Purification and characterization of highly branched α-glucan-producing enzymes from Paenibacillus sp. PP710.

PubMed

Tsusaki, Keiji; Watanabe, Hikaru; Yamamoto, Takuo; Nishimoto, Tomoyuki; Chaen, Hiroto; Fukuda, Shigeharu

2012-01-01

Highly branched α-glucan molecules exhibit low digestibility for α-amylase and glucoamylase, and abundant in α-(1→3)-, α-(1→6)-glucosidic linkages and α-(1→6)-linked branch points where another glucosyl chain is initiated through an α-(1→3)-linkage. From a culture supernatant of Paenibacillus sp. PP710, we purified α-glucosidase (AGL) and α-amylase (AMY), which were involved in the production of highly branched α-glucan from maltodextrin. AGL catalyzed the transglucosylation reaction of a glucosyl residue to a nonreducing-end glucosyl residue by α-1,6-, α-1,4-, and α-1,3-linkages. AMY catalyzed the hydrolysis of the α-1,4-linkage and the intermolecular or intramolecular transfer of maltooligosaccharide like cyclodextrin glucanotransferase (CGTase). It also catalyzed the transfer of an α-1,4-glucosyl chain to a C3- or C4-hydroxyl group in the α-1,4- or α-1,6-linked nonreducing-end residue or the α-1,6-linked residue located in the other chains. Hence AMY was regarded as a novel enzyme. We think that the mechanism of formation of highly branched α-glucan from maltodextrin is as follows: α-1,6- and α-1,3-linked residues are generated by the transglucosylation of AGL at the nonreducing ends of glucosyl chains. Then AMY catalyzes the transfer of α-1,4-chains to C3- or C4-hydroxyl groups in the α-1,4- or α-1,6-linked residues generated by AGL. Thus the concerted reactions of both AGL and AMY are necessary to produce the highly branched α-glucan from maltodextrin.

Enzyme replacement therapy in alpha-mannosidosis guinea-pigs.

PubMed

Crawley, Allison C; King, Barbara; Berg, Thomas; Meikle, Peter J; Hopwood, John J

2006-01-01

alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of lysosomal alpha-mannosidase and is characterised by massive accumulation of mannose-containing oligosaccharides in affected individuals. Patients develop behaviour and learning difficulties, skeletal abnormalities, immune deficiency and hearing impairment. Disease in alpha-mannosidosis guinea-pigs resembles the clinical, histopathological, biochemical and molecular features of the human disease. We have used the guinea-pig model to investigate efficacy of enzyme replacement therapy as a treatment for alpha-mannosidosis. Intravenous recombinant human lysosomal alpha-mannosidase, administered at a dose of 1mg/kg, was cleared from circulation with a half-life of 53 h, with significant enzyme activity (1.4x normal levels) detected in circulation one week post-injection. alpha-Mannosidase administered to alpha-mannosidosis guinea-pigs at 1mg/kg (onset at birth or approximately 30 days) and 10mg/kg (at birth) was distributed widely amongst tissues, including to capillary depleted brain. By monitoring with tandem mass spectrometry, enzyme replacement therapy was found to be effective in reducing stored substrates in peripheral tissues at both dose rates, and in brain by up to 39% at the 10mg/kg dose, compared with untreated alpha-mannosidosis controls. Reductions of up to 60% of urinary mannose containing oligosaccharides were also observed. No histological improvements were seen in the brain at either dose, however marked decreases in lysosomal vacuolation in liver, kidney, spleen and endocrine pancreas, as well as a significant reduction in trigeminal ganglion neurons were observed. Multiple injections of 1mg/kg recombinant enzyme in alpha-mannosidosis guinea-pigs induced a very rapid humoral immune response precluding long-term intravenous treatment.

Screening of beta-glucan contents in commercially cultivated and wild growing mushrooms.

PubMed

Sari, Miriam; Prange, Alexander; Lelley, Jan I; Hambitzer, Reinhard

2017-02-01

Mushrooms have unique sensory properties and nutritional values as well as health benefits due to their bioactive compounds, especially beta-glucans. Well-known edible and medicinal mushroom species as well as uncommon or unknown species representing interesting sources of bioactive beta-glucans have been widely studied. Commercially cultivated and wild growing mushrooms were analysed for their beta-glucan contents. Enzymatic determinations of all glucans, alpha-glucans and beta-glucans in 39 mushrooms species were performed, leading to very remarkable results. Many wild growing species present high beta-glucan contents, especially Bracket fungi. The well-known cultivated species Agaricus bisporus, Lentinula edodes and Cantharellus cibarius as well as most screened wild growing species show higher glucan contents in their stipes than caps. Copyright © 2016 Elsevier Ltd. All rights reserved.

Inter-serotype comparison of polysaccharides produced by extracellular enzymes from Streptococcus mutans.

PubMed

Yakushiji, T; Inoue, M; Koga, T

1984-04-15

The biochemical and morphological characteristics of polysaccharides synthesized from sucrose by extracellular enzymes from D-glucose-grown Streptococcus mutans representing serotypes a-g were compared. The polysaccharides synthesized by the enzymes from serotypes a, d, and g formed visible aggregates and firmly adhered to glass surfaces, whereas those formed by the enzymes from serotypes b, c, e, and f floated homogeneously and were poorly adherent. The enzymes of serotypes a, d, and g produced large amounts of water-insoluble polysaccharides (IPs, D-glucans), and those of serotypes b, c, e, and f water-soluble polysaccharides (SPs, D-glucans and D- fructans ). As compared with the IPs of serotypes b, c, e, and f, the IPs of serotypes a, d, and g (a) contained a higher proportion of (1----3)-alpha-D-glucosidic linkages and alpha-D-(1----3,6) branch linkages; (b) showed higher susceptibility to (1----3)-alpha-D-glucanase (serotype a excepted) and lower (1----6)-alpha-D-glucanase sensitivity; (c) contained larger amounts of high-molecular-weight fractions; (d) showed higher intrinsic viscosities (serotype b excepted); and (e) had lower S. mutans cell-agglutination activities. On electron-microscope observation, the IPs of all serotypes showed two fibrillar components; a double-stranded fibril, with short, fluffy protrusions extending out of its periphery, and a fine, single-stranded fibril. Thus, the serotypes could be divided into two major groups: a, d, and g; and b, c, e, and f. No similar grouping of serotypes was indicated by the chemical and morphological properties of SPs.

Unique carbohydrate binding platforms employed by the glucan phosphatases

PubMed Central

MEEKINS, David A.; GENTRY, Matthew S.

2016-01-01

Glucan phosphatases are a family of enzymes that are functionally conserved at the enzymatic level in animals and plants. These enzymes bind and dephosphorylate glycogen in animals and starch in plants. While the enzymatic function is conserved, the glucan phosphatases employ distinct mechanisms to bind and dephosphorylate glycogen or starch. The founding member of the family is a bimodular human protein called laforin that is comprised of a carbohydrate binding module 20 (CBM20) followed by a dual specificity phosphatase domain. Plants contain two glucan phosphatases: Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2). SEX4 contains a chloroplast targeting peptide, dual specificity phosphatase (DSP) domain, a CBM45, and a carboxy-terminal motif. LSF2 is comprised of simply a chloroplast targeting peptide, DSP domain, and carboxy-terminal motif. SEX4 employs an integrated DSP-CBM glucan-binding platform to engage and dephosphorylate starch. LSF2 lacks a CBM and instead utilizes two surface binding sites to bind and dephosphorylate starch. Laforin is a dimeric protein in solution and it utilizes a tetramodular architecture and cooperativity to bind and dephosphorylate glycogen. This chapter describes the biological role of glucan phosphatases in glycogen and starch metabolism and compares and contrasts their ability to bind and dephosphorylate glucans. PMID:27147465

(1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

PubMed

Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

2016-04-05

Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

A novel glucan-binding protein with lipase activity from the oral pathogen Streptococcus mutans.

PubMed

Shah, Deepan S H; Russell, Roy R B

2004-06-01

Streptococcus mutans produces extracellular glucosyltransferases (GTFs) that synthesize glucans from sucrose. These glucans are important in determining the permeability properties and adhesiveness of dental plaque. GTFs and the GbpA glucan-binding protein are characterized by a binding domain containing a series of 33-amino-acid repeats, called 'A' repeats. The S. mutans genome sequence was searched for ORFs containing 'A' repeats, and one novel gene, gbpD, which appears to be unique to the mutans group of streptococci, was identified. The GbpD sequence revealed the presence of three 'A' repeats, in the middle of the protein, and a novel glucan-binding assay showed that GbpD binds to dextran with a K(D) of 2-3 nM. Construction of truncated derivatives of GbpD confirmed that the 'A' repeat region was essential for binding. Furthermore, a gbpD knockout mutant was modified in the extent of aggregation induced by polymers derived from sucrose. The N-terminus of GbpD has a signal sequence, followed by a region with no homologues in the public databases, while the C-terminus has homology to the alpha/beta hydrolase family (including lipases and carboxylesterases). GbpD contains the two regions typical of these enzymes: a GxSxG active site 'lipase box' and an 'oxyanion hole'. GbpD released free fatty acids (FFAs) from a range of triglycerides in the presence of calcium, indicating a lipase activity. The glucan binding/lipase bifunctionality suggested the natural substrate for the enzyme may be a surface macromolecule consisting of carbohydrate linked to lipid. The gbpD mutant was less hydrophobic than wild-type and pure recombinant GbpD reduced the hydrophobicity of S. mutans and another plaque bacterium, Streptococcus sanguinis. GbpD bound to and released FFA from lipoteichoic acid (LTA) of S. sanguinis, but had no effect on LTA from S. mutans. These results raise the intriguing possibility that GbpD may be involved in direct interspecies competition within the plaque

Mechanistic Insights into Glucan Phosphatase Activity against Polyglucan Substrates*

PubMed Central

Meekins, David A.; Raththagala, Madushi; Auger, Kyle D.; Turner, Benjamin D.; Santelia, Diana; Kötting, Oliver; Gentry, Matthew S.; Vander Kooi, Craig W.

2015-01-01

Glucan phosphatases are central to the regulation of starch and glycogen metabolism. Plants contain two known glucan phosphatases, Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2), which dephosphorylate starch. Starch is water-insoluble and reversible phosphorylation solubilizes its outer surface allowing processive degradation. Vertebrates contain a single known glucan phosphatase, laforin, that dephosphorylates glycogen. In the absence of laforin, water-soluble glycogen becomes insoluble, leading to the neurodegenerative disorder Lafora Disease. Because of their essential role in starch and glycogen metabolism glucan phosphatases are of significant interest, yet a comparative analysis of their activities against diverse glucan substrates has not been established. We identify active site residues required for specific glucan dephosphorylation, defining a glucan phosphatase signature motif (CζAGΨGR) in the active site loop. We further explore the basis for phosphate position-specific activity of these enzymes and determine that their diverse phosphate position-specific activity is governed by the phosphatase domain. In addition, we find key differences in glucan phosphatase activity toward soluble and insoluble polyglucan substrates, resulting from the participation of ancillary glucan-binding domains. Together, these data provide fundamental insights into the specific activity of glucan phosphatases against diverse polyglucan substrates. PMID:26231210

Structural Mechanisms of Plant Glucan Phosphatases in Starch Metabolism

PubMed Central

Meekins, David A.; Vander Kooi, Craig W.; Gentry, Matthew S.

2016-01-01

Glucan phosphatases are a recently discovered class of enzymes that dephosphorylate starch and glycogen, thereby regulating energy metabolism. Plant genomes encode for two glucan phosphatases called Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2) that regulate starch metabolism by selectively dephosphorylating glucose moieties within starch glucan chains. Recently, the structures of both SEX4 and LSF2 were determined, with and without phosphoglucan products bound, revealing the mechanism for their unique activities. This review explores the structural and enzymatic features of the plant glucan phosphatases and outlines how they are uniquely adapted for carrying out their cellular functions. We outline the physical mechanisms employed by SEX4 and LSF2 to interact with starch glucans: SEX4 binds glucan chains via a continuous glucan binding platform comprised of its Dual Specificity Phosphatase (DSP) domain and Carbohydrate Binding Module (CBM) while LSF2 utilizes Surface Binding Sites (SBSs). SEX4 and LSF2 both contain a unique network of aromatic residues in their catalytic DSP domains that serve as glucan engagement platforms and are unique to the glucan phosphatases. We also discuss the phosphoglucan substrate specificities inherent to SEX4 and LSF2 and outline structural features within the active site that govern glucan orientation. This review defines the structural mechanism of the plant glucan phosphatases with respect to phosphatases, starch metabolism, and protein-glucan interaction; thereby providing a framework for their applications in both agricultural and industrial settings. PMID:26934589

Depolymerization of starch and pectin using superporous matrix supported enzymes.

PubMed

Lali, Arvind; Manudhane, Kushal; Motlekar, Nuzhat; Karandikar, Priti

2002-08-01

Immobilized enzyme catalyzed biotransformations involving macromolecular substrates and/or products are greatly retarded due to slow diffusion of large substrate molecules in and out of the typical enzyme supports. Slow diffusion of macromolecules into the matrix pores can be speeded up by use of macroporous supports as enzyme carriers. Depolymerization reactions of polysaccharides like starch, pectin, and dextran to their respective low molecular weight products are some of the reactions that can benefit from use of such superporous matrices. In the present work, an indigenously prepared rigid cross-linked cellulose matrix (called CELBEADS) has been used as support for immobilizing alpha amylase (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1.) and pectinase (endo-PG: poly(1,4-alpha-galactouronide) glycanohydrolase, EC 3.2.1.15). The immobilized enzymes were used for starch and pectin hydrolysis respectively, in batch, packed bed and expanded bed modes. The macroporosity of CELBEADS was found to permit through-flow and easy diffusion of substrates pectin and starch to enzyme sites in the porous supports and gave reaction rates comparable to the rates obtained using soluble enzymes.

In vivo growth-inhibition of Sarcoma 180 by an alpha-(1-->4)-glucan-beta-(1-->6)-glucan-protein complex polysaccharide obtained from Agaricus blazei Murill.

PubMed

Gonzaga, Maria Leônia Costa; Bezerra, Daniel Pereira; Alves, Ana Paula Negreiros Nunes; de Alencar, Nylane Maria Nunes; Mesquita, Rodney de Oliveira; Lima, Michael Will; Soares, Sandra de Aguiar; Pessoa, Cláudia; de Moraes, Manoel Odorico; Costa-Lotufo, Letícia Veras

2009-01-01

Agaricus blazei Murrill, a native mushroom of Brazil, has been widely consumed in different parts of the world due to its anticancer potential. This effect is generally attributed to its polysaccharides; however, the precise structure of these has not been fully characterized. To better understand the relationship between polysaccharide structures and antitumor activity, we investigated the effect of the intraperitoneally (i.p.) or orally (p.o.) administered alpha-(1-->4)-glucan-beta-(1-->6)-glucan-protein complex polysaccharide from A. blazei alone or in association with 5-fluorouracil (5-FU) in tumor growth using Sarcoma 180 transplanted mice. Hematological, biochemical, and histopathological analyses were performed in order to evaluate the toxicological aspects of the polysaccharide treatment. The polysaccharide had no direct cytotoxic action on tumor cells in vitro. However, the polysaccharide showed strong in vivo antitumor effect. Thus, the tumor growth-inhibitory effect of the polysaccharide is apparently due to host-mediated mechanisms. The histopathological analysis suggests that the liver and the kidney were not affected by polysaccharide treatment. Neither enzymatic activity of transaminases (AST and ALT) nor urea levels were significantly altered. In hematological analysis, leucopeny was observed after 5-FU treatment, but this effect was prevented when the treatment was associated with the polysaccharide. In conclusion, this polysaccharide probably could explain the ethnopharmacological use of this mushroom in the treatment of cancer.

β-(1,3)-Glucan Exposure Assessment by Passive Airborne Dust Sampling and New Sensitive Immunoassays▿

PubMed Central

Noss, Ilka; Wouters, Inge M.; Bezemer, Gillina; Metwali, Nervana; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.; Thorne, Peter S.; Doekes, Gert

2010-01-01

Associations between house dust-associated β-(1,3)-glucan exposure and airway inflammatory reactions have been reported, while such exposures in early childhood have been suggested to protect against asthma and wheezing. Most epidemiological studies have used reservoir dust samples and an inhibition enzyme immunoassay (EIA) for β-(1,3)-glucan exposure assessment. The objective of this study was to develop inexpensive but highly sensitive enzyme immunoassays to measure airborne β-(1,3)-glucans in low-exposure environments, like homes. Specificities of available anti-β-(1,3)-glucan antibodies were defined by direct and inhibition experiments. Three suitable antibody combinations were selected for sandwich EIAs. β-(1,3)-Glucans in passive airborne dust collected with an electrostatic dust fall collector (EDC) and floor dust from seven homes were measured with the three EIAs. Floor dust samples were additionally analyzed in the inhibition EIA. The sandwich EIAs were sensitive enough for airborne glucan measurement and showed different specificities for commercial glucans, while the β-(1,3)-glucan levels in house dust samples correlated strongly. The feasibility of measuring glucans in airborne dust with the recently introduced EDC method was further investigated by selecting the most suitable of the three EIAs to measure and compare β-(1,3)-glucan levels in the EDC and in floor and actively collected airborne dust samples of the previously performed EDC validation study. The EDC β-(1,3)-glucan levels correlated moderately with β-(1,3)-glucans in actively collected airborne dust and floor dust samples, while the glucan levels in the airborne dust and floor dust samples did not correlate. The combination of the newly developed β-(1,3)-glucan sandwich EIA with EDC sampling now allows assessment in large-scale population studies of exposure to airborne β-(1,3)-glucans in homes or other low-exposure environments. PMID:20038709

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus

PubMed Central

Møller, Marie S.; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R.; Svensson, Birte

2017-01-01

ABSTRACT Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 (LaPul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest Km reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Tumor necrosis factor alpha converting enzyme: an encouraging target for various inflammatory disorders.

PubMed

Bahia, Malkeet S; Silakari, Om

2010-05-01

Tumor necrosis factor alpha is one of the most common pro-inflammatory cytokines responsible for various inflammatory disorders. It plays an important role in the origin and progression of rheumatoid arthritis and also in other autoimmune disease conditions. Some anti-tumor necrosis factor alpha antibodies like Enbrel, Humira and Remicade have been successfully used in these disease conditions as antagonists of tumor necrosis factor alpha. Inhibition of generation of active form of tumor necrosis factor alpha is a promising therapy for various inflammatory disorders. Therefore, the inhibition of an enzyme (tumor necrosis factor alpha converting enzyme), which is responsible for processing inactive form of tumor necrosis factor alpha into its active soluble form, is an encouraging target. Many tumor necrosis factor alpha converting enzyme inhibitors have been the candidates of clinical trials but none of them have reached in to the market because of their broad spectrum inhibitory activity for other matrix metalloproteases. Selectivity of tumor necrosis factor alpha converting enzyme inhibition over matrix metalloproteases is of utmost importance. If selectivity is achieved successfully, side-effects can be over-ruled and this approach may become a novel therapy for treatment of rheumatoid arthritis and other inflammatory disorders. This cytokine not only plays a pivotal role in inflammatory conditions but also in some cancerous conditions. Thus, successful targeting of tumor necrosis factor alpha converting enzyme may result in multifunctional therapy.

Cereal β-glucan quantification with calcofluor-application to cell culture supernatants.

PubMed

Rieder, Anne; Knutsen, Svein H; Ballance, Simon; Grimmer, Stine; Airado-Rodríguez, Diego

2012-11-06

The specific binding of the fluorescent dye calcofluor to cereal β-glucan results in increased fluorescence intensity of the formed complex and is in use for the quantification of β-glucan above a critical molecular weight (MW) by flow injection analysis. In this study, this method was applied in a fast and easy batch mode. In order to emphasize the spectral information of the emission spectra of the calcofluor/β-glucan complexes, derivative signals were calculated. A linear relationship was found between the amplitude of the second derivative signals and the β-glucan concentration between 0.1 and 0.4 μg/mL. The low detection limit of this new method (0.045 μg/mL) enabled its use to study the transport of cereal β-glucans over differentiated Caco-2 cell monolayers. Additionally, the method was applied to quantify β-glucan in arabinoxylan samples, which correlated well with data by an enzyme based method. Copyright © 2012 Elsevier Ltd. All rights reserved.

Two Strategies for Microbial Production of an Industrial Enzyme-Alpha-Amylase

NASA Technical Reports Server (NTRS)

Bernhardsdotter, Eva C. M. J.; Garriott, Owen; Pusey, Marc L.; Ng, Joseph D.

2003-01-01

Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments including hot springs, soda lakes and arctic water. This ability of survival at extreme conditions has rendered extremophiles to be of interest in astrobiology, evolutionary biology as well as in industrial applications. Of particular interest to the biotechnology industry are the biological catalysts of the extremophiles, the extremozymes, whose unique stabilities at extreme conditions make them potential sources of novel enzymes in industrial applications. There are two major approaches to microbial enzyme production. This entails enzyme isolation directly from the natural host or creating a recombinant expression system whereby the targeted enzyme can be overexpressed in a mesophilic host. We are employing both methods in the effort to produce alpha-amylases from a hyperthermophilic archaeon (Thermococcus) isolated from a hydrothermal vent in the Atlantic Ocean, as well as from alkaliphilic bacteria (Bacillus) isolated from a soda lake in Tanzania. Alpha-amylases catalyze the hydrolysis of internal alpha-1,4-glycosidic linkages in starch to produce smaller sugars. Thermostable alpha-amylases are used in the liquefaction of starch for production of fructose and glucose syrups, whereas alpha-amylases stable at high pH have potential as detergent additives. The alpha-amylase encoding gene from Thermococcus was PCR amplified using carefully designed primers and analyzed using bioinformatics tools such as BLAST and Multiple Sequence Alignment for cloning and expression in E.coli. Four strains of Bacillus were grown in alkaline starch-enriched medium of which the culture supernatant was used as enzyme source. Amylolytic activity was detected using the starch-iodine method.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

PubMed

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

β-glucans and cholesterol (Review)

PubMed Central

Sima, Petr; Vetvicka, Vaclav

2018-01-01

Hypercholesterolemia is one of primary risk factors of cardiovascular disease, together with metabolic syndrome, hypertension and diabetes. Although progress has been made, the search for novel methods of preventing and treating dyslipidemia is ongoing and current therapies for cardiovascular disease induce various side effects. β-glucans are linear unbranched polysaccharides found in various natural sources, such as mushrooms. Due to their structure they are able to interact with innate immunity receptors, however they also act as dietary fibers in the digestive tract. As there are two forms of β-glucans, insoluble and soluble forms, they are able to interact with lipids and biliary salts in the bowel and consequently reduce cholesterol levels. Therefore, they may be developed as a suitable therapeutic option to treat patients with dyslipidemia, as they are natural molecules that do not induce any significant side effects. The current review discusses the evidence supporting the effects of β-glucans on cholesterol levels. PMID:29393350

Micafungin Enhances the Human Macrophage Response to Candida albicans through β-Glucan Exposure.

PubMed

Guirao-Abad, José Pedro; Sánchez-Fresneda, Ruth; Machado, Francisco; Argüelles, Juan Carlos; Martínez-Esparza, María

2018-05-01

Micafungin belongs to the antifungal family of echinocandins, which act as noncompetitive inhibitors of the fungal cell wall β-1,3-d-glucan synthase. Since Candida albicans is the most prevalent pathogenic fungus in humans, we study the involvement of micafungin in the modulation of the inflammatory response developed by human tissue macrophages against C. albicans The MIC for micafungin was 0.016 μg/ml on the C. albicans SC5314 standard strain. Micafungin induced a drastic reduction in the number of exponential SC5314 viable cells, with the fungicidal effect being dependent on the cellular metabolic activity. Notably, micafungin also caused a structural remodelling of the cell wall, leading to exposure of the β-glucan and chitin content on the external surface. At the higher doses used (0.05 μg/ml), the antifungal also induced the blowing up of budding yeasts. In addition, preincubation with micafungin before exposure to human tissue macrophages enhanced the secretion of tumor necrosis factor alpha (TNF-α), interleukin-17A (IL-17A), and IL-10 cytokines. Our results strongly suggest that in C. albicans treatment with micafungin, in addition to having the expected toxic antifungal effect, it potentiates the immune response, improving the interaction and activation of human macrophages, probably through the unmasking of β-glucans on the cell wall surface. Copyright © 2018 American Society for Microbiology.

Structural characterization of the cell wall D-glucans isolated from the mycelium of Botryosphaeria rhodina MAMB-05.

PubMed

de Lourdes Corradi da Silva, Maria; Fukuda, Eliane K; Vasconcelos, Ana Flora D; Dekker, Robert F H; Matias, Andreza C; Monteiro, Nilson K; Cardoso, Marilsa S; Barbosa, Aneli M; Silveira, Joana L M; Sassaki, Guilherme L; Carbonero, Elaine R

2008-03-17

Three D-glucans were isolated from the mycelium of the fungus Botryosphaeria rhodina MAMB-05 by sequential extraction with hot-water and hot aqueous KOH (2% w/v) followed by ethanol precipitation. Following their purification by gel permeation chromatography on Sepharose CL-4B, the structural characteristics of the D-glucans were determined by FT-IR and 13C NMR spectroscopy and, after methylation, by GC-MS. The hot-water extract produced a fraction designated Q1A that was a beta-(1-->6)-D-glucan with the following structure: [Formula: see text] The alkaline extract, when subjected to repeated freeze-thawing, yielded two fractions: K1P (insoluble) that comprised a beta-(1-->3)-D-glucan with beta-D-glucose branches at C-6 with the structure: [Formula: see text] and K1SA (soluble) consisting of a backbone chain of alpha-(1-->4)-linked D-glucopyranosyl residues substituted at O-6 with alpha-D-glucopyranosyl residues: [Formula: see text

Interaction between wheat alpha-amylase/trypsin bi-functional inhibitor and mammalian digestive enzymes: Kinetic, equilibrium and structural characterization of binding.

PubMed

Cuccioloni, Massimiliano; Mozzicafreddo, Matteo; Ali, Ishtiaq; Bonfili, Laura; Cecarini, Valentina; Eleuteri, Anna Maria; Angeletti, Mauro

2016-12-15

Alpha-amylase/trypsin bi-functional inhibitors (ATIs) are non-gluten protein components of wheat and other cereals that can hypersensitise the human gastrointestinal tract, eventually causing enteropathies in predisposed individuals. These inhibitory proteins can act both directly by targeting specific pro-inflammatory receptors, and indirectly by impairing the activity of digestive enzymes, the latter event causing the accumulation of undigested peptides with potential immunogenic properties. Herein, according to a concerted approach based on in vitro and in silico methods we characterized kinetics, equilibrium parameters and modes of binding of the complexes formed between wheat ATI and two representative mammalian digestive enzymes, namely trypsin and alpha-amylase. Interestingly, we demonstrated ATI to target both enzymes with independent binding sites and with moderately high affinity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi.

PubMed

Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

2017-11-18

Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

PubMed Central

Yoshimi, Akira; Miyazawa, Ken; Abe, Keietsu

2017-01-01

Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan. PMID:29371579

Effect of GM-CSF on cytokine induction by soluble beta-glucan SCG in vitro in beta-glucan-treated mice.

PubMed

Hida, Toshie H; Kawaminami, Hiromi; Ishibashi, Ken-Ichi; Miura, Noriko N; Adachi, Yoshiyuki; Yadomae, Toshiro; Ohno, Naohito

2009-07-01

SCG is a 6-branched 1,3-beta-D-glucan, which are major cell wall structural components in fungi. Leukocytes from DBA/1 and DBA/2 mice are highly sensitive to SCG, producing cytokines such as GM-CSF, IFN-gamma, TNF-alpha and IL-12p70, but not IL-6. GM-CSF plays a key biological role in this activity. In the present study, we examined the effect of giving i.p. SCG to DBA/2 mice on cytokine production in vitro. SCG was given i.p. to DBA/2 mice on day 0. Splenocytes were prepared on day 7 and cultured in the presence of SCG in vitro. The levels of cytokine production induced by SCG in vitro were lower in the cells from SCG-treated mice than in control mice. Expression of the beta-glucan receptor, dectin-1, in SCG-treated mice was comparable with that shown in control mice. However, the consumption of exogenously added rmGM-CSF in vitro was observed in SCG-treated mice. The addition of a large amount of rmGM-CSF to the culture medium resulted in larger amounts of TNF-alpha and IL-6 in SCG-treated mice than in normal mice. These results suggested that GM-CSF was closely related with the reactivity of beta-glucan. Giving SCG increased the number of macrophages and granulocytes in the spleen. These results suggested that in SCG-treated mice, a change of cell population would be related to modulation of the profile of cytokine production induced by SCG in vitro.

Structure-function relationships of family GH70 glucansucrase and 4,6-α-glucanotransferase enzymes, and their evolutionary relationships with family GH13 enzymes.

PubMed

Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert

2016-07-01

Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their reaction mechanism, especially structural features determining their linkage specificity. In addition, with the increase of genome sequencing, more and more GS enzymes are identified and characterized. Together, such knowledge may promote the synthesis of α-glucans with desired structures and properties from sucrose. In the meantime, two new GH70 subfamilies (GTFB- and GTFC-like) have been identified as 4,6-α-glucanotransferases (4,6-α-GTs) that represent novel evolutionary intermediates between the family GH13 and "classical GH70 enzymes". These enzymes are not active on sucrose; instead, they use (α1 → 4) glucans (i.e. malto-oligosaccharides and starch) as substrates to synthesize novel α-glucans by introducing linear chains of (α1 → 6) linkages. All these GH70 enzymes are very interesting biocatalysts and hold strong potential for applications in the food, medicine and cosmetic industries. In this review, we summarize the microbiological distribution and the structure-function relationships of family GH70 enzymes, introduce the two newly identified GH70 subfamilies, and discuss evolutionary relationships between family GH70 and GH13 enzymes.

Brucella β 1,2 Cyclic Glucan Is an Activator of Human and Mouse Dendritic Cells

PubMed Central

Martirosyan, Anna; Pérez-Gutierrez, Camino; Banchereau, Romain; Dutartre, Hélène; Lecine, Patrick; Dullaers, Melissa; Mello, Marielle; Pinto Salcedo, Suzana; Muller, Alexandre; Leserman, Lee; Levy, Yves; Zurawski, Gerard; Zurawski, Sandy; Moreno, Edgardo; Moriyón, Ignacio; Klechevsky, Eynav; Banchereau, Jacques; Oh, SangKon; Gorvel, Jean-Pierre

2012-01-01

Bacterial cyclic glucans are glucose polymers that concentrate within the periplasm of alpha-proteobacteria. These molecules are necessary to maintain the homeostasis of the cell envelope by contributing to the osmolarity of Gram negative bacteria. Here, we demonstrate that Brucella β 1,2 cyclic glucans are potent activators of human and mouse dendritic cells. Dendritic cells activation by Brucella β 1,2 cyclic glucans requires TLR4, MyD88 and TRIF, but not CD14. The Brucella cyclic glucans showed neither toxicity nor immunogenicity compared to LPS and triggered antigen-specific CD8+ T cell responses in vivo. These cyclic glucans also enhanced antigen-specific CD4+ and CD8+ T cell responses including cross-presentation by different human DC subsets. Brucella β 1,2 cyclic glucans increased the memory CD4+ T cell responses of blood mononuclear cells exposed to recombinant fusion proteins composed of anti-CD40 antibody and antigens from both hepatitis C virus and Mycobacterium tuberculosis. Thus cyclic glucans represent a new class of adjuvants, which might contribute to the development of effective antimicrobial therapies. PMID:23166489

21 CFR 173.115 - Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus...

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Alpha-acetolactate decarboxylase (α-ALDC) enzyme... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.115 Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus subtilis. The food additive alpha...

Enhanced enzymatic hydrolysis of lignocellulose by optimizing enzyme complexes.

PubMed

Zhang, Mingjia; Su, Rongxin; Qi, Wei; He, Zhimin

2010-03-01

To enhance the conversion of the cellulose and hemicellulose, the corncob pretreated by aqueous ammonia soaking was hydrolyzed by enzyme complexes. The saturation limit for cellulase (Spezyme CP) was determined as 15 mg protein/g glucan (50 filter paper unit (FPU)/g glucan). The accessory enzymes (beta-glucosidase, xylanase, and pectinase) were supplemented to hydrolyze cellobiose (cellulase-inhibiting product), hemicellulose, and pectin (the component covering the fiber surfaces), respectively. It was found that beta-glucosidase (Novozyme 188) loading of 1.45 mg protein/g glucan [30 cellobiase units (CBU)/g glucan] was enough to eliminate the cellobiose inhibitor, and 2.9 mg protein/g glucan (60 CBU/g glucan) was the saturation limit. The supplementation of xylanase and pectinase can increase the conversion of cellulose and hemicellulose significantly. The yields of glucose and xylose enhanced with the increasing enzyme loading, but the increasing trend became low at high loading. Compared with xylanase, pectinase was more effective to promote the hydrolysis of cellulose and hemicellulose. The supplementation of pectinase with 0.12 mg protein/g glucan could increase the yields of glucose and xylose by 7.5% and 29.3%, respectively.

Evidence for Proinflammatory β-1,6 Glucans in the Pneumocystis carinii Cell Wall

PubMed Central

Kottom, Theodore J.; Hebrink, Deanne M.; Jenson, Paige E.; Gudmundsson, Gunnar

2015-01-01

Inflammation is a major cause of respiratory impairment during Pneumocystis pneumonia. Studies support a significant role for cell wall β-glucans in stimulating inflammatory responses. Fungal β-glucans are comprised of d-glucose homopolymers containing β-1,3-linked glucose backbones with β-1,6-linked glucose side chains. Prior studies in Pneumocystis carinii have characterized β-1,3 glucan components of the organism. However, recent investigations in other organisms support important roles for β-1,6 glucans, predominantly in mediating host cellular activation. Accordingly, we sought to characterize β-1,6 glucans in the cell wall of Pneumocystis and to establish their activity in lung cell inflammation. Immune staining revealed specific β-1,6 localization in P. carinii cyst walls. Homology-based cloning facilitated characterization of a functional P. carinii kre6 (Pckre6) β-1,6 glucan synthase in Pneumocystis that, when expressed in kre6-deficient Saccharomyces cerevisiae, restored cell wall stability. Recently synthesized β-1,6 glucan synthase inhibitors decreased the ability of isolated P. carinii preparations to generate β-1,6 carbohydrate. In addition, isolated β-1,6 glucan fractions from Pneumocystis elicited vigorous tumor necrosis factor alpha (TNF-α) responses from macrophages. These inflammatory responses were significantly dampened by inhibition of host cell plasma membrane microdomain function. Together, these studies indicate that β-1,6 glucans are present in the P. carinii cell wall and contribute to lung cell inflammatory activation during infection. PMID:25916991

Self-Assembled Polysaccharide Nanotubes Generated from β-1,3-Glucan Polysaccharides

NASA Astrophysics Data System (ADS)

Numata, Munenori; Shinkai, Seiji

β-1,3-Glucans act as unique natural nanotubes, the features of which are greatly different from other natural or synthetic helical polymers. The origin mostly stems from their strong helix-forming nature and reversible interconversion between single-strand random coil and triple-strand helix. During this interconversion process, they can accept functional polymers, molecular assemblies and nanoparticles in an induced-fit manner to create water-soluble one-dimensional nanocomposites, where individual conjugated polymers or molecular assemblies can be incorporated into the one-dimensional hollow constructed by the helical superstructure of β-1,3-glucans. The advantageous point of the β-1,3-glucan hosting system is that the selective modification of β-1,3-glucans leads to the creation of various functional one-dimensional nanocomposites in a supramolecular manner, being applicable toward fundamental nanomaterials such as sensors or circuits. Furthermore, the composites with functional surfaces can act as one-dimensional building blocks toward further hierarchical self-assemblies, leading to the creation of two- or three-dimensional nanoarchitectures.

Structure of the Arabidopsis Glucan Phosphatase LIKE SEX FOUR2 Reveals a Unique Mechanism for Starch Dephosphorylation[W

PubMed Central

Meekins, David A.; Guo, Hou-Fu; Husodo, Satrio; Paasch, Bradley C.; Bridges, Travis M.; Santelia, Diana; Kötting, Oliver; Vander Kooi, Craig W.; Gentry, Matthew S.

2013-01-01

Starch is a water-insoluble, Glc-based biopolymer that is used for energy storage and is synthesized and degraded in a diurnal manner in plant leaves. Reversible phosphorylation is the only known natural starch modification and is required for starch degradation in planta. Critical to starch energy release is the activity of glucan phosphatases; however, the structural basis of dephosphorylation by glucan phosphatases is unknown. Here, we describe the structure of the Arabidopsis thaliana starch glucan phosphatase LIKE SEX FOUR2 (LSF2) both with and without phospho-glucan product bound at 2.3Å and 1.65Å, respectively. LSF2 binds maltohexaose-phosphate using an aromatic channel within an extended phosphatase active site and positions maltohexaose in a C3-specific orientation, which we show is critical for the specific glucan phosphatase activity of LSF2 toward native Arabidopsis starch. However, unlike other starch binding enzymes, LSF2 does not possess a carbohydrate binding module domain. Instead we identify two additional glucan binding sites located within the core LSF2 phosphatase domain. This structure is the first of a glucan-bound glucan phosphatase and provides new insights into the molecular basis of this agriculturally and industrially relevant enzyme family as well as the unique mechanism of LSF2 catalysis, substrate specificity, and interaction with starch granules. PMID:23832589

The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

PubMed Central

Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

2015-01-01

ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings

Ovine cardiac Na,K-ATPase: isolation by means of selective solubilization in Lubrol and the effect of 1 alpha,2 alpha-epoxyscillirosidin on this enzyme.

PubMed

Venter, P A; Naudé, R J; Oelofsen, W; Swan, G E

1997-01-01

The inhibition of cardiac Na,K-ATPase by 1 alpha,2 alpha-epoxyscillirosidin is the principal cause of poisoning of cattle by the tulip, Homeria pallida. The ultimate goals of this study were to study the interaction between 1 alpha,2 alpha-epoxyscillirosidin and ovine Na,K-ATPase by means of inhibition and displacement binding studies. Ovine cardiac Na,K-ATPase was isolated in membrane-bound form by means of deoxycholate treatment, high-speed ultracentrifugation, NaI treatment and selective solubilization in Lubrol. The inhibition of ovine cardiac and commercial porcine cerebral cortex Na,K-ATPase by 1 alpha,2 alpha-epoxyscilirosidin and ouabain was studied using a discontinuous Na,K-ATPase assay. The binding of 1 alpha,2 alpha-epoxyscillirosidin, ouabain and digoxin to the above enzymes was compared using a displacement binding assay with [3H] oubain. The Lubrol-solubilized ovine cardiac Na,K-ATPase showed a specific activity of 0.3 U/mg with no ouabain insensitive activity. I50 values of 2.1 x 10(-8) and 2.7 x 10(-8) were obtained for the inhibition of this enzyme by 1 alpha,2 alpha-epoxyscillirosidin and ouabain, respectively. 1 alpha,2 alpha-Epoxyscillirosidin has a much higher KD value (1.5 x 10(-7) M), however, than ouabain (9.5 x 10(-9) M) and digoxin (1.7 x 10(-8) M) in displacement binding studies with [3H]ouabain. 1 alpha,2 alpha-Epoxyscillirosidin is a potent inhibitor of ovine cardiac Na,K-ATPase and is a slightly stronger inhibitor of the enzyme than ouabain. The anomalous result for the displacement of 1 alpha,2 alpha-epoxyscillirosidin from its receptor is either a result of different affinities that K+ has for the enzyme ouabain and enzyme-1 alpha,2 alpha-epoxyscillirosidin complexes or because of different complex stabilities of these complexes.

Quantitative iTRAQ secretome analysis of Aspergillus niger reveals novel hydrolytic enzymes.

PubMed

Adav, Sunil S; Li, An A; Manavalan, Arulmani; Punt, Peter; Sze, Siu Kwan

2010-08-06

The natural lifestyle of Aspergillus niger made them more effective secretors of hydrolytic proteins and becomes critical when this species were exploited as hosts for the commercial secretion of heterologous proteins. The protein secretion profile of A. niger and its mutant at different pH was explored using iTRAQ-based quantitative proteomics approach coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). This study characterized 102 highly confident unique proteins in the secretome with zero false discovery rate based on decoy strategy. The iTRAQ technique identified and relatively quantified many hydrolyzing enzymes such as cellulases, hemicellulases, glycoside hydrolases, proteases, peroxidases, and protein translocating transporter proteins during fermentation. The enzymes have potential application in lignocellulosic biomass hydrolysis for biofuel production, for example, the cellulolytic and hemicellulolytic enzymes glucan 1,4-alpha-glucosidase, alpha-glucosidase C, endoglucanase, alpha l-arabinofuranosidase, beta-mannosidase, glycosyl hydrolase; proteases such as tripeptidyl-peptidase, aspergillopepsin, and other enzymes including cytochrome c oxidase, cytochrome c oxidase, glucose oxidase were highly expressed in A. niger and its mutant secretion. In addition, specific enzyme production can be stimulated by controlling pH of the culture medium. Our results showed comprehensive unique secretory protein profile of A. niger, its regulation at different pH, and the potential application of iTRAQ-based quantitative proteomics for the microbial secretome analysis.

Glucansucrases: three-dimensional structures, reactions, mechanism, α-glucan analysis and their implications in biotechnology and food applications.

PubMed

Leemhuis, Hans; Pijning, Tjaard; Dobruchowska, Justyna M; van Leeuwen, Sander S; Kralj, Slavko; Dijkstra, Bauke W; Dijkhuizen, Lubbert

2013-01-20

Glucansucrases are extracellular enzymes that synthesize a wide variety of α-glucan polymers and oligosaccharides, such as dextran. These carbohydrates have found numerous applications in food and health industries, and can be used as pure compounds or even be produced in situ by generally regarded as safe (GRAS) lactic acid bacteria in food applications. Research in the recent years has resulted in big steps forward in the understanding and exploitation of the biocatalytic potential of glucansucrases. This paper provides an overview of glucansucrase enzymes, their recently elucidated crystal structures, their reaction and product specificity, and the structural analysis and applications of α-glucan polymers. Furthermore, we discuss key developments in the understanding of α-glucan polymer formation based on the recently elucidated three-dimensional structures of glucansucrase proteins. Finally we discuss the (potential) applications of α-glucans produced by lactic acid bacteria in food and health related industries. Copyright © 2012 Elsevier B.V. All rights reserved.

Macrophage Internalization of Fungal β-Glucans Is Not Necessary for Initiation of Related Inflammatory Responses

PubMed Central

McCann, Frances; Carmona, Eva; Puri, Vishwajeet; Pagano, Richard E.; Limper, Andrew H.

2005-01-01

Cell wall β-glucans are highly conserved structural components of fungi that potently trigger inflammatory responses in an infected host. Identification of molecular mechanisms responsible for internalization and signaling of fungal β-glucans should enhance our understanding of innate immune responses to fungi. In this study, we demonstrated that internalization of fungal β-glucan particles requires actin polymerization but not participation of components of caveolar uptake mechanisms. Using fluorescence microscopy, we observed that uptake of 5-([4,6-dichlorotriazin-2-yl] amino)-fluorescein hydrochloride-Celite complex-labeled Saccharomyces cerevisiae β-glucan by RAW macrophages was substantially reduced in the presence of cytochalasin D, which antagonizes actin-mediated internalization pathways, but not by treatment with nystatin, which blocks caveolar uptake. Interestingly, β-glucan-induced NF-κB translocation, which is necessary for inflammatory activation, and tumor necrosis factor alpha production were both normal in the presence of cytochalasin D, despite defective internalization of β-glucan particles following actin disruption. Dectin-1, a major β-glucan receptor on macrophages, colocalized to phagocytic cups on macrophages and exhibited tyrosine phosphorylation after challenge with β-glucan particles. Dectin-1 localization and other membrane markers were not affected by treatment with cytochalasin D. Furthermore, dectin-1 receptors rather than Toll-like receptor 2 receptors were shown to be necessary for both efficient internalization of β-glucan particles and cytokine release in response to the fungal cell wall component. PMID:16177305

21 CFR 173.115 - Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus...

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Alpha-acetolactate decarboxylase (α-ALDC) enzyme...) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.115 Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant...

21 CFR 173.115 - Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus...

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Alpha-acetolactate decarboxylase (α-ALDC) enzyme...) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.115 Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant...

21 CFR 173.115 - Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus...

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Alpha-acetolactate decarboxylase (α-ALDC) enzyme...) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.115 Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant...

21 CFR 173.115 - Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant Bacillus...

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Alpha-acetolactate decarboxylase (α-ALDC) enzyme...) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.115 Alpha-acetolactate decarboxylase (α-ALDC) enzyme preparation derived from a recombinant...

The effects of β-glucan on human immune and cancer cells

PubMed Central

Chan, Godfrey Chi-Fung; Chan, Wing Keung; Sze, Daniel Man-Yuen

2009-01-01

Non-prescriptional use of medicinal herbs among cancer patients is common around the world. The alleged anti-cancer effects of most herbal extracts are mainly based on studies derived from in vitro or in vivo animal experiments. The current information suggests that these herbal extracts exert their biological effect either through cytotoxic or immunomodulatory mechanisms. One of the active compounds responsible for the immune effects of herbal products is in the form of complex polysaccharides known as β-glucans. β-glucans are ubiquitously found in both bacterial or fungal cell walls and have been implicated in the initiation of anti-microbial immune response. Based on in vitro studies, β-glucans act on several immune receptors including Dectin-1, complement receptor (CR3) and TLR-2/6 and trigger a group of immune cells including macrophages, neutrophils, monocytes, natural killer cells and dendritic cells. As a consequence, both innate and adaptive response can be modulated by β-glucans and they can also enhance opsonic and non-opsonic phagocytosis. In animal studies, after oral administration, the specific backbone 1→3 linear β-glycosidic chain of β-glucans cannot be digested. Most β-glucans enter the proximal small intestine and some are captured by the macrophages. They are internalized and fragmented within the cells, then transported by the macrophages to the marrow and endothelial reticular system. The small β-glucans fragments are eventually released by the macrophages and taken up by other immune cells leading to various immune responses. However, β-glucans of different sizes and branching patterns may have significantly variable immune potency. Careful selection of appropriate β-glucans is essential if we wish to investigate the effects of β-glucans clinically. So far, no good quality clinical trial data is available on assessing the effectiveness of purified β-glucans among cancer patients. Future effort should direct at performing well

β-Glucoside Activators of Mung Bean UDP-Glucose: β-Glucan Synthase 1

PubMed Central

Callaghan, Theresa; Ross, Peter; Weinberger-Ohana, Patricia; Benziman, Moshe

1988-01-01

n-Alkyl (C6-C12) β-d-monoglucopyranosides have been found to be highly potent activators of mung bean β-glucan synthase in vitro, increasing the Vmax of the enzyme as much as 60-fold and with Ka values as low as 10 micromolar. Activation is highly specific for the β-linked terminal glucose residue; other alkyl glycosides such as, octyl-α-glucoside, dodecyl β-maltoside, 6-lauryl sucrose, 6-lauryl glucose, which lack this structure, are ineffective as activators. Based on the similarities in their structure and effects on β-glucan synthesis under a variety of conditions, it is proposed that the alkyl β-glucosides are structural analogs of the native glucolipid activator of β-glucan synthase isolated from mung bean extracts. PMID:16666039

Purification and properties of an alpha-amylase protein-inhibitor from Arachis hypogaea seeds.

PubMed

Irshad, M; Sharma, C B

1981-06-15

A protein showing highly specific inhibitory activity towards hog pancreatic and human salivary alpha-amylases (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1), but not towards plant and bacterial alpha-amylases, has been purified 197-fold from an aqueous extract of peanut cotyledons using heat treatment, (NH4)2SO4 precipitation and ion-exchange chromatography on DEAE- and CM-cellulose. The purified inhibitor was homogeneous by polyacrylamide gel electrophoresis. Its molecular weight, as determined by Sephadex G-100 gel-filtration, and its electrophoretic mobility at pH 8 relative to bromophenol blue, were 25 000 and 0.14, respectively. The inhibitory activity was relatively resistant to thermal treatment and markedly increased when the inhibitor was preincubated with the enzyme before the addition of starch. Further, the inhibition was found to be pH-dependent and non-competitive in nature.

Alpha-glucosidase folding during urea denaturation: enzyme kinetics and computational prediction.

PubMed

Wu, Xue-Qiang; Wang, Jun; Lü, Zhi-Rong; Tang, Hong-Min; Park, Daeui; Oh, Sang-Ho; Bhak, Jong; Shi, Long; Park, Yong-Doo; Zou, Fei

2010-03-01

In this study, we investigated structural changes in alpha-glucosidase during urea denaturation. Alpha-glucosidase was inactivated by urea in a dose-dependent manner. The inactivation was a first-order reaction with a monophase process. Urea inhibited alpha-glucosidase in a mixed-type reaction. We found that an increase in the hydrophobic surface of this enzyme induced by urea resulted in aggregation caused by unstable folding intermediates. We also simulated the docking between alpha-glucosidase and urea. The docking simulation suggested that several residues, namely THR9, TRP14, LYS15, THR287, ALA289, ASP338, SER339, and TRP340, interact with urea. Our study provides insights into the alpha-glucosidase unfolding pathway and 3D structure of alpha-glucosidase.

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

PubMed

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

PubMed

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Heat treatment of curdlan enhances the enzymatic production of biologically active β-(1,3)-glucan oligosaccharides.

PubMed

Kumagai, Yuya; Okuyama, Masayuki; Kimura, Atsuo

2016-08-01

Biologically active β-(1,3)-glucan oligosaccharides were prepared from curdlan using GH64 enzyme (KfGH64). KfGH64 showed low activity toward native curdlan; thereby pretreatment conditions of curdlan were evaluated. KfGH64 showed the highest activity toward curdlan with heat treatment. The most efficient pretreatment (90°C for 0.5h) converted approximately 60% of curdlan into soluble saccharides under the optimized enzyme reaction conditions (pH 5.5, 37°C, 100rpm mixing speed, 24h, and 10μg of KfGH64/1g of curdlan). The resulting products were predominantly laminaripentaose and a small amount of β-(1,3)-glucans with an average degree of polymerization (DP) of 13 and 130. The products did not contain small oligosaccharides (DP<5), indicating that the hydrolysis of heat-treated curdlan by KfGH64 is a suitable method for the production of biologically active β-(1,3)-glucan oligosaccharides. Copyright © 2016 Elsevier Ltd. All rights reserved.

Binding of glucosyltransferase and glucan synthesis by Streptococcus mutans and other bacteria.

PubMed

Hamada, S; Tai, S; Slade, H D

1978-07-01

Lyophilized and heat-treated cells from the seven serotypes of Streptococcus mutans were examined for their ability to bind added insoluble-product glucosyl-transferase (GTase) and to synthesize cell-associated glucan from [(14)C]sucrose. Lyophilized cells of serotypes a and g did not synthesize any more additional glucan than did the controls after exposure to GTase. These cells, however, synthesized four- to eightfold-greater quantities of glucan than did the cells of the remaining serotypes. Lyophilized cells of serotypes b, c, d, e, and f synthesized two- to threefold-greater quantities of glucan after exposure to GTase than did the controls without added enzyme. Lyophilized cells of serotypes a and g synthesized 6- to 10-fold-greater quantities of glucan than did heat-treated cells of the same strain after binding of GTase. Lyophilized cells of the remaining serotypes synthesized only 1.6- to 3.3-fold-greater quantities of glucan than did the heat-treated cells. These results demonstrate that heat treatment to inactivate cell-associated GTase does not create additional GTase binding sites in S. mutans and that serotypes a and g are considerably more active in cell-associated glucan synthesis than cells of the other five serotypes. Ten species of gram-positive and gram-negative bacteria from five genera which do not produce in vitro plaque synthesized 10- to 100-fold-less glucan than did the S. mutans strains after exposure to GTase. Of these species, S. sanguis, Actinomyces viscosus, and A. naeslundii synthesized the largest quantities of glucan. Three mutant strains of S. mutans which possess a reduced ability for in vitro adherence but do agglutinate with glucan or dextran synthesized only one-third as much glucan after binding of GTase as the control. These results are discussed in relation to in vitro and in vivo plaque development and the agglutination of S. mutans. The results support earlier findings which indicate that the presence of bacterial species

Gamma-irradiated β-glucan modulates signaling molecular targets of hepatocellular carcinoma in rats.

PubMed

Elsonbaty, Sawsan M; Zahran, Walid E; Moawed, Fatma Sm

2017-08-01

β-glucans are one of the most abundant forms of polysaccharides known as biological response modifiers which influence host's biological response and stimulate immune system. Accordingly, this study was initiated to evaluate irradiated β-glucan as a modulator for cellular signaling growth factors involved in the pathogenesis of hepatocellular carcinoma in rats. Hepatocellular carcinoma was induced with 20 mg diethylnitrosamine/kg BW. Rats received daily by gastric gavage 65 mg irradiated β-glucan/kg BW. It was found that treatment of rats with diethylnitrosamine induced hepatic injury and caused significant increase in liver injury markers with a concomitant significant increase in both hepatic oxidative and inflammatory indices: alpha-fetoprotein, interferon gamma, and interleukin 6 in comparison with normal and irradiated β-glucan-treated groups. Western immunoblotting showed a significant increase in the signaling growth factors: extracellular signal-regulated kinase 1 and phosphoinositide 3-kinase proteins in a diethylnitrosamine-treated group while both preventive and therapeutic irradiated β-glucan treatments recorded significant improvement versus diethylnitrosamine group via the modulation of growth factors that encounters hepatic toxicity. The transcript levels of vascular endothelial growth factor A and inducible nitric oxide synthase genes were significantly higher in the diethylnitrosamine-treated group in comparison with controls. Preventive and therapeutic treatments with irradiated β-glucan demonstrated that the transcript level of these genes was significantly decreased which demonstrates the protective effect of β-glucan. Histological investigations revealed that diethylnitrosamine treatment affects the hepatic architecture throughout the significant severe appearance of inflammatory cell infiltration in the portal area and congestion in the portal vein in association with severe degeneration and dysplasia in hepatocytes all over hepatic

Association of Beta-Glucan Endogenous Production with Increased Stress Tolerance of Intestinal Lactobacilli▿

PubMed Central

Stack, Helena M.; Kearney, Niamh; Stanton, Catherine; Fitzgerald, Gerald F.; Ross, R. Paul

2010-01-01

The exopolysaccharide beta-glucan has been reported to be associated with many health-promoting and prebiotic properties. The membrane-associated glycosyltransferase enzyme (encoded by the gtf gene), responsible for microbial beta-glucan production, catalyzes the conversion of sugar nucleotides into beta-glucan. In this study, the gtf gene from Pediococcus parvulus 2.6 was heterologously expressed in Lactobacillus paracasei NFBC 338. When grown in the presence of glucose (7%, wt/vol), the recombinant strain (pNZ44-GTF+) displayed a “ropy” phenotype, while scanning electron microscopy (SEM) revealed strands of polysaccharide-linking neighboring cells. Beta-glucan biosynthesis was confirmed by agglutination tests carried out with Streptococcus pneumoniae type 37-specific antibodies, which specifically detect glucan-producing cells. Further analysis showed a ∼2-fold increase in viscosity in broth media for the beta-glucan-producing strain over 24 h compared to the control strain, which did not show any significant increase in viscosity. In addition, we analyzed the ability of beta-glucan-producing Lactobacillus paracasei NFBC 338 to survive both technological and gastrointestinal stresses. Heat stress assays revealed that production of the polysaccharide was associated with significantly increased protection during heat stress (60-fold), acid stress (20-fold), and simulated gastric juice stress (15-fold). Bile stress assays revealed a more modest but significant 5.5-fold increase in survival for the beta-glucan-producing strain compared to that of the control strain. These results suggest that production of a beta-glucan exopolysaccharide by strains destined for use as probiotics may afford them greater performance/protection during cultivation, processing, and ingestion. As such, expression of the gtf gene may prove to be a straightforward approach to improve strains that might otherwise prove sensitive in such applications. PMID:19933353

Structural Insights of Glucan Phosphatase Dynamics using Amide Hydrogen/Deuterium Exchange Mass Spectrometry

PubMed Central

Hsu, Simon; Kim, Youngjun; Li, Sheng; Durrant, Eric S.; Pace, Rachel M.; Woods, Virgil L.; Gentry, Matthew S.

2009-01-01

Laforin and Starch Excess 4 (SEX4) are founding members of a class of phosphatases that dephosphorylate phosphoglucans. Each protein contains a carbohydrate binding module (CBM) and a dual specificity phosphatase (DSP) domain. The gene encoding laforin is mutated in a fatal neurodegenerative disease called Lafora disease (LD). In the absence of laforin function, insoluble glucans accumulate that are hyperphosphorylated and exhibit sparse branching. It is hypothesized that these accumulations trigger the neurodegeneration and premature death of LD patients. We recently demonstrated that laforin removes phosphate from phosphoglucans and hypothesized that this function inhibits insoluble glucan accumulation. Loss of SEX4 function in plants yields a similar cellular phenotype; cells accumulate an excess amount of insoluble, hyperphosphorylated glucans. While multiple groups have shown that these phosphatases dephosphorylate phosphoglucans, there is no structure of a glucan phosphatase and little is known about the mechanism whereby they perform this action. We utilized hydrogen-deuterium exchange mass spectrometry (DXMS) and structural modeling to probe the conformational and structural dynamics of the glucan phosphatase SEX4. We found that the enzyme does not undergo a global conformational change upon glucan binding, but instead undergoes minimal rearrangement upon binding. The CBM undergoes increased protection from deuteration when bound to glucans, confirming its role in glucan binding. More interestingly, we identified structural components of the DSP that also undergo increased protection from deuteration upon glucan addition. To determine the position of these regions, we generated a homology model of the SEX4 DSP. The homology model shows that all of these regions are adjacent the DSP active site. Therefore, our results suggest that these regions of the DSP participate in presenting the phosphoglucan to the active site and provide the first structural analysis

Potential of glucans as vaccine adjuvants: A review of the α-glucans case.

PubMed

Moreno-Mendieta, Silvia; Guillén, Daniel; Hernández-Pando, Rogelio; Sánchez, Sergio; Rodríguez-Sanoja, Romina

2017-06-01

α-Glucans are present in virtually all domains of life, and these glucose chains linked by α-1,4- and α-1,6-linked branches form the most important storage carbohydrates in cells. It is likely for this reason that α-glucans are not generally considered as bioactive molecules as β-glucans are. Nevertheless, it is known that depending on their source, many α-glucans play important roles as modulators of immune response. Recent efforts have attempted to elucidate the mechanisms through which α-glucans exert their immunostimulant effects; however, the main challenge is the accurate identification of the receptors of immune cells involved in their recognition. Here, we review the adjuvant properties reported for some polysaccharides and ultimately focus on α-glucans and how their structural characteristics, such as molecular weight, solubility and derivatization, influence their immunostimulatory properties. As a final point, we discuss the potential and associated challenges of using these polysaccharides as adjuvants, particularly in mucosal vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of the Paenibacillus beijingensis DSM 24997 GtfD and its glucan polymer products representing a new glycoside hydrolase 70 subfamily of 4,6-α-glucanotransferase enzymes.

PubMed

Gangoiti, Joana; Lamothe, Lisa; van Leeuwen, Sander Sebastiaan; Vafiadi, Christina; Dijkhuizen, Lubbert

2017-01-01

Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4) glucan chains connected by alternating (α1→4)/(α1→6) linkages and (α1→4,6) branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org). In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4) sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures.

Characterization of the Paenibacillus beijingensis DSM 24997 GtfD and its glucan polymer products representing a new glycoside hydrolase 70 subfamily of 4,6-α-glucanotransferase enzymes

PubMed Central

Lamothe, Lisa; van Leeuwen, Sander Sebastiaan; Vafiadi, Christina; Dijkhuizen, Lubbert

2017-01-01

Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4) glucan chains connected by alternating (α1→4)/(α1→6) linkages and (α1→4,6) branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org). In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4) sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures. PMID:28399167

β-Glucan from Saccharomyces cerevisiae Induces IFN-γ Production In Vivo in BALB/c Mice.

PubMed

Javmen, Artur; Nemeikaitė-Čėnienė, Aušra; Bratchikov, Maksim; Grigiškis, Saulius; Grigas, Fortūnatas; Jonauskienė, Irena; Zabulytė, Danguolė; Mauricas, Mykolas

2015-01-01

β-Glucan is one of the most abundant polymers in nature and has been established as an immunomodulator. This compound has notable physiological effects on mammalian immune systems, including anti-tumor and anti-infective activities and can activate the immune response. It is considered that the immune-stimulating activities of β-glucan can depend on physicochemical parameters, such as molecular size. Saccharomyces cerevisiae, also known as baker's yeast, is a frequently used source of β-glucan. The aim of the experiments was to investigate how different Saccharomyces cerevisiae β-glucan preparations with different molecular size affect interferon-gamma (IFN-γ) production in BALB/c mice. In vivo and in vitro BALB/c mouse models were used for the investigations. Different β-glucan preparations were orally administrated in the in vivo experiments. IFN-γ production in BALB/c mice was analyzed by enzyme-linked immunosorbent assay and measuring interferon-γ RNA concentration. The results showed that orally-administered β-glucan from S. cerevisiae enhanced IFN-γ production in BALB/c mice in the in vivo model, but not by mouse leukocytes in vitro. Moreover, water-soluble β-glucan enhanced IFN-γ production more effectively than did particulate β-glucan. IFN-γ plays an important role in immunity against viral and bacterial infections. Our experiments have shown that β-glucan preparations enhance IFN-γ production in BALB/c mice and can be potentially used for immune system stimulation in mammals. Current results may be used to develop soluble β-glucan nutritional supplements. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

PubMed

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

NASA Technical Reports Server (NTRS)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

The Exiguobacterium sibiricum 255-15 GtfC Enzyme Represents a Novel Glycoside Hydrolase 70 Subfamily of 4,6-α-Glucanotransferase Enzymes.

PubMed

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

2016-01-15

The glycoside hydrolase 70 (GH70) family originally was established for glucansucrase enzymes found solely in lactic acid bacteria synthesizing α-glucan polysaccharides from sucrose (e.g., GtfA). In recent years, we have characterized GtfB and related Lactobacillus enzymes as 4,6-α-glucanotransferase enzymes. These GtfB-type enzymes constitute the first GH70 subfamily of enzymes that are unable to act on sucrose as a substrate but are active with maltodextrins and starch, cleave α1→4 linkages, and synthesize linear α1→6-glucan chains. The GtfB disproportionating type of activity results in the conversion of malto-oligosaccharides into isomalto/malto-polysaccharides with a relatively high percentage of α1→6 linkages. This paper reports the identification of the members of a second GH70 subfamily (designated GtfC enzymes) and the characterization of the Exiguobacterium sibiricum 255-15 GtfC enzyme, which is also inactive with sucrose and displays 4,6-α-glucanotransferase activity with malto-oligosaccharides. GtfC differs from GtfB in synthesizing isomalto/malto-oligosaccharides. Biochemically, the GtfB- and GtfC-type enzymes are related, but phylogenetically, they clearly constitute different GH70 subfamilies, displaying only 30% sequence identity. Whereas the GtfB-type enzyme largely has the same domain order as glucansucrases (with α-amylase domains A, B, and C plus domains IV and V), this GtfC-type enzyme differs in the order of these domains and completely lacks domain V. In GtfC, the sequence of conserved regions I to IV of clan GH-H is identical to that in GH13 (I-II-III-IV) but different from that in GH70 (II-III-IV-I because of a circular permutation of the (β/α)8 barrel. The GtfC 4,6-α-glucanotransferase enzymes thus represent structurally and functionally very interesting evolutionary intermediates between α-amylase and glucansucrase enzymes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Specific starch digestion of maize alpha-limit dextrins by recombinant mucosal glucosidase enzymes

USDA-ARS?s Scientific Manuscript database

Starch digestion requires two luminal enzymes, salivary and pancreatic alpha-amylase (AMY), and four small intestinal mucosal enzyme activities from the N- and C-terminals of maltase-glucoamylase (MGAM) and sucrose-isomaltase (SI) complexes. AMY is not a requirement for starch digestion to glucose b...

Starch Granule Re-Structuring by Starch Branching Enzyme and Glucan Water Dikinase Modulation Affects Caryopsis Physiology and Metabolism

PubMed Central

Shaik, Shahnoor S.; Obata, Toshihiro; Hebelstrup, Kim H.; Schwahn, Kevin; Fernie, Alisdair R.; Mateiu, Ramona V.; Blennow, Andreas

2016-01-01

Starch is of fundamental importance for plant development and reproduction and its optimized molecular assembly is potentially necessary for correct starch metabolism. Re-structuring of starch granules in-planta can therefore potentially affect plant metabolism. Modulation of granule micro-structure was achieved by decreasing starch branching and increasing starch-bound phosphate content in the barley caryopsis starch by RNAi suppression of all three Starch Branching Enzyme (SBE) isoforms or overexpression of potato Glucan Water Dikinase (GWD). The resulting lines displayed Amylose-Only (AO) and Hyper-Phosphorylated (HP) starch chemotypes, respectively. We studied the influence of these alterations on primary metabolism, grain composition, starch structural features and starch granule morphology over caryopsis development at 10, 20 and 30 days after pollination (DAP) and at grain maturity. While HP showed relatively little effect, AO showed significant reduction in starch accumulation with re-direction to protein and β-glucan (BG) accumulation. Metabolite profiling indicated significantly higher sugar accumulation in AO, with re-partitioning of carbon to accumulate amino acids, and interestingly it also had high levels of some important stress-related metabolites and potentially protective metabolites, possibly to elude deleterious effects. Investigations on starch molecular structure revealed significant increase in starch phosphate and amylose content in HP and AO respectively with obvious differences in starch granule morphology at maturity. The results demonstrate that decreasing the storage starch branching resulted in metabolic adjustments and re-directions, tuning to evade deleterious effects on caryopsis physiology and plant performance while only little effect was evident by increasing starch-bound phosphate as a result of overexpressing GWD. PMID:26891365

Immunostimulant effects and potential application of β-glucans derived from marine yeast Debaryomyces hansenii in goat peripheral blood leucocytes.

PubMed

Medina-Córdova, Noé; Reyes-Becerril, Martha; Ascencio, Felipe; Castellanos, Thelma; Campa-Córdova, Angel I; Angulo, Carlos

2018-05-12

Debaryomyces hansenii has been described to be effective probiotic and immunostimulatory marine yeast in fish. Nonetheless, to the best of our knowledge, it has been not assayed in ruminants. This study attempts to describe the immunostimulatory effects of its β-glucan content through in vitro assays using goat peripheral blood leukocytes at 24 h of stimulation. The structural characterization of yeast glucans by proton nuclear magnetic resonance indicated structures containing (1-6)-branched (1-3)-β-D-glucan. In vitro assays using peripheral blood leukocytes stimulated with β-glucans derived from three D. hansenii strains and zymosan revealed that β-glucans significantly increased cell immune parameters, such as phagocytic ability, reactive oxygen species production (respiratory burst), peroxidase activity and nitric oxide production. Antioxidant enzymes revealed an increase in superoxide dismutase and catalase activities in leukocytes stimulated with yeast β-glucans. This study revealed that yeast β-glucans were able to activate dectin-1 mRNA gene expression in leukocytes. The TLR4 gene expression was up-regulated in leukocytes after stimulation with yeast β-glucans. In conclusion, β-glucans were able to modulate the immune system by promoting cell viability, phagocytic activity, antioxidant immune response and immune-related gene expression in leukocytes. Therefore, β-glucans derived from Debaryomyces hansenii should be considered a potential immunostimulant for goat production systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

PubMed Central

Choi, E. Y.; Lee, S. S.; Hyeon, J. Y.; Choe, S. H.; Keum, B. R.; Lim, J. M.; Park, D. C.; Choi, I. S.; Cho, K. K.

2016-01-01

This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS) of Escherichia. The incubated layer was used for a nitric oxide (NO) analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli) LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS)-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1) in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP). This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK) and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α) decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1) that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator. PMID:27488844

Histoplasma capsulatum α-(1,3)-glucan blocks innate immune recognition by the β-glucan receptor

PubMed Central

Rappleye, Chad A.; Eissenberg, Linda Groppe; Goldman, William E.

2007-01-01

Successful infection by fungal pathogens depends on subversion of host immune mechanisms that detect conserved cell wall components such as β-glucans. A less common polysaccharide, α-(1,3)-glucan, is a cell wall constituent of most fungal respiratory pathogens and has been correlated with pathogenicity or linked directly to virulence. However, the precise mechanism by which α-(1,3)-glucan promotes fungal virulence is unknown. Here, we show that α-(1,3)-glucan is present in the outermost layer of the Histoplasma capsulatum yeast cell wall and contributes to pathogenesis by concealing immunostimulatory β-glucans from detection by host phagocytic cells. Production of proinflammatory TNFα by phagocytes was suppressed either by the presence of the α-(1,3)-glucan layer on yeast cells or by RNA interference based depletion of the host β-glucan receptor dectin-1. Thus, we have functionally defined key molecular components influencing the initial host–pathogen interaction in histoplasmosis and have revealed an important mechanism by which H. capsulatum thwarts the host immune system. Furthermore, we propose that the degree of this evasion contributes to the difference in pathogenic potential between dimorphic fungal pathogens and opportunistic fungi. PMID:17227865

Biological indicators for steam sterilization: characterization of a rapid biological indicator utilizing Bacillus stearothermophilus spore-associated alpha-glucosidase enzyme.

PubMed

Albert, H; Davies, D J; Woodson, L P; Soper, C J

1998-11-01

The alpha-glucosidase enzyme was isolated from vegetative cells and spores of Bacillus stearothermophilus, ATCC 7953. Spore-associated enzyme had a molecular weight of approximately 92,700, a temperature optimum of 60 degrees C, and a pH optimum of 7.0-7.5. The enzyme in crude aqueous spore extract was stable for 30 min up to a temperature of 65 degrees C, above which the enzyme was rapidly denatured. The optimal pH for stability of the enzyme was approximately 7.2. The alpha-glucosidase in crude vegetative cell extract had similar characteristics to the spore-associated enzyme but its molecular weight was 86,700. The vegetative cell and spore-associated enzymes were cross-reactive. The enzymes are postulated to derive from a single gene product, which undergoes modification to produce the spore-associated form. The location of alpha-glucosidase in the spore coats (outside the spore protoplast) is consistent with the location of most enzymes involved in activation, germination and outgrowth.

Biosynthesis of a (1. -->. 4)-. beta. -D-glucan. [Lupinus albus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brummond, D.O.

1983-01-01

An enzymatic activity isolated from Lupinus albus that produced an insoluble (1..-->..4)-..beta..-D-glucan from UDP-D-glucose has been solubilized and partially purified. Some of the properties of the enzyme system have been characterized. A proposed sequence of reactions between UDP-D-glucose and the final dextran may involve a (1..-->..4)-..beta..-linked polysaccharide bonded to UDP.

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed Central

Janecek, S.

1996-01-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed

Janecek, S

1996-06-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the

Characterization of the functional interactions of plastidial starch phosphorylase and starch branching enzymes from rice endosperm during reserve starch biosynthesis.

PubMed

Nakamura, Yasunori; Ono, Masami; Sawada, Takayuki; Crofts, Naoko; Fujita, Naoko; Steup, Martin

2017-11-01

Functional interactions of plastidial phosphorylase (Pho1) and starch branching enzymes (BEs) from the developing rice endosperm are the focus of this study. In the presence of both Pho1 and BE, the same branched primer molecule is elongated and further branched almost simultaneously even at very low glucan concentrations present in the purified enzyme preparations. By contrast, in the absence of any BE, glucans are not, to any significant extent, elongated by Pho1. Based on our in vitro data, in the developing rice endosperm, Pho1 appears to be weakly associated with any of the BE isozymes. By using fluorophore-labeled malto-oligosaccharides, we identified maltose as the smallest possible primer for elongation by Pho1. Linear dextrins act as carbohydrate substrates for BEs. By functionally interacting with a BE, Pho1 performs two essential functions during the initiation of starch biosynthesis in the rice endosperm: First, it elongates maltodextrins up to a degree of polymerization of at least 60. Second, by closely interacting with BEs, Pho1 is able to elongate branched glucans efficiently and thereby synthesizes branched carbohydrates essential for the initiation of amylopectin biosynthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

The effect of alpha amylase enzyme on quality of sweet sorghum juice for chrystal sugar

NASA Astrophysics Data System (ADS)

Marwati, T.; Cahyaningrum, N.; Widodo, S.; Astiati, U. T.; Budiyanto, A.; Wahyudiono; Arif, A. B.; Richana, N.

2018-01-01

Sweet sorghum juice (Sorghum bicolor L. Moench) has characteristics similar to sugar cane juice and potentially used for sugar substitutes that can support food security. Nevertheless the sweet sorghum juicecontain starch which impede sorghum sugar crystallization. Therefore, research on the enzymatic process is needed to convert starch into reducing sugar. The experimental design used was the Factorial Randomized Design with the first factor was alpha amylase enzyme concentration (0, 20, 40, 60, 80, 100, 120 μL/100 mL) and second factor was incubation time (0, 30, 60, 90 minute) at temperature 100°C. The experiment was conducted on fresh sweet sorghum. The results showed that the addition of the alpha amylase enzyme increased the content of reducing sugar and decreased levels of starch. Elevating concentration of alpha amylase enzyme will increase the reducing sugar content in sweet sorghum juice. The optimum alpha amylase enzyme concentration to produce the highest total sugar was 80 μL/100 mL of sweet sorghum juice with the optimum incubation time was 90 minutes. The results of this study are expected to create a new sweetener for sugar substitution. From the economic prospective aspect, sorghum is a potential crop and can be relied upon to support the success of the food diversification program which further leads to the world food security

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

PubMed

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

PubMed

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

Distinct Patterns of Dendritic Cell Cytokine Release Stimulated by Fungal β-Glucans and Toll-Like Receptor Agonists▿

PubMed Central

Huang, Haibin; Ostroff, Gary R.; Lee, Chrono K.; Wang, Jennifer P.; Specht, Charles A.; Levitz, Stuart M.

2009-01-01

β-Glucans derived from fungal cell walls have potential uses as immunomodulating agents and vaccine adjuvants. Yeast glucan particles (YGPs) are highly purified Saccharomyces cerevisiae cell walls composed of β1,6-branched β1,3-d-glucan and free of mannans. YGPs stimulated secretion of the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) in wild-type murine bone marrow-derived myeloid dendritic cells (BMDCs) but did not stimulate interleukin-12p70 (IL-12p70) production. A purified soluble β1,6-branched β1,3-d-glucan, scleroglucan, also stimulated TNF-α in BMDCs. These two β-glucans failed to stimulate TNF-α in Dectin-1 (β-glucan receptor) knockout BMDCs. Costimulation of wild-type BMDCs with β-glucans and specific Toll-like receptor (TLR) ligands resulted in greatly enhanced TNF-α production but decreased IL-12p70 production compared with TLR agonists alone. The upregulation of TNF-α and downregulation of IL-12p70 required Dectin-1, but not IL-10. Gamma interferon (IFN-γ) priming did not overcome IL-12p70 reduction by β-glucans. Similar patterns of cytokine regulation were observed in human monocyte-derived dendritic cells (DCs) costimulated with YGPs and the TLR4 ligand lipopolysaccharide. Finally, costimulation of BMDCs with YGPs and either the TLR9 ligand, CpG, or the TLR2/1 ligand, Pam3CSK4, resulted in upregulated secretion of IL-1α and IL-10 and downregulated secretion of IL-1β, IL-6, and IFN-γ-inducible protein 10 but had no significant effects on IL-12p40, keratinocyte-derived chemokine, monocyte chemotactic protein 1, or macrophage inflammatory protein α, compared with the TLR ligand alone. Thus, β-glucans have distinct effects on cytokine responses following DC stimulation with different TLR agonists. These patterns of response might contribute to the skewing of immune responses during mycotic infections and have implications for the design of immunomodulators and vaccines containing β-glucans. PMID:19273561

Digestibility of new dietary fibre materials, resistant glucan and hydrogenated resistant glucan in rats and humans, and the physical effects in rats.

PubMed

Oku, Tsuneyuki; Tanabe, Kenichi; Morita, Shigeki; Hamaguchi, Norihisa; Shimura, Fumio; Nakamura, Sadako

2015-11-28

Resistant glucan (RG) and hydrogenated resistant glucan (HRG) are newly developed non-digestible carbohydrate materials that decrease lifestyle-related diseases. The bioavailability of RG and HRG was investigated by in vitro experiments using human and rat small intestinal enzymes and by in vivo experiments using rats in the present study. Oligosaccharides, which are minor components of RG and HRG, were hydrolysed slightly by small intestinal enzymes of humans and rats, and the hydrolysing activity was slightly higher in rats than in humans. The amount of glucose released from HRG was greater than that from RG. However, the high-molecular-weight carbohydrates of the main components were hardly hydrolysed. Furthermore, neither RG nor HRG inhibited disaccharidase activity. When rats were raised on a diet containing 5 % of RG, HRG, resistant maltodextrin or fructo-oligosaccharide (FOS) for 4 weeks, all rats developed loose stools and did not recover during the experiment, except for the FOS group. Body weight gain was normal in all groups and was not significantly different compared with the control group. Caecal tissue and content weights were significantly increased by feeding RG or HRG, although other organ and tissue weights were not significantly different among the groups. In conclusion, RG and HRG consist of small amounts of glucose and digestible and non-digestible oligosaccharides, and large amounts of glucose polymers, which were hardly hydrolysed by α-amylase and small intestinal enzymes. RG and HRG, which were developed newly as dietary fibre materials, had no harmful effects on the growth and development of rats.

Effect of β-glucan on MUC4 and MUC5B expression in human airway epithelial cells.

PubMed

Kim, Yong-Dae; Bae, Chang Hoon; Song, Si-Youn; Choi, Yoon Seok

2015-08-01

β-Glucan is found in the cell walls of fungi, bacteria, and some plant tissues, and is detected by the innate immune system. Furthermore, this recognition is known to worsen respiratory symptoms in patients with allergic and inflammatory airway diseases. However, the means by which β-glucan affects the secretion of major mucins by human airway epithelial cells has not been elucidated. Therefore, in this study, the effect and signaling pathway of β-glucan on mucins MUC4 and MUC5B were investigated in human airway epithelial cells. In NCI-H292 cells and human normal nasal epithelial cells, the effect and signaling pathway of β-glucan on MUC4 and MUC5B expression were investigated using reverse transcriptase-polymerase chain reaction (RT-PCR), real-time PCR, enzyme immunoassay, and immunoblot analysis with specific inhibitors and small interfering RNA (siRNA). β-Glucan increased MUC4 and MUC5B expression and activated the phosphorylation of p38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). SB203580 (a p38 MAPK inhibitor) and pyrrolidine dithiocarbamate (PDTC; a NF-κB inhibitor) inhibited β-glucan-induced MUC4 and MUC5B expression. In addition, siRNA knockdown of p38 MAPK blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of NF-κB. Furthermore, Toll-like receptor 4 (TLR4) mRNA expression was increased by β-glucan, and siRNA knockdown of TLR4 blocked β-glucan-induced MUC4 and MUC5B mRNA expression and β-glucan-activated phosphorylation of p38 MAPK and NF-κB. These results demonstrate that in human airway epithelial cells β-glucan induces MUC4 and MUC5B expression via the TLR4-p38 MAPK-NF-κB signaling pathway. © 2015 ARS-AAOA, LLC.

Metabolic Network for the Biosynthesis of Intra- and Extracellular α-Glucans Required for Virulence of Mycobacterium tuberculosis

PubMed Central

van de Weerd, Robert; Chandra, Govind; Appelmelk, Ben; Alber, Marina; Ioerger, Thomas R.; Jacobs, William R.; Geurtsen, Jeroen; Bornemann, Stephen

2016-01-01

Mycobacterium tuberculosis synthesizes intra- and extracellular α-glucans that were believed to originate from separate pathways. The extracellular glucose polymer is the main constituent of the mycobacterial capsule that is thought to be involved in immune evasion and virulence. However, the role of the α-glucan capsule in pathogenesis has remained enigmatic due to an incomplete understanding of α-glucan biosynthetic pathways preventing the generation of capsule-deficient mutants. Three separate and potentially redundant pathways had been implicated in α-glucan biosynthesis in mycobacteria: the GlgC-GlgA, the Rv3032 and the TreS-Pep2-GlgE pathways. We now show that α-glucan in mycobacteria is exclusively assembled intracellularly utilizing the building block α-maltose-1-phosphate as the substrate for the maltosyltransferase GlgE, with subsequent branching of the polymer by the branching enzyme GlgB. Some α-glucan is exported to form the α-glucan capsule. There is an unexpected convergence of the TreS-Pep2 and GlgC-GlgA pathways that both generate α-maltose-1-phosphate. While the TreS-Pep2 route from trehalose was already known, we have now established that GlgA forms this phosphosugar from ADP-glucose and glucose 1-phosphate 1000-fold more efficiently than its hitherto described glycogen synthase activity. The two routes are connected by the common precursor ADP-glucose, allowing compensatory flux from one route to the other. Having elucidated this unexpected configuration of the metabolic pathways underlying α-glucan biosynthesis in mycobacteria, an M. tuberculosis double mutant devoid of α-glucan could be constructed, showing a direct link between the GlgE pathway, α-glucan biosynthesis and virulence in a mouse infection model. PMID:27513637

The specificity of induction of alpha-galactosidase from Saccharomyces carlsbergensis.

PubMed

Flórez, I G; Lazo, P S; Ochoa, A G; Gascón, S

1981-04-17

A number of sugars and derivatives have been tested for their ability to induce the synthesis of alpha-galactosidase from Saccharomyces carlsbergensis. Besides galactose and the substrates of the enzyme melibiose, raffinose and stachyose, D-galacturonic acid, L-arabinose, D-tagatose, methyl-alpha-D-galactoside, lactose and isopropyl-beta-D-thiogalactoside were able to act as inducers. Of these, methyl-alpha-D-galactoside, lactose, isopropyl-beta-D-thiogalactoside and L-arabinose have been shown to be gratuitous inducers with which kinetic studies of induction have been carried out. Lactose was the most efficient inducer, giving a maximal differential rate of synthesis of the enzyme of 110 mU/10(7) cells at a concentration of 180 mM, followed by L-arabinose (60 mU/10(7) cells at 40 mM), isopropyl-beta-D-thiogalactoside (43 mU/10(7) cells at 60 mM) and methyl-alpha-D-galactoside (25 mU/10(7) cells at 150 mM). The concentration of inducer required to obtain half-maximal induction was similar for lactose, L-arabinose and isopropyl-beta-D-thiogalactoside and about 5-fold higher for methyl-alpha-D-galactoside. The property of the compounds to act as inducers was compared to their ability to interact with the enzyme and the results discussed in terms of the molecular structures which are recognized by the enzyme and by the induction machinery.

Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

PubMed

Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

2015-10-01

Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact. Copyright © 2015 John Wiley & Sons, Ltd.

16S rRNA-Based Identification of a Glucan-Hyperproducing Weissella confusa

PubMed Central

Shukla, Shraddha; Goyal, Arun

2011-01-01

A gram-positive, nonmotile, irregular, short, rod-shaped new strain of Weissella confusa bacterium was isolated from fermented cabbage. The isolate was physiologically and biochemically characterised. The 16S rDNA was amplified by polymerase chain reaction (PCR). The isolate was identified as Weissella confusa (GenBank accession number: GU138518.1) based on nucleotide homology and phylogenetic analysis. The isolate produces glucansucrase when grown in sucrose-supplemented culture medium which catalyses glucan formation. This novel isolate possesses high capacity of industrial use due to its high productivity of glucan (34 mg/mL) as compared to other strains reported. The optimum temperature for glucansucrase production was 25°C. The shaking condition gave an enzyme activity of 6.1 U/mL which was 1.5 times higher than that given by static condition (4.1 U/mL). The temperature 35°C, pH 5.4, and ionic strength 10–20 mM were optimum for enzyme assay. This investigation unraveled the abundance of industrially valuable microflora of the north east India. PMID:21603260

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

PubMed

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mechanism of enhanced hematopoietic response by soluble beta-glucan SCG in cyclophosphamide-treated mice.

PubMed

Harada, Toshie; Kawaminami, Hiromi; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2006-01-01

SCG is a major 6-branched 1,3-beta-D-glucan in Sparassis crispa Fr. SCG shows antitumor activity and also enhances the hematopoietic response in cyclophosphamide (CY)-treated mice. In the present study, the molecular mechanism of the enhancement of the hematopoietic response was investigated. The levels of interferon-(IFN-)gamma, tumor necrosis factor-(TNF-)alpha, granulocyte-macrophage-colony stimulating factor (GM-CSF), interleukin-(IL-) 6 and IL-12p70 were significantly increased by SCG in CY-treated mice. GM-CSF production in the splenocytes from the CY-treated mice was higher than that in normal mice regardless of SCG stimulation. Neutralizing GM-CSF significantly inhibited the induction of IFN-gamma, TNF-alpha and IL-12p70 by SCG. The level of cytokine induction by SCG was regulated by the amount of endogenous GM-CSF produced in response to CY treatment in a dose-dependent manner. The expression of beta-glucan receptors, such as CR3 and dectin-1, was up-regulated by CY treatment. Blocking dectin-1 significantly inhibited the induction of TNF-alpha and IL-12p70 production by SCG. Taken together, these results suggest that the key factors in the cytokine induction in CY-treated mice were the enhanced levels of both endogenous GM-CSF production and dectin-1 expression.

Polysaccharide-inducible endoglucanases from Lentinula edodes exhibit a preferential hydrolysis of 1,3-1,4-β-glucan and xyloglucan.

PubMed

Takeda, Takumi; Nakano, Yuki; Takahashi, Machiko; Sakamoto, Yuichi; Konno, Naotake

2013-08-07

Three genes encoding glycoside hydrolase family 12 (GH12) enzymes from Lentinula edodes, namely Lecel12A, Lecel12B, and Lecel12C, were newly cloned by PCR using highly conserved sequence primers. To investigate enzymatic properties, recombinant enzymes encoded by L. edodes DNAs and GH12 genes from Postia placenta (PpCel12A and PpCel12B) and Schizophyllum commune (ScCel12A) were prepared in Brevibacillus choshinensis. Recombinant LeCel12A, PpCel12A, and PpCel12B, which were grouped in GH12 subfamily 1, preferentially hydrolyzed 1,3-1,4-β-glucan. By contrast, LeCel12B, LeCel12C, and ScCel12A, members of the subfamily 2, exhibited specific hydrolysis of xyloglucan. These results suggest that two subfamilies of GH12 are separated based on the substrate specificity. Transcript levels of L. edodes genes increased 72 h after growth of L. edodes mycelia cells in the presence of plant cell wall polymers such as xyloglucan, 1,3-1,4-β-glucan, and cellulose. These results suggest that L. edodes GH12 enzymes have evolved to hydrolyze 1,3-1,4-β-glucan and xyloglucan, which might enhance hyphal extension and nutrient acquisition.

The Quaternary Structure of a Glycoside Hydrolase Dictates Specificity toward β-Glucans*

PubMed Central

Lafond, Mickael; Sulzenbacher, Gerlind; Freyd, Thibaud; Henrissat, Bernard; Berrin, Jean-Guy; Garron, Marie-Line

2016-01-01

In the Carbohydrate-Active Enzyme (CAZy) database, glycoside hydrolase family 5 (GH5) is a large family with more than 6,000 sequences. Among the 51 described GH5 subfamilies, subfamily GH5_26 contains members that display either endo-β(1,4)-glucanase or β(1,3;1,4)-glucanase activities. In this study, we focused on the GH5_26 enzyme from Saccharophagus degradans (SdGluc5_26A), a marine bacterium known for its capacity to degrade a wide diversity of complex polysaccharides. SdGluc5_26A displays lichenase activity toward β(1,3;1,4)-glucans with a side cellobiohydrolase activity toward β(1,4)-glucans. The three-dimensional structure of SdGluc5_26A adopts a stable trimeric quaternary structure also observable in solution. The N-terminal region of SdGluc5_26A protrudes into the active site of an adjacent monomer. To understand whether this occupation of the active site could influence its activity, we conducted a comprehensive enzymatic characterization of SdGluc5_26A and of a mutant truncated at the N terminus. Ligand complex structures and kinetic analyses reveal that the N terminus governs the substrate specificity of SdGluc5_26A. Its deletion opens the enzyme cleft at the −3 subsite and turns the enzyme into an endo-β(1,4)-glucanase. This study demonstrates that experimental approaches can reveal structure-function relationships out of reach of current bioinformatic predictions. PMID:26755730

Transcriptome wide identification and characterization of starch branching enzyme in finger millet.

PubMed

Tyagi, Rajhans; Tiwari, Apoorv; Garg, Vijay Kumar; Gupta, Sanjay

2017-01-01

Starch-branching enzymes (SBEs) are one of the four major enzyme classes involved in starch biosynthesis in plants and play an important role in determining the structure and physical properties of starch granules. Multiple SBEs are involved in starch biosynthesis in plants. Finger millet is calcium rich important serial crop belongs to grass family and the transcriptome data of developing spikes is available on NCBI. In this study it was try to find out the gene sequence of starch branching enzyme and annotate the sequence and submit the sequence for further use. Rice SBE sequence was taken as reference and for characterization of the sequence different in silico tools were used. Four domains were found in the finger millet Starch branching enzyme like alpha amylase catalytic domain from 925 to2172 with E value 0, N-terminal Early set domain from 634 to 915 with E value 1.62 e-42, Alpha amylase, C-terminal all-beta domain from 2224 to 2511 with E value 5.80e-24 and 1,4-alpha-glucan-branching enzyme from 421 to 2517 with E value 0. Major binding interactions with the GLC (alpha-d-glucose), CA (calcium ion), GOL (glycerol), TRS (2-amino-2-hydroxymethylpropane- 1, 3-diol), MG (magnesium ion) and FLC (citrate anion) are fond with different residues. It was found in the phylogenetic study of the finger millet SBE with the 6 species of grass family that two clusters were form A and B. In cluster A, finger millet showed closeness with Oryzasativa and Setariaitalica, Sorghum bicolour and Zea mays while cluster B was formed with Triticumaestivum and Brachypodium distachyon. The nucleotide sequence of Finger millet SBE was submitted to NCBI with the accession no KY648913 and protein structure of SBE of finger millet was also submitted in PMDB with the PMDB id - PM0080938. This research presents a comparative overview of Finger millet SBE and includes their properties, structural and functional characteristics, and recent developments on their post-translational regulation.

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192

PubMed Central

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung

2017-01-01

ABSTRACT Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast (Saccharomyces cerevisiae) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter (malEFG1) and pullulanase (aapA) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

PubMed

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Mechanism of the lysosomal membrane enzyme acetyl coenzyme A: alpha-glucosaminide N-acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bame, K.J.

1986-01-01

Acetyl-CoA:..cap alpha..-glucosaminide N-acetyltransferase is a lysosomal membrane enzyme, deficient in the genetic disease Sanfilippo C syndrome. The enzyme catalyzes the transfer of an acetyl group from cytoplasmic acetyl-CoA to terminal ..cap alpha..-glucosamine residues of heparan sulfate within the organelle. The reaction mechanism was examined using high purified lysosomal membranes from rat liver and human fibroblasts. The N-acetyltransferase reaction is optimal above pH 5.5 and a 2-3 fold stimulation of activity is observed in the presence of 0.1% taurodeoxycholate. Double reciprocal analysis and product inhibition studies indicate that the enzyme works by a Di-Iso Ping Pong Bi Bi mechanism. The bindingmore » of acetyl-CoA to the enzyme is measured by exchange label from (/sup 3/H)CoA to acetyl-CoA, and is optimal at pH's above 7.0. The acetyl-enzyme intermediate is formed by incubating membranes with (/sup 3/H)acetyl-CoA. The acetyl group can be transferred to glucosamine, forming (/sup 3/H)N-acetylglucosamine; the transfer is optimal between pH 4 and 5. Lysosomal membranes from Sanfilippo C fibroblasts confirm that these half reactions carried out by the N-acetyltransferase. The enzyme is inactivated by N-bromosuccinimide and diethylpyrocarbonate, indicating that a histidine is involved in the reaction. These results suggest that the histidine residue is at the active site of the enzyme. The properties of the N-acetyltransferase in the membrane, the characterization of the enzyme kinetics, the chemistry of a histidine mediated acetylation and the pH difference across the lysosomal membrane all support a transmembrane acetylation mechanism.« less

Effects of mutations on the insoluble glucan synthesized by Leuconostoc mesenteroides NRRL B-1118 glucansucrase

USDA-ARS?s Scientific Manuscript database

Twelve different amino acids were each substituted for Threonine-654 in a cloned glucansucrase from Leuconostoc mesenteroides NRRL B-1118 (DSR-I). The native enzyme produces a water-insoluble glucan containing approximately 44 mol% 1,3-disubstituted a-D-glucopyranosyl units and 29 mol% 1,6-disubstit...

Fungal β-glucan, a Dectin-1 ligand, promotes protection from Type 1 Diabetes by inducing regulatory innate immune response1

PubMed Central

Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan

2014-01-01

Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443

Reflection on design and testing of pancreatic alpha-amylase inhibitors: an in silico comparison between rat and rabbit enzyme models

PubMed Central

2012-01-01

Background Inhibitors of pancreatic alpha-amylase are potential drugs to treat diabetes and obesity. In order to find compounds that would be effective amylase inhibitors, in vitro and in vivo models are usually used. The accuracy of models is limited, but these tools are nonetheless valuable. In vitro models could be used in large screenings involving thousands of chemicals that are tested to find potential lead compounds. In vivo models are still used as preliminary mean of testing compounds behavior in the whole organism. In the case of alpha-amylase inhibitors, both rats and rabbits could be chosen as in vivo models. The question was which animal could present more accuracy with regard to its pancreatic alpha-amylase. Results As there is no crystal structure of these enzymes, a molecular modeling study was done in order to compare the rabbit and rat enzymes with the human one. The overall result is that rabbit enzyme could probably be a better choice in this regard, but in the case of large ligands, which could make putative interactions with the −4 subsite of pancreatic alpha-amylase, interpretation of results should be made cautiously. Conclusion Molecular modeling tools could be used to choose the most suitable model enzyme that would help to identify new enzyme inhibitors. In the case of alpha-amylase, three-dimensional structures of animal enzymes show differences with the human one which should be taken into account when testing potential new drugs. PMID:23352052

Immunomodulatory Activity of Dietary Fiber: Arabinoxylan and Mixed-Linked Beta-Glucan Isolated from Barley Show Modest Activities in Vitro

PubMed Central

Samuelsen, Anne Berit; Rieder, Anne; Grimmer, Stine; Michaelsen, Terje E.; Knutsen, Svein H.

2011-01-01

High intake of dietary fiber is claimed to protect against development of colorectal cancer. Barley is a rich source of dietary fiber, and possible immunomodulatory effects of barley polysaccharides might explain a potential protective effect. Dietary fiber was isolated by extraction and enzyme treatment. A mixed-linked β-glucan (WSM-TPX, 96.5% β-glucan, Mw 886 kDa), an arabinoxylan (WUM-BS-LA, 96.4% arabinoxylan, Mw 156 kDa), a mixed-linked β-glucan rich fraction containing 10% arabinoxylan (WSM-TP) and an arabinoxylan rich fraction containing 30% mixed-linked β-glucan (WUM-BS) showed no significant effect on IL-8 secretion and proliferation of two intestinal epithelial cell lines, Caco-2 and HT-29, and had no significant effect on the NF-κB activity in the monocytic cell line U937-3κB-LUC. Further enriched arabinoxylan fractions (WUM-BS-LA) from different barley varieties (Tyra, NK96300, SB94897 and CDCGainer) were less active than the mixed-linked β-glucan rich fractions (WSM-TP and WSM-TPX) in the complement-fixing test. The mixed-linked β-glucan rich fraction from NK96300 and CDCGainer showed similar activities as the positive control while mixed-linked β-glucan rich fractions from Tyra and SB94897 were less active. From these results it is concluded that the isolated high molecular weight mixed-linked β-glucans and arabinoxylans from barley show low immunological responses in selected in vitro test systems and thus possible anti-colon cancer effects of barley dietary fiber cannot be explained by our observations. PMID:21340001

Plants with elevated levels of glucan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

A new colorimetric method to quantify β-1,3-1,6-glucans in comparison with total β-1,3-glucans in edible mushrooms.

PubMed

Nitschke, Jörg; Modick, Hendrik; Busch, Ekkehard; von Rekowski, Reimund Wantoch; Altenbach, Hans-Josef; Mölleken, Helga

2011-07-15

Mushroom β-glucans are known for their activity as biological response modifiers and anticarcinogenic agents. β-1,3-1,6 Branched glucans with a triple helix tertiary structure are recognised as the most potent ones. In the present work, a colorimetric method for β-1,3-1,6-glucan quantification based on the dye Congo red is introduced. This method is specific for β-glucans with a triple helix. The β-1,3-1,6-glucan content of mycelia and fruiting bodies from various mushrooms was determined and compared with the total β-1,3-glucan content, measured by a fluorimetric method. The results show equal amounts of β-1,3-1,6- and total β-1,3-glucans in the analysed species but obvious differences between mycelia and fruiting bodies. On the average, 3% of mycelia and 8% of fruiting body dry mass consist of β-1,3-1,6-glucans. The average percentage of β-1,3-1,6-glucans in the total β-1,3-glucan content differs between mycelia (46%) and fruiting bodies (87%). Copyright © 2011 Elsevier Ltd. All rights reserved.

In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

PubMed Central

Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

2016-01-01

Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials. PMID:27469976

In vitro synthesis of linear α-1,3-glucan and chemical modification to ester derivatives exhibiting outstanding thermal properties

NASA Astrophysics Data System (ADS)

Puanglek, Sakarin; Kimura, Satoshi; Enomoto-Rogers, Yukiko; Kabe, Taizo; Yoshida, Makoto; Wada, Masahisa; Iwata, Tadahisa

2016-07-01

Bio-based polymer is considered as one of potentially renewable materials to reduce the consumption of petroleum resources. We report herein on the one-pot synthesis and development of unnatural-type bio-based polysaccharide, α-1,3-glucan. The synthesis can be achieved by in vitro enzymatic polymerization with GtfJ enzyme, one type of glucosyltransferase, cloned from Streptococcus salivarius ATCC 25975 utilizing sucrose, a renewable feedstock, as a glucose monomer source, via environmentally friendly one-pot water-based reaction. The structure of α-1,3-glucan is completely linear without branches with weight-average molecular weight (Mw) of 700 kDa. Furthermore, acetate and propionate esters of α-1,3-glucan were synthesized and characterized. Interestingly, α-1,3-glucan acetate showed a comparatively high melting temperature at 339 °C, higher than that of commercially available thermoplastics such as PET (265 °C) and Nylon 6 (220 °C). Thus, the discovery of crystalline α-1,3-glucan esters without branches with high thermal stability and melting temperature opens the gate for further researches in the application of thermoplastic materials.

Promotion of beta-glucan synthase activity in corn microsomal membranes by calcium and protein phosphorylation

NASA Technical Reports Server (NTRS)

Paliyath, G.; Poovaiah, B. W.

1988-01-01

Regulation of the activity of beta-glucan synthase was studied using microsomal preparations from corn coleoptiles. The specific activity as measured by the incorporation of glucose from uridine diphospho-D-[U-14C]glucose varied between 5 to 15 pmol (mg protein)-1 min-1. Calcium promoted beta-glucan synthase activity and the promotion was observed at free calcium concentrations as low as 1 micromole. Kinetic analysis of substrate-velocity curve showed an apparent Km of 1.92 x 10(-4) M for UDPG. Calcium increased the Vmax from 5.88 x 10(-7) mol liter-1 min-1 in the absence of calcium to 9.52 x 10(-7) mol liter-1 min-1 and 1.66 x 10(-6) mol liter-1 min-1 in the presence of 0.5 mM and 1 mM calcium, respectively. The Km values remained the same under these conditions. Addition of ATP further increased the activity above the calcium-promoted level. Sodium fluoride, a phosphoprotein phosphatase inhibitor, promoted glucan synthase activity indicating that phosphorylation and dephosphorylation are involved in the regulation of the enzyme activity. Increasing the concentration of sodium fluoride from 0.25 mM to 10 mM increased glucan synthase activity five-fold over the + calcium + ATP control. Phosphorylation of membrane proteins also showed a similar increase under these conditions. Calmodulin, in the presence of calcium and ATP stimulated glucan synthase activity substantially, indicating that calmodulin could be involved in the calcium-dependent phosphorylation and promotion of beta-glucan synthase activity. The role of calcium in mediating auxin action is discussed.

Effect of modification with 1,4-α-glucan branching enzyme on the rheological properties of cassava starch.

PubMed

Li, Yadi; Li, Caiming; Gu, Zhengbiao; Hong, Yan; Cheng, Li; Li, Zhaofeng

2017-10-01

Steady and dynamic shear measurements were used to investigate the rheological properties of cassava starches modified using the 1,4-α-glucan branching enzyme (GBE) from Geobacillus thermoglucosidans STB02. GBE treatment lowered the hysteresis loop areas, the activation energy (E a ) values and the parameters in rheological models of cassava starch pastes. Moreover, GBE treatment increased its storage (G') and loss (G″) moduli, and decreased their tan δ (ratio of G″/G') values and frequency-dependencies. Scanning electron microscopic studies showed the selective and particular attack of GBE on starch granules, and X-ray diffraction analyses showed that GBE treatment produces significant structural changes in amylose and amylopectin. These changes demonstrate that GBE modification produces cassava starch with a more structured network and improved stability towards mechanical processing. Differential scanning calorimetric analysis and temperature sweeps indicated greater resistance to granule rupture, higher gel rigidity, and a large decrease in the rate of initial conformational ordering with increasing GBE treatment time. Pronounced changes in rheological parameters revealed that GBE modification enhances the stability of cassava starch and its applicability in the food processing industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Lipid oxidation induced oxidative degradation of cereal beta-glucan.

PubMed

Wang, Yu-Jie; Mäkelä, Noora; Maina, Ndegwa Henry; Lampi, Anna-Maija; Sontag-Strohm, Tuula

2016-04-15

In food systems, lipid oxidation can cause oxidation of other molecules. This research for the first time investigated oxidative degradation of β-glucan induced by lipid oxidation using an oil-in-water emulsion system which simulated a multi-phased aqueous food system containing oil and β-glucan. Lipid oxidation was monitored using peroxide value and hexanal production while β-glucan degradation was evaluated by viscosity and molecular weight measurements. The study showed that while lipid oxidation proceeded, β-glucan degradation occurred. Emulsions containing β-glucan, oil and ferrous ion showed significant viscosity and molecular weight decrease after 1 week of oxidation at room temperature. Elevated temperature (40°C) enhanced the oxidation reactions causing higher viscosity drop. In addition, the presence of β-glucan appeared to retard the hexanal production in lipid oxidation. The study revealed that lipid oxidation may induce the degradation of β-glucan in aqueous food systems where β-glucan and lipids co-exist. Copyright © 2015 Elsevier Ltd. All rights reserved.

β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

PubMed Central

Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

2013-01-01

Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

Similarity of different beta-strands flanked in loops by glycines and prolines from distinct (alpha/beta)8-barrel enzymes: chance or a homology?

PubMed Central

Janecek, S.

1995-01-01

Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed. PMID:7549888

Similarity of different beta-strands flanked in loops by glycines and prolines from distinct (alpha/beta)8-barrel enzymes: chance or a homology?

PubMed

Janecek, S

1995-06-01

Many (alpha/beta)8-barrel enzymes contain their conserved sequence regions at or around the beta-strand segments that are often preceded and succeeded by glycines and prolines, respectively. alpha-Amylase is one of these enzymes. Its sequences exhibit a very low degree of similarity, but strong conservation is seen around its beta-strands. These conserved regions were used in the search for similarities with beta-strands of other (alpha/beta)8-barrel enzymes. The analysis revealed an interesting similarity between the segment around the beta 2-strand of alpha-amylase and the one around the beta 4-strand of glycolate oxidase that are flanked in loops by glycines and prolines. The similarity can be further extended on other members of the alpha-amylase and glycolate oxidase subfamilies, i.e., cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, and flavocytochrome b2, respectively. Moreover, the alpha-subunit of tryptophan synthase, the (alpha/beta)8-barrel enzyme belonging to the other subfamily of (alpha/beta)8-barrels, has both investigated strands, beta 2 and beta 4, similar to beta 2 of alpha-amylase and beta 4 of glycolate oxidase. The possibilities of whether this similarity exists only by chance or is a consequence of some processes during the evolution of (alpha/beta)8-barrel proteins are briefly discussed.

In vitro fermentation of oat flours from typical and high beta-glucan oat lines.

PubMed

Kim, Hyun Jung; White, Pamela J

2009-08-26

Two publicly available oat (Avena sativa) lines, "Jim" and "Paul" (5.17 and 5.31% beta-glucan, respectively), and one experimental oat line "N979" (7.70% beta-glucan), were used to study the effect of beta-glucan levels in oat flours during simulated in vitro digestion and fermentation with human fecal flora obtained from different individuals. The oat flours were digested by using human digestion enzymes and fermented by batch fermentation under anaerobic conditions for 24 h. The fermentation progress was monitored by measuring pH, total gas, and short-chain fatty acid (SCFA) production. Significant effects of beta-glucan on the formation of gas and total SCFA were observed compared to the blank without substrate (P < 0.05); however, there were no differences in pH changes, total gas, and total SCFA production among oat lines (P > 0.05). Acetate, propionate, and butyrate were the main SCFA produced from digested oat flours during fermentation. More propionate and less acetate were produced from digested oat flours compared to lactulose. Different human fecal floras obtained from three healthy individuals had similar patterns in the change of pH and the production of gas during fermentation. Total SCFA after 24 h of fermentation were not different, but the formation rates of total SCFA differed between individuals. In vitro fermentation of digested oat flours with beta-glucan could provide favorable environmental conditions for the colon and these findings, thus, will help in developing oat-based food products with desirable health benefits.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) regulates cytokine induction by 1,3-beta-D-glucan SCG in DBA/2 mice in vitro.

PubMed

Harada, Toshie; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2004-08-01

Sparassis crispa Fr. is an edible/medicinal mushroom that recently became cultivable in Japan. SCG is a major 6-branched 1,3-beta-D-glucan in S. crispa showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice strongly react with SCG to produce interferon-gamma (IFN-gamma). In this study, cytokines induced by SCG were screened and found to be IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12 (IL-12p70). The addition of recombinant murine GM-CSF (rMuGM-CSF) to spleen cell cultures from various strains of mice synergistically enhanced IFN-gamma, TNF-alpha and IL-12p70 in the presence of SCG. In contrast, neutralizing GM-CSF using anti-GM-CSF monoclonal antibody (mAb) significantly inhibited IFN-gamma, TNF-alpha, and IL-12p70 elicited by SCG. We conclude that GM-CSF is a key molecule for cytokine induction by beta-glucan, and GM-CSF induction by SCG is the specific step in DBA/2 mice in vitro.

Action of an endo-β-1,3(4)-glucanase on cellobiosyl unit structure in barley β-1,3:1,4-glucan

PubMed Central

Kuge, Takao; Nagoya, Hiroki; Tryfona, Theodora; Kurokawa, Tsunemi; Yoshimi, Yoshihisa; Dohmae, Naoshi; Tsubaki, Kazufumi; Dupree, Paul; Tsumuraya, Yoichi; Kotake, Toshihisa

2015-01-01

β-1,3:1,4-Glucan is a major cell wall component accumulating in endosperm and young tissues in grasses. The mixed linkage glucan is a linear polysaccharide mainly consisting of cellotriosyl and cellotetraosyl units linked through single β-1,3-glucosidic linkages, but it also contains minor structures such as cellobiosyl units. In this study, we examined the action of an endo-β-1,3(4)-glucanase from Trichoderma sp. on a minor structure in barley β-1,3:1,4-glucan. To find the minor structure on which the endo-β-1,3(4)-glucanase acts, we prepared oligosaccharides from barley β-1,3:1,4-glucan by endo-β-1,4-glucanase digestion followed by purification by gel permeation and paper chromatography. The endo-β-1,3(4)-glucanase appeared to hydrolyze an oligosaccharide with degree of polymerization 5, designated C5-b. Based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight (ToF)/ToF-mass spectrometry (MS)/MS analysis, C5-b was identified as β-Glc-1,3-β-Glc-1,4-β-Glc-1,3-β-Glc-1,4-Glc including a cellobiosyl unit. The results indicate that a type of endo-β-1,3(4)-glucanase acts on the cellobiosyl units of barley β-1,3:1,4-glucan in an endo-manner. PMID:26027730

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

PubMed

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

α- and β-d-Glucans from the edible mushroom Pleurotus albidus differentially regulate lipid-induced inflammation and foam cell formation in human macrophage-like THP-1 cells.

PubMed

Castro-Alves, Victor Costa; Nascimento, João Roberto Oliveira do

2018-05-01

Macrophages play an essential role in lipid metabolism; however, the excessive uptake of modified lipids and cholesterol crystals (CC) leads to the formation of pro-inflammatory lipid-laden macrophages called foam cells. Since the α-1,6- and β-1,3-d-glucans from the basidiome and the mycelium of the edible mushroom Pleurotus albidus have previously been shown to regulate macrophage function, these glucans were tested in macrophage-like THP-1 cells previously exposed to acetylated low-density lipoproteins (acLDL) or CC. The glucans inhibited lipid-induced inflammation, but only the β-1,3-d-glucan regulated both the NLRP3 inflammasome activation and the expression of genes involved on lipid efflux in acLDL- or CC-pretreated cells, thereby reducing foam cell formation. In contrast, the two α-1,6-glucans tested inhibited foam cell formation only in acLDL-pretreated cells and had no effect on the expression of the peroxisome proliferator-activated receptor gamma and liver X receptor alpha genes, suggesting that these glucans regulate lipid influx rather than lipid efflux. Thus, α- and β-d-glucans differentially regulate lipid-induced inflammation and foam cell formation in macrophage-like cells. Furthermore, results emphasize that P. albidus has potential to be used as a functional food or as a source for the extraction of biologically-active glucans. Copyright © 2018 Elsevier B.V. All rights reserved.

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

PubMed

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

Aureobasidium-Derived Soluble Branched (1,3-1,6) β-Glucan (Sophy β-glucan) Enhances Natural Killer Activity in Leishmania amazonensis-Infected Mice

PubMed Central

Yatawara, Lalani; Wickramasinghe, Susiji; Nagataki, Mitsuru; Takamoto, Misa; Nomura, Haruka; Ikeue, Yasunori; Watanabe, Yoshiya

2009-01-01

The β-glucans derived from yeast cell walls have been reported for having many immunomodulatory activities in vivo and in vitro. In this study, Aureobasidium-derived soluble branched (1,3-1,6) β-glucan (Sophy β-glucan) was checked for natural killer (NK) activity and for the production of IFN-γ and IL-4 in Leishmania amazonensis infection. The main experiment was performed with a group of female C57BL/6 and BALB/c mice, orally supplemented with 5% of Sophy β-glucan and infected with promastogotes of L. amazonensis (1 × 107) into the footpad. Increase in the footpad thickness with time was observed in BALB/c mice in spite of the oral Sophy β-glucan supplement, but it was less in C57BL/6 mice. The difference in overall mean footpad thickness between 'infection only' versus 'infection + glucan' groups was statistically significant (P < 0.001). High NK activity in C57BL/6 than BALB/c mice was observed in 'glucan only' group compared to the control group and also in 'infection + glucan' group compared to 'infection only' group. The difference in the NK activity among these groups was significant (P < 0.05). The IFN-γ level increased at weeks 7 and 8 post-infection in C57BL/6 mice and was significantly high in 'infection + glucan' group compared to the 'infection only' group (P < 0.05). IL-4 levels did not increase up to detectable levels throughout the study. The results led a conclusion that Sophy β-glucan enhances NK activity and cellular immunity in L. amazonensis-infected mice. PMID:19967081

Tumor necrosis factor-alpha converting enzyme in the human placenta throughout gestation.

PubMed

Hung, Tai-Ho; Chen, Szu-Fu; Hsieh, Ching-Chang; Hsu, Jenn-Jeih; Li, Meng-Jen; Yeh, Yi-Lin; Hsieh, T'sang-T'ang

2008-02-01

Ectodomain shedding of epidermal growth factor receptor ligands such as transforming growth factor- alpha (TGF-alpha), heparin-binding epidermal growth factor-like growth factor (HBEGF), and amphiregulin (AREG) is considered to be important during implantation. Tumor necrosis factor-alpha converting enzyme (TACE) has been suggested as the major sheddase for these molecules. The objectives of this study are (1) to characterize the expression of TACE in the human placenta throughout gestation; (2) to determine the association between the expression of TACE with TGF-alpha, HBEGF, and AREG; (3) to ascertain whether TACE mediates TGF-alpha, HBEGF, and AREG shedding; and (4) to examine the effect of hypoxia on the expression of TACE. By analyzing a total of 55 villous samples representing different gestational ages, the authors found that TACE was continuously expressed in the placentas throughout gestation and that the levels of TACE were positively correlated with the levels of TGF-alpha, HBEGF, and AREG. Preadministration of a TACE inhibitor in villous explant cultures or transfection of cytotrophoblastic cells with TACE-specific small interference RNA decreased the shedding of HBEGF and AREG. Moreover, hypoxia (2% O(2)) caused an increase in the levels of TACE mRNA and protein in villous explants and primary cytotrophoblastic cells in vitro. These results indicate that oxygen regulates the expression of TACE and that TACE may be important for placental development during human pregnancy.

Structural Dissection of the Maltodextrin Disproportionation Cycle of the Arabidopsis Plastidial Disproportionating Enzyme 1 (DPE1)*

PubMed Central

O'Neill, Ellis C.; Stevenson, Clare E. M.; Tantanarat, Krit; Latousakis, Dimitrios; Donaldson, Matthew I.; Rejzek, Martin; Nepogodiev, Sergey A.; Limpaseni, Tipaporn; Field, Robert A.; Lawson, David M.

2015-01-01

The degradation of transitory starch in the chloroplast to provide fuel for the plant during the night requires a suite of enzymes that generate a series of short chain linear glucans. However, glucans of less than four glucose units are no longer substrates for these enzymes, whereas export from the plastid is only possible in the form of either maltose or glucose. In order to make use of maltotriose, which would otherwise accumulate, disproportionating enzyme 1 (DPE1; a 4-α-glucanotransferase) converts two molecules of maltotriose to a molecule of maltopentaose, which can now be acted on by the degradative enzymes, and one molecule of glucose that can be exported. We have determined the structure of the Arabidopsis plastidial DPE1 (AtDPE1), and, through ligand soaking experiments, we have trapped the enzyme in a variety of conformational states. AtDPE1 forms a homodimer with a deep, long, and open-ended active site canyon contained within each subunit. The canyon is divided into donor and acceptor sites with the catalytic residues at their junction; a number of loops around the active site adopt different conformations dependent on the occupancy of these sites. The “gate” is the most dynamic loop and appears to play a role in substrate capture, in particular in the binding of the acceptor molecule. Subtle changes in the configuration of the active site residues may prevent undesirable reactions or abortive hydrolysis of the covalently bound enzyme-substrate intermediate. Together, these observations allow us to delineate the complete AtDPE1 disproportionation cycle in structural terms. PMID:26504082

Modified Alternan: A Novel Microbial Gum with Potential as a Low-Viscosity Bulking Agent

USDA-ARS?s Scientific Manuscript database

Alternan is a microbial gum produced by rare strains of the GRAS lactic acid bacterium, Leuconostoc mesenteroides. The unique alternating alpha-(1,6) and alpha-(1,3) linkage pattern of this glucan imparts high solubility and resistance to most digestive enzymes. Previously, we invented a bioconver...

Mucosal C-terminal maltase-glucoamylase hydrolyzes large size starch digestion products that may contribute to rapid postprandial glucose generation

USDA-ARS?s Scientific Manuscript database

The four mucosal alpha-glucosidases, which differ in their digestive roles, generate glucose from glycemic carbohydrates and accordingly can be viewed as a control point for rate of glucose delivery to the body. In this study, individual recombinant enzymes were used to understand how alpha-glucan o...

Multipoint attachment to a support protects enzyme from inactivation by organic solvents: alpha-Chymotrypsin in aqueous solutions of alcohols and diols.

PubMed

Mozhaev, V V; Sergeeva, M V; Belova, A B; Khmelnitsky, Y L

1990-03-25

Inactivation of alpha-chymotrypsin in aqueous solutions of alcohols and diols proceeds both reversibly and irreversibly. Reversible loss of the specific enzyme activity results from conformational changes (unfolding) of the enzyme detected by fluorescence spectroscopy. Multipoint covalent attachment to the matrix of polyacryl-amide gel by copolymerization method stabilizes alpha-chymotrypsin from denaturation by alcohols, the stabilizing effect increasing with the number of bonds between the protein and the support. Immobilization protects the enzyme also from irreversible inactivation by organic solvents resulting from bimolecular aggregation and autolysis.

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

PubMed

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

Biogenesis of lysosomal enzymes in the alpha-glucosidase II-deficient modA mutant of Dictyostelium discoideum: retention of alpha-1,3-linked glucose on N-linked oligosaccharides delays intracellular transport but does not alter sorting of alpha-mannosidase or beta-glucosidase.

PubMed

Ebert, D L; Bush, J M; Dimond, R L; Cardelli, J A

1989-09-01

The endoplasmic reticulum-localized enzyme alpha-glucosidase II is responsible for removing the two alpha-1,3-linked glucose residues from N-linked oligosaccharides of glycoproteins. This activity is missing in the modA mutant strain, M31, of Dictyostelium discoideum. Results from both radiolabeled pulse-chase and subcellular fractionation experiments indicate that this deficiency did not prevent intracellular transport and proteolytic processing of the lysosomal enzymes, alpha-mannosidase and beta-glucosidase. However, the rate at which the glucosylated precursors left the rough endoplasmic reticulum was several-fold slower than the rate at which the wild-type precursors left this compartment. Retention of glucose residues did not disrupt the binding of the precursor forms of the enzymes with intracellular membranes, indicating that the delay in movement of proteins from the ER did not result from lack of association with membranes. However, the mutant alpha-mannosidase precursor contained more trypsin-sensitive sites than did the wild-type precursor, suggesting that improper folding of precursor molecules might account for the slow rate of transport to the Golgi complex. Percoll density gradient fractionation of extracts prepared from M31 cells indicated that the proteolytically processed mature forms of alpha-mannosidase and beta-glucosidase were localized to lysosomes. Finally, the mutation in M31 may have other, more dramatic, effects on the lysosomal system since two enzymes, N-acetylglucosaminidase and acid phosphatase, were secreted much less efficiently from lysosomal compartments by the mutant strain.

β-glucan extract from oat bran and its industrial importance

NASA Astrophysics Data System (ADS)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

PubMed

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

The Dual Activity Responsible for the Elongation and Branching of β-(1,3)-Glucan in the Fungal Cell Wall.

PubMed

Aimanianda, Vishukumar; Simenel, Catherine; Garnaud, Cecile; Clavaud, Cecile; Tada, Rui; Barbin, Lise; Mouyna, Isabelle; Heddergott, Christoph; Popolo, Laura; Ohya, Yoshikazu; Delepierre, Muriel; Latge, Jean-Paul

2017-06-20

space. Using Saccharomyces cerevisiae as a model, we identified GH72 and GH17 family glycosyltransferases, Gas1p and Bgl2p, respectively, involved in the β-(1,3)-glucan branching. The sick phenotype of the double Scgas1 Δ bgl2 Δ mutant suggested that β-(1,3)-glucan branching is essential. In addition to Sc Gas1p, GH72 family Sc Gas2p and Aspergillus fumigatus Gel4p, having CBM43 in their sequences, showed dual β-(1,3)-glucan elongating and branching activity. Our report identifies the fungal cell wall β-(1,3)-glucan branching mechanism. The essentiality of β-(1,3)-glucan branching suggests that enzymes involved in the glucan branching could be exploited as antifungal targets. Copyright © 2017 Aimanianda et al.

Protective effects of β-glucan against oxidative injury induced by 2.45-GHz electromagnetic radiation in the skin tissue of rats.

PubMed

Ceyhan, Ali Murat; Akkaya, Vahide Baysal; Güleçol, Şeyma Celik; Ceyhan, Betül Mermi; Özgüner, Fehmi; Chen, WenChieh

2012-09-01

In recent times, there is widespread use of 2.45-GHz irradiation-emitting devices in industrial, medical, military and domestic application. The aim of the present study was to investigate the effect of 2.45-GHz electromagnetic radiation (EMR) on the oxidant and antioxidant status of skin and to examine the possible protective effects of β-glucans against the oxidative injury. Thirty-two male Wistar albino rats were randomly divided into four equal groups: control; sham exposed; EMR; and EMR + β-glucan. A 2.45-GHz EMR emitted device from the experimental exposure was applied to the EMR group and EMR + β-glucan group for 60 min daily, respectively, for 4 weeks. β-glucan was administered via gavage at a dose of 50 mg/kg/day before each exposure to radiation in the treatment group. The activities of antioxidant enzymes, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and catalase (CAT), as well as the concentration of malondialdehyde (MDA) were measured in tissue homogenates of the skin. Exposure to 2.45-GHz EMR caused a significant increase in MDA levels and CAT activity, while the activities of SOD and GSH-Px decreased in skin tissues. Systemic β-glucan significantly reversed the elevation of MDA levels and the reduction of SOD activities. β-glucan treatment also slightly enhanced the activity of CAT and prevented the depletion of GSH-Px activity caused by EMR, but not statistically significantly. The present study demonstrated the role of oxidative mechanisms in EMR-induced skin tissue damages and that β-glucan could ameliorate oxidative skin injury via its antioxidant properties.

Functionally essential, invariant glutamate near the C-terminus of strand beta 5 in various (alpha/beta)8-barrel enzymes as a possible indicator of their evolutionary relatedness.

PubMed

Janecek, S; Baláz, S

1995-08-01

Twelve different (alpha/beta)8-barrel enzymes belonging to three structurally distinct families were found to contain, near the C-terminus of their strand beta 5, a conserved invariant glutamic acid residue that plays an important functional role in each of these enzymes. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif owing to their mutual evolutionary relatedness. For this purpose, the sequence region around the well conserved fifth beta-strand of alpha-amylase containing catalytic glutamate (Glu230, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The isolated sequence stretches of the 12 (alpha/beta)8-barrels are discussed from both the sequence-structural and the evolutionary point of view, the invariant glutamate residue being proposed to be a joining feature of the studied group of enzymes remaining from their ancestral (alpha/beta)8-barrel.

Microwave pretreatment of paramylon enhances the enzymatic production of soluble β-1,3-glucans with immunostimulatory activity.

PubMed

Gissibl, Alexander; Care, Andrew; Parker, Lindsay M; Iqbal, Sameera; Hobba, Graham; Nevalainen, Helena; Sunna, Anwar

2018-09-15

A hydrothermal microwave pretreatment was established to facilitate the enzymatic production of soluble bioactive β-1,3-glucans from the recalcitrant substrate paramylon. The efficacy of this pretreatment was monitored with a newly developed direct Congo Red dye-based assay over a range of temperatures. Microwave pretreatment at 170 °C for 2 min resulted in a significantly enhanced enzymatic hydrolysis of paramylon. The action of endo-β-1,3- and exo- β-1,3-glucanases on the microwave-pretreated paramylon produced soluble β-1,3-glucans with degrees of polymerisation (DP) ranging from 2-59 and 2-7, respectively. In comparison, acid-mediated hydrolysis of untreated paramylon resulted in β-1,3-glucans with a DP range of 2-38. The hydrolysates were assayed on their immunostimulatory effect on murine macrophages by measuring the production of the inflammation-linked marker tumour necrosis factor alpha (TNFα) using immunofluorescence. All of the tested hydrolysis products were shown to induce TNFα production, with the most significant immunostimulatory effect observed with the hydrolysate from the exo-β-1,3-glucanase treatment. Copyright © 2018 Elsevier Ltd. All rights reserved.

Enzyme replacement therapy with velmanase alfa (human recombinant alpha-mannosidase): Novel global treatment response model and outcomes in patients with alpha-mannosidosis.

PubMed

Harmatz, Paul; Cattaneo, Federica; Ardigò, Diego; Geraci, Silvia; Hennermann, Julia B; Guffon, Nathalie; Lund, Allan; Hendriksz, Christian J; Borgwardt, Line

2018-06-01

Alpha-mannosidosis is an ultra-rare monogenic disorder resulting from a deficiency in the lysosomal enzyme alpha-mannosidase, with a prevalence estimated to be as low as 1:1,000,000 live births. The resulting accumulation of mannose-rich oligosaccharides in all tissues leads to a very heterogeneous disorder with a continuum of clinical manifestations with no distinctive phenotypes. Long-term enzyme replacement therapy (ERT) with velmanase alfa is approved in Europe for the treatment of non-neurological manifestations in patients with mild to moderate alpha-mannosidosis. The clinical heterogeneity and rarity of the disease limit the sensitivity of single parameters to detect clinically relevant treatment effects. Thus, we propose a novel multiple variable responder analysis to evaluate the efficacy of ERT for alpha-mannosidosis and present efficacy analyses for velmanase alfa using this method. Global treatment response to velmanase alfa (defined by response to ≥2 domains comprising pharmacodynamic, functional, and quality of life outcomes) was applied post hoc to data from the pivotal placebo-controlled rhLAMAN-05 study and to the longer-term integrated data from all patients in the clinical development program (rhLAMAN-10). After 12 months of treatment, a global treatment response was achieved by 87% of patients receiving velmanase alfa (n = 15) compared with 30% of patients receiving placebo (n = 10). Longer-term data from all patients in the clinical program (n = 33) showed 88% of patients were global responders, including all (100%) pediatric patients (n = 19) and the majority (71%) of adult patients (n = 14). The responder analysis model demonstrates a clinically meaningful treatment effect with velmanase alfa and supports the early initiation and continued benefit of longer-term treatment of all patients with alpha-mannosidosis with this ERT. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Functional diversity of carbohydrate-active enzymes enabling a bacterium to ferment plant biomass.

PubMed

Boutard, Magali; Cerisy, Tristan; Nogue, Pierre-Yves; Alberti, Adriana; Weissenbach, Jean; Salanoubat, Marcel; Tolonen, Andrew C

2014-11-01

Microbial metabolism of plant polysaccharides is an important part of environmental carbon cycling, human nutrition, and industrial processes based on cellulosic bioconversion. Here we demonstrate a broadly applicable method to analyze how microbes catabolize plant polysaccharides that integrates carbohydrate-active enzyme (CAZyme) assays, RNA sequencing (RNA-seq), and anaerobic growth screening. We apply this method to study how the bacterium Clostridium phytofermentans ferments plant biomass components including glucans, mannans, xylans, galactans, pectins, and arabinans. These polysaccharides are fermented with variable efficiencies, and diauxies prioritize metabolism of preferred substrates. Strand-specific RNA-seq reveals how this bacterium responds to polysaccharides by up-regulating specific groups of CAZymes, transporters, and enzymes to metabolize the constituent sugars. Fifty-six up-regulated CAZymes were purified, and their activities show most polysaccharides are degraded by multiple enzymes, often from the same family, but with divergent rates, specificities, and cellular localizations. CAZymes were then tested in combination to identify synergies between enzymes acting on the same substrate with different catalytic mechanisms. We discuss how these results advance our understanding of how microbes degrade and metabolize plant biomass.

Progress of pancreatitis disease biomarker alpha amylase enzyme by new nano optical sensor.

PubMed

Attia, M S; Al-Radadi, Najlaa S

2016-12-15

A new nano optical sensor binuclear Pd-(2-aminothiazole) (urea), Pd(atz,ur) complex was prepared and characterized for the assessment of the activity of alpha amylase enzyme in urine and serum samples for early diagnosis of Pancreatitis disease. The assessment of alpha amylase activity is carried out by the quenching of the luminescence intensity of the nano optical sensor binuclear Pd(atz,ur) complex at 457nm by the 2-chloro-4-nitrophenol (2-CNP) which produced from the reaction of the enzyme with 2-chloro-4-nitrophenyl-α-d-maltotrioside (CNPG3) substrate. The remarkable quenching of the luminescence intensity at 457nm of nano Pd(atz,ur) doped in sol-gel matrix by various concentrations of the 2-CNP was successfully used as an optical sensor for the assessment of α-amylase activity. The calibration plot was achieved over the concentration range 8.5×10(-6) to 1.9×10(-9)molL(-1) 2-CNP with a correlation coefficient of (0.999) and a detection limit of (7.4×10(-10)molL(-1)). The method was used satisfactorily for the assessment of the α-amylase activity over activity range (3-321U/L) in different urine and serum samples of pancreatitis patients. The assessment of the alpha amylase biomarker by the proposed method increases its sensitivity (96.88%) and specificity (94.41%) for early diagnosis of pancreatitis diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Extraction and characterization of beta-D-glucan from oat for industrial utilization.

PubMed

Ahmad, Asif; Anjum, Faqir Muhammad; Zahoor, Tahir; Nawaz, Haq; Ahmed, Zaheer

2010-04-01

Oat beta-D-glucan is a valuable functional ingredient having numerous industrial, nutritional and health benefits. Its extraction needs careful attention as extraction process may affect the physiochemical and functional properties of extracted beta-D-glucan. The present study aimed at analyzing the effect of extraction of beta-D-glucan gum pellets from oat cultivar followed by detailed chemical and functional analysis. Enzymatic extraction process resulted in highest yield and recovery. Chemical analysis revealed protein as a dominating impurity. The water binding capacity of the beta-D-glucan ranged between 3.14 and 4.52 g g(-1) of sample. beta-D-Glucan exhibited ideal foaming stability when appropriate extraction technique was used. The viscosity of beta-D-glucan gum ranged between 35.6 and 56.16 cp. The color analysis showed L* value of beta-D-glucan gum pellet ranged between 72.18 and 83.54. Phosphorus, potassium and calcium appeared as major minerals in beta-D-glucan gum whereas iron, manganese and copper appeared as minor minerals. FTIR spectroscopy also confirms the presence of beta-D-glucan, protein and other components in extracted beta-D-glucan gum pellets. Overall, extracted beta-D-glucan showed a good potential for industrial usage. Copyright 2010 Elsevier B.V. All rights reserved.

Effects of interferon-gamma and tumor necrosis factor-alpha on macrophage enzyme levels

NASA Technical Reports Server (NTRS)

Pierangeli, Silvia S.; Sonnenfeld, Gerald

1989-01-01

Murine peritoneal macrophages were treated with interferon-gamma (IFN-gamma) or tumor necrosis factor-alpha (TNF). Measurements of changes in acid phosphatase and beta-glucuronidase levels were made as an indication of activation by cytokine treatment. IFN-gamma or TNF-gamma treatment resulted in a significant increase in the activities of both enzymes measured in the cell lysates. This increase was observable after 6 h of incubation, but reached its maximum level after 24 h of incubation. The effect of the treatment of the cell with both cytokines together was additive. No synergistic effect of addition of both cytokines on the enzyme levels was observed.

Enzyme immunoassay of two nicergoline metabolites, 10 alpha-methoxy-9, 10-dihydrolysergol (MDL) and 1-methyl-10 alpha-methoxy-9, 10-dihydrolysergol (MMDL).

PubMed

Chen, P; Tian, Z; Digenis, G A; Tai, H H

1996-06-01

Specific and sensitive enzyme immunoassays for two nicergoline metabolites, 10 alpha-methoxy-9, 10-dihydrolysergol (MDL) and 1-methyl-10 alpha-methoxy-9, 10-dihydrolysergol (MMDL) have been developed. The hydroxyl group of hydroxymethyl at position 8 of either MDL or MMDL was carboxymethylated to introduce a carboxyl group for protein conjugation. Antibodies generated from O-carboxymethyl MDL or MMDL recognized the spacer arm between the hapten and the carrier protein and the molecular domain near the conjugation site as well. A heterologous bridge strategy was used to improve the affinity of the hapten-enzyme conjugate to the antibodies. The sensitivity of both assays was greatly increased by using such an approach. Both antibodies are specific for their own haptens. Little cross reactivity was observed with nicergoline and other metabolites. Determination of MDL and MMDL from both spiked plasma and urine showed nearly quantitative recovery. Detection of MDL and MMDL can be as sensitive as 10 pg/ml.

Down-regulation of the CSLF6 gene results in decreased (1,3;1,4)-beta-D-glucan in endosperm of wheat.

PubMed

Nemeth, Csilla; Freeman, Jackie; Jones, Huw D; Sparks, Caroline; Pellny, Till K; Wilkinson, Mark D; Dunwell, Jim; Andersson, Annica A M; Aman, Per; Guillon, Fabienne; Saulnier, Luc; Mitchell, Rowan A C; Shewry, Peter R

2010-03-01

(1,3;1,4)-beta-d-Glucan (beta-glucan) accounts for 20% of the total cell walls in the starchy endosperm of wheat (Triticum aestivum) and is an important source of dietary fiber for human nutrition with potential health benefits. Bioinformatic and array analyses of gene expression profiles in developing caryopses identified the CELLULOSE SYNTHASE-LIKE F6 (CSLF6) gene as encoding a putative beta-glucan synthase. RNA interference constructs were therefore designed to down-regulate CSLF6 gene expression and expressed in transgenic wheat under the control of a starchy endosperm-specific HMW subunit gene promoter. Analysis of wholemeal flours using an enzyme-based kit and by high-performance anion-exchange chromatography after digestion with lichenase showed decreases in total beta-glucan of between 30% and 52% and between 36% and 53%, respectively, in five transgenic lines compared to three control lines. The content of water-extractable beta-glucan was also reduced by about 50% in the transgenic lines, and the M(r) distribution of the fraction was decreased from an average of 79 to 85 x 10(4) g/mol in the controls and 36 to 57 x 10(4) g/mol in the transgenics. Immunolocalization of beta-glucan in semithin sections of mature and developing grains confirmed that the impact of the transgene was confined to the starchy endosperm with little or no effect on the aleurone or outer layers of the grain. The results confirm that the CSLF6 gene of wheat encodes a beta-glucan synthase and indicate that transgenic manipulation can be used to enhance the health benefits of wheat products.

Demonstration of 3 alpha(17 beta)-hydroxysteroid dehydrogenase distinct from 3 alpha-hydroxysteroid dehydrogenase in hamster liver.

PubMed Central

Ohmura, M; Hara, A; Nakagawa, M; Sawada, H

1990-01-01

NAD(+)-linked and NADP(+)-linked 3 alpha-hydroxysteroid dehydrogenases were purified to homogeneity from hamster liver cytosol. The two monomeric enzymes, although having similar molecular masses of 38,000, differed from each other in pI values, activation energy and heat stability. The two proteins also gave different fragmentation patterns by gel electrophoresis after digestion with protease. The NADP(+)-linked enzyme catalysed the oxidoreduction of various 3 alpha-hydroxysteroids, whereas the NAD(+)-linked enzyme oxidized the 3 alpha-hydroxy group of pregnanes and some bile acids, and the 17 beta-hydroxy group of testosterone and androstanes. The thermal stabilities of the 3 alpha- and 17 beta-hydroxysteroid dehydrogenase activities of the NAD(+)-linked enzyme were identical, and the two enzyme activities were inhibited by mixing 17 beta- and 3 alpha-hydroxysteroid substrates, respectively. Medroxyprogesterone acetate, hexoestrol and 3 beta-hydroxysteroids competitively inhibited 3 alpha- and 17 beta-hydroxysteroid dehydrogenase activities of the enzyme. These results show that hamster liver contains a 3 alpha(17 beta)-hydroxysteroid dehydrogenase structurally and functionally distinct from 3 alpha-hydroxysteroid dehydrogenase. Images Fig. 1. Fig. 2. PMID:2317205

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control

PubMed Central

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S.; Westler, William M.; Azadi, Parastoo; Nett, Jeniel

2018-01-01

ABSTRACT Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non-albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan-Candida species biofilm therapy. PMID:29615504

Cell to cell contact through ICAM-1-LFA-1 and TNF-alpha synergistically contributes to GM-CSF and subsequent cytokine synthesis in DBA/2 mice induced by 1,3-beta-D-Glucan SCG.

PubMed

Harada, Toshie; Kawaminami, Hiromi; Miura, Noriko N; Adachi, Yoshiyuki; Nakajima, Mitsuhiro; Yadomae, Toshiro; Ohno, Naohito

2006-04-01

SCG is a major 6-branched 1,3-beta-D-glucan in Sparassis crispa Fr. showing antitumor activity. We recently found that the splenocytes from naive DBA/1 and DBA/2 mice are potently induced by SCG to produce interferon- gamma (IFN-gamma), tumor necrosis factor-alpha (TNF-alpha), granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-12p70 (IL-12p70), and that GM-CSF plays a key biologic role among these cytokines. In this study, we investigated the contribution of cell-cell contact and soluble factors to cytokine induction by SCG in DBA/2 mice. Cell-cell contact involving intercellular adhesion molecule-1 (ICAM-1) and lymphocyte function-associated antigen-1 (LFA-1) was an essential step for the induction of GM-CSF and IFN-gamma by SCG but not for the induction of TNF-alpha or IL-12p70 by SCG. SCG directly induced adherent splenocytes to produce TNF-alpha and IL-12p70. GM-CSF was required for the induction of TNF-alpha by SCG, and in turn, TNF-alpha enhanced the release of GM-CSF and thereby augmented the induction of IL-12p70 and IFN-gamma by SCG. Neutralization of IL-12 significantly inhibited the induction of IFN-gamma by SCG. We concluded that induction of GM-CSF production by SCG was mediated through ICAM-1 and LFA-1 interaction, GM-CSF subsequently contributed to further cytokine induction by SCG, and reciprocal actions of the cytokines were essential for enhancement of the overall response to SCG in DBA/2 mice.

Preparation, characterization, and biological properties of β-glucans

PubMed Central

Rahar, Sandeep; Swami, Gaurav; Nagpal, Navneet; Nagpal, Manisha A.; Singh, Gagan Shah

2011-01-01

β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast), and Agaricus blazei murell (mushroom). Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC) analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa) being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa) to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine. PMID:22171300

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

PubMed Central

El Khoury, D.; Cuda, C.; Luhovyy, B. L.; Anderson, G. H.

2012-01-01

Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan) is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications. PMID:22187640

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

PubMed

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Suppressing effects of glucan on micronuclei induced by Co60 in mice.

PubMed

Chorvatovicová, D

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P less than 0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy.

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

PubMed

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

PubMed Central

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-01-01

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate. PMID:28718825

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii.

PubMed

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-07-18

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

POLYSACCHARIDES FROM CELL WALLS OF AUREOBASIDIUM (PULLULARIA) PULLULANS. PART I. GLUCANS,

DTIC Science & Technology

The cell wall of Aureobasidium (Pullularia) pullulans contains three types of beta - glucan . One, extracted with dilute alkali, has a linear backbone...insoluble in dilute alkali contains a highly crystalline, essentially linear linked glucan and an amorphous glucan . (Author)

Antigen-specific response of murine immune system toward a yeast beta-glucan preparation, zymosan.

PubMed

Miura, T; Ohno, N; Miura, N N; Adachi, Y; Shimada, S; Yadomae, T

1999-06-01

Zymosan, a particulate beta-glucan preparation from Saccharomyces cerevisiae, shows various biological activities, including anti-tumor activity. We have previously shown that soluble beta-glucan initiated anti-tumor activity was long-lived and was effective even by prophylactic treatment at 1 month prior to tumor challenge. However, the activity by zymosan was relatively short-lived. Antigen-specific responses of mice to zymosan might be a causative mechanism. In this paper, mice were immunized with zymosan and antibody production and antigen-specific responses of lymphocytes to zymosan were analyzed. Sera of zymosan immune mice contained zymosan-specific IgG assessed by enzyme-linked immunosorbent assay and FACS. Spleen and bone marrow cells of zymosan-immune mice showed higher cytokine production in response to zymosan. Specificity of zymosan-specific responses were also analyzed using various derivatives prepared from zymosan. These facts strongly suggested that mice recognize zymosan as antigen in addition to non-specific immune stimulant.

Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

PubMed

Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

2012-01-01

Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

PubMed

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

PubMed

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Clinical and Physiological Perspectives of β-Glucans: The Past, Present, and Future

PubMed Central

Bashir, Khawaja Muhammad Imran; Choi, Jae-Suk

2017-01-01

β-Glucans are a group of biologically-active fibers or polysaccharides from natural sources with proven medical significance. β-Glucans are known to have antitumor, anti-inflammatory, anti-obesity, anti-allergic, anti-osteoporotic, and immunomodulating activities. β-Glucans are natural bioactive compounds and can be taken orally, as a food supplement, or as part of a daily diet, and are considered safe to use. The medical significance and efficiency of β-glucans are confirmed in vitro, as well as using animal- and human-based clinical studies. However, systematic study on the clinical and physiological significance of β-glucans is scarce. In this review, we not only discuss the clinical and physiological importance of β-glucans, we also compare their biological activities through the existing in vitro and animal-based in vivo studies. This review provides extensive data on the clinical study of β-glucans. PMID:28872611

Identification and Deletion of Tft1, a Predicted Glycosyltransferase Necessary for Cell Wall β-1,3;1,4-Glucan Synthesis in Aspergillus fumigatus

PubMed Central

Samar, Danial; Kieler, Joshua B.; Klutts, J. Stacey

2015-01-01

Aspergillus fumigatus is an environmental mold that causes severe, often fatal invasive infections in immunocompromised patients. The search for new antifungal drug targets is critical, and the synthesis of the cell wall represents a potential area to find such a target. Embedded within the main β-1,3-glucan core of the A. fumigatus cell wall is a mixed linkage, β-D-(1,3;1,4)-glucan. The role of this molecule or how it is synthesized is unknown, though it comprises 10% of the glucans within the wall. While this is not a well-studied molecule in fungi, it has been studied in plants. Using the sequences of two plant mixed linkage glucan synthases, a single ortholog was identified in A. fumigatus (Tft1). A strain lacking this enzyme (tft1Δ) was generated along with revertant strains containing the native gene under the control of either the native or a strongly expressing promoter. Immunofluorescence staining with an antibody against β-(1,3;1,4)-glucan and biochemical quantification of this polysaccharide in the tft1Δ strain demonstrated complete loss of this molecule. Reintroduction of the gene into the knockout strain yielded reappearance in amounts that correlated with expected expression of the gene. The loss of Tft1 and mixed linkage glucan yielded no in vitro growth phenotype. However, there was a modest increase in virulence for the tft1Δ strain in a wax worm model. While the precise roles for β-(1,3;1,4)-glucan within A. fumigatus cell wall are still uncertain, it is clear that Tft1 plays a pivotal role in the biosynthesis of this cell wall polysaccharide. PMID:25723175

Enzyme replacement therapy in a patient with Fabry disease and the development of IgE antibodies against agalsidase beta but not agalsidase alpha.

PubMed

Tanaka, Akemi; Takeda, Taisuke; Hoshina, Takao; Fukai, Kazuyoshi; Yamano, Tsunekazu

2010-12-01

Fabry disease is an X-linked inherited lysosomal storage disorder caused by an inborn deficiency of the enzyme α-galactosidase A. Enzyme replacement therapy (ERT) with agalsidase alpha or beta isozymes is an effective treatment. Cross-reactivity of immunoglobulin G (IgG) antibodies with agalsidase alpha and beta has been reported, but no such reaction has been recorded for IgE antibodies. We present the case of a patient with Fabry disease who developed antiagalsidase beta IgE antibodies without cross-reactivity to agalsidase alpha. A 17-year-old boy with Fabry disease had suffered from severe atopic dermatitis since infancy, and he complained for several years of peripheral pain during the summer months and when exercising. Fabry disease was confirmed by family history and a positive enzyme test, and ERT was commenced. Following infusion of agalsidase beta (1.0 mg/kg), the patient complained of a high temperature in his hands and feet, and purulent eczema developed. The infusion dose was reduced to 0.2 mg/kg, but the hyperthermia did not change, although its duration decreased. After three infusions, eosinophilia developed (9.4%; 573 cells/μl blood) and remained unresolved after four infusions with agalsidase beta. Treatment with this enzyme was discontinued, and agalsidase alpha (0.2 mg/kg) started. This produced immediate resolution of the eosinophilia, which has been maintained during follow-up. In conclusion, this patient developed IgE antibodies against agalsidase beta, which demonstrated no cross-reactivity to agalsidase alpha. These findings emphasize the importance of analyzing IgE antibodies against both enzymes when patients exhibit severe infusion-related events.

Identification and characterization of core cellulolytic enzymes from Talaromyces cellulolyticus (formerly Acremonium cellulolyticus) critical for hydrolysis of lignocellulosic biomass

DOE PAGES

Inoue, Hiroyuki; Decker, Stephen R.; Taylor, Larry E.; ...

2014-10-09

Background: Enzymatic hydrolysis of pretreated lignocellulosic biomass is an essential process for the production of fermentable sugars for industrial use. A better understanding of fungal cellulase systems will provide clues for maximizing the hydrolysis of target biomass. Talaromyces cellulolyticus is a promising fungus for cellulase production and efficient biomass hydrolysis. Several cellulolytic enzymes purified from T. cellulolyticus were characterized in earlier studies, but the core enzymes critical for hydrolysis of lignocellulosic biomass remain unknown. Results: Six cellulolytic enzymes critical for the hydrolysis of crystalline cellulose were purified from T. cellulolyticus culture supernatant using an enzyme assay based on synergistic hydrolysismore » of Avicel. The purified enzymes were identified by their substrate specificities and analyses of trypsin-digested peptide fragments and were classified into the following glycosyl hydrolase (GH) families: GH3 (β-glucosidase, Bgl3A), GH5 (endoglucanase, Cel5A), GH6 (cellobiohydrolase II, Cel6A), GH7 (cellobiohydrolase I and endoglucanase, Cel7A and Cel7B, respectively), and GH10 (xylanase, Xyl10A). Hydrolysis of dilute acid-pretreated corn stover (PCS) with mixtures of the purified enzymes showed that Cel5A, Cel7B, and Xyl10A each had synergistic effects with a mixture of Cel6A and Cel7A. Cel5A seemed to be more effective in the synergistic hydrolysis of the PCS than Cel7B. The ratio of Cel5A, Cel6A, Cel7A, and Xyl10A was statistically optimized for the hydrolysis of PCS glucan in the presence of Bgl3A. The resultant mixture achieved higher PCS glucan hydrolysis at lower enzyme loading than a culture filtrate from T. cellulolyticus or a commercial enzyme preparation, demonstrating that the five enzymes play a role as core enzymes in the hydrolysis of PCS glucan. In Conclusion: Core cellulolytic enzymes in the T. cellulolyticus cellulase system were identified to Cel5A, Cel6A, Cel7A, Xyl10A, and Bgl3A

Identification and characterization of core cellulolytic enzymes from Talaromyces cellulolyticus (formerly Acremonium cellulolyticus) critical for hydrolysis of lignocellulosic biomass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoue, Hiroyuki; Decker, Stephen R.; Taylor, Larry E.

Background: Enzymatic hydrolysis of pretreated lignocellulosic biomass is an essential process for the production of fermentable sugars for industrial use. A better understanding of fungal cellulase systems will provide clues for maximizing the hydrolysis of target biomass. Talaromyces cellulolyticus is a promising fungus for cellulase production and efficient biomass hydrolysis. Several cellulolytic enzymes purified from T. cellulolyticus were characterized in earlier studies, but the core enzymes critical for hydrolysis of lignocellulosic biomass remain unknown. Results: Six cellulolytic enzymes critical for the hydrolysis of crystalline cellulose were purified from T. cellulolyticus culture supernatant using an enzyme assay based on synergistic hydrolysismore » of Avicel. The purified enzymes were identified by their substrate specificities and analyses of trypsin-digested peptide fragments and were classified into the following glycosyl hydrolase (GH) families: GH3 (β-glucosidase, Bgl3A), GH5 (endoglucanase, Cel5A), GH6 (cellobiohydrolase II, Cel6A), GH7 (cellobiohydrolase I and endoglucanase, Cel7A and Cel7B, respectively), and GH10 (xylanase, Xyl10A). Hydrolysis of dilute acid-pretreated corn stover (PCS) with mixtures of the purified enzymes showed that Cel5A, Cel7B, and Xyl10A each had synergistic effects with a mixture of Cel6A and Cel7A. Cel5A seemed to be more effective in the synergistic hydrolysis of the PCS than Cel7B. The ratio of Cel5A, Cel6A, Cel7A, and Xyl10A was statistically optimized for the hydrolysis of PCS glucan in the presence of Bgl3A. The resultant mixture achieved higher PCS glucan hydrolysis at lower enzyme loading than a culture filtrate from T. cellulolyticus or a commercial enzyme preparation, demonstrating that the five enzymes play a role as core enzymes in the hydrolysis of PCS glucan. In Conclusion: Core cellulolytic enzymes in the T. cellulolyticus cellulase system were identified to Cel5A, Cel6A, Cel7A, Xyl10A, and Bgl3A

Combined Expression of Aspergillus nidulans Endoxylanase X24 and Aspergillus oryzae (alpha)-Amylase in Industrial Baker's Yeasts and Their Use in Bread Making.

PubMed

Monfort, A; Blasco, A; Prieto, J A; Sanz, P

1996-10-01

The Aspergillus nidulans endoxylanase X24 and the Aspergillus oryzae (alpha)-amylase cDNAs were placed under the control of the Saccharomyces cerevisiae actin promoter (pACT1) and introduced into baker's yeast. Bread made with transformants expressing both enzymes (YEpACT-AMY-ACT-X24) showed a 30% increase in volume and reduced firmness in comparison with that produced with a commercial strain. Endoxylanase X24 and (alpha)-amylase seem to act synergistically to improve the quality of bread in terms of volume and density.

Pressure effects on enzyme reactions in mainly organic media: alpha-chymotrypsin in reversed micelles of Aerosol OT in octane.

PubMed

Mozhaev, V V; Bec, N; Balny, C

1994-08-01

Biocatalytic transformations in reversed micelles formed by anionic surfactant Aerosol OT in octane have been studied at high pressures by an example of alpha-chymotrypsin-catalyzed hydrolysis of N-carbobenzoxy-L-tyrosine p-nitrophenyl ester and N-succinyl-L-phenylalanine p-nitroanilide. For the first time it has been found that the enzyme retains high activity in these water-in-oil microemulsions up to a pressure of 2 kbar. The value of the activation volume (delta V*) for the enzyme reactions shows a dependence on the water content in the system. When the size of the micellar aqueous inner cavity (as evaluated at 1 atm) approaches the molecular size of alpha-chymotrypsin, delta V* becomes significantly different from the value in aqueous solution and in the micelles with a larger size. Possibilities of regulating the enzyme activity by pressure in systems with a low content of water are discussed.

Isolation and characterization of periplasmic cyclic beta-glucans of Azorhizobium caulinodans.

PubMed

Komaniecka, Iwona; Choma, Adam

2003-10-24

Oligoglucose molecules isolated from Azorhizobium caulinodans were characterized by compositional analysis, Smith degradation, matrix-assisted laser desorption/ionization time of flight mass spectrometry, and (1)H and (13)C nuclear magnetic resonance analysis. A. caulinodans produced nonbranched and unsubstituted cyclic glucans composed solely of glucose, with the degree of polymerization ranging from 10 to 13. A major fraction of the periplasmic glucans contains 11 glucose residues within rings. The glucose residues are linked by beta-(1,3) and beta-(1,6) glycosidic bonds. These molecules seem to be quite similar to the periplasmic beta-(1,3);(1,6)-glucans synthesized by the Bradyrhizobium strain and are substantially different from the cyclic beta-(1,2)-glucans produced by Agrobacterium and Sinorhizobium species. Azorhizobial cyclic glucan synthesis is not osmoregulated. The response to the osmotic stress in Azorhizobium can be regulated similarly to Brucella spp. It is probable that the biosynthesis of beta-glucans is subject to the feedback control mechanism.

Pattern Recognition Protein Binds to Lipopolysaccharide and β-1,3-Glucan and Activates Shrimp Prophenoloxidase System*

PubMed Central

Amparyup, Piti; Sutthangkul, Jantiwan; Charoensapsri, Walaiporn; Tassanakajon, Anchalee

2012-01-01

The prophenoloxidase (proPO) system is activated upon recognition of pathogens by pattern recognition proteins (PRPs), including a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP). However, shrimp LGBPs that are involved in the proPO system have yet to be clarified. Here, we focus on characterizing the role of a Penaeus monodon LGBP (PmLGBP) in the proPO system. We found that PmLGBP transcripts are expressed primarily in the hemocytes and are increased at 24 h after pathogenic bacterium Vibrio harveyi challenge. The binding studies carried out using ELISA indicated that recombinant (r)PmLGBP binds to β-1,3-glucan and LPS with a dissociation constant of 6.86 × 10−7 m and 3.55 × 10−7 m, respectively. Furthermore, we found that rPmLGBP could enhance the phenoloxidase (PO) activity of hemocyte suspensions in the presence of LPS or β-1,3-glucan. Using dsRNA interference-mediated gene silencing assay, we further demonstrated that knockdown of PmLGBP in shrimp in vivo significantly decreased the PmLGBP transcript level but had no effect on the expression of the other immune genes tested, including shrimp antimicrobial peptides (AMPs). However, suppression of proPO expression down-regulated PmLGBP, proPO-activating enzyme (PmPPAE2), and AMPs (penaeidin and crustin). Such PmLGBP down-regulated shrimp showed significantly decreased total PO activity. We conclude that PmLGBP functions as a pattern recognition protein for LPS and β-1,3-glucan in the shrimp proPO activating system. PMID:22235126

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

NASA Astrophysics Data System (ADS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immunomodulation of Fungal β-Glucan in Host Defense Signaling by Dectin-1

PubMed Central

Batbayar, Sainkhuu; Lee, Dong Hee; Kim, Ha Won

2012-01-01

During the course of evolution, animals encountered the harmful effects of fungi, which are strong pathogens. Therefore, they have developed powerful mechanisms to protect themselves against these fungal invaders. β-Glucans are glucose polymers of a linear β(1,3)-glucan backbone with β(1,6)-linked side chains. The immunostimulatory and antitumor activities of β-glucans have been reported; however, their mechanisms have only begun to be elucidated. Fungal and particulate β-glucans, despite their large size, can be taken up by the M cells of Peyer's patches, and interact with macrophages or dendritic cells (DCs) and activate systemic immune responses to overcome the fungal infection. The sampled β-glucans function as pathogen-associated molecular patterns (PAMPs) and are recognized by pattern recognition receptors (PRRs) on innate immune cells. Dectin-1 receptor systems have been incorporated as the PRRs of β-glucans in the innate immune cells of higher animal systems, which function on the front line against fungal infection, and have been exploited in cancer treatments to enhance systemic immune function. Dectin-1 on macrophages and DCs performs dual functions: internalization of β-glucan-containing particles and transmittance of its signals into the nucleus. This review will depict in detail how the physicochemical nature of β-glucan contributes to its immunostimulating effect in hosts and the potential uses of β-glucan by elucidating the dectin-1 signal transduction pathway. The elucidation of β-glucan and its signaling pathway will undoubtedly open a new research area on its potential therapeutic applications, including as immunostimulants for antifungal and anti-cancer regimens. PMID:24009832

Discovering an Accessible Enzyme: Salivary [alpha]-Amylase--"Prima Digestio Fit in Ore"--A Didactic Approach for High School Students

ERIC Educational Resources Information Center

Marini, Isabella

2005-01-01

Human salivary [alpha]-amylase is used in this experimental approach to introduce biology high school students to the concept of enzyme activity in a dynamic way. Through a series of five easy, rapid, and inexpensive laboratory experiments students learn what the activity of an enzyme consists of: first in a qualitative then in a semi-quantitative…

alpha-Galactosidase from Bacillus megaterium VHM1 and its application in removal of flatulence-causing factors from soymilk.

PubMed

Patil, Aravind Goud G; K, Praveen Kumar S; Mulimani, Veerappa H; Veeranagouda, Yaligara; Lee, Kyoung

2010-11-01

A bacterial strain capable of producing extracellular alpha-galactosidase was isolated from sugar cane industrial waste soil sample. Microbiological, physiological, and biochemical studies revealed that isolate belonged to Bacillus sp,. Furthermore, 16S rDNA sequence analysis of new isolates was identified as Bacillus megaterium VHM1. The production of alpha-galactosidase was optimized by various physical culture conditions. Guar gum and yeast extract acted as the best carbon and nitrogen source, respectively for the production of alpha-galactosidase. The enzyme showed an optimum pH at 7.5 and was stable over a pH between 5 and 9. The enzyme was optimally active in 55degreesC and the enzyme was thermostable with half life of 120 minutes at 55 degrees C and lost their 90%, residual activity in 120 minutes at 60 degrees C. alpha-Galactosidase was strongly inhibited by Ag2, Cu2, and Hg2+ at 1mM concentration. The metal ions Fe2, Mn2+, and Mg2+ had no effect on alpha-galactosidase activity, Zn2+,Ni2+, and Ca2+ reduced the enzyme activity slightly. The B megaterium VHM1 enzyme treatment completely hydrolyzed flatulence-causing sugars of soymilk within one and half hour.

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

21 CFR 866.3050 - Beta-glucan serological assays.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Beta-glucan serological assays. 866.3050 Section 866.3050 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3050 Beta-glucan...

Role of tumour necrosis factor alpha converting enzyme (TACE/ADAM17) and associated proteins in coronary artery disease and cardiac events.

PubMed

Chemaly, Melody; McGilligan, Victoria; Gibson, Mark; Clauss, Matthias; Watterson, Steven; Alexander, H Denis; Bjourson, Anthony John; Peace, Aaron

2017-12-01

Tumour necrosis factor alpha converting enzyme (TACE/ADAM17) is a member of the A disintegrin and metalloproteinase (ADAM) family of ectodomain shedding proteinases. It regulates many inflammatory processes by cleaving several transmembrane proteins, including tumour necrosis factor alpha (TNFα) and its receptors tumour necrosis factor alpha receptor 1 and tumour necrosis factor alpha receptor 2. There is evidence that TACE is involved in several inflammatory diseases, such as ischaemia, heart failure, arthritis, atherosclerosis, diabetes and cancer as well as neurological and immune diseases. This review summarizes the latest discoveries regarding the mechanism of action and regulation of TACE. It also focuses on the role of TACE in atherosclerosis and coronary artery disease (CAD), highlighting clinical studies that have investigated its expression and protein activity. The multitude of substrates cleaved by TACE make this enzyme an attractive target for therapy and a candidate for biomarker research and development in CAD. Crown Copyright © 2017. Published by Elsevier Masson SAS. All rights reserved.

Alpha-Mannosidosis: Therapeutic Strategies.

PubMed

Ceccarini, Maria Rachele; Codini, Michela; Conte, Carmela; Patria, Federica; Cataldi, Samuela; Bertelli, Matteo; Albi, Elisabetta; Beccari, Tommaso

2018-05-17

Alpha-mannosidosis (α-mannosidosis) is a rare lysosomal storage disorder with an autosomal recessive inheritance caused by mutations in the gene encoding for the lysosomal α-d-mannosidase. So far, 155 variants from 191 patients have been identified and in part characterized at the biochemical level. Similarly to other lysosomal storage diseases, there is no relationship between genotype and phenotype in alpha-mannosidosis. Enzyme replacement therapy is at the moment the most effective therapy for lysosomal storage disease, including alpha-mannosidosis. In this review, the genetic of alpha-mannosidosis has been described together with the results so far obtained by two different therapeutic strategies: bone marrow transplantation and enzyme replacement therapy. The primary indication to offer hematopoietic stem cell transplantation in patients affected by alpha-mannosidosis is preservation of neurocognitive function and prevention of early death. The results obtained from a Phase I⁻II study and a Phase III study provide evidence of the positive clinical effect of the recombinant enzyme on patients with alpha-mannosidosis.

Production of low-molecular weight soluble yeast β-glucan by an acid degradation method.

PubMed

Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Kanzaki, Ken; Iwakura, Yoichiro; Ohno, Naohito

2018-02-01

β-glucan is widely distributed in nature as water soluble and insoluble forms. Both forms of β-glucan are utilized in several fields, especially for functional foods. Yeast β-glucan is a medically important insoluble particle. Solubilization of yeast β-glucan may be valuable for improving functional foods and in medicinal industries. In the present study, we applied an acid degradation method to solubilize yeast β-glucan and found that β-glucan was effectively solubilized to low-molecular weight β-glucans by 45% sulfuric acid treatment at 20°C. The acid-degraded soluble yeast β-glucan (ad-sBBG) was further fractionated into a higher-molecular weight fraction (ad-sBBG-high) and a lower-molecular weight fraction (ad-sBBG-low). Since ad-sBBG-high contained mannan, while ad-sBBG-low contained it only scarcely, it was possible to prepare low-molecular weight soluble β-glucan with higher purity. In addition, ad-sBBG-low bound to dectin-1, which is an innate immunity receptor of β-glucan, and showed antagonistic activity against reactive oxygen production and cytokine synthesis by macrophages. Thus, this acid degradation method is an important procedure for generating immune-modulating, low-molecular weight, soluble yeast β-glucan. Copyright © 2017 Elsevier B.V. All rights reserved.

Combined Expression of Aspergillus nidulans Endoxylanase X24 and Aspergillus oryzae (alpha)-Amylase in Industrial Baker's Yeasts and Their Use in Bread Making

PubMed Central

Monfort, A.; Blasco, A.; Prieto, J. A.; Sanz, P.

1996-01-01

The Aspergillus nidulans endoxylanase X24 and the Aspergillus oryzae (alpha)-amylase cDNAs were placed under the control of the Saccharomyces cerevisiae actin promoter (pACT1) and introduced into baker's yeast. Bread made with transformants expressing both enzymes (YEpACT-AMY-ACT-X24) showed a 30% increase in volume and reduced firmness in comparison with that produced with a commercial strain. Endoxylanase X24 and (alpha)-amylase seem to act synergistically to improve the quality of bread in terms of volume and density. PMID:16535419

Lung cancer and β-glucans: review of potential therapeutic applications.

PubMed

Roudi, Raheleh; Mohammadi, Shahla Roudbar; Roudbary, Maryam; Mohsenzadegan, Monireh

2017-08-01

The potential of natural substances with immunotherapeutic properties has long been studied. β-glucans, a cell wall component of certain bacteria and fungi, potentiate the immune system against microbes and toxic substances. Moreover, β-glucans are known to exhibit direct anticancer effects and can suppress cancer proliferation through immunomodulatory pathways. Mortality of lung cancer has been alarmingly increasingly worldwide; therefore, treatment of lung cancer is an urgent necessity. Numerous researchers are now dedicated to using β-glucans as a therapy for lung cancer. In the present attempt, we have reviewed the studies addressing therapeutic effects of β-glucans in primary and metastatic lung cancer published in the time period of 1991-2016.

Beta-glucan enhances the response to SVCV infection in zebrafish.

PubMed

M Medina-Gali, Regla; Ortega-Villaizan, María Del Mar; Mercado, Luis; Novoa, Beatriz; Coll, Julio; Perez, Luis

2018-07-01

The antiviral effects of beta-glucan, an immunostimulatory agent were studied in zebrafish both in vitro and in vivo. Here we show that zebrafish ZF4 cells as well as whole fish primed with yeast β-glucan zymosan exhibited increased cytokine expression and elevated response to spring viremia of carp virus (SVCV) infection. In vitro, previous treatment of β-glucan enhanced ZF4 cell viability against SVCV infection which is associated to the activation of interferon signaling pathway and inflammatory cytokines gene expression. In vivo, the SVCV-infected fish primed with β-glucan had a higher survival rate (≈73%) than the control SVCV-infected group (≈33%). Additionally, up-regulation of the expression of a set of genes involved in innate immune response was detected in zebrafish intraperitoneally injected of β-glucan: il1b, il6, il8, il10 and tnfa transcripts showed increased expression that appear to be rapid (2 days) but not long-lived (less than 2 weeks). The present study is, to our knowledge, the first to combine cell culture and in vivo approaches to describe host response to β-glucan stimulation and viral infection in zebrafish. Copyright © 2018 Elsevier Ltd. All rights reserved.

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

PubMed

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Antioxidant enzymes stimulation in Aspergillus parasiticus by Lentinula edodes inhibits aflatoxin production.

PubMed

Reverberi, M; Fabbri, A A; Zjalic, S; Ricelli, A; Punelli, F; Fanelli, C

2005-11-01

Biosynthesis of aflatoxins, toxic metabolites produced by Aspergillus parasiticus, is correlated to the fungal oxidative stress and cell ageing. In this paper, the mechanism underlying the aflatoxin-inhibiting effect of the Lentinula edodes culture filtrates was studied by analysing their anti-oxidant activity and beta-glucan content. Mushroom beta-glucans are pharmacologically active compounds stimulating anti-oxidant responses in animal cells. L. edodes lyophilised filtrates stimulate A. parasiticus anti-oxidant enzymes (superoxide dismutase, catalase, glutathione peroxidase) and aflatoxin inhibition was better correlated with beta-glucan content than with anti-oxidant activity of the filtrates. RT-PCR analyses on treated mycelia showed a delay in the activation of aflR, and norA, genes of aflatoxin cluster and a synchronous activation of hsf2-like, a homologue of a yeast transcription factor involved in oxidative stress responses. The first evidence of hsf2-like in A. parasiticus and its activation during aflatoxin biosynthesis is reported. L. edodes filtrates could play a role as external stimulus affecting the anti-oxidant status in the fungal cell that, in turn, leads to aflatoxin inhibition. In the fungal cell, beta-glucans present in the filtrates could stimulate the activation of transcription factors related to anti-oxidant response and anti-oxidant enzyme activity with a contemporaneous delay of aflatoxin genes transcription, which led to a marked reduction of aflatoxin production. This research suggests new perspectives to set suitable strategies against aflatoxins and L. edodes could be considered a promising tool.

Nutraceutical, Anti-Inflammatory, and Immune Modulatory Effects of β-Glucan Isolated from Yeast

PubMed Central

Bacha, Umar; Iqbal, Sanaullah; Anjum, Aftab Ahmad

2017-01-01

β-Glucan is a dietary fibre, found in many natural sources, and controls chronic metabolic diseases effectively. However, β-glucan from the yeast has rarely been investigated. Objectively, conditions were optimized to isolate β-glucan from the yeast (max. 66% yield); those optimized conditions included 1.0 M NaOH, pH 7.0, and 90°C. The purity and identity of the isolated β-glucan were characterized through FT-IR, SEM, DSC, and physicofunctional properties. The obtained results from DSC revealed highly stable β-glucan (m.p., 125°C) with antioxidant activity (TAC value 0.240 ± 0.0021 µg/mg, H2O2 scavenging 38%), which has promising bile acid binding 40.463% and glucose control (in vitro). In line with these results, we evaluated the in vivo anti-inflammatory potential, that is, myeloperoxidase activity and reduction in MDA and NO; protective effect on proteins and keeping viscosity within normal range exhibited improvement. Also, the in vivo cholesterol binding and reduction in the skin thickness by β-glucan were highly encouraging. Finally, our results confirmed that yeast β-glucan is effective against some of the inflammatory and oxidative stress markers studied in this investigation. In general, the effect of 4%  β-glucan was more noticeable versus 2%  β-glucan. Therefore, our results support the utilization of β-glucan as a novel, economically cheap, and functional food ingredient. PMID:28913359

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

PubMed

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

[Regulation of thermal stability of enzymes by changing the composition of media. Native and modified alpha-chymotrypsin].

PubMed

Levitskiĭ, V Iu; Melik-Nubarov, N S; Slepnev, V I; Shikshnis, V A; Mozhaev, V V

1990-01-01

Stabilizing effect of denaturing salts on irreversible thermoinactivation of native and modified alpha-chymotrypsin at elevated temperatures is observed. The effect is caused by a shift of conformational equilibrium, at the primary step of reversible unfolding in the course of thermoinactivation, to a more unfolded form which is not able to refold "incorrectly". The stability of alpha-chymotrypsin is regulated within a wide range by medium alteration: the stabilizing effects are similar to those achieved by multipoint attachment of the enzyme to a support or by hydrophilization of protein by covalent modification.

Beta-1-3-Glucan effect on sow antibody production and passive immunization of Progeny

USDA-ARS?s Scientific Manuscript database

Beta-glucans are glucose homopolymers known to modulate immunity. Here, the beta-glucan effect on sow antibody production and passive immunization of neonatal pigs was analyzed. Treatments included: 1) Corn-soy fed control group, 2) beta-glucan, 3) App vaccination, and 4) beta-glucan + App vaccinati...

Organosolv pretreatment for enzymatic hydrolysis of poplars: I. enzyme hydrolysis of cellulosic residues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chum, H.L.; Johnson, D.K.; Black, S.

1988-01-01

Aspen (Populus tremuloides) and black cottonwood (Populus trichocarpa) organosolv pulps produced in a wide range of solvent composition (between 30 and 70% by volume of methanol) and catalysts (H/sub 2/SO/sub 4/ and H/sub 3/PO/sub 4/) such that the cooking liquor pH less than or equal to 3 are easily digested by enzymes. The total yields of hydrolysis residues (pulps) are in the 40-60% range; the acid-catalyzed delignification followed by enzyme hydrolysis can generate 70-88% of the original six-carbon sugars contained in the wood. Glucomannan and arabinogalactan are dissolved in to the pulping liquor in the pH range of 2-4.5. Lowermore » pH (less than or equal to 3) leads to additional solubilization of six-carbon sugars. These sugars may be fermented directly. From the insoluble hydrolysis residues, 36-41% conversions of wood into fermentable sugars were obtained after enzyme hydrolysis; the starting feedstocks contain 50.8 and 46.6% hexosans, respectively, for aspen and black cottonwood. The kinetics of enzymatic hydrolysis of cellulose can be formally treated as two simultaneous pseudo-first-order reactions in which fast and slow hydrolysis of cellulose occur. Correlations between the glucan digestibility and the effect of the pretreatment have been made. The higher residual xylan content reduces the amount of the rapidly hydrolyzable glucan fraction and lowers the glucan digestibility. The proposed simple kinetic treatment is very helpful in assessing the effect of the pretreatment on pulp enzyme hydrolyzability.« less

Inactivation of pecS restores the virulence of mutants devoid of osmoregulated periplasmic glucans in the phytopathogenic bacterium Dickeya dadantii.

PubMed

Bontemps-Gallo, Sébastien; Madec, Edwige; Lacroix, Jean-Marie

2014-04-01

Dickeya dadantii is a phytopathogenic enterobacterium that causes soft rot disease in a wide range of plant species. Maceration, an apparent symptom of the disease, is the result of the synthesis and secretion of a set of plant cell wall-degrading enzymes (PCWDEs), but many additional factors are required for full virulence. Among these, osmoregulated periplasmic glucans (OPGs) and the PecS transcriptional regulator are essential virulence factors. Several cellular functions are controlled by both OPGs and PecS. Strains devoid of OPGs display a pleiotropic phenotype including total loss of virulence, loss of motility and severe reduction in the synthesis of PCWDEs. PecS is one of the major regulators of virulence in D. dadantii, acting mainly as a repressor of various cellular functions including virulence, motility and synthesis of PCWDEs. The present study shows that inactivation of the pecS gene restored virulence in a D. dadantii strain devoid of OPGs, indicating that PecS cannot be de-repressed in strains devoid of OPGs.

Divergent strategy for the synthesis of alpha-aryl-substituted fosmidomycin analogues.

PubMed

Devreux, Vincent; Wiesner, Jochen; Jomaa, Hassan; Rozenski, Jef; Van der Eycken, Johan; Van Calenbergh, Serge

2007-05-11

Fosmidomycin is the first representative of a new class of antimalarial drugs acting through inhibition of 1-deoxy-D-xylulose 5-phosphate (DOXP) reductoisomerase (DXR), an essential enzyme in the non-mevalonate pathway for the synthesis of isoprenoids. This work describes a divergent strategy for the synthesis of a series of alpha-aryl-substituted fosmidomycin analogues, featuring a palladium-catalyzed Stille coupling as the key step. An alpha-(4-cyanophenyl)fosmidomycin analogue emerged as the most potent analogue in the present series. Its antimalarial activity clearly surpasses that of the reference compound fosmidomycin.

Optimizing Tumor Microenvironment for Cancer Immunotherapy: β-Glucan-Based Nanoparticles

PubMed Central

Zhang, Mei; Kim, Julian A.; Huang, Alex Yee-Chen

2018-01-01

Immunotherapy is revolutionizing cancer treatment. Recent clinical success with immune checkpoint inhibitors, chimeric antigen receptor T-cell therapy, and adoptive immune cellular therapies has generated excitement and new hopes for patients and investigators. However, clinically efficacious responses to cancer immunotherapy occur only in a minority of patients. One reason is the tumor microenvironment (TME), which potently inhibits the generation and delivery of optimal antitumor immune responses. As our understanding of TME continues to grow, strategies are being developed to change the TME toward one that augments the emergence of strong antitumor immunity. These strategies include eliminating tumor bulk to provoke the release of tumor antigens, using adjuvants to enhance antigen-presenting cell function, and employ agents that enhance immune cell effector activity. This article reviews the development of β-glucan and β-glucan-based nanoparticles as immune modulators of TME, as well as their potential benefit and future therapeutic applications. Cell-wall β-glucans from natural sources including plant, fungi, and bacteria are molecules that adopt pathogen-associated molecular pattern (PAMP) known to target specific receptors on immune cell subsets. Emerging data suggest that the TME can be actively manipulated by β-glucans and their related nanoparticles. In this review, we discuss the mechanisms of conditioning TME using β-glucan and β-glucan-based nanoparticles, and how this strategy enables future design of optimal combination cancer immunotherapies. PMID:29535722

Binding of Soluble Yeast β-Glucan to Human Neutrophils and Monocytes is Complement-Dependent

PubMed Central

Bose, Nandita; Chan, Anissa S. H.; Guerrero, Faimola; Maristany, Carolyn M.; Qiu, Xiaohong; Walsh, Richard M.; Ertelt, Kathleen E.; Jonas, Adria Bykowski; Gorden, Keith B.; Dudney, Christine M.; Wurst, Lindsay R.; Danielson, Michael E.; Elmasry, Natalie; Magee, Andrew S.; Patchen, Myra L.; Vasilakos, John P.

2013-01-01

The immunomodulatory properties of yeast β-1,3/1,6 glucans are mediated through their ability to be recognized by human innate immune cells. While several studies have investigated binding of opsonized and unopsonized particulate β-glucans to human immune cells mainly via complement receptor 3 (CR3) or Dectin-1, few have focused on understanding the binding characteristics of soluble β-glucans. Using a well-characterized, pharmaceutical-grade, soluble yeast β-glucan, this study evaluated and characterized the binding of soluble β-glucan to human neutrophils and monocytes. The results demonstrated that soluble β-glucan bound to both human neutrophils and monocytes in a concentration-dependent and receptor-specific manner. Antibodies blocking the CD11b and CD18 chains of CR3 significantly inhibited binding to both cell types, establishing CR3 as the key receptor recognizing the soluble β-glucan in these cells. Binding of soluble β-glucan to human neutrophils and monocytes required serum and was also dependent on incubation time and temperature, strongly suggesting that binding was complement-mediated. Indeed, binding was reduced in heat-inactivated serum, or in serum treated with methylamine or in serum reacted with the C3-specific inhibitor compstatin. Opsonization of soluble β-glucan was demonstrated by detection of iC3b, the complement opsonin on β-glucan-bound cells, as well as by the direct binding of iC3b to β-glucan in the absence of cells. Binding of β-glucan to cells was partially inhibited by blockade of the alternative pathway of complement, suggesting that the C3 activation amplification step mediated by this pathway also contributed to binding. PMID:23964276

Immune-modulatory effects of dietary Yeast Beta-1,3/1,6-D-glucan

PubMed Central

2014-01-01

Beta-glucans are a heterogeneous group of natural polysaccharides mostly investigated for their immunological effects. Due to the low systemic availability of oral preparations, it has been thought that only parenterally applied beta-glucans can modulate the immune system. However, several in vivo and in vitro investigations have revealed that orally applied beta-glucans also exert such effects. Various receptor interactions, explaining possible mode of actions, have been detected. The effects mainly depend on the source and structure of the beta-glucans. In the meantime, several human clinical trials with dietary insoluble yeast beta-glucans have been performed. The results confirm the previous findings of in vivo studies. The results of all studies taken together clearly indicate that oral intake of insoluble yeast beta-glucans is safe and has an immune strengthening effect. PMID:24774968

Custom-tailored water-insoluble glucans from sucrose via glucansucrases

USDA-ARS?s Scientific Manuscript database

Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

Characterization of β-Glucan Recognition Site on C-Type Lectin, Dectin 1

PubMed Central

Adachi, Yoshiyuki; Ishii, Takashi; Ikeda, Yoshihiko; Hoshino, Akiyoshi; Tamura, Hiroshi; Aketagawa, Jun; Tanaka, Shigenori; Ohno, Naohito

2004-01-01

Dectin 1 is a mammalian cell surface receptor for (1→3)-β-d-glucans. Since (1→3)-β-d-glucans are commonly present on fungal cell walls, it has been suggested that dectin 1 is important for recognizing fungal invasion. In this study we tried to deduce the amino acid residues in dectin 1 responsible for β-glucan recognition. HEK293 cells transfected with mouse dectin 1 cDNA could bind to a gel-forming (1→3)-β-d-glucan, schizophyllan (SPG). The binding of SPG to a dectin 1 transfectant was inhibited by pretreatment with other β-glucans having a (1→3)-β-d-glucosyl linkage but not by pretreatment with α-glucans. Dectin 1 has a carbohydrate recognition domain (CRD) consisting of six cysteine residues that are highly conserved in C-type lectins. We prepared 32 point mutants with mutations in the CRD and analyzed their binding to SPG. Mutations at Trp221 and His223 resulted in decreased binding to β-glucan. Monoclonal antibody 4B2, a dectin- 1 monoclonal antibody which had a blocking effect on the β-glucan interaction, completely failed to bind the dectin-1 mutant W221A. A mutant with mutations in Trp221 and His223 did not have a collaborative effect on Toll-like receptor 2-mediated cellular activation in response to zymosan. These amino acid residues are distinct from residues in other sugar-recognizing peptide sequences of typical C-type lectins. These results suggest that the amino acid sequence W221-I222-H223 is critical for formation of a β-glucan binding site in the CRD of dectin 1. PMID:15213161

Characterization of the starch-acting MaAmyB enzyme from Microbacterium aurum B8.A representing the novel subfamily GH13_42 with an unusual, multi-domain organization

PubMed Central

Valk, Vincent; van der Kaaij, Rachel M.; Dijkhuizen, Lubbert

2016-01-01

The bacterium Microbacterium aurum strain B8.A degrades granular starches, using the multi-domain MaAmyA α-amylase to initiate granule degradation through pore formation. This paper reports the characterization of the M. aurum B8.A MaAmyB enzyme, a second starch-acting enzyme with multiple FNIII and CBM25 domains. MaAmyB was characterized as an α-glucan 1,4-α-maltohexaosidase with the ability to subsequently hydrolyze maltohexaose to maltose through the release of glucose. MaAmyB also displays exo-activity with a double blocked PNPG7 substrate, releasing PNP. In M. aurum B8.A, MaAmyB may contribute to degradation of starch granules by rapidly hydrolyzing the helical and linear starch chains that become exposed after pore formation by MaAmyA. Bioinformatics analysis showed that MaAmyB represents a novel GH13 subfamily, designated GH13_42, currently with 165 members, all in Gram-positive soil dwelling bacteria, mostly Streptomyces. All members have an unusually large catalytic domain (AB-regions), due to three insertions compared to established α-amylases, and an aberrant C-region, which has only 30% identity to established GH13 C-regions. Most GH13_42 members have three N-terminal domains (2 CBM25 and 1 FNIII). This is unusual as starch binding domains are commonly found at the C-termini of α-amylases. The evolution of the multi-domain M. aurum B8.A MaAmyA and MaAmyB enzymes is discussed. PMID:27808246

Synthetic enzyme mixtures for biomass deconstruction: production and optimization of a core set.

PubMed

Banerjee, Goutami; Car, Suzana; Scott-Craig, John S; Borrusch, Melissa S; Aslam, Nighat; Walton, Jonathan D

2010-08-01

The high cost of enzymes is a major bottleneck preventing the development of an economically viable lignocellulosic ethanol industry. Commercial enzyme cocktails for the conversion of plant biomass to fermentable sugars are complex mixtures containing more than 80 proteins of suboptimal activities and relative proportions. As a step toward the development of a more efficient enzyme cocktail for biomass conversion, we have developed a platform, called GENPLAT, that uses robotic liquid handling and statistically valid experimental design to analyze synthetic enzyme mixtures. Commercial enzymes (Accellerase 1000 +/- Multifect Xylanase, and Spezyme CP +/- Novozyme 188) were used to test the system and serve as comparative benchmarks. Using ammonia-fiber expansion (AFEX) pretreated corn stover ground to 0.5 mm and a glucan loading of 0.2%, an enzyme loading of 15 mg protein/g glucan, and 48 h digestion at 50 degrees C, commercial enzymes released 53% and 41% of the available glucose and xylose, respectively. Mixtures of three, five, and six pure enzymes of Trichoderma species, expressed in Pichia pastoris, were systematically optimized. Statistical models were developed for the optimization of glucose alone, xylose alone, and the average of glucose + xylose for two digestion durations, 24 and 48 h. The resulting models were statistically significant (P < 0.0001) and indicated an optimum composition for glucose release (values for optimized xylose release are in parentheses) of 29% (5%) cellobiohydrolase 1, 5% (14%) cellobiohydrolase 2, 25% (25%) endo-beta1,4-glucanase 1, 14% (5%) beta-glucosidase, 22% (34%) endo-beta1,4-xylanase 3, and 5% (17%) beta-xylosidase in 48 h at a protein loading of 15 mg/g glucan. Comparison of two AFEX-treated corn stover preparations ground to different particle sizes indicated that particle size (100 vs. 500 microm) makes a large difference in total digestibility. The assay platform and the optimized "core" set together provide a starting

Hyperexpression of the gene for a Bacillus alpha-amylase in Bacillus subtilis cells: enzymatic properties and crystallization of the recombinant enzyme.

PubMed

Ikawa, K; Araki, H; Tsujino, Y; Hayashi, Y; Igarashi, K; Hatada, Y; Hagihara, H; Ozawa, T; Ozaki, K; Kobayashi, T; Ito, S

1998-09-01

We have constructed a new excretion vector, pHSP64, to develop a hyperexcretion system for Bacillus subtilis [Sumitomo et al., Biosci. Biotech. Biochem., 59, 2172-2175 (1995)]. The structural gene for a novel liquefying semi-alkaline alpha-amylase from the alkaliphilic Bacillus sp. KSM-1378 was amplified by PCR. It was cloned into a SalI-SmaI site of pHSP64 and the recombinant plasmid obtained was introduced into B. subtilis. The transformed B. subtilis hyperproduced the alpha-amylase activity extracellularly, corresponding to approximately 1.0 g (5 x 10(6) units) per liter of an optimized liquid culture. The recombinant enzyme was purified to homogeneity by a simple purification procedure with very high yield. No significant differences in physiochemical and catalytic properties were observed between the recombinant enzyme and the native enzyme produced by Bacillus sp. KSM-1378. The enzymatic properties of the recombinant enzyme were further examined with respect to the responses to various metal ions. The recombinant enzyme could easily be crystallized at room temperature within one day in a buffered solution of 10% (w/v) ammonium sulfate (pH 6.5).

β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia

PubMed Central

Kutty, Geetha; Davis, A. Sally; Ferreyra, Gabriela A.; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A.

2016-01-01

β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis. In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. PMID:27324243

Subsite mapping of enzymes. Application of the depolymerase computer model to two alpha-amylases.

PubMed Central

Allen, J D; Thoma, J A

1976-01-01

In the preceding paper (Allen and Thoma, 1976) we developed a depolymerase computer model, which uses a minimization routine to establish a subsite map for a depolymerase. In the present paper we show how the model is applied to experimental data for two alpha-amylases. Michaelis parameters and bond-cleavage frequencies for substrates of chain lengths up to twelve glucosyl units have been reported for Bacillus amyloliquefaciens, and a subsite map has been proposed for this enzyme [Thoma et al. (1971) J. Biol. Chem. 246, 5621-5635]. By applying the computer model to the experimental data, we have arrived at a ten-subsite map. We find that a significant improvement in this map is achieved by allowing the hydrolytic rate coefficient to vary as a function of the number of occupied subsites comprising the enzyme-binding region. The bond-cleavage frequencies, the enzyme is found to have eight subsites. A partial subsite map is arrived at, but the entire binding region cannot be mapped because Michaelis parameters are complicated by transglycosylation reactions. The hydrolytic rate coefficients for this enzyme are not constant. PMID:999630

Comparison of the potency of a variety of β-glucans to induce cytokine production in human whole blood

PubMed Central

Noss, Ilka; Doekes, Gert; Thorne, Peter S; Heederik, Dick J.J.; Wouters, Inge M.

2014-01-01

Beta-glucans are components of fungal cell walls and potent stimulants of innate immunity. The majority of research on biological activities of glucans has focused on β-(1,3)-glucans, which have been implicated in relation with fungal exposure-associated respiratory symptoms, and as important stimulatory agents in anti-fungal immune responses. Fungi - and bacteria and plants - produce a wide variety of glucans with vast differences in proportion and arrangement of their 1,3-, 1,4-, and 1,6-β-glycosidic linkages. Thus far the proinflammatory potential of different β-glucans has not been studied within the same experimental model. Therefore, we compared the potency of 13 different glucan preparations to induce in vitro production of IL1β, IL6, IL8 and TNF-α in human whole blood cultures. The strongest inducers of all cytokines were pustulan (β-(1,6)-glucan), lichenan (β-(1,3)-(1,4)-glucan), xyloglucan (β-(1,4)-glucan), and pullulan (α-(1,4)-(1,6)-glucan). Moderate to strong cytokine production was observed for curdlan (β-(1,3)-glucan), baker’s yeast glucan (β-(1,3)-(1,6)-glucan), and barley glucan (β-(1,3)-(1,4)-glucan), while all other glucan preparations induced only low or no detectable levels of cytokines. We therefore conclude that innate immunity reactions are not exclusively induced by β-(1,3)-glucans, but also by β-(1,6)- and β-(1,4)-structures. Thus, not only β-(1,3)-glucan, but also other β-glucans and particularly β-(1,6)-glucans should be considered in future research. PMID:22653750

Endotoxin and β-(1,3)-glucan levels in automobiles: a pilot study.

PubMed

Wu, Francis Fu-Sheng; Wu, Mei-Wen; Chang, Chin-Fu; Lai, Shu-Mei; Pierse, Nevil; Crane, Julian; Siebers, Rob

2010-01-01

Exposure to bacterial endotoxin and fungal β-(1,3)-glucan in the indoor environment can induce respiratory symptoms. Automobiles are an exposure source of allergens but it is not known if, and how much exposure there is to endotoxin and fungal β-(1,3)-glucan. The objective of the study was to determine whether automobiles are a potential source of exposure to these microbial products. Dust was sampled from the passenger seats of 40 automobiles. Specific Limulus amoebocyte kinetic assays were used to measure endotoxin and β-(1,3)-glucan, respectively. Endotoxin and β-(1,3)-glucan was detected in all samples ranging from 19.9-247.0 EU/mg and 1.6-59.8 μg/g, respectively. There were no significant differences in endotoxin levels between automobiles of smokers and non-smokers, but β-(1,3)-glucan levels were about two-fold higher in the automobiles of non-smokers. In conclusion, endotoxin and β-(1,3)-glucan exposure in automobiles at levels found in our study may be of importance for asthmatics.

Immunostimulatory properties and antitumor activities of glucans

PubMed Central

VANNUCCI, LUCA; KRIZAN, JIRI; SIMA, PETR; STAKHEEV, DMITRY; CAJA, FABIAN; RAJSIGLOVA, LENKA; HORAK, VRATISLAV; SAIEH, MUSTAFA

2013-01-01

New foods and natural biological modulators have recently become of scientific interest in the investigation of the value of traditional medical therapeutics. Glucans have an important part in this renewed interest. These fungal wall components are claimed to be useful for various medical purposes and they are obtained from medicinal mushrooms commonly used in traditional Oriental medicine. The immunotherapeutic properties of fungi extracts have been reported, including the enhancement of anticancer immunity responses. These properties are principally related to the stimulation of cells of the innate immune system. The discovery of specific receptors for glucans on dendritic cells (dectin-1), as well as interactions with other receptors, mainly expressed by innate immune cells (e.g., Toll-like receptors, complement receptor-3), have raised new attention toward these products as suitable therapeutic agents. We briefly review the characteristics of the glucans from mycelial walls as modulators of the immunity and their possible use as antitumor treatments. PMID:23739801

In vitro synthesis of a crystalline (1-->3,1-->4)-beta-D-glucan by a mutated (1-->3,1-->4)-beta-D-glucanase from Bacillus.

PubMed Central

Faijes, Magda; Imai, Tomoya; Bulone, Vincent; Planas, Antoni

2004-01-01

Oligo- and poly-saccharides have a large number of important biological functions, and they occur in natural composite materials, such as plant cell walls, where they self-assemble during biosynthesis in a poorly understood manner. They can also be used for the formation of artificial composite materials with industrial applications. Fundamental and applied research in biology and nanobiotechnology would benefit from the possibility of synthesizing tailor-made oligo-/poly-saccharides. In the present paper, we demonstrate that such syntheses are possible using genetically modified glycoside hydrolases, i.e. glycosynthases. The ability of the endoglycosynthase derived from Bacillus (1-->3,1-->4)-beta-D-glucanase to catalyse self-condensation of sugar donors was exploited for the in vitro synthesis of a regular polysaccharide. The specificity of the enzyme allowed the polymerization of alpha-laminaribiosyl fluoride via the formation of (1-->4)-beta-linkages to yield a new linear crystalline (1-->3,1-->4)-beta-D-glucan with a repeating 4betaG3betaG unit. MS and methylation analyses indicated that the in vitro product consisted of a mixture of oligosaccharides, the one having a degree of polymerization of 12 being the most abundant. Morphological characterization revealed that the (1-->3,1-->4)-beta-D-glucan forms spherulites which are composed of platelet crystals. X-ray and electron diffraction analyses allowed the proposition of a putative crystallographic structure which corresponds to a monoclinic unit cell with a =0.834 nm, b =0.825 nm, c =2.04 nm and gamma=90.5 degrees. The dimensions of the ab plane are similar to those of cellulose I(beta), but the length of the c -axis is nearly twice that of cellulose I. It is proposed that four glucose residues are present in an extended conformation along the c -axis of the unit cell. The data presented show that glycosynthases represent promising enzymic systems for the synthesis of novel polysaccharides with specific and

A heuristic approach to the analysis of enzymic catalysis: reaction of delta-(L-alpha-aminoadipoyl)-L-cysteinyl-D-alpha-aminobutyrate and delta-(L-alpha-aminoadipoyl)-L-cysteinyl-D-allylglycine catalyzed by isopenicillin N synthase isozymes.

PubMed

Blackburn, J M; Sutherland, J D; Baldwin, J E

1995-06-06

Isopenicillin N synthase (IPNS) catalyzes the oxidative cyclization of delta-(L-alpha-aminoadipoyl)-L-cysteinyl-D-valine to isopenicillin N. It is proposed that the multiple products produced from certain substrate analogues result from pathway branching after formation of a ferryl oxene intermediate. We have been interested in ascertaining the reasons for multiple product formation. One possibility is that the products are predisposed toward formation once the beta-lactam ring and the ferryl oxene are produced. Alternately, the products may be persuaded into being by the enzyme restricting conformations such that otherwise less favorable chemistry can take place. With the existing description of the IPNS catalytic cycle, this fundamental question has not been answerable. We describe here the application of a heuristic method to resolve this key issue. It was reasoned that by comparing the ratios of products formed by a set of perturbed IPNS variants it might be possible to generate qualitative information about the relative magnitude of certain activation parameters. If certain product ratios are affected but others are not, then it should be possible to say which steps in the reaction are dictated merely by chemical fundamentals and which steps are directly effected by the enzyme. In this paper we report the high-level expression, purification, and characterization of four IPNS isozymes. Comparison of the product ratios obtained on incubation of unnatural substrate analogues with four IPNS isozymes corresponding to perturbed active site variants shows substantial variation in some cases and little in others. Interpretation of the results obtained with delta-(L-alpha-aminoadipoyl)-L-cysteinyl-D-alpha-aminobutyrate (ACAB) allows conclusions to be drawn regarding the role of the enzyme in restricting available conformations of the natural substrate to disfavor certain otherwise chemically favorable pathways and hence products. The results obtained with delta-(L-alpha

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

PubMed

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS.

PubMed

Boulos, Samy; Nyström, Laura

2017-01-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO • ) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO • -attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random

Complementary Sample Preparation Strategies for Analysis of Cereal β-Glucan Oxidation Products by UPLC-MS/MS

PubMed Central

Boulos, Samy; Nyström, Laura

2017-01-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

β-Glucans Are Masked but Contribute to Pulmonary Inflammation During Pneumocystis Pneumonia.

PubMed

Kutty, Geetha; Davis, A Sally; Ferreyra, Gabriela A; Qiu, Ju; Huang, Da Wei; Sassi, Monica; Bishop, Lisa; Handley, Grace; Sherman, Brad; Lempicki, Richard; Kovacs, Joseph A

2016-09-01

β-glucans, which can activate innate immune responses, are a major component in the cell wall of the cyst form of Pneumocystis In the current study, we examined whether β-1,3-glucans are masked by surface proteins in Pneumocystis and what role β-glucans play in Pneumocystis-associated inflammation. For 3 species, including Pneumocystis jirovecii, which causes Pneumocystis pneumonia in humans, Pneumocystis carinii, and Pneumocystis murina, β-1,3-glucans were masked in most organisms, as demonstrated by increased exposure following trypsin treatment. Using quantitative polymerase chain reaction and microarray techniques, we demonstrated in a mouse model of Pneumocystis pneumonia that treatment with caspofungin, an inhibitor of β-1,3-glucan synthesis, for 21 days decreased expression of a broad panel of inflammatory markers, including interferon γ, tumor necrosis factor α, interleukin 1β, interleukin 6, and multiple chemokines/chemokine ligands. Thus, β-glucans in Pneumocystis cysts are largely masked, which likely decreases innate immune activation; this mechanism presumably was developed for interactions with immunocompetent hosts, in whom organism loads are substantially lower. In immunosuppressed hosts with a high organism burden, organism death and release of glucans appears to be an important contributor to deleterious host inflammatory responses. Published by Oxford University Press for the Infectious Diseases Society of America 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

AlphaACT

DTIC Science & Technology

2014-07-20

t**k HOUM 1i7iOSh»d, uro .*fto»d ^Sunflower V«()*Uil«n Rviiauiani :{31 Chkn Bii^ R:ad •Pel Lov*ri Cotnpanton ^&i«na’i RMUuram 1U17 VVtMjltfl...Select a case to tailor • Click Customize CUSTOMIZE lO ) Alpha j[~:: 0:09:15 3 .~^’’ I ~J^’ Purpose Tasks Tailor the case to scenario...present o o ® =T Does the event area have tall buildings o o ® a^ ^KBPPB^ or choose up lo 3 n«nts Irom the VKiii^P Knowledge Base bela» Tim

High Molecular Weight Barley β-Glucan Alters Gut Microbiota Toward Reduced Cardiovascular Disease Risk

PubMed Central

Wang, Yanan; Ames, Nancy P.; Tun, Hein M.; Tosh, Susan M.; Jones, Peter J.; Khafipour, Ehsan

2016-01-01

The physiological cholesterol-lowering benefits of β-glucan have been well documented, however, whether modulation of gut microbiota by β-glucan is associated with these physiological effects remains unknown. The objectives of this study were therefore to determine the impact of β-glucan on the composition of gut microbiota in mildly hypercholesterolemic individuals and to identify if the altered microbiota are associated with bioactivity of β-glucan in improving risk factors of cardiovascular disease (CVD). Using a randomized, controlled crossover study design, individuals received for 5-week either a treatment breakfast containing 3 g high molecular weight (HMW), 3 g low molecular weight (LMW), 5 g LMW barley β-glucan, or wheat and rice. The American Heart Association (AHA) diet served as the background diet for all treatment groups. Phases were separated by 4-week washout periods. Fecal samples were collected at the end of each intervention phase and subjected to Illumina sequencing of 16S rRNA genes. Results revealed that at the phylum level, supplementation of 3 g/d HMW β-glucan increased Bacteroidetes and decreased Firmicutes abundances compared to control (P < 0.001). At the genus level, consumption of 3 g/d HMW β-glucan increased Bacteroides (P < 0.003), tended to increase Prevotella (P < 0.1) but decreased Dorea (P < 0.1), whereas diets containing 5 g LMW β-glucan and 3 g LMW β-glucan failed to alter the gut microbiota composition. Bacteroides, Prevotella, and Dorea composition correlated (P < 0.05) with shifts of CVD risk factors, including body mass index, waist circumference, blood pressure, as well as triglyceride levels. Our data suggest that consumption of HMW β-glucan favorably alters the composition of gut microbiota and this altered microbiota profile associates with a reduction of CVD risk markers. Together, our study suggests that β-glucan induced shifts in gut microbiota in a MW-dependent manner and that might be one of the

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

PubMed

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

The structure of a β-(1→3)-d-glucan from yeast cell walls

PubMed Central

Manners, David J.; Masson, Alan J.; Patterson, James C.

1973-01-01

Yeast glucan as normally prepared by various treatments of yeast (Saccharomyces cerevisiae) cell walls to remove mannan and glycogen is still heterogeneous. The major component (about 85%) is a branched β-(1→3)-glucan of high molecular weight (about 240000) containing 3% of β-(1→6)-glucosidic interchain linkages. The minor component is a branched β-(1→6)-glucan. A comparison of our results with those of other workers suggests that different glucan preparations may differ in the degree of heterogeneity and that the major β-(1→3)-glucan component may vary considerably in degree of branching. PMID:4359920

Effect of pregnant mare's serum gonadotrophin on the activities of delta 4-5 alpha-reductase, aromatase, and other enzymes in the ovaries of immature rats.

PubMed

Suzuki, K; Kawakura, K; Tamaoki, B I

1978-05-01

After incubation of progesterone, 17 alpha-hydroxyprogesterone, androstenedione, and testostrone with an ovarian preparation (supernatant fluid at 10,000 x g) of immature rats (21-23 days of age) in the presence of NADPH, 3 alpha- and 3 beta-hydroxy-5 alpha-reduced steroids were obtained as the major metabolites. Among the enzyme activities relevant to the metabolism, delta 4-5 alpha-reductase and 3 beta-hydroxysteroid dehydrogenase were intracellularly localized to the microsomal fraction (10,000--105,000 x g), and 3 alpha-hydroxysteroid dehydrogenase was detected exclusively in the cytosol fraction (supernatant fluid at 105,000 x g). Within 2 days after a single injection of pregnant mare's serum gonadotrophin (10 IU/rat) to 21-day-old female rats, the following occurred: 1) an enhancement of 17 alpha-hydroxylase and C-17-C-20 lyase activities; 2) a suppression of delta 4-5 alpha-reductase activity; and 3) an increase in aromatizing activity. From the above-mentioned results, it was concluded that the increased secretion of estrogen from ovaries of immature rats stimulated by pregnant mare's serum gonadotrophin administration was caused by a modification of the ovarian enzyme activities relevant to estrogen production.

The alpha glycerophosphate cycle in Drosophila melanogaster VI. structure and evolution of enzyme paralogs in the genus Drosophila.

PubMed

Carmon, Amber; MacIntyre, Ross

2010-01-01

The genome sequences of 12 Drosophila species contain 3 paralogs for alpha glycerophosphate dehydrogenase (GPDH) and for the mitochondrial alpha glycerophosphate oxidase (GPO). These 2 enzymes participate in the alpha glycerophosphate cycle in the adult thoracic flight muscles. The flight muscle enzymes are encoded by gpdh-1 at 26A2 and gpo-1 at 52C8. In this paper, we show that the GPDH paralogs share the same evolutionarily conserved functional domains and most intron positions, whereas the GPO paralogs share only some of the functional domains of mitochondrial oxidoreductases. The GPO paralogs not expressed in the flight muscles essentially lack introns. GPDH paralogs encoded by gpdh-2 and gpdh-3 and the GPO paralogs encoded by gpo-2 and gpo-3 are expressed only in the testes. Gene trees for the GPDH and GPO paralogs indicate that the genes expressed in the flight muscles are evolving very slowly presumably under strong purifying selection whereas the paralogs expressed in the testes are evolving more rapidly. The concordance between species and gene trees, d(N)/d(S) ratios, phylogenetic analysis by maximum likelihood-based tests, and analyses of radical and conservative substitutions all indicate that the additional GPDH and GPO paralogs are also evolving under purifying selection.

Improving the performance of enzymes in hydrolysis of high solids paper pulp derived from MSW.

PubMed

Puri, Dhivya J; Heaven, Sonia; Banks, Charles J

2013-01-01

The research aimed to improve the overall conversion efficiency of the CTec® family of enzymes by identifying factors that lead to inhibition and seeking methods to overcome these through process modification and manipulation. The starting material was pulp derived from municipal solid waste and processed in an industrial-scale washing plant. Analysis of the pulp by acid hydrolysis showed a ratio of 55 : 12 : 6 : 24 : 3 of glucan : xylan : araban/galactan/mannan : lignin : ash. At high total solids content (>18.5% TS) single-stage enzyme hydrolysis gave a maximum glucan conversion of 68%. It was found that two-stage hydrolysis could give higher conversion if sugar inhibition was removed by an intermediate fermentation step between hydrolysis stages. This, however, was not as effective as direct removal of the sugar products, including xylose, by washing of the residual pulp at pH 5. This improved the water availability and allowed reactivation of the pulp-bound enzymes. Inhibition of enzyme activity could further be alleviated by replenishment of β-glucosidase which was shown to be removed during the wash step. The two-stage hydrolysis process developed could give an overall glucan conversion of 88%, with an average glucose concentration close to 8% in 4 days, thus providing an ideal starting point for ethanol fermentation with a likely yield of 4 wt%. This is a significant improvement over a single-step process. This hydrolysis configuration also provides the potential to recover the sugars associated with residual solids which are diluted when washing hydrolysed pulp.

Protection of turmeric plants from rhizome rot disease under field conditions by β-D-glucan nanoparticle.

PubMed

Anusuya, Sathiyanarayanan; Sathiyabama, Muthukrishnan

2015-01-01

The rhizome rot caused by Pythium aphanidermatum is one of the most devastating diseases of the turmeric crop. Fungicides are unable to control the rapidly evolving P. aphanidermatum and new control strategies are urgently needed. This study examined the effect of β-d-glucan nanoparticles (GNP) in turmeric plants under field condition by the foliar spray method. Enhanced plant growth, rhizome yield, and curcumin content demonstrate the positive effect of the GNP on turmeric plants. Rapid activation of various defense enzymes was also observed in leaves and rhizomes of treated plants. GNP-treated plants showed a decreased rot incidence. It may be possible that increased defense enzymes might have played a role in reducing the colonization of pathogen. Copyright © 2015 Elsevier B.V. All rights reserved.

Vitronectin and fibronectin function as glucan binding proteins augmenting macrophage responses to Pneumocystis carinii.

PubMed

Vassallo, R; Kottom, T J; Standing, J E; Limper, A H

2001-08-01

beta-glucans represent major structural components of fungal cell walls. We recently reported that Pneumocystis carinii beta-glucans stimulate alveolar macrophages to release proinflammatory cytokines. Macrophage activation by beta-glucan is augmented by serum, implying the presence of circulating factors that interact with beta-glucans and enhance their ability to stimulate macrophages. Using beta-glucan-enriched cell wall fractions from P. carinii and Saccharomyces cerevisiae, two prominent proteins were precipitated from serum and demonstrated to be vitronectin (VN) and fibronectin (FN) by immune analysis. Preincubation of beta-glucan with VN or FN enhanced macrophage activation in response to this cell wall component. Because VN and FN accumulate in the lungs during P. carinii pneumonia, we further investigated hepatic and pulmonary expression of VN and FN messenger RNA during infection. P. carinii pneumonia in rodents is associated with increased hepatic expression of VN and FN as well as increased local expression of FN in the lung. Because interleukin (IL)-6 represents the major regulator of VN and FN expression during inflammatory conditions, we measured macrophage IL-6 release in response to stimulation with P. carinii beta-glucan. Stimulation of macrophages with P. carinii beta-glucan induced significant release of IL-6. Elevated concentrations of IL-6 were noted in the blood of infected animals compared with uninfected control animals. These studies indicate that VN and FN bind to beta-glucan components of P. carinii and augment macrophage inflammatory responses. P. carinii cell wall beta-glucan stimulates secretion of IL-6 by macrophages, thereby enhancing hepatic synthesis of both VN and FN, and lung synthesis of FN during pneumonia.

(1-->6)-beta-D-glucan as cell wall receptor for Pichia membranifaciens killer toxin.

PubMed

Santos, A; Marquina, D; Leal, J A; Peinado, J M

2000-05-01

The killer toxin from Pichia membranifaciens CYC 1106, a yeast isolated from fermenting olive brines, binds primarily to the (1-->6)-beta-D-glucan of the cell wall of a sensitive yeast (Candida boidinii IGC 3430). The (1-->6)-beta-D-glucan was purified from cell walls of C. boidinii by alkali and hot-acetic acid extraction, a procedure which solubilizes glucans. The major fraction of receptor activity remained with the alkali-insoluble (1-->6)-beta- and (1-->3)-beta-D-glucans. The chemical (gas-liquid chromatography) and structural (periodate oxidation, infrared spectroscopy, and (1)H nuclear magnetic resonance) analyses of the fractions obtained showed that (1-->6)-beta-D-glucan was a receptor. Adsorption of most of the killer toxin to the (1-->6)-beta-D-glucan was complete within 2 min. Killer toxin adsorption to the linear (1-->6)-beta-D-glucan, pustulan, and a glucan from Penicillium allahabadense was observed. Other polysaccharides with different linkages failed to bind the killer toxin. The specificity of the killer toxin for its primary receptor provides an effective means to purify the killer toxin, which may have industrial applications for fermentations in which salt is present as an adjunct, such as olive brines. This toxin shows its maximum killer activity in the presence of NaCl. This report is the first to identify the (1-->6)-beta-D-glucan as a receptor for this novel toxin.

Effects of Purified Saccharomyces cerevisiae (1→3)-β-Glucan on Venous Ulcer Healing

PubMed Central

Medeiros, Sarah Dantas Viana; Cordeiro, Sara Lima; Cavalcanti, Jéssica Escorel Chaves; Melchuna, Karina Mendes; Lima, Aleida Maria da Silva; Filho, Irami Araújo; Medeiros, Aldo Cunha; Rocha, Keyla Borges Ferreira; Oliveira, Elizabeth Maia; Faria, Eduardo Dantas Baptista; Sassaki, Guilherme Lanzi; Rocha, Hugo Alexandre Oliveira; Sales, Valéria Soraya Farias

2012-01-01

Water-insoluble glucan was isolated from the baker’s yeast Saccharomyces cerevisiae. The yeast cells were treated with alkali and the residue then with acid. Chemical and NMR (1D and 2D) analyses showed that a linear (1→3)-β-glucan was purified that was not contaminated with other carbohydrates, proteins or phenolic compounds. The effects of the glucan on wound healing were assessed in human venous ulcers by histopathological analysis after 30 days of topical treatment. (1→3)-β-glucan enhanced ulcer healing and increased epithelial hyperplasia, as well as increased inflammatory cells, angiogenesis and fibroblast proliferation. In one patient who had an ulcer that would not heal for over 15 years, glucan treatment caused a 67.8% decrease in the area of the ulcer. This is the first study to investigate the effects of (1→3)-β-glucan on venous ulcer healing in humans; our findings suggest that this glucan is a potential natural biological response modifier in wound healing. PMID:22942695

Stimulated hemopoiesis and enhanced survival following glucan treatment in sublethally and lethally irradiated mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patchen, M.L.; MacVittie, T.J.

1985-01-01

Hemopoietic effects of the reticuloendothelial agent glucan were assayed in normal mice and in mice hemopoietically depleted by exposure to /sup 60/Co radiation. In normal mice, glucan administration increased the content of bone marrow and splenic transplantable pluripotent hemopoietic stem cells (CFU-2), committed granulocyte-macrophage progenitor cells (GM-CFC), and pure macrophage progenitor cells (M-CFC). Erythroid progenitor cells (CFU-e) were increased only in the spleen. In sublethally irradiated mice (650 rads), glucan increased the number of endogeneous pluripotent hemopoietic stem cells (E-CFU) when administered either before or after irradiation. The most pronounced effects were observed when glucan was administered 1 day before,more » 1 h before, or 1 h after irradiation. In addition, the administration of glucan before lethal irradiation (900 rads) enhanced survival. The most significant results were seen when glucan was administered 1 day prior to irradiation. The possibility of using agents such as glucan to enhance hemopoietic reconstitution and prevent septicemia following chemotherapy and/or radiotherapy is discussed.« less

D-lactic acid production from cellooligosaccharides and beta-glucan using L-LDH gene-deficient and endoglucanase-secreting Lactobacillus plantarum.

PubMed

Okano, Kenji; Zhang, Qiao; Yoshida, Shogo; Tanaka, Tsutomu; Ogino, Chiaki; Fukuda, Hideki; Kondo, Akihiko

2010-01-01

In order to achieve direct fermentation of an optically pure D: -lactic acid from cellulosic materials, an endoglucanase from a Clostridium thermocellum (CelA)-secreting plasmid was introduced into an L: -lactate dehydrogenase gene (ldhL1)-deficient Lactobacillus plantarum (ldhL1) bacterial strain. CelA expression and its degradation of beta-glucan was confirmed by western blot analysis and enzyme assay, respectively. Although the CelA-secreting ldhL1 assimilated cellooligosaccharides up to cellohexaose (although not cellotetraose), the main end product was acetic acid, not lactic acid, due to the conversion of lactic acid to acetic acid. Cultivation under anaerobic conditions partially suppressed this conversion resulting in the production of 1.27 g/l of D: -lactic acid with a high optical purity of 99.5% from a medium containing 2 g/l of cellohexaose. Subsequently, D: -lactic acid fermentation from barley beta-glucan was carried out with the addition of Aspergillus aculeatus beta-glucosidase produced by recombinant Aspergillus oryzae and 1.47 g/l of D: -lactic was produced with a high optical purity of 99.7%. This is the first report of direct lactic acid fermentation from beta-glucan and a cellooligosaccharide that is a more highly polymerized sugar than cellotriose.

Distribution and Molecular Characterization of β-Glucans from Hull-Less Barley Bran, Shorts and Flour

PubMed Central

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12–13.01%), followed by bran (6.15–7.58%) and flour (2.48–2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38–71.41% β-glucan, 10.81–17.26% arabinoxylan, 2.6–9.6% protein, 2.7–9.0% starch, and 5.23–9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91–95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw. PMID:21673907

Immunomodulatory effect of glucan on specific and nonspecific immunity after vaccination in puppies.

PubMed

Haladová, Eva; Mojžišová, Jana; Smrčo, Peter; Ondrejková, Anna; Vojtek, Boris; Prokeš, Marián; Petrovová, Eva

2011-03-01

The objective of the study was to determine the immunostimulatory effect of β-(1,3/1,6)-D-glucan in puppies. The effect exerted on the efficacy of vaccination, especially against canine parvovirus and rabies infection, was studied. The application of vaccine and glucan leads to significant increases in the nonspecific immunological parameters (phagocytic ability of leukocytes, blastogenic response of lymphocytes, metabolic and chemotactic activity of polymorphonuclear cells). The level of antibodies against canine parvovirus (Ab CPV) and rabies infection reached the most statistically significant values on the 28th day after the application of vaccine and a syrup containing β-(1,3/1,6)-D-glucan (Group GV) as compared to the control group (Group V, puppies receiving only vaccine). Dogs without glucan supplementation did not produce such significant levels of antibodies. We can conclude that glucan has relevant immunostimulatory effects in dogs with altered immunity. The glucan product tested in this study (PleraSAN V, PLEURAN, Bratislava, Slovakia) could be used in the small animal clinical practice.

Effects of enzyme loading and β-glucosidase supplementation on enzymatic hydrolysis of switchgrass processed by leading pretreatment technologies.

PubMed

Pallapolu, Venkata Ramesh; Lee, Y Y; Garlock, Rebecca J; Balan, Venkatesh; Dale, Bruce E; Kim, Youngmi; Mosier, Nathan S; Ladisch, Michael R; Falls, Matthew; Holtzapple, Mark T; Sierra-Ramirez, Rocio; Shi, Jian; Ebrik, Mirvat A; Redmond, Tim; Yang, Bin; Wyman, Charles E; Donohoe, Bryon S; Vinzant, Todd B; Elander, Richard T; Hames, Bonnie; Thomas, Steve; Warner, Ryan E

2011-12-01

The objective of this work is to investigate the effects of cellulase loading and β-glucosidase supplementation on enzymatic hydrolysis of pretreated Dacotah switchgrass. To assess the difference among various pretreatment methods, the profiles of sugars and intermediates were determined for differently treated substrates. For all pretreatments, 72 h glucan/xylan digestibilities increased sharply with enzyme loading up to 25mg protein/g-glucan, after which the response varied depending on the pretreatment method. For a fixed level of enzyme loading, dilute sulfuric acid (DA), SO(2), and Lime pretreatments exhibited higher digestibility than the soaking in aqueous ammonia (SAA) and ammonia fiber expansion (AFEX). Supplementation of Novozyme-188 to Spezyme-CP improved the 72 h glucan digestibility only for the SAA treated samples. The effect of β-glucosidase supplementation was discernible only at the early phase of hydrolysis where accumulation of cellobiose and oligomers is significant. Addition of β-glucosidase increased the xylan digestibility of alkaline treated samples due to the β-xylosidase activity present in Novozyme-188. Copyright © 2011 Elsevier Ltd. All rights reserved.

Electron and Fluorescence Microscopy of Extracellular Glucan and Aryl-Alcohol Oxidase during Wheat-Straw Degradation by Pleurotus eryngii

PubMed Central

Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.

1998-01-01

The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085

Alpha-mannosidase activity in goats fed with Sida carpinifolia.

PubMed

Bedin, Marisete; Moleta Colodel, Edson; Viapiana, Marli; Matte, Ursula; Driemeier, David; Giugliani, Roberto

2010-03-01

Human alpha-mannosidosis results from alpha-mannosidase deficiency and progressive accumulation of mannose-rich oligosaccharides in lysosomes. Two days before Saanen goats were fed with Sida carpinifolia, alpha-mannosidase activity in leukocytes was 128+/-28 nmoles4-MU/h/mgprotein (first trial) and 104+/-6 nmoles4-MU/h/mgprotein (second trial). At day 5, after the introduction of S. carpinifolia diet, the alpha-mannosidase activity in leukocytes was significantly increased, both in the first (288+/-13 nmoles4-MU/h/mgprotein) and in the second trial (303+/-45 nmoles4-MU/h/mgprotein), and it returned to normal levels 2 days after the withdrawal of the plant from the diet (114+/-7 nmoles4-MU/h/mgprotein in first trial, and 108+/-25 nmoles4-MU/h/mgprotein in the second one). Plasma alpha-mannosidase activity decreased significantly 4 days after animal exposure to the S. carpinifolia diet (769+/-167 nmoles4-MU/h/ml) and returned to normal values 10 days after the withdrawal of the plant from the diet (1289+/-163 nmoles4-MU/h/ml). Thin-layer chromatography showed an abnormal excretion of oligosaccharides in urine as of day 2 after diet exposure, which persisted until one day after the withdrawal of the plant. Animals presented neurological clinical signs beginning at day 37 (in the first trial) and at day 25 (in the second trial) after being fed with the plant. The results obtained herein suggest that oligosaccharides observed in urine are a result of a decrease in alpha-mannosidase activity in plasma. S. carpinifolia seems to have other compounds that act on alpha-mannosidase enzyme in leukocytes in a competitive manner with swainsonine. The increase in alpha-mannosidase enzyme in leukocytes could be attributed to one of these compounds present in S. carpinifolia. Copyright 2009 Elsevier GmbH. All rights reserved.

Immunomodulatory effects of beta-glucan on neutrophil function in fathead minnows (Pimephales promelas Rafinesque, 1820).

PubMed

Palić, Dusan; Andreasen, Claire B; Herolt, Dawn M; Menzel, Bruce W; Roth, James A

2006-01-01

Stimulatory effects of yeast beta-1,3-1,6-glucans on neutrophils have long been recognized, but effects of glucans on degranulation of primary granules in fish neutrophils have not been previously reported. Neutrophil function was monitored during in vitro and in vivo application of glucans to non- (NS), acute- (AS) and chronically stressed (CS) fish. beta-Glucan proved to be a strong and quick (80%, 2 min) stimulant of degranulation. Dietary glucan increased degranulation in NS fish, and prevented a decrease in AS fish. Degranulation in CS fish returned to NS levels 3 days after the glucan diet was fed. Fathead minnows appear to be a useful model to investigate neutrophil degranulation in fish exposed to different environmental conditions and immunomodulators. Use of beta-glucans in fish diets prior to AS and during chronic stress can enhance neutrophil function, potentially increasing disease resistance and survival rates after transportation or exposure to poor water quality.

Unravelling Glucan Recognition Systems by Glycome Microarrays Using the Designer Approach and Mass Spectrometry*

PubMed Central

Palma, Angelina S.; Liu, Yan; Zhang, Hongtao; Zhang, Yibing; McCleary, Barry V.; Yu, Guangli; Huang, Qilin; Guidolin, Leticia S.; Ciocchini, Andres E.; Torosantucci, Antonella; Wang, Denong; Carvalho, Ana Luísa; Fontes, Carlos M. G. A.; Mulloy, Barbara; Childs, Robert A.; Feizi, Ten; Chai, Wengang

2015-01-01

Glucans are polymers of d-glucose with differing linkages in linear or branched sequences. They are constituents of microbial and plant cell-walls and involved in important bio-recognition processes, including immunomodulation, anticancer activities, pathogen virulence, and plant cell-wall biodegradation. Translational possibilities for these activities in medicine and biotechnology are considerable. High-throughput micro-methods are needed to screen proteins for recognition of specific glucan sequences as a lead to structure–function studies and their exploitation. We describe construction of a “glucome” microarray, the first sequence-defined glycome-scale microarray, using a “designer” approach from targeted ligand-bearing glucans in conjunction with a novel high-sensitivity mass spectrometric sequencing method, as a screening tool to assign glucan recognition motifs. The glucome microarray comprises 153 oligosaccharide probes with high purity, representing major sequences in glucans. Negative-ion electrospray tandem mass spectrometry with collision-induced dissociation was used for complete linkage analysis of gluco-oligosaccharides in linear “homo” and “hetero” and branched sequences. The system is validated using antibodies and carbohydrate-binding modules known to target α- or β-glucans in different biological contexts, extending knowledge on their specificities, and applied to reveal new information on glucan recognition by two signaling molecules of the immune system against pathogens: Dectin-1 and DC-SIGN. The sequencing of the glucan oligosaccharides by the MS method and their interrogation on the microarrays provides detailed information on linkage, sequence and chain length requirements of glucan-recognizing proteins, and are a sensitive means of revealing unsuspected sequences in the polysaccharides. PMID:25670804

Characterization and enzymatic hydrolysis of hydrothermally treated β-1,3-1,6-glucan from Aureobasidium pullulans.

PubMed

Hirabayashi, Katsuki; Kondo, Nobuhiro; Hayashi, Sachio

2016-12-01

The chemical structure of hydrothermally treated β-1,3-1,6-glucan from Aureobasidium pullulans was characterized using techniques such as gas chromatography/mass spectrometry (GC/MS) and nuclear magnetic resonance (NMR). The chemical shifts of anomeric carbons observed in the 13 C-NMR spectra suggested the presence of single flexible chains of polysaccharide in the sample. β-1,3-1,6-Glucan from A. pullulans became water-soluble, with an average molecular weight of 128,000 Da after hydrothermal treatment, and the solubility in water was approximately 10% (w/w). Sample (3% w/v) was completely hydrolyzed to glucose by enzymatic reaction with Lysing enzymes from Trichoderma harzianum. Gentiobiose (Glcβ1 → 6Glc) and glucose were released as products during the reaction, and the maximum yield of gentiobiose was approximately 70% (w/w). The molar ratio of gentiobiose to glucose after 1 h reaction suggested that the sample is likely highly branched. Sample (3% w/v) was also hydrolyzed to glucose by Uskizyme from Trichoderma sp., indicating that it is very sensitive to enzymatic hydrolysis.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

PubMed Central

Chen, Jiezhong; Raymond, Kenneth

2008-01-01

Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan. PMID:19337540

The alpha glycerophosphate cycle in Drosophila melanogaster V. molecular analysis of alpha glycerophosphate dehydrogenase and alpha glycerophosphate oxidase mutants.

PubMed

Carmon, Amber; Chien, Jeff; Sullivan, David; MacIntyre, Ross

2010-01-01

Two enzymes, alpha glycerophosphate dehydrogenase (GPDH-1) in the cytoplasm and alpha glycerophosphate oxidase (GPO-1) in the mitochondrion cooperate in Drosophila flight muscles to generate the ATP needed for muscle contraction. Null mutants for either enzyme cannot fly. Here, we characterize 15 ethyl methane sulfonate (EMS)-induced mutants in GPDH-1 at the molecular level and assess their effects on structural and evolutionarily conserved domains of this enzyme. In addition, we molecularly characterize 3 EMS-induced GPO-1 mutants and excisions of a P element insertion in the GPO-1 gene. The latter represent the best candidate for null or amorphic mutants in this gene.

Preparation and evaluation of β-glucan hydrogel prepared by the radiation technique for drug carrier applications.

PubMed

Park, Jong-Seok; Lim, Youn-Mook; Baik, Jae; Jeong, Jin-Oh; An, Sung-Jun; Jeong, Sung-In; Gwon, Hui-Jeong; Khil, Myung-Seob

2018-06-14

β-Glucan can provide excellent environment to apply to drug carrier due to its immunological and anti-inflammatory effect. Minocycline hydrochloride (MH) has excellent oral bioavailability pharmacological properties. Specifically, MH is effectively absorbed into the gingiva for periodontal disease treatment. In this study, we attempt to develop MH loaded β-glucan hydrogel for periodontal disease treatment through radiation-crosslinking technique. In addition, MH loaded β-glucan hydrogels were tested for their cytotoxicity and antibacterial activity. Finally, we conducted an in vivo study to demonstrate the potential to prevent the invasion of bacteria to treat periodontal disease. The gel content and compressive strength of the β-glucan hydrogels increased as the β-glucan content and the absorbed dose (up to 7 kGy) increased. For a radiation dose of 7 kGy, the gelation and the compressive strength of a 6 wt% β-glucan hydrogel were approximately 92% and 270 kPa, respectively. As a drug, MH was consistently released from β-glucan hydrogels, reaching 80% at approximately 90 min. Furthermore, the MH loaded β-glucan hydrogels showed no cytotoxicity. The MH loaded β-glucan hydrogels exhibited good antibacterial activity against Porphyromonas gingivalis. In addition, MH loaded β-glucan hydrogel demonstrated the potential of a good capability to prevent the invasion of bacteria and to treat wounds. Copyright © 2017. Published by Elsevier B.V.

[beta]-Glucan Synthesis in the Cotton Fiber (III. Identification of UDP-Glucose-Binding Subunits of [beta]-Glucan Synthases by Photoaffinity Labeling with [[beta]-32P]5[prime]-N3-UDP-Glucose.

PubMed Central

Li, L.; Drake, R. R.; Clement, S.; Brown, R. M.

1993-01-01

Using differential product entrapment and photolabeling under specifying conditions, we identifIed a 37-kD polypeptide as the best candidate among the UDP-glucose-binding polypeptides for the catalytic subunit of cotton (Gossypium hirsutum) cellulose synthase. This polypeptide is enriched by entrapment under conditions favoring [beta]-1,4-glucan synthesis, and it is magnesium dependent and sensitive to unlabeled UDP-glucose. A 52-kD polypeptide was identified as the most likely candidate for the catalytic subunit of [beta]-1,3-glucan synthase because this polypeptide is the most abundant protein in the entrapment fraction obtained under conditions favoring [beta]-1,3-glucan synthesis, is coincident with [beta]-1,3-glucan synthase activity, and is calcium dependent. The possible involvement of other polypeptides in the synthesis of [beta]-1,3-glucan is discussed. PMID:12231766

Structural complex of sterol 14[alpha]-demethylase (CYP51) with 14[alpha]-methylenecyclopropyl-[delta]7-24, 25-dihydrolanosterol[S

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hargrove, Tatiana Y.; Wawrzak, Zdzislaw; Liu, Jialin

2012-06-28

Sterol 14{alpha}-demethylase (CYP51) that catalyzes the removal of the 14{alpha}-methyl group from the sterol nucleus is an essential enzyme in sterol biosynthesis, a primary target for clinical and agricultural antifungal azoles and an emerging target for antitrypanosomal chemotherapy. Here, we present the crystal structure of Trypanosoma (T) brucei CYP51 in complex with the substrate analog 14{alpha}-methylenecyclopropyl-{Delta}7-24,25-dihydrolanosterol (MCP). This sterol binds tightly to all protozoan CYP51s and acts as a competitive inhibitor of F105-containing (plant-like) T. brucei and Leishmania (L) infantum orthologs, but it has a much stronger, mechanism-based inhibitory effect on I105-containing (animal/fungi-like) T. cruzi CYP51. Depicting substrate orientation inmore » the conserved CYP51 binding cavity, the complex specifies the roles of the contact amino acid residues and sheds new light on CYP51 substrate specificity. It also provides an explanation for the effect of MCP on T. cruzi CYP51. Comparison with the ligand-free and azole-bound structures supports the notion of structural rigidity as the characteristic feature of the CYP51 substrate binding cavity, confirming the enzyme as an excellent candidate for structure-directed design of new drugs, including mechanism-based substrate analog inhibitors.« less

Purification and characterization of the {alpha}-glucuronidase from Thermoanaerobacterium sp. strain JW/SL-YS485, an important enzyme for the utilization of substituted xylans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, W.; Obi, S.K.C.; Wiegel, J.

1995-03-01

A cell-associated {alpha}-glucuronidase was purified to gel electrophoretic homogeneity from the thermophilic anaerobic bacterium Thermoanaerobacterium sp. strain JW/SL-YS485. This enzyme had a pI of 4.65, a molecular weight of 130,000, and two subunits; the molecular weight of each subunit was 74,000. The enzyme exhibited the highest level of activity at pH 5.4 and 60{degrees}C, as determined by a 5-min assay. The K{sub m} and k{sub cat} values of the enzyme for 4-methylglucuronosyl xylobiose were 0.76 mM and 1,083 IU/{mu}mol, respectively. The Arrhenius energy was 26.4 kJ/mol. The specific activities of the enzyme with 4-0-methylglucuronosyl xylobiose, 4-0-methylglucuronosyl xylotriose, and 4-0-methylglucuronosyl xylotetraosemore » were 8.4, 4.8, and 3.9 IU/mg, respectively. The purified {alpha}-glucuronidase and a {beta}-xylosidase purified from the same organism interacted synergistically to hydrolyze 4-methylglucuronosyl xylotetraose.« less

Production of insoluble glucans using modified recombinant glycosyltransferase from Leuconostoc mesenteroides

USDA-ARS?s Scientific Manuscript database

Glucansucrases catalyze the transfer of D-glucopyranosyl units from sucrose to form a-glucan chains. Glucansucrases are capable of catalyzing the synthesis of several different a-glucosidic linkages that affect molecular mass, branching, and solubility of the polysaccharide. In general, a-glucans co...

Barley and Oat beta-Glucan content measured by Calcofluor fluorescence in a microplate assay

USDA-ARS?s Scientific Manuscript database

Beta-glucans, linear glucan polymers of mixed linkage, are important constituents of cereal cell walls. They have important health benefits in the human diet, but also can negatively affect the use of barley grain as an animal feed. High beta-glucans in barley malt can also cause problems in brewi...

The effect of lignin removal by alkaline peroxide pretreatment on the susceptibility of corn stover to purified cellulolytic and xylanolytic enzymes.

PubMed

Selig, Michael J; Vinzant, Todd B; Himmel, Michael E; Decker, Stephen R

2009-05-01

Pretreatment of corn stover with alkaline peroxide (AP) at pH 11.5 resulted in reduction of lignin content in the residual solids as a function of increasing batch temperature. Scanning electron microscopy of these materials revealed notably more textured surfaces on the plant cell walls as a result of the delignifying pretreatment. As expected, digestion of the delignified samples with commercial cellulase preparations showed an inverse relationship between the content of lignin present in the residual solids after pretreatment and the extent of both glucan and xylan conversion achievable. Digestions with purified enzymes revealed that decreased lignin content in the pretreated solids did not significantly impact the extent of glucan conversion achievable by cellulases alone. Not until purified xylanolytic activities were included with the cellulases were significant improvements in glucan conversion realized. In addition, an inverse relationship was observed between lignin content after pretreatment and the extent of xylan conversion achievable in a 24-h period with the xylanolytic enzymes in the absence of the cellulases. This observation, coupled with the direct relationship between enzymatic xylan and glucan conversion observed in a number of cases, suggests that the presence of lignins may not directly occlude cellulose present in lignocelluloses but rather impact cellulase action indirectly by its association with xylan.

Interconversion of the Specificities of Human Lysosomal Enzymes Associated with Fabry and Schindler Diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomasic, Ivan B.; Metcalf, Matthew C.; Guce, Abigail I.

2010-09-03

The human lysosomal enzymes {alpha}-galactosidase ({alpha}-GAL, EC 3.2.1.22) and {alpha}-N-acetylgalactosaminidase ({alpha}-NAGAL, EC 3.2.1.49) share 46% amino acid sequence identity and have similar folds. The active sites of the two enzymes share 11 of 13 amino acids, differing only where they interact with the 2-position of the substrates. Using a rational protein engineering approach, we interconverted the enzymatic specificity of {alpha}-GAL and {alpha}-NAGAL. The engineered {alpha}-GAL (which we call {alpha}-GALSA) retains the antigenicity of {alpha}-GAL but has acquired the enzymatic specificity of {alpha}-NAGAL. Conversely, the engineered {alpha}-NAGAL (which we call {alpha}-NAGAL{sup EL}) retains the antigenicity of {alpha}-NAGAL but has acquired themore » enzymatic specificity of the {alpha}-GAL enzyme. Comparison of the crystal structures of the designed enzyme {alpha}-GAL{sup SA} to the wild-type enzymes shows that active sites of {alpha}-GAL{sup SA} and {alpha}-NAGAL superimpose well, indicating success of the rational design. The designed enzymes might be useful as non-immunogenic alternatives in enzyme replacement therapy for treatment of lysosomal storage disorders such as Fabry disease.« less

Soluble Glucan Is Internalized and Trafficked to the Golgi Apparatus in Macrophages via a Clathrin-Mediated, Lipid Raft-Regulated Mechanism

PubMed Central

Goldman, Matthew P.; Kalbfleisch, John H.; Williams, David L.

2012-01-01

Glucans are natural product carbohydrates that stimulate immunity. Glucans are internalized by the pattern recognition receptor, Dectin-1. Glucans were thought to be trafficked to phagolysosomes, but this is unproven. We examined the internalization and trafficking of soluble glucans in macrophages. Incubation of macrophages with glucan resulted in internalization of Dectin-1 and glucan. Inhibition of clathrin blocked internalization of the Dectin-1/glucan complex. Lipid raft depletion resulted in decreased Dectin levels and glucan uptake. Once internalized, glucans colocalized with early endosomes at 0 to 15 min, with the Golgi apparatus at 15 min to 24 h, and with Dectin-1 immediately (0 h) and again later (15 min-24 h). Glucans did not colocalize with lysosomes at any time interval examined. We conclude that the internalization of Dectin-1/glucan complexes in macrophages is mediated by clathrin and negatively regulated by lipid rafts and/or caveolin-1. Upon internalization, soluble glucans are trafficked via endosomes to the Golgi apparatus, not lysosomes. PMID:22700434

Effects of functional β-glucan on proliferation, differentiation, metabolism and its anti-fibrosis properties in muscle cells.

PubMed

Li, Yan; Fan, Yihui; Pan, Haiou; Qian, Haifeng; Qi, Xiguang; Wu, Gangcheng; Zhang, Hui; Xu, Meijuan; Rao, Zhiming; Wang, Li; Ying, Hao

2018-05-26

Skeletal muscles plays a crucial role in metabolism and exercise. Fuctional β-glucan is polysaccharide that is found in the cell walls of cereal, which is known to reduce cholesterol and lipid, prevent diabetes, cancer and cardiovascular diseases. In an attempt to identify β-glucan that could promote skeletal muscle function, we analyzed the proliferation, differentiation, metabolism and anti-fibrotic properties of β-glucan in C2C12 muscle cells. Treatment of β-glucan in C2C12 myoblasts led to increased proliferation and differentiation. Besides that, we found that C2C12 myotubes treated with β-glucan displayed a fast-to-slow muscle fiber conversion and improved oxidative metabolism. Further study revealed that β-glucan treatment could prevent myotubes from becoming myofibroblasts. Together, our study suggests that functional β-glucan might have a therapeutic potential to improve skeletal muscle function, which might contribute to the development of β-glucan. Copyright © 2018. Published by Elsevier B.V.

Development of downstream processing to minimize beta-glucan impurities in GMP-manufactured therapeutic antibodies.

PubMed

Vigor, Kim; Emerson, John; Scott, Robert; Cheek, Julia; Barton, Claire; Bax, Heather J; Josephs, Debra H; Karagiannis, Sophia N; Spicer, James F; Lentfer, Heike

2016-11-01

The presence of impurities or contaminants in biological products such as monoclonal antibodies (mAb) could affect efficacy or cause adverse reactions in patients. ICH guidelines (Q6A and Q6B) are in place to regulate the level of impurities within clinical drug products. An impurity less often reported and, therefore, lacking regulatory guideline is beta-glucan. Beta-glucans are polysaccharides of d-glucose monomers linked by (1-3) beta-glycosidic bonds, and are produced by prokaryotic and eukaryotic organisms, including plants. They may enter manufacturing processes via raw materials such as cellulose-based membrane filters or sucrose. Here we report the detection of beta-glucan contamination of a monoclonal IgE antibody (MOv18), manufactured in our facility for a first-in-human, first-in-class clinical trial in patients with cancer. Since beta-glucans have potential immunostimulatory properties and can cause symptomatic infusion reactions, it was of paramount importance to identify the source of beta-glucans in our product and to reduce the levels to clinically insignificant concentrations. We identified beta-glucans in sucrose within the formulation buffer and within the housing storage buffer of the virus removal filter. We also detected low level beta-glucan contamination in two of four commercially available antibodies used in oncology. Both formulation buffers contained sucrose. We managed to reduce levels of beta-glucan in our product 10-fold, by screening all sucrose raw material, filtering the sucrose by Posidyne® membrane filtration, and by incorporating extra wash steps when preparing the virus removal filter. The beta-glucan levels now lie within a range that is unlikely to cause clinically significant immunological effects. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1494-1502, 2016. © 2016 American Institute of Chemical Engineers.

Effects of barley β-glucan-enriched flour fractions on the glycaemic index of bread.

PubMed

Finocchiaro, Franca; Ferrari, Barbara; Gianinetti, Alberto; Scazzina, Francesca; Pellegrini, Nicoletta; Caramanico, Rosita; Salati, Claudia; Shirvanian, Vigen; Stanca, Antonio Michele

2012-02-01

The aim of this research was to evaluate β-glucan-enriched flours, obtained from barleys with either normal or waxy starch, for their effects on the glycaemic index (GI) and the quality of bread. Rheological results confirmed that when barley flour was included in the dough the overall quality of bread slightly worsened. However, positive consequences on glycaemia were obtained with the normal starch barley: the GI of all-wheat bread (82.8 ± 7.2) was significantly reduced (57.2 ± 7.9) when 40% of wheat flour was substituted with β-glucan-enriched barley flour (6.0% ± 0.1 β-glucan in the final flour blend). In contrast, this positive effect was significantly reduced (GI: 70.1 ± 9.1) when 40% of wheat flour was substituted with the β-glucan-enriched flour of a waxy barley (CDC Alamo; 6.6 ± 0.2 β-glucan in the final flour blend), suggesting that the ability of β-glucans to lower the GI was affected by the barley starch-type.

Optimization of enzyme complexes for efficient hydrolysis of corn stover to produce glucose.

PubMed

Yu, Xiaoxiao; Liu, Yan; Meng, Jiatong; Cheng, Qiyue; Zhang, Zaixiao; Cui, Yuxiao; Liu, Jiajing; Teng, Lirong; Lu, Jiahui; Meng, Qingfan; Ren, Xiaodong

2015-05-01

Hydrolysis of cellulose to glucose is the critical step for transferring the lignocellulose to the industrial chemicals. For improving the conversion rate of cellulose of corn stover to glucose, the cocktail of celllulase with other auxiliary enzymes and chemicals was studied in this work. Single factor tests and Response Surface Methodology (RSM) were applied to optimize the enzyme mixture, targeting maximum glucose release from corn stover. The increasing rate of glucan-to-glucose conversion got the higher levels while the cellulase was added 1.7μl tween-80/g cellulose, 300μg β-glucosidase/g cellulose, 400μg pectinase/g cellulose and 0.75mg/ml sodium thiosulphate separately in single factor tests. To improve the glucan conversion, the β-glucosidase, pectinase and sodium thiosulphate were selected for next step optimization with RSM. It is showed that the maximum increasing yield was 45.8% at 377μg/g cellulose Novozyme 188, 171μg/g cellulose pectinase and 1mg/ml sodium thiosulphate.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

PubMed

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

[Liver enzymes elevation: etiologic study and efficiency of a single-act office visit].

PubMed

Bendezú García, Rogger Álvaro; Casado Martín, Marta; Lázaro Sáez, Marta; Patrón Román, Gustavo Óliver; Gálvez Miras, Alejandra; Rodríguez Laiz, Gonzalo P; González Sánchez, Mercedes; Vega Sáenz, José Luis

2013-01-01

Liver enzyme (LE) elevation is a common finding in routine blood analysis. There is very little information on the most prevalent causes of these alterations in our population. In addition, a number of tests and several visits to the specialist are required to reach a diagnosis. For these reasons, we designed a protocol to streamline the evaluation of patients with LE elevations in a single-act office visit. From March 2008 until June 2010, we studied all patients with incidental LE elevation (isolated transaminase elevation, combined elevation of alkaline phosphatase [FA] and gamma-glutamyl transpeptidase [GGT], or isolated elevation of GGT) who were referred by their primary care physicians. At the time of referral, a complete biochemistry analysis was performed (LE, viral serology, autoantibodies, ceruloplasmin, iron metabolism, alpha-1-antitrypsin and thyroid hormones) and the patients underwent an abdominal ultrasound scan on the day of the office evaluation by the hepatologist. A total of 427 patients were included in our study. The most common cause of transaminase elevation was non-alcoholic fatty liver disease (NAFLD) (40%), followed by alcohol intake (17%), and hepatitis C virus infection (13%). Elevated GGT levels were most commonly related to NAFLD (30%), closely followed by alcohol intake (27%), and hepatotoxicity (8%). Combined elevation of GGT and FA was associated with NAFLD (21%), alcohol (17%), and hepatotoxicity (11%). Self-limited elevation was seen in 9% of the patients and we could not identify a definite cause in 11%. A definitive diagnosis was reached in 79% of the patients. The single-act office visit has proven to be efficient, yielding a diagnosis in most of the patients. The most common cause of elevated LE was NAFLD. Transaminase elevation must be confirmed before a more thorough work-up is started. Copyright © 2013 Elsevier España, S.L. and AEEH y AEG. All rights reserved.

Rapid quantitative analysis of 8-iso-prostaglandin-F(2alpha) using liquid chromatography-tandem mass spectrometry and comparison with an enzyme immunoassay method.

PubMed

Dahl, Jeffrey H; van Breemen, Richard B

2010-09-15

A rapid liquid chromatography-tandem mass spectrometry (LC-MS/MS) assay was developed for the measurement of urinary 8-iso-prostaglandin F(2alpha) (8-iso-PGF(2alpha)), a biomarker of lipid peroxidation. Because urine contains numerous F(2) prostaglandin isomers, each with identical mass and similar mass spectrometric fragmentation patterns, chromatographic separation of 8-iso-PGF(2alpha) from its isomers is necessary for its quantitative analysis using MS/MS. We were able to achieve this separation using an isocratic LC method with a run time of less than 9min, which is at least threefold faster than previous methods, while maintaining sensitivity, accuracy, precision, and reliability. The limits of detection and quantitation were 53 and 178pg/ml urine, respectively. We compared our method with a commercially available affinity purification and enzyme immunoassay kit and found both assays to be in agreement. Despite the high sensitivity of the enzyme immunoassay method, it is more expensive and has a narrower dynamic range than LC-MS/MS. Our method was optimized for rapid measurement of 8-iso-PGF(2alpha) in urine, and it is ideally suited for clinical sample analysis. 2010 Elsevier Inc. All rights reserved.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

PubMed

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

PubMed

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

β-Glucoside Activators of Mung Bean UDP-Glucose: β-Glucan Synthase 1

PubMed Central

Callaghan, Theresa; Ross, Peter; Weinberger-Ohana, Patricia; Garden, Gwenn; Benziman, Moshe

1988-01-01

Heat-stable activators of membranous β-glucan synthase have been isolated from the supernatant fraction of crude mung bean (Vigna radiata) extracts by DEAE-cellulose and silica-gel chromatography. One of the activators has been partially purified and characterized on the basis of susceptibility to various enzymes and by analysis of the products formed upon total acid hydrolysis, alkaline-methanolysis, and β-glucosidase digestion. This activator has the characteristics of a 1,2-dioleoyl diglyceride containing β-linked glucose residue(s) at the C-3 position. When expressed per mole of glucosyl residues, the maximal Ka value of the activator is estimated to be 25 micromolar. Both the intact glucosyl and fatty acid moiety are essential to the stimulatory effect of the activator. PMID:16666038

New developments and prospective applications for beta (1,3) glucans.

PubMed

Laroche, Celine; Michaud, Philippe

2007-01-01

Publications and patents relative to newly observed functions of beta-(1,3)-D-glucans have notably increased in the last few years with the exploitation of their biological activities. The term beta-(1,3)-D-glucans includes a very large number of polysaccharides from bacterial, fungal and vegetable sources. Their structures have a common backbone of beta-(1,3) linked glucopyranosyl residues but the polysaccharidic chain can be beta-(1,6) branched with glucose or integrate some beta-(1,4) linked glucopyranosyl residues in the main chain. Except for the curdlan, a bacterial linear beta-(1,3)-D-glucans, and for the scleroglucan produced by Sclerotium rolfsii, the main drawback limiting the development of these polysaccharides is the lack of efficient processes for their extraction and purification and their cost. However new applications in agronomy, foods, cosmetic and therapeutic could in a next future accentuate the effort of research for their development. So this review focuses on these beta-(1,3)-D-glucans with the objective to detail the strategies employed for their extraction and the relation structure-functions identified when they induce biological activities.

Glucan-Induced Enhancement of Host Resistance to Selected Infectious Diseases

DTIC Science & Technology

1980-10-01

infectious foci. J. Exp. Med. 133:1090-1104. to bacterial endotoxin and Sabmnoiefa emteridu ia bfc 2. Burgaleta, C., and D. W. Golde. 1977. The effect of...aerosol with Pseudomonas pseudomalei, whereas intravenous glucan pretreatment did not increase survival. Mice given glucan combined with a marginally...Its effects can be catego- , responses been recognized (14). Apparently, rized as macrophage-mediated immunotimula- macrophages not only are capable

Differential pathways regulating innate and adaptive antitumor immune responses by particulate and soluble yeast-derived β-glucans

PubMed Central

Qi, Chunjian; Cai, Yihua; Gunn, Lacey; Ding, Chuanlin; Li, Bing; Kloecker, Goetz; Qian, Keqing; Vasilakos, John; Saijo, Shinobu; Iwakura, Yoichiro; Yannelli, John R.

2011-01-01

β-glucans have been reported to function as a potent adjuvant to stimulate innate and adaptive immune responses. However, β-glucans from different sources are differential in their structure, conformation, and thus biologic activity. Different preparations of β-glucans, soluble versus particulate, further complicate their mechanism of action. Here we show that yeast-derived particulate β-glucan activated dendritic cells (DCs) and macrophages via a C-type lectin receptor dectin-1 pathway. Activated DCs by particulate β-glucan promoted Th1 and cytotoxic T-lymphocyte priming and differentiation in vitro. Treatment of orally administered yeast-derived particulate β-glucan elicited potent antitumor immune responses and drastically down-regulated immunosuppressive cells, leading to the delayed tumor progression. Deficiency of the dectin-1 receptor completely abrogated particulate β-glucan–mediated antitumor effects. In contrast, yeast-derived soluble β-glucan bound to DCs and macrophages independent of the dectin-1 receptor and did not activate DCs. Soluble β-glucan alone had no therapeutic effect but significantly augmented antitumor monoclonal antibody-mediated therapeutic efficacy via a complement activation pathway but independent of dectin-1 receptor. These findings reveal the importance of different preparations of β-glucans in the adjuvant therapy and allow for the rational design of immunotherapeutic protocols usable in clinical trials. PMID:21531981

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

NASA Astrophysics Data System (ADS)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

Aureobasidium pullulans produced β-glucan is effective to enhance Kurosengoku soybean extract induced Thrombospondin-1 expression.

PubMed

Muramatsu, Daisuke; Okabe, Mitsuyasu; Takaoka, Akinori; Kida, Hiroshi; Iwai, Atsushi

2017-06-06

Black yeast, Aureobasidium pullulans is extracellularly produced β-(1,3), (1,6)-D-glucan (β-glucan) under certain conditions. In this study, using Glycine max cv. Kurosengoku (Kurosengoku soybeans), the production of β-glucan through fermentation of A. pullulans was evaluated, and the effects of A. pullulans cultured fluid (AP-CF) containing β-glucan made with Kurosengoku soybeans (kAP-CF) on a human monocyte derived cell line, Mono Mac 6 cells were investigated. Concentration of β-glucan in kAP-CF reached the same level as normal AP-CF. An anti-angiogenic protein, Thrombospondin-1 (THBS1) was effectively induced after the stimulation with kAP-CF for comparison with AP-CF. The THBS1 is also induced after stimulation with hot water extract of Kurosengoku soybeans (KS-E), while the combined stimulation of β-glucan with KS-E more effectively induced THBS1 than that with KS-E alone. These results suggest effects of A. pullulans-produced β-glucan on the enhancement of Kurosengoku soybean-induced THBS1 expression.

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

PubMed

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

PubMed

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

β-D-glucan inhibits endocrine-resistant breast cancer cell proliferation and alters gene expression

PubMed Central

JAFAAR, ZAINAB M.T.; LITCHFIELD, LACEY M.; IVANOVA, MARGARITA M.; RADDE, BRANDIE N.; AL-RAYYAN, NUMAN; KLINGE, CAROLYN M.

2014-01-01

Endocrine therapies have been successfully used for breast cancer patients with estrogen receptor α (ERα) positive tumors, but ∼40% of patients relapse due to endocrine resistance. β-glucans are components of plant cell walls that have immunomodulatory and anticancer activity. The objective of this study was to examine the activity of β-D-glucan, purified from barley, in endocrine-sensitive MCF-7 versus endocrine-resistant LCC9 and LY2 breast cancer cells. β-D-glucan dissolved in DMSO but not water inhibited MCF-7 cell proliferation in a concentration-dependent manner as measured by BrdU incorporation with an IC50 of ∼164±12 μg/ml. β-D-glucan dissolved in DMSO inhibited tamoxifen/endocrine-resistant LCC9 and LY2 cell proliferation with IC50 values of 4.6±0.3 and 24.2±1.4 μg/ml, respectively. MCF-10A normal breast epithelial cells showed a higher IC50 ∼464 μg/ml and the proliferation of MDA-MB-231 triple negative breast cancer cells was not inhibited by β-D-glucan. Concentration-dependent increases in the BAX/BCL2 ratio and cell death with β-D-glucan were observed in MCF-7 and LCC9 cells. PCR array analysis revealed changes in gene expression in response to 24-h treatment with 10 or 50 μg/ml β-D-glucan that were different between MCF-7 and LCC9 cells as well as differences in basal gene expression between the two cell lines. Select results were confirmed by quantitative real-time PCR demonstrating that β-D-glucan increased RASSF1 expression in MCF-7 cells and IGFBP3, CTNNB1 and ERβ transcript expression in LCC9 cells. Our data indicate that β-D-glucan regulates breast cancer-relevant gene expression and may be useful for inhibiting endocrine-resistant breast cancer cell proliferation. PMID:24534923

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

PubMed Central

Arena, Mattia P.; Caggianiello, Graziano; Fiocco, Daniela; Russo, Pasquale; Torelli, Michele; Spano, Giuseppe; Capozzi, Vittorio

2014-01-01

Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed. PMID:24562330

Fibrinolytic, anti-inflammatory and anti-microbial properties of α-(1-3)-glucans produced from Streptococcus mutans (MTCC 497).

PubMed

Buddana, Sudheer Kumar; Varanasi, Yaswanth Venkata Naga; Shetty, Prakasham Reddy

2015-01-22

Streptococcus mutans (MTCC 497) cell associated α-(1-3)-glucans were isolated, characterized and evaluated for their bioactivity profile. Acid hydrolysis of α-(1-3)-glucans revealed presence of glucose moieties. Water insoluble α-(1-3)-glucans (WIG) were sulfated to convert them into water soluble glucans which were characterized by FT-IR spectral studies. The sulfation of WIG was confirmed by the presence of -O-SO3- and C-O-SO3- characteristic peaks at 1240 and 820 cm(-1). MALDI-TOF analysis of sulfated α-(1-3)-glucan revealed 1.2 to 9kDa fragmentation. Antibacterial profile studies revealed higher growth inhibitory activity against Gram negative than Gram positive bacterial strains by sulfated α-(1-3)-glucans. One-fold higher anti-inflammatory activity with IC50 value of 0.11mg/ml was observed with sulfated α-(1-3)-glucans over WIG. Time dependent fibrinolytic potential without requirement of tissue plasminogen activators was observed for sulfated α-(1-3)-glucans. This is the first report demonstrating the fibrinolytic and anti-inflammatory property for sulfated α-(1-3)-glucans. Copyright © 2014 Elsevier Ltd. All rights reserved.

Combination Therapy with Glucan and Coenzyme Q10 in Murine Experimental Autoimmune Disease and Cancer.

PubMed

Vetvicka, Vaclav; Vetvickova, Jana

2018-06-01

Coenzyme Q 10 is a well-accepted anti-oxidant agent known to play a protective role in various physiological and disease processes. Recently, Coenzyme Q 10 is gaining attention as a substance with significant anti-inflammatory properties. β-Glucan is the most studied immunomodulator with significant synergetic effects with numerous bioactive molecules. We aimed to evaluate the possible synergistic effects of simultaneous use of coenzyme Q 10 with the well-established immune modulator, β-glucan, on immune reactions and cancer development. Coenzyme Q 10 and β-glucan were used, both in vivo and in vitro, and their effects were evaluated using phagocytosis and cytokine secretion. Our study confirmed the strong anti-inflammatory effects of coenzyme Q 10 and showed that these effects were further potentiated with the addition of β-glucan. The anticancer effects of coenzyme Q 10 were less pronounced, but stronger, with the addition of β-glucan. There is significant synergy between coenzyme Q 10 and β-glucan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Free-radical scavenging properties and antioxidant activities of botryosphaeran and some other β-D-glucans.

PubMed

Giese, Ellen C; Gascon, Jacob; Anzelmo, Gianluca; Barbosa, Aneli M; da Cunha, Mário A Alves; Dekker, Robert F H

2015-01-01

β-D-Glucans are known to present antitumor, anticancer, and anti-inflammatory activities that are influenced by their own antioxidant capacity. The antioxidant activity of botryosphaeran, an exopolysaccharide of the (1 → 3;1 → 6)-β-D-glucan type produced by the Botryosphaeria rhodina MAMB-05 was evaluated and compared to some other β-D-glucans (lasiodiplodan an exocellular (1 → 6)-β-D-glucan from Lasiodiplodia theobromae, laminarin and curdlan), and oligosaccharides, disaccharides, and monosaccharides in a study of scavenging activities of free radicals in-vitro. Botryosphaeran displayed high total antioxidant activity (80%) as well as good scavenging activity against hydroxyl radical (90.6%), superoxide anion (37%), hydrogen peroxide (38%), and nitric oxide radical (90%). No reducing power, metal-chelating capacity or inhibition of lipid peroxidation was observed for these β-D-glucans. The results demonstrated that botryosphaeran exhibited effective antioxidant activity as supported by many different assays, suggesting that this β-D-glucan may serve as a source of a new bioactive compound with effective antioxidant activity. Copyright © 2014 Elsevier B.V. All rights reserved.

4,6-α-glucanotransferase, a novel enzyme that structurally and functionally provides an evolutionary link between glycoside hydrolase enzyme families 13 and 70.

PubMed

Kralj, Slavko; Grijpstra, Pieter; van Leeuwen, Sander S; Leemhuis, Hans; Dobruchowska, Justyna M; van der Kaaij, Rachel M; Malik, Amarila; Oetari, Ariyanti; Kamerling, Johannis P; Dijkhuizen, Lubbert

2011-11-01

Lactobacillus reuteri 121 uses the glucosyltransferase A (GTFA) enzyme to convert sucrose into large amounts of the α-D-glucan reuteran, an exopolysaccharide. Upstream of gtfA lies another putative glucansucrase gene, designated gtfB. Previously, we have shown that the purified recombinant GTFB protein/enzyme is inactive with sucrose. Various homologs of gtfB are present in other Lactobacillus strains, including the L. reuteri type strain, DSM 20016, the genome sequence of which is available. Here we report that GTFB is a novel α-glucanotransferase enzyme with disproportionating (cleaving α1→4 and synthesizing α1→6 and α1→4 glycosidic linkages) and α1→6 polymerizing types of activity on maltotetraose and larger maltooligosaccharide substrates (in short, it is a 4,6-α-glucanotransferase). Characterization of the types of compounds synthesized from maltoheptaose by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), methylation analysis, and 1-dimensional ¹H nuclear magnetic resonance (NMR) spectroscopy revealed that only linear products were made and that with increasing degrees of polymerization (DP), more α1→6 glycosidic linkages were introduced into the final products, ranging from 18% in the incubation mixture to 33% in an enriched fraction. In view of its primary structure, GTFB clearly is a member of the glycoside hydrolase 70 (GH70) family, comprising enzymes with a permuted (β/α)₈ barrel that use sucrose to synthesize α-D-glucan polymers. The GTFB enzyme reaction and product specificities, however, are novel for the GH70 family, resembling those of the GH13 α-amylase type of enzymes in using maltooligosaccharides as substrates but differing in introducing a series of α1→6 glycosidic linkages into linear oligosaccharide products. We conclude that GTFB represents a novel evolutionary intermediate between the GH13 and GH70 enzyme families, and we speculate about its origin.

Structural basis for the glucan phosphatase activity of Starch Excess4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vander Kooi, Craig W.; Taylor, Adam O.; Pace, Rachel M.

Living organisms utilize carbohydrates as essential energy storage molecules. Starch is the predominant carbohydrate storage molecule in plants while glycogen is utilized in animals. Starch is a water-insoluble polymer that requires the concerted activity of kinases and phosphatases to solubilize the outer surface of the glucan and mediate starch catabolism. All known plant genomes encode the glucan phosphatase Starch Excess4 (SEX4). SEX4 can dephosphorylate both the starch granule surface and soluble phosphoglucans and is necessary for processive starch metabolism. The physical basis for the function of SEX4 as a glucan phosphatase is currently unclear. Herein, we report the crystal structuremore » of SEX4, containing phosphatase, carbohydrate-binding, and C-terminal domains. The three domains of SEX4 fold into a compact structure with extensive interdomain interactions. The C-terminal domain of SEX4 integrally folds into the core of the phosphatase domain and is essential for its stability. The phosphatase and carbohydrate-binding domains directly interact and position the phosphatase active site toward the carbohydrate-binding site in a single continuous pocket. Mutagenesis of the phosphatase domain residue F167, which forms the base of this pocket and bridges the two domains, selectively affects the ability of SEX4 to function as a glucan phosphatase. Together, these results reveal the unique tertiary architecture of SEX4 that provides the physical basis for its function as a glucan phosphatase.« less

Endotoxin and β-1,3-d-Glucan in Concentrated Ambient Particles Induce Rapid Increase in Blood Pressure in Controlled Human Exposures.

PubMed

Zhong, Jia; Urch, Bruce; Speck, Mary; Coull, Brent A; Koutrakis, Petros; Thorne, Peter S; Scott, James; Liu, Ling; Brook, Robert D; Behbod, Behrooz; Gibson, Heike; Silverman, Frances; Mittleman, Murray A; Baccarelli, Andrea A; Gold, Diane R

2015-09-01

Short-term exposure to particulate matter (PM) is associated with increased blood pressure (BP) in epidemiological studies. Understanding the impact of specific PM components on BP is essential in developing effective risk-reduction strategies. We investigated the association between endotoxin and β-1,3-d-Glucan-two major biological PM components-and BP. We also examined whether vascular endothelial growth factor, a vasodilatory inflammatory marker, modified these associations. We conducted a single-blind, randomized, crossover trial of controlled human exposure to concentrated ambient particles with 50 healthy adults. Particle-associated-endotoxin and β-1,3-d-Glucan were sampled using polycarbonate-membrane-filters. Supine resting systolic BP and diastolic BP were measured pre-, 0.5-hour post-, and 20-hour postexposure. Urine vascular endothelial growth factor concentration was determined using enzyme-linked immunosorbant assay and creatinine-corrected. Exposures to endotoxin and β-1,3-d-Glucan for 130 minutes were associated with increases in BPs: at 0.5-hour postexposure, every doubling in endotoxin concentration was associated with 1.73 mm Hg higher systolic BP (95% confidence interval, 0.28, 3.18; P=0.02) and 2.07 mm Hg higher diastolic BP (95% confidence interval, 0.74, 3.39; P=0.003); every doubling in β-1,3-d-Glucan concentration was associated with 0.80 mm Hg higher systolic BP (95% confidence interval, -0.07, 1.67; P=0.07) and 0.88 mm Hg higher diastolic BP (95% confidence interval, 0.09, 1.66; P=0.03). Vascular endothelial growth factor rose after concentrated ambient particle endotoxin exposure and attenuated the association between endotoxin and 0.5-hour postexposure diastolic BP (Pinteraction=0.02). In healthy adults, short-term endotoxin and β-1,3-d-Glucan exposures were associated with increased BP. Our findings suggest that the biological PM components contribute to PM-related cardiovascular outcomes, and postexposure vascular endothelial

Water-insoluble glucans from sucrose via glucansucrases. Factors influencing structures and yields

USDA-ARS?s Scientific Manuscript database

Dextrans and related glucans produced from sucrose by lactic acid bacteria have been studied for many years and are used in numerous commercial applications and products. Most of these glucans are water-soluble, except for a few notable exceptions from cariogenic Streptococcus spp. and a very small ...

Overview of β-Glucans from Laminaria spp.: Immunomodulation Properties and Applications on Biologic Models

PubMed Central

Bonfim-Mendonça, Patrícia de Souza; Capoci, Isis Regina Grenier; Tobaldini-Valerio, Flávia Kelly; Negri, Melyssa; Svidzinski, Terezinha Inez Estivalet

2017-01-01

Glucans are a group of glucose polymers that are found in bacteria, algae, fungi, and plants. While their properties are well known, their biochemical and solubility characteristics vary considerably, and glucans obtained from different sources can have different applications. Research has described the bioactivity of β-glucans extracted from the algae of the Laminaria genus, including in vivo and in vitro studies assessing pro- and anti-inflammatory cytokines, vaccine production, inhibition of cell proliferation, and anti- and pro-oxidant activity. Thus, the objective of this article was to review the potential application of β-glucans from Laminaria spp. in terms of their immunomodulatory properties, microorganism host interaction, anti-cancer activity and vaccine development. PMID:28878139

Bile alcohol metabolism in man. Conversion of 5beta-cholestane-3alpha, 7alpha,12alpha, 25-tetrol to cholic acid.

PubMed Central

Salen, G; Shefer, S; Setoguchi, T; Mosbach, E H

1975-01-01

To study the role of C25-HYDROXY BILE ALCOHOLS AS PRECURSORS OF CHOlic acid, [G-3-H]5beta-cholestane-3alpha,7alpha12alpha,25-tetrol was administered intravenously to two subjects with cerebrotendinous xanthomatosis (CTX) and two normal individuals. One day after pulse labeling, radioactivity was present in the cholic acid isolated from the bile and feces of the subjects with CTX and the bile of the normal individuals. In the two normal subjects, the sp act decay curves of [G-3-H]-cholic acid were exponential, and no traces of [G-3-H]-5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol were detected. In contrast, appreciable quantities of labeled 5beta-cholestane-3alpha,-7aopha,12alpha,25-tetrol were present in the bile and feces of the CTX subjects. The sp act vs. time curves of fecal [G-3-H]5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol and [G-3-H]-cholic acid showed a precursor-product relationship. Although these results suggest that 5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol may be a precursor of cholic acid in man, the possibility that C26-hydroxy intermediates represent the normal pathway can not be excluded. PMID:1141434

Steroid 5 alpha-reductase deficiency in a 65-year-old male pseudohermaphrodite: the natural history, ultrastructure of the testes, and evidence for inherited enzyme heterogeneity.

PubMed

Imperato-McGinley, J; Peterson, R E; Leshin, M; Griffin, J E; Cooper, G; Draghi, S; Berenyi, M; Wilson, J D

1980-01-01

We report a 65-yr-old male pseudohermaphrodite with steroid 5 alpha-reductase deficiency in whom there was no medical intervention before, during, or after puberty, enabling us to observe the natural history of this condition. The affected subject has an android build, with more facial and body hair than in previously described affected adults. Although the subject was raised as a girl, a male gender identity evolved with the events of puberty, but social factors have delayed the complete expression of a male gender role. Plasma levels of dihydrotestosterone and the in vivo conversion of radiolabeled testosterone to dihydrotestosterone were decreased. There was an elevated urinary etiocholanolone to androsterone ratio, typical of the syndrome. Characterization of 5 alpha-reductase enzyme activity in cultured genital skin fibroblasts demonstrated a pattern of enzyme activity distinctly different from three previously described families with this condition. There was decreased enzyme affinity for testosterone and NADPH. Also, the stability of the enzyme to elevated temperature was not protected by NADPH, resulting in rapid disappearance of enzyme activity after inhibition of protein synthesis with cycloheximide. Electron microscopic evaluation of the testes was carried out.

Effects of cryopreservation and hypothermic storage on cell viability and enzyme activity in recombinant encapsulated cells overexpressing alpha-L-iduronidase.

PubMed

Mayer, Fabiana Quoos; Baldo, Guilherme; de Carvalho, Talita Giacomet; Lagranha, Valeska Lizzi; Giugliani, Roberto; Matte, Ursula

2010-05-01

Here, we show the effects of cryopreservation and hypothermic storage upon cell viability and enzyme release in alginate beads containing baby hamster kidney cells overexpressing alpha-L-iduronidase (IDUA), the enzyme deficient in mucopolysaccharidosis type I. In addition, we compared two different concentrations of alginate gel (1% and 1.5%) in respect to enzyme release from the beads and their shape and integrity. Our results indicate that in both alginate concentrations, the enzyme is released in lower amounts compared with nonencapsulated cells. Alginate 1% beads presented increased levels of IDUA release, although this group presented more deformities when compared with alginate 1.5% beads. Importantly, both encapsulated groups presented higher cell viability after long cryopreservation period and hypothermic storage. In addition, alginate 1.5% beads presented higher enzyme release after freezing protocols. Taken together, our findings suggest a benefic effect of alginate upon cell viability and functionality. These results may have important application for treatment of both genetic and nongenetic diseases using microencapsulation-based artificial organs.

Cloning and expression of the Aspergillus oryzae glucan 1,3-beta-glucosidase A (exgA) in Pichia pastoris.

PubMed

Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut

2012-10-01

The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.

Nicotine promotes cell proliferation via {alpha}7-nicotinic acetylcholine receptor and catecholamine-synthesizing enzymes-mediated pathway in human colon adenocarcinoma HT-29 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Helen Pui Shan; Yu Le; Lam, Emily Kai Yee

Cigarette smoking has been implicated in colon cancer. Nicotine is a major alkaloid in cigarette smoke. In the present study, we showed that nicotine stimulated HT-29 cell proliferation and adrenaline production in a dose-dependent manner. The stimulatory action of nicotine was reversed by atenolol and ICI 118,551, a {beta}{sub 1}- and {beta}{sub 2}-selective antagonist, respectively, suggesting the role of {beta}-adrenoceptors in mediating the action. Nicotine also significantly upregulated the expression of the catecholamine-synthesizing enzymes [tyrosine hydroxylase (TH), dopamine-{beta}-hydroxylase (D{beta}H) and phenylethanolamine N-methyltransferase]. Inhibitor of TH, a rate-limiting enzyme in the catecholamine-biosynthesis pathway, reduced the actions of nicotine on cell proliferationmore » and adrenaline production. Expression of {alpha}7-nicotinic acetylcholine receptor ({alpha}7-nAChR) was demonstrated in HT-29 cells. Methyllycaconitine, an {alpha}7-nAChR antagonist, reversed the stimulatory actions of nicotine on cell proliferation, TH and D{beta}H expression as well as adrenaline production. Taken together, through the action on {alpha}7-nAChR nicotine stimulates HT-29 cell proliferation via the upregulation of the catecholamine-synthesis pathway and ultimately adrenaline production and {beta}-adrenergic activation. These data reveal the contributory role {alpha}7-nAChR and {beta}-adrenoceptors in the tumorigenesis of colon cancer cells and partly elucidate the carcinogenic action of cigarette smoke on colon cancer.« less

Purification and Properties of Mesophyll and Bundle Sheath Cell α-Glucan Phosphorylases from Zea mays L. 1

PubMed Central

Mateyka, Christian; Schnarrenberger, Claus

1988-01-01

Two major α-glucan phosphorylases (I and II) from leaves of the C4 plant corn (Zea mays L.) were previously shown to be compartmented in mesophyll and bundle sheath cells, respectively (C Mateyka, C Schnarrenberger 1984 Plant Sci Lett 36: 119-123). The two enzymes were separated by chromatography on DEAE-cellulose and purified to homogeneity by affinity chromatography on immobilized starch, according to published procedures, as developed for the cytosol and chloroplast phosphorylase from the C3 plant spinach. The two α-glucan phosphorylases have their pH optimum at pH 7. The specificity for polyglucans was similar for soluble starch and amylopectin, however, differed for glycogen (Km = 16 micrograms per milliliter for the mesophyll cell and 250 micrograms per milliliter for the bundle sheath cell phosphorylase). Maltose, maltotriose, and maltotetraose were not cleaved by either phosphorylase. If maltopentaose was used as substrate, the rate was about twice as high with the bundle sheath cell phosphorylase, than with the mesophyll cell phosphorylase. The phosphorylase I showed a molecular mass of 174 kilodaltons and the phosphorylase II of 195 kilodaltons for the native enzyme and of 87 and of 53 kilodaltons for the SDS-treated proteins, respectively. Specific antisera raised against mesophyll cell phosphorylase from corn leaves and against chloroplast phosphorylase from spinach leaves implied high similarity for the cytosol phosphorylase of the C3 plant spinach with mesophyll cell phosphorylase of the C4 plant corn and of chloroplast phosphorylase of spinach with the bundle sheath cell phosphorylase of corn. Images Fig. 2 Fig. 7 PMID:16665923

Inactivation of chloroplast H(+)-ATPase by modification of Lys beta 359, Lys alpha 176 and Lys alpha 266.

PubMed

Horbach, M; Meyer, H E; Bickel-Sandkötter, S

1991-09-01

Treatment of isolated, latent chloroplast ATPase with pyridoxal-5-phosphate (pyridoxal-P) in presence of Mg2+ causes inhibition of dithiothreitol-activated plus heat-activated ATP hydrolysis. The amount of [3H]pyridoxal-P bound to chloroplast coupling factor 1 (CF1) was estimated to run up to 6 +/- 1 pyridoxal-P/enzyme, almost equally distributed between the alpha- and beta-subunits. Inactivation, however, is complete after binding of 1.5-2 pyridoxal-P/CF1, suggesting that two covalently modified lysines prevent the activation of the enzyme. ADP as well as ATP in presence of Mg2+ protects the enzyme against inactivation and concomittantly prevents incorporation of a part of the 3H-labeled pyridoxal-P into beta- and alpha-subunits. Phosphate prevents labeling of the alpha-subunit, but has only a minor effect on protection against inactivation. The data indicate a binding site at the interface between the alpha- and beta-subunits. Cleavage of the pyridoxal-P-labeled subunits with cyanogen bromide followed by sequence analysis of the labeled peptides led to the detection of Lys beta 359, Lys alpha 176 and Lys alpha 266, which are closely related to proposed nucleotide-binding regions of the alpha- and beta-subunits.

Effect of γ-irradiation on structure and nutraceutical potential of β-D-glucan from barley (Hordeum vulgare).

PubMed

Shah, Asima; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Gani, Adil; Masoodi, Farooq Ahmad; Wani, Idrees Ahmed; Wani, Sajad Mohd; Gani, Asir

2015-01-01

This paper reports the characterization and potential antioxidant activity of β-D-glucan isolated from barley treated with γ-rays. The β-D-glucan was irradiated with 0, 2, 4 and 8 kGy by gamma ray. The samples were characterized by Fourier transform-infrared spectroscopy, gel permeation chromatography (GPC) and quantitative estimation by Megazyme β-D-glucan assay kit. The average molecular weight of non-irradiated β-D-glucan was 177 kDa that decreased to 79 kDa at 8 kGy. Antioxidant activity was evaluated by five complementary assays including DPPH, lipid peroxidation, reducing power, metal chelating ability and oxidative DNA damage assays. Further, the antiproliferative potential of irradiated β-D-glucan was tested against three human cancer cell lines including Colo-205, T47D and MCF7 using MTT assay. Irradiated β-D-glucan exhibited dose dependent cancer cell growth inhibition. In conclusion, the present study demonstrates that irradiation leads to the formation of low molecular weight β-D-glucan with enhanced antioxidant and antiproliferative activities. Copyright © 2014 Elsevier B.V. All rights reserved.

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

PubMed

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor

Mechanisms of antimelanoma effect of oat β-glucan supported by electroporation.

PubMed

Choromanska, Anna; Lubinska, Sandra; Szewczyk, Anna; Saczko, Jolanta; Kulbacka, Julita

2018-06-06

There are still not specified mechanisms how beta-glucan molecules are transported into cells. Supposing, beta-glucan toxicity against tumor cells may be related to the overexpression of the transporter responsible for the transport of glucose molecules in the cells. In this case, glucans - polymers composed of glucose units are much more up-taken by tumor than normal cells. Increased GLUT1 (Glucose Transporter Type 1) expression has been demonstrated earlier in malignant melanomas. GLUT1 expression promotes glucose uptake and cell growth in that cells. Also, in human melanoma tissues a significant correlation between GLUT1 expression and mitotic activity was found. The aim of the study was to verify if oat β-glucan (OβG) is delivered into cells by GLUT-1 membrane protein. To check it out we blocked GLUT1 transporters by an inhibitor WZB117 and then we investigated cells viability with and without reversible electroporation (EP). The obtained results bring us to elucidate the mechanism of transport of the OβG into the cells is GLUT-1 dependent and moreover can be supported by EP method. Copyright © 2018. Published by Elsevier B.V.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

PubMed

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P < 0.05). Product expansion increased with the introduction of both barley and mushroom fraction (P < 0.05) which in turn resulted in a reduction in product hardness (P < 0.05). In vitro digestion protocol illustrated that inclusion of barley and mushroom β-glucan rich fractions manipulated the starch digestibility profile and hence rate of glucose release during digestion compared to the control sample. This in turn resulted in a significant (P < 0.05) reduction in potential glycaemic response of the samples of between 20 and 25 % for barley β-glucan rich fractions and between 17 and 25 % for mushroom β-glucan rich fractions. We conclude that the inclusion of these fractions could be utilised by the food industry to manipulate the glycaemic response of extruded snack products.

Protective effect of β-(1,3 → 1,6)-D-glucan against irritant-induced gastric lesions.

PubMed

Tanaka, Ken-ichiro; Tanaka, Yuta; Suzuki, Toshio; Mizushima, Tohru

2011-08-01

β-(1,3)-D-Glucan with β-(1,6) branches has been reported to have various pharmacological activities, such as anti-tumour and anti-infection activities, which result from its immunomodulating effects. Gastric lesions result from an imbalance between aggressive and defensive factors. In the present study, we examined the effect of β-(1,3)-D-glucan with β-(1,6) branches isolated from Aureobasidium pullulans on the gastric ulcerogenic response in mice. Oral administration of β-glucan ameliorated gastric lesions induced by ethanol (EtOH) or HCl. This administration of β-glucan also suppressed EtOH-induced inflammatory responses, such as infiltration of neutrophils and expression of pro-inflammatory cytokines, chemokines and cell adhesion molecules (CAM) at the gastric mucosa. Of the various defensive factors, the levels of heat shock protein (HSP) 70 and mucin but not PGE(2) were increased by the administration of β-glucan. β-Glucan-dependent induction of the expression of HSP70 and mucin proteins and suppression of the expression of pro-inflammatory cytokines, chemokines and CAM were also observed in cultured cells in vitro. The results of the present study suggest that β-glucan protects the gastric mucosa from the formation of irritant-induced lesions by increasing the levels of defensive factors, such as HSP70 and mucin.

Cost-effectiveness of Maintaining Daily Intake of Oat β-Glucan for Coronary Heart Disease Primary Prevention.

PubMed

Earnshaw, Stephanie R; McDade, Cheryl L; Chu, YiFang; Fleige, Lisa E; Sievenpiper, John L

2017-04-01

Oat β-glucan reduces cholesterol levels and thus reduces the risk for coronary heart disease (CHD). However, its economic impact has not been well studied. We examined the economic impact of daily intake of ≥3 g of oat β-glucan in primary prevention of CHD in patients receiving statins or no pharmacologic treatment. A decision model was developed to compare costs and outcomes associated with lowering cholesterol levels with no pharmacologic treatment and normal diet, no pharmacologic treatment plus ≥3 g/d of oat β-glucan, and statin therapy plus ≥3 g/d of oat β-glucan. The population comprised men 45, 55, or 65 years of age with no history of cardiovascular disease and a 10-year risk for CHD of 5%, 7.5%, or 10%. Clinical efficacy data were gathered from meta-analyses; safety data, costs, and utilities were gathered from published literature. Cost per quality-adjusted life years and number of first events were reported. Maintaining ≥3 g/d of β-glucan may be cost-effective in men aged 45, 55, and 65 years with 10-year CHD risks of 5.0%, 7.5%, and 10.0% taking no pharmacologic treatment or on statins. It may also reduce first events of myocardial infarction and CHD death. Results are sensitive to oat β-glucan cost but insensitive to changes in other parameters. Maintaining ≥3 g of oat β-glucan daily remains cost-effective within plausible range of values. β-glucan may be cost-effective for preventing CHD events in middle-aged men with no history of cardiovascular events whose 10-year CHD risk is ≥5%. Maintaining daily β-glucan intake may have considerable impact on first events. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceaemore » of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.« less

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

PubMed

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Novel Structural Features in Candida albicans Hyphal Glucan Provide a Basis for Differential Innate Immune Recognition of Hyphae Versus Yeast*

PubMed Central

Lowman, Douglas W.; Greene, Rachel R.; Bearden, Daniel W.; Kruppa, Michael D.; Pottier, Max; Monteiro, Mario A.; Soldatov, Dmitriy V.; Ensley, Harry E.; Cheng, Shih-Chin; Netea, Mihai G.; Williams, David L.

2014-01-01

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. 1H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or “closed chain” structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae. PMID:24344127

Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme

NASA Technical Reports Server (NTRS)

Leznicki, A. J.; Bandurski, R. S.

1988-01-01

The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.

Soluble β-1,3/1,6-glucan in seaweed from the southern hemisphere and its immunomodulatory effect.

PubMed

Bobadilla, Francisca; Rodriguez-Tirado, Carolina; Imarai, Mónica; Galotto, María José; Andersson, Roger

2013-01-30

Five types of macroalgae from the southern hemisphere were analysed for the presence of β-1,3/1,6-glucan and its immunostimulant properties. We were able to extract soluble β-1,3/1,6-D-glucan from Durvillaea antarctica (Chamisso) Hariot (DA). The morphology of the brown algae influenced extraction, and the highest percentage of β-glucan was found in the fronds. The content of β-glucan in the stipes and holdfast was on average 33% and <5%, respectively, of that in the fronds. A simple laboratory extraction process was developed. A highly pure water-soluble polysaccharide, mainly composed of glucose residues, was obtained with a dominant average molecular weight of 6.9 kDa. NMR spectroscopy confirmed the polysaccharide structure to be of β-1,3/1,6-glucan type, comprising a β-1,3-glucan backbone and 21% degree of branching of β-1,6-glucan side chains. Mouse cells were exposed to four DA extract concentrations in water (50, 100, 250 and 500 μg/mL) and no adverse effects on survival were noted. Remarkably, the β-glucan induced a 16.9% increase in activated CD19+ B lymphocytes compared with the control sample. The optimal concentration for maximum activity was 100 μg DA extract/mL. Copyright © 2012 Elsevier Ltd. All rights reserved.

Aerosolization of Particulate (1→3)-β-d-Glucan from Moldy Materials▿

PubMed Central

Seo, Sung-Chul; Reponen, Tiina; Levin, Linda; Borchelt, Tiffany; Grinshpun, Sergey A.

2008-01-01

Mold-damaged building materials may contain biologically active agents, such as (1→3)-β-d-glucan, allergens, and mycotoxins, which have been associated with adverse health effects. The release of these components from contaminated surfaces into the air is not well understood. The purpose of this study was to characterize the release of particulate (1→3)-β-d-glucan from the surface of artificially mold-contaminated materials. Aspergillus versicolor and Stachybotrys chartarum were grown on malt extract agar (MEA), white ceiling tiles, and a wall-papered gypsum board for 1 and 6 months. The (1→3)-β-d-glucan on the surfaces of moldy materials and in air samples collected from these materials was analyzed by the Limulus amebocyte lysate assay. The aerosolization ratio was defined as the amount of (1→3)-β-d-glucan in the air divided by the amount on the surface. The results showed that the aerosolization of particulate (1→3)-β-d-glucan was influenced mainly by the type of material and the fungal species. For A. versicolor, the aerosolization ratios of particulate (1→3)-β-d-glucan released from the three types of material were not significantly different. However, the ratios for S. chartarum released from ceiling tiles and gypsum board were significantly higher than the ratios for this organism released from MEA (P < 0.001) and were comparable to those for A. versicolor. These findings indicate that the use of MEA in aerosolization experiments is likely to underestimate the release of S. chartarum particles from building materials. These results provide important background information for design of future laboratory or animal experiments, as well as for interpretation of field measurement data. PMID:18065630

Effect of storage conditions on the solubility and viscosity of β-glucan extracted from bread under in vitro conditions.

PubMed

Moriartey, Stephanie; Temelli, Feral; Vasanthan, Thava

2011-01-01

The viscosity and solubility of β-glucan in muffins have been shown to be reduced by certain storage conditions, though the effect of storage on bread fortified with barley β-glucan concentrate has not been investigated. Therefore, this study investigated the effect of storage temperature and time (23 °C for 1, 4, and 7 d, 4 °C for 4, 7, and 14 d, and -20 °C for 1, 2, 4, and 8 wk) on the solubility and viscosity of β-glucan upon incorporation into bread at levels corresponding to 0 or 1.5 g β-glucan/serving, with or without vital gluten addition. The firmness and moisture content of bread following each storage treatment were also evaluated. The highest moisture and lowest firmness values were found in fresh bread, though these parameters were still maintained at appreciable levels upon room temperature storage of the 1.5 g β-glucan/serving bread with added gluten and at either room temperature or frozen storage for the 1.5 g β-glucan/serving bread for 4 d. If it is desirable to store bread for 7 d or more, frozen storage should be utilized in order to best maintain bread moisture and firmness levels. It is recommended that β-glucan-fortified bread be consumed fresh for greatest β-glucan solubility and viscosity, though β-glucan solubility of approximately 40% is still achievable upon frozen storage of the bread for up to 2 wk. It is still unclear, however, as to what extent of reductions in the solubility and viscosity of β-glucan would lower its physiological effectiveness. Previous research has demonstrated that solubility and thus viscosity of β-glucan, which is an important property associated with its health benefits can be impacted by different storage conditions applied to some bakery products, like muffins. This study demonstrates the extent of changes in the solubility and viscosity of β-glucan incorporated into bread. Therefore, storage time and temperature should be optimized to minimize changes in β-glucan for maintaining its efficacy

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

PubMed

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sterigmatomyces halophilus β-glucan improves the immune response and bacterial resistance in Pacific red snapper (Lutjanus peru) peripheral blood leucocytes: In vitro study.

PubMed

Reyes-Becerril, Martha; Guardiola, Francisco A; Sanchez, Veronica; Maldonado, Minerva; Angulo, Carlos

2018-04-21

β-Glucans are naturally occurring polysaccharides that are produced by bacteria, fungi and yeast. They are considered immunostimulants in fish acting on non-specific defense mechanism. Yeast-derived glucans from cell wall (Sterigmatomyces halophilus, β-Gluc/Sh) have been used for this purpose in this study. Therefore, an in vitro assay using peripheral blood leucocytes (PBLs) from Pacific red snapper was performed to evaluate the stimulant effects of β-Gluc/Sh and zymosan A (positive control) for 12 and 24 h and after bacterial challenge with Aeromonas hydrophila at 24 h. In addition, structural characterization of this marine yeast glucan was performed by proton nuclear magnetic resonance (NMR) revealing structures containing (1-6)-branched (1-3)-β-D-glucan. PBLs responded positively to β-Gluc/Sh where cell viability was higher than 80%. After challenge, β-Gluc/Sh was able to inhibit cytotoxicity caused by A. hydrophila, highlighting that the PBLs incubated with β-Gluc/Sh significantly increased the non-specific immune response, such as phagocytic activity, respiratory burst, nitric oxide and peroxidase activities followed by an increase in superoxide dismutase and catalase activities after 12 and 24 h post-stimulation and after challenge with the pathogen. Regarding induction of antioxidant gene expression, it was more pronounced in stimulated β-Gluc/Sh leucocytes compared to other groups at all experimental times of the trial and after bacterial challenge. Indeed, our results clearly showed the ability of leucocytes to strongly react to β-Gluc/Sh with an increase in cytokine gene expression, particularly the IL-1β, IL-10 and IL-17 genes. These results confirm that S. halophilus yeast-derived β-glucan, isolated from