunit gene.

    PubMed Central

    Fong, S L

    1992-01-01

    The human rod transducin alpha subunit (Tr alpha) gene has been cloned. A cDNA clone, HG14, contained a 1.1 kb insertion when compared with the human Tr alpha cDNA published by Van Dop et al. (1). Based on two overlapping clones isolated from a human genomic library, the human Tr alpha gene is 4.9 kb in length and consists of nine exons interrupted by eight introns. Northern blots of human retina total RNA showed that the gene is transcribed by rod photoreceptors into two species of mRNA, 1.3 kb and 2.4 kb in size. Apparently, this is the result of alternative splicing. Two putative transcription initiation sites were determined by primer extension and S1 nuclease protection assays. The putative promoter regions of the human and mouse Tr alpha genes have an identity of 78.1%. As found in the mouse gene (2), no TATA consensus sequence is present in the human gene. Images PMID:1614872

  16. Alpha-globin loci in homozygous beta-thalassemia intermedia.

    PubMed

    Triadou, P; Lapoumeroulie, C; Girot, R; Labie, D

    1983-01-01

    Homozygous beta-thalassemia intermediate (TI) differs from thalassemia major (TM) in being less severe clinically. Associated alpha-thalassemia could account for the TI phenotype by reducing the alpha/non-alpha chain imbalance. We have analyzed the alpha loci of 9 TI and 11 TM patients by restriction endonuclease mapping. All the TM and 7 of the TI patients have the normal complement of four alpha-globin genes (alpha alpha/alpha alpha). One TI patient has three alpha-globin genes (alpha alpha/-alpha), and another TI patient has five alpha genes (alpha alpha/alpha alpha alpha). PMID:6305827

  17. Satellite Services Workshop, Volume 1

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Key issues associated with the orbital servicing of satellites are examined including servicing spacecraft and equipment, servicing operations, economics, satellite design, docking and berthing, and fluid management.

  18. Simultaneous satellite and riometer studies. [for solar cosmic ray events

    NASA Technical Reports Server (NTRS)

    Baker, M. B.; Masley, A. J.; Satterblom, P. R.

    1974-01-01

    The expected 30 and 50 MHz riometer absorption was calculated for the 7 June, 25 September and 2 November 1969 solar events using data from the McDonnell Douglas charged particle experiment on the polar orbiting OGO-6 Satellite. Excellent agreement was found between measured polar cap riometer absorption during the events and absorption calculated from detailed particle data obtained on the satellite passing over the riometer. Electrons are found to contribute the greater part of the 30 MHz absorption before the peak of the 2 November 1969 event; at all other times protons produce most of the absorption. The alpha-particle contribution is negligible in all cases.

  19. In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alpha-isopropylmalate.

    PubMed

    Sze, J Y; Woontner, M; Jaehning, J A; Kohlhaw, G B

    1992-11-13

    In the absence of the leucine biosynthetic precursor alpha-isopropylmalate (alpha-IPM), the yeast LEU3 protein (Leu3p) binds DNA and acts as a transcriptional repressor in an in vitro extract. Addition of alpha-IPM resulted in a dramatic increase in Leu3p-dependent transcription. The presence of alpha-IPM was also required for Leu3p to compete effectively with another transcriptional activator, GAL4/VP16, for limiting transcription factors. Therefore, the addition of alpha-IPM appears to convert a transcriptional repressor into an activator. This represents an example in eukaryotes of direct transcriptional regulation by a small effector molecule. PMID:1439822

  20. Assessment of fecal bacteria with bile acid 7 alpha-dehydroxylating activity for the presence of bai-like genes.

    PubMed Central

    Doerner, K C; Takamine, F; LaVoie, C P; Mallonee, D H; Hylemon, P B

    1997-01-01

    Eubacterium sp. strain VPI 12708 has several bile acid-inducible (bai) genes which encode enzymes in the bile acid 7 alpha-dehydroxylation (7 alpha DeOH) pathway. Twelve 7 alpha DeOH-positive intestinal bacterial strains were assayed for 7 alpha DeOH activity, and 13 strains were tested for hybridization with bai genes. Cholic acid 7 alpha DeOH activity varied greatly (> 100-fold) among these strains. Southern blot experiments showed that DNA prepared from 7 of 13 strains hybridized with at least one of the bai genes from Eubacterium sp. strain VPI 12708. PMID:9055436

  1. Nucleolin links to arsenic-induced stabilization of GADD45alpha mRNA.

    PubMed

    Zhang, Yadong; Bhatia, Deepak; Xia, Hongfeng; Castranova, Vince; Shi, Xianglin; Chen, Fei

    2006-01-01

    The present study shows that arsenic induces GADD45alpha (growth arrest and DNA damage inducible gene 45alpha) mainly through post-transcriptional mechanism. Treatment of the human bronchial epithelial cell line, BEAS-2B, with arsenic(III) chloride (As3+) resulted in a significant increase in GADD45alpha protein and mRNA. However, As3+ only exhibited a marginal effect on the transcription of the GADD45alpha gene. The accumulation of GADD45alpha mRNA is largely achieved by the stabilization of GADD45alpha mRNA in the cellular response to As3+. As3+ is able to induce binding of mRNA stabilizing proteins, nucleolin and less potently, HuR, to the GADD45alpha mRNA. Although As3+ was unable to affect the expression of nucleolin, treatment of the cells with As3+ resulted in re-distribution of nucleolin from nucleoli to nucleoplasm. Silencing of the nucleolin mRNA by RNA interference reversed As3+-induced stabilization of the GADD45alpha mRNA and accumulation of the GADD45alpha protein. Stabilization of GADD45alpha mRNA, thus, represents a novel mechanism contributing to the production of GADD45alpha and cell cycle arrest in response to As3+. PMID:16421274

  2. Skeletal muscle satellite cells

    NASA Technical Reports Server (NTRS)

    Schultz, E.; McCormick, K. M.

    1994-01-01

    Evidence now suggests that satellite cells constitute a class of myogenic cells that differ distinctly from other embryonic myoblasts. Satellite cells arise from somites and first appear as a distinct myoblast type well before birth. Satellite cells from different muscles cannot be functionally distinguished from one another and are able to provide nuclei to all fibers without regard to phenotype. Thus, it is difficult to ascribe any significant function to establishing or stabilizing fiber type, even during regeneration. Within a muscle, satellite cells exhibit marked heterogeneity with respect to their proliferative behavior. The satellite cell population on a fiber can be partitioned into those that function as stem cells and those which are readily available for fusion. Recent studies have shown that the cells are not simply spindle shaped, but are very diverse in their morphology and have multiple branches emanating from the poles of the cells. This finding is consistent with other studies indicating that the cells have the capacity for extensive migration within, and perhaps between, muscles. Complexity of cell shape usually reflects increased cytoplasmic volume and organelles including a well developed Golgi, and is usually associated with growing postnatal muscle or muscles undergoing some form of induced adaptive change or repair. The appearance of activated satellite cells suggests some function of the cells in the adaptive process through elaboration and secretion of a product. Significant advances have been made in determining the potential secretion products that satellite cells make. The manner in which satellite cell proliferative and fusion behavior is controlled has also been studied. There seems to be little doubt that cellcell coupling is not how satellite cells and myofibers communicate. Rather satellite cell regulation is through a number of potential growth factors that arise from a number of sources. Critical to the understanding of this form

  3. Land mobile communications satellite

    NASA Astrophysics Data System (ADS)

    Carnebianca, C.; Pavesi, B.; Tuozzi, A.

    1986-09-01

    The economic value and salient technical and operational characteristics of a European Land Mobile Communication Satellite (LMCS) to complement and supplement the demand for mobile services of Western European countries in the 1995 to 2005 time frames were assessed. A significant future expansion of demand for LCMS services on the part of the public is anticipated. Important augmentations of current service capabilities could be achieved by a satellite service, improving the overall system performances and/or assisting the PTT's in containing their investments in the required infrastructure. The satellite service itself could represent a profitable revenue producer.

  4. Advanced communications satellite systems

    NASA Technical Reports Server (NTRS)

    Sivo, J. N.

    1983-01-01

    There is a rapidly growing demand for satellite circuits, particularly for domestic service within the U.S. NASA's current program is aimed at developing the high risk, advanced satellite communications technologies required to significantly increase the capacity of future satellite communications systems. Attention is given to aspects of traffic distribution and service scenario, problems related to effects of rain attenuation, details regarding system configuration, a 30/20 GHz technology development approach, an experimental flight system, the communications payload for the experimental flight system, a typical experiment flight system coverage, and a typical three axis stabilized flight spacecraft.

  5. Satellite Breakup Risk Mitigation

    NASA Technical Reports Server (NTRS)

    Leleux, Darrin P.; Smith, Jason T.

    2006-01-01

    Many satellite breakups occur as a result of an explosion of stored energy on-board spacecraft or rocket-bodies. These breakups generate a cloud of tens or possibly hundreds of thousands of debris fragments which may pose a transient elevated threat to spaceflight crews and vehicles. Satellite breakups pose a unique threat because the majority of the debris fragments are too small to be tracked from the ground. The United States Human Spaceflight Program is currently implementing a risk mitigation strategy that includes modeling breakup events, establishing action thresholds, and prescribing corresponding mitigation actions in response to satellite breakups.

  6. Satellites save lives

    NASA Astrophysics Data System (ADS)

    Bulloch, Chris

    The use of satellites, in particular weather satellites, to detect emergency transmitter signals for search and rescue (SAR) operations is studied. The benefits provided to SAR operations by the Doppler processing of signals and the assignment of the 100-kHz band, 406.0-406.1 MHz in UHF region for satellite SAR services are discussed. The capabilities of Argos, a data collection system, and its function in SAR operations are described. Future developments for the COSPAS-SARSAT system are considered.

