Science.gov

Sample records for alpha satellite dna

  1. Locational diversity of alpha satellite DNA and intergeneric hybridization aspects in the Nomascus and Hylobates genera of small apes.

    PubMed

    Baicharoen, Sudarath; Miyabe-Nishiwaki, Takako; Arsaithamkul, Visit; Hirai, Yuriko; Duangsa-ard, Kwanruen; Siriaroonrat, Boripat; Domae, Hiroshi; Srikulnath, Kornsorn; Koga, Akihiko; Hirai, Hirohisa

    2014-01-01

    Recently, we discovered that alpha satellite DNA has unique and genus-specific localizations on the chromosomes of small apes. This study describes the details of alpha satellite localization in the genera Nomascus and Hylobates and explores their usefulness in distinguishing parental genome sets in hybrids between these genera. Fluorescence in situ hybridization was used to establish diagnostic criteria of alpha satellite DNA markers in discriminating small ape genomes. In particular we established the genus specificity of alpha satellite distribution in three species of light-cheeked gibbons (Nomascus leucogenys, N. siki, and N. gabriellae) in comparison to that of Hylobates lar. Then we determined the localization of alpha satellite DNA in a hybrid individual which resulted from a cross between these two genera. In Nomascus the alpha satellite DNA blocks were located at the centromere, telomere, and four interstitial regions. In Hylobates detectable amounts of alpha satellite DNA were seen only at centromeric regions. The differences in alpha satellite DNA locations between Nomascus and Hylobates allowed us to easily distinguish the parental chromosomal sets in the genome of intergeneric hybrid individuals found in Thai and Japanese zoos. Our study illustrates how molecular cytogenetic markers can serve as diagnostic tools to identify the origin of individuals. These molecular tools can aid zoos, captive breeding programs and conservation efforts in managing small apes species. Discovering more information on alpha satellite distribution is also an opportunity to examine phylogenetic and evolutionary questions that are still controversial in small apes. PMID:25290445

  2. Marker chromosomes lacking {alpha}-satellite DNA: A new intriguing class of abnormalities

    SciTech Connect

    Becker, L.A.; Zinn, A.B.; Stallard, J.R.

    1994-09-01

    Recent studies have implicated {alpha}-satellite DNA as an integral part of the centromere and important for the normal segregation of chromosomes. We analyzed four supernumerary marker chromosomes in which fluorescence in situ hybridization (FISH) could detect neither pancentromeric or chromosome specific {alpha}-satellite DNA. Mosaicism of the markers existed, but each was present in the majority of cells indicating that they segregated normally. FISH with chromosome-specific libraries identified the origins of these markers as chromosomes 13 (1 case) and 15 (3 cases). High resolution analysis, combined with hybridization of a series of cosmid probes, revealed that each marker was a symmetrical duplication of the terminal long arm of the parent chromosome. Telomeric sequences were detected by FISH indicating linear structures. Breakpoint heterogeneity, as defined by cosmid probes, was demonstrated in the three cases involving chromosome 15. No pericentromeric satellite III DNA could be detected on three markers. Studies with anti-centromere antibodies are in progress to assay for centromeric antigens on the markers, as expected at functional centromeric sites. Our results demonstrate that the precise structural identification and heterogeneity of these markers can be easily elucidated using FISH with unique sequence cosmid probes. We conclude from our studies and others in the literature: (1) there is a newly defined class of markers lacking {alpha}-satellite DNA and containing duplications of terminal sequences; (2)neither {alpha}-satellite nor satellite III DNA at levels detectable by FISH is necessary for fidelity in the normal segregation of chromosomes; and (3) these markers were most likely formed by recombination of the long arms during meiosis.

  3. Genomic organization of alpha satellite DNA on human chromosome 7: evidence for two distinct alphoid domains on a single chromosome.

    PubMed Central

    Waye, J S; England, S B; Willard, H F

    1987-01-01

    A complete understanding of chromosomal disjunction during mitosis and meiosis in complex genomes such as the human genome awaits detailed characterization of both the molecular structure and genetic behavior of the centromeric regions of chromosomes. Such analyses in turn require knowledge of the organization and nature of DNA sequences associated with centromeres. The most prominent class of centromeric DNA sequences in the human genome is the alpha satellite family of tandemly repeated DNA, which is organized as distinct chromosomal subsets. Each subset is characterized by a particular multimeric higher-order repeat unit consisting of tandemly reiterated, diverged alpha satellite monomers of approximately 171 base pairs. The higher-order repeat units are themselves tandemly reiterated and represent the most recently amplified or fixed alphoid sequences. We present evidence that there are at least two independent domains of alpha satellite DNA on chromosome 7, each characterized by their own distinct higher-order repeat structure. We determined the complete nucleotide sequences of a 6-monomer higher-order repeat unit, which is present in approximately 500 copies per chromosome 7, as well as those of a less-abundant (approximately 10 copies) 16-monomer higher-order repeat unit. Sequence analysis indicated that these repeats are evolutionarily distinct. Genomic hybridization experiments established that each is maintained in relatively homogeneous tandem arrays with no detectable interspersion. We propose mechanisms by which multiple unrelated higher-order repeat domains may be formed and maintained within a single chromosomal subset. Images PMID:3561394

  4. Nucleotide sequence heterogeneity of alpha satellite repetitive DNA: a survey of alphoid sequences from different human chromosomes.

    PubMed Central

    Waye, J S; Willard, H F

    1987-01-01

    The human alpha satellite DNA family is composed of diverse, tandemly reiterated monomer units of approximately 171 basepairs localized to the centromeric region of each chromosome. These sequences are organized in a highly chromosome-specific manner with many, if not all human chromosomes being characterized by individually distinct alphoid subsets. Here, we compare the nucleotide sequences of 153 monomer units, representing alphoid components of at least 12 different human chromosomes. Based on the analysis of sequence variation at each position within the 171 basepair monomer, we have derived a consensus sequence for the monomer unit of human alpha satellite DNA which we suggest may reflect the monomer sequence from which different chromosomal subsets have evolved. Sequence heterogeneity is evident at each position within the consensus monomer unit and there are no positions of strict nucleotide sequence conservation, although some regions are more variable than others. A substantial proportion of the overall sequence variation may be accounted for by nucleotide changes which are characteristic of monomer components of individual chromosomal subsets or groups of subsets which have a common evolutionary history. PMID:3658703

  5. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  6. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  7. Start/stop codon like trinucleotides extensions in primate alpha satellites.

    PubMed

    Rosandić, Marija; Glunčić, Matko; Paar, Vladimir

    2013-01-21

    The centromeres remain "the final frontier" in unexplored segments of genome landscape in primate genomes, characterized by 2-5 Mb arrays of evolutionary rapidly evolving alpha satellite (AS) higher order repeats (HORs). Alpha satellites as specific noncoding sequences may be also significant in light of regulatory role of noncoding sequences. Using the Global Repeat Map (GRM) algorithm we identify in NCBI assemblies of chromosome 5 the species-specific alpha satellite HORs: 13mer in human, 5mer in chimpanzee, 14mer in orangutan and 3mers in macaque. The suprachromosomal family (SF) classification of alpha satellite HORs and surrounding monomeric alpha satellites is performed and specific segmental structure was found for major alpha satellite arrays in chromosome 5 of primates. In the framework of our novel concept of start/stop Codon Like Trinucleotides (CLTs) as a "new DNA language in noncoding sequences", we find characteristics and differences of these species in CLT extensions, in particular the extensions of stop-TGA CLT. We hypothesize that these are regulators in noncoding sequences, acting at a distance, and that they can amplify or weaken the activity of start/stop codons in coding sequences in protein genesis, increasing the richness of regulatory phenomena. PMID:23026763

  8. Isolation and characterization of an alpha-satellite repeated sequence from human chromosome 22.

    PubMed

    McDermid, H E; Duncan, A M; Higgins, M J; Hamerton, J L; Rector, E; Brasch, K R; White, B N

    1986-01-01

    We constructed a library in lambda L47.1 with DNA isolated from flow-sorted human chromosome 22. Over 50% of the recombinants contained the same highly repetitive sequence. When this sequence was used to probe Southern blots of EcoRI-digested genomic DNA, a ladder of bands with increments of about 170 bp was observed. This sequence comigrates with satellite III in Ag+/Cs2SO4 gradients and may account for at least part of the 170 bp Hae III ladder seen in isolated satellite III DNA. Partial sequence analysis revealed homology to the 171 bp monomeric repeat unit of alpha-R1-DNA and the X specific alpha-satellite consensus sequence. After low stringency in situ hybridization, silver grains were found over the centromeres of a number of chromosomes. Under high stringency conditions, however, the labeling was concentrated over the centromeric region of chromosome 22. This localization was confirmed using DNA from a panel of human/hamster cell lines which showed that the homologous 2.1 and 2.8 kb EcoR1 restriction fragments were chromosome 22 specific. These clones therefore contain chromosome 22 derived alpha-satellite sequences analogous to other chromosome-specific satellite sequences described previously. PMID:3769652

  9. Physical Interactions between Mcm10, DNA, and DNA Polymerase [alpha

    SciTech Connect

    Warren, Eric M.; Huang, Hao; Fanning, Ellen; Chazin, Walter J.; Eichman, Brandt F.

    2009-10-21

    Mcm10 is an essential eukaryotic protein required for the initiation and elongation phases of chromosomal replication. Specifically, Mcm10 is required for the association of several replication proteins, including DNA polymerase {alpha} (pol {alpha}), with chromatin. We showed previously that the internal (ID) and C-terminal (CTD) domains of Mcm10 physically interact with both single-stranded (ss) DNA and the catalytic p180 subunit of pol {alpha}. However, the mechanism by which Mcm10 interacts with pol {alpha} on and off DNA is unclear. As a first step toward understanding the structural details for these critical intermolecular interactions, x-ray crystallography and NMR spectroscopy were used to map the binary interfaces between Mcm10-ID, ssDNA, and p180. The crystal structure of an Mcm10-ID {center_dot} ssDNA complex confirmed and extended our previous evidence that ssDNA binds within the oligonucleotide/oligosaccharide binding-fold cleft of Mcm10-ID. We show using NMR chemical shift perturbation and fluorescence spectroscopy that p180 also binds to the OB-fold and that ssDNA and p180 compete for binding to this motif. In addition, we map a minimal Mcm10 binding site on p180 to a small region within the p180 N-terminal domain (residues 286-310). These findings, together with data for DNA and p180 binding to an Mcm10 construct that contains both the ID and CTD, provide the first mechanistic insight into how Mcm10 might use a handoff mechanism to load and stabilize pol {alpha} within the replication fork.

  10. Epigenetic profiling of heterochromatic satellite DNA.

    PubMed

    Zakrzewski, Falk; Weisshaar, Bernd; Fuchs, Jörg; Bannack, Ekaterina; Minoche, André E; Dohm, Juliane C; Himmelbauer, Heinz; Schmidt, Thomas

    2011-08-01

    Sugar beet (Beta vulgaris) chromosomes consist of large heterochromatic blocks in pericentromeric, centromeric, and intercalary regions comprised of two different highly abundant DNA satellite families. To investigate DNA methylation at single base resolution at heterochromatic regions, we applied a method for strand-specific bisulfite sequencing of more than 1,000 satellite monomers followed by statistical analyses. As a result, we uncovered diversity in the distribution of different methylation patterns in both satellite families. Heavily methylated CG and CHG (H=A, T, or C) sites occur more frequently in intercalary heterochromatin, while CHH sites, with the exception of CAA, are only sparsely methylated, in both intercalary and pericentromeric/centromeric heterochromatin. We show that the difference in DNA methylation intensity is correlated to unequal distribution of heterochromatic histone H3 methylation marks. While clusters of H3K9me2 were absent from pericentromeric heterochromatin and restricted only to intercalary heterochromatic regions, H3K9me1 and H3K27me1 were observed in all types of heterochromatin. By sequencing of a small RNA library consisting of 6.76 million small RNAs, we identified small interfering RNAs (siRNAs) of 24 nucleotides in size which originated from both strands of the satellite DNAs. We hypothesize an involvement of these siRNAs in the regulation of DNA and histone methylation for maintaining heterochromatin. PMID:21594600

  11. The Orbital Design of Alpha Centauri Exoplanet Satellite (ACESat)

    NASA Technical Reports Server (NTRS)

    Weston, Sasha; Belikov, Rus; Bendek, Eduardo

    2015-01-01

    Exoplanet candidates discovered by Kepler are too distant for biomarkers to be detected with foreseeable technology. Alpha Centauri has high separation from other stars and is of close proximity to Earth, which makes the binary star system 'low hanging fruit' for scientists. Alpha Centauri Exoplanet Satellite (ACESat) is a mission proposed to Small Explorer Program (SMEX) that will use a coronagraph to search for an orbiting planet around one of the stars of Alpha Centauri. The trajectory design for this mission is presented here where three different trajectories are considered: Low Earth Orbit (LEO), Geosynchronous Orbit (GEO) and a Heliocentric Orbit. Uninterrupted stare time to Alpha Centauri is desirable for meeting science requirements, or an orbit that provides 90% stare time to the science target. The instrument thermal stability also has stringent requirements for proper function, influencing trajectory design.

  12. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    SciTech Connect

    Warburton, P.E.; Gosden, J.; Lawson, D.

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  13. Phosphorylation-independent stimulation of DNA topoisomerase II alpha activity.

    PubMed

    Kimura, K; Saijo, M; Tanaka, M; Enomoto, T

    1996-05-01

    It has been suggested that casein kinase II phosphorylates DNA topoisomerase II alpha (topo II alpha) in mouse FM3A cells, by comparison of phosphopeptide maps of topo II alpha labeled in intact cells and of topo II alpha phosphorylated by various kinases in vitro. The phosphorylation of purified topo II alpha by casein kinase II, which attached a maximum of two phosphate groups per topo II alpha molecule, had no effect on the activity of topo II alpha. Dephosphorylation of purified topo II alpha by potato acid phosphatase, which almost completely dephosphorylated the topo II alpha, did not reduce the activity of topo II alpha. The incubation itself, regardless of phosphorylation or dephosphorylation status, stimulated the enzyme activity in both reactions. Topo II alpha activity was stimulated by incubation in a medium containing low concentrations of glycerol but not in that containing high concentrations of glycerol, such as the 50% in which purified topo II alpha is stored. The stimulation of topo II alpha activity by incubation was dependent on the concentration of topo II alpha, requiring a relatively high concentration of topo II alpha. PMID:8631919

  14. [Non-radioactive in situ hybridization of alpha-satellite sequences in cytogenetic diagnosis].

    PubMed

    Perfumo, C; Arslanian, A; Zara, F; Piombo, G; Pierluigi, M

    1992-01-01

    Non isotopic in situ hybridization with alpha-satellite DNA probes in the cytogenetic diagnosis. Standard banding cytogenetic techniques do not always allow to define the structure and the origin of chromosome rearrangements involving the centromere region. Non-isotopic in situ hybridization of alphoid sequences has allowed to determine the origin of the centromeres in the metaphases of 5 patients referred to us for: 2 structural rearrangements involving chromosome 21, 2 structural rearrangements involving chromosome Y and 1 reciprocal translocation involving on chromosome 20 and one chromosome 15. PMID:1465321

  15. Organization and Molecular Evolution of CENP-A–Associated Satellite DNA Families in a Basal Primate Genome

    PubMed Central

    Lee, Hye-Ran; Hayden, Karen E.; Willard, Huntington F.

    2011-01-01

    Centromeric regions in many complex eukaryotic species contain highly repetitive satellite DNAs. Despite the diversity of centromeric DNA sequences among species, the functional centromeres in all species studied to date are marked by CENP-A, a centromere-specific histone H3 variant. Although it is well established that families of multimeric higher-order alpha satellite are conserved at the centromeres of human and great ape chromosomes and that diverged monomeric alpha satellite is found in old and new world monkey genomes, little is known about the organization, function, and evolution of centromeric sequences in more distant primates, including lemurs. Aye-Aye (Daubentonia madagascariensis) is a basal primate and is located at a key position in the evolutionary tree to study centromeric satellite transitions in primate genomes. Using the approach of chromatin immunoprecipitation with antibodies directed to CENP-A, we have identified two satellite families, Daubentonia madagascariensis Aye-Aye 1 (DMA1) and Daubentonia madagascariensis Aye-Aye 2 (DMA2), related to each other but unrelated in sequence to alpha satellite or any other previously described primate or mammalian satellite DNA families. Here, we describe the initial genomic and phylogenetic organization of DMA1 and DMA2 and present evidence of higher-order repeats in Aye-Aye centromeric domains, providing an opportunity to study the emergence of chromosome-specific modes of satellite DNA evolution in primate genomes. PMID:21828373

  16. Lability of DNA polymerase alpha correlated with decreased DNA synthesis and increased age in human cells

    SciTech Connect

    Busbee, D.; Sylvia, V.; Stec, J.; Cernosek, Z.; Norman, J.

    1987-12-01

    DNA excision repair and mitogen-initiated blastogenesis in human cells declined in efficiency as an apparent function of decreased DNA polymerase alpha specific activity with increased age of the cell donor. DNA polymerase alpha isolated from fetal cells contained a single, high-specific-activity enzyme form that could not be further activated and that was stable with regard to enzyme activity and affinity for DNA template-primer. DNA polymerase alpha isolated from adult-derived cells contained both low-specific-activity and high-specific-activity forms. The low-activity enzyme form, which showed low affinity of binding to DNA template-primer, was activated by treatment with phosphatidylinositol, /sup 32/P-ATP, and phosphatidylinositol kinase, resulting in a /sup 32/P-labeled enzyme that exhibited high affinity of binding to DNA template-primer. The activated enzyme was unstable, exhibiting a loss of /sup 32/P-label correlated with the loss of both specific activity and high affinity of binding to DNA template-primer. The data suggest that DNA polymerase alpha isolated from adult-derived human cells has low-activity and high-activity forms. Decreased specific activity of DNA polymerase alpha correlated with increased age of the donor appears to be a function of loss of an enzyme activator molecule resulting in diminished ability of the enzyme to bind DNA template-primer.

  17. T-antigen-DNA polymerase alpha complex implicated in simian virus 40 DNA replication.

    PubMed Central

    Smale, S T; Tjian, R

    1986-01-01

    We have combined in vitro DNA replication reactions and immunological techniques to analyze biochemical interactions between simian virus (SV40) large T antigen and components of the cellular replication apparatus. First, in vitro SV40 DNA replication was characterized with specific origin mutants. Next, monoclonal antibodies were used to demonstrate that a specific domain of T antigen formed a complex with cellular DNA polymerase alpha. Several antibodies were identified that coprecipitated T antigen and DNA polymerase alpha, while others were found to selectively prevent this interaction and concomitantly inhibit DNA replication. DNA polymerase alpha also bound efficiently to a T-antigen affinity column, confirming the immunoprecipitation results and providing a useful method for purification of the complete protein complex. Taken together, these results suggest that the T-antigen-polymerase association may be a key step in the initiation of SV40 DNA replication. Images PMID:3025630

  18. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: activation of a latent centromere?

    PubMed Central

    Voullaire, L E; Slater, H R; Petrovic, V; Choo, K H

    1993-01-01

    We report the investigation of an unusual human supernumerary marker chromosome 10 designated "mar del(10)." This marker is present together with two other marker chromosomes in the karyotype of a boy with mild developmental delay. It has a functional centromere at a primary constriction and is mitotically stable. Fluorescence in situ hybridization (FISH) using alpha-satellite and satellite III DNA as probes failed to detect any signal at the primary constriction site. CENP-B protein could not be demonstrated, although the presence of at least some centromeric proteins was confirmed using a CREST antiserum. Consideration of these and other cytogenetic and FISH results supports a mechanism of formation of the mar del(10) chromosome involving the activation of a latent intercalary centromere at 10q25. Images Figure 5 Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 PMID:7684888

  19. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: Activation of a latent centromere

    SciTech Connect

    Voullaire, L.E.; Slater, H.R.; Petrovic, V.; Choo, K.H.A. )

    1993-06-01

    The authors report the investigation of an unusual human supernumerary marker chromosome 10 designated [open quotes]mar del(10)[close quotes]. This marker is present together with two other marker chromosomes in the karyotype of a boy with mild developmental delay. It has a functional centromere at a primary constriction and is mitotically stable. Fluorescence in situ hybridization (FISH) using alpha-satellite and satellite III DNA as probes failed to detect any signal at the primary constriction site. CENP-B protein could not be demonstrated, although the presence of at least some centromeric proteins was confirmed using a CREST antiserum. Consideration of these and other cytogenetic and Fish results supports a mechanism of formation of the mar del(10) chromosome involving the activation of a latent intercalary centromere at 10q25. 33 refs., 6 figs.

  20. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  1. Detection of alpha particles using DNA/Al Schottky junctions

    NASA Astrophysics Data System (ADS)

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-09-01

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current-voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  2. Detection of alpha particles using DNA/Al Schottky junctions

    SciTech Connect

    Al-Ta'ii, Hassan Maktuff Jaber E-mail: vengadeshp@um.edu.my; Periasamy, Vengadesh E-mail: vengadeshp@um.edu.my; Amin, Yusoff Mohd

    2015-09-21

    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current–voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  3. Mutation and recombination in cattle satellite DNA: a feedback model for the evolution of satellite DNA repeats.

    PubMed

    Nijman, I J; Lenstra, J A

    2001-04-01

    The cattle genome contains several distinct centromeric satellites with interrelated evolutionary histories. We compared these satellites in Bovini species that diverged 0.2 to about 5 Myr ago. Quantification of hybridization signals by phosphor imaging revealed a large variation in the relative amounts of the major satellites. In the genome of water buffalo this has led to the complete deletion of satellite III. Comparative sequencing and PCR-RFLP analysis of satellites IV, 1.711a, and 1.711b from the related Bos and Bison species revealed heterogeneities in 0.5 to 2% of the positions, again with variations in the relative amounts of sequence variants. Restriction patterns generated by double digestions suggested a recombination of sequence variants. Our results are compatible with a model of the life history of satellites during which homogeneity of interacting repeat units is both cause and consequence of the rapid turnover of satellite DNA. Initially, a positive feedback loop leads to a rapid saltatory amplification of homogeneous repeat units. In the second phase, mutations inhibit the interaction of repeat units and coexisting sequence variants amplify independently. Homogenization by the spreading of one of the variants is prevented by recombination and the satellite is eventually outcompeted by another, more homogeneous tandem repeat sequence. PMID:11343132

  4. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    SciTech Connect

    Kuzuhara, T. Suganuma, M.; Oka, K.; Fujiki, H.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.

  5. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  6. Human DNA polymerase. alpha. : Predicted functional domains and relationships with viral DNA polymerases

    SciTech Connect

    Wang, T.S.F.; Wong, S.W.; Korn, D. )

    1989-01-01

    The primary sequence of human DNA polymerase {alpha} deduced from the full-length cDNA contains regions of striking similarity to sequences in replicative DNA polymerases from Escherichia coli phages PRD1 and T4, Bacillus phage {phi}19, yeast DNA polymerase I, yeast linear plasmid pGKL1, maize S1 mitochondrial DNA, herpes family viruses, vaccinia virus, and adenovirus. The conservation of these homologous regions across this vast phylogenetic expanse indicates that these prokaryotic and eukaryotic DNA polymerases may all have evolved from a common primordial gene. Based on the sequence analysis and genetic results from yeast and herpes simplex virus studies, these consensus sequences are suggested to define potential sites that subserve essential roles in the DNA polymerase reaction. Two of these conserved regions appear to participate directly in the active site required for substrate deoxynucleotide interaction. One region toward the carboxyl-terminus has the potential to be the DNA interacting domain is predicted toward the amino-terminus. The provisional assignment of these domains can be used to identify unique or dissimilar features of functionally homologous catalytic sites in viral DBA polymerases of pathogenetic significance and thereby serve to guide more rational antiviral drug design.

  7. Cleavage patterns of Drosophila melanogaster satellite DNA by restriction enzymes.

    PubMed Central

    Shen, C J; Wiesehahn, G; Hearst, J E

    1976-01-01

    The five satellite DNAs of Drosophila melanogaster have been isolated by the combined use of different equilibrium density gradients and hydrolyzed by seven different restriction enzymes; Hae III, Hind II + Hind III, Hinf, Hpa II, EcoR I and EcoR II. The 1.705 satellite is not hydrolyzed by any of the enzymes tested. Hae III is the only restriction enzyme that cuts the 1.672 and 1.686 satellites. The cleavage products from either of these reactions has a heterogeneous size distribution. Part of the 1.688 satellite is cut by Hae III and by Hinf into three discrete fragments with M.W. that are multiples of 2.3 X 10(5) daltons (approximately 350 base pairs). In addition, two minor bands are detected in the 1.688-Hinf products. The mole ratios of the trimer, dimer and monomer are: 1:6.30 : 63.6 for 1.688-Hae III and 1 : 22.0 : 403 for 1.688-Hinf. Circular mitochondrial DNA (rho = 1.680) is cut into discrete fragments by all of the enzymes tested and molecular weights of these fragments have been determined. Images PMID:818625

  8. DNA polymorphisms and mutations of the tumor necrosis factor-alpha (TNF-alpha) promoter in Langerhans cell histiocytosis (LCH).

    PubMed

    Wu, W S; McClain, K L

    1997-10-01

    Langerhans cell histiocytosis (LCH) is a clonal proliferation of dendritic histiocytes expressing elevated levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1 (IL-1), and leukemia inhibitory factor (LIF). The cause of the increased cytokine levels is unknown, but DNA sequence changes in promoters could alter expression. The TNF-alpha and IFN-gamma promoter DNA sequences of 12 LCH patients were studied and compared with normal individuals by dideoxy fingerprinting and DNA sequencing. Functional consequences of polymorphic or mutated sequences were assessed by cloning altered and control promoter sequences into a luciferase reporter gene vector. Electrophoretic mobility shifts (EMSA) after binding of nuclear extracts from a macrophage cell line (U-937) by mutated promoters were compared with controls. Five of 12 LCH patients had alterations in the TNF-alpha promoter DNA sequence. None were found in the IFN-gamma gene promoter. Of the 5 with TNF-alpha DNA alterations, 2 were at position -308, which has been described as a G-A polymorphism associated with upregulation of TNF-alpha in some patients with infections or immune-mediated diseases. The polymorphism at -308 but not the other TNF-alpha promoter mutations caused a 3-fold to 7-fold increased production of the luciferase reporter gene. EMSA showed that the -308 mutant promoters bound fewer nuclear proteins than normals. Polymorphisms of the TNF-alpha promoter in LCH patients could increase the production of that cytokine. PMID:9355965

  9. Involvement of DNA polymerase alpha in host cell reactivation of UV-irradiated herpes simplex virus

    SciTech Connect

    Nishiyama, Y.; Yoshida, S.; Maeno, K.

    1984-02-01

    Aphidicolin is a potent inhibitor of both host cell DNA polymerase alpha and herpes simplex virus (HSV)-induced DNA polymerase but has no effect on DNA polymerases beta and gamma of host cells. By using an aphidicolin-resistant mutant (Aphr) of HSV, a possible involvement of DNA polymerase alpha in host cell reactivation of UV-damaged HSV was studied. Plaque formation by UV-irradiated Aphr was markedly inhibited by 1 microgram of aphidicolin per ml, which did not affect the plating efficiency of nonirradiated Aphr. Aphidicolin added before 12 h postinfection inhibited plaque formation by irradiated Aphr, which became aphidicolin insensitive after 36 h postinfection. The results strongly suggest that host cell DNA polymerase alpha is involved in the repair of UV-irradiated HSV DNA.

  10. Characterization and chromosome location of satellite DNA in the leaf beetle Chrysolina americana (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, P; Palomeque, T; Garnería, I; Petitpierre, E

    2000-01-01

    This paper is the first record of the satellite DNA of the specialized phytophagous genus Chrysolina. The satellite DNA of Chrysolina americana is organized in a tandem repeat of monomers 189 bp long, has a A + T content of 59.6% and presents direct and inverted internal repeats. Restriction analysis of the total DNA with methylation sensitive enzymes suggests that this repetitive DNA is undermethylated. In siti hybridization with a biotinylated probe of the satellite DNA showed the pericentromeric localization of these sequences in all meiotic bivalents. The presence of this repetitive DNA in other species of the genus was also tested by Southern analysis. The results showed that this satellite DNA sequence is specific to the C. americana genome and has not been found in three other species of Chrysolina with a different choice of host plants than in the former. PMID:11678504

  11. Molecular analysis of a deletion polymorphism in alpha satellite of human chromosome 17: evidence for homologous unequal crossing-over and subsequent fixation.

    PubMed Central

    Waye, J S; Willard, H F

    1986-01-01

    The human alpha satellite DNA family is organized into chromosome-specific subsets characterized by distinct higher-order repeats based on a approximately 171 basepair monomer unit. On human chromosome 17, the predominant form of alpha satellite is a 16-monomer (16-mer) higher-order repeat present in 500-1000 copies per chromosome 17. In addition, less abundant 15-monomer and 14-monomer repeats are also found constitutively on chromosome 17. Polymorphisms in the form of different higher-order repeat lengths have been described for this subset, the most prominent polymorphism being a 13-monomer (13-mer) higher-order repeat present on approximately 35% of all chromosomes 17. To investigate the nature of this polymorphism, we have cloned, sequenced and compared the relevant regions of the 13-mer to the previously characterized 16-mer repeat. The results show that the repeats are virtually identical, with the principal difference being the exclusion of three monomers from the 13-mer repeat. We propose that the 13-mer is the product of an isolated homologous recombination event between two monomers of the 16-mer repeat. Sequence comparisons reveal the approximate site of recombination and flanking regions of homology. This recombination site corresponds to a position within the alphoid monomer which has been previously implicated in an independent homologous recombination event, suggesting that there may exist a preferred register for recombination in alphoid DNA. We suggest that these events are representative of an ongoing process capable of reorganizing the satellite subset of a given chromosome, thereby contributing to the establishment of chromosome-specific alpha satellite subsets. Images PMID:3763396

  12. DNA polymerases alpha and gamma during pre-emergence and early larval development of Artemia.

    PubMed

    Slater, J M; McLennan, A G

    1982-12-15

    DNA polymerases alpha and gamma have been studied in cryptobiotic cysts and developing embryos and larvae of the brine shrimp Artemia. The two enzymes readily separate on Cibacron blue 3-GA Matrex gel. Assay requirements with activated DNA as primer-template are pH 8.0, 1 mM Mg2+, 50 mM K+ for DNA polymerase alpha and pH 8.4, 10 mM Mg2+, 80 mM K+ for DNA polymerase gamma. DNA polymerase alpha is inhibited by N-ethylmaleimide (94% and 100% at 1 mM and 10 mM respectively) and aphidicolin (96% at 60 microM). DNA polymerase gamma is also sensitive to N-ethylmaleimide (83% and 100% inhibition at 1 mM and 10 mM respectively) but is resistant to aphidicolin. 2',3'-Dideoxythymidine 5'-triphosphate (ddTTP) inhibits the gamma polymerase by 88% when in fivefold excess over dTTP whereas the alpha polymerase is unaffected by this compound. DNA polymerase alpha has a sedimentation coefficient of 7.6 S which is reduced to 6.2 S by a phenylmethylsulphonyl fluoride-sensitive proteinase. The gamma polymerase sediments at 8.3 S. No DNA polymerase beta activity could be detected. After the reinitiation of development both activities increased twofold up to 8 h (gamma polymerase) and 16 h (alpha polymerase), then declined before the onset of nuclear DNA replication after hatching. Thymidine kinase activity increased over 200-fold up to the time of replication. Analysis on Percoll density gradients of the intracellular distribution of both polymerases during development suggests that the changes in their activities may be due to migration from storage sites to replication complexes in the nuclei and mitochondria. The content of the mitochondrial DNA polymerase gamma in different batches of cysts may reflect the relative viabilities of the cysts. PMID:7151804

  13. Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

    PubMed Central

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa. PMID:23372772

  14. cDNA cloning and sequencing of rat alpha sub 1 -macroglobulin

    SciTech Connect

    Waermegaard, B.; Martin, N.; Johansson, S. )

    1992-03-03

    cDNA clones coding for the plasma protease inhibitor {alpha}{sub 1}-macroglobulin were isolated from a rat liver library. The obtained cDNA sequence contained 4701 nucleotides and had an open reading frame coding for a 1500 amino acid long protein, including a 24 amino acid signal peptide. The identity of the deduced protein sequence as {alpha}{sub 1}-macroglobulin was established by comparison with published peptide sequences of the protein. The mature protein shares 53% and 57% overall amino acid identity with the two other identified members of the rat {alpha}-macroglobulin family, {alpha}{sub 1}-inhibitor 3 and {alpha}{sub 2}-macroglobulin. A sequence typical for an internal thiol ester was identified. Of the 24 cysteines, 23 are conserved with {alpha}{sub 2}-macroglobulin. However, instead of the two most C-terminal cysteines in {alpha}{sub 2}-macroglobulin, which forms a disulfide bridge in the receptor binding domain, {alpha}{sub 1}-macroglobulin contains phenylalanine. One MRNA species hybridizing with the {alpha}{sub 1}-macroglobulin probe was observed in rat and mouse liver RNA ({approximately} 6.2 kb), whereas no corresponding transcript was detected in RNA from human liver.

  15. A novel nanometric DNA thin film as a sensor for alpha radiation

    NASA Astrophysics Data System (ADS)

    Kulkarni, Atul; Kim, Byeonghoon; Dugasani, Sreekantha Reddy; Joshirao, Pranav; Kim, Jang Ah; Vyas, Chirag; Manchanda, Vijay; Kim, Taesung; Park, Sung Ha

    2013-06-01

    The unexpected nuclear accidents have provided a challenge for scientists and engineers to develop sensitive detectors, especially for alpha radiation. Due to the high linear energy transfer value, sensors designed to detect such radiation require placement in close proximity to the radiation source. Here we report the morphological changes and optical responses of artificially designed DNA thin films in response to exposure to alpha radiation as observed by an atomic force microscope, a Raman and a reflectance spectroscopes. In addition, we discuss the feasibility of a DNA thin film as a radiation sensing material. The effect of alpha radiation exposure on the DNA thin film was evaluated as a function of distance from an 241Am source and exposure time. Significant reflected intensity changes of the exposed DNA thin film suggest that a thin film made of biomolecules can be one of promising candidates for the development of online radiation sensors.

  16. Organisation of nucleosomal arrays reconstituted with repetitive African green monkey α-satellite DNA as analysed by atomic force microscopy

    PubMed Central

    Bussiek, Malte; Müller, Gabriele; Waldeck, Waldemar; Diekmann, Stephan

    2007-01-01

    Alpha-satellite DNA (AS) is part of centromeric DNA and could be relevant for centromeric chromatin structure: its repetitive character may generate a specifically ordered nucleosomal arrangement and thereby facilitate kinetochore protein binding and chromatin condensation. Although nucleosomal positioning on some satellite sequences had been shown, including AS from African green monkey (AGM), the sequence-dependent nucleosomal organisation of repetitive AS of this species has so far not been analysed. We therefore studied the positioning of reconstituted nucleosomes on AGM AS tandemly repeated DNA. Enzymatic analysis of nucleosome arrays formed on an AS heptamer as well as the localisation of mononucleosomes on an AS dimer by atomic force microscopy (AFM) showed one major positioning frame, in agreement with earlier results. The occupancy of this site was in the range of 45–50%, in quite good agreement with published in vivo observations. AFM measurements of internucleosomal distances formed on the heptamer indicated that the nucleosomal arrangement is governed by sequence-specific DNA-histone interactions yielding defined internucleosomal distances, which, nevertheless, are not compatible with a uniform phasing of the nucleosomes with the AGM AS repeats. PMID:17503032

  17. Satellite DNA as a Driver of Population Divergence in the Red Flour Beetle Tribolium castaneum

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Brajković, Josip; Zlatar, Ivo; Ugarković, Đurđica

    2015-01-01

    Tandemly repeated satellite DNAs are among most rapidly evolving sequences in eukaryotic genome, usually differing significantly among closely related species. By inducing changes in heterochromatin and/or centromere, satellite DNAs are expected to drive population and species divergence. However, despite high evolutionary dynamics, divergence of satellite DNA profiles at the level of natural population which precedes and possibly triggers speciation process is not readily detected. Here, we characterize minor TCAST2 satellite DNA of the red flour beetle Tribolium castaneum and follow its dynamics among wild-type strains originating from diverse geographic locations. The investigation revealed presence of three distinct subfamilies of TCAST2 satellite DNA which differ in monomer size, genome organization, and subfamily specific mutations. Subfamilies Tcast2a and Tcast2b are tandemly arranged within pericentromeric heterochromatin whereas Tcast2c is preferentially dispersed within euchromatin of all chromosomes. Among strains, TCAST2 subfamilies are conserved in sequence but exhibit a significant content variability. This results in overrepresentation or almost complete absence of particular subfamily in some strains and enables discrimination between strains. It is proposed that homologous recombination, probably stimulated by environmental stress, is responsible for the emergence of TCAST2 satellite subfamilies, their copy number variation and dispersion within genome. The results represent the first evidence for the existence of population-specific satellite DNA profiles. Partial organization of TCAST2 satellite DNA in the form of single repeats dispersed within euchromatin additionally contributes to the genome divergence at the population level. PMID:25527837

  18. The p38alpha/beta MAPK functions as a molecular switch to activate the quiescent satellite cell.

    PubMed

    Jones, Nathan C; Tyner, Kristina J; Nibarger, Lisa; Stanley, Heather M; Cornelison, Dawn D W; Fedorov, Yuri V; Olwin, Bradley B

    2005-04-11

    Somatic stem cells cycle slowly or remain quiescent until required for tissue repair and maintenance. Upon muscle injury, stem cells that lie between the muscle fiber and basal lamina (satellite cells) are activated, proliferate, and eventually differentiate to repair the damaged muscle. Satellite cells in healthy muscle are quiescent, do not express MyoD family transcription factors or cell cycle regulatory genes and are insulated from the surrounding environment. Here, we report that the p38alpha/beta family of mitogen-activated protein kinases (MAPKs) reversibly regulates the quiescent state of the skeletal muscle satellite cell. Inhibition of p38alpha/beta MAPKs (a) promotes exit from the cell cycle, (b) prevents differentiation, and (c) insulates the cell from most external stimuli allowing the satellite cell to maintain a quiescent state. Activation of satellite cells and p38alpha/beta MAPKs occurs concomitantly, providing further support that these MAPKs function as a molecular switch for satellite cell activation. PMID:15824134

  19. Active heterodimers are formed from human DNA topoisomerase II alpha and II beta isoforms.

    PubMed Central

    Biersack, H; Jensen, S; Gromova, I; Nielsen, I S; Westergaard, O; Andersen, A H

    1996-01-01

    DNA topoisomerase II is a nuclear enzyme essential for chromosome dynamics and DNA metabolism. In mammalian cells, two genetically and biochemically distinct topoisomerase II forms exist, which are designated topoisomerase II alpha and topoisomerase II beta. In our studies of human topoisomerase II, we have found that a substantial fraction of the enzyme exists as alpha/beta heterodimers in HeLa cells. The ability to form heterodimers was verified when human topoisomerases II alpha and II beta were coexpressed in yeast and investigated in a dimerization assay. Analysis of purified heterodimers shows that these enzymes maintain topoisomerase II specific catalytic activities. The natural existence of an active heterodimeric subclass of topoisomerase II merits attention whenever topoisomerases II alpha and II beta function, localization, and cell cycle regulation are investigated. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8710863

  20. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  1. Activation of an Mg2+-dependent DNA endonuclease of avian myeloblastosis virus alpha beta DNA polymerase by in vitro proteolytic cleavage.

    PubMed Central

    Grandgenett, D P; Golomb, M; Vora, A C

    1980-01-01

    Partial chymotryptic digestion of purified avian myeloblastosis virus alpha beta DNA polymerase resulted in the activation of a Mg2+-dependent DNA endonuclease activity. Incubation of the polymerase-protease mixture in the presence of super-coiled DNA and Mg2+ permitted detection of the cleaved polymerase fragment possessing DNA nicking activity. Protease digestion conditions were established permitting selective cleavage of beta to alpha, which contained DNA polymerase and RNase H activity and to a family of polypeptides ranging in size from 30,000 to 34,000 daltons. These latter beta-unique fragments were purified by polyuridylate-Sepharose 4B chromatography and were shown to contain both DNA binding and DNA endonuclease activities. We have demonstrated that this group of polymerase fragments derived by chymotryptic digestion of alpha beta DNA polymerase is similar to the in vivo-isolated avian myeloblastosis virus p32pol in size, sequence, and DNA endonuclease activity. Images PMID:6154149

  2. Expression of human. alpha. sub 2 -macroglobulin cDNA in baby hamster kidney fibroblasts: Secretion of high levels of active. alpha. sub 2 -macroglobulin

    SciTech Connect

    Boel, E.; Mortensen, S.B. ); Kristensen, T.; Sottrup-Jensen, L. ); Petersen, C.M. )

    1990-05-01

    Human {alpha}{sub 2}-macroglobulin ({alpha}{sub 2}M) is a unique 720-kDa proteinase inhibitor with a broad specificity. Unlike most other proteinase inhibitors, it does not inhibit proteolytic activity by blocking the active site of the proteinase. During complex formation with a proteinase {alpha}{sub 2}M entraps the proteinase molecule in a reaction that involves large conformational changes in {alpha}{sub 2}M. The authors describe the molecular cloning of {alpha}{sub 2}M cDNA from the human hepatoblastoma cell line HepG2. The cDNA was subcloned under control of the adenovirus major late promoter in a mammalian expression vector and introduced into the baby hamster kidney (BHK) cell line. Transformed clones were isolated and tested for production of human {alpha}{sub 2}M with a specific enzyme-linked immunosorbent assay. Human recombinant {alpha}{sub 2}M (r{alpha}{sub 2}M), secreted and purified form isolated transfected BHK cell lines, was structurally and functionally compared to {alpha}{sub 2}M purified from human serum. The results show that r{alpha}{sub 2}M was secreted from the BHK cells as an active proteinase-binding tetramer with functional thiol esters. Cleavage reactions of r{alpha}{sub 2}M with methylamine and trypsin showed that the recombinant product, which was correctly processed at the N-terminus, exhibited molecular characteristics similar to those of the human serum derived reference.

  3. The CHH motif in sugar beet satellite DNA: a modulator for cytosine methylation.

    PubMed

    Zakrzewski, Falk; Schubert, Veit; Viehoever, Prisca; Minoche, André E; Dohm, Juliane C; Himmelbauer, Heinz; Weisshaar, Bernd; Schmidt, Thomas

    2014-06-01

    Methylation of DNA is important for the epigenetic silencing of repetitive DNA in plant genomes. Knowledge about the cytosine methylation status of satellite DNAs, a major class of repetitive DNA, is scarce. One reason for this is that arrays of tandemly arranged sequences are usually collapsed in next-generation sequencing assemblies. We applied strategies to overcome this limitation and quantified the level of cytosine methylation and its pattern in three satellite families of sugar beet (Beta vulgaris) which differ in their abundance, chromosomal localization and monomer size. We visualized methylation levels along pachytene chromosomes with respect to small satellite loci at maximum resolution using chromosome-wide fluorescent in situ hybridization complemented with immunostaining and super-resolution microscopy. Only reduced methylation of many satellite arrays was obtained. To investigate methylation at the nucleotide level we performed bisulfite sequencing of 1569 satellite sequences. We found that the level of methylation of cytosine strongly depends on the sequence context: cytosines in the CHH motif show lower methylation (44-52%), while CG and CHG motifs are more strongly methylated. This affects the overall methylation of satellite sequences because CHH occurs frequently while CG and CHG are rare or even absent in the satellite arrays investigated. Evidently, CHH is the major target for modulation of the cytosine methylation level of adjacent monomers within individual arrays and contributes to their epigenetic function. This strongly indicates that asymmetric cytosine methylation plays a role in the epigenetic modification of satellite repeats in plant genomes. PMID:24661787

  4. Isolation and characterization of human cDNA clones encoding the. alpha. and the. alpha. prime subunits of casein kinase II

    SciTech Connect

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs E.G. )

    1990-09-11

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two {alpha} or {alpha}{prime} subunits (or one of each) and two {beta} subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell {lambda}gt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5{prime} untranslated region) and followed by 871 bp (3{prime} untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5{prime} untranslated region) and followed by 550 bp (3{prime} untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of {alpha} and {alpha}{prime} subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the {alpha} and {alpha}{prime} subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II ({alpha} and {alpha}{prime}) and that the sequence of these subunits is largely conserved between the bovine and the human.

  5. A role for DNA polymerase alpha in epigenetic control of transcriptional silencing in fission yeast.

    PubMed

    Nakayama Ji; Allshire, R C; Klar, A J; Grewal, S I

    2001-06-01

    In the fission yeast Schizosaccharomyces pombe, transcriptional silencing at the mating-type region, centromeres and telomeres is epigenetically controlled, and results from the assembly of higher order chromatin structures. Chromatin proteins associated with these silenced loci are believed to serve as molecular bookmarks that help promote inheritance of the silenced state during cell division. Specifically, a chromodomain protein Swi6 is believed to be an important determinant of the epigenetic imprint. Here, we show that a mutation in DNA polymerase alpha (pol(alpha)) affects Swi6 localization at the mating-type region and causes a 45-fold increase in spontaneous transition from the silenced epigenetic state to the expressed state. We also demonstrate that pol(alpha) mutant cells are defective in Swi6 localization at centromeres and telomeres. Genetic analysis suggests that Polalpha and Swi6 are part of the same silencing pathway. Interestingly, we found that Swi6 directly binds to Pol(alpha) in vitro. Moreover, silencing-defective mutant Pol(alpha) displays reduced binding to Swi6 protein. This work indicates involvement of a DNA replication protein, Pol(alpha), in heterochromatin assembly and inheritance of epigenetic chromatin structures. PMID:11387218

  6. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    PubMed Central

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  7. High-throughput analysis of the satellitome illuminates satellite DNA evolution.

    PubMed

    Ruiz-Ruano, Francisco J; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M

    2016-01-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term "satellitome" for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings. PMID:27385065

  8. High-throughput analysis of the satellitome illuminates satellite DNA evolution

    NASA Astrophysics Data System (ADS)

    Ruiz-Ruano, Francisco J.; López-León, María Dolores; Cabrero, Josefa; Camacho, Juan Pedro M.

    2016-07-01

    Satellite DNA (satDNA) is a major component yet the great unknown of eukaryote genomes and clearly underrepresented in genome sequencing projects. Here we show the high-throughput analysis of satellite DNA content in the migratory locust by means of the bioinformatic analysis of Illumina reads with the RepeatExplorer and RepeatMasker programs. This unveiled 62 satDNA families and we propose the term “satellitome” for the whole collection of different satDNA families in a genome. The finding that satDNAs were present in many contigs of the migratory locust draft genome indicates that they show many genomic locations invisible by fluorescent in situ hybridization (FISH). The cytological pattern of five satellites showing common descent (belonging to the SF3 superfamily) suggests that non-clustered satDNAs can become into clustered through local amplification at any of the many genomic loci resulting from previous dissemination of short satDNA arrays. The fact that all kinds of satDNA (micro- mini- and satellites) can show the non-clustered and clustered states suggests that all these elements are mostly similar, except for repeat length. Finally, the presence of VNTRs in bacteria, showing similar properties to non-clustered satDNAs in eukaryotes, suggests that this kind of tandem repeats show common properties in all living beings.

  9. Functionalized 2'-amino-alpha-L-LNA: directed positioning of intercalators for DNA targeting.

    PubMed

    Kumar, T Santhosh; Madsen, Andreas S; Østergaard, Michael E; Sau, Sujay P; Wengel, Jesper; Hrdlicka, Patrick J

    2009-02-01

    Chemically modified oligonucleotides are increasingly applied in nucleic acid based therapeutics and diagnostics. LNA (locked nucleic acid) and its diastereomer alpha-L-LNA are two promising examples thereof that exhibit increased thermal and enzymatic stability. Herein, the synthesis, biophysical characterization, and molecular modeling of N2'-functionalized 2'-amino-alpha-L-LNA is described. Chemoselective N2'-functionalization of protected amino alcohol 1 followed by phosphitylation afforded a structurally varied set of target phosphoramidites, which were incorporated into oligodeoxyribonucleotides. Incorporation of pyrene-functionalized building blocks such as 2'-N-(pyren-1-yl)carbonyl-2'-amino-alpha-L-LNA (monomer X) led to extraordinary increases in thermal affinity of up to +19.5 degrees C per modification against DNA targets in particular. In contrast, incorporation of building blocks with small nonaromatic N2'-functionalities such as 2'-N-acetyl-2'-amino-alpha-L-LNA (monomer V) had detrimental effects on thermal affinity toward DNA/RNA complements with decreases of as much as -16.5 degrees C per modification. Extensive thermal DNA selectivity, favorable entropic contributions upon duplex formation, hybridization-induced bathochromic shifts of pyrene absorption maxima and increases in circular dichroism signal intensity, and molecular modeling studies suggest that pyrene-functionalized 2'-amino-alpha-L-LNA monomers W-Y having short linkers between the bicyclic skeleton and the pyrene moiety allow high-affinity hybridization with DNA complements and precise positioning of intercalators in nucleic acid duplexes. This rigorous positional control has been utilized for the development of probes for emerging therapeutic and diagnostic applications focusing on DNA targeting. PMID:19108636

  10. A novel subviral agent associated with a geminivirus: the first report of a DNA satellite.

    PubMed

    Dry, I B; Krake, L R; Rigden, J E; Rezaian, M A

    1997-06-24

    Numerous plant RNA viruses have associated with them satellite (sat) RNAs that have little or no nucleotide sequence similarity to either the viral or host genomes but are completely dependent on the helper virus for replication. We report here on the discovery of a 682-nt circular DNA satellite associated with tomato leaf curl geminivirus (TLCV) infection in northern Australia. This is the first demonstration that satellite molecules are not limited to RNA viral systems. The DNA satellite (TLCV sat-DNA) is strictly dependent for replication on the helper virus replication-associated protein and is encapsidated by TLCV coat protein. It has no significant open reading frames, and it shows no significant sequence similarity to the 2766-nt helper-virus genome except for two short motifs present in separate putative stem-loop structures: TAATATTAC, which is universally conserved in all geminiviruses, and AATCGGTGTC, which is identical to a putative replication-associated protein binding motif in TLCV. Replication of TLCV sat-DNA is also supported by other taxonomically distinct geminiviruses, including tomato yellow leaf curl virus, African cassava mosaic virus, and beet curly top virus. Therefore, this unique DNA satellite does not appear to strictly conform with the requirements that dictate the specificity of interaction of geminiviral replication-associated proteins with their cognate origins as predicted by the current model of geminivirus replication. PMID:9192696

  11. Organization of highly repetitive satellite DNA of two Cucurbitaceae species (Cucumis melo and Cucumis sativus).

    PubMed Central

    Hemleben, V; Leweke, B; Roth, A; Stadler, J

    1982-01-01

    The prominent satellites of the Cucurbitaceae Cucumis melo (melon) and Cucumis sativus (cucumber) have been characterized, in actinomycin/CsCl gradients where the satellite sequences can be separated from ribosomal, organelle, and main band DNA the location of the satellites is different indicating a different GC content. The purified satellite of C. melo is cut by HindIII into a repeat unit of 380 bp; AluI digestion gives rise to two bands (about 80 and 220 bp in size). The HindIII repeat unit if cloned into pBR325 exhibits new recognition sites for HpaII leaving two bands with 150 and 80 bp suggesting methylation of the C/CGG cutting site in the uncloned material. The restriction pattern indicates an internal sequence repeat within the 380 bp HindIII fragment. The C. sativus satellite is cut by AluI to a repeat unit of 180 bp showing no other recognition site for the restriction enzymes tested so far. About 10% sequence homology has been determined between the C. melo and C. sativus satellites by cross hybridization studies. A high methylation degree of cytosines has been measured for both satellites and the ribosomal DNA of C. sativus (about 30%). No transcription products of the C. melo satellite were found during seedling development. Images PMID:6278425

  12. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    PubMed Central

    Martins-Pinheiro, Marinalva; Marques, Regina CP; Menck, Carlos FM

    2007-01-01

    Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA), endonuclease III (nth), O6-methylguanine-DNA methyltransferase (ada gene), photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular aspects of the C. crescentus

  13. Inhibition of DNA topoisomerase II alpha gene expression by the p53 tumor suppressor.

    PubMed Central

    Wang, Q; Zambetti, G P; Suttle, D P

    1997-01-01

    DNA topoisomerase II (topo II) is an essential nuclear enzyme involved in major cellular functions such as DNA replication, transcription, recombination, and mitosis. While an elevated level of topo II alpha is associated with cell proliferation, wild-type (wt) p53 inhibits the expression of various growth-stimulatory genes. To determine if p53 downregulates topo II alpha gene expression, a murine cell line, (10)1val, that expresses a temperature-sensitive p53 was utilized. The (10)1val cells had significantly lower levels of topo II alpha mRNA and protein following incubation for 24 h at 32 degrees C (p53 with wt conformation) than at 39 degrees C (p53 with mutant conformation). The effect of p53 on the human topo II alpha gene promoter was determined by using luciferase reporter plasmids containing varying lengths of the topo II alpha promoter transiently cotransfected into p53-deficient (10)1 cells together with wt or mutant p53 expression plasmids. Transcription from the full-length (bp -557 to +90) topo II alpha promoter was decreased 15-fold by wt p53 in a concentration-dependent manner, whereas mutant p53 exerted much weaker inhibition. Consecutive deletion of the five inverted CCAAT elements (ICEs) from the topo II alpha promoter reduced both the basal promoter activity and wt p53-induced suppression. Transcription of the minimal promoter (-32 to +90), which contains no ICE, was slightly stimulated by wt or mutant p53 expression. When point mutations were introduced into the most proximal ICE (-68), the inhibitory effect of wt p53 was alleviated and stimulation of topo II alpha expression resulted. Our study suggests that wt p53 functions as a transcriptional repressor of topo II alpha gene expression, possibly through a functional interaction with specific ICEs. Inactivation of wt p53 may reduce normal regulatory suppression of topo II alpha and contribute to abortive cell cycle checkpoints, accelerated cell proliferation, and alterations in genomic

  14. Satellites

    SciTech Connect

    Burns, J.A.; Matthews, M.S.

    1986-01-01

    The present work is based on a conference: Natural Satellites, Colloquium 77 of the IAU, held at Cornell University from July 5 to 9, 1983. Attention is given to the background and origins of satellites, protosatellite swarms, the tectonics of icy satellites, the physical characteristics of satellite surfaces, and the interactions of planetary magnetospheres with icy satellite surfaces. Other topics include the surface composition of natural satellites, the cratering of planetary satellites, the moon, Io, and Europa. Consideration is also given to Ganymede and Callisto, the satellites of Saturn, small satellites, satellites of Uranus and Neptune, and the Pluto-Charon system.

  15. Flavonoid glycoside: a new inhibitor of eukaryotic DNA polymerase alpha and a new carrier for inhibitor-affinity chromatography.

    PubMed

    Mizushina, Yoshiyuki; Ishidoh, Tomomi; Kamisuki, Shinji; Nakazawa, Satoshi; Takemura, Masaharu; Sugawara, Fumio; Yoshida, Hiromi; Sakaguchi, Kengo

    2003-02-01

    Two flavonoid glycosides, kaempferol 3-O-(6"-acetyl)-beta-glucopyranoside (KAG) and quercetin 3-O-(6"-acetyl)-beta-glucopyranoside (QAG), were found to be inhibitors of eukaryotic DNA polymerases from a Japanese vegetable, Petasites japonicus. These compounds inhibited the activities of mammalian replicative DNA polymerases (i.e., pol alpha, delta, and epsilon), but not other pol beta, eta, kappa, and lambda activities. KAG was a stronger inhibitor and more selective to pol alpha than QAG. The IC(50) values of KAG for pol alpha, delta, and epsilon were 41, 164, and 127 microM, respectively. The pol alpha inhibition by KAG was non-competitive with respect to both the DNA template-primer and the dNTP substrate. KAG and QAG did not influence the activities of prokaryotic DNA polymerases or other mammalian DNA metabolic enzymes such as human immunodeficiency virus type 1 reverse transcriptase, human telomerase, human DNA topoisomerase I and II, T7 RNA polymerase, and bovine deoxyribonuclease I. Therefore, we concluded that these flavonoid glycosides are moderate replicative DNA polymerase inhibitors leaning more relatively to pol alpha, and could be used as chromatographic carriers to purify the DNA polymerases rather than cytotoxic agents. We then made a KAG-conjugated column such as the epoxy-activated Sepharose 6B. In the column, pol alpha was selectively adsorbed and eluted. PMID:12565887

  16. Replicating satellite RNA induces sequence-specific DNA methylation and truncated transcripts in plants.

    PubMed Central

    Wang, M B; Wesley, S V; Finnegan, E J; Smith, N A; Waterhouse, P M

    2001-01-01

    Tobacco plants were transformed with a chimeric transgene comprising sequences encoding beta-glucuronidase (GUS) and the satellite RNA (satRNA) of cereal yellow dwarf luteovirus. When transgenic plants were infected with potato leafroll luteovirus (PLRV), which replicated the transgene-derived satRNA to a high level, the satellite sequence of the GUS:Sat transgene became densely methylated. Within the satellite region, all 86 cytosines in the upper strand and 73 of the 75 cytosines in the lower strand were either partially or fully methylated. In contrast, very low levels of DNA methylation were detected in the satellite sequence of the transgene in uninfected plants and in the flanking nonsatellite sequences in both infected and uninfected plants. Substantial amounts of truncated GUS:Sat RNA accumulated in the satRNA-replicating plants, and most of the molecules terminated at nucleotides within the first 60 bp of the satellite sequence. Whereas this RNA truncation was associated with high levels of satRNA replication, it appeared to be independent of the levels of DNA methylation in the satellite sequence, suggesting that it is not caused by methylation. All the sequenced GUS:Sat DNA molecules were hypermethylated in plants with replicating satRNA despite the phloem restriction of the helper PLRV. Also, small, sense and antisense approximately 22 nt RNAs, derived from the satRNA, were associated with the replicating satellite. These results suggest that the sequence-specific DNA methylation spread into cells in which no satRNA replication occurred and that this was mediated by the spread of unamplified satRNA and/or its associated 22 nt RNA molecules. PMID:11214177

  17. An unusual polyanion from Physarum polycephalum that inhibits homologous DNA polymerase. alpha. in vitro

    SciTech Connect

    Fischer, H.; Erdmann, S.; Holler, E. )

    1989-06-13

    From extracts of microplasmodia of Physarum polycephalum and their culture medium, an unusual substance was isolated which inhibited homologous DNA polymerase {alpha} of this slime mold but not {beta}-like DNA polymerase and not heterologous DNA polymerases. Analysis, especially NMR spectroscopy, revealed the major component to be an anionic polyester of L-malic acid and the inhibition to be due to poly(L-malate) in binding reversibly to DNA polymerase {alpha}. The mode of inhibition is competitive with substrate DNA and follows an inhibition constant K{sub i} = 10 ng/mL. Inhibition is reversed in the presence of spermine, spermidine, poly(ethylene imine), and calf thymus histone H1. According to its ester nature, the inhibitor is slightly labile at neutral and instable at acid and alkaline conditions. Its largest size corresponds to a molecular mass of 40-50 kDa, but the bulk of the material after purification has lower molecular masses. The inhibitory activity depends on the polymer size and has a minimal size requirement.

  18. Characterization of two unrelated satellite DNA families in the Colorado potato beetle Leptinotarsa decemlineata (Coleoptera, Chrysomelidae).

    PubMed

    Lorite, Pedro; Torres, M Isabel; Palomeque, Teresa

    2013-10-01

    The Colorado potato beetle (Leptinotarsa decemlineata, family Chrysomelidae),a phytophagous insect, which feeds preferably on potatoes, constitutes a serious pest of this crop and causes extensive damage to tomatoes and egg plants. It has a remarkable ability to develop resistance quickly against insecticides and shows a diversified and flexible life history. Consequently, the control of this pest has become difficult, requiring the development of new alternative biotechnology-based strategies. Such strategies require a thorough knowledge of the beetle’s genome,including the repetitive DNA. Satellite DNA (stDNA), composed of long arrays of tandemly arranged repeat units, constitutes the major component of heterochromatin and is located mainly in centromeric and telomeric chromosomal regions. We have studied two different unrelated satellite-DNA families of which the consensus sequences were 295 and 109bp in length, named LEDE-I and LEDE-II, respectively.Both were AT-rich (70.8% and 71.6%, respectively). Predictive models of sequence-dependent DNA bending and the study of electrophoretic mobility on non-denaturing polyacrylamide gels have shown that the DNA was curved in both satellite-DNA families. Among other features, the chromosome localization of both stDNAs has been studied. In situ hybridization performed on meiotic and mitoticnuclei showed chromosomes, including the X chromosome, with zero, one, or two stDNAs. In recent years, it has been proposed that the repetitive DNA may play a key role in biological diversification processes. This is the first molecular and cytogenetic study conducted on L. decemlineata repetitive DNA and specifically on stDNA, which is one of the important constituents of eukaryotic genomes. PMID:23448367

  19. Anti-tumor effects of dehydroaltenusin, a specific inhibitor of mammalian DNA polymerase {alpha}

    SciTech Connect

    Maeda, Naoki; Kokai, Yasuo; Ohtani, Seiji; Sahara, Hiroeki; Kuriyama, Isoko; Kamisuki, Shinji; Takahashi, Shunya; Sakaguchi, Kengo; Sugawara, Fumio; Yoshida, Hiromi; Sato, Noriyuki; Mizushina, Yoshiyuki . E-mail: mizushin@nutr.kobegakuin.ac.jp

    2007-01-12

    In the screening of selective inhibitors of eukaryotic DNA polymerases (pols), dehydroaltenusin was found to be an inhibitor of pol {alpha} from a fungus (Alternaria tennuis). We succeeded in chemically synthesizing dehydroaltenusin, and the compound inhibited only mammalian pol {alpha} with IC{sub 50} value of 0.5 {mu}M, and did not influence the activities of other replicative pols such as pols {delta} and {epsilon}, but also showed no effect on pol {alpha} activity from another vertebrate, fish, or from a plant species. Dehydroaltenusin also had no influence on the other pols and DNA metabolic enzymes tested. The compound also inhibited the proliferation of human cancer cells with LD{sub 50} values of 38.0-44.4 {mu}M. In an in vivo anti-tumor assay on nude mice bearing solid tumors of HeLa cells, dehydroaltenusin was shown to be a promising suppressor of solid tumors. Histopathological examination revealed that increased tumor necrosis and decreased mitotic index were apparently detected by the compound in vivo. Therefore, dehydroaltenusin could be of interest as not only a mammalian pol {alpha}-specific inhibitor, but also as a candidate drug for anti-cancer treatment.

  20. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0-20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung's and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung's methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  1. Guidelines for internal validation of the HLA-DQ alpha DNA typing system.

    PubMed

    Wilson, R B; Ferrara, J L; Baum, H J; Shaler, R C

    1994-05-25

    Validation experiments were performed to evaluate the HLA-DQ alpha DNA typing system for forensic casework. Temperature profiles for two Perkin Elmer TC-1 Thermal Cyclers were measured, and the efficiency of the instruments was tested by amplifying a control sample (DQ alpha 1.2,4) susceptible to allelic drop-out. DNA extraction using chelex was compared to non-organic extraction, and the amplification and hybridization procedures were evaluated at extremes of time and temperature. With the protocol in place, samples exposed to stresses commonly encountered in forensic casework were typed to determine the flexibility of the system. Mixed samples of two different bloods and blood mixed with saliva were typed to determine the threshold at which mixtures could be resolved using the reverse dot blot method. Different storage conditions were evaluated using a set of control bloodstrains, and a set of 12 postmortem blood samples was typed repeatedly over the course of 5 months to determine the effects of natural degradation on the DQ alpha results. Finally, casework stains on a variety of substrates were typed. These experiments demonstrate the flexibility of the HLA-DQ alpha system. Based upon these results, a comprehensive quality assurance program was developed to ensure the integrity of typing results for casework. PMID:7927091

  2. Electronic Properties of DNA-Based Schottky Barrier Diodes in Response to Alpha Particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Amin, Yusoff Mohd

    2015-01-01

    Detection of nuclear radiation such as alpha particles has become an important field of research in recent history due to nuclear threats and accidents. In this context; deoxyribonucleic acid (DNA) acting as an organic semiconducting material could be utilized in a metal/semiconductor Schottky junction for detecting alpha particles. In this work we demonstrate for the first time the effect of alpha irradiation on an Al/DNA/p-Si/Al Schottky diode by investigating its current-voltage characteristics. The diodes were exposed for different periods (0–20 min) of irradiation. Various diode parameters such as ideality factor, barrier height, series resistance, Richardson constant and saturation current were then determined using conventional, Cheung and Cheung’s and Norde methods. Generally, ideality factor or n values were observed to be greater than unity, which indicates the influence of some other current transport mechanism besides thermionic processes. Results indicated ideality factor variation between 9.97 and 9.57 for irradiation times between the ranges 0 to 20 min. Increase in the series resistance with increase in irradiation time was also observed when calculated using conventional and Cheung and Cheung’s methods. These responses demonstrate that changes in the electrical characteristics of the metal-semiconductor-metal diode could be further utilized as sensing elements to detect alpha particles. PMID:26007733

  3. Functional association of poly(ADP-ribose) polymerase with DNA polymerase alpha-primase complex: a link between DNA strand break detection and DNA replication.

    PubMed Central

    Dantzer, F; Nasheuer, H P; Vonesch, J L; de Murcia, G; Ménissier-de Murcia, J

    1998-01-01

    Poly(ADP-ribose) polymerase (PARP) is an element of the DNA damage surveillance network evolved by eukaryotic cells to cope with numerous environmental and endogenous genotoxic agents. PARP has been found to be involved in vivo in both cell proliferation and base excision repair of DNA. In this study the interaction between PARP and the DNA polymerase alpha-primase tetramer has been examined. We provide evidence that in proliferating cells: (i) PARP is physically associated with the catalytic subunit of the DNA polymerase alpha-primase tetramer, an association confirmed by confocal microscopy, demonstrating that both enzymes are co-localized at the nuclear periphery of HeLa cells; (ii) this interaction requires the integrity of the second zinc finger of PARP and is maximal during the S and G2/M phases of the cell cycle; (iii) PARP-deficient cells derived from PARP knock-out mice exhibited reduced DNA polymerase activity, compared with the parental cells, a reduction accentuated following exposure to sublethal doses of methylmethanesulfonate. Altogether, the present results strongly suggest that PARP participates in a DNA damage survey mechanism implying its nick-sensor function as part of the control of replication fork progression when breaks are present in the template. PMID:9518481

  4. Phylogenetic relationships and the primitive X chromosome inferred from chromosomal and satellite DNA analysis in Bovidae.

    PubMed

    Chaves, Raquel; Guedes-Pinto, Henrique; Heslop-Harrison, John S

    2005-10-01

    The early phylogeny of the 137 species in the Bovidae family is difficult to resolve; knowledge of the evolution and relationships of the tribes would facilitate comparative mapping, understanding chromosomal evolution patterns and perhaps assist breeding and domestication strategies. We found that the study of the presence and organization of two repetitive DNA satellite sequences (the clone pOaKB9 from sheep, a member of the 1.714 satellite I family and the pBtKB5, a 1.715 satellite I clone from cattle) on the X and autosomal chromosomes by in situ hybridization to chromosomes from 15 species of seven tribes, was informative. The results support a consistent phylogeny, suggesting that the primitive form of the X chromosome is acrocentric, and has satellite I sequences at its centromere. Because of the distribution of the ancient satellite I sequence, the X chromosome from the extant Tragelaphini (e.g. oryx), rather than Caprini (sheep), line is most primitive. The Bovini (cow) and Tragelaphini tribes lack the 1.714 satellite present in the other tribes, and this satellite is evolutionarily younger than the 1.715 sequence, with absence of the 1.714 sequence being a marker for the Bovini and Tragelaphini tribes (the Bovinae subfamily). In the other tribes, three (Reduncini, Hippotragini and Aepycerotini) have both 1.714 and 1.715 satellite sequences present on both autosomes and the X chromosome. We suggest a parallel event in two lineages, leading to X chromosomes with the loss of 1.715 satellite from the Bovini, and the loss of both 1.714 and 1.715 satellites in a monophyletic Caprini and Alcelaphini lineage. The presence and X chromosome distribution of these satellite sequences allow the seven tribes to be distributed to four groups, which are consistent with current diversity estimates, and support one model to resolve points of separation of the tribes. PMID:16191610

  5. Fabry disease: isolation of a cDNA clone encoding human alpha-galactosidase A.

    PubMed Central

    Calhoun, D H; Bishop, D F; Bernstein, H S; Quinn, M; Hantzopoulos, P; Desnick, R J

    1985-01-01

    Fabry disease is an X-linked inborn error of metabolism resulting from the deficient activity of the lysosomal hydrolase, alpha-galactosidase A (alpha-Gal A; alpha-D-galactoside galactohydrolase, EC 3.2.1.22). To investigate the structure, organization, and expression of alpha-Gal A, as well as the nature of mutations in Fabry disease, a clone encoding human alpha-Gal A was isolated from a lambda gt11 human liver cDNA expression library. To facilitate screening, an improved affinity purification procedure was used to obtain sufficient homogeneous enzyme for production of monospecific antibodies and for amino-terminal and peptide microsequencing. On the basis of an amino-terminal sequence of 24 residues, two sets of oligonucleotide mixtures were synthesized corresponding to adjacent, but not overlapping, amino acid sequences. In addition, an oligonucleotide mixture was synthesized based on a sequence derived from an alpha-Gal A internal tryptic peptide isolated by reversed-phase HPLC. Four positive clones were initially identified by antibody screening of 1.4 X 10(7) plaques. Of these, only one clone (designated lambda AG18) demonstrated both antibody binding specificity by competition studies using homogeneous enzyme and specific hybridization to synthetic oligonucleotide mixtures corresponding to amino-terminal and internal amino acid sequences. Nucleotide sequencing of the 5' end of the 1250-base-pair EcoRI insert of clone lambda AG18 revealed an exact correspondence between the predicted and known amino-terminal amino acid sequence. The insert of clone lambda AG18 appears to contain the full-length coding region of the processed, enzymatically active alpha-Gal A, as well as sequences coding for five amino acids of the amino-terminal propeptide, which is posttranslationally cleaved during enzyme maturation. Images PMID:2997789

  6. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    PubMed Central

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  7. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison.

    PubMed

    Kato, Mikio

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  8. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences

    SciTech Connect

    Shaul, Y.; Garcia, P.D.; Schonberg, S.; Rutter, W.J.

    1986-09-01

    The authors previously reported the cloning and detailed analysis of the integrated hepatitis B virus sequences in a human hepatoma cell line. They report here the integration of at least one of hepatitis B virus at human satellite DNA sequences. The majority of the cellular sequences identified by this satellite were organized as a multimeric composition of a 0.6-kilobase EcoRI fragment. This clone hybridized in situ almost exclusively to the centromeric heterochromatin of chromosomes 1 and 16 and to a lower extent to chromosome 2 and to the heterochromatic region of the Y chromosome. The immediate flanking host sequence appeared as a hierarchy of repeating units which were almost identical to a previously reported human satellite III DNA sequence.

  9. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress

    PubMed Central

    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica

    2015-01-01

    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223

  10. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. PMID:24769180

  11. Biochemical properties of the stimulatory activity of DNA polymerase alpha by the hyper-phosphorylated retinoblastoma protein.

    PubMed

    Takemura, Masaharu

    2002-06-01

    Previously, my colleagues and I have reported that the immunopurified hyper-phosphorylated retinoblastoma protein (ppRb) stimulates the activity of DNA polymerase alpha. I describe here the biochemical characteristics of this stimulatory activity. DNA polymerase alpha-stimulatory activity of ppRb was most remarkable when using activated DNA as a template-primer, rather than using poly(dT)-(rA)(10), poly(dA)-(dT)(12-18), and so on. Kinetic analysis showed that there was no significant difference in K(m) value for deoxyribonucleotides of DNA polymerase alpha in the presence of ppRb. Adding ppRb resulted in the overcoming pause site on the template, but did not affect the rate of misincorporation of incorrect deoxyribonucleotides. By adding ppRb, the optimal concentration of template-primer was shifted to a higher region, but not using M13 singly primed DNA. The ppRb seemed to assist the process that DNA polymerase alpha changed its conformation resulting in appropriate enzyme activity. These results suggest that ppRb affects both template-primer and DNA polymerase alpha and makes appropriate circumstances for the enzyme reaction. PMID:12049795

  12. Synthesis of DNA containing the simian virus 40 origin of replication by the combined action of DNA polymerases alpha and delta.

    PubMed Central

    Lee, S H; Eki, T; Hurwitz, J

    1989-01-01

    Proliferating-cell nuclear antigen (PCNA) mediates the replication of simian virus 40 (SV40) DNA by reversing the effects of a protein that inhibits the elongation reaction. Two other protein fractions, activator I and activator II, were also shown to play important roles in this process. We report that activator II isolated from HeLa cell extracts is a PCNA-dependent DNA polymerase delta that is required for efficient replication of DNA containing the SV40 origin of replication. PCNA-dependent DNA polymerase delta on a DNA singly primed phi X174 single-stranded circular DNA template required PCNA, a complex of the elongation inhibitor and activator I, and the single-stranded DNA-binding protein essential for SV40 DNA replication. DNA polymerase delta, in contrast to DNA polymerase alpha, hardly used RNA-primed DNA templates. These results indicate that both DNA polymerase alpha and delta are involved in SV40 DNA replication in vitro and their activity depends on PCNA, the elongation inhibitor, and activator I. Images PMID:2571990

  13. Insights on genome size evolution from a miniature inverted repeat transposon driving a satellite DNA.

    PubMed

    Scalvenzi, Thibault; Pollet, Nicolas

    2014-12-01

    The genome size in eukaryotes does not correlate well with the number of genes they contain. We can observe this so-called C-value paradox in amphibian species. By analyzing an amphibian genome we asked how repetitive DNA can impact genome size and architecture. We describe here our discovery of a Tc1/mariner miniature inverted-repeat transposon family present in Xenopus frogs. These transposons named miDNA4 are unique since they contain a satellite DNA motif. We found that miDNA4 measured 331 bp, contained 25 bp long inverted terminal repeat sequences and a sequence motif of 119 bp present as a unique copy or as an array of 2-47 copies. We characterized the structure, dynamics, impact and evolution of the miDNA4 family and its satellite DNA in Xenopus frog genomes. This led us to propose a model for the evolution of these two repeated sequences and how they can synergize to increase genome size. PMID:25193611

  14. Is Radon Emission in Caves Causing Deletions in Satellite DNA Sequences of Cave-Dwelling Crickets?

    PubMed Central

    Allegrucci, Giuliana; Sbordoni, Valerio; Cesaroni, Donatella

    2015-01-01

    The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae) sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA). Radon concentration in the analyzed caves ranged from 221 to 26000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration. PMID:25822625

  15. Satellite DNA from the brine shrimp Artemia affects the expression of a flanking gene in yeast.

    PubMed

    Maiorano, D; Cece, R; Badaracco, G

    1997-04-11

    We have previously revealed that in the brine shrimp Artemia franciscana an AluI DNA family of repeats, 113 bp in length, is the major component of the constitutive heterochromatin and that this repetitive DNA shows a stable curvature that confers a solenoidal geometry on the double helix in vitro. It was suggested that this particular structure may play a relevant role in determining the condensation of the heterochromatin. In this report we have cloned hexamers of highly-repetitive sequence (AluI-satellite DNA) in proximity to a yeast lacZ reporter gene on a plasmid. We find that the expression of the reporter gene is affected by the presence of this DNA in a dose- and orientation-dependent manner in the yeast, S. cerevisiae. We show that this effect is not dependent on under-replication or re-arrangements of the repetitive DNA in the cell but is due to decreased expression of the reporter gene. Our results indicate that the AluI-satellite DNA of Artemia per se is able to influence gene expression. PMID:9161405

  16. Unusual chromosomal distribution of a major satellite DNA from Discoglossus pictus (Amphibia, Anura).

    PubMed

    Amor, N; Odierna, G; Chinali, G; Said, K; Picariello, O

    2009-01-01

    A new highly abundant satellite DNA from Discoglossus pictus (Dp-sat1) was isolated and characterized. The repetitive unit (0.51 kb) has 2 HindIII sites and only one SpeI site: digestion of genomic DNA with HindIII produces 3 fragments: HA (0.17 kb), HB (0.34 kb), and HC = HA + HB (0.51 kb), while digestion with SpeI produces the whole repetitive unit (0.51 kb) that contains both HindIII sites. Sequence analysis of cloned repeats indicates an average A + T content of 71%, with many A- and T-runs. Southern blot analysis shows an arrangement of multiple bands of the 0.51 kb monomer in SpeI-digested DNA, while HindIII-digested DNA shows a ladder composed of all the possible combinations of the 3 digested fragments. Quantitative dot-blot indicates that Dp-sat1 accounts for about 6% of the D. pictus genome: this value represents about 1.5 x 10(6) copies of repetitive units per nucleus. This satellite DNA is also a major repetitive DNA in 4 other Discoglossus species, in which the repetitive unit presents the same size and restriction sites except in D. montalentii where it contains a unique HindIII site. This satellite DNA was absent in all the other tested archaeo- and neo-bratrachian species, as well as non-amphibian species. Fluorescent in situ hybridization (FISH) analysis shows that Dp-sat1 is localized only in peri- and/or para-centromeric areas of the 7 small chromosome pairs, while no labeling was observed in the 7 large chromosome pairs. Remarkably, Dp-sat1 heterochromatin is found only at one pole of the nucleus, suggesting that during interphase all 7 small chromosome pairs are located in the same nuclear region. PMID:20110657

  17. Cloning and expression of a human kidney cDNA for an /alpha//sub 2/-adrenergic receptor subtype

    SciTech Connect

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-09-01

    An /alpha//sub 2/-adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet /alpha//sub 2/-adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet /alpha//sub 2/-adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the /alpha//sub 2/-adrenergic ligand (/sup 3/H)rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the /alpha//sub 2/B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet /alpha//sub 2/-adrenergic receptor (/alpha//sub 2/A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective /alpha/-adrenergic ligands.

  18. Sanfilippo syndrome type B: cDNA and gene encoding human {alpha}-N-acetylglucosaminidase

    SciTech Connect

    Zhao, H.G.; Lopez, R.; Rennecker, J.

    1994-09-01

    Deficiency of the lysosomal enzyme {alpha}-N-acetlyglucosaminidase underlies the type B Sanfilippo syndrome (MPS III B), a mucopolysaccharide storage disease with profound neurologic deterioration. We are acquiring tools to study the molecular basis of the disorder. The enzyme was purified from bovine testis; after ConA-, DEAE- and phenyl-Sepharose chromatography, it was subjected to SDS-PAGE without preheating. Of two bands of activity detected on the gel, 170 kDa and 87 kDa, the larger one, which coincided with a well-defined Coomassie blue band, was selected for sequence analysis. Degenerate 17-base oligonucleotides, corresponding to the ends of an internal 23 amino acid sequence, were used for RT-PCR of RNA from human fibroblasts. A 41-mer was synthesized from the sequence of the RT-PCR product and used to screen a human testis cDNA library. A number of cDNA inserts were isolated, all lacking the 5{prime} end and none longer than 1.7 kb. An additional 300 bp segment has been obtained by RACE. The cDNA sequence accounts for 9 of 11 peptides, allowing for species difference. Northern analysis of fibroblast RNA with a 1.5 kb cDNA probe showed the presence of a 3 kb mRNA; marked deficiency of this mRNA in two MPS III B fibroblast lines confirmed the authenticity of the cloned cDNA. While no homologous amino acid sequence has been found in a search of GenBank, the nucleotide sequence (interrupted by 4 introns) is present in a flanking region upstream of an unrelated gene on chromosome 17q11-21 (human 17{beta}-hydroxysteroid dehydrogenase). This must therefore be the chromosomal locus of the {alpha}-N-acetylglucosaminidase gene and of MPS III B.

  19. Differential spreading of HinfI satellite DNA variants during radiation in Centaureinae

    PubMed Central

    Quesada del Bosque, María Ester; López-Flores, Inmaculada; Suárez-Santiago, Víctor N.; Garrido-Ramos, Manuel A.

    2013-01-01

    Background and Aims Subtribe Centaureinae appears to be an excellent model group in which to analyse satellite DNA and assess the influence that the biology and/or the evolution of different lineages have had on the evolution of this class of repetitive DNA. Phylogenetic analyses of Centaureinae support two main phases of radiation, leading to two major groups of genera of different ages. Furthermore, different modes of evolution are observed in different lineages, reflected by morphology and DNA sequences. Methods The sequences of 502 repeat units of the HinfI satellite DNA family from 38 species belonging to ten genera of Centaureinae were isolated and compared. A phylogenetic reconstruction was carried out by maximum likelihood and Bayesian inference. Key Results Up to eight different HinfI subfamilies were found, based on the presence of a set of diagnostic positions given by a specific mutation shared by all the sequences of one group. Subfamilies V–VIII were mostly found in older genera (first phase of radiation in the subtribe, late Oligocene–Miocene), although some copies of these types of repeats were also found in some species of the derived genera. Subfamilies I–IV spread mostly in species of the derived clade (second phase of radiation, Pliocene to Pleistocene), although repeats of these subfamilies exist in older species. Phylogenetic trees did not group the repeats by taxonomic affinity, but sequences were grouped by subfamily provenance. Concerted evolution was observed in HinfI subfamilies spread in older genera, whereas no genetic differentiation was found between species, and several subfamilies even coexist within the same species, in recently radiated groups or in groups with a history of recurrent hybridization of lineages. Conclusions The results suggest that the eight HinfI subfamilies were present in the common ancestor of Centaureinae and that each spread differentially in different genera during the two main phases of radiation

  20. A novel satellite DNA isolated in Pecten jacobaeus shows high sequence similarity among molluscs.

    PubMed

    Petraccioli, Agnese; Odierna, Gaetano; Capriglione, Teresa; Barucca, Marco; Forconi, Mariko; Olmo, Ettore; Biscotti, Maria Assunta

    2015-10-01

    The aim of this work is to investigate the sequence conservation and the evolution of repeated DNA in related species. Satellite DNA is a component of eukaryotic genomes and is made up of tandemly repeated sequences. These sequences are affected by high rates of mutation that lead to the occurrence of species-specific satellite DNAs, which are different in terms of both quantity and quality. In this work, a novel repetitive DNA family, named PjHhaI sat, is described in Pecten jacobaeus. The quantitative analyses revealed a different abundance of this element in the molluscan species investigated in agreement with the "library hypothesis" even if, in this case, at a high taxonomic level. In addition, the qualitative analysis demonstrated an astonishing sequence conservation not only among scallops but also in six other molluscan species belonging to three classes. These findings suggest that the PjHhaI sat may be considered as the most ancients of DNA described so far, which remained "frozen" during molluscan evolution. The widespread distribution of this sat DNA in molluscs as well as its long evolutionary preservation open up questions on the functional role of this element. A future challenge might be the identification of proteins or molecules which interact with the PjHhaI sat. PMID:25832354

  1. Representative and efficient cloning of satellite DNAs based on PFGE pre-fractionation of restriction digests of genomic DNA.

    PubMed

    Burgtorf, C; Bünemann, H

    1994-06-01

    Using DNA from Drosophila hydei KUN-DH-33 cells we describe an efficient method for selective and representative cloning of complex mixtures of satellite DNAs from eukaryotic genomes. Effective separation of satellite DNA from the bulk of all other sequences it obtained by fractionation of high molecular weight DNA by PFGE after treating it with '6 bp' restriction enzymes. Since extended clusters of tandemly arranged, so called simple sequence, repeats are inert to cleavage by most '6 bp' restriction enzymes the DNA fraction recovered from the gel region > 50 kb is mainly a mixture of satellites. Efficient and representative cloning of this DNA is performed by sonication to an average size of 50-500 bp and ligation of the blunt ended DNA fragments into the Bluescript vector pBS. PMID:7963251

  2. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978. PMID:27433591

  3. Characterization of Satellite DNA from Three Marine Dinoflagellates (Dinophyceae): Glenodinium sp. and Two Members of the Toxic Genus, Protogonyaulax 1

    PubMed Central

    Boczar, Barbara A.; Liston, John; Cattolico, Rose Ann

    1991-01-01

    Using CsCl-Hoechst dye or CsCl-ethidium bromide gradients, satellite and nuclear DNAs were separated and characterized in three marine dinoflagellates: Glenodinium sp., and two toxic dinoflagellates, Protogonyaulax tamarensis and Protogonyaulax catenella. In all three dinoflagellates, the lowest density fraction, satellite DNA1, hybridized to chloroplast genes derived from terrestrial plants and/or other algae. Dinoflagellate chloroplast DNAs exhibited molecular sizes of 114 to 125 kilobase pairs, which is consistent with plastid sizes determined for other chromophytic algae (120-150 kilobase pairs). Mitochondrial DNA was not resolved from nuclear DNA in this system. Two additional satellite DNAs, satellite DNA2 and satellite DNA3, recovered from P. tamarensis and P. catenella were similar to one another, both within and between species, when characterized by restriction enzyme analysis. These satellites were 85 to 95 kilobase pairs in size, and exhibited restriction fragments that hybridized to yeast nuclear ribosomal RNA genes. Restriction enzyme analyses and DNA hybridization studies of cpDNA document that the two Protogonyaulax isolates are not evolutionarily identical. ImagesFigure 1Figure 2Figure 3Figure 4 PMID:16668443

  4. A novel satellite DNA sequence in the Peromyscus genome (PMSat): Evolution via copy number fluctuation.

    PubMed

    Louzada, Sandra; Vieira-da-Silva, Ana; Mendes-da-Silva, Ana; Kubickova, Svatava; Rubes, Jiri; Adega, Filomena; Chaves, Raquel

    2015-11-01

    Satellite DNAs (satDNA) are tandemly arrayed repeated sequences largely present in eukaryotic genomes, which play important roles in genome evolution and function, and therefore, their analysis is vital. Here, we describe the isolation of a novel satellite DNA family (PMSat) from the rodent Peromyscus eremicus (Cricetidae, Rodentia), which is located in pericentromeric regions and exhibits a typical satellite DNA genome organization. Orthologous PMSat sequences were isolated and characterized from three species belonging to Cricetidae: Cricetus cricetus, Phodopus sungorus and Microtus arvalis. In these species, PMSat is highly conserved, with the absence of fixed species-specific mutations. Strikingly, different numbers of copies of this sequence were found among the species, suggesting evolution by copy number fluctuation. Repeat units of PMSat were also found in the Peromyscus maniculatus bairdii BioProject, but our results suggest that these repeat units are from genome regions outside the pericentromere. The remarkably high evolutionary sequence conservation along with the preservation of a few numbers of copies of this sequence in the analyzed genomes may suggest functional significance but a different sequence nature/organization. Our data highlight that repeats are difficult to analyze due to the limited tools available to dissect genomes and the fact that assemblies do not cover regions of constitutive heterochromatin. PMID:26103000

  5. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat.

    PubMed

    Koo, Dal-Hoe; Tiwari, Vijay K; Hřibová, Eva; Doležel, Jaroslav; Friebe, Bernd; Gill, Bikram S

    2016-01-01

    Fluorescence in situ hybridization (FISH) provides an efficient system for cytogenetic analysis of wild relatives of wheat for individual chromosome identification, elucidation of homoeologous relationships, and for monitoring alien gene transfers into wheat. This study is aimed at developing cytogenetic markers for chromosome identification of wheat and Aegilops geniculata (2n = 4x = 28, UgUgMgMg) using satellite DNAs obtained from flow-sorted chromosome 5Mg. FISH was performed to localize the satellite DNAs on chromosomes of wheat and selected Aegilops species. The FISH signals for satellite DNAs on chromosome 5Mg were generally associated with constitutive heterochromatin regions corresponding to C-band-positive chromatin including telomeric, pericentromeric, centromeric, and interstitial regions of all the 14 chromosome pairs of Ae. geniculata. Most satellite DNAs also generated FISH signals on wheat chromosomes and provided diagnostic chromosome arm-specific cytogenetic markers that significantly improved chromosome identification in wheat. The newly identified satellite DNA CL36 produced localized Mg genome chromosome-specific FISH signals in Ae. geniculata and in the M genome of the putative diploid donor species Ae. comosa subsp. subventricosa but not in Ae. comosa subsp. comosa, suggesting that the Mg genome of Ae. geniculata was probably derived from subsp. subventricosa. PMID:27403741

  6. MULTI-ELEMENT ABUNDANCE MEASUREMENTS FROM MEDIUM-RESOLUTION SPECTRA. IV. ALPHA ELEMENT DISTRIBUTIONS IN MILKY WAY SATELLITE GALAXIES

    SciTech Connect

    Kirby, Evan N.; Cohen, Judith G.; Smith, Graeme H.; Guhathakurta, Puragra; Sohn, Sangmo Tony

    2011-02-01

    We derive the star formation histories of eight dwarf spheroidal (dSph) Milky Way satellite galaxies from their alpha element abundance patterns. Nearly 3000 stars from our previously published catalog comprise our data set. The average [{alpha}/Fe] ratios for all dSphs follow roughly the same path with increasing [Fe/H]. We do not observe the predicted knees in the [{alpha}/Fe] versus [Fe/H] diagram, corresponding to the metallicity at which Type Ia supernovae begin to explode. Instead, we find that Type Ia supernova ejecta contribute to the abundances of all but the most metal-poor ([Fe/H] < -2.5) stars. We have also developed a chemical evolution model that tracks the star formation rate, Types II and Ia supernova explosions, and supernova feedback. Without metal enhancement in the supernova blowout, massive amounts of gas loss define the history of all dSphs except Fornax, the most luminous in our sample. All six of the best-fit model parameters correlate with dSph luminosity but not with velocity dispersion, half-light radius, or Galactocentric distance.

  7. Anatomy of herpes simplex virus DNA VII. alpha-RNA is homologous to noncontiguous sites in both the L and S components of viral DNA.

    PubMed Central

    Jones, P C; Hayward, G S; Roizman, B

    1977-01-01

    Previous reports from this laboratory (Honess and Roizman, 1974) have operationally defined alpha polypeptides as the viral proteins that are synthesized first in HEp-2 cells treated with cycloheximide from the time of infection with herpes simplex virus type 1 until the withdrawal of the drug 12 to 15 h after infection. It has also been shown that the viral RNA (designated alpha RNA) that accumulates in the cytoplasm during cycloheximide treatment and on polyribosomes immediately upon withdrawal of the drug is homologous to 10 to 12% of viral DNA, whereas the viral RNA accumulating in the cytoplasm of untreated cells at 8 to 14 h after infection is homologous to 43% of viral DNA (Kozak and Roizman, 1974). In the present study, alpha RNA and cytoplasmic RNA extracted from untreated cells 8 h after infection were each hybridized in liquid to in vitro labeled restriction endonuclease fragments generated by cleavage of herpes simplex virus type 1 DNA with Hsu I, with Bgl II, and with both enzymes simultaneously. The data show that only a subset of the fragments hybridized to alpha RNA, and these are scattered within both the L and S components of the DNA. There are at least five noncontiguous regions in the DNA homologous to alpha RNA; two of these are located partially within the reiterated sequences in the S component. All fragments tested hybridized more extensively with 8-h cytoplasmic RNA than with alpha RNA. Four adjacent fragments, corresponding to 30% of the DNA and mapping within the L component, hybridized exclusively with the cytoplasmic RNA extracted from cells 8 h after infection. Images PMID:189068

  8. cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

    SciTech Connect

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-05-15

    cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.

  9. Target practice: aiming at satellite repeats with DNA minor groove binders.

    PubMed

    Susbielle, Guillaume; Blattes, Roxane; Brevet, Vanessa; Monod, Caroline; Käs, Emmanuel

    2005-07-01

    Much progress has been made in recent years in developing small molecules that target the minor groove of DNA. Striking advances have led to the design of synthetic molecules that recognize specific DNA sequences with affinities comparable to those of eukaryotic transcription factors. This makes it feasible to modulate or inhibit DNA/protein interactions in vivo, a major step towards the development of general strategies of anti-gene therapy. Examples from anti-parasitic drugs also suggest that synthetic molecules can affect a variety of cellular functions crucial to cell viability by more generally targeting vast portions of genomes based on their biased base composition. This provides a rationale for developing approaches based on selective interactions with broad genomic targets such as satellite repeats that are associated with structural or architectural components of chromatin essential for cellular proliferation. Using examples drawn from the Drosophila melanogaster model system, we review here the use of synthetic polyamides or diamidines that bind the DNA minor groove and can be used as highly selective agents capable of interfering with specific protein/DNA interactions that occur in A+T-rich repeated sequences that constitute a significant portion of eukaryotic genomes. The satellite localization of cellular proteins that bind the minor groove of DNA via domains such as the AT hook motif is highly sensitive to these molecules. A major consequence of the competition between these proteins and their synthetic mimics is an alteration of the nuclear localization and function of proteins such as topoisomerase II, a major target of anti-cancer drugs. PMID:16101491

  10. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability.

    PubMed

    Lambert, Muriel W

    2016-09-01

    Non-erythroid alpha spectrin (αIISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. αIISp's interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear αIISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in maintenance of genomic stability following ICL damage to DNA. We have proposed that αIISp acts as a scaffold aiding to recruit repair proteins to sites of damage. This involvement of αIISp in ICL repair and telomere maintenance after ICL damage represents new and critical functions for αIISp. These studies have led to development of a model for the role of αIISp in DNA ICL repair. They have been aided by examination of cells from patients with Fanconi anemia (FA), a repair-deficient genetic disorder in which a deficiency in αIISp leads to defective ICL repair in genomic and telomeric DNA, telomere dysfunction, and chromosome instability following DNA ICL damage. We have shown that loss of αIISp in FA cells is due to increased breakdown by the protease, µ-calpain. Importantly, we have demonstrated that this deficiency can be corrected by knockdown of µ-calpain and restoring αIISp levels to normal. This corrects a number of the phenotypic deficiencies in FA after ICL damage. These studies suggest a new and unexplored direction for therapeutically restoring genomic stability in FA cells and for correcting numerous phenotypic deficiencies occurring after ICL damage. Developing a more in-depth understanding of the importance of the interaction of αIISp with other nuclear proteins could significantly enhance our knowledge of the consequences of loss of αIISp on critical nuclear processes. PMID:27480253

  11. Stable yeast transformants that secrete functional. cap alpha. -amylase encoded by cloned mouse pancreatic cDNA

    SciTech Connect

    Filho, S.A.; Galembeck, E.V.; Faria, J.B.; Frascino, A.C.S.

    1986-04-01

    Mouse pancreatic ..cap alpha..-amylase complementary DNA was inserted into a yeast shuttle vector after the Saccharomyces cerevisiae MF..cap alpha..1 promoter and secretion signals coding sequences. When transformed with the recombinant plasmid, S. cerevisiae cells were able to synthesize and secrete functional ..cap alpha..-amylase, efficiently hydrolyzing starch present in the culture medium. Stable amylolytic cells were obtained from different yeast strains. This work represents a significant step towards producing yeast that can convert starchy materials directly to ethanol.

  12. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH)

    PubMed Central

    Cortés-Gutiérrez, Elva I.; Ortíz-Hernández, Brenda L.; Dávila-Rodríguez, Martha I.; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2013-01-01

    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1. PMID:23429197

  13. Identification of cDNA encoding an additional. alpha. subunit of a human GTP-binding protein: Expression of three. alpha. sub i subtypes in human tissues and cell lines

    SciTech Connect

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J. )

    1988-06-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of {alpha}, {beta}, and {gamma} subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of {alpha}{sub i} that is different from the human {alpha}{sub i} subtypes previously reported. {alpha}{sub i} is the {alpha} subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the {alpha}{sub i-3} subtype of G proteins on the basis of its similarity to other {alpha}{sub i}-like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human {alpha}{sub i} ({alpha}{sub i-1} and {alpha}{sub i-2}) in a variety of human fetal tissues and in human cell lines. All three {alpha}{sub i} subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of {alpha}{sub i-1} expression. mRNA for {alpha}{i-1} is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of {alpha}{sub i-1} genes may permit characterization of distinct physiological roles for this {alpha}{sub i} subunit. mRNA for {alpha}{sub i-2} and {alpha}{sub i-3} was found in all the primary and transformed cell lines tested. Thus, some cells contain all three {alpha}{sub i} subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar {alpha} proteins.

  14. Hyperhomocysteinemia inhibits satellite cell regenerative capacity through p38 alpha/beta MAPK signaling.

    PubMed

    Veeranki, Sudhakar; Lominadze, David; Tyagi, Suresh C

    2015-07-15

    Chronic failure in maintenance and regeneration of skeletal muscles leads to lower muscle mass (sarcopenia), muscle weakness, and poor response to injury. Evidence suggests that aberrant p38 MAPK signaling undermines the repair process after injury in aged mice. Previous studies have shown that hyperhomocysteinemia (HHcy) has been associated with muscle weakness and lower than normal body weights. However, whether or not HHcy condition also compromises skeletal muscle regenerative capabilities is not clear. In the current study, we show that CBS-/+ mice, a model for HHcy condition, exhibited compromised regenerative function and cell proliferation upon injury. However, there was no significant difference in Pax7 expression levels in the satellite cells from CBS-/+ mouse skeletal muscles. Interestingly, the satellite cells from CBS-/+ mice not only exhibited diminished in vitro proliferative capabilities, but also there was heightened oxidative stress. In addition, there was enhanced p38 MAPK activation as well as p16 and p21 expression in the CBS-/+ mouse satellite cells. Moreover, the C2C12 myoblasts also exhibited higher p38 MAPK activation and p16 expression upon treatment with homocysteine in addition to enhanced ROS presence. Tissue engraftment potential and regeneration after injury were restored to some extent upon treatment with the p38-MAPK inhibitor, SB203580, in the CBS-/+ mice. These results together suggest that HHcy-induced diminished satellite cell proliferation involves excessive oxidative stress and p38 MAPK signaling. Our study further proposes that HHcy is a potential risk factor for elderly frailty, and need to be considered as a therapeutic target while designing the alleviation interventions/postinjury rehabilitation measures for adults with HHcy. PMID:25980021

  15. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-01-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors. PMID:27160654

  16. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    NASA Astrophysics Data System (ADS)

    Al-Ta’Ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-05-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors.

  17. Humidity influenced capacitance and resistance of an Al/DNA/Al Schottky diode irradiated by alpha particles

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2016-01-01

    Deoxyribonucleic acid or DNA based sensors, especially as humidity and alpha particle sensors have become quite popular in recent times due to flexible and highly optimizable nature of this fundamental biomaterial. Application of DNA electronics allow for more sensitive, accurate and effective sensors to be developed and fabricated. In this work, we examined the effect of different humidity conditions on the capacitive and resistive response of Aluminum (Al)/DNA/Al Schottky barrier structure when bombarded by time-dependent dosages of alpha particles. Based on current-voltage profiles, which demonstrated rectifying behaviours, Schottky diode parameters such as ideality factor, barrier height and series resistance was calculated. Results observed generally pointed towards a decrease in the resistance value from the pristine to the radiated structures. It was also demonstrated that under the effect of humidity, the capacitance of the DNA thin film increased from 0.05894 to 92.736 nF, with rising relative humidity level. We also observed the occurrence of the hypersensitivity phenomena after alpha irradiation between 2 to 4 min by observing a drop in the series resistance, crucial in the study of DNA damage and repair mechanisms. These observations may also suggest the exciting possibility of utilizing Al/DNA/Al Schottky diodes as potentially sensitive humidity sensors. PMID:27160654

  18. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.

    PubMed

    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  19. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús

    2016-01-01

    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  20. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae).

    PubMed

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E; Breitbart, Mya

    2016-02-01

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640-750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity. PMID:26848679

  1. Begomovirus-Associated Satellite DNA Diversity Captured Through Vector-Enabled Metagenomic (VEM) Surveys Using Whiteflies (Aleyrodidae)

    PubMed Central

    Rosario, Karyna; Marr, Christian; Varsani, Arvind; Kraberger, Simona; Stainton, Daisy; Moriones, Enrique; Polston, Jane E.; Breitbart, Mya

    2016-01-01

    Monopartite begomoviruses (Geminiviridae), which are whitefly-transmitted single-stranded DNA viruses known for causing devastating crop diseases, are often associated with satellite DNAs. Since begomovirus acquisition or exchange of satellite DNAs may lead to adaptation to new plant hosts and emergence of new disease complexes, it is important to investigate the diversity and distribution of these molecules. This study reports begomovirus-associated satellite DNAs identified during a vector-enabled metagenomic (VEM) survey of begomoviruses using whiteflies collected in various locations (California (USA), Guatemala, Israel, Puerto Rico, and Spain). Protein-encoding satellite DNAs, including alphasatellites and betasatellites, were identified in Israel, Puerto Rico, and Guatemala. Novel alphasatellites were detected in samples from Guatemala and Puerto Rico, resulting in the description of a phylogenetic clade (DNA-3-type alphasatellites) dominated by New World sequences. In addition, a diversity of small (~640–750 nucleotides) satellite DNAs similar to satellites associated with begomoviruses infecting Ipomoea spp. were detected in Puerto Rico and Spain. A third class of satellite molecules, named gammasatellites, is proposed to encompass the increasing number of reported small (<1 kilobase), non-coding begomovirus-associated satellite DNAs. This VEM-based survey indicates that, although recently recovered begomovirus genomes are variations of known genetic themes, satellite DNAs hold unexplored genetic diversity. PMID:26848679

  2. A DNA polymerase alpha accessory protein, Mcl1, is required for propagation of centromere structures in fission yeast.

    PubMed

    Natsume, Toyoaki; Tsutsui, Yasuhiro; Sutani, Takashi; Dunleavy, Elaine M; Pidoux, Alison L; Iwasaki, Hiroshi; Shirahige, Katsuhiko; Allshire, Robin C; Yamao, Fumiaki

    2008-01-01

    Specialized chromatin exists at centromeres and must be precisely transmitted during DNA replication. The mechanisms involved in the propagation of these structures remain elusive. Fission yeast centromeres are composed of two chromatin domains: the central CENP-A(Cnp1) kinetochore domain and flanking heterochromatin domains. Here we show that fission yeast Mcl1, a DNA polymerase alpha (Pol alpha) accessory protein, is critical for maintenance of centromeric chromatin. In a screen for mutants that alleviate both central domain and outer repeat silencing, we isolated several cos mutants, of which cos1 is allelic to mcl1. The mcl1-101 mutation causes reduced CENP-A(Cnp1) in the central domain and an aberrant increase in histone acetylation in both domains. These phenotypes are also observed in a mutant of swi7(+), which encodes a catalytic subunit of Pol alpha. Mcl1 forms S-phase-specific nuclear foci, which colocalize with those of PCNA and Pol alpha. These results suggest that Mcl1 and Pol alpha are required for propagation of centromere chromatin structures during DNA replication. PMID:18493607

  3. Elevated DNA polymerase alpha, DNA polymerase beta, and DNA topoisomerase II in a melphalan-resistant rhabdomyosarcoma xenograft that is cross-resistant to nitrosoureas and topotecan.

    PubMed

    Friedman, H S; Dolan, M E; Kaufmann, S H; Colvin, O M; Griffith, O W; Moschel, R C; Schold, S C; Bigner, D D; Ali-Osman, F

    1994-07-01

    Previous investigations have revealed that the human TE-671 MR human rhabdomyosarcoma xenograft selected in vivo for melphalan resistance (M. C. Rosenberg, et al., Cancer Res., 49: 6917-6922, 1989) is cross-resistant to a wide variety of alkylating agents and to bleomycin, but is collaterally sensitive to etoposide. Although glutathione levels were noted to be elevated in TE-671 MR compared to the melphalan-sensitive parental TE-671 xenograft, treatment with buthionine sulfoximine to deplete glutathione levels did not fully restore melphalan sensitivity in the TE-671 MR xenograft. The present studies were undertaken to search for additional mechanisms of resistance in the TE-671 MR xenograft. Drug sensitivity testing performed at the dose of agents that was lethal to 10% of the animals revealed that the TE-671 MR xenograft maintained resistance to the bifunctional cross-linking agent 1,3-bis(2-chloroethyl)-1-nitrosourea and was cross-resistant to the topoisomerase I poison topotecan. Treatment with buthionine sulfoximine did not sensitize the TE-671 MR xenograft to 1,3-bis(2-chloroethyl)-1-nitrosourea. Further, even though O6-alkylguanine-DNA alkyltransferase levels were high in both the TE-671 and TE-671 MR xenografts, depletion of O6-alkylguanine-DNA alkyltransferase activity by treatment with O6-benzylguanine substantially sensitized the TE-671 xenografts but not the TE-671 MR xenografts, suggesting an additional mechanism of resistance. Measurement of additional enzyme activities that might be involved in DNA repair revealed significant elevations in DNA polymerase alpha (46 +/- 8 (SD) units/mg protein in TE-671, 69 +/- 6 units/mg protein in TE-671 MR, P < 0.05) and DNA polymerase beta (0.43 +/- 0.01 units/mg protein in TE-671, 0.78 +/- 0.12 units/mg protein in TE-671 MR, P < 0.05) but not DNA polymerase delta or total DNA ligase. Examination of topoisomerases by activity assays and Western blotting revealed a 2-fold increase in topoisomerase II and a 2-fold

  4. Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

    PubMed Central

    Buczek, Pawel; Horvath, Martin P.

    2010-01-01

    The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

  5. CHO cell repair of single-strand and double-strand DNA breaks induced by gamma- and alpha-radiations.

    PubMed

    Cole, A; Shonka, F; Corry, P; Cooper, W G

    1975-01-01

    Neutral and alkaline sucrose gradient sedimentation analysis was used to measure double- and single-strand breaks in the DNA of Chinese hamster ovary (CHO) cells exposed to either gamma- or alpha-radiation. After irradiation, cells were incubated for 15-180 min to test the ability of the cell to rejoin the DNA breaks. Essentially complete rejoining was observed for single-strand breaks induced by gamma- or alpha-doses below 20 krad and for double-strand breaks induced by gamma doses below 60 krad. Approximately 80% rejoining was observed for double-strand breaks induced by alpha doses below 40 krad. At higher doses, the repair system appeared to saturate in such a way that essentially no additional breaks were rejoined. PMID:1191188

  6. Modeling proton and alpha elastic scattering in liquid water in Geant4-DNA

    NASA Astrophysics Data System (ADS)

    Tran, H. N.; El Bitar, Z.; Champion, C.; Karamitros, M.; Bernal, M. A.; Francis, Z.; Ivantchenko, V.; Lee, S. B.; Shin, J. I.; Incerti, S.

    2015-01-01

    Elastic scattering of protons and alpha (α) particles by water molecules cannot be neglected at low incident energies. However, this physical process is currently not available in the "Geant4-DNA" extension of the Geant4 Monte Carlo simulation toolkit. In this work, we report on theoretical differential and integral cross sections of the elastic scattering process for 100 eV-1 MeV incident protons and for 100 eV-10 MeV incident α particles in liquid water. The calculations are performed within the classical framework described by Everhart et al., Ziegler et al. and by the ICRU 49 Report. Then, we propose an implementation of the corresponding classes into the Geant4-DNA toolkit for modeling the elastic scattering of protons and α particles. Stopping powers as well as ranges are also reported. Then, it clearly appears that the account of the elastic scattering process in the slowing-down of the charged particle improves the agreement with the existing data in particular with the ICRU recommendations.

  7. cDNA cloning and disruption of the major vault protein alpha gene (mvpA) in Dictyostelium discoideum.

    PubMed

    Vasu, S K; Kedersha, N L; Rome, L H

    1993-07-25

    Vaults are large cytoplasmic ribonucleoprotein particles found in nearly all eukaryotic cells. Dictyostelium vaults contain two major proteins, MVP alpha (94.2 kDa) and MVP beta (approximately 92 kDa). Using an anti-rat vault antibody, we screened a Dictyostelium cDNA expression library and isolated a 2.8-kilobase pair clone that contained a single full-length reading frame. The identity of the clone was established by the presence of a predicted 20-amino acid sequence identical to that found in a peptide sequenced from purified MVP alpha. We have disrupted the single copy gene using homologous recombination and have demonstrated a loss of MVP alpha. Although the cells still produce MVP beta, they do not contain characteristic vault particles, suggesting that MVP alpha is required for normal vault structure. These cells should be a valuable tool for elucidating the function of vaults. PMID:8340365

  8. Pericentromeric satellite repeat expansions through RNA-derived DNA intermediates in cancer

    PubMed Central

    Bersani, Francesca; Lee, Eunjung; Kharchenko, Peter V.; Xu, Andrew W.; Liu, Mingzhu; Xega, Kristina; MacKenzie, Olivia C.; Brannigan, Brian W.; Wittner, Ben S.; Jung, Hyunchul; Ramaswamy, Sridhar; Park, Peter J.; Maheswaran, Shyamala; Ting, David T.; Haber, Daniel A.

    2015-01-01

    Aberrant transcription of the pericentromeric human satellite II (HSATII) repeat is present in a wide variety of epithelial cancers. In deriving experimental systems to study its deregulation, we observed that HSATII expression is induced in colon cancer cells cultured as xenografts or under nonadherent conditions in vitro, but it is rapidly lost in standard 2D cultures. Unexpectedly, physiological induction of endogenous HSATII RNA, as well as introduction of synthetic HSATII transcripts, generated cDNA intermediates in the form of DNA/RNA hybrids. Single molecule sequencing of tumor xenografts showed that HSATII RNA-derived DNA (rdDNA) molecules are stably incorporated within pericentromeric loci. Suppression of RT activity using small molecule inhibitors reduced HSATII copy gain. Analysis of whole-genome sequencing data revealed that HSATII copy number gain is a common feature in primary human colon tumors and is associated with a lower overall survival. Together, our observations suggest that cancer-associated derepression of specific repetitive sequences can promote their RNA-driven genomic expansion, with potential implications on pericentromeric architecture. PMID:26575630

  9. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.

    PubMed

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica

    2012-08-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  10. Ocean Primary Production Estimates from Terra MODIS and Their Dependency on Satellite Chlorophyll Alpha Algorithms

    NASA Technical Reports Server (NTRS)

    Essias, Wayne E.; Abbott, Mark; Carder, Kendall; Campbell, Janet; Clark, Dennis; Evans, Robert; Brown, Otis; Kearns, Ed; Kilpatrick, Kay; Balch, W.

    2003-01-01

    Simplistic models relating global satellite ocean color, temperature, and light to ocean net primary production (ONPP) are sensitive to the accuracy and limitations of the satellite estimate of chlorophyll and other input fields, as well as the primary productivity model. The standard MODIS ONPP product uses the new semi-analytic chlorophyll algorithm as its input for two ONPP indexes. The three primary MODIS chlorophyll Q estimates from MODIS, as well as the SeaWiFS 4 chlorophyll product, were used to assess global and regional performance in estimating ONPP for the full mission, but concentrating on 2001. The two standard ONPP algorithms were examined with 8-day and 39 kilometer resolution to quantify chlorophyll algorithm dependency of ONPP. Ancillary data (MLD from FNMOC, MODIS SSTD1, and PAR from the GSFC DAO) were identical. The standard MODIS ONPP estimates for annual production in 2001 was 59 and 58 GT C for the two ONPP algorithms. Differences in ONPP using alternate chlorophylls were on the order of 10% for global annual ONPP, but ranged to 100% regionally. On all scales the differences in ONPP were smaller between MODIS and SeaWiFS than between ONPP models, or among chlorophyll algorithms within MODIS. Largest regional ONPP differences were found in the Southern Ocean (SO). In the SO, application of the semi-analytic chlorophyll resulted in not only a magnitude difference in ONPP (2x), but also a temporal shift in the time of maximum production compared to empirical algorithms when summed over standard oceanic areas. The resulting increase in global ONPP (6-7 GT) is supported by better performance of the semi-analytic chlorophyll in the SO and other high chlorophyll regions. The differences are significant in terms of understanding regional differences and dynamics of ocean carbon transformations.

  11. alpha-MSH tripeptide analogs activate the melanocortin 1 receptor and reduce UV-induced DNA damage in human melanocytes.

    PubMed

    Abdel-Malek, Zalfa A; Ruwe, Andrew; Kavanagh-Starner, Renny; Kadekaro, Ana Luisa; Swope, Viki; Haskell-Luevano, Carrie; Koikov, Leonid; Knittel, James J

    2009-10-01

    One skin cancer prevention strategy that we are developing is based on synthesizing and testing melanocortin analogs that reduce and repair DNA damage resulting from exposure to solar ultraviolet (UV) radiation, in addition to stimulating pigmentation. Previously, we reported the effects of tetrapeptide analogs of alpha-melanocortin (alpha-MSH) that were more potent and stable than the physiological alpha-MSH, and mimicked its photoprotective effects against UV-induced DNA damage in human melanocytes. Here, we report on a panel of tripeptide analogs consisting of a modified alpha-MSH core His(6)-d-Phe(7)-Arg(8), which contained different N-capping groups, C-terminal modifications, or arginine mimics. The most potent tripeptides in activating cAMP formation and tyrosinase of human melanocytes were three analogs with C-terminal modifications. The most effective C-terminal tripeptide mimicked alpha-MSH in reducing hydrogen peroxide generation and enhancing nucleotide excision repair following UV irradiation. The effects of these three analogs required functional MC1R, as they were absent in human melanocytes that expressed non-functional receptor. These results demonstrate activation of the MC1R by tripeptide melanocortin analogs. Designing small analogs for topical delivery should prove practical and efficacious for skin cancer prevention. PMID:19558415

  12. Complementary DNA cloning, messenger RNA expression, and induction of alpha-class glutathione S-transferases in mouse tissues.

    PubMed

    Buetler, T M; Eaton, D L

    1992-01-15

    Glutathione S-transferases (EC 2.5.1.18) are a multigene family of related proteins divided into four classes. Each class has multiple isoforms that exhibit tissue-specific expression, which may be an important determinant of susceptibility of that tissue to toxic injury or cancer. Recent studies have suggested that alpha-class glutathione S-transferase isoforms may play an important role in the development of cancers. Several alpha-class glutathione S-transferase isozymes have been characterized, purified, and cloned from a number of species, including rats, mice, and humans. Here we report on the cloning, sequencing, and mRNA expression of two alpha-class glutathione S-transferases from mouse liver, termed mYa and mYc. While mYa was shown to be identical to the known alpha-class glutathione S-transferase complementary DNA clone pGT41 (W. R. Pearson et al., J. Biol. Chem., 263: 13324-13332, 1988), the other clone, mYc, was demonstrated to be a novel complementary DNA clone encoding a glutathione S-transferase homologous to rat Yc (subunit 2). The mRNA for this novel complementary DNA is expressed constitutively in mouse liver. It also is the major alpha-class glutathione S-transferase isoform expressed in lung. The levels of expression of the butylated hydroxyanisole-inducible form (mYa) are highest in kidney and intestine. Treatment of mice with butylated hydroxyanisole had little effect on the expression levels of mYc but strongly induced mYa expression in liver. Butylated hydroxyanisole treatment increased expression levels for both mYa and mYc to varying degrees in kidney, lung, and intestine. The importance of the novel mouse liver alpha-class glutathione S-transferase isoform (mYc) in the metabolism of aflatoxin B1 and other carcinogens is discussed. PMID:1728405

  13. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone

    PubMed Central

    Böhm, Markus; Hill, Helene Z.

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  14. The Trypanosoma brucei DNA polymerase alpha core subunit gene is developmentally regulated and linked to a constitutively expressed open reading frame.

    PubMed Central

    Leegwater, P A; Strating, M; Murphy, N B; Kooy, R F; van der Vliet, P C; Overdulve, J P

    1991-01-01

    As an initial step towards the characterization of replicative DNA polymerases of trypanosomes, we have cloned, sequenced and examined the expression of the Trypanosoma (Trypanozoon) brucei brucei gene that encodes the DNA polymerase alpha catalytic core (pol alpha). The protein sequence contains the six conserved regions that have been recognized previously in eukaryotic and viral replicative DNA polymerases. In addition, we have identified a seventh region which appears to be conserved primarily in alpha-type DNA polymerases. The T.brucei DNA pol alpha core N-terminus is 123 and 129 amino acids smaller than that of the human and yeast homologue, respectively. The gene is separated by 386 bp from an upstream open reading frame (ORF) of 442 codons. Stable transcripts of the upstream sequence are detected in both dividing and non-dividing forms, while pol alpha transcripts are detected principally in dividing forms. Allelic copies of the T.brucei pol alpha region exhibit restriction site polymorphisms; one such sequence polymorphism affects the amino acid sequence of the T.brucei DNA pol alpha core. The T.brucei pol alpha region cross-hybridizes weakly with that of T.(Nannomonas) congolense and T.(Duttonella) vivax. Images PMID:1754381

  15. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone.

    PubMed

    Böhm, Markus; Hill, Helene Z

    2016-01-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  16. The severity of alpha-particle-induced DNA damage is revealed by exposure to cell-free extracts

    SciTech Connect

    Hodgkins, P.S.; O`Neill, P.; Stevens, D.; Fairman, M.P.

    1996-12-01

    The rejoining of single-strand breaks induced by {alpha}-particle and {gamma} irradiation in plasmid DNA under two scavenging conditions has been compared. At the two scavenger conditions has been compared. At the two scavenger capacities used of 1.5 {times} 10{sup 7} and 3 {times} 10{sup 8}s{sup {minus}1} using Tris-HCl as the scavenger, the ratio of single- to double-strand breaks for {alpha} particles is fivefold less than the corresponding ratios for {gamma} irradiation. The repair of such radiation-induced single-strand breaks has been examined using a cell-free system derived from human whole-cell extracts. We show that the rejoining of single-strand breaks for both {alpha}-particle- and {gamma}-irradiated plasmid is dependent upon the scavenging capacity and that the efficiency of rejoining of {alpha}-particle-induced single-strand breaks is significantly less than that observed for {gamma}-ray-induced breaks. In addition, for DNA that had been irradiated under conditions that mimic the cellular environment with respect to the radical scavenging capacity, 50 of {alpha}-particle-induced single-strand breaks are converted to double-strand breaks, in contrast with only {approximately}12% conversion of {gamma}-ray-induced single-strand breaks, indicating that the initial damage caused by {alpha} particles is more severe. These studies provide experimental evidence for increased clustering of damage which may have important implications for the induction of cancer by low-level {alpha}-particle sources such as domestic radon. 37 refs., 5 figs., 1 tab.

  17. Subspecies of DNA polymerase alpha from calf thymus with different fidelity in copying synthetic template-primers.

    PubMed Central

    Brosius, S; Grosse, F; Krauss, G

    1983-01-01

    Three different subspecies of DNA polymerase alpha from calf thymus sedimenting at 9 S, 7 S and 5.7 S have been investigated with respect to their accuracy of in vitro DNA synthesis on poly (dA) (dT)16 and poly d(AT) as template-primers. Our results indicate that the structure of DNA polymerase alpha has a strong influence on the accuracy of DNA synthesis. The 9 S enzyme shows a misincorporation frequency of about 1:100 000. An error rate of 1:15 000 is measured for the 7 S species. The 5.7 S enzyme for which an error rate of 1:3 000 is determined, has to be considered as error prone. Lowering the rate of DNA synthesis leads to a decrease in fidelity. The single stranded DNA binding protein from E.coli increases the accuracy of the 5.7 S and the 7 S enzyme by a factor of two. Mn2+ decreases the fidelity of all three subspecies in a concentration dependent manner. PMID:6866763

  18. Calculation of the electronic parameters of an Al/DNA/p-Si Schottky barrier diode influenced by alpha radiation.

    PubMed

    Al-Ta'ii, Hassan Maktuff Jaber; Mohd Amin, Yusoff; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889-1.423 Ω for 2-8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  19. Calculation of the Electronic Parameters of an Al/DNA/p-Si Schottky Barrier Diode Influenced by Alpha Radiation

    PubMed Central

    Al-Ta’ii, Hassan Maktuff Jaber; Amin, Yusoff Mohd; Periasamy, Vengadesh

    2015-01-01

    Many types of materials such as inorganic semiconductors have been employed as detectors for nuclear radiation, the importance of which has increased significantly due to recent nuclear catastrophes. Despite the many advantages of this type of materials, the ability to measure direct cellular or biological responses to radiation might improve detector sensitivity. In this context, semiconducting organic materials such as deoxyribonucleic acid or DNA have been studied in recent years. This was established by studying the varying electronic properties of DNA-metal or semiconductor junctions when exposed to radiation. In this work, we investigated the electronics of aluminium (Al)/DNA/silicon (Si) rectifying junctions using their current-voltage (I-V) characteristics when exposed to alpha radiation. Diode parameters such as ideality factor, barrier height and series resistance were determined for different irradiation times. The observed results show significant changes with exposure time or total dosage received. An increased deviation from ideal diode conditions (7.2 to 18.0) was observed when they were bombarded with alpha particles for up to 40 min. Using the conventional technique, barrier height values were observed to generally increase after 2, 6, 10, 20 and 30 min of radiation. The same trend was seen in the values of the series resistance (0.5889–1.423 Ω for 2–8 min). These changes in the electronic properties of the DNA/Si junctions could therefore be utilized in the construction of sensitive alpha particle detectors. PMID:25730484

  20. Centromeric satellite DNA in the newt Triturus cristatus karelinii and related species: its distribution and transcription on lampbrush chromosomes.

    PubMed

    Baldwin, L; Macgregor, H C

    1985-01-01

    Two abundant satellite DNA sequences have been identified in and cloned from the DNA of Triturus cristatus karelinii. The smaller of these with a repeat unit of 33 base pairs (bp) is designated TkS1, the larger with 68 bp is designated TkS2. These satellites are also present in DNA from T.c. cristatus, T.c. carnifex and T. marmoratus but in substantially lower copy number. In situ hybridisations to lampbrush chromosomes of T.c. karelinii and T.c. cristatus have shown that the satellites are concentrated in the heterochromatic centromere bars of T.c. karelinii and in a region around the centromere granule in T.c. cristatus. The satellites also bind specifically to the centromere regions of mitotic metaphase chromosomes. They do not bind to the heteromorphic arms of chromosome 1, which have previously been shown to be rich in highly repeated DNA. DNA/RNA-transcript in situ hybrids to lampbrush chromosomes with TkS1 suggest that this sequence is occasionally transcribed on lampbrush loops near the centromeres. PMID:2988877

  1. DNA homologous recombination factor SFR1 physically and functionally interacts with estrogen receptor alpha.

    PubMed

    Feng, Yuxin; Singleton, David; Guo, Chun; Gardner, Amanda; Pakala, Suresh; Kumar, Rakesh; Jensen, Elwood; Zhang, Jinsong; Khan, Sohaib

    2013-01-01

    Estrogen receptor alpha (ERα), a ligand-dependent transcription factor, mediates the expression of its target genes by interacting with corepressors and coactivators. Since the first cloning of SRC1, more than 280 nuclear receptor cofactors have been identified, which orchestrate target gene transcription. Aberrant activity of ER or its accessory proteins results in a number of diseases including breast cancer. Here we identified SFR1, a protein involved in DNA homologous recombination, as a novel binding partner of ERα. Initially isolated in a yeast two-hybrid screen, the interaction of SFR1 and ERα was confirmed in vivo by immunoprecipitation and mammalian one-hybrid assays. SFR1 co-localized with ERα in the nucleus, potentiated ER's ligand-dependent and ligand-independent transcriptional activity, and occupied the ER binding sites of its target gene promoters. Knockdown of SFR1 diminished ER's transcriptional activity. Manipulating SFR1 expression by knockdown and overexpression revealed a role for SFR1 in ER-dependent and -independent cancer cell proliferation. SFR1 differs from SRC1 by the lack of an intrinsic activation function. Taken together, we propose that SFR1 is a novel transcriptional modulator for ERα and a potential target in breast cancer therapy. PMID:23874500

  2. Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of Arabidopsis thaliana centromeres.

    PubMed Central

    Nagaki, Kiyotaka; Talbert, Paul B; Zhong, Cathy Xiaoyan; Dawe, R Kelly; Henikoff, Steven; Jiang, Jiming

    2003-01-01

    The centromeres of Arabidopsis thaliana chromosomes contain megabases of complex DNA consisting of numerous types of repetitive DNA elements. We developed a chromatin immunoprecipitation (ChIP) technique using an antibody against the centromeric H3 histone, HTR12, in Arabidopsis. ChIP assays showed that the 180-bp centromeric satellite repeat was precipitated with the antibody, suggesting that this repeat is the key component of the centromere/kinetochore complex in Arabidopsis. PMID:12663558

  3. Clusters of alpha satellite on human chromosome 21 are dispersed far onto the short arm and lack ancient layers.

    PubMed

    Ziccardi, William; Zhao, Chongjian; Shepelev, Valery; Uralsky, Lev; Alexandrov, Ivan; Andreeva, Tatyana; Rogaev, Evgeny; Bun, Christopher; Miller, Emily; Putonti, Catherine; Doering, Jeffrey

    2016-09-01

    Human alpha satellite (AS) sequence domains that currently function as centromeres are typically flanked by layers of evolutionarily older AS that presumably represent the remnants of earlier primate centromeres. Studies on several human chromosomes reveal that these older AS arrays are arranged in an age gradient, with the oldest arrays farthest from the functional centromere and arrays progressively closer to the centromere being progressively younger. The organization of AS on human chromosome 21 (HC21) has not been well-characterized. We have used newly available HC21 sequence data and an HC21p YAC map to determine the size, organization, and location of the AS arrays, and compared them to AS arrays found on other chromosomes. We find that the majority of the HC21 AS sequences are present on the p-arm of the chromosome and are organized into at least five distinct isolated clusters which are distributed over a larger distance from the functional centromere than that typically seen for AS on other chromosomes. Using both phylogenetic and L1 element age estimations, we found that all of the HC21 AS clusters outside the functional centromere are of a similar relatively recent evolutionary origin. HC21 contains none of the ancient AS layers associated with early primate evolution which is present on other chromosomes, possibly due to the fact that the p-arm of HC21 and the other acrocentric chromosomes underwent substantial reorganization about 20 million years ago. PMID:27430641

  4. Murine branched chain alpha-ketoacid dehydrogenase kinase; cDNA cloning, tissue distribution, and temporal expression during embryonic development.

    PubMed

    Doering, C B; Coursey, C; Spangler, W; Danner, D J

    1998-06-01

    These studies were designed to demonstrate the structural and functional similarity of murine branched chain alpha-ketoacid dehydrogenase and its regulation by the complex-specific kinase. Nucleotide sequence and deduced amino acid sequence for the kinase cDNA demonstrate a highly conserved coding sequence between mouse and human. Tissue-specific expression in adult mice parallels that reported in other mammals. Kinase expression in female liver is influenced by circadian rhythm. Of special interest is the fluctuating expression of this kinase during embryonic development against the continuing increase in the catalytic subunits of this mitochondrial complex during development. The need for regulation of the branched chain alpha-ketoacid dehydrogenase complex by kinase expression during embryogenesis is not understood. However, the similarity of murine branched chain alpha-ketoacid dehydrogenase and its kinase to the human enzyme supports the use of this animal as a model for the human system. PMID:9611264

  5. In Silico Screening for Novel Inhibitors of DNA Polymerase III Alpha Subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv)

    PubMed Central

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N.; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents. PMID:25811866

  6. A monopartite begomovirus-associated DNA beta satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection.

    PubMed

    Saeed, Muhammad; Zafar, Yusuf; Randles, John W; Rezaian, M Ali

    2007-10-01

    DNA beta is a circular single-stranded satellite DNA which co-infects with certain monopartite helper begomoviruses to cause economically important diseases, such as cotton leaf curl disease (CLCuD). DNA beta encodes a single protein, betaC1. Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus in which both DNA A and DNA B are required for systemic infection. Inoculation of tomato plants with ToLCNDV DNA A alone induced local but not systemic infection, whereas co-inoculation with DNA A and the DNA beta associated with CLCuD resulted in systemic infection. DNA beta containing a disrupted betaC1 open reading frame (ORF) did not mobilize DNA A systemically. Co-inoculation of plants with DNA A and a construct of the betaC1 ORF, under the control of the cauliflower mosaic virus 35S promoter, resulted in the systemic movement of DNA A. In inoculated tobacco and onion epidermal cells, betaC1 fused to GFP was localized at the cell periphery in association with punctate bodies, around and within the cell nucleus and with the endoplasmic reticulum. It is concluded that heterologous betaC1 protein can replace the movement function of the DNA B of a bipartite begomovirus. Evidence is also provided that tomato leaf curl virus-encoded C4 protein confers the same movement function to ToLCNDV DNA A. The intracellular distribution of betaC1 is consistent with the hypothesis that it has a role in transporting the DNA A from the nuclear site of replication to the plasmodesmatal exit sites of the infected cell. PMID:17872543

  7. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale.

    PubMed

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-12-01

    Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  8. Evolution of satellite DNA sequences in two tribes of Bovidae: A cautionary tale

    PubMed Central

    Nieddu, Mariella; Mezzanotte, Roberto; Pichiri, Giuseppina; Coni, Pier Paolo; Dedola, Gian Luca; Dettori, Maria Luisa; Pazzola, Michele; Vacca, Giuseppe Massimo; Robledo, Renato

    2015-01-01

    Abstract Two clones, Bt1 from Bos taurus and Om1 from Ovis orientalis musimon, were used as probes for hybridization on genomic DNA and on metaphase chromosomes in members of Bovini and Caprini tribes. Bt1 and Om1 are sequences respectively belonging to the 1.715 and 1.714 DNA satellite I families. Southern blots and fluorescence in situ hybridization experiments showed completely coherent results: the Bovini probe Bt1 hybridized only to members of the Bovini tribe and not to members of Caprini. Likewise, the Caprini probe Om1 hybridized only to members of the Caprini tribe and not to members of Bovini. Hybridization signals were detected in the heterochromatic regions of every acrocentric autosome, except for two pairs of autosomes from Capra hircus that did not show hybridization to probe Om1. No signal was detected on X and Y chromosomes or on bi-armed autosomes. Remarkably, probe Om1 showed almost 100% homology with a bacterial sequence reported in Helicobacter pylori. PMID:26692159

  9. [beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

    SciTech Connect

    Brown, C.A.; Mahuran, D.J. )

    1993-08-01

    In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

  10. Bhendi yellow vein mosaic disease in India is caused by association of a DNA Beta satellite with a begomovirus.

    PubMed

    Jose, Joyce; Usha, Ramakrishnan

    2003-01-20

    Yellow vein mosaic disease is the major limitation in the production of bhendi or okra (Abelmoschus esculentus), an important vegetable crop of India. This disease is caused by a complex consisting of the monopartite begomovirus Bhendi yellow vein mosaic virus (BYVMV, family: Geminiviridae) and a small satellite DNA beta component. BYVMV can systemically infect bhendi upon agroinoculation but produces only mild leaf curling in this host. DNA beta induces typical symptoms of bhendi yellow vein mosaic disease (BYVMD) when co-agroinoculated with the begomovirus to bhendi. The DNA beta component associated with BYVMD has a number of features in common with those reported for ageratum yellow vein disease and cotton leaf curl disease. BYVMV represents a new member of the emerging group of monopartite begomoviruses requiring a satellite component for symptom induction. PMID:12573576

  11. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  12. The B subunit of the DNA polymerase alpha-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication.

    PubMed Central

    Foiani, M; Marini, F; Gamba, D; Lucchini, G; Plevani, P

    1994-01-01

    The four-subunit DNA polymerase alpha-primase complex is unique in its ability to synthesize DNA chains de novo, and some in vitro data suggest its involvement in initiation and elongation of chromosomal DNA replication, although direct in vivo evidence for a role in the initiation reaction is still lacking. The function of the B subunit of the complex is unknown, but the Saccharomyces cerevisiae POL12 gene, which encodes this protein, is essential for cell viability. We have produced different pol12 alleles by in vitro mutagenesis of the cloned gene. The in vivo analysis of our 18 pol12 alleles indicates that the conserved carboxy-terminal two-thirds of the protein contains regions that are essential for cell viability, while the more divergent NH2-terminal portion is partially dispensable. The characterization of the temperature-sensitive pol12-T9 mutant allele demonstrates that the B subunit is required for in vivo DNA synthesis and correct progression through S phase. Moreover, reciprocal shift experiments indicate that the POL12 gene product plays an essential role at the early stage of chromosomal DNA replication, before the hydroxyurea-sensitive step. A model for the role of the B subunit in initiation of DNA replication at an origin is presented. Images PMID:8289832

  13. Human placental Na/sup +/, K/sup +/-ATPase. cap alpha. subunit: cDNA cloning, tissue expression, DNA polymorphism, and chromosomal localization

    SciTech Connect

    Chehab, F.F.; Kan, Y.W.; Law, M.L.; Hartz, J.; Kao, F.T.; Blostein, R.

    1987-11-01

    A 2.2-kilobase clone comprising a major portion of the coding sequence of the Na/sup +/, K/sup +/-ATPase ..cap alpha.. subunit was cloned from human placenta and its sequence was identical to that encoding the ..cap alpha.. subunit of human kidney and HeLa cells. Transfer blot analysis of the mRNA products of the Na/sup +/, K/sup +/-ATPase gene from various human tissues and cell lines revealed only one band (approx. = 4.7 kilobases) under low and high stringency washing conditions. The levels of expression in the tissues were intestine > placenta > liver > pancreas, and in the cell lines the levels were human erythroleukemia > butyrate-induced colon > colon > brain > HeLa cells. mRNA was undetectable in reticulocytes, consistent with the authors failure to detect positive clones in a size-selected ( > 2 kilobases) lambdagt11 reticulocyte cDNA library. DNA analysis revealed by a polymorphic EcoRI band and chromosome localization by flow sorting and in situ hybridization showed that the ..cap alpha.. subunit is on the short is on the short arm (band p11-p13) of chromosome 1.

  14. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  15. Sequence-specific microscopic visualization of DNA methylation status at satellite repeats in individual cell nuclei and chromosomes

    PubMed Central

    Li, Yufeng; Miyanari, Yusuke; Shirane, Kenjiro; Nitta, Hirohisa; Kubota, Takeo; Ohashi, Hirofumi; Okamoto, Akimitsu; Sasaki, Hiroyuki

    2013-01-01

    Methylation-specific fluorescence in situ hybridization (MeFISH) was developed for microscopic visualization of DNA methylation status at specific repeat sequences in individual cells. MeFISH is based on the differential reactivity of 5-methylcytosine and cytosine in target DNA for interstrand complex formation with osmium and bipyridine-containing nucleic acids (ICON). Cell nuclei and chromosomes hybridized with fluorescence-labeled ICON probes for mouse major and minor satellite repeats were treated with osmium for crosslinking. After denaturation, fluorescent signals were retained specifically at satellite repeats in wild-type, but not in DNA methyltransferase triple-knockout (negative control) mouse embryonic stem cells. Moreover, using MeFISH, we successfully detected hypomethylated satellite repeats in cells from patients with immunodeficiency, centromeric instability and facial anomalies syndrome and 5-hydroxymethylated satellite repeats in male germ cells, the latter of which had been considered to be unmethylated based on anti-5-methylcytosine antibody staining. MeFISH will be suitable for a wide range of applications in epigenetics research and medical diagnosis. PMID:23990328

  16. Sequence-specific microscopic visualization of DNA methylation status at satellite repeats in individual cell nuclei and chromosomes.

    PubMed

    Li, Yufeng; Miyanari, Yusuke; Shirane, Kenjiro; Nitta, Hirohisa; Kubota, Takeo; Ohashi, Hirofumi; Okamoto, Akimitsu; Sasaki, Hiroyuki

    2013-10-01

    Methylation-specific fluorescence in situ hybridization (MeFISH) was developed for microscopic visualization of DNA methylation status at specific repeat sequences in individual cells. MeFISH is based on the differential reactivity of 5-methylcytosine and cytosine in target DNA for interstrand complex formation with osmium and bipyridine-containing nucleic acids (ICON). Cell nuclei and chromosomes hybridized with fluorescence-labeled ICON probes for mouse major and minor satellite repeats were treated with osmium for crosslinking. After denaturation, fluorescent signals were retained specifically at satellite repeats in wild-type, but not in DNA methyltransferase triple-knockout (negative control) mouse embryonic stem cells. Moreover, using MeFISH, we successfully detected hypomethylated satellite repeats in cells from patients with immunodeficiency, centromeric instability and facial anomalies syndrome and 5-hydroxymethylated satellite repeats in male germ cells, the latter of which had been considered to be unmethylated based on anti-5-methylcytosine antibody staining. MeFISH will be suitable for a wide range of applications in epigenetics research and medical diagnosis. PMID:23990328

  17. The Structural Basis for Partitioning of the XRCC1/DNA Ligase III-alpha BRCT-mediated Dimer Complexes

    SciTech Connect

    M Cuneo; S Gabel; J Krahn; M Ricker; R London

    2011-12-31

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  18. The structural basis for partitioning of the XRCC1/DNA ligase III-[alpha] BRCT-mediated dimer complexes

    SciTech Connect

    Cuneo, Matthew J.; Gabel, Scott A.; Krahn, Joseph M.; Ricker, Melissa A.; London, Robert E.

    2011-11-17

    The ultimate step common to almost all DNA repair pathways is the ligation of the nicked intermediate to form contiguous double-stranded DNA. In the mammalian nucleotide and base excision repair pathways, the ligation step is carried out by ligase III-{alpha}. For efficient ligation, ligase III-{alpha} is constitutively bound to the scaffolding protein XRCC1 through interactions between the C-terminal BRCT domains of each protein. Although structural data for the individual domains has been available, no structure of the complex has been determined and several alternative proposals for this interaction have been advanced. Interpretation of the models is complicated by the formation of homodimers that, depending on the model, may either contribute to, or compete with heterodimer formation. We report here the structures of both homodimer complexes as well as the heterodimer complex. Structural characterization of the heterodimer formed from a longer XRCC1 BRCT domain construct, including residues comprising the interdomain linker region, revealed an expanded heterodimer interface with the ligase III-{alpha} BRCT domain. This enhanced linker-mediated binding interface plays a significant role in the determination of heterodimer/homodimer selectivity. These data provide fundamental insights into the structural basis of BRCT-mediated dimerization, and resolve questions related to the organization of this important repair complex.

  19. Divergence of satellite DNA and interspersion of dispersed repeats in the genome of the wild beet Beta procumbens.

    PubMed

    Dechyeva, Daryna; Gindullis, Frank; Schmidt, Thomas

    2003-01-01

    Several repetitive sequences of the genome of Beta procumbens Chr. Sm., a wild beet species of the section Procumbentes of the genus Beta have been isolated. According to their genomic organization, the repeats were assigned to satellite DNA and families of dispersed DNA sequences. The tandem repeats are 229-246 bp long and belong to an AluI restriction satellite designated pAp11. Monomers of this satellite DNA form subfamilies which can be distinguished by the divergence or methylation of an internal restriction site. The satellite is amplified in the section Procumbentes, but is also found in species of the section Beta including cultivated beet (Beta vulgaris). The existence of the pAp11 satellite in distantly related species suggests that the AluI sequence family is an ancient component of Beta genomes and the ancestor of the diverged satellite subfamily pEV4 in B. vulgaris. Comparative fluorescent in-situ hybridization revealed remarkable differences in the chromosomal position between B. procumbens and B. vulgaris, indicating that the pAp11 and pEV4 satellites were most likely involved in the expansion or rearrangement of the intercalary B. vulgaris heterochromatin. Furthermore, we describe the molecular structure, and genomic and chromosomal organization of two repetitive DNA families which were designated pAp4 and pAp22 and are 1354 and 582 bp long, respectively. The families consist of sequence elements which are widely dispersed along B. procumbens chromosomes with local clustering and exclusion from distal euchromatic regions. FISH on meiotic chromosomes showed that both dispersed repeats are colocalized in some chromosomal regions. The interspersion of repeats of the pAp4 and pAp22 family was studied by PCR and enabled the determination of repeat flanking sequences. Sequence analysis revealed that pAp22 is either derived from or part of a long terminal repeat (LTR) of an Athila-like retrotransposon. Southern analysis and FISH with pAp4 and pAp22 showed

  20. Characterization and evolutionary dynamics of a complex family of satellite DNA in the leaf beetle Chrysolina carnifex (Coleoptera, Chrysomelidae).

    PubMed

    Palomeque, Teresa; Muñoz-López, Martín; Carrillo, José A; Lorite, Pedro

    2005-01-01

    The present study characterizes the complex satellite DNA from the specialized phytophagous beetle species Chrysolina carnifex. The satellite DNA is formed by six monomer types, partially homologous but having diverged enough to be separate on the phylogenetic trees, since each monomer type is located on a different branch, having statistically significant bootstrap values. Its analysis suggests a common evolutionary origin of all monomers from the same 211-bp sequence mainly by means of base-substitution mutations evolutionarily fixed to each monomer type and duplications and/or deletions of pre-existing segments in the 211-bp sequence. The analysis of the sequences and Southern hybridizations suggest that the monomers are organized in three types of repeats: monomers (211-bp) and higher-order repeats in the form of dimers (477-bp) or even trimers (633-bp). These repetitive units are not isolated from others, and do not present the pattern characteristic for the regular tandem arrangement of satellite DNA. In-situ hybridization with biotinylated probes corresponding to the three types of repeats showed the pericentromeric location of these sequences in all meiotic bivalents, coinciding with the heterochromatic blocks revealed by C-banding, indicating in addition that each type of repeat is neither isolated from others nor located in specific chromosomes but rather that they are intermixed in the heterochromatic regions. The presence of this repetitive DNA in C. haemoptera, C. bankii and C. americana was also tested by Southern analysis. The results show that this satellite DNA sequence is specific to the C. carnifex genome but has not been found in three other species of Chrysolina occupying similar or different host plants. PMID:16331411

  1. DNA polymerase alpha associated protein P1, a murine homolog of yeast MCM3, changes its intranuclear distribution during the DNA synthetic period.

    PubMed Central

    Kimura, H; Nozaki, N; Sugimoto, K

    1994-01-01

    We isolated a murine gene for the DNA polymerase alpha associated protein P1, which shares high homology with the budding yeast MCM3 protein, which is a member of a protein family involved in the early event of DNA replication having a putative DNA-dependent ATPase motif. Using a polyclonal anti-P1 antibody raised against a beta-galactosidase-P1 fusion protein, we identified at least two forms of P1 protein in the nucleus of a mouse cell line, an underphosphorylated form that was associated with a particular nuclear structure and a hyperphosphorylated form loosely bound to the nucleus. During progression through S phase, P1 disappeared, first from the euchromatic region, then from the heterochromatic region, apparently in parallel with temporally ordered DNA replication. Thus, it is likely that the underphosphorylated P1 is dissociated from the nuclear structure after DNA replication by cell cycle-dependent phosphorylation. This is the first direct observation of a protein whose behavior is consistent with that of a hypothetical factor which restricts the chromatin to replicate once per cell cycle in higher eukaryotes. Images PMID:7925275

  2. Distinction between mouse DNA polymerases alpha and beta by tryptic peptide mapping.

    PubMed Central

    Planck, S R; Tanabe, K; Wilson, S H

    1980-01-01

    Results presented here and in a previous paper (Tanabe et al. (1979) Biochemistry 18, 3401--3406) indicate that mouse beta-polymerase is a single polypeptide with an apparent molecular weight of 40,000. This polypeptide has now been analyzed by tryptic peptide mapping. Comparison of the results with identical analysis of mouse alpha-polymerase reveals that the tryptic peptides derived from the two enzymes are different. These results indicate that beta-polymerase is neither a subunit of alpha-polymerase nor a proteolytic degradation product of alpha-polymerase. Images PMID:7433094

  3. cDNA sequence and deduced primary structure of an alpha-amylase inhibitor from a bruchid-resistant wild common bean.

    PubMed

    Suzuki, K; Ishimoto, M; Kitamura, K

    1994-06-12

    alpha-Amylase inhibitor-2 (alpha AI-2), a seed storage protein present in a bruchid-resistant wild common bean (Phaseolus vulgaris), inhibits the growth of bruchid pests. The authors isolated and determined the sequence of an 852 nucleotide cDNA, designated as alpha ai2, and found it to contain a 720 base open reading frame (ORF). This ORF encodes a 240 amino-acid alpha AI-2 polypeptide 75.8% identical with alpha-amylase inhibitor-1 (alpha AI-1) and 50.6-55.6% with arcelin-1, phytohemagglutinin (PHA)-L and PHA-E of common bean. The high degree of sequence homology suggests that there is an evolutionary relationship among these genes. PMID:8003534

  4. Stereospecificity of human DNA polymerases alpha, beta, gamma, delta and epsilon, HIV-reverse transcriptase, HSV-1 DNA polymerase, calf thymus terminal transferase and Escherichia coli DNA polymerase I in recognizing D- and L-thymidine 5'-triphosphate as substrate.

    PubMed Central

    Focher, F; Maga, G; Bendiscioli, A; Capobianco, M; Colonna, F; Garbesi, A; Spadari, S

    1995-01-01

    L-beta-Deoxythymidine (L-dT), the optical enantiomer of D-beta-deoxythymidine (D-dT), and L-enantiomers of nucleoside analogs, such as 5-iodo-2'-deoxy-L-uridine (L-IdU) and E-5-(2-bromovinyl)-2'-deoxy-L-uridine (L-BVdU), are not recognized in vitro by human cytosolic thymidine kinase (TK), but are phosphorylated by herpes simplex virus type 1 (HSV-1) TK and inhibit HSV-1 proliferation in infected cells. Here we report that: (i) L-dT is selectively phosphorylated in vivo to L-dTMP by HSV-1 TK and L-dTMP is further phosphorylated to the di- and triphosphate forms by non-stereospecific cellular kinases; (ii) L-dTTP not only inhibits HSV-1 DNA polymerase in vitro, but also human DNA polymerase alpha, gamma, delta and epsilon, human immunodeficiency virus reverse transcriptase (HIV-1 RT), Escherichia coli DNA polymerase 1 and calf thymus terminal transferase, although DNA polymerase beta was resistant; (iii) whereas DNA polymerase beta, gamma, delta and epsilon are unable to utilize L-dTTP as a substrate, the other DNA polymerases clearly incorporate at least one L-dTMP residue, with DNA polymerase alpha and HIV-1 RT able to further elongate the DNA chain by catalyzing the formation of the phosphodiester bond between the incorporated L-dTMP and an incoming L-dTTP; (iv) incorporated L-nucleotides at the 3'-OH terminus make DNA more resistant to 3'-->5' exonucleases. In conclusion, our results suggest a possible mechanism for the inhibition of viral proliferation by L-nucleosides. Images PMID:7544886

  5. Stereospecificity of human DNA polymerases alpha, beta, gamma, delta and epsilon, HIV-reverse transcriptase, HSV-1 DNA polymerase, calf thymus terminal transferase and Escherichia coli DNA polymerase I in recognizing D- and L-thymidine 5'-triphosphate as substrate.

    PubMed

    Focher, F; Maga, G; Bendiscioli, A; Capobianco, M; Colonna, F; Garbesi, A; Spadari, S

    1995-08-11

    L-beta-Deoxythymidine (L-dT), the optical enantiomer of D-beta-deoxythymidine (D-dT), and L-enantiomers of nucleoside analogs, such as 5-iodo-2'-deoxy-L-uridine (L-IdU) and E-5-(2-bromovinyl)-2'-deoxy-L-uridine (L-BVdU), are not recognized in vitro by human cytosolic thymidine kinase (TK), but are phosphorylated by herpes simplex virus type 1 (HSV-1) TK and inhibit HSV-1 proliferation in infected cells. Here we report that: (i) L-dT is selectively phosphorylated in vivo to L-dTMP by HSV-1 TK and L-dTMP is further phosphorylated to the di- and triphosphate forms by non-stereospecific cellular kinases; (ii) L-dTTP not only inhibits HSV-1 DNA polymerase in vitro, but also human DNA polymerase alpha, gamma, delta and epsilon, human immunodeficiency virus reverse transcriptase (HIV-1 RT), Escherichia coli DNA polymerase 1 and calf thymus terminal transferase, although DNA polymerase beta was resistant; (iii) whereas DNA polymerase beta, gamma, delta and epsilon are unable to utilize L-dTTP as a substrate, the other DNA polymerases clearly incorporate at least one L-dTMP residue, with DNA polymerase alpha and HIV-1 RT able to further elongate the DNA chain by catalyzing the formation of the phosphodiester bond between the incorporated L-dTMP and an incoming L-dTTP; (iv) incorporated L-nucleotides at the 3'-OH terminus make DNA more resistant to 3'-->5' exonucleases. In conclusion, our results suggest a possible mechanism for the inhibition of viral proliferation by L-nucleosides. PMID:7544886

  6. Knockdown of {alpha}II spectrin in normal human cells by siRNA leads to chromosomal instability and decreased DNA interstrand cross-link repair

    SciTech Connect

    McMahon, Laura W.; Zhang Pan; Sridharan, Deepa M.; Lefferts, Joel A.; Lambert, Muriel W.

    2009-04-03

    Nonerythroid {alpha}-spectrin ({alpha}IISp) is a structural protein involved in repair of DNA interstrand cross-links and is deficient in cells from patients with Fanconi anemia (FA), which are defective in ability to repair cross-links. In order to further demonstrate the importance of the role that {alpha}IISp plays in normal human cells and in the repair defect in FA, {alpha}IISp was knocked down in normal cells using siRNA. Depletion of {alpha}IISp in normal cells by siRNA resulted in chromosomal instability and cellular hypersensitivity to DNA interstrand cross-linking agents. An increased number of chromosomal aberrations were observed and, following treatment with a DNA interstrand cross-linking agent, mitomycin C, cells showed decreased cell growth and survival and decreased formation of damage-induced {alpha}IISp and XPF nuclear foci. Thus depletion of {alpha}IISp in normal cells leads to a number of defects observed in FA cells, such as chromosome instability and a deficiency in cross-link repair.

  7. A histone arginine methylation localizes to nucleosomes in satellite II and III DNA sequences in the human genome

    PubMed Central

    2012-01-01

    Background Applying supervised learning/classification techniques to epigenomic data may reveal properties that differentiate histone modifications. Previous analyses sought to classify nucleosomes containing histone H2A/H4 arginine 3 symmetric dimethylation (H2A/H4R3me2s) or H2A.Z using human CD4+ T-cell chromatin immunoprecipitation sequencing (ChIP-Seq) data. However, these efforts only achieved modest accuracy with limited biological interpretation. Here, we investigate the impact of using appropriate data pre-processing —deduplication, normalization, and position- (peak-) finding to identify stable nucleosome positions — in conjunction with advanced classification algorithms, notably discriminatory motif feature selection and random forests. Performance assessments are based on accuracy and interpretative yield. Results We achieved dramatically improved accuracy using histone modification features (99.0%; previous attempts, 68.3%) and DNA sequence features (94.1%; previous attempts, <60%). Furthermore, the algorithms elicited interpretable features that withstand permutation testing, including: the histone modifications H4K20me3 and H3K9me3, which are components of heterochromatin; and the motif TCCATT, which is part of the consensus sequence of satellite II and III DNA. Downstream analysis demonstrates that satellite II and III DNA in the human genome is occupied by stable nucleosomes containing H2A/H4R3me2s, H4K20me3, and/or H3K9me3, but not 18 other histone methylations. These results are consistent with the recent biochemical finding that H4R3me2s provides a binding site for the DNA methyltransferase (Dnmt3a) that methylates satellite II and III DNA. Conclusions Classification algorithms applied to appropriately pre-processed ChIP-Seq data can accurately discriminate between histone modifications. Algorithms that facilitate interpretation, such as discriminatory motif feature selection, have the added potential to impart information about underlying

  8. Polymorphism, recombination and alternative unscrambling in the DNA polymerase alpha gene of the ciliate Stylonychia lemnae (Alveolata; class Spirotrichea).

    PubMed Central

    Ardell, David H; Lozupone, Catherine A; Landweber, Laura F

    2003-01-01

    DNA polymerase alpha is the most highly scrambled gene known in stichotrichous ciliates. In its hereditary micronuclear form, it is broken into >40 pieces on two loci at least 3 kb apart. Scrambled genes must be reassembled through developmental DNA rearrangements to yield functioning macronuclear genes, but the mechanism and accuracy of this process are unknown. We describe the first analysis of DNA polymorphism in the macronuclear version of any scrambled gene. Six functional haplotypes obtained from five Eurasian strains of Stylonychia lemnae were highly polymorphic compared to Drosophila genes. Another incompletely unscrambled haplotype was interrupted by frameshift and nonsense mutations but contained more silent mutations than expected by allelic inactivation. In our sample, nucleotide diversity and recombination signals were unexpectedly high within a region encompassing the boundary of the two micronuclear loci. From this and other evidence we infer that both members of a long repeat at the ends of the loci provide alternative substrates for unscrambling in this region. Incongruent genealogies and recombination patterns were also consistent with separation of the two loci by a large genetic distance. Our results suggest that ciliate developmental DNA rearrangements may be more probabilistic and error prone than previously appreciated and constitute a potential source of macronuclear variation. From this perspective we introduce the nonsense-suppression hypothesis for the evolution of ciliate altered genetic codes. We also introduce methods and software to calculate the likelihood of hemizygosity in ciliate haplotype samples and to correct for multiple comparisons in sliding-window analyses of Tajima's D. PMID:14704164

  9. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    PubMed

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  10. Sequence variability of the MspI satellite DNA family of the pinewood nematode Bursaphelenchus xylophilus at different geographic scales.

    PubMed

    Vieira, Paulo; Castagnone, Chantal; Mallez, Sophie; Espada, Margarida; Navas, Alfonso; Mota, Manuel; Castagnone-Sereno, Philippe

    2014-01-01

    Tandemly repeated sequences known as satellite DNA (satDNA) generally exhibit complex evolutionary patterns of concerted evolution in which mutations are homogenized and fixed in a stochastic process of molecular drive. Here, the nucleotidic variability of the MspI satDNA family of the pinewood nematode Bursaphelenchus xylophilus is analyzed in order to understand the evolutionary dynamics of satDNA at the intraspecific level. A total of 425 MspI monomer units, either PCR-amplified from isolates of local (Peninsula of Setúbal, Portugal) or worldwide origin, or retrieved from the B. xylophilus genome sequence, were characterized and compared. Whatever their origin, sliding window analysis of sequence variability patterns among monomers revealed low, moderate and highly variant domains, indicating that variable levels of evolutionary constraint may act upon the entire monomers. The phylogenetic inference based on the different sets of MspI satDNA family for this species shows a broad polymorphism of the individual monomers, which were distributed into four main clusters. However, such clustering appeared independent from the geographic origin of the nematodes, and could not discriminate isolates or groups of geographically close isolates. Rather, the formation of different phylogenetic groups within this satDNA family suggests an a priori embodying of a set of diverging repeats from a common ancestor satDNA library, which have been differently amplified along the evolutionary pathway of this species. The present work improves knowledge on the evolutionary dynamics of satDNA at the intraspecific level, and provides new information on satDNA sequence variability among natural populations sampled at a local geographic scale. PMID:24076248

  11. Induction of single- and double-strand breaks in plasmid DNA by monoenergetic alpha-particles with energies below the Bragg-maximum.

    PubMed

    Scholz, V; Weidner, J; Köhnlein, W; Frekers, D; Wörtche, H J

    1997-01-01

    The yield of single-strand breaks (ssb) and double-strand breaks (dsb) produced by alpha-particles at the end of their track in DNA-films was determined experimentally. Helium nuclei were accelerated to 600 keV in the 400 kV ion accelerator and scattered at a carbon target. The elastically scattered alpha-particles with energies of 344 keV and 485 keV were used to irradiate supercircular plasmid DNA in vacuo. For the dosimetry of the alpha-particles a surface barrier detector was used and the energy distribution of the alpha-particles determined. The energy loss of the particles in the DNA-layer was calculated. DNA samples were separated into the three conformational isomers using agarose gel electrophoresis. After fluorochromation the number of ssb and dsb per plasmid DNA molecule was established from the band intensities assuming the validity of Poisson statistics. Linear dose effect correlations were found for ssb and dsb per plasmid molecule. In the case of 344 keV-alpha-particles the yield of dsb was (8.6 +/- 0.9) x 10(-11) breaks/Gy x dalton. The ratio of ssb/dsb was 0.5 +/- 0.2. This is at least a factor of six larger than the ratio found in experiments with higher energy alpha-particles and from model calculations. Similar experiments with protons yielded a relative biological effectiveness (rbe) value of 2.8 for the induction of double-strand breaks by track end alpha-particles. PMID:9232893

  12. Non-linearity issues and multiple ionization satellites in the PIXE portion of spectra from the Mars alpha particle X-ray spectrometer

    NASA Astrophysics Data System (ADS)

    Campbell, John L.; Heirwegh, Christopher M.; Ganly, Brianna

    2016-09-01

    Spectra from the laboratory and flight versions of the Curiosity rover's alpha particle X-ray spectrometer were fitted with an in-house version of GUPIX, revealing departures from linear behavior of the energy-channel relationships in the low X-ray energy region where alpha particle PIXE is the dominant excitation mechanism. The apparent energy shifts for the lightest elements present were attributed in part to multiple ionization satellites and in part to issues within the detector and/or the pulse processing chain. No specific issue was identified, but the second of these options was considered to be the more probable. Approximate corrections were derived and then applied within the GUAPX code which is designed specifically for quantitative evaluation of APXS spectra. The quality of fit was significantly improved. The peak areas of the light elements Na, Mg, Al and Si were changed by only a few percent in most spectra. The changes for elements with higher atomic number were generally smaller, with a few exceptions. Overall, the percentage peak area changes are much smaller than the overall uncertainties in derived concentrations, which are largely attributable to the effects of rock heterogeneity. The magnitude of the satellite contributions suggests the need to incorporate these routinely in accelerator-based PIXE using helium beams.

  13. A recombinant DNA vaccine protects mice deficient in the alpha/beta interferon receptor against lethal challenge with Usutu virus.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Cañas-Arranz, Rodrigo; Vázquez-Calvo, Ángela; Merino-Ramos, Teresa; Escribano-Romero, Estela; Sobrino, Francisco; Saiz, Juan-Carlos

    2016-04-19

    Usutu virus (USUV) is a mosquito-borne flavivirus whose circulation had been confined to Africa since it was first detected in 1959. However, in the last decade USUV has emerged in Europe causing episodes of avian mortality and sporadic severe neuroinvasive infections in humans. Remarkably, adult laboratory mice exhibit limited susceptibility to USUV infection, which has impaired the analysis of the immune responses, thus complicating the evaluation of virus-host interactions and of vaccine candidates against this pathogen. In this work, we showed that mice deficient in the alpha/beta interferon receptor (IFNAR (-/-) mice) were highly susceptible to USUV infection and provided a lethal challenge model for vaccine testing. To validate this infection model, a plasmid DNA vaccine candidate encoding the precursor of membrane (prM) and envelope (E) proteins of USUV was engineered. Transfection of cultured cells with this plasmid resulted in expression of USUV antigens and the assembly and secretion of small virus-like particles also known as recombinant subviral particles (RSPs). A single intramuscular immunization with this plasmid was sufficient to elicit a significant level of protection against challenge with USUV in IFNAR (-/-) mice. The characterization of the humoral response induced revealed that DNA vaccination primed anti-USUV antibodies, including neutralizing antibodies. Overall, these results probe the suitability of IFNAR (-/-) mice as an amenable small animal model for the study of USUV host virus interactions and vaccine testing, as well as the feasibility of DNA-based vaccine strategies for the control of this pathogen. PMID:26993334

  14. Molecular cloning of the. alpha. -subunit of human prolyl 4-hydroxylase: The complete cDNA-derived amino acid sequence and evidence for alternative splicing of RNA transcripts

    SciTech Connect

    Helaakoski, T.; Vuori, K.; Myllylae, R.; Kivirikko, K.I.; Pihlajaniemi, T. )

    1989-06-01

    Prolyl 4-hydroxylase an {alpha}{sub 2}{beta}{sub 2} tetramer, catalyzes the formation of 4-hydroxyproline in collagens by the hydroxylation of proline residues in peptide linkages. The authors report here on the isolation of cDNA clones encoding the {alpha}-subunit of the enzyme from human tumor HT-1080, placenta, and fibroblast cDNA libraries. Eight overlapping clones covering almost all of the corresponding 3,000-nucleotide mRNA, including all the coding sequences, were characterized. These clones encode a polypeptide of 517 amino acid residues and a signal peptide of 17 amino acids. Previous characterization of cDNA clones for the {beta}-subunit of prolyl 4-hydroxylase has indicated that its C terminus has the amino acid sequence Lys-Asp-Gly-Leu, which, it has been suggested, is necessary for the retention of a polypeptide within the lumen of the endoplasmic reticulum. The {alpha}-subunit does not have this C-terminal sequence, and thus one function of the {beta}-subunit in the prolyl 4-hydroxylase tetramer appears to be to retain the enzyme within this cell organelle. Southern blot analyses of human genomic DNA with a cDNA probe for the {alpha}-subunit suggested the presence of only one gene encoding the two types of mRNA, which appear to result from mutually exclusive alternative splicing of primary transcripts of one gene.

  15. Satellite DNA as a target for TaqMan real-time PCR detection of the pinewood nematode, Bursaphelenchus xylophilus.

    PubMed

    François, Cecile; Castagnone, Chantal; Boonham, Neil; Tomlinson, Jenny; Lawson, Rebecca; Hockland, Sue; Quill, James; Vieira, Paulo; Mota, Manuel; Castagnone-Sereno, Philippe

    2007-11-01

    SUMMARY The pinewood nematode (PWN), Bursaphelenchus xylophilus, is a major pathogen of conifers, which impacts on forest health, natural ecosystem stability and international trade. As a consequence, it has been listed as a quarantine organism in Europe. A real-time PCR approach based on TaqMan chemistry was developed to detect this organism. Specific probe and primers were designed based on the sequence of the MspI satellite DNA family previously characterized in the genome of the nematode. The method proved to be specific in tests with target DNA from PWN isolates from worldwide origin. From a practical point of view, detection limit was 1 pg of target DNA or one individual nematode. In addition, PWN genomic DNA or single individuals were positively detected in mixed samples in which B. xylophilius was associated with the closely related non-pathogenic species B. mucronatus, up to the limit of 0.01% or 1% of the mixture, respectively. The real-time PCR assay was also used in conjunction with a simple DNA extraction method to detect PWN directly in artificially infested wood samples. These results demonstrate the potential of this assay to provide rapid, accurate and sensitive molecular identification of the PWN in relation to pest risk assessment in the field and quarantine regulation. PMID:20507540

  16. Molecular mechanisms of DNA damage initiated by alpha, beta-unsaturated carbonyl compounds as criteria for genotoxicity and mutagenicity.

    PubMed Central

    Eder, E; Hoffman, C; Bastian, H; Deininger, C; Scheckenbach, S

    1990-01-01

    alpha, beta-Unsaturated carbonyl compounds are important not only from a theoretical but also a practical standpoint. These ubiquitous compounds can interact with DNA through various mechanisms. The predominant interaction is the formation of cyclic 1,N2-deoxyguanosine adducts; 7,8-cyclic guanine adducts are also found. We have synthesized and characterized the stereoisomers of adducts formed by about 20 alpha, beta-unsaturated carbonyl compounds. The different types of adducts and the mutagenic and genotoxic response can be explained by the molecular structures of the agents. Compounds forming saturated cyclic adducts are mutagenic in S. typhimurium strain TA100 and to a lesser extent in TA1535. Substances with a leaving group at the C-3 position form unsaturated conjugated cyclic adducts and are mutagenic only in the His D3052 frameshift strains with an intact excision repair system (no urvA mutation). Metabolic epoxidation of the double bond and other metabolic activation, e.g., activation of the nitrogroups via nitroreductases, were also found to contribute to genotoxic and mutagenic activities. Our results have further elucidated the genotoxic mechanisms of these compounds; however, additional investigations are required for a complete understanding of the genotoxic activity of this class of compounds. PMID:2272339

  17. DNA methylation profiles in the human genes for tumor necrosis factors alpha and beta in subpopulations of leukocytes and in leukemias.

    PubMed Central

    Kochanek, S; Radbruch, A; Tesch, H; Renz, D; Doerfler, W

    1991-01-01

    The genomic sequencing technique has been applied to assess the state of methylation in the DNA from human leukocyte subpopulations from healthy individuals and in the DNA from several individuals with myeloid or lymphatic leukemias or non-Hodgkin lymphomas. Leukocyte populations were purified by the high-gradient magnetic cell sorting technique. In the human tumor necrosis factor alpha (TNF-alpha) gene segment between nucleotides 300 and 1150, the specific methylation profile in the DNA from human granulocytes and monocytes is maintained in three cases of myeloid leukemia. In one such case, all 5-methyl-2'-deoxycytidine residues have been replaced by cytidine. In a chronic lymphatic T-cell leukemia, all 5-methyl-2'-deoxycytidine residues have been substituted by cytidine. In normal B lymphocytes, in two cases of chronic lymphatic B-cell leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences in this gene segment are devoid of methylation. In the TNF-beta gene, DNA methylation is decreased in several examples of acute or chronic myeloid leukemias in comparison to normal human granulocytes or monocytes, whose DNA is almost completely methylated between nucleotides 700 and 900. In human T and B lymphocytes, the main producers of TNF-beta, in three instances of chronic lymphatic leukemias and two cases of non-Hodgkin lymphomas, all 5'-CG-3' sequences are unmethylated in this region. The DNA from the human HeLa cell line is highly methylated at all 5'-CG-3' sequences in the TNF-alpha and -beta genes. The TNF-alpha gene is transcribed in the cells of one case of acute myeloid leukemia in which the analyzed region of the TNF-alpha gene is completely unmethylated. The TNF-beta gene is not transcribed in any of the malignant cells tested. Images PMID:2062856

  18. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  19. Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX

    PubMed Central

    Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong

    2015-01-01

    Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223

  20. A Novel Sandwich Electrochemical Immunosensor Based on the DNA-Derived Magnetic Nanochain Probes for Alpha-Fetoprotein

    PubMed Central

    Gan, Ning; Jia, Liyong; Zheng, Lei

    2011-01-01

    One novel electrochemical immunosensor was constructed by immobilizing capture antibody of alpha-fetoprotein (AFP Ab1) on a nafion/nanogold-particle modified glassy carbon electrode. With a sandwich immunoassay, one DNA-derived magnetic nanoprobe, simplified as DNA/(ZMPs—HRP-AFP Ab2)n, was employed for the detection of AFP. The fabricated procedure of the proposed biosensor was characterized by cyclic voltammetry and electrochemical impedance spectroscopy. The performance and factors influencing the performance of the biosensor were also evaluated. Under optimal conditions, the developed biosensor exhibited a well-defined electrochemical behavior toward the reduction of AFP ranging from 0.01 to 200 ng/mL with a detection limit of 4 pg/mL (S/N = 3). The biosensor was applied to the determination of AFP in serum with satisfactory results. It is important to note that the sandwich nanochainmodified electro-immunosensor provided an alternative substrate for the immobilization of other tumor markers. PMID:22013390

  1. cDNA cloning and complete primary structure of the alpha subunit of a leukocyte adhesion glycoprotein, p150,95.

    PubMed Central

    Corbi, A L; Miller, L J; O'Connor, K; Larson, R S; Springer, T A

    1987-01-01

    The leukocyte adhesion receptors, p150,95, Mac-1 and LFA-1 are integral membrane glycoproteins which contain distinct alpha subunits of 180,000-150,000 Mr associated with identical beta subunits of 95,000 Mr in alpha beta complexes. p150,95 alpha subunit tryptic peptides were used to specify oligonucleotide probes and a cDNA clone of 4.7 kb containing the entire coding sequence was isolated from a size-selected myeloid cell cDNA library. The 4.7-kb cDNA clone encodes a signal sequence, an extracellular domain of 1081 amino acids containing 10 potential glycosylation sites, a transmembrane domain of 26 amino acids, and a C-terminal cytoplasmic tail of 29 residues. The extracellular domain contains three tandem homologous repeats of approximately 60 amino acids with putative divalent cation-binding sites, and four weaker repeats which lack such binding sites. The cDNA clone hybridizes with a mRNA of 4.7 kb which is induced during in vitro differentiation of myeloid cell lines. The p150,95 alpha subunit is homologous to the alpha subunits of receptors which recognize the RGD sequence in extracellular matrix components, as has previously been shown for the beta subunits, supporting the concept that receptors involved in both cell-cell and cell-matrix interactions belong to a single gene superfamily termed the integrins. Distinctive features of the p150,95 alpha subunit include an insertion of 126 residues N-terminal to the putative metal binding region and a deletion of the region in which the matrix receptors are proteolytically cleaved during processing. Images Fig. 2. PMID:3327687

  2. DNA topoisomerase II-alpha as a proliferation marker in astrocytic neoplasms of the central nervous system: correlation with MIB1 expression and patient survival.

    PubMed

    Holden, J A; Townsend, J J

    1999-12-01

    DNA topoisomerase II-alpha (topo II-alpha) is the target of a variety of clinically used anticancer drugs such as etoposide, teniposide, and doxorubicin. The enzyme has also been used as a cell proliferation marker. Because proliferation measurements in central nervous system (CNS) astrocytic neoplasms have been shown to have prognostic importance and because drugs targeting topo II-alpha may be useful in treating these tumors, we determined topo II-alpha expression in 26 patients with CNS astrocytomas. In these tumors, topo II-alpha expression correlated well with the known proliferation marker, MIB1 (correlation coefficient = 0.94). Topo II-alpha expression also correlated with the histologic classification of the tumor. Grade 1 lesions had an average topo II-alpha index of 2.1 (range, 0 to 3.4); grade 2 lesions, 4.0 (range, 0 to 11.4); grade 3 lesions, 17.3 (range, 3.8 to 69.8); and grade 4 lesions (glioblastoma multiforme), 39.5 (range, 14.8 to 84.0). The average topo II-alpha and MIB1 index of patients alive two years after diagnosis was 8.8 (range, 0 to 45.6) and 11.8 (range, 0.2 to 44.0), respectively. In contrast, the average topo II-alpha and MIB1 index of 30.5 (range, 2.8 to 69.8) and 33.8 (range, 2.2 to 84.6), respectively, was observed in tumors from patients who were dead from disease by two years. The topo II-alpha index between patients alive and dead at two years was statistically different at the 95% confidence level. The MIB1 differences between these two groups of patients was not found to be statistically different. PMID:10619260

  3. Characterization of a cDNA encoding a novel human Golgi alpha 1, 2-mannosidase (IC) involved in N-glycan biosynthesis.

    PubMed

    Tremblay, L O; Herscovics, A

    2000-10-13

    A human cDNA encoding a 70.9-kDa type II membrane protein with sequence similarity to class I alpha1,2-mannosidases was isolated. The enzymatic properties of the novel alpha1,2-mannosidase IC were studied by expressing its catalytic domain in Pichia pastoris as a secreted glycoprotein. alpha1,2-Mannosidase IC sequentially hydrolyzes the alpha1,2-linked mannose residues of [(3)H]mannose-labeled Man(9)GlcNAc to form [(3)H]Man(6)GlcNAc and a small amount of [(3)H]Man(5)GlcNAc. The enzyme requires calcium for activity and is inhibited by both 1-deoxymannojirimycin and kifunensine. The order of mannose removal was determined by separating oligosaccharide isomers formed from pyridylaminated Man(9)GlcNAc(2) by high performance liquid chromatography. The terminal alpha1,2-linked mannose residue from the middle branch is the last mannose removed by the enzyme. This residue is the mannose cleaved from Man(9)GlcNAc(2) by the endoplasmic reticulum alpha1, 2-mannosidase I to form Man(8)GlcNAc(2) isomer B. The order of mannose hydrolysis from either pyridylaminated Man(9)GlcNAc(2) or Man(8)GlcNAc(2) isomer B differs from that previously reported for mammalian Golgi alpha1,2-mannosidases IA and IB. The full-length alpha1,2-mannosidase IC was localized to the Golgi of MDBK and MDCK cells by indirect immunofluorescence. Northern blot analysis showed tissue-specific expression of a major transcript of 3.8 kilobase pairs. The expression pattern is different from that of human Golgi alpha1,2-mannosidases IA and IB. Therefore, the human genome contains at least three differentially regulated Golgi alpha1, 2-mannosidase genes encoding enzymes with similar, but not identical specificities. PMID:10915796

  4. Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates DNA-binding and transcriptional activities of NF-kappa B.

    PubMed Central

    Arenzana-Seisdedos, F; Thompson, J; Rodriguez, M S; Bachelerie, F; Thomas, D; Hay, R T

    1995-01-01

    The transcription factor NF-kappa B is exploited by many viruses, including the human immunodeficiency virus, for expression of viral genes, but its primary role appears to be in the rapid induction of cellular genes during immune and inflammatory responses. The inhibitor protein I kappa B alpha maintains NF-kappa B in an inactive form in the cytoplasms of unstimulated cells, but upon cell activation, I kappa B alpha is rapidly degraded, leading to nuclear translocation of free NF-kappa B. However, NF-kappa B-dependent transcription of the I kappa B alpha gene leads to rapid resynthesis of the I kappa B alpha protein and inhibition of NF-kappa B-dependent transcription. Here we demonstrate a new regulatory function of I kappa B alpha exerted on NF-kappa B in the nuclear compartment. Although normally found in the cytoplasm, I kappa B alpha, newly synthesized in response to tumor necrosis factor or interleukin I, is transported to the nucleus. In the nucleus I kappa B alpha associates with the p50 and p65 subunits of NF-kappa B, inhibiting DNA binding of the transcription factor. Furthermore, nuclear expression of I kappa B alpha correlates with transcription termination of transfected NF-kappa B-dependent luciferase genes. Following the appearance of I kappa B alpha in the nuclei of activated cells, a dramatic reduction in the amount of nuclear p50 occurs, suggesting that NF-kappa B-I kappa B alpha complexes are cleared from the nucleus. PMID:7739549

  5. Alphoid satellite DNA is tightly associated with centromere antigens in human chromosomes throughout the cell cycle

    SciTech Connect

    Masumoto, Hiroshi; Sugimoto, Kenji; Okazaki, Tuneko )

    1989-03-01

    In this study, the authors have examined a DNA element specific to the centromere domain of human chromosomes. Purified HeLa chromosomes were digested with the restriction enzyme Sau3AI and fractionated by sedimentation through a sucrose gradient. Fractions showing antigenicity to anticentromere (kinetochore) serum obtained from a scleroderma CREST patient were used to construct a DNA library. From this library they found one clone which has specifically hybridized to the centromere domain of metaphase chromosomes using a biotinylated probe DNA and FITC-conjugated avidin. The clone contained a stretch of alphoid DNA dimer. To determine precisely the relative location of the alphoid DNA stretch and the centromere antigen, a method was developed to carry out in situ hybridization of DNA and indirect immunofluorescent staining of antigen on the same cell preparation. Using this method, they have found perfect overlapping of the alphoid DNA sites with the centromere antigen in both metaphase chromosomes and nuclei at various stages in the cell cycle. They have also observed this exact correlation at the attachment sites of artificially extended sister chromatids. These results suggest the possibility that alphoid DNA repeats are a key component of kinetochore structure.

  6. Alpha-DNA. IV: Alpha-anomeric and beta-anomeric tetrathymidylates covalently linked to intercalating oxazolopyridocarbazole. Synthesis, physicochemical properties and poly (rA) binding.

    PubMed Central

    Gautier, C; Morvan, F; Rayner, B; Huynh-Dinh, T; Igolen, J; Imbach, J L; Paoletti, C; Paoletti, J

    1987-01-01

    A new set of molecules made of an intercalating agent (oxazolopyridocarbazole, OPC) covalently linked through a polymethylene chain of various length to the 3' end of alpha-anomeric or beta-anomeric tetradeoxynucleotides (alpha- or beta-T4) have been synthesized. The beta-thymidylate modified compound (beta-T4C5OPC) is able to interact with the complementary sequence, beta-poly (rA); this interaction is strongly stabilized compared to the parent compound, beta-oligo(dT)4 and is specific for poly (rA). The molecule synthesized from the unnatural alpha-anomer, alpha-T4C5OPC, is also able to interact with poly (rA) leading to the formation of an alpha-beta hybrid stabilized by the energy provided by the OPC moiety. The stoechiometry of the binding reaction shows that an A-T pairing occurs in the alpha-beta heterohybrids. Tm studies reveal that the alpha-beta heterohybrids are more stable than their beta-beta counterparts. PMID:3628001

  7. Evolutionary dynamics of two satellite DNA families in rock lizards of the genus Iberolacerta (Squamata, Lacertidae): different histories but common traits.

    PubMed

    Rojo, Verónica; Martínez-Lage, Andrés; Giovannotti, Massimo; González-Tizón, Ana M; Nisi Cerioni, Paola; Caputo Barucchi, Vincenzo; Galán, Pedro; Olmo, Ettore; Naveira, Horacio

    2015-09-01

    Satellite DNAs compose a large portion of all higher eukaryotic genomes. The turnover of these highly repetitive sequences is an important element in genome organization and evolution. However, information about the structure and dynamics of reptilian satellite DNA is still scarce. Two satellite DNA families, HindIII and TaqI, have been previously characterized in four species of the genus Iberolacerta. These families showed different chromosomal locations, abundances, and evolutionary rates. Here, we extend the study of both satellite DNAs (satDNAs) to the remaining Iberolacerta species, with the aim to investigate the patterns of variability and factors influencing the evolution of these repetitive sequences. Our results revealed disparate patterns but also common traits in the evolutionary histories of these satellite families: (i) each satellite DNA is made up of a library of monomer variants or subfamilies shared by related species; (ii) species-specific profiles of satellite repeats are shaped by expansions and/or contractions of different variants from the library; (iii) different turnover rates, even among closely related species, result in great differences in overall sequence homogeneity and in concerted or non-concerted evolution patterns, which may not reflect the phylogenetic relationships among taxa. Contrasting turnover rates are possibly related to genomic constraints such as karyotype architecture and the interspersed organization of diverging repeat variants in satellite arrays. Moreover, rapid changes in copy number, especially in the centromeric HindIII satDNA, may have been associated with chromosomal rearrangements and even contributed to speciation within Iberolacerta. PMID:26384818

  8. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin.

    PubMed

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; Dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N; Henriques, João A P; Brendel, Martin; Pungartnik, Cristina; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as "mangosteen fruit," originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  9. RECQL5 cooperates with Topoisomerase II alpha in DNA decatenation and cell cycle progression

    PubMed Central

    Ramamoorthy, Mahesh; Tadokoro, Takashi; Rybanska, Ivana; Ghosh, Avik K.; Wersto, Robert; May, Alfred; Kulikowicz, Tomasz; Sykora, Peter; Croteau, Deborah L.; Bohr, Vilhelm A.

    2012-01-01

    DNA decatenation mediated by Topoisomerase II is required to separate the interlinked sister chromatids post-replication. SGS1, a yeast homolog of the human RecQ family of helicases interacts with Topoisomerase II and plays a role in chromosome segregation, but this functional interaction has yet to be identified in higher organisms. Here, we report a physical and functional interaction of Topoisomerase IIα with RECQL5, one of five mammalian RecQ helicases, during DNA replication. Direct interaction of RECQL5 with Topoisomerase IIα stimulates the decatenation activity of Topoisomerase IIα. Consistent with these observations, RECQL5 co-localizes with Topoisomerase IIα during S-phase of the cell cycle. Moreover, cells with stable depletions of RECQL5 display a slow proliferation rate, a G2/M cell cycle arrest and late S-phase cycling defects. Metaphase spreads generated from RECQL5-depleted cells exhibit undercondensed and entangled chromosomes. Further, RECQL5-depleted cells activate a G2/M checkpoint and undergo apoptosis. These phenotypes are similar to those observed when Topoisomerase II catalytic activity is inhibited. These results reveal an important role for RECQL5 in the maintenance of genomic stability and a new insight into the decatenation process. PMID:22013166

  10. [DNA bend sites in the promoter region of the human estrogen receptor alpha gene].

    PubMed

    Kuwabara, K; Sakuma, Y

    1998-12-01

    DNA bend sites in the promoter region of the human estrogen receptor a gene were determined by the circular permutation assay. Among a total of five sites (ERB -4 to -1, and ERB + 1) mapped in the 3 kb region, three matched with the positions of the predicted periodicity while the other two did not. Most of the sites were accompanied by the short poly (dA)-poly (dT) tracts including the potential bend core sequence A2N8A2N8A2 (A/A/A). Fine mapping of the ERB-2 site indicated that this A/A/A and the immediate franking sequences contained motifs for the estrogen response element. This region had a higher affinity for the nuclear scaffold and was included in the core region of the nucleosome structure. However, binding of the nuclear factor(s) to the motifs and disruption of nucleosome structure occurred without ATP. These results suggest that a class of periodic bent DNA could act as a site of multiple interactions among the nuclear scaffold, core histones and nuclear factors. PMID:9893449

  11. DNA Protection against Oxidative Damage Using the Hydroalcoholic Extract of Garcinia mangostana and Alpha-Mangostin

    PubMed Central

    Carvalho-Silva, Ronaldo; Pereira, Alanna Cibelle Fernandes; dos Santos Alves, Rúbens Prince; Guecheva, Temenouga N.; Henriques, João A. P.; Brendel, Martin; Rios-Santos, Fabrício

    2016-01-01

    Garcinia mangostana, popularly known as “mangosteen fruit,” originates from Southeast Asia and came to Brazil about 80 years ago where it mainly grows in the states of Pará and Bahia. Although mangosteen or its extracts have been used for ages in Asian folk medicine, data on its potential genotoxicity is missing. We, therefore, evaluated genotoxicity/mutagenicity of hydroethanolic mangosteen extract [HEGM, 10 to 640 μg/mL] in established test assays (Comet assay, micronucleus test, and Salmonella/microsome test). In the Comet assay, HEGM-exposed human leukocytes showed no DNA damage. No significant HEGM-induced mutation in TA98 and TA100 strains of Salmonella typhimurium (with or without metabolic activation) was observed and HEGM-exposed human lymphocytes had no increase of micronuclei. However, HEGM suggested exposure concentration-dependent antigenotoxic potential in leukocytes and antioxidant potential in the yeast Saccharomyces cerevisiae. HEGM preloading effectively protected against H2O2-induced DNA damage in leukocytes (Comet assay). Preloading of yeast with HEGM for up to 4 h significantly protected the cells from lethality of chronic H2O2-exposure, as expressed in better survival. Absence of genotoxicity and demonstration of an antigenotoxic and antioxidant potential suggest that HEGM or some substances contained in it may hold promise for pharmaceutical or nutraceutical application. PMID:27042187

  12. Intracellular localization of human ZBP1: Differential regulation by the Z-DNA binding domain, Z{alpha}, in splice variants

    SciTech Connect

    Hong Thanh Pham; Park, Mi-Young; Kim, Kyeong Kyu; Kim, Yang-Gyun; Ahn, Jin-Hyun . E-mail: jahn@med.skku.ac.kr

    2006-09-15

    We investigated the subcellular distribution of human ZBP1, which harbors the N-terminal Z-DNA binding domains, Z{alpha} and Z{beta}. ZBP1 was distributed primarily in the cytoplasm and occasionally as nuclear foci in interferon (IFN)-treated primary hepatocellular carcinoma cells, and in several other transfected cell types. In leptomycin B (LMB)-treated cells, endogenous ZBP1 efficiently accumulated in nuclear foci, which overlapped PML oncogenic domains (PODs) or nuclear bodies (NBs). In transfection assays, the unique C-terminal region of ZBP1 was necessary for its typical cytoplasmic localization. Interestingly, the Z{alpha}-deleted form displayed an increased association with PODs compared to wild-type and, unlike wild-type, perfectly accumulated in PODs in LMB-treated cells, implying that the presence of Z{alpha} domain also facilitates the cytoplasmic localization. Our results demonstrate that ZBP1 is localized primarily in the cytoplasm but also associated with nuclear PODs in IFN or LMB-treated cells. Given that about half of ZBP1 mRNA lacks exon 2 encoding the Z{alpha} domain, our data also suggest that the localization of ZBP1 may be differentially regulated by the Z-DNA binding domain, Z{alpha}, in splice variants.

  13. Cloning of the cDNA of the heme-regulated eukaryotic initiation factor 2. alpha. (eIF-2. alpha. ) kinase of rabbit reticulocytes: Homology to yeast GCN2 protein kinase and human double-stranded-RNA-dependent eIF-2. alpha. kinase

    SciTech Connect

    Chen, J.J.; Throop, M.S.; Kuo, I.; Pal, J.K.; Brodsky, M.; London, I.M. ); Gehrke, L. Harvard Medical School, Boston, MA )

    1991-09-01

    The authors have cloned the cDNA of the heme-regulated eIF-2{alpha} kinase (HRI) of rabbit reticulocytes. In vitro translation of mRNA transcribed from the HRI cDNA yields a 90-kDa polypeptide that exhibits eIF-2{alpha} kinase activity and is recognized by a monoclonal antibody directed against authentic HRI. The open reading frame sequence of the HRI cDNA contains all 11 catalytic domains of protein kinases with consensus sequences of protein-serine/threonine kinases in conserved catalytic domains VI and VIII. The HRI cDNA also contains an insert of {approx} 140 amino acids between catalytic domains V and VI. The HRI cDNA coding sequence has extensive homology to GCN2 protein kinase of Saccharomyces cerevisiae and to human double-stranded-RNA-dependent eIF-2{alpha} kinase. This observation suggests that GCN2 protein kinase may be an eIF-2{alpha} kinase in yeast. In addition, HRI has an unusually high degree of homology to three protein kinases (NimA, Wee1, and CDC2) that are involved in the regulation of the cell cycle.

  14. Microtubule-associated protein MAP2 preferentially binds to a dA/dT sequence present in mouse satellite DNA.

    PubMed Central

    Avila, J; Montejo de Garcini, E; Wandosell, F; Villasante, A; Sogo, J M; Villanueva, N

    1983-01-01

    Microtubule-associated protein MAP2 binds to the Sau96.1 restriction monomer fragment of mouse satellite DNA. This fragment is also present in a lower proportion in bulk DNA. The digestion of MAP2-Sau96.1 fragment complex by DNase results in the protection of certain nucleotide sequences. The sequence poly(dA)4/poly(dT)4 is mainly protected against DNase digestion. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. PMID:10872313

  15. [DNA content in the organs of animals in space flight on the Kosmos-690 satellite].

    PubMed

    Guseĭnov, F T; Komolova, G S; Egorov, I A; Tigranian, R A; Serova, L V

    1978-01-01

    The DNA content in the liver, spleen and bone marrow of white rats exposed to a prolonged gamma-irradiation at a dose of 220 and 800 rad on the 10th day of the 20.5-day space flight and the ground-based synchronous experiment was measured. Space flight factors produced a modifying effect on the postradiation changes in the DNA content. This modifying influence was detected in all organs tested, although in a different degree, and involved an enhancement of the radiation effect which was associated with retardation of postradiation regenerative processes. PMID:713477

  16. Targeting Aberrant DNA double strand break repair in triple negative breast cancer with alpha particle emitter radiolabeled anti-EGFR antibody

    PubMed Central

    Song, Hong; Hedayati, Mohammad; Hobbs, Robert F.; Shao, Chunbo; Bruchertseifer, Frank; Morgenstern, Alfred; DeWeese, Theodore L.; Sgouros, George

    2013-01-01

    The higher potential efficacy of alpha-particle radiopharmaceutical therapy lies in the 3 to 8-fold greater biological effectiveness (RBE) of alpha particles relative to photon or beta-particle radiation. This greater RBE, however, also applies to normal tissue, thereby reducing the potential advantage of high RBE. Since alpha particles typically cause DNA double strand breaks (DSBs), targeting tumors that are defective in DSB repair effectively increases the RBE, yielding a secondary, RBE-based differentiation between tumor and normal tissue that is complementary to conventional, receptor-mediated tumor targeting. In some triple negative breast cancers (TNBC, ER−/PR−/HER-2−), germline mutation in BRCA-1, a key gene in homologous recombination (HR) DSB repair, predisposes patients to early onset of breast cancer. These patients have few treatment options once the cancer has metastasized. In this study, we investigated the efficacy of alpha particle emitter, 213Bi labeled anti-EGFR antibody, Cetuximab, in BRCA-1 defective TNBC. 213Bi-Cetuximab was found to be significantly more effective in the BRCA-1 mutated TNBC cell line HCC1937 than BRCA-1 competent TNBC cell MDA-MB-231. siRNA knockdown of BRCA-1 or DNA-PKcs, a key gene in non-homologous end joining (NHEJ) DSB repair pathway, also sensitized TNBC cells to 213Bi-Cetuximab. Furthermore, the small molecule inhibitor of DNA-PKcs, NU7441, sensitized BRCA-1 competent TNBC cells to alpha particle radiation. Immunofluorescent staining of γH2AX foci and comet assay confirmed that enhanced RBE is caused by impaired DSB repair. These data offer a novel strategy for enhancing conventional receptor-mediated targeting with an additional, potentially synergistic radiobiological targeting that could be applied to TNBC. PMID:23873849

  17. Purification, cDNA cloning, and expression of GDP-L-Fuc:Asn-linked GlcNAc alpha1,3-fucosyltransferase from mung beans.

    PubMed

    Leiter, H; Mucha, J; Staudacher, E; Grimm, R; Glössl, J; Altmann, F

    1999-07-30

    Substitution of the asparagine-linked GlcNAc by alpha1,3-linked fucose is a widespread feature of plant as well as of insect glycoproteins, which renders the N-glycan immunogenic. We have purified from mung bean seedlings the GDP-L-Fuc:Asn-linked GlcNAc alpha1,3-fucosyltransferase (core alpha1,3-fucosyltransferase) that is responsible for the synthesis of this linkage. The major isoform had an apparent mass of 54 kDa and isoelectric points ranging from 6. 8 to 8.2. From that protein, four tryptic peptides were isolated and sequenced. Based on an approach involving reverse transcriptase-polymerase chain reaction with degenerate primers and rapid amplification of cDNA ends, core alpha1,3-fucosyltransferase cDNA was cloned from mung bean mRNA. The 2200-base pair cDNA contained an open reading frame of 1530 base pairs that encoded a 510-amino acid protein with a predicted molecular mass of 56.8 kDa. Analysis of cDNA derived from genomic DNA revealed the presence of three introns within the open reading frame. Remarkably, from the four exons, only exon II exhibited significant homology to animal and bacterial alpha1,3/4-fucosyltransferases which, though, are responsible for the biosynthesis of Lewis determinants. The recombinant fucosyltransferase was expressed in Sf21 insect cells using a baculovirus vector. The enzyme acted on glycopeptides having the glycan structures GlcNAcbeta1-2Manalpha1-3(GlcNAcbeta1-2Manalpha1- 6)Manbeta1-4GlcNAcbet a1-4GlcNAcbeta1-Asn, GlcNAcbeta1-2Manalpha1-3(GlcNAcbeta1-2Manalpha1- 6)Manbeta1-4GlcNAcbet a1-4(Fucalpha1-6)GlcNAcbeta1-Asn, and GlcNAcbeta1-2Manalpha1-3[Manalpha1-3(Manalpha1-6 )Manalpha1-6]Manbeta1 -4GlcNAcbeta1-4GlcNAcbeta1-Asn but not on, e.g. N-acetyllactosamine. The structure of the core alpha1,3-fucosylated product was verified by high performance liquid chromatography of the pyridylaminated glycan and by its insensitivity to N-glycosidase F as revealed by matrix-assisted laser desorption/ionization time of flight mass

  18. cDNA cloning, characterization, and developmental expression of the 20S proteasome alpha5 subunit in the Mediterranean fruit fly Ceratitis capitata.

    PubMed

    Verras, Meletios; Gourzi, Polyxeni; Kalosaka, Katerina; Zacharopoulou, Antigone; Mintzas, Anastassios C

    2008-03-01

    In the present study, we report the cDNA cloning, characterization, and developmental expression of the 20S proteasome alpha5 subunit from the Mediterranean fruit fly Ceratitis capitata (medfly). Using an RT-PCR fragment that corresponds to the amino-terminal region of the Drosophila melanogaster 20S proteasome alpha5 subunit, we isolated a 987-bp cDNA that encodes the complete coding region of the medfly ortholog, which was named CcPSMA5. CcPSMA5 consists of 241 amino acids and has a predicted molecular weight of 26.4 kDa and pI 4.75. Comparison of the CcPSMA5 amino acid sequence with the sequences of all known 20S proteasome alpha5 subunits from different organisms indicated that the medfly 20S proteasome alpha5 subunit has the strongest homology to that of Drosophila. In situ hybridization showed that the CcPSMA5 gene is mapped in the region 44B of chromosome 4. Northern blot hybridization analysis showed that the CcPSMA5 mRNA has a size of approximately 1.2 kb. High levels of the CcPSMA5 mRNA were detected in freshly laid eggs, indicating that they were maternally deposited. The mRNA expression pattern during medfly development suggests that the CcPSMA5 gene is upregulated before mid-embryogenesis and at the onset of metamorphosis. PMID:18163525

  19. cDNA cloning, biochemical characterization and inhibition by plant inhibitors of the alpha-amylases of the Western corn rootworm, Diabrotica virgifera virgifera.

    PubMed

    Titarenko, E; Chrispeels, M J

    2000-10-01

    We report the characterization and cDNA cloning of two alpha-amylase isozymes from larvae of the Western corn rootworm (Diabrotica virgifera virgifera LeConte). Larvae raised on artificial media have very low levels of amylase activity, and much higher levels are found in larvae raised on maize seedlings. At pH 5.7, the optimum pH for enzyme activity, the alpha-amylases are substantially but not completely inhibited by amylase inhibitors from the common bean (Phaseolus vulgaris) and from wheat (Triticum aestivum). Using the reverse transcriptase polymerase chain reaction (RT-PCR), we cloned two cDNAs with 83% amino acid identity that encode alpha-amylase-like polypeptides. Expression of one of the two cDNAs in insect cells with a baculovirus vector shows that this cDNA encodes an active amylase with a mobility that corresponds to that of one of the two isozymes present in larval extracts. The expressed enzyme is substantially inhibited by the same two inhibitors. We also show that expression in Arabidopsis of the cDNA that encodes the amylase inhibitor AI-1 of the common bean results in the accumulation of active inhibitor in the roots, and the results are discussed with reference to the possibility of using amylase inhibitors as a strategy to genetically engineer maize plants that are resistant to Western corn rootworm larvae. PMID:10899464

  20. Tetris Is a Foldback Transposon that Provided the Building Blocks for an Emerging Satellite DNA of Drosophila virilis

    PubMed Central

    Dias, Guilherme B.; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C.S.

    2014-01-01

    Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. PMID:24858539

  1. Effect of 4-quinolones and novobiocin on calf thymus DNA polymerase alpha primase complex, topoisomerases I and II, and growth of mammalian lymphoblasts.

    PubMed

    Hussy, P; Maass, G; Tümmler, B; Grosse, F; Schomburg, U

    1986-06-01

    The influence of ciprofloxacin, nalidixic acid, norfloxacin, novobiocin, and ofloxacin on elements of eucaryotic DNA replication was investigated in vitro. Each of the 4-quinolones, when present in amounts of more than 100 micrograms/ml, reversibly inhibited the DNA synthesis performed by the 95 DNA polymerase alpha primase complex from calf thymus. Novobiocin at 500 micrograms/ml or at higher concentrations irreversibly inactivated DNA polymerase alpha primase complex. The accuracy of in vitro DNA synthesis in the absence of repair mechanisms was determined from amber-revertant assays with phi X174am16(+) DNA as template. The antimicrobial agents did not significantly increase the frequencies of base pairing mismatches during the course of replication, indicating that the basal mutation rate is not affected by novobiocin and the 4-quinolones. The Ki values of 50% inhibition of DNA topoisomerases from calf thymus by ciprofloxacin, norfloxacin, novobiocin, nalidixic acid, and ofloxacin were 300, 400, 1,000 or more, 1,000 or more, and 1,500 or more micrograms/ml, respectively, in the case of topoisomerase I, and the Ki values were 150, 300, 500, 1,000, and 1,300 micrograms/ml, respectively, in the case of topoisomerase II. The procaryotic topoisomerase II is approximately 100-fold more sensitive to inhibition by ciprofloxacin, norfloxacin, and ofloxacin than is its eucaryotic counterpart. Growth curves of lymphoblasts were recorded in the presence of ofloxacin and ciprofloxacin. Neither 1 nor 10 micrograms of ciprofloxacin or of ofloxacin per ml affected cell proliferation. Ofloxacin and ciprofloxacin at 100 micrograms/ml inhibited cell growth; 1,000 micrograms/ml led to cell death. No correlation exists between the antimicrobial and cytotoxic activities of the 4-quinolones. PMID:3015015

  2. DNA bending is induced by a transcription factor that interacts with the human c-FOS and alpha-actin promoters.

    PubMed Central

    Gustafson, T A; Taylor, A; Kedes, L

    1989-01-01

    Conserved sequence elements in the human cardiac and skeletal alpha-actin promoters that contain the CC(A + T-rich)6GG motif have been shown to regulate transcription of these genes. A similar sequence is found in the serum response element of the human c-FOS gene. In this study, we demonstrate that indistinguishable proteins bind to each of five CC(A + T-rich)6GG elements examined in the human cardiac and skeletal alpha-actin promoters and the c-FOS serum response element. Using electrophoretic techniques, we show that these factors induce a stable bend in the DNA upon binding, and the bend center is shown to coincide with the CC(A + T-rich)6GG element. In addition, the ability to bend DNA is retained by a small proteolytic fragment of the protein, suggesting that the DNA-binding domain of the protein is resistant to proteases and is sufficient to bend DNA. Images PMID:2494661

  3. Lipid peroxidation and etheno DNA adducts in white blood cells of liver fluke-infected patients: protection by plasma alpha-tocopherol and praziquantel.

    PubMed

    Dechakhamphu, Somkid; Pinlaor, Somchai; Sitthithaworn, Paiboon; Nair, Jagadeesan; Bartsch, Helmut; Yongvanit, Puangrat

    2010-01-01

    Chronic infection by the liver fluke Opisthorchis viverrini is a strong risk factor for cholangiocarcinoma. To clarify the involvement of oxidative stress and lipid peroxidation-derived DNA damage, etheno (epsilon)-DNA adducts (epsilondA, epsilondC) in WBC and plasma alpha-tocopherol were measured in samples collected from O. viverrini-infected Thai patients (n = 50) and healthy noninfected volunteers (n = 20). epsilondA and epsilondC levels were three to five times higher (P < 0.001) in infected patients than in controls; O. viverrini infection also increased two to three times in the plasma inflammatory indicators, 8-isoprostane, malondialdehyde, and nitrate/nitrite. Mean plasma alpha-tocopherol levels were two times lower in patients than in healthy controls (P < 0.001). Two months after a single dose to infected patients of the antiparasitic drug praziquantel, epsilondA and epsilondC levels in WBC were decreased to control level (P < 0.03); plasma 8-isoprostane, malondialdehyde, nitrate/nitrite, and alkaline phosphatase (ALP) were concomitantly lowered. epsilondA and epsilondC levels in WBC were positively correlated with plasma 8-isoprostane, malondialdehyde, and nitrate/nitrite levels and ALP activity, whereas plasma alpha-tocopherol levels showed inverse correlations. We conclude that chronic O.viverrini infection induces an accumulation of lipid peroxidation-derived DNA damage through oxidative/nitrative stress, which is lowered by the plasma alpha-tocopherol and by antiparasitic drug therapy. Etheno adducts in WBC and urine should be explored as a risk marker for opisthorchiasis-related cholangiocarcinoma, and to assess the efficacy of preventive and therapeutic interventions. PMID:20056652

  4. Dynamic changes in the distribution of a satellite homologous to intergenic 26-18S rDNA spacer in the evolution of Nicotiana.

    PubMed Central

    Lim, K Y; Skalicka, K; Koukalova, B; Volkov, R A; Matyasek, R; Hemleben, V; Leitch, A R; Kovarik, A

    2004-01-01

    An approximately 135-bp sequence called the A1/A2 repeat was isolated from the transcribed region of the 26-18S rDNA intergenic spacer (IGS) of Nicotiana tomentosiformis. Fluorescence in situ hybridization (FISH) and Southern blot analysis revealed its occurrence as an independent satellite (termed an A1/A2 satellite) outside of rDNA loci in species of Nicotiana section Tomentosae. The chromosomal location, patterns of genomic dispersion, and copy numbers of its tandemly arranged units varied between the species. In more distantly related Nicotiana species the A1/A2 repeats were found only at the nucleolar organizer regions (NOR). There was a trend toward the elimination of the A1/A2 satellite in N. tabacum (tobacco), an allotetraploid with parents closely related to the diploids N. sylvestris and N. tomentosiformis. This process may have already commenced in an S(3) generation of synthetic tobacco. Cytosine residues in the IGS were significantly hypomethylated compared with the A1/A2 satellite. There was no clear separation between the IGS and satellite fractions in sequence analysis of individual clones and we found no evidence for CG suppression. Taken together the data indicate a dynamic nature of the A1/A2 repeats in Nicotiana genomes, with evidence for recurrent integration, copy number expansions, and contractions. PMID:15126410

  5. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    SciTech Connect

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. ); Kalsheker, N. )

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  6. Physical organization of the 1.709 satellite IV DNA family in Bovini and Tragelaphini tribes of the Bovidae: sequence and chromosomal evolution.

    PubMed

    Adega, F; Chaves, R; Guedes-Pinto, H; Heslop-Harrison, J S

    2006-01-01

    Repetitive DNA in the mammalian genome is a valuable record and marker for evolution, providing information about the order and driving forces related to evolutionary events. The evolutionarily young 1.709 satellite IV DNA family is present near the centromeres of many chromosomes in the Bovidae. Here, we isolated 1.709 satellite DNA sequences from five Bovidae species belonging to Bovini: Bos taurus (BTA, cattle), Bos indicus (BIN, zebu), Bubalus bubalis (BBU, water buffalo) and Tragelaphini tribes: Taurotragus oryx (TOR, eland) and Tragelaphus euryceros (TEU, bongo). Its presence in both tribes shows the sequence predates the evolutionary separation of the two tribes (more than 10 million years ago), and primary sequence shows increasing divergence with evolutionary distance. Genome organization (Southern hybridization) and physical distribution (in situ hybridization) revealed differences in the molecular organization of these satellite DNA sequences. The data suggest that the sequences on the sex chromosomes and the autosomes evolve as relatively independent groups, with the repetitive sequences suggesting that Bovini autosomes and the Tragelaphini sex chromosomes represent the more primitive chromosome forms. PMID:16825766

  7. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  8. Structural and functional analysis of the control region of the human DNA topoisomerase II alpha gene in drug-resistant cells.

    PubMed

    Takano, H; Ise, T; Nomoto, M; Kato, K; Murakami, T; Ohmori, H; Imamura, T; Nagatani, G; Okamoto, T; Ohta, R; Furukawa, M; Shibao, K; Izumi, H; Kuwano, M; Kohno, K

    1999-04-01

    We have previously shown that the DNA topoisomerase II alpha (topo II alpha) gene is down-regulated in VP16/VM26-resistant cells at the transcriptional level. To determine the DNA elements responsible for down-regulation, the transcriptional activities of luciferase reporter constructs containing various lengths of the promoter sequences were investigated by transient transfection of two resistant cell lines, KB/VP2 and KB/VM4. The transcriptional activities of the full-length promoter (-295 to +85) and of three deletion constructs (-197, -154 and -74 to +85) were significantly down-regulated in resistant cells. In contrast, the transcriptional activity of the minimal promoter (-20 to +85) in resistant cells was similar to that in parental KB cells. Furthermore, introduction of a mutation in ICE1 abolished the down-regulation of the topo II alpha promoter activity in drug-resistant cells. In vivo footprinting analysis of topo II alpha gene promoter revealed several specific protein-binding sites, a GC box, ICE1, ICE2 and ICE3. In vivo footprinting analysis also identified a cluster of hypersensitive sites. However, there was no marked difference in protein-binding sites between parental and resistant cells. To confirm our previous results, we have established the VP16-resistant cell lines T12-VP1 and T12-VP2 from T12 cells derived from human bladder cancer T24 cells stably transfected with the chloramphenicol acetyltransferase reporter gene driven by the topo II alpha gene promoter. The expression to topo II alpha was down-regulated in both cell lines. We also found that CAT gene expression was significantly decreased to one-fifth of that in T12 parental cells. These results suggest that the expression of the topo II alpha gene requires the binding of multiple factors to the core promoter and is down-regulated at the transcriptional level, probably through binding of a negative factor to ICE1 in drug-resistant cells. PMID:10405635

  9. Purification and characterization of alpha-glucosidase I from Japanese honeybee (Apis cerana japonica) and molecular cloning of its cDNA.

    PubMed

    Wongchawalit, Jintanart; Yamamoto, Takeshi; Nakai, Hiroyuki; Kim, Young-Min; Sato, Natsuko; Nishimoto, Mamoru; Okuyama, Masayuki; Mori, Haruhide; Saji, Osamu; Chanchao, Chanpen; Wongsiri, Siriwat; Surarit, Rudee; Svasti, Jisnuson; Chiba, Seiya; Kimura, Atsuo

    2006-12-01

    alpha-Glucosidase (JHGase I) was purified from a Japanese subspecies of eastern honeybee (Apis cerana japonica) as an electrophoretically homogeneous protein. Enzyme activity of the crude extract was mainly separated into two fractions (component I and II) by salting-out chromatography. JHGase I was isolated from component I by further purification procedure using CM-Toyopearl 650M and Sephacryl S-100. JHGase I was a monomeric glycoprotein (containing 15% carbohydrate), of which the molecular weight was 82,000. Enzyme displayed the highest activity at pH 5.0, and was stable up to 40 degrees C and in a pH-range of 4.5-10.5. JHGase I showed unusual kinetic features: the negative cooperative behavior on the intrinsic reaction on cleavage of sucrose, maltose, and p-nitrophenyl alpha-glucoside, and the positive cooperative behavior on turanose. We isolated cDNA (1,930 bp) of JHGase I, of which the deduced amino-acid sequence (577 residues) confirmed that JHGase I was a member of alpha-amylase family enzymes. Western honeybees (Apis mellifera) had three alpha-glucosidase isoenzymes (WHGase I, II, and III), in which JHGase I was considered to correspond to WHGase I. PMID:17151473

  10. Molecular cloning, sequence, and expression of a human GDP-L-fucose:. beta. -D-galactoside 2-. alpha. -L-fucosyltransferase cDNA that can form the H blood group antigen

    SciTech Connect

    Larsen, R.D.; Ernst, L.K.; Nair, R.P.; Lowe, J.B. )

    1990-09-01

    The authors have previously used a gene-transfer scheme to isolate a human genomic DNA fragment that determines expression of a GDP-L-fucose:{beta}D-galactoside 2-{alpha}-L-fucosyltransferase. Although this fragment determined expression of an {alpha}(1,2)FT whose kinetic properties mirror those of the human H blood group {alpha}(1,2)FT, their precise nature remained undefined. They describe here the molecular cloning, sequence, and expression of a human of cDNA corresponding to these human genomic sequences. When expressed in COS-1 cells, the cDNA directs expression of cell surface H structures and a cognate {alpha}(1,2)FT activity with properties analogous to the human H blood group {alpha}(1,2)FT. The cDNA sequence predicts a 365-amino acid polypeptide characteristic of a type II transmembrane glycoprotein with a domain structure analogous to that of other glycosyltransferases but without significant primary sequence similarity to these or other known proteins. To directly demonstrate that the cDNA encodes an {alpha}(1,2)FT, the COOH-terminal domain predicted to be Golgi-resident was expressed in COS-1 cells as a catalytically active, secreted, and soluble protein A fusion peptide. Southern blot analysis showed that this cDNA identified DNA sequences syntenic to the human H locus on chromosome 19. These results strongly suggest that this cloned {alpha}(1,2)FT cDNA represents the product of the human H blood group locus.

  11. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    PubMed

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  12. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  13. The Saccharomyces cerevisiae DNA polymerase alpha catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein.

    PubMed Central

    Wittmeyer, J; Formosa, T

    1997-01-01

    We have used DNA polymerase alpha affinity chromatography to identify factors involved in eukaryotic DNA replication in the yeast Saccharomyces cerevisiae. Two proteins that bound to the catalytic subunit of DNA polymerase alpha (Pol1 protein) are encoded by the essential genes CDC68/SPT16 and POB3. The binding of both proteins was enhanced when extracts lacking a previously characterized polymerase binding protein, Ctf4, were used. This finding suggests that Cdc68 and Pob3 may compete with Ctf4 for binding to Pol1. Pol1 and Pob3 were coimmunoprecipitated from whole-cell extracts with antiserum directed against Cdc68, and Pol1 was immunoprecipitated from whole-cell extracts with antiserum directed against the amino terminus of Pob3, suggesting that these proteins may form a complex in vivo. CDC68 also interacted genetically with POL1 and CTF4 mutations; the maximum permissive temperature of double mutants was lower than for any single mutant. Overexpression of Cdc68 in a pol1 mutant strain dramatically decreased cell viability, consistent with the formation or modulation of an essential complex by these proteins in vivo. A mutation in CDC68/SPT16 had previously been shown to cause pleiotropic effects on the regulation of transcription (J. A. Prendergrast et al., Genetics 124:81-90, 1990; E. A. Malone et al., Mol. Cell. Biol. 11:5710-5717, 1991; A. Rowley et al., Mol. Cell. Biol. 11:5718-5726, 1991), with a spectrum of phenotypes similar to those caused by mutations in the genes encoding histone proteins H2A and H2B (Malone et al., Mol. Cell. Biol. 11:5710-5717, 1991). We show that at the nonpermissive temperature, cdc68-1 mutants arrest as unbudded cells with a 1C DNA content, consistent with a possible role for Cdc68 in the prereplicative stage of the cell cycle. The cdc68-1 mutation caused elevated rates of chromosome fragment loss, a phenotype characteristic of genes whose native products are required for normal DNA metabolism. However, this mutation did not

  14. Exploring the Diversity of Plant DNA Viruses and Their Satellites Using Vector-Enabled Metagenomics on Whiteflies

    PubMed Central

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E.; Bixby, Elise; Vallad, Gary E.; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed “vector-enabled metagenomics” (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral

  15. Exploring the diversity of plant DNA viruses and their satellites using vector-enabled metagenomics on whiteflies.

    PubMed

    Ng, Terry Fei Fan; Duffy, Siobain; Polston, Jane E; Bixby, Elise; Vallad, Gary E; Breitbart, Mya

    2011-01-01

    Current knowledge of plant virus diversity is biased towards agents of visible and economically important diseases. Less is known about viruses that have not caused major diseases in crops, or viruses from native vegetation, which are a reservoir of biodiversity that can contribute to viral emergence. Discovery of these plant viruses is hindered by the traditional approach of sampling individual symptomatic plants. Since many damaging plant viruses are transmitted by insect vectors, we have developed "vector-enabled metagenomics" (VEM) to investigate the diversity of plant viruses. VEM involves sampling of insect vectors (in this case, whiteflies) from plants, followed by purification of viral particles and metagenomic sequencing. The VEM approach exploits the natural ability of highly mobile adult whiteflies to integrate viruses from many plants over time and space, and leverages the capability of metagenomics for discovering novel viruses. This study utilized VEM to describe the DNA viral community from whiteflies (Bemisia tabaci) collected from two important agricultural regions in Florida, USA. VEM successfully characterized the active and abundant viruses that produce disease symptoms in crops, as well as the less abundant viruses infecting adjacent native vegetation. PCR assays designed from the metagenomic sequences enabled the complete sequencing of four novel begomovirus genome components, as well as the first discovery of plant virus satellites in North America. One of the novel begomoviruses was subsequently identified in symptomatic Chenopodium ambrosiodes from the same field site, validating VEM as an effective method for proactive monitoring of plant viruses without a priori knowledge of the pathogens. This study demonstrates the power of VEM for describing the circulating viral community in a given region, which will enhance our understanding of plant viral diversity, and facilitate emerging plant virus surveillance and management of viral diseases

  16. Sealing of chromosomal DNA nicks during nucleotide excision repair requires XRCC1 and DNA ligase III alpha in a cell-cycle-specific manner.

    PubMed

    Moser, Jill; Kool, Hanneke; Giakzidis, Ioannis; Caldecott, Keith; Mullenders, Leon H F; Fousteri, Maria I

    2007-07-20

    Impaired gap filling and sealing of chromosomal DNA in nucleotide excision repair (NER) leads to genome instability. XRCC1-DNA ligase IIIalpha (XRCC1-Lig3) plays a central role in the repair of DNA single-strand breaks but has never been implicated in NER. Here we show that XRCC1-Lig3 is indispensable for ligation of NER-induced breaks and repair of UV lesions in quiescent cells. Furthermore, our results demonstrate that two distinct complexes differentially carry out gap filling in NER. XRCC1-Lig3 and DNA polymerase delta colocalize and interact with NER components in a UV- and incision-dependent manner throughout the cell cycle. In contrast, DNA ligase I and DNA polymerase epsilon are recruited to UV-damage sites only in proliferating cells. This study reveals an unexpected and key role for XRCC1-Lig3 in maintenance of genomic integrity by NER in both dividing and nondividing cells and provides evidence for cell-cycle regulation of NER-mediated repair synthesis in vivo. PMID:17643379

  17. The G115S mutation associated with maturity-onset diabetes of the young impairs hepatocyte nuclear factor 4alpha activities and introduces a PKA phosphorylation site in its DNA-binding domain.

    PubMed

    Oxombre, Bénédicte; Kouach, Mostafa; Moerman, Ericka; Formstecher, Pierre; Laine, Bernard

    2004-11-01

    HNF4alpha (hepatocyte nuclear factor 4alpha) belongs to a complex transcription factor network that is crucial for the function of hepatocytes and pancreatic beta-cells. In these cells, it activates the expression of a very large number of genes, including genes involved in the transport and metabolism of glucose and lipids. Mutations in the HNF4alpha gene correlate with MODY1 (maturity-onset diabetes of the young 1), a form of type II diabetes characterized by an impaired glucose-induced insulin secretion. The MODY1 G115S (Gly115-->Ser) HNF4alpha mutation is located in the DNA-binding domain of this nuclear receptor. We show here that the G115S mutation failed to affect HNF4alpha-mediated transcription on apolipoprotein promoters in HepG2 cells. Conversely, in pancreatic beta-cell lines, this mutation resulted in strong impairments of HNF4alpha transcriptional activity on the promoters of LPK (liver pyruvate kinase) and HNF1alpha, with this transcription factor playing a key role in endocrine pancreas. We show as well that the G115S mutation creates a PKA (protein kinase A) phosphorylation site, and that PKA-mediated phosphorylation results in a decreased transcriptional activity of the mutant. Moreover, the G115E (Gly115-->Glu) mutation mimicking phosphorylation reduced HNF4alpha DNA-binding and transcriptional activities. Our results may account for the 100% penetrance of diabetes in human carriers of this mutation. In addition, they suggest that introduction of a phosphorylation site in the DNA-binding domain may represent a new mechanism by which a MODY1 mutation leads to loss of HNF4alpha function. PMID:15233628

  18. DNA cleavage by new oxovanadium(IV) complexes of N-salicylidene alpha-amino acids and phenanthroline bases in the photodynamic therapy window.

    PubMed

    Sasmal, Pijus K; Patra, Ashis K; Nethaji, Munirathinam; Chakravarty, Akhil R

    2007-12-24

    Oxovanadium(IV) complexes [VO(salmet)(B)] (1-3) and [VO(saltrp)(B)] (4-6), where salmet and saltrp are N-salicylidene-l-methionate and N-salicylidene-l-tryptophanate, respectively, and B is a N,N-donor heterocyclic base (viz. 1,10-phenanthroline (phen, 1, 4), dipyrido[3,2-d:2',3'-f]quinoxaline (dpq, 2, 5), and dipyrido[3,2-a:2',3'-c]phenazine (dppz, 3, 6)) are prepared and characterized and their DNA binding and photoinduced DNA cleavage activity studied. Complexes 1, 2, and 4 are structurally characterized by single-crystal X-ray crystallography. The molecular structure shows the presence of a vanadyl group in the VO3N3 coordination geometry. The dianionic alpha-amino acid Schiff base acts as a tridentate O,N,O-donor ligand in a meridional binding mode. The N,N-donor heterocyclic base displays a chelating mode of bonding with a N-donor site trans to the oxo group. The complexes show a d-d band in the range of 680-710 nm in DMF with a shoulder near 840 nm. They exhibit an irreversible oxidative cyclic voltammetric response near 0.8 V assignable to the V(V)/V(IV) couple and a quasi-reversible V(IV)/V(III) redox couple near -1.1 V vs SCE in DMF-0.1 M TBAP. The complexes show good binding propensity to calf thymus DNA giving binding constant values in the range from 5.2 x 10(4) to 7.2 x 10(5) M(-1). The binding site size, thermal melting, and viscosity data suggest DNA surface and/or groove binding nature of the complexes. The complexes show poor "chemical nuclease" activity in the dark in the presence of 3-mercaptopropionic acid or hydrogen peroxide. The dpq and dppz complexes show efficient DNA cleavage activity on irradiation with UV-A light of 365 nm via a mechanistic pathway involving formation of singlet oxygen as the reactive species. They also show significant DNA cleavage activity on photoexcitation in red light (>750 nm) by (1)O2 species. Observation of red-light-induced cleavage of DNA is unprecedented in the vanadium chemistry. The DNA cleavage activity is

  19. Albumin and alpha-fetoprotein gene transcription in rat hepatoma cell lines is correlated with specific DNA hypomethylation and altered chromatin structure in the 5' region.

    PubMed Central

    Tratner, I; Nahon, J L; Sala-Trepat, J M; Venetianer, A

    1987-01-01

    We examined DNA methylation and DNase I hypersensitivity of the alpha-fetoprotein (AFP) and albumin gene region in hepatoma cell lines which showed drastic differences in the level of expression of these genes. We assayed for methylation of the CCGG sequences by using the restriction enzyme isoschizomers HpaII and MspI. We found two methylation sites located in the 5' region of the AFP gene and one in exon 1 of the albumin gene for which hypomethylation is correlated with gene expression. Another such site, located about 4,000 base pairs upstream from the AFP gene, seems to be correlated with the tissue specificity of the cells. DNase I-hypersensitive sites were mapped by using the indirect end-labeling technique with cloned genomic DNA probes. Three tissue-specific DNase I-hypersensitive sites were mapped in the 5' flanking region of the AFP gene when this gene was transcribed. Similarly, three tissue-specific DNase I-hypersensitive sites were detected upstream from the albumin gene in producing cell lines. In both cases, the most distal sites were maintained after cessation of gene activity and appear to be correlated with the potential expression of the gene. Interestingly, specific methylation sites are localized in the same DNA region as DNase I hypersensitive sites. This suggests that specific alterations of chromatin structure and changes in methylation pattern occur in specific critical regulatory regions upstream from the albumin and AFP genes in rat hepatoma cell lines. Images PMID:2439898

  20. A sensitive amperometric immunosensor for alpha-fetoprotein based on carbon nanotube/DNA/Thi/nano-Au modified glassy carbon electrode.

    PubMed

    Ran, Xiao-Qi; Yuan, Ruo; Chai, Ya-Qin; Hong, Cheng-Lin; Qian, Xiao-Qing

    2010-09-01

    A novel amperometric immunosensor for the determination of alpha-fetoprotein (AFP) was constructed using films of multi-wall carbon nanotubes/DNA/thionine/gold nanoparticles (nano-Au). Firstly, multiwall carbon nanotubes (MWCNT) dispersed in poly(diallydimethlammonium chloride) (PDDA) were immobilized on the nano-Au film which was electrochemically deposited on the surface of glassy carbon electrode. Then a negatively charged DNA film was absorbed on the positively charged PDDA. Subsequently, thionine was attached to the electrode via the electrostatic interaction between thionine and the DNA. Finally, the nano-Au was retained on the thionine film for immobilization of AFP antibody (anti-AFP). The modification process was characterized by cyclic voltammetry (CV) and scanning electron microscope (SEM). The factors possibly influenced the performance of the proposed immunosensors were studied in detail. Under optimal conditions, the proposed immunosensor exhibited good electrochemical behavior to AFP in a two concentration ranges: 0.01-10.0 and 10.0-200.0 ng/mL with a relatively low detection limit of 0.04 ng/mL at three times the background noise. Moreover, the selectivity, repeatability and stability of the proposed immunosensor were acceptable. PMID:20627666

  1. The Structure of DNA-Bound Human Topoisomerase II Alpha: Conformational Mechanisms for Coordinating Inter-Subunit Interactions with DNA Cleavage

    PubMed Central

    Wendorff, Timothy J.; Schmidt, Bryan H.; Heslop, Pauline; Austin, Caroline A.; Berger, James M.

    2012-01-01

    Type II topoisomerases are required for the management of DNA superhelicity and chromosome segregation, and serve as frontline targets for a variety of small-molecule therapeutics. To better understand how these enzymes act in both contexts, we determined the 2.9-Å-resolution structure of the DNA cleavage core of human topoisomerase IIα (TOP2A) bound to a doubly nicked, 30-bp duplex oligonucleotide. In accord with prior biochemical and structural studies, TOP2A significantly bends its DNA substrate using a bipartite, nucleolytic center formed at an N-terminal dimerization interface of the cleavage core. However, the protein also adopts a global conformation in which the second of its two inter-protomer contact points, one at the C-terminus, has separated. This finding, together with comparative structural analyses, reveals that the principal site of DNA engagement undergoes highly quantized conformational transitions between distinct binding, cleavage, and drug-inhibited states that correlate with the control of subunit–subunit interactions. Additional consideration of our TOP2A model in light of an etoposide-inhibited complex of human topoisomerase IIβ (TOP2B) suggests possible modification points for developing paralog-specific inhibitors to overcome the tendency of topoisomerase II-targeting chemotherapeutics to generate secondary malignancies. PMID:22841979

  2. Identification of a novel alpha-amylase by expression of a newly cloned human amy3 cDNA in yeast.

    PubMed

    Shiosaki, K; Takata, K; Omichi, K; Tomita, N; Horii, A; Ogawa, M; Matsubara, K

    1990-05-14

    A novel amylase gene (amy3) that differs in nucleotide sequence from salivary amylase gene (amy1) and pancreatic amylase gene (amy2) has been described [Tomita et al., Gene 76 (1989) 11-18], but whether this gene can ever code for an active enzyme has not been shown. We prepared cDNA of this gene from an mRNA obtained from lung carcinoid tissue, and expressed it in Saccharomyces cerevisiae under the control of an acid phosphatase promoter. The product was secreted into culture media, and showed enzymatic activity, demonstrating that this novel alpha-amylase gene (amy3) can code for a functional isozyme. We purified this enzyme, and compared its biological properties with those of salivary and pancreatic human amylases similarly expressed in yeast. We observed that the novel amylase isozyme is more heat-sensitive than others, and that its substrate specificity is different from the other two isozymes. PMID:2197187

  3. Relationship between maternal environment and DNA methylation patterns of estrogen receptor alpha in wild Eastern Bluebird (Sialia sialis) nestlings: a pilot study.

    PubMed

    Bentz, Alexandra B; Sirman, Aubrey E; Wada, Haruka; Navara, Kristen J; Hood, Wendy R

    2016-07-01

    There is mounting evidence that, across taxa, females breeding in competitive environments tend to allocate more testosterone to their offspring prenatally and these offspring typically have more aggressive and faster-growing phenotypes. To date, no study has determined the mechanisms mediating this maternal effect's influence on offspring phenotype. However, levels of estrogen receptor alpha (ER α) gene expression are linked to differences in early growth and aggression; thus, maternal hormones may alter gene regulation, perhaps via DNA methylation, of ER α in offspring during prenatal development. We performed a pilot study to examine natural variation in testosterone allocation to offspring through egg yolks in wild Eastern Bluebirds (Sialia sialis) in varying breeding densities and percent DNA methylation of CG dinucleotides in the ER α promoter in offspring brain regions associated with growth and behavior. We hypothesized that breeding density would be positively correlated with yolk testosterone, and prenatal exposure to maternal-derived yolk testosterone would be associated with greater offspring growth and decreased ER α promoter methylation. Yolk testosterone concentration was positively correlated with breeding density, nestling growth rate, and percent DNA methylation of one out of five investigated CpG sites (site 3) in the diencephalon ER α promoter, but none in the telencephalon (n = 10). Percent DNA methylation of diencephalon CpG site 3 was positively correlated with growth rate. These data suggest a possible role for epigenetics in mediating the effects of the maternal environment on offspring phenotype. Experimentally examining this mechanism with a larger sample size in future studies may help elucidate a prominent way in which animals respond to their environment. Further, by determining the mechanisms that mediate maternal effects, we can begin to understand the potential for the heritability of these mechanisms and the impact that

  4. The highly conserved amino acid sequence motif Tyr-Gly-Asp-Thr-Asp-Ser in alpha-like DNA polymerases is required by phage phi 29 DNA polymerase for protein-primed initiation and polymerization.

    PubMed Central

    Bernad, A; Lázaro, J M; Salas, M; Blanco, L

    1990-01-01

    The alpha-like DNA polymerases from bacteriophage phi 29 and other viruses, prokaryotes and eukaryotes contain an amino acid consensus sequence that has been proposed to form part of the dNTP binding site. We have used site-directed mutants to study five of the six highly conserved consecutive amino acids corresponding to the most conserved C-terminal segment (Tyr-Gly-Asp-Thr-Asp-Ser). Our results indicate that in phi 29 DNA polymerase this consensus sequence, although irrelevant for the 3'----5' exonuclease activity, is essential for initiation and elongation. Based on these results and on its homology with known or putative metal-binding amino acid sequences, we propose that in phi 29 DNA polymerase the Tyr-Gly-Asp-Thr-Asp-Ser consensus motif is part of the dNTP binding site, involved in the synthetic activities of the polymerase (i.e., initiation and polymerization), and that it is involved particularly in the metal binding associated with the dNTP site. Images PMID:2191296

  5. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  6. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  7. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    PubMed

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes. PMID:26205503

  8. Alpha-CENTAURI: assessing novel centromeric repeat sequence variation with long read sequencing

    PubMed Central

    Sevim, Volkan; Bashir, Ali; Chin, Chen-Shan; Miga, Karen H.

    2016-01-01

    Motivation: Long arrays of near-identical tandem repeats are a common feature of centromeric and subtelomeric regions in complex genomes. These sequences present a source of repeat structure diversity that is commonly ignored by standard genomic tools. Unlike reads shorter than the underlying repeat structure that rely on indirect inference methods, e.g. assembly, long reads allow direct inference of satellite higher order repeat structure. To automate characterization of local centromeric tandem repeat sequence variation we have designed Alpha-CENTAURI (ALPHA satellite CENTromeric AUtomated Repeat Identification), that takes advantage of Pacific Bioscience long-reads from whole-genome sequencing datasets. By operating on reads prior to assembly, our approach provides a more comprehensive set of repeat-structure variants and is not impacted by rearrangements or sequence underrepresentation due to misassembly. Results: We demonstrate the utility of Alpha-CENTAURI in characterizing repeat structure for alpha satellite containing reads in the hydatidiform mole (CHM1, haploid-like) genome. The pipeline is designed to report local repeat organization summaries for each read, thereby monitoring rearrangements in repeat units, shifts in repeat orientation and sites of array transition into non-satellite DNA, typically defined by transposable element insertion. We validate the method by showing consistency with existing centromere high order repeat references. Alpha-CENTAURI can, in principle, run on any sequence data, offering a method to generate a sequence repeat resolution that could be readily performed using consensus sequences available for other satellite families in genomes without high-quality reference assemblies. Availability and implementation: Documentation and source code for Alpha-CENTAURI are freely available at http://github.com/volkansevim/alpha-CENTAURI. Contact: ali.bashir@mssm.edu Supplementary information: Supplementary data are available at

  9. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central

    2010-01-01

    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  10. Centriolar Satellites

    PubMed Central

    Kubo, Akiharu; Sasaki, Hiroyuki; Yuba-Kubo, Akiko; Tsukita, Shoichiro; Shiina, Nobuyuki

    1999-01-01

    We identified Xenopus pericentriolar material-1 (PCM-1), which had been reported to constitute pericentriolar material, cloned its cDNA, and generated a specific pAb against this molecule. Immunolabeling revealed that PCM-1 was not a pericentriolar material protein, but a specific component of centriolar satellites, morphologically characterized as electron-dense granules, ∼70–100 nm in diameter, scattered around centrosomes. Using a GFP fusion protein with PCM-1, we found that PCM-1–containing centriolar satellites moved along microtubules toward their minus ends, i.e., toward centrosomes, in live cells, as well as in vitro reconstituted asters. These findings defined centriolar satellites at the molecular level, and explained their pericentriolar localization. Next, to understand the relationship between centriolar satellites and centriolar replication, we examined the expression and subcellular localization of PCM-1 in ciliated epithelial cells during ciliogenesis. When ciliogenesis was induced in mouse nasal respiratory epithelial cells, PCM-1 immunofluorescence was markedly elevated at the apical cytoplasm. At the electron microscopic level, anti–PCM-1 pAb exclusively labeled fibrous granules, but not deuterosomes, both of which have been suggested to play central roles in centriolar replication in ciliogenesis. These findings suggested that centriolar satellites and fibrous granules are identical novel nonmembranous organelles containing PCM-1, which may play some important role(s) in centriolar replication. PMID:10579718

  11. Alpha taxonomy of the genus Kessleria Nowicki, 1864, revisited in light of DNA-barcoding (Lepidoptera, Yponomeutidae)

    PubMed Central

    Huemer, Peter; Mutanen, Marko

    2015-01-01

    Abstract The taxonomy of Kessleria, a highly specialized montane genus of Yponomeutidae with larval host restriction to Saxifragaceae and Celastraceae (Saxifraga spp. – subgenus Kessleria; Saxifraga spp. and Parnassia spp. – subgenus Hofmannia), is revised based on external morphology, genitalia and DNA barcodes. An integrative taxonomic approach supports the existence of 29 species in Europe (the two known species from Asia and North America are not treated herein). A full 658 bp fragment of COI was obtained from 135 specimens representing 24 species, a further seven sequences are >560 bp. Five new species are described: Kessleria cottiensis sp. n. (Prov. Torino, Italy; Dep. Hautes Alpes, France), Kessleria dimorpha sp. n. (Dep. Alpes-de-Haute-Provence, France), Kessleria alpmaritimae sp. n. (Dep. Alpes-Maritimes, France), Kessleria apenninica sp. n. (Prov. Rieti, Prov. L´Aquila, Italy), and Kessleria orobiae sp. n. (Prov. Bergamo, Italy). PMID:26019672

  12. Hepatic global DNA and peroxisome proliferator-activated receptor alpha promoter methylation are altered in peripartal dairy cows fed rumen-protected methionine.

    PubMed

    Osorio, J S; Jacometo, C B; Zhou, Z; Luchini, D; Cardoso, F C; Loor, J J

    2016-01-01

    The availability of Met in metabolizable protein (MP) of a wide range of diets for dairy cows is low. During late pregnancy and early lactation, in particular, suboptimal Met in MP limits its use for mammary and liver metabolism and also for the synthesis of S-adenosylmethionine, which is essential for many biological processes, including DNA methylation. The latter is an epigenetic modification involved in the regulation of gene expression, hence, tissue function. Thirty-nine Holstein cows were fed throughout the peripartal period (-21 d to 30 d in milk) a basal control (CON) diet (n=14) with no Met supplementation, CON plus MetaSmart (MS; Adisseo NA, Alpharetta, GA; n=12), or CON plus Smartamine M (SM; Adisseo NA; n=13). The total mixed ration dry matter for the close-up and lactation diets was measured weekly, then the Met supplements were adjusted daily and top-dressed over the total mixed ration at a rate of 0.19 (MS) or 0.07% (SM) on a dry matter basis. Liver tissue was collected on -10, 7, and 21 d for global DNA and peroxisome proliferator-activated receptor alpha (PPARα) promoter region-specific methylation. Several PPARα target and putative target genes associated with carnitine synthesis and uptake, fatty acid metabolism, hepatokines, and carbohydrate metabolism were also studied. Data were analyzed using PROC MIXED of SAS (SAS Institute Inc., Cary, NC) with the preplanned contrast CON versus SM + MS. Global hepatic DNA methylation on d 21 postpartum was lower in Met-supplemented cows than CON. However, of 2 primers used encompassing 4 to 12 CpG sites in the promoter region of bovine PPARA, greater methylation occurred in the region encompassing -1,538 to -1,418 from the transcription start site in cows supplemented with Met. Overall expression of PPARA was greater in Met-supplemented cows than CON. Concomitantly, PPARA-target genes, such as ANGPTL4, FGF21, and PCK1, were also upregulated overall by Met supplementation. The upregulation of PPAR

  13. A Naturally Occurring Defective DNA Satellite Associated with a Monopartite Begomovirus: Evidence for Recombination between Alphasatellite and Betasatellite

    PubMed Central

    Huang, Changjun; Xie, Yan; Zhao, Liling; Ren, He; Li, Zhenghe

    2013-01-01

    Monopartite begomoviruses and their associated satellites form unique disease complexes that have emerged as a serious threat to agriculture worldwide. It is well known that frequent recombination contributes to the diversification and evolution of geminiviruses. In this study, we identified a novel defective satellite molecule (RecSat) in association with Tobacco leaf curl Yunnan virus (TbLCYNV) in a naturally infected tobacco plant. Sequence analysis showed that Recsat comprises 754 nucleotides in size and is a chimera involving alphasatellite and betasatellite sequences, containing both betasatellite-conserved region and alphasatellite stem-loop structure. Recombination analysis revealed that RecSat has arisen from three independent recombination events likely involving Tomato yellow leaf curl China betasatellite, Ageratum yellow vein China betasatellite and Tobacco curly shoot alphasatellite. Co-inoculation of RecSat with TbLCYNV induced symptoms indistinguishable from those induced by TbLCYNV alone in Nicotiana benthamiana. Southern blot hybridization showed that RecSat could be trans-replicated stably in N. benthamiana plants by TbLCYNV, and impaired the accumulation of helper virus and co-inoculated alphasatellite. Our results provide the first evidence for recombination between two distinct types of satellites among geminivirus complex and highlight recombination as a driving force for geminivirus evolution. PMID:24018984

  14. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  15. Cloning and characterization of the 5'-upstream sequence governing the cell cycle-dependent transcription of mouse DNA polymerase alpha 68 kDa subunit gene.

    PubMed

    Nishikawa, N S; Izumi, M; Uchida, H; Yokoi, M; Miyazawa, H; Hanaoka, F

    2000-04-01

    We have isolated the genomic DNA fragment spanning the 5-end and the first four exons encoding the 68 kDa subunit (p68) of the mouse DNA polymerase alpha-primase complex [corrected]. The p68 promoter region lacks TATA and CAAT boxes, but contains a GC-rich sequence, two palindrome sequences and two putative E2F-binding sites [corrected]. A series of transient expression assays using a luciferase reporter gene indicated that a region from nucleotide position -89 to -30 (-89/-30) with respect to the transcription initiation site is crucial for basal transcription of the p68 gene in proliferating NIH 3T3 cells. In particular, part of the GC-rich sequence (-57/-46) and the palindrome (-81/-62) elements were necessary for promoter activity, both of which share homology with the E-box sequence. Gel mobility shift assays using NIH 3T3 nuclear extracts revealed that the upstream stimulatory factor, known as an E-box-binding protein, binds to these sites. Moreover, we observed binding of E2F to two sites near the transcription initiation site (-11/-3 and +9/+16). A transient luciferase expression assay using synchronized NIH 3T3 cells in G(0)phase revealed that these E2F sites are essential for transcription induction of the p68 gene after serum stimulation, but are dispensable for basal transcription. These results indicate that growth-dependent regulation of transcription of the mouse p68 and p180 genes is mediated by a common factor, E2F; however, basal transcription of the genes, interestingly, is regulated by different transcription factors. PMID:10710418

  16. Genome-wide analysis of tandem repeats in Tribolium castaneum genome reveals abundant and highly dynamic tandem repeat families with satellite DNA features in euchromatic chromosomal arms

    PubMed Central

    Pavlek, Martina; Gelfand, Yevgeniy; Plohl, Miroslav; Meštrović, Nevenka

    2015-01-01

    Although satellite DNAs are well-explored components of heterochromatin and centromeres, little is known about emergence, dispersal and possible impact of comparably structured tandem repeats (TRs) on the genome-wide scale. Our bioinformatics analysis of assembled Tribolium castaneum genome disclosed significant contribution of TRs in euchromatic chromosomal arms and clear predominance of satellite DNA-typical 170 bp monomers in arrays of ≥5 repeats. By applying different experimental approaches, we revealed that the nine most prominent TR families Cast1–Cast9 extracted from the assembly comprise ∼4.3% of the entire genome and reside almost exclusively in euchromatic regions. Among them, seven families that build ∼3.9% of the genome are based on ∼170 and ∼340 bp long monomers. Results of phylogenetic analyses of 2500 monomers originating from these families show high-sequence dynamics, evident by extensive exchanges between arrays on non-homologous chromosomes. In addition, our analysis shows that concerted evolution acts more efficiently on longer than on shorter arrays. Efficient genome-wide distribution of nine TR families implies the role of transposition only in expansion of the most dispersed family, and involvement of other mechanisms is anticipated. Despite similarities in sequence features, FISH experiments indicate high-level compartmentalization of centromeric and euchromatic tandem repeats. PMID:26428853

  17. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

    PubMed

    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R

    1995-11-01

    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  18. Structural bases of dimerization of yeast telomere protein Cdc13 and its interaction with the catalytic subunit of DNA polymerase [alpha

    SciTech Connect

    Sun, Jia; Yang, Yuting; Wan, Ke; Mao, Ninghui; Yu, Tai-Yuan; Lin, Yi-Chien; DeZwaan, Diane C.; Freeman, Brian C.; Lin, Jing-Jer; Lue, Neal F.; Lei, Ming

    2011-08-24

    Budding yeast Cdc13-Stn1-Ten1 (CST) complex plays an essential role in telomere protection and maintenance, and has been proposed to be a telomere-specific replication protein A (RPA)-like complex. Previous genetic and structural studies revealed a close resemblance between Stn1-Ten1 and RPA32-RPA14. However, the relationship between Cdc13 and RPA70, the largest subunit of RPA, has remained unclear. Here, we report the crystal structure of the N-terminal OB (oligonucleotide/oligosaccharide binding) fold of Cdc13. Although Cdc13 has an RPA70-like domain organization, the structures of Cdc13 OB folds are significantly different from their counterparts in RPA70, suggesting that they have distinct evolutionary origins. Furthermore, our structural and biochemical analyses revealed unexpected dimerization by the N-terminal OB fold and showed that homodimerization is probably a conserved feature of all Cdc13 proteins. We also uncovered the structural basis of the interaction between the Cdc13 N-terminal OB fold and the catalytic subunit of DNA polymerase {alpha} (Pol1), and demonstrated a role for Cdc13 dimerization in Pol1 binding. Analysis of the phenotypes of mutants defective in Cdc13 dimerization and Cdc13-Pol1 interaction revealed multiple mechanisms by which dimerization regulates telomere lengths in vivo. Collectively, our findings provide novel insights into the mechanisms and evolution of Cdc13.

  19. Stable transfection of protein kinase C alpha cDNA in hormone-dependent breast cancer cell lines

    PubMed Central

    Tonetti, D A; Chisamore, M J; Grdina, W; Schurz, H; Jordan, V C

    2000-01-01

    An inverse relationship between protein kinase C (PKC) activity and oestrogen receptor (ER) expression in human breast cell lines and tumours has been firmly established over the past 10 years. To determine whether specific alterations in PKC expression accompany hormone-independence, we examined the expression of PKC isozymes in the hormone-independent human breast cancer cell clones MCF-7 5C and T47D:C42 compared with their hormone-dependent counterparts, MCF-7 A4, MCF-7 WS8 and T47D:A18 respectively. Both hormone-independent cell clones exhibit elevated PKCα expression and increased basal AP-1 activity compared with the hormone-dependent cell clones. To determine whether PKCα overexpression is sufficient to mediate the hormone-independent phenotype, we stably transfected an expression plasmid containing PKCα cDNA to the T47D:A18 and MCF-7 A4 cell lines. This is the first report of PKCα transfection in T47D cells. In contrast to MCF-7 cells, T47D has the propensity to lose the ER and more readily forms tamoxifen-stimulated tumours in athymic mice. We find that in T47D:A18/PKCα clones, there is concomitant up-regulation of PKC βI and δ, whereas in the MCF-7 A4/PKCα transfectants PKC ɛ is up-regulated. In T47D:A18, but not in MCF-7 A4, PKCα stable transfection is accompanied by down-regulation of ER function whilst basal AP-1 activity is elevated. Our results suggest PKCα overexpression may play a role in growth signalling during the shift from hormone dependent to hormone-independent breast cancers. © 2000 Cancer Research Campaign PMID:10952784

  20. Complementary DNA and derived amino acid sequence of the. beta. subunit of human complement protein C8: identification of a close structural and ancestral relationship to the. cap alpha. subunit and C9

    SciTech Connect

    Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.

    1987-06-16

    A cDNA clone encoding the ..beta.. subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire ..beta.. sequence (1608 base pairs (bp)). Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for ..beta.. to be approx. 2.5 kb. This is similar to the message size for the ..cap alpha.. subunit of C8 and confirms the existence of different mRNAs for ..cap alpha.. and ..beta... This finding supports genetic evidence that ..cap alpha.. and ..beta.. are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate ..beta.. interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the ..beta.. sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For ..beta.. and ..cap alpha.., the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For ..beta.. and C9, the values are 26% and 47/sup 5/, respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that ..cap alpha.., ..beta.. and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association.

  1. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.

    PubMed

    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P

    2003-11-01

    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  2. DNA Double Strand Breaks as Predictor of Efficacy of the Alpha-Particle Emitter Ac-225 and the Electron Emitter Lu-177 for Somatostatin Receptor Targeted Radiotherapy

    PubMed Central

    Graf, Franziska; Fahrer, Jörg; Maus, Stephan; Morgenstern, Alfred; Bruchertseifer, Frank; Venkatachalam, Senthil; Fottner, Christian; Weber, Matthias M.; Huelsenbeck, Johannes; Schreckenberger, Mathias; Kaina, Bernd; Miederer, Matthias

    2014-01-01

    Rationale Key biologic effects of the alpha-particle emitter Actinium-225 in comparison to the beta-particle emitter Lutetium-177 labeled somatostatin-analogue DOTATOC in vitro and in vivo were studied to evaluate the significance of γH2AX-foci formation. Methods To determine the relative biological effectiveness (RBE) between the two isotopes (as - biological consequence of different ionisation-densities along a particle-track), somatostatin expressing AR42J cells were incubated with Ac-225-DOTATOC and Lu-177-DOTATOC up to 48 h and viability was analyzed using the MTT assay. DNA double strand breaks (DSB) were quantified by immunofluorescence staining of γH2AX-foci. Cell cycle was analyzed by flow cytometry. In vivo uptake of both radiolabeled somatostatin-analogues into subcutaneously growing AR42J tumors and the number of cells displaying γH2AX-foci were measured. Therapeutic efficacy was assayed by monitoring tumor growth after treatment with activities estimated from in vitro cytotoxicity. Results Ac-225-DOTATOC resulted in ED50 values of 14 kBq/ml after 48 h, whereas Lu-177-DOTATOC displayed ED50 values of 10 MBq/ml. The number of DSB grew with increasing concentration of Ac-225-DOTATOC and similarly with Lu-177-DOTATOC when applying a factor of 700-fold higher activity compared to Ac-225. Already 24 h after incubation with 2.5–10 kBq/ml, Ac-225-DOTATOC cell-cycle studies showed up to a 60% increase in the percentage of tumor cells in G2/M phase. After 72 h an apoptotic subG1 peak was also detectable. Tumor uptake for both radio peptides at 48 h was identical (7.5%ID/g), though the overall number of cells with γH2AX-foci was higher in tumors treated with 48 kBq Ac-225-DOTATOC compared to tumors treated with 30 MBq Lu-177-DOTATOC (35% vs. 21%). Tumors with a volume of 0.34 ml reached delayed exponential tumor growth after 25 days (44 kBq Ac-225-DOTATOC) and after 21 days (34 MBq Lu-177-DOTATOC). Conclusion γH2AX-foci formation, triggered by beta- and

  3. Expression of ATP synthase CF1 alpha subunit gene (CTL-spn) as screened by the cDNA-SRAP approach is correlated with spininess in Carthamus tinctorius L.

    PubMed

    Guo, Dan-dan; Guo, Qing-hua; Gao, Yue; Guo, Mei-li

    2015-08-01

    The safflower floret is a traditional Chinese medicine used to promote blood circulation and remove obstruction in the channels. The spines on its bracts are considered a handicap when manual harvest is involved. In this study, cDNA-SRAP was used to systematically investigate which genes are associated with the spines. Sixty pairs of possible primer combinations were used on two cDNA pools representing spininess and spinelessness. Six transcript-derived fragments were identified, of which two with low recombination were sequenced successfully and named as GPY-1 and GPY-2. By using the RACE method, the full-length cDNA of GPY-2 is cloned and named as CTL-spn. The full-length cDNA of CTL-spn was 1 679 bp long with a 1 524 bp ORF encoding a 508 aminoacid protein. The deduced amino acid sequence of the CTL-spn gene shared a high homology (97%) with other known ATP synthase CF1 alpha subunits. Semiquantitative RT-PCR analysis revealed that the mRNA of GPY-1 and GPY-2 accumulated in only spiny lines. Considering the important role of ATP synthase CF1 alpha subunit in plants, it may directly take part in the formation process of spininess and enhancing resistance reaction of spiny safflower. Also, our results provide the important insights for breeding spineless cultivars of safflower. PMID:26669008

  4. Alpha Particle

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...

  5. Replication pattern of human repeated DNA sequences.

    PubMed

    Meneveri, R; Agresti, A; Breviario, D; Ginelli, E

    1984-10-01

    Either aphidicolin- or thymidine-synchronized human HL-60 cells were used to study the replication pattern of a family of human repetitive DNA sequences, the Eco RI 340 bp family (alpha RI-DNA), and of the ladders of fragments generated in total human DNA after digestion with XbaI and HaeIII (alpha satellite sequences). DNAs replicated in early, middle-early, middle-late and late S periods were labelled with BUdR or with [3H]thymidine. The efficiency of the cell synchronization procedure was confirmed by the transition from a high-GC to a high-AT average base composition of the DNA synthesized going from early to late S periods. By hybridizing EcoRI 340 bp repetitive fragments to BUdR-DNAs it was found that this family of sequences is replicated throughout the entire S period. Comparing fluorograph densitometric scans of [3H]DNAs to the scans of ethidium bromide patterns of total HL-60 DNA digested with XbaI and HaeIII, it was observed that DNA synthesized in different S periods is characterized by approximately the same ladder of fragments, while the intensity of each band may vary through the S phase; in particular, the XbaI 2.4 kb fragment becomes undetectable in late S. PMID:6089891

  6. An improved DNA-based test for detection of the codon 616 mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi.

    PubMed

    Petersen-Jones, Simon M; Entz, David D

    2002-06-01

    The aim of the study was to develop an improved test to detect the codon 616 gene mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi. We studied 10 control dogs of known genotype at codon 616 of the alpha cyclic GMP phosphodiesterase gene and 80 Cardigan Welsh Corgis of unknown genotype. A polymerase chain reaction (PCR) utilizing a mismatched primer was designed so that it introduced a HinfI restriction enzyme digestion site into the PCR product only if the normal gene sequence was present, the restriction site was not introduced if the codon 616 mutation was present. An additional HinfI site present in the amplified section from both normal and mutant alleles acted as a positive control for restriction enzyme digestion. The PCR reliably amplified a portion of the alpha cyclic GMP phosphodiesterase gene spanning the codon 616 mutation site. Restriction enzyme digestion with HinfI and analysis on a suitable agarose gel reliably ascertained the genotype of the control dogs and was used to identify the genotype of a further 80 test dogs. An improved DNA-based test for detection of the codon 616 mutation in the alpha cyclic GMP phosphodiesterase gene that causes progressive retinal atrophy in the Cardigan Welsh Corgi has been designed. This overcomes potential problems that could be associated with allele-specific PCR tests such as that used previously in a diagnostic test for this gene mutation. PMID:12071867

  7. Satellite Communication.

    ERIC Educational Resources Information Center

    Technology Teacher, 1985

    1985-01-01

    Presents a discussion of communication satellites: explains the principles of satellite communication, describes examples of how governments and industries are currently applying communication satellites, analyzes issues confronting satellite communication, links mathematics and science to the study of satellite communication, and applies…

  8. Helitrons shaping the genomic architecture of Drosophila: enrichment of DINE-TR1 in α- and β-heterochromatin, satellite DNA emergence, and piRNA expression.

    PubMed

    Dias, Guilherme B; Heringer, Pedro; Svartman, Marta; Kuhn, Gustavo C S

    2015-09-01

    Drosophila INterspersed Elements (DINEs) constitute an abundant but poorly understood group of Helitrons present in several Drosophila species. The general structure of DINEs includes two conserved blocks that may or not contain a region with tandem repeats in between. These central tandem repeats (CTRs) are similar within species but highly divergent between species. It has been assumed that CTRs have independent origins. Herein, we identify a subset of DINEs, termed DINE-TR1, which contain homologous CTRs of approximately 150 bp. We found DINE-TR1 in the sequenced genomes of several Drosophila species and in Bactrocera tryoni (Acalyptratae, Diptera). However, interspecific high sequence identity (∼ 88 %) is limited to the first ∼ 30 bp of each tandem repeat, implying that evolutionary constraints operate differently over the monomer length. DINE-TR1 is unevenly distributed across the Drosophila phylogeny. Nevertheless, sequence analysis suggests vertical transmission. We found that CTRs within DINE-TR1 have independently expanded into satellite DNA-like arrays at least twice within Drosophila. By analyzing the genome of Drosophila virilis and Drosophila americana, we show that DINE-TR1 is highly abundant in pericentromeric heterochromatin boundaries, some telomeric regions and in the Y chromosome. It is also present in the centromeric region of one autosome from D. virilis and dispersed throughout several euchromatic sites in both species. We further found that DINE-TR1 is abundant at piRNA clusters, and small DINE-TR1-derived RNA transcripts (∼25 nt) are predominantly expressed in the testes and the ovaries, suggesting active targeting by the piRNA machinery. These features suggest potential piRNA-mediated regulatory roles for DINEs at local and genome-wide scales in Drosophila. PMID:26408292

  9. Detection of alpha- and epsilon-toxigenic Clostridium perfringens type D in sheep and goats using a DNA amplification technique (PCR).

    PubMed

    Miserez, R; Frey, J; Buogo, C; Capaul, S; Tontis, A; Burnens, A; Nicolet, J

    1998-05-01

    Clostridium perfringens isolated from sheep and goat with enterotoxaemia at necropsy and from healthy animals at slaughter were typed using specific PCR assays for the detection of the alpha-, beta- and epsilon-toxin genes. Clostridium perfringens isolated from all 52 animals with pathological signs of enterotoxaemia showed the presence of the alpha- and epsilon-toxin genes but were devoid of the beta-toxin gene. These strains could therefore be identified as type D, characteristic for clostridial enterotoxaemia of sheep, lambs and goats. In contrast, Cl. perfringens isolated from 11 of 13 healthy animals only contained the alpha-toxin gene which is typical for type A. Two of the healthy animals contained Cl. perfringens with the alpha- and epsilon-toxin genes. However, when several individual Cl. perfringens colonies were analysed from each of these two animals, only a small percentage was found to contain the epsilon-toxin gene, whereas the majority of the colonies were of type A with the alpha-toxin gene only. This is in contrast to the findings from the diseased animals which contained practically only type D Cl. perfringens. The beta-toxin gene was not found in any Cl. perfringens isolate from goat and sheep. Comparison of the PCR data with results obtained by the classical biological toxin assay using the mouse model showed a good correlation. PMID:9674169

  10. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    PubMed Central

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  11. The All-Alpha Domains of Coupling Proteins from the Agrobacterium tumefaciens VirB/VirD4 and Enterococcus faecalis pCF10-Encoded Type IV Secretion Systems Confer Specificity to Binding of Cognate DNA Substrates

    PubMed Central

    Whitaker, Neal; Chen, Yuqing; Jakubowski, Simon J.; Sarkar, Mayukh K.; Li, Feng

    2015-01-01

    ABSTRACT Bacterial type IV coupling proteins (T4CPs) bind and mediate the delivery of DNA substrates through associated type IV secretion systems (T4SSs). T4CPs consist of a transmembrane domain, a conserved nucleotide-binding domain (NBD), and a sequence-variable helical bundle called the all-alpha domain (AAD). In the T4CP structural prototype, plasmid R388-encoded TrwB, the NBD assembles as a homohexamer resembling RecA and DNA ring helicases, and the AAD, which sits at the channel entrance of the homohexamer, is structurally similar to N-terminal domain 1 of recombinase XerD. Here, we defined the contributions of AADs from the Agrobacterium tumefaciens VirD4 and Enterococcus faecalis PcfC T4CPs to DNA substrate binding. AAD deletions abolished DNA transfer, whereas production of the AAD in otherwise wild-type donor strains diminished the transfer of cognate but not heterologous substrates. Reciprocal swaps of AADs between PcfC and VirD4 abolished the transfer of cognate DNA substrates, although strikingly, the VirD4-AADPcfC chimera (VirD4 with the PcfC AAD) supported the transfer of a mobilizable plasmid. Purified AADs from both T4CPs bound DNA substrates without sequence preference but specifically bound cognate processing proteins required for cleavage at origin-of-transfer sequences. The soluble domains of VirD4 and PcfC lacking their AADs neither exerted negative dominance in vivo nor specifically bound cognate processing proteins in vitro. Our findings support a model in which the T4CP AADs contribute to DNA substrate selection through binding of associated processing proteins. Furthermore, MOBQ plasmids have evolved a docking mechanism that bypasses the AAD substrate discrimination checkpoint, which might account for their capacity to promiscuously transfer through many different T4SSs. IMPORTANCE For conjugative transfer of mobile DNA elements, members of the VirD4/TraG/TrwB receptor superfamily bind cognate DNA substrates through mechanisms that are

  12. Satellite communications

    NASA Astrophysics Data System (ADS)

    Saha, M. K.

    1982-11-01

    The paper describes the basic principles and the historial development of satellite communications. Various satellite systems for global communications are discused and compared. Some typical operational communication satellite systems summary including geostationary systems are presented. Considerations leading to the system design including the link design for various multiple access techniques and the future trends in satellite communications systems are also discussed.

  13. Satellite communications

    NASA Astrophysics Data System (ADS)

    Rubin, Philip A.

    A review of the economic and technological status of the satellite communications industry is presented. The history of satellite communications is outlined, focusing on the launching of Syncom III in 1963. The basic operation of communication satellites is explained. The differences between C and Ku frequency bands are examined. Economic issues related to satellite communications are discussed in detail.

  14. Virophages or satellite viruses?

    PubMed

    Krupovic, Mart; Cvirkaite-Krupovic, Virginija

    2011-11-01

    It has been argued that the smaller viruses associated with giant DNA viruses are a new biological entity. However, Mart Krupovic and Virginija Cvirkaite-Krupovic argue here that these smaller viruses should be classified with the satellite viruses. PMID:22016897

  15. Suppression of RNA Silencing by a Plant DNA Virus Satellite Requires a Host Calmodulin-Like Protein to Repress RDR6 Expression

    PubMed Central

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-01-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  16. Suppression of RNA silencing by a plant DNA virus satellite requires a host calmodulin-like protein to repress RDR6 expression.

    PubMed

    Li, Fangfang; Huang, Changjun; Li, Zhenghe; Zhou, Xueping

    2014-02-01

    In plants, RNA silencing plays a key role in antiviral defense. To counteract host defense, plant viruses encode viral suppressors of RNA silencing (VSRs) that target different effector molecules in the RNA silencing pathway. Evidence has shown that plants also encode endogenous suppressors of RNA silencing (ESRs) that function in proper regulation of RNA silencing. The possibility that these cellular proteins can be subverted by viruses to thwart host defense is intriguing but has not been fully explored. Here we report that the Nicotiana benthamiana calmodulin-like protein Nbrgs-CaM is required for the functions of the VSR βC1, the sole protein encoded by the DNA satellite associated with the geminivirus Tomato yellow leaf curl China virus (TYLCCNV). Nbrgs-CaM expression is up-regulated by the βC1. Transgenic plants over-expressing Nbrgs-CaM displayed developmental abnormities reminiscent of βC1-associated morphological alterations. Nbrgs-CaM suppressed RNA silencing in an Agrobacterium infiltration assay and, when over-expressed, blocked TYLCCNV-induced gene silencing. Genetic evidence showed that Nbrgs-CaM mediated the βC1 functions in silencing suppression and symptom modulation, and was required for efficient virus infection. Moreover, the tobacco and tomato orthologs of Nbrgs-CaM also possessed ESR activity, and were induced by betasatellite to promote virus infection in these Solanaceae hosts. We further demonstrated that βC1-induced Nbrgs-CaM suppressed the production of secondary siRNAs, likely through repressing RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) expression. RDR6-deficient N. benthamiana plants were defective in antiviral response and were hypersensitive to TYLCCNV infection. More significantly, TYLCCNV could overcome host range restrictions to infect Arabidopsis thaliana when the plants carried a RDR6 mutation. These findings demonstrate a distinct mechanism of VSR for suppressing PTGS through usurpation of a host ESR, and highlight an essential

  17. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  18. FISH analysis of the arrangement of chromosomes in interphase nuclei using telomeric, centromeric, and DNA painting probes

    NASA Astrophysics Data System (ADS)

    Monajembashi, Shamci; Schmitt, Eberhard; Dittmar, Heike; Greulich, Karl-Otto

    1999-01-01

    Fluorescence in situ hybridization is used to study the arrangement of chromosomes in interphase nuclei of unsynchronized human lymphocytes. DNA probes specific for telomeric DNA, centromeric (alpha) -satellite DNA and whole chromosomes 2, 7, 9 and X are employed. It is demonstrated that the shape of the chromosome territories is variable in cycling cells, for example, close to the metaphase chromosome homologues are arranged pairwise. Furthermore, the relative arrangement of chromosome homologues to each other is not spatially defined. Also, the relative orientation of centromeres and telomeres within a chromosome domain is variable.

  19. Tau protein binds to pericentromeric DNA: a putative role for nuclear tau in nucleolar organization.

    PubMed

    Sjöberg, Marcela K; Shestakova, Elena; Mansuroglu, Zeyni; Maccioni, Ricardo B; Bonnefoy, Eliette

    2006-05-15

    The microtubule-associated tau protein participates in the organization and integrity of the neuronal cytoskeleton. A nuclear form of tau has been described in neuronal and non-neuronal cells, which displays a nucleolar localization during interphase but is associated with nucleolar-organizing regions in mitotic cells. In the present study, based on immunofluorescence, immuno-FISH and confocal microscopy, we show that nuclear tau is mainly present at the internal periphery of nucleoli, partially colocalizing with the nucleolar protein nucleolin and human AT-rich alpha-satellite DNA sequences organized as constitutive heterochromatin. By using gel retardation, we demonstrate that tau not only colocalizes with, but also specifically binds to, AT-rich satellite DNA sequences apparently through the recognition of AT-rich DNA stretches. Here we propose a functional role for nuclear tau in relation to the nucleolar organization and/or heterochromatinization of a portion of RNA genes. Since nuclear tau has also been found in neurons from patients with Alzheimer's disease (AD), aberrant nuclear tau could affect the nucleolar organization during the course of AD. We discuss nucleolar tau associated with AT-rich alpha-satellite DNA sequences as a potential molecular link between trisomy 21 and AD. PMID:16638814

  20. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  1. Satellite RNAs and Satellite Viruses.

    PubMed

    Palukaitis, Peter

    2016-03-01

    Satellite RNAs and satellite viruses are extraviral components that can affect either the pathogenicity, the accumulation, or both of their associated viruses while themselves being dependent on the associated viruses as helper viruses for their infection. Most of these satellite RNAs are noncoding RNAs, and in many cases, have been shown to alter the interaction of their helper viruses with their hosts. In only a few cases have the functions of these satellite RNAs in such interactions been studied in detail. In particular, work on the satellite RNAs of Cucumber mosaic virus and Turnip crinkle virus have provided novel insights into RNAs functioning as noncoding RNAs. These effects are described and potential roles for satellite RNAs in the processes involved in symptom intensification or attenuation are discussed. In most cases, models describing these roles involve some aspect of RNA silencing or its suppression, either directly or indirectly involving the particular satellite RNA. PMID:26551994

  2. RADIATION SENSITIVITY & PROCESSING OF DNA DAMAGE FOLLOWING LOW DOSES OF GAMMA-RAY ALPHA PARTICLES & HZE IRRADIATION OF NORMAL DSB REPAIR DEFICIENT CELLS

    SciTech Connect

    O'Neil, Peter

    2009-05-15

    Non-homologous end joining (NHEJ) predominates in the repair of DNA double strand breaks (DSB) over homologous recombination (HR). NHEJ occurs throughout the cell cycle whereas HR occurs in late S/G2 due to the requirement of a sister chromatid (Rothkamm et al, Mol Cell Biol 23 5706-15 [2003]). To date evidence obtained with DSB repair deficient cells using pulsed-field gel electrophoresis has revealed the major pathway throughout all phases of the cell cycle for processing high dose induced DSBs is NHEJ (Wang et al, Oncogene 20 2212-24 (2001); Pluth et al, Cancer Res. 61 2649-55 [2001]). These findings however were obtained at high doses when on average >> 20-30 DSBs are formed per cell. The contribution of the repair pathways (NHEJ and HR) induced in response to DNA damage during the various phases of the cell cycle may depend upon the dose (the level of initial DSBs) especially since low levels of DSBs are induced at low dose. To date, low dose studies using NHEJ and HR deficient mutants have not been carried out to address this important question with radiations of different quality. The work presented here leads us to suggest that HR plays a relatively minor role in the repair of radiation-induced prompt DSBs. SSBs lead to the induction of DSBs which are associated specifically with S-phase cells consistent with the idea that they are formed at stalled replication forks in which HR plays a major role in repair. That DNA-PKcs is in some way involved in the repair of the precursors to replication-induced DSB remains an open question. Persistent non-DSB oxidative damage also leads to an increase in RAD51 positive DSBs. Both simple and complex non-DSB DNA damage may therefore contribute to indirect DSBs induced by ionising radiation at replication forks.

  3. Transcription of the catalytic 180-kDa subunit gene of mouse DNA polymerase alpha is controlled by E2F, an Ets-related transcription factor, and Sp1.

    PubMed

    Izumi, M; Yokoi, M; Nishikawa, N S; Miyazawa, H; Sugino, A; Yamagishi, M; Yamaguchi, M; Matsukage, A; Yatagai, F; Hanaoka, F

    2000-07-24

    We have isolated a genomic DNA fragment spanning the 5'-end of the gene encoding the catalytic subunit of mouse DNA polymerase alpha. The nucleotide sequence of the upstream region was G/C-rich and lacked a TATA box. Transient expression assays in cycling NIH 3T3 cells demonstrated that the GC box of 20 bp (at nucleotides -112/-93 with respect to the transcription initiation site) and the palindromic sequence of 14 bp (at nucleotides -71/-58) were essential for basal promoter activity. Electrophoretic mobility shift assays showed that Sp1 binds to the GC box. We also purified a protein capable of binding to the palindrome and identified it as GA-binding protein (GABP), an Ets- and Notch-related transcription factor. Transient expression assays in synchronized NIH 3T3 cells revealed that three variant E2F sites near the transcription initiation site (at nucleotides -23/-16, -1/+7 and +17/+29) had no basal promoter activity by themselves, but were essential for growth-dependent stimulation of the gene expression. These data indicate that E2F, GABP and Sp1 regulate the gene expression of this principal replication enzyme. PMID:11004506

  4. Effect of DNA interaction involving antioxidative 4-aminoantipyrine incorporating mixed ligand complexes having alpha-amino acid as co-ligand

    NASA Astrophysics Data System (ADS)

    Raman, Natarajan; Sakthivel, Arunagiri; Selvaganapathy, Muthusamy; Mitu, Liviu

    2014-02-01

    Few new mixed ligand transition metal complexes of the stoichiometry [ML(A)2], where M = Co(II), Ni(II), Cu(II) and Zn(II), L = FFAP (furfurylidene-4-aminoantipyrine) and A = amino acid (glycine/alanine/valine), have been designed, synthesized and characterized. The molar conductivity of the complexes in DMF at 10-3 M concentration shows that they are non-electrolytes. The interaction of these complexes with CT-DNA indicates that the valine mixed ligand complexes are having higher binding constant than alanine and glycine mixed ligand complexes. This analysis reveals that binding constant depends on the size of the alkyl group present in the amino acid. The binding constants of valine mixed ligand complexes are in the order of 104 to 105 M-1 revealing that the complexes interact with DNA through moderate intercalation mode. The metal complexes exhibit effective cleavage of pUC19 DNA but it is not preceded via radical cleavage and superoxide anion radical. They are good antimicrobial agents than the free ligand. On comparing the IC50 values, [Ni(L)(Gly)2] is considered as a potential drug to eliminate the hydroxyl radical.

  5. The solar Ly-alpha line profile

    NASA Technical Reports Server (NTRS)

    Woods, Thomas N.; Rottman, Gary J.; White, O. R.; Fontenla, Juan; Avrett, E. H.

    1995-01-01

    Solar Ly-alpha irradiance measurements from the SOLar STellar Irradiance Comparison Experiment (SOLSTICE) on the Upper Atmosphere Research Satellite (UARS) have been made since 1991 October with a spectral resolution of 0.1 nm. The uniqueness of the small molecular oxygen cross section near Ly-alpha permits the Ly-alpha radiation to penetrate much deeper into the atmosphere than the other emissions near Ly-alpha. We have taken advantage of this phenomenon by performing solar occultation experiments near the Ly-alpha to evaluate precisely the instrument scattered light contribution. After correcting for scattered light, the broad wings of the solar Ly-alpha line can be extracted out to 5 nm from line center with a typical accuracy of +/-20%. The variability in the Ly-alpha wings near 2 nm from line center is about one-half that of the Ly-alpha core emission, defined within 0.1 nm from line center. These Ly-alpha profile measurements are found to be consistent with the Skylab radiance measurements and theoretical models of the Ly-alpha line profiles computed using partial redistribution of photons in the source function.

  6. Comparison of barley malt alpha-amylase isozymes 1 and 2: construction of cDNA hybrids by in vivo recombination and their expression in yeast.

    PubMed

    Juge, N; Søgaard, M; Chaix, J C; Martin-Eauclaire, M F; Svensson, B; Marchis-Mouren, G; Guo, X J

    1993-08-25

    Germinating barley produces two alpha-amylase isozymes, AMY1 and AMY2, having 80% amino acid (aa) sequence identity and differing with respect to a number of functional properties. Recombinant AMY1 (re-AMY1) and AMY2 (re-AMY2) are produced in yeast, but whereas all re-AMY1 is secreted, re-AMY2 accumulates within the cell and only traces are secreted. Expression of AMY1::AMY2 hybrid cDNAs may provide a means of understanding the difference in secretion efficiency between the two isozymes. Here, the efficient homologous recombination system of the yeast, Saccharomyces cerevisiae, was used to generate hybrids of barley AMY with the N-terminal portion derived from AMY1, including the signal peptide (SP), and the C-terminal portion from AMY2. Hybrid cDNAs were thus generated that encode either the SP alone, or the SP followed by the N-terminal 21, 26, 53, 67 or 90 aa from AMY1 and the complementary C-terminal sequences from AMY2. Larger amounts of re-AMY are secreted by hybrids containing, in addition to the SP, 53 or more aa of AMY1. In contrast, only traces of re-AMY are secreted for hybrids having 26 or fewer aa of AMY1. In this case, re-AMY hybrid accumulates intracellularly. Transformants secreting hybrid enzymes also accumulated some re-AMY within the cell. The AMY1 SP, therefore, does not ensure re-AMY2 secretion and a certain portion of the N-terminal sequence of AMY1 is required for secretion of a re-AMY1::AMY2 hybrid. PMID:8359683

  7. Microtubule depolymerization potentiates alpha-synuclein oligomerization.

    PubMed

    Esteves, A Raquel; Arduíno, Daniela M; Swerdlow, Russell H; Oliveira, Catarina R; Cardoso, Sandra M

    2010-01-01

    Parkinson's disease (PD) is associated with perturbed mitochondria function and alpha-synuclein fibrillization. We evaluated potential mechanistic links between mitochondrial dysfunction and alpha-synuclein aggregation. We studied a PD cytoplasmic hybrid (cybrid) cell line in which platelet mitochondria from a PD subject were transferred to NT2 neuronal cells previously depleted of endogenous mitochondrial DNA. Compared to a control cybrid cell line, the PD line showed reduced ATP levels, an increased free/polymerized tubulin ratio, and alpha-synuclein oligomer accumulation. Taxol (which stabilizes microtubules) normalized the PD tubulin ratio and reduced alpha-synuclein oligomerization. A nexus exists between mitochondrial function, cytoskeleton homeostasis, and alpha-synuclein oligomerization. In our model, mitochondrial dysfunction triggers an increased free tubulin, which destabilizes the microtubular network and promotes alpha-synuclein oligomerization. PMID:20552056

  8. Satellite myths

    NASA Astrophysics Data System (ADS)

    Easton, Roger L.; Hall, David

    2008-01-01

    Richard Corfield's article “Sputnik's legacy” (October 2007 pp23-27) states that the satellite on board the US Vanguard rocket, which exploded during launch on 6 December 1957 two months after Sputnik's successful take-off, was “a hastily put together contraption of wires and circuitry designed only to send a radio signal back to Earth”. In fact, the Vanguard satellite was developed over a period of several years and put together carefully using the best techniques and equipment available at the time - such as transistors from Bell Laboratories/Western Electric. The satellite contained not one but two transmitters, in which the crystal-controlled oscillators had been designed to measure both the temperature of the satellite shell and of the internal package.

  9. Satellite Videoconferences

    NASA Technical Reports Server (NTRS)

    1990-01-01

    NASA is helping thousands of teachers to learn more about aerospace matters, improve their classroom skills, and expand significantly the content of their aerospace education curricula by means of live educational satellite videoconferences. The 1 1/2 hour 'Update for Teachers' programs originate at Oklahoma State University (OSU) Telecommunications Center. The television signals are transmitted to the WESTAR IV communications satellite, which remits them to participating schools across the U.S. and in parts of Mexico and Canada. The schools are equipped with small home style satellite reception dishes. Education Satellite Videoconference programs are conducted four times yearly, covering a variety of aerospace subjects. Teachers can call toll-free and have questions answered after the speaker's presentations. Information about NASA educational resources and how to obtain them will be provided.

  10. Satellite observations

    NASA Astrophysics Data System (ADS)

    1984-05-01

    In 1982 and 1983, six scientific satellites were operated successfully. Two of them, JIKIKEN and ISS-b, performed observations of the Earth's plasma environment. HINOTORI, the solar maximum satellite, observed a number of solar flares. HAKUCHO and newly launched TENMA conducted various observations of cosmic X-ray sources. HIMAWARI-2 is a meteorological satellite but its payload includes a solar particle monitor. EXOS-C was successfully launched in February, 1983, and participants in the MAP (Middle Atmosphere Program). Following these missions, the PLANET-A project comprising two missions, MS-T5 and PLANET-A, is under preparation for the participation in the international cooperative exploration of Comet P/Halley. The third X-ray astronomy satellite ASTRO-C is currently scheduled for 1987 launch.