  7. Overview of commercial satellite communications

    NASA Astrophysics Data System (ADS)

    Beakley, G. W.

    1984-07-01

    A brief history of communications satellites is presented, taking into account the launching of Sputnik 1 in October 1957, the Explorer 1 in January of 1958, the launch of the Score as the world's first active communications satellite in December 1958, the Communications Satellite Act in 1962, and the launch of 'Early Bird' in 1964. The Intelsat satellites are considered along with maritime satellite communications, the U.S. domestic satellite systems, Alaskan satellite communications, cable television, broadcast TV stations, print media, the hotel/motel industry as a large market for satellite communications terminals, the opening of a minicable and satellite master antenna TV market for TV receive-only systems, and business telecommunications earth terminals. Attention is also given to future directions regarding satellite positions, the concept of 'video-plus', and direct broadcast satellites.

  8. Involvement of proliferating cell nuclear antigen (cyclin) in DNA replication in living cells.

    PubMed Central

    Zuber, M; Tan, E M; Ryoji, M

    1989-01-01

    Proliferating cell nuclear antigen (PCNA) (also called cyclin) is known to stimulate the activity of DNA polymerase delta but not the other DNA polymerases in vitro. We injected a human autoimmune antibody against PCNA into unfertilized eggs of Xenopus laevis and examined the effects of this antibody on the replication of injected plasmid DNA as well as egg chromosomes. The anti-PCNA antibody inhibited plasmid replication by up to 67%, demonstrating that PCNA is involved in plasmid replication in living cells. This result further implies that DNA polymerase delta is necessary for plasmid replication in vivo. Anti-PCNA antibody alone did not block plasmid replication completely, but the residual replication was abolished by coinjection of a monoclonal antibody against DNA polymerase alpha. Anti-DNA polymerase alpha alone inhibited plasmid replication by 63%. Thus, DNA polymerase alpha is also required for plasmid replication in this system. In similar studies on the replication of egg chromosomes, the inhibition by anti-PCNA antibody was only 30%, while anti-DNA polymerase alpha antibody blocked 73% of replication. We concluded that the replication machineries of chromosomes and plasmid differ in their relative content of DNA polymerase delta. In addition, we obtained evidence through the use of phenylbutyl deoxyguanosine, an inhibitor of DNA polymerase alpha, that the structure of DNA polymerase alpha holoenzyme for chromosome replication is significantly different from that for plasmid replication. Images PMID:2564636

  9. Biological satellite Kosmos-936

    NASA Technical Reports Server (NTRS)

    Vedeshin, L. A.

    1978-01-01

    A description is given of physiological experiments performed on the biological satellite Kosmos-936. Other experiments to determine the electrostatic and dielectric responses to the effects of cosmic radiation are discussed.

  10. AUSSAT mobile satellite services

    NASA Technical Reports Server (NTRS)

    Nowland, Wayne L.; Wagg, Michael; Simpson, Daniel

    1988-01-01

    An overview of AUSSAT's planned mobile satellite system is given. The development program which is being undertaken to achieve the 1992 service date is described. Both business and technical aspects of the development program are addressed.

  11. Domestic Communication Satellites

    ERIC Educational Resources Information Center

    Horowitz, Andrew

    1974-01-01

    A discussion of the Federal Communications Commission's new policy on domestic satellites in light of our 1) military and economic history; 2) corporate interests; 3) citizen surveillance; and 4) media control. (HB)

  12. Meteorological satellite accomplishments

    NASA Technical Reports Server (NTRS)

    Allison, L. J.; Arking, A.; Bandeen, W. R.; Shenk, W. E.; Wexler, R.

    1974-01-01

    The various types of meteorological satellites are enumerated. Vertical sounding, parameter extraction technique, and both macroscale and mesoscale meteorological phenomena are discussed. The heat budget of the earth-atmosphere system is considered, along with ocean surface and hydrology.

  13. Aiming a Satellite Dish.

    ERIC Educational Resources Information Center

    Zebrowski, Ernest, Jr.

    1988-01-01

    Develops a pair of equations for calculating the elevation and azimuth angles for the various satellites. Uses 3-dimensional vector difference calculations. Provides a practical example, figures, and table. (YP)

  14. Disaster warning satellite study

    NASA Technical Reports Server (NTRS)

    1971-01-01

    The Disaster Warning Satellite System is described. It will provide NOAA with an independent, mass communication system for the purpose of warning the public of impending disaster and issuing bulletins for corrective action to protect lives and property. The system consists of three major segments. The first segment is the network of state or regional offices that communicate with the central ground station; the second segment is the satellite that relays information from ground stations to home receivers; the third segment is composed of the home receivers that receive information from the satellite and provide an audio output to the public. The ground stations required in this system are linked together by two, separate, voice bandwidth communication channels on the Disaster Warning Satellites so that a communications link would be available in the event of disruption of land line service.

  15. Weather, land satellite sale

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    President Ronald Reagan announced on March 8 plans to sell to private industry the nation's land and meteorological remote-sensing satellites, including the responsibility for any future ocean-observing systems. According to the plan, the private firm successful in its bid to buy the five satellites would sell back to the government the data received by the satellites. The Reagan administration says the sale will save money and will put activities appropriate for commercial ventures into the commercial sector. Response to the announcement from scientists and congressmen has been anything but dulcet; one senator, in fact, charges that the Commerce Department and the corporation most likely to purchase the satellites are engaged in a ‘sweetheart deal.’

  16. Measuring Phytoplankton From Satellites

    NASA Technical Reports Server (NTRS)

    Davis, C. O.

    1989-01-01

    Present and future methods examined. Report reviews methods of calculating concentration of phytoplankton from satellite measurements of color of ocean and using such calculations to estimate productivity of phytoplankton.

  17. Orbit determination accuracies using satellite-to-satellite tracking

    NASA Technical Reports Server (NTRS)

    Vonbun, F. O.; Argentiero, P. D.; Schmid, P. E.

    1977-01-01

    The uncertainty in relay satellite sate is a significant error source which cannot be ignored in the reduction of satellite-to-satellite tracking data. Based on simulations and real data reductions, it is numerically impractical to use simultaneous unconstrained solutions to determine both relay and user satellite epoch states. A Bayesian or least squares estimation technique with an a priori procedure is presented which permits the adjustment of relay satellite epoch state in the reduction of satellite-to-satellite tracking data without the numerical difficulties introduced by an ill-conditioned normal matrix.

  18. Epos TCS Satellite Data

    NASA Astrophysics Data System (ADS)

    Manunta, Michele; Mandea, Mioara; Fernández-Turiel, José Luis; Stramondo, Salvatore; Wright, Tim; Walter, Thomas; Bally, Philippe; Casu, Francesco; Zeni, Giovanni; Buonanno, Sabatino; Zinno, Ivana; Tizzani, Pietro; Castaldo, Raffaele; Ostanciaux, Emilie; Diament, Michel; Hooper, Andy; Maccaferri, Francesco; Lanari, Riccardo

    2016-04-01

    TCS Satellite Data is devoted to provide Earth Observation (EO) services, transversal with respect to the large EPOS community, suitable to be used in several application scenarios. In particular, the main goal is to contribute with mature services that have already well demonstrated their effectiveness and relevance in investigating the physical processes controlling earthquakes, volcanic eruptions and unrest episodes as well as those driving tectonics and Earth surface dynamics. The TCS Satellite Data will provide two kinds of services: satellite products/services, and Value-added satellite products/services. The satellite products/services are composed of three (EPOSAR, GDM and COMET) well-identified and partly already operational elements for delivering Level 1 products. Such services will be devoted to the generation of SAR interferograms, DTM and ground displacement maps through the exploitation of different advanced EO techniques for InSAR and optical data analysis. The Value-added satellite products/services are composed of 4 elements (EPOSAR, 3D-Def, Mod and COMET) of Level 2 and 3 products. Such services integrate satellite and in situ measurements and observations to retrieve information on source mechanism, such as the geometry (spatial location, depth, volume changes) and the physical parameters of the deformation sources, through the exploitation of modelling approaches. The TCS Satellite Data will provide products in two different processing and delivery modes: 1- surveillance mode - routinely product generation; 2- on demand mode - product generation performed on demand by the user. Concerning the surveillance mode, the goal is providing continuous satellite measurements in areas of particular interest from a geophysical perspective (supersites). The objective is the detection of displacement patterns changing along time and their geophysical explanation. This is a valid approach for inter-seismic movements and volcanic unrest, post-seismic and post

  19. Alpha-mannosidosis

    PubMed Central

    Malm, Dag; Nilssen, Øivind

    2008-01-01

    Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be

  20. Lyman-alpha observations of Comet Kohoutek 1973 XII with Copernicus

    NASA Technical Reports Server (NTRS)

    Drake, J. F.; Jenkins, E. B.; Bertaux, J. L.; Festou, M.; Keller, H. U.

    1976-01-01

    Comet Kohoutek 1973 XII was observed with a telescope-spectrometer on the Copernicus satellite on six occasions over a 1-month period starting on January 29, 1974. Positive detection of the cometary Ly-alpha emission profile was obtained on January 29 and February 2. Earlier observations of the geocoronal Ly-alpha emission profile allowed an instrumental intensity calibration and confirmation of the computed instrumental profile for an extended source at the Ly-alpha wavelength. After allowing for broadening by the instrument, a hydrogen-outflow velocity of about 10.6 km/s is derived from the width of the Ly-alpha emission on January 29. The intensity calibration combined with an appropriate cometary model led to cometary water-production rates for January 29 and February 2. Only upper limits were obtained for Ly-alpha on and after February 14. Searches for OH and D led to negative results.

  1. Satellite battery testing status

    NASA Technical Reports Server (NTRS)

    Haag, R.; Hall, S.

    1986-01-01

    Because of the large numbers of satellite cells currently being tested and anticipated at the Naval Weapons Support Center (NAVWPNSUPPCEN) Crane, Indiana, satellite cell testing is being integrated into the Battery Test Automation Project (BTAP). The BTAP, designed to meet the growing needs for battery testing at the NAVWPNSUPPCEN Crane, will consist of several Automated Test Stations (ATSs) which monitor batteries under test. Each ATS will interface with an Automation Network Controller (ANC) which will collect test data for reduction.

  2. Solar Power Satellites

    NASA Technical Reports Server (NTRS)

    Kraft, C. C., Jr.

    1977-01-01

    A satellite based energy concept is described, including the advantages of the basic concept, system characteristics, cost, and environmental considerations. An outline of a plan for the further evaluation and implementation of the system is given. It is concluded that the satellite concept is competitive with other advanced power generation systems when a variety of factors are considered, including technical feasibility, cost, safety, natural resources, environment, baseload capability, location flexibility, land use, and existing industrial base for implementation.

  3. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  4. Mitochondrial DNA.

    ERIC Educational Resources Information Center

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  5. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.

    1981-12-01

    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  6. Satellite Applications for Public Service: Project Summaries.

    ERIC Educational Resources Information Center

    Lauffer, Sandra; And Others

    Summaries of 18 different projects involving the use of satellite communications are presented in this report, including PEACESAT Education and Communication Experiments, USP Network Satellite Communication Project, Project Satellite, Satellite Instructional Television Experiment (SITE), Appalachian Education Satellite Program, Alaska Education…

  7. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  8. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  9. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  10. DNA Banking

    SciTech Connect

    Reilly, P.R. )

    1992-11-01

    The author is involved in the ethical, legal, and social issues of banking of DNA and data from DNA analysis. In his attempt to determine the extent of DNA banking in the U.S., the author surveyed some commercial companies performing DNA banking services. This article summarizes the results of that survey, with special emphasis on the procedures the companies use to protect the privacy of individuals. 4 refs.

  11. Direct Broadcasting Satellites in Japan.

    ERIC Educational Resources Information Center

    Maeda, Jiro

    The development and use of broadcasting satellites in Japan are discussed in this paper. The paper describes the medium-scale experimental broadcasting satellite, YURI, launched by NASA in 1978, and reports that experiments with YURI in the areas of basic technologies in the broadcasting satellite system, experiments on satellite control…

  12. Satellite Technologies in the Classroom.

    ERIC Educational Resources Information Center

    Portz, Stephen M.

    1999-01-01

    Focuses on ways of using satellite imagery obtained from the Internet, to enhance classroom learning. Discusses satellite deployment; classroom applications, including infrared imagery, high-resolution photography, and global positioning satellites; and use of satellite data for hands-on activities, including cartography, city and community…

  13. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  14. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  15. Hb Oegstgeest [alpha104(G11)Cys-->Ser (alpha1)]. A new hemoglobin variant associated with a mild alpha-thalassemia phenotype.

    PubMed

    Harteveld, Cornelis L; Rozendaal, Lieke; Blom, Nico A; Lo-A-Njoe, Shirley; Akkerman, Nicole; Arkestijn, Sandra; Van Delft, Peter; Giordano, Piero C

    2005-01-01

    A microcytic hypochromic anemic state was observed in an 8-year old Black female of Surinam origin during pre-operative Hb S [beta6(A3)Glu-->Val] screening. Her high zinc protoporphyrin (ZPP) level suggested a chronic iron depletion but, in contrast, the high red blood cell (RBC) count (5.85 x 10(12)/L) was indicative of a possible coexisting thalassemia. No abnormal hemoglobin (Hb) bands were present on high performance liquid chromatography (HPLC) or alkaline electrophoresis and the Hb A2 level was normal. Break point polymerase chain reaction (PCR) failed to reveal any of the common alpha-thalassemia (thal) mutations but selective DNA sequencing of both alpha-globin genes disclosed a TGC-->AGC transversion at codon 104 of the alpha1 gene. Cystine at codon 104 is involved in alpha/beta globin contact and has been described to be a critical amino acid of the alpha2 chain when substituted by a tyrosine (Hb Sallanches), inducing Hb H (beta4) disease in the homozygous state. Our heterozygous patient had a moderate anemia of 12.2 g/dL and a borderline haptoglobin suggesting some degree of hemolysis. PMID:16114179

  16. Satellite Communications for ATM

    NASA Technical Reports Server (NTRS)

    Shamma, Mohammed A.

    2003-01-01

    This presentation is an overview on Satellite Communication for the Aeronautical Telecommunication Management (ATM) research. Satellite Communications are being considered by the FAA and NASA as a possible alternative to the present and future ground systems supporting Air Traffic Communications. The international Civil Aviation Organization (ICAO) have in place Standards and Recommended Practices (SARPS) for the Aeronautical Mobile Satellite Services (AMSS) which is mainly derived from the pre-existing Inmarsat service that has been in service since the 1980s. The Working Group A of the Aeronautical Mobile Communication Panel of ICAO has also been investigating SARPS for what is called the Next Generation Satellite Service (NGSS) which conforms less to the Inmarsat based architecture and explores wider options in terms of satellite architectures. Several designs are being proposed by Firms such as Boeing, ESA, NASA that are geared toward full or secondary usage of satellite communications for ATM. Satellite communications for ATM can serve several purposes ranging from primary usage where ground services would play a minimal backup role, to an integrated solution where it will be used to cover services, or areas that are less likely to be supported by the proposed and existing ground infrastructure. Such Integrated roles can include usage of satellite communications for oceanic and remote land areas for example. It also can include relieving the capacity of the ground network by providing broadcast based services of Traffic Information Services messages (TIS-B), or Flight Information Services (FIS-B) which can take a significant portion of the ground system capacity. Additionally, satellite communication can play a backup role to support any needs for ground replacement, or additional needed capacity even after the new digital systems are in place. The additional bandwidth that can be provided via satellite communications can also open the door for many new

  17. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  18. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  19. Structural Basis of Natural Promoter Recognition by a Unique Nuclear Receptor, HNF4[alpha

    SciTech Connect

    Lu, Peng; Rha, Geun Bae; Melikishvili, Manana; Wu, Guangteng; Adkins, Brandon C.; Fried, Michael G.; Chi, Young-In

    2010-11-09

    HNF4{alpha} (hepatocyte nuclear factor 4{alpha}) plays an essential role in the development and function of vertebrate organs, including hepatocytes and pancreatic {beta}-cells by regulating expression of multiple genes involved in organ development, nutrient transport, and diverse metabolic pathways. As such, HNF4{alpha} is a culprit gene product for a monogenic and dominantly inherited form of diabetes, known as maturity onset diabetes of the young (MODY). As a unique member of the nuclear receptor superfamily, HNF4{alpha} recognizes target genes containing two hexanucleotide direct repeat DNA-response elements separated by one base pair (DR1) by exclusively forming a cooperative homodimer. We describe here the 2.0 {angstrom} crystal structure of human HNF4{alpha} DNA binding domain in complex with a high affinity promoter element of another MODY gene, HNF1{alpha}, which reveals the molecular basis of unique target gene selection/recognition, DNA binding cooperativity, and dysfunction caused by diabetes-causing mutations. The predicted effects of MODY mutations have been tested by a set of biochemical and functional studies, which show that, in contrast to other MODY gene products, the subtle disruption of HNF4{alpha} molecular function can cause significant effects in afflicted MODY patients.

  20. 3D timelapse analysis of muscle satellite cell motility.

    PubMed

    Siegel, Ashley L; Atchison, Kevin; Fisher, Kevin E; Davis, George E; Cornelison, D D W

    2009-10-01

    Skeletal muscle repair and regeneration requires the activity of satellite cells, a population of myogenic stem cells scattered throughout the tissue and activated to proliferate and differentiate in response to myotrauma or disease. While it seems likely that satellite cells would need to navigate local muscle tissue to reach damaged areas, relatively little data on such motility exist, and most studies have been with immortalized cell lines. We find that primary satellite cells are significantly more motile than myoblast cell lines, and that adhesion to laminin promotes primary cell motility more than fourfold over other substrates. Using timelapse videomicroscopy to assess satellite cell motility on single living myofibers, we have identified a requirement for the laminin-binding integrin alpha 7 beta 1 in satellite cell motility, as well as a role for hepatocyte growth factor in promoting directional persistence. The extensive migratory behavior of satellite cells resident on muscle fibers suggests caution when determining, based on fixed specimens, whether adjacent cells are daughters from the same mother cell. We also observed more persistent long-term contact between individual satellite cells than has been previously supposed, potential cell-cell attractive and repulsive interactions, and migration between host myofibers. Based on such activity, we assayed for expression of "pathfinding" cues, and found that satellite cells express multiple guidance ligands and receptors. Together, these data suggest that satellite cell migration in vivo may be more extensive than currently thought, and could be regulated by combinations of signals, including adhesive haptotaxis, soluble factors, and guidance cues. PMID:19609936

  1. Molecular characterization of a rat alpha 2B-adrenergic receptor.

    PubMed Central

    Zeng, D W; Harrison, J K; D'Angelo, D D; Barber, C M; Tucker, A L; Lu, Z H; Lynch, K R

    1990-01-01

    Alpha 2-adrenergic receptors comprise a heterogeneous population based on pharmacologic and molecular evidence. We have isolated a cDNA clone (pRNG alpha 2) encoding a rat alpha 2-adrenergic receptor. A rat kidney cDNA library was screened with an oligonucleotide complementary to a highly conserved region found in all biogenic amine receptors described to date. The deduced amino acid sequence displays many features of guanyl nucleotide-binding protein-coupled receptors except it does not have a consensus N-linked glycosylation site near the amino terminus. Membranes prepared from COS cells transfected with pRNG alpha 2 DNA display high affinity and saturable binding to [3H]rauwolscine (Kd = 2 nM). Competition curve data analysis shows that RNG alpha 2 protein binds to a variety of adrenergic drugs with the following rank order of potency: yohimbine greater than or equal to chlorpromazine greater than or equal to prazosin greater than or equal to clonidine greater than norepinephrine greater than or equal to oxymetazoline. RNG alpha 2 RNA accumulates in both rat kidney and neonatal rat lung (predominant species is 4000 nucleotides). When a cysteine residue (Cys-169) that is conserved among all members of the seven-transmembrane-region superfamily is changed to phenylalanine, the RNG alpha 2 protein fails to bind [3H]rauwolscine after expression in COS cells. We conclude that pRNG alpha 2 likely represents a cDNA for a rat alpha 2B-adrenergic receptor. Images PMID:2158103

  2. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  3. Alpha Kappa Alpha Sorority's Reading Improvement Program for Minorities.

    ERIC Educational Resources Information Center

    Marable, June Morehead

    This document discusses the founding and establishment of Alpha Kappa Alpha Sorority's reading experience pilot project. The efforts of this project were aligned with those of Right to Read and Reading Is Fundamental (RIF). Because of the response from parents and children, plans are being made to increase present operations within the next…

  4. The expression of a naturally occuriing truncated allele of an alpha-SNAP gene suppresses plant parasitic nematode infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    rhg1, defined within a 67 kb region of DNA on chromosome 18, is a major quantitative trait locus (QTL) in Glycine max (soybean) providing defense to the soybean cyst nematode (Heterodera glycines). Transcriptional mapping experiments identified an alpha soluble NSF attachment protein (alpha-SNAP) wi...

  5. Dielectronic satellite spectra of hydrogen-like titanium (Ti XXII)

    SciTech Connect

    Bitter, M.; von Goeler, S.; Cohen, S.; Hill, K.W.; Sesnic, S.; Tenney, F.; Timberlake, J.; Safronova, U.I.; Vainshtein, L.A.; Dubau, J.

    1983-07-01

    High resolution spectra of the Ly ..cap alpha../sub 1/ and Ly ..cap alpha../sub 2/ lines of hydrogenlike titanium, TiXXII, and the associated dielectronic satellites which are due to transitions 1snl-2pnl with n greater than or equal to 2, have been observed from tokamak discharges with auxiliary ion cyclotron heating (ICRH) with central electron temperatures of 2 keV and central electron densities of 8 x 10/sup 13/ cm/sup -3/ on the Princeton Large Torus (PLT). The data have been used for a detailed comparison with theoretical predictions based on the Z - expansion method and Hartree - Fock calculations. The results obtained with the Z - expansion method are in excellent agreement with the observed spectral data except for minor discrepancies between the theoretical and experimental wavelengths of 0.0003 A for the n = 2 satellites and of 0.0001 A for the separation of the Ly ..cap alpha../sub 1/ and Ly ..cap alpha../sub 2/ lines. Very good agreement with the experimental data is also obtained for the results from the Hartree - Fock calculations though somewhat larger discrepancies (approx. = 0.0009 A) exist between experimental and theoretical wavelengths which are systematically too small. The observed spectra are used for diagnosis of the central ion and electron temperatures of the PLT discharges and for a measurement of the dielectronic recombination rate coefficient of TiXXII.

  6. Impacts of satellite galaxies on the redshift-space distortions

    SciTech Connect

    Hikage, Chiaki; Yamamoto, Kazuhiro E-mail: kazuhiro@hiroshima-u.ac.jp

    2013-08-01

    We study the impacts of the satellite galaxies on the redshift-space distortions. In our multipole power spectrum analysis of the luminous red galaxies (LRGs) samples of the Sloan digital sky survey (SDSS), we have clearly detected the non-zero signature of the hexadecapole and tetrahexadecapole spectrum, which almost disappears in the power spectrum with the sample of the brightest LRGs only. We thus demonstrate that the satellite LRGs in multiple systems make a significant contribution to the multipole power spectrum though its fraction is small. The behavior can be understood by a simple halo model, in which the one-halo term, describing the Finger of God (FoG) effect from the satellite galaxies, makes the dominant contribution to the higher multipole spectra. We demonstrate that the small-scale information of higher multipole spectrum is useful for calibrating the satellite FoG effect and improves the measurement of the cosmic growth rate dramatically. We further demonstrate that the fiber collision in the galaxy survey influences the one-halo term and the higher multipole spectra, because the number of satellite galaxies in the halo occupation distribution (HOD) is changed. We also discuss about the impact of satellite galaxies on future high-redshift surveys targeting the H-alpha emitters.

  7. International communications via satellite

    NASA Astrophysics Data System (ADS)

    McLucas, J. L.

    The evolution of communications satellite systems is traced in terms of technical capabilities and technological advances. The Communications Act of 1962 led to the establishment of INTELSAT on an international basis in 1964. The original 19 signatory nations has grown to over 100, and over 800 ground relay stations have been built. The INTELSAT system comprises spacecraft over the Atlantic, Pacific, and Indian Oceans and handles 2/3 of the world's international electronic communications and all transoceanic television. The 1965 Early Bird satellite had a 240 two-way telephone link capacity and weighed 38 kg, while the Intelsat V satellites, of which there will be nine, have increased the capacity to 20,000 voice circuits and Intelsat VI will double the number by 1993. Increasing demand for satellite communications links is driving the design and development of space platforms for multiple missions of communications, meteorological studies, and on-board switching and data processing in excess of current multiple satellite systems.

  8. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  9. Identification, cloning, and expression of human estrogen receptor-{alpha}36, a novel variant of human estrogen receptor-{alpha}66

    SciTech Connect

    Wang Zhaoyi; Zhang Xintian; Shen Peng; Loggie, Brian W.; Chang Yunchao; Deuel, Thomas F. . E-mail: tfdeuel@scripps.edu

    2005-11-04

    The identification and subsequent cloning of the 66-kDa human estrogen receptor (here termed hER-{alpha}66), its 46-kDa splice variant hER-{alpha}46, and the closely related hER-{beta} have had a profound impact on the generation of new understanding of estrogen-mediated functions and led to progress in diagnosis and treatment of human breast cancer. However, a persistent problem has been that not all findings previously reported in estrogen-stimulated cell proliferation can be explained through the known properties of the different estrogen receptors described. As the consequence of a search for alternative mechanisms to account for these different findings, we have now identified, cloned, and expressed in HEK 293 cells a previously unrecognized 36-kDa variant of hER-{alpha}66, termed hER-{alpha}36. hER-{alpha}36 differs from hER-{alpha}66 since it lacks both transcriptional activation domains (AF-1 and AF-2) but it retains the DNA-binding domain, and partial dimerization and ligand-binding domains of hER-{alpha}66. It also contains three myristoylation sites postulated to direct ER-{alpha}36 to the plasma membrane. It is concluded that ER-{alpha}36 is a unique variant of ER-{alpha}66; ER-{alpha}36 is predicted to function as a dominant-negative effector of hER-{alpha}66-mediated estrogen-responsive gene pathways and has the potential to trigger membrane-initiated mitogenic estrogen signaling.

  10. Cooperative interaction of hypoxia-inducible factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular endothelial growth factor receptor-2 (Flk-1).

    PubMed

    Elvert, Gerd; Kappel, Andreas; Heidenreich, Regina; Englmeier, Ursula; Lanz, Stephan; Acker, Till; Rauter, Manuel; Plate, Karl; Sieweke, Michael; Breier, Georg; Flamme, Ingo

    2003-02-28

    Interactions between Ets family members and a variety of other transcription factors serve important functions during development and differentiation processes, e.g. in the hematopoietic system. Here we show that the endothelial basic helix-loop-helix PAS domain transcription factor, hypoxia-inducible factor-2alpha (HIF-2alpha) (but not its close relative HIF-1alpha), cooperates with Ets-1 in activating transcription of the vascular endothelial growth factor receptor-2 (VEGF-2) gene (Flk-1). The receptor tyrosine kinase Flk-1 is indispensable for angiogenesis, and its expression is closely regulated during development. Consistent with the hypothesis that HIF-2alpha controls the expression of Flk-1 in vivo, we show here that HIF-2alpha and Flk-1 are co-regulated in postnatal mouse brain capillaries. A tandem HIF-2alpha/Ets binding site was identified within the Flk-1 promoter that acted as a strong enhancer element. Based on the analysis of transgenic mouse embryos, these motifs are essential for endothelial cell-specific reporter gene expression. A single HIF-2alpha/Ets element conferred strong cooperative induction by HIF-2alpha and Ets-1 when fused to a heterologous promoter and was most active in endothelial cells. The physical interaction of HIF-2alpha with Ets-1 was demonstrated and localized to the HIF-2alpha carboxyl terminus and the autoinhibitory exon VII domain of Ets-1, respectively. The deletion of the DNA binding and carboxyl-terminal transactivation domains of HIF-2alpha, respectively, created dominant negative mutants that suppressed transactivation by the wild type protein and failed to synergize with Ets-1. These results suggest that the interaction between HIF-2alpha and endothelial Ets factors is required for the full transcriptional activation of Flk-1 in endothelial cells and may therefore represent a future target for the manipulation of angiogenesis. PMID:12464608

  11. An unusually long non-coding region in rat lens alpha-crystallin messenger RNA.

    PubMed Central

    Moormann, R J; van der Velden, H M; Dodemont, H J; Andreoli, P M; Bloemendal, H; Schoenmakers, J G

    1981-01-01

    Most of the mRNA sequence coding for the alpha A2 chain of the ocular lens protein alpha-crystallin from rat, has been determined by sequencing cloned DNA copies of this mRNA. The 892-base pair cDNA sequence encompasses all but 52 N-terminal amino acids of the alpha A2 chain. It lacks the sequence characteristic for the 22 extra amino acids inserted in the alpha A2 -like chain, named alpha AIns. A stretch of 583 nuceotides, representing more than 50% of the entire mRNA sequence, is located 3' wards of the alpha A2 coding sequence. It contains the characteristic AAUAAA signal involved in poly(A) -addition and represents an unexpectedly long non-coding region. Examination of the total cytoplasmic poly(A) RNA of rat lens by filter-hybridization and subsequent translation of the electrophoretically separated mRNA fractions shows that the alpha A2 chain is encoded by mRNA species which are distinct from the alpha AIns encoding mRNA. No evidence is obtained for an extensive size heterogeneity in the 3' untranslated regions of these two different rat lens mRNAs. Images PMID:6171772

  12. Alpha glucosidase inhibitors.

    PubMed

    Kalra, Sanjay

    2014-04-01

    Alpha glucosidase inhibitors (AGIs) are a unique class of anti-diabetic drugs. Derived from bacteria, these oral drugs are enzyme inhibitors which do not have a pancreato -centred mechanism of action. Working to delay carbohydrate absorption in the gastrointestinal tract, they control postprandial hyperglycaemia and provide unquestioned cardiovascular benefit. Specially suited for a traditional Pakistani carbohydrate-rich diet, AGIs have been termed the 'untapped diamonds' of diabetology. The use of these oral antidiabetic drugs (OADs) that target pathophysiology in the early stages of type 2 diabetes, notably to reduce postprandial hyperglycaemia and hyperinsulinaemia will inevitably increase with time. This review describes the history of their development, mechanism of action, basic and clinical pharmacology, and suggests practical, evidence-based guidance for their optimal use. PMID:24864650

  13. DFT CONFORMATIONAL STUDIES OF ALPHA-MALTOTRIOSE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent DFT optimization studies on alpha-maltose improved our understanding of the preferred conformations of alpha-maltose and the present study extends these studies to alpha-maltotriose with three alpha-D-glucopyranose residues linked by two alpha-[1-4] bridges, denoted herein as DP-3's. Combina...

  14. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  15. Prothymosin alpha in human blood.

    PubMed Central

    Panneerselvam, C; Haritos, A A; Caldarella, J; Horecker, B L

    1987-01-01

    The major cross-reacting peptide in human plasma detected with a radioimmunoassay (RIA) for thymosin alpha 1 was identified as prothymosin alpha, based on its elution properties in gel-filtration chromatography and its amino acid composition after purification by HPLC. A small quantity (less than 10%) of the total cross-reacting material was recovered in fractions corresponding to lower molecular weight thymosin alpha 1-like peptides. The total quantity of cross-reacting material detected in human blood, expressed as thymosin alpha 1 equivalents, was 11-14 pmol/ml (approximately 90% was recovered in the leukocyte fraction, approximately 10% was in the plasma fraction, and 1-2% was in the erythrocyte fraction). The peptide present in leukocytes was also identified as prothymosin alpha. After correction for the 5-times lower molar reactivity of prothymosin alpha in the thymosin alpha 1 RIA employed in these experiments, we estimate that the content of prothymosin alpha in human blood is 55-70 pmol/ml (0.6-0.8 microgram/ml). The relatively small quantities recovered in the erythrocyte and plasma fractions may be attributed to contamination of the former by leukocytes or to leakage from leukocytes into the plasma. PMID:3474615

  16. EEG Alpha Power and Intelligence.

    ERIC Educational Resources Information Center

    Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.

    2002-01-01

    Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

  17. Lyman-Alpha aurora

    SciTech Connect

    Durrance, S.T.; Clarke, J.T.

    1984-10-01

    The existence of intense and variable H Ly a emission from Uranus is demonstrated utilizing the monochromatic imaging capabilities of the International Ultraviolet Explorer satellite. A series of 14 observations, using the IUE short wavelength spectrograph in low dispersion and covering the period from 3 March 1982 through 2 September 1983, shows the disk averaged Ly a brightness of Uranus to vary between 690 and 2230 Rayleighs. Model calculations indicates that 400 R of this emission can be attributed to resonant scattering of solar Ly a radiation. An upper limit of 100 R is obtained for the Raman scattering of solar Ly a by H2 (1280 A). This implies that 300 R is contributed to the planetary Ly a emission by Rayleigh scattering. In addition to being unexpectedly strong, the Uranian Ly a emission has been observed to vary by a factor of two in one 24 hr period and by about 50% in one 5 hr period.

  18. Small satellites - An overview

    NASA Astrophysics Data System (ADS)

    Ward, A. K.

    The present review of small satellites examines spacecraft activities in the U.K. and compiles a checklist of advantages and applications for the class. These advantages are illustrated with references to recent small satellite missions and technologies developed to facilitate such launches and projects. Specific programs examined include AMPTE-UKS, Viking, and the UoSAT program, and information is given regarding the Small Explorer program, the RAE Space Technology Research Vehicle, the AEA Argos Program, and space research programs in both Japan and India. Low-cost launches are shown to be available in the form of the Ariane Structure for Auxiliary Payloads, the Pegasus and Delta vehicles, and with the Shuttle Free-flying Getaway Special. Small-satellite technologies that play key roles in their effective implementation are: structure/thermal advances, attitude control systems, on-board communications, and power and data-handling systems.

  19. Brazilian Small Satellites

    NASA Astrophysics Data System (ADS)

    Carvalho, Himilcon

    Brazilian experience with micro scientific satellites began in 1995 with the SACI project that comprised 2 scientific satellites that carried onboard experiments from Brazil, Japan and US. The first one failed after launch (1998) and the second was lost during the second launch attempt of the Brazilian national launcher, VLS, in1999. Started by 1997, the French-Brazilian Microsatellite Project comprised a set of 9 experiments from French and Brazilian scientists. The project was terminated by the French side in 2002. Currently, there are two ongoing science projects, MIRAX (devoted to X-Ray astronomy) and EQUARS (to study the higher atmosphere). These projects include experiments from US, Netherlands, Japan, Canada, and Brazil, with launch scheduled to 2011 or 2012. This paper presents a brief summary of the history of the development of these satellites along with some highlights on the Brazilian Space Program.

  20. Uranus satellites - Surface properties

    NASA Technical Reports Server (NTRS)

    Veverka, J.; Brown, R. H.; Bell, Jeffrey F.

    1991-01-01

    The post-Voyager knowledge of the photometric, colorimetric, spectral, and thermal properties of the Uranian satellites is reviewed, focusing on such fundamental physical properties as albedo, color, and surface texture. While albedo variations of at least a factor of 2 exist, color differences are almost absent (Miranda) or subdued (Oberon). In the case of Titania, the strong opposition effect reported by ground-based observers was confirmed by Voyager. Voyager did not observe the opposition parts of the phase curves of the other satellites. Voyager thermal observations of Ariel and Miranda suggest that both have highly porous regoliths, thermophysically similar to those of Jupiter's icy satellites. At the time of the flyby (south pole facing the sun), maximum surface temperatures reached or exceeded 85 K, but nighttime polar temperatures are predicted to drop to 20 to 30 K because each pole spends about 40 yr in darkness. Ground-based spectroscopy identified water ice as an important surface constituent.

  1. Satellite failures revisited

    NASA Astrophysics Data System (ADS)

    Balcerak, Ernie

    2012-12-01

    In January 1994, the two geostationary satellites known as Anik-E1 and Anik-E2, operated by Telesat Canada, failed one after the other within 9 hours, leaving many northern Canadian communities without television and data services. The outage, which shut down much of the country's broadcast television for hours and cost Telesat Canada more than $15 million, generated significant media attention. Lam et al. used publicly available records to revisit the event; they looked at failure details, media coverage, recovery effort, and cost. They also used satellite and ground data to determine the precise causes of those satellite failures. The researchers traced the entire space weather event from conditions on the Sun through the interplanetary medium to the particle environment in geostationary orbit.

  2. Artificial gravity experiment satellites

    NASA Astrophysics Data System (ADS)

    Harada, Tadashi

    1992-07-01

    An overview of the conceptual study of an artificial gravity experiment satellite based on the assumption of a launch by the H-2 launch vehicle with a target launch date in the Year 2000 is presented. While many satellites provided with artificial gravity have been reported in relation to a manned Mars exploration spacecraft mission, the review has been conducted on missions and test subjects only for experimental purposes. Mission requirements were determined based on the results of reviews on the mission, test subjects, and model missions. The system baseline and development plan were based on the results of a study on conceptual structure and scale of the system, including measures to generate artificial gravity. Approximate scale of the system and arm length, mission orbit, visibility of the operation orbit from ground stations in Japan, and satellite attitude on the mission orbit are outlined.

  3. Satellite sale update

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    A senior Department of Commerce official whose connections with the Communications Satellite Corp. (Comsat) regarding the proposed sale of the weather and land satellites (Eos, March 22, 1983, p. 113) have been the subject of congressional inquiry has resigned. Comsat is considered the frontrunner of those looking to purchase the satellites.Guy W. Fiske, Deputy Secretary of Commerce, submitted his letter of resignation on May 10; the resignation became effective May 14. He had been scheduled to testify to two House Science and Technology subcommittees this month on the nature, extent, and propriety of his relationship with Comsat. As Eos went to press, it was unclear whether Fiske would still be asked to testify.

  4. ESA's satellite communications programme

    NASA Astrophysics Data System (ADS)

    Bartholome, P.

    1985-02-01

    The developmental history, current status, and future plans of the ESA satellite-communications programs are discussed in a general survey and illustrated with network diagrams and maps. Consideration is given to the parallel development of national and European direct-broadcast systems and telecommunications networks, the position of the European space and electronics industries in the growing world market, the impact of technological improvements (both in satellite systems and in ground-based networks), and the technological and commercial advantages of integrated space-terrestrial networks. The needs for a European definition of the precise national and international roles of satellite communications, for maximum speed in implementing such decisions (before the technology becomes obsolete), and for increased cooperation and standardization to assure European equipment manufacturers a reasonable share of the market are stressed.

  5. Nucleotide sequence of the mRNA encoding the pre-alpha-subunit of mouse thyrotropin.

    PubMed Central

    Chin, W W; Kronenberg, H M; Dee, P C; Maloof, F; Habener, J F

    1981-01-01

    We have constructed and cloned in bacteria recombinant DNA molecules containing DNA sequences coding for the precursor of the alpha subunit of thyrotropin (pre-TSH-alpha). Double-stranded DNA complementary to total poly(A)+RNA derived from a mouse pituitary thyrotropic tumor was prepared enzymatically, inserted into the Pst I site of the plasmid pBR322 by using poly(dC).poly(dG) homopolymeric extensions, and cloned in Escherichia coli chi 1776. Cloned cDNAs encoding pre-TSH-alpha were identified by their hybridization to pre-TSH-alpha mRNA as determined by cell-free translations of hybrid-selected and hybrid-arrested RNA. The nucleotide sequences of two cDNAs (510 and 480 base pairs) were determined with chemical methods and corresponded to much of the region coding for the alpha subunit and the 3' untranslated region of pre-TSH-alpha mRNA. The sequence of the 5' end of the mRNA was determined from cDNA synthesized by using total mRNA as template and a restriction enzyme DNA fragment as primer. Together these sequences represented greater than 90% of the coding and noncoding regions of full-length pre-TSH-alpha mRNA, which was determined to be 800 bases long. The amino acid sequence of the pre-TSH-alpha deduced from the nucleotide sequence showed a NH2-terminal leader sequence of 24 amino acids followed by the 96-amino-acid sequence of the apoprotein of TSH-alpha. There is greater than 90% homology in the amino acid sequences among the murine, ruminant, and porcine alpha subunits and 75-80% homology among the murine, equine, and human alpha subunits. Several regions of the sequence remain absolutely conserved among all species, suggesting that these particular regions are essential for the biological function of the subunit. The successful cloning of the alpha subunit of TSH will permit further studies of the organization of the genes coding for the glycoprotein hormone subunits and the regulation of their expression. Images PMID:6272299

  6. Alpha Schottky junction energy source

    NASA Astrophysics Data System (ADS)

    Litz, Marc S.; Fan, Zhaoyang; Carroll, James J.; Bayne, Stephen

    2012-06-01

    Isotope batteries offer solutions for long-lived low-power sensor requirements. Alpha emitting isotopes have energy per decay 103 times that of beta emitters. Alpha particles are absorbed within 20 μm of most materials reducing shielding mitigation. However, damage to materials from the alphas limits their practical use. A Schottky Barrier Diode (SBD) geometry is considered with an alpha emitting contact-layer on a diamond-like crystal semiconductor region. The radiation tolerance of diamond, the safety of alpha particles, combined with the internal field of the SBD is expected to generate current useful for low-power electronic devices over decades. Device design parameters and calculations of the expected current are described.

  7. Binding of Protein Factor CTCF within Chicken Genome Alpha-Globin Locus.

    PubMed

    Kotova, E S; Akopov, S B; Didych, D A; Petrova, N V; Iarovaia, O V; Razin, S V; Nikolaev, L G

    2016-01-01

    A systematic search for DNA fragments containing potential CTCF transcription factor binding sites in the chicken alpha-globin domain and its flanking regions was performed by means of the two-dimension electrophoretic mobility shift assay. For the alpha-globin domain fragments selected, the occupancy by the CTCF in erythroid and lymphoid chicken cells was tested by chromatin immunoprecipitation. Only one of 13 DNA fragments capable of CTCF binding in vitro was efficiently bound to this protein in vivo in erythroid cells, and somewhat less efficiently - in lymphoid cells. So, binding of CTCF to the DNA fragment in vitro in most cases does not mean that this fragment will be occupied by CTCF in the cell nucleus. Yet, CTCF binding in vivo, as a rule, is accompanied by the binding of the protein to this DNA region in vitro. During the erythroid differentiation, no significant changes in CTCF binding to the DNA fragments studied were detected. PMID:27099788

  8. Binding of Protein Factor CTCF within Chicken Genome Alpha-Globin Locus

    PubMed Central

    Kotova, E. S.; Akopov, S. B.; Didych, D. A.; Petrova, N. V.; Iarovaia, O. V.; Razin, S. V.; Nikolaev, L. G.

    2016-01-01

    A systematic search for DNA fragments containing potential CTCF transcription factor binding sites in the chicken alpha-globin domain and its flanking regions was performed by means of the two-dimension electrophoretic mobility shift assay. For the alpha-globin domain fragments selected, the occupancy by the CTCF in erythroid and lymphoid chicken cells was tested by chromatin immunoprecipitation. Only one of 13 DNA fragments capable of CTCF binding in vitro was efficiently bound to this protein in vivo in erythroid cells, and somewhat less efficiently – in lymphoid cells. So, binding of CTCF to the DNA fragment in vitro in most cases does not mean that this fragment will be occupied by CTCF in the cell nucleus. Yet, CTCF binding in vivo, as a rule, is accompanied by the binding of the protein to this DNA region in vitro. During the erythroid differentiation, no significant changes in CTCF binding to the DNA fragments studied were detected. PMID:27099788

  9. Satellites For Sale

    NASA Technical Reports Server (NTRS)

    1984-01-01

    Astronaut Dale A. Gardner, having just completed the major portion of his second extravehicular activity (EVA) period in three days, holds up a 'For Sale' sign refering to the two satellites, Palapa B-2 and Westar 6 that they retrieved from orbit after their Payload Assist Modules (PAM) failed to fire. Astronaut Joseph P. Allen IV, who also participated in the two EVAs, is reflected in Gardner's helmet visor. A portion of each of two recovered satellites is in the lower right corner, with Westar 6 nearer Discovery's aft.

  10. Satellite communications system 'Tyulpan'

    NASA Astrophysics Data System (ADS)

    Tchuyan, R. K.; Tarasov, E. V.; Belousov, A. P.; Balyk, V. M.; Kovtunenko, V. M.; Morozov, V. A.; Andreev, V. A.; v'yunenko, K. A.

    1993-10-01

    A concept of the satellite communication system called 'Tyulpan' (because or its tulip-resembling shape) is considered. This conception envisages the use of six satellites-retranslators installed on high-latitude elliptic orbits. Such a system can provide the communication for mean- and high-latitude region of Europe, Asia, and America. For the communication, super small ground stations of 0.4 m in diameter can be used. In the development of system conception, the already existing technical solutions and possibility of conversion or existing installations of military destination were taken into account. Therefore, the system considered can be realized at the earliest possible date.

  11. Mexico's first domestic satellite

    NASA Astrophysics Data System (ADS)

    Sanchez-Ruiz, M. E.; Elbert, B. R.

    The principal features of the Morelos communications satellite program, providing Mexico with C-band and Ku-band TV and telephone services beginning in 1985, are reviewed. Two satellites, modified versions of the Hughes HS-376 dual-spin bus, will be launched by STS and controlled from a tracking, telemetery, and command station near Mexico City; the 184-station ground network currently operating with Intelsat-IV will be expanded to about 1000 C-band stations (plus numerous small Ku-band receivers) by 1990. The spacecraft design, communications-subsystem performance, repeater equipment, antennas, and coverage pattern are presented in tables, drawings, diagrams, photographs and maps and discussed.

  12. Satellite Laser Ranging operations

    NASA Technical Reports Server (NTRS)

    Pearlman, Michael R.

    1994-01-01

    Satellite Laser Ranging (SLR) is currently providing precision orbit determination for measurements of: 1) Ocean surface topography from satellite borne radar altimetry, 2) Spatial and temporal variations of the gravity field, 3) Earth and ocean tides, 4) Plate tectonic and regional deformation, 5) Post-glacial uplift and subsidence, 6) Variations in the Earth's center-of-mass, and 7) Variations in Earth rotation. SLR also supports specialized programs in time transfer and classical geodetic positioning, and will soon provide precision ranging to support experiments in relativity.

  13. Satellite oceanography - The instruments

    NASA Technical Reports Server (NTRS)

    Stewart, R. H.

    1981-01-01

    It is pointed out that no instrument is sensitive to only one oceanographic variable; rather, each responds to a combination of atmospheric and oceanic phenomena. This complicates data interpretation and usually requires that a number of observations, each sensitive to somewhat different phenomena, be combined to provide unambiguous information. The distinction between active and passive instruments is described. A block diagram illustrating the steps necessary to convert data from satellite instruments into oceanographic information is included, as is a diagram illustrating the operation of a radio-frequency radiometer. Attention is also given to the satellites that carry the various oceanographic instruments.

  14. Oceanography from satellites

    NASA Technical Reports Server (NTRS)

    Wilson, W. S.

    1981-01-01

    It is pointed out that oceanographers have benefited from the space program mainly through the increased efficiency it has brought to ship operations. For example, the Transit navigation system has enabled oceanographers to compile detailed maps of sea-floor properties and to more accurately locate moored subsurface instrumentation. General descriptions are given of instruments used in satellite observations (altimeter, color scanner, infrared radiometer, microwave radiometer, scatterometer, synthetic aperture radar). It is pointed out that because of the large volume of data that satellite instruments generate, the development of algorithms for converting the data into a form expressed in geophysical units has become especially important.

  15. Declassified intelligence satellite photographs

    USGS Publications Warehouse

    U.S. Geological Survey

    1998-01-01

    Recently declassified photographs from spy satellites are an important addition to the record of the Earth?s land surface held by the U.S. Geological Survey (USGS). More than 800,000 high-resolution photos taken between 1959 through 1972 were made available by Executive Order of the President. The collection is held at the USGS EROS Data Center, near Sioux Falls, S. Dak., and are offered for public sale. For some purposes in earth science studies, these photos extend the record of changes in the land surface another decade back in time from the advent of the Landsat earth-observing satellite program.

  16. Public service satellite communications

    NASA Technical Reports Server (NTRS)

    Wolff, E. A.

    1978-01-01

    It is suggested that the high effective isotropic radiated power provided by high-power satellite transmitters and high-gain antennas could be used in conjunction with economical ground receivers to furnish public services in remote areas of the U.S. Applications to health care, education and public safety are mentioned. A system concept involving a communications satellite operating in the Ku-band (12-GHz down, 14-GHz up) and either 100/30 watt stationary earth terminals with 1-1.8 m antennas or mobile terminals with omnidirectional antennas is presented.

  17. Satellite altitude determination uncertainties

    NASA Technical Reports Server (NTRS)

    Siry, J. W.

    1972-01-01

    Satellite altitude determination uncertainties will be discussed from the standpoint of the GEOS-C satellite, from the longer range viewpoint afforded by the Geopause concept. Data are focused on methods for short-arc tracking which are essentially geometric in nature. One uses combinations of lasers and collocated cameras. The other method relies only on lasers, using three or more to obtain the position fix. Two typical locales are looked at, the Caribbean area, and a region associated with tracking sites at Goddard, Bermuda and Canada which encompasses a portion of the Gulf Stream in which meanders develop.

  18. Numerical simulation of satellite-ring interactions - Resonances and satellite-ring torques

    NASA Technical Reports Server (NTRS)

    Brophy, Thomas G.; Esposito, Larry W.; Stewart, Glen R.; Rosen, Paul A.

    1992-01-01

    The Krook kinetic equation for planetary rings is numerically solved in two spatial dimensions and in time, with (1) interparticle collisions and (2) satellite-forcing, but (3) without self-gravity, for the case of a flattened planetary ring that undergoes gravitational perturbation by a nearby satellite. It is noted that the amplitude of wakes is limited by purely kinematic effects, even in the absence of collisions. Attention is given to the results of a simulation of an inner Lindblad-resonance location, as the distribution approaches steady state; these simulations do not show an increase in velocity dispersion in the resonance zone, obviating a net torque.

  19. Tracking the GLOMR satellite

    NASA Technical Reports Server (NTRS)

    Reiss, Keith W.; Oneil, Jason C.

    1987-01-01

    The task of day-to-day low orbiting satellite tracking utilizing the NAVSPASUR orbital elements is discussed and methods for improving pass time predictions are presented. Estimates are needed for preprogramming of satellite-initiated communications scheduling which requires an accuracy of approximately 30 seconds. This can be achieved by removing the variance associated with the NAVSPASUR D sub 2 (decay) term. Finally, the shock evidenced in GLOMR's orbit on February 7, 1986 is documented and attributed to a severe solar storm with immediately enhanced drag. GLOMR's life expectancy in orbit is now estimated to have dropped approximately 17% by the end of orbit in early February, 1987.

  20. A classification system for virophages and satellite viruses.

    PubMed

    Krupovic, Mart; Kuhn, Jens H; Fischer, Matthias G

    2016-01-01

    Satellite viruses encode structural proteins required for the formation of infectious particles but depend on helper viruses for completing their replication cycles. Because of this unique property, satellite viruses that infect plants, arthropods, or mammals, as well as the more recently discovered satellite-like viruses that infect protists (virophages), have been grouped with other, so-called "sub-viral agents." For the most part, satellite viruses are therefore not classified. We argue that possession of a coat-protein-encoding gene and the ability to form virions are the defining features of a bona fide virus. Accordingly, all satellite viruses and virophages should be consistently classified within appropriate taxa. We propose to create four new genera - Albetovirus, Aumaivirus, Papanivirus, and Virtovirus - for positive-sense single-stranded (+) RNA satellite viruses that infect plants and the family Sarthroviridae, including the genus Macronovirus, for (+)RNA satellite viruses that infect arthopods. For double-stranded DNA virophages, we propose to establish the family Lavidaviridae, including two genera, Sputnikvirus and Mavirus. PMID:26446887

  1. Gamma and alpha motor neurons distinguished by expression of transcription factor Err3.

    PubMed

    Friese, Andreas; Kaltschmidt, Julia A; Ladle, David R; Sigrist, Markus; Jessell, Thomas M; Arber, Silvia

    2009-08-11

    Spinal motor neurons are specified to innervate different muscle targets through combinatorial programs of transcription factor expression. Whether transcriptional programs also establish finer aspects of motor neuron subtype identity, notably the prominent functional distinction between alpha and gamma motor neurons, remains unclear. In this study, we identify DNA binding proteins with complementary expression profiles in alpha and gamma motor neurons, providing evidence for molecular distinctions in these two motor neuron subtypes. The transcription factor Err3 is expressed at high levels in gamma but not alpha motor neurons, whereas the neuronal DNA binding protein NeuN marks alpha but not gamma motor neurons. Signals from muscle spindles are needed to support the differentiation of Err3(on)/NeuN(off) presumptive gamma motor neurons, whereas direct proprioceptive sensory input to a motor neuron pool is apparently dispensable. Together, these findings provide evidence that transcriptional programs define functionally distinct motor neuron subpopulations, even within anatomically defined motor pools. PMID:19651609

  2. The American Satellite Company (ASC) satellite deployed from payload bay

    NASA Technical Reports Server (NTRS)

    1985-01-01

    The American Satellite Company (ASC) communications satellite is deployed from the payload bay of the Shuttle Discovery. A portion of the cloudy surface of the earth can be seen to the left of the frame.

  3. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  4. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  5. DNA Damage Response and DNA Repair in Skeletal Myocytes From a Mouse Model of Spinal Muscular Atrophy.

    PubMed

    Fayzullina, Saniya; Martin, Lee J

    2016-09-01

    We studied DNA damage response (DDR) and DNA repair capacities of skeletal muscle cells from a mouse model of infantile spinal muscular atrophy (SMA) caused by loss-of-function mutation of survival of motor neuron (Smn). Primary myocyte cultures derived from skeletal muscle satellite cells of neonatal control and mutant SMN mice had similar myotube length, myonuclei, satellite cell marker Pax7 and differentiated myotube marker myosin, and acetylcholine receptor clustering. DNA damage was induced in differentiated skeletal myotubes by γ-irradiation, etoposide, and methyl methanesulfonate (MMS). Unexposed control and SMA myotubes had stable genome integrity. After γ-irradiation and etoposide, myotubes repaired most DNA damage equally. Control and mutant myotubes exposed to MMS exhibited equivalent DNA damage without repair. Control and SMA myotube nuclei contained DDR proteins phospho-p53 and phospho-H2AX foci that, with DNA damage, dispersed and then re-formed similarly after recovery. We conclude that mouse primary satellite cell-derived myotubes effectively respond to and repair DNA strand-breaks, while DNA alkylation repair is underrepresented. Morphological differentiation, genome stability, genome sensor, and DNA strand-break repair potential are preserved in mouse SMA myocytes; thus, reduced SMN does not interfere with myocyte differentiation, genome integrity, and DNA repair, and faulty DNA repair is unlikely pathogenic in SMA. PMID:27452406

  6. Formation of phosphonester bonds catalyzed by DNA polymerase.

    PubMed Central

    Victorova, L S; Dyatkina, N B; Mozzherin DJu; Atrazhev, A M; Krayevsky, A A; Kukhanova, M K

    1992-01-01

    3'-Fluoro-2',3'-dideoxythymidine 5'-(alpha-methylphosphonyl)-beta,gamma- diphosphate and 2'-deoxythymidine-5'-(alpha-methylphosphonyl)-beta, gamma- diphosphate have been synthesized. Both compounds are incorporated into DNA chains during catalysis by reverse transcriptases of human immunodeficiency (HIV) and avian myeloblastosis (AMV) viruses, DNA polymerase beta from rat liver, terminal deoxynucleotidyl transferase from calf thymus and (at a very low rate) is by E. coli DNA polymerase I, Klenow fragment. The first compound is a termination substrate while the second is capable of multiple incorporation into the DNA chains. For instance, reverse transcriptase catalysis resulted in the appearance of 8 residues of second compound. DNA polymerases alpha and epsilon from human placenta incorporated none of the above compounds into DNA chains, although an inhibition of DNA synthesis by both compounds was observed with all enzymes mentioned. The 3'----5'-exonuclease activity of DNA polymerase I, Klenow fragment, hydrolyzed DNA fragments containing phosphonomethyl internucleoside groups, while such DNA fragments were resistant to the E. coli exonuclease III. Images PMID:1371865

  7. Alpha particle heating at comet-solar wind interaction regions

    NASA Technical Reports Server (NTRS)

    Sharma, A. S.; Papadopoulos, K.

    1995-01-01

    The satellite observations at comet Halley have shown strong heating of solar wind alpha particles over an extended region dominated by high-intensity, low-frequency turbulence. These waves are excited by the water group pickup ions and can energize the solar wind plasma by different heating processes. The alpha particle heating by the Landau damping of kinetic Alfven waves and the transit time damping of low-frequency hydromagnetic waves in this region of high plasma beta are studied in this paper. The Alfven wave heating was shown to be the dominant mechanism for the observed proton heating, but it is found to be insufficient to account for the observed alpha particle heating. The transit time damping due to the interaction of the ions with the electric fields associated with the magnetic field compressions of magnetohydrodynamic waves is found to heat the alpha particles preferentially over the protons. Comparison of the calculated heating times for the transit time damping with the observations from comet Halley shows good agreement. These processes contribute to the thermalization of the solar wind by the conversion of its directed energy into the thermal energy in the transition region at comet-solar wind interaction.

  8. Variability of Lyman-alpha emission from Jupiter

    NASA Technical Reports Server (NTRS)

    Cochran, W. D.; Barker, E. S.

    1979-01-01

    The Jovian Lyman-alpha emission line was reobserved in 1978 March using the high-resolution spectrometer of the Copernicus satellite. An intensity of 8.3 plus or minus 2.9 kilorayleighs was measured. This value represents a significant increase in intensity over previous (1976) Copernicus observations, but is lower than the recent (1979) values obtained by Voyager 1 and IUE. The increase in intensity has been accompanied by a significant increase in line width giving strong support to the theory that the emission results from resonant scattering of the solar Lyman-alpha line by H atoms in the upper Jovian atmossphere. The strength of Jovian Lyman-alpha emission correlates well with the level of solar activity. The solar extreme ultraviolet radiation varies with the solar cycle. This radiation causes the dissociation of H2 and CH4 into H atoms in the Jovian atmosphere. Therefore, in times of high solar activity, the H column density will increase, causing the observed strong Jovian Lyman-alpha emission.

  9. Variability of Lyman-alpha emission from Jupiter

    NASA Technical Reports Server (NTRS)

    1979-01-01

    The Jovian Lyman-alpha emission line was again observed in 1978 using the high resolution spectrometer on the Copernicus satellite. In intensity of 8.4+3.0 kilo Rayleighs was measured. This value represents a significant increase in intensity over previous (1976) Copernicus observations, but is lower than the recent (1979) values obtained by Voyager I and IUE. The increase in intensity was accompanied by a significant increase in line width, giving strong support to the theory that the emission results from resonant scattering of the solar Ly-alpha line by H atoms in the upper Jovian atmosphere. The strength of Jovian Ly-alpha emission correlates well with the level of solar activity. The solar extreme ultraviolet radiation varies with the solar cycle. This radiation causes the dissociation of H2 and CH4 into H atoms in the Jovian atmosphere. Therefore, in times of high solar activity, the H column density will increase, causing the observed stronger Jovian Ly-alpha emission.

  10. Mobile satellite ranging

    NASA Technical Reports Server (NTRS)

    Silverberg, E. C.

    1978-01-01

    A brief review of the constraints which have limited satellite ranging hardware and an outline of the steps which are underway to improve the status of the equipment in this area are given. In addition, some suggestions are presented for the utilization of newer instruments and for possible future research and development work in this area.

  11. Satellite Town Meeting.

    ERIC Educational Resources Information Center

    Department of Education, Washington, DC.

    On the third Tuesday of each month, U.S. Secretary of Education, Richard W. Riley, and Deputy Secretary, Madeleine M. Kunin, host the Satellite Town Meeting--a live, interactive teleconference where renowned national experts, local educators, and community leaders share ideas on how to improve schools and reach the National Educational Goals. It…

  12. Small satellite radiometric measurements

    SciTech Connect

    Weber, P.G.

    1991-01-01

    A critical need for the Mission to Planet Earth is to provide continuous, well-calibrated radiometric data for the radiation budget. This paper describes a new, compact, flexible radiometer which will provide both spectrally integrated data and data in selected spectral bands. The radiometer design is suitable for use on small satellites, aircraft, or remotely piloted vehicles (RPVs). 12 refs., 2 figs.

  13. Perception via satellite

    USGS Publications Warehouse

    Robinove, Charles J.

    1970-01-01

    The earth resources observation satellite (EROS) program in the Department of the Interior is intended to gather and use data from satellites and aircraft on natural and man-made features of the earth's surface. Earth resources technology satellite will provide the EROS program with data for use in dealing with natural resource problems and understanding the interaction between man and the environment. Applications will include studies of tectonic features, hydrologic problems, location of fish schools, determination of the conditions of range land, mapping land use for urban planning, studies of erosion and change along coastlines and major streams, and inventories of land use and land forms. In addition, the ERTS data may be used for detecting forest and crop diseases and inventorying crops. The ERTS satellite will be in a polar, sun-synchronous orbit so that each point on the earth's surface will be sensed every 17 to 20 days, at the same time of day. Multispectral photography is being investigated for its usefulness in hydrology. Side-looking airborne radar has not yet been widely used in hydrologic studies, although it is an excellent tool for all-weather, day or night, coverage of large areas. Other techniques being investigated include passive microwave radiometry, ultraviolet and visible stimulated luminescence, and absorption spectroscopy.

  14. Building Satellites is Easier

    NASA Technical Reports Server (NTRS)

    Marsh, Phyllis Nimmo

    1996-01-01

    'Building Satellites' is a story about Jim Marsh's recovery from a severe head injury told by his wife Phyllis from the moment she learned of its happening, through the ups and downs of a lengthy rehabilitation, until his return to work and daily living. It continues on, however, and narrates his battle with the more insidious Grave's disease. Told in the first person, 'Building Satellites' vividly portrays Phyllis's thoughts and feelings throughout this experience with scrupulous honestly. This is a story worth reading for many reasons. First of all, Jim was an accomplished scientist, respected by his colleagues both in this country and abroad. Secondly, it narrates the many stages of his recovery from head injury with detailed readable accuracy; it informs us as well as inspires. Finally, 'Building Satellites" also tells us the story of Phyllis Marsh's remarkable creative response to this crisis. It narrates her personal experiences as she progresses through the strange and somewhat bizarre world of medicine and rehabilitation, guided by a few basic beliefs, which she learned as a child in Iowa, that provided her with the strength to endure. 'Building Satellites' seems to reaffirm our unconscious, but settled conviction, that when confornted overnight with adversity, we are somehow given the means for coping, supported by our basic beliefs, strengthened by family and friends, and eventually learning to accept any outcome.

  15. Experimental Satellite Quantum Communications

    NASA Astrophysics Data System (ADS)

    Vallone, Giuseppe; Bacco, Davide; Dequal, Daniele; Gaiarin, Simone; Luceri, Vincenza; Bianco, Giuseppe; Villoresi, Paolo

    2015-07-01

    Quantum communication (QC), namely, the faithful transmission of generic quantum states, is a key ingredient of quantum information science. Here we demonstrate QC with polarization encoding from space to ground by exploiting satellite corner cube retroreflectors as quantum transmitters in orbit and the Matera Laser Ranging Observatory of the Italian Space Agency in Matera, Italy, as a quantum receiver. The quantum bit error ratio (QBER) has been kept steadily low to a level suitable for several quantum information protocols, as the violation of Bell inequalities or quantum key distribution (QKD). Indeed, by taking data from different satellites, we demonstrate an average value of QBER =4.6 % for a total link duration of 85 s. The mean photon number per pulse μsat leaving the satellites was estimated to be of the order of one. In addition, we propose a fully operational satellite QKD system by exploiting our communication scheme with orbiting retroreflectors equipped with a modulator, a very compact payload. Our scheme paves the way toward the implementation of a QC worldwide network leveraging existing receivers.

  16. Learning Through Satellite Broadcasting

    ERIC Educational Resources Information Center

    Krishnamoorthy, P. V.

    1975-01-01

    SITE is an experimental project which would provide vital inputs in designing and executing a satellite-based instructional television system, particularly in rural areas, to stimulate national development in India with important managerial, economic, technological, and social implications. (Author/BP)

  17. Advances in satellite oceanography

    NASA Technical Reports Server (NTRS)

    Brown, O. B.; Cheney, R. E.

    1983-01-01

    Technical advances and recent applications of active and passive satellite remote sensing techniques to the study of oceanic processes are summarized. The general themes include infrared and visible radiometry, active and passive microwave sensors, and buoy location systems. The surface parameters of sea surface temperature, windstream, sea state, altimetry, color, and ice are treated as applicable under each of the general methods.

  18. Retroreflector spherical satellite

    NASA Astrophysics Data System (ADS)

    Akentyev, A. S.; Vasiliev, V. P.; Sadovnikov, M. A.; Sokolov, A. L.; Shargorodskiy, V. D.

    2015-10-01

    Specific features of spherical retroreflector arrays for high-precision laser ranging are considered, and errors in distance measurements are analyzed. A version of a glass retroreflector satellite with a submillimeter "target error" is proposed. Its corner cube reflectors are located in depressions to reduce the working angular aperture, and their faces have a dielectric interference coating.

  19. Which satellites were used?

    Atmospheric Science Data Center

    2014-12-08

    ... (Scanner and NonScanner) were used. The NASA Goddard Space Flight Center built the Earth Radiation Budget Satellite (ERBS) on which the first ERBE instruments were launched by the Space Shuttle Challenger in 1984. ERBE instruments were also launched on two ...

  20. Domestic Communications Satellites.

    ERIC Educational Resources Information Center

    Network Project Notebook, 1972

    1972-01-01

    The June, 1972 Federal Communications Commission's (FCC) decision allowed an "open skies" policy in regard to domestic communication satellites and raised Liberal opposition to a situation where exclusive and unchecked communications power is now in the hands of private entrepreneurs, primarily the big Defense Department oriented aerospace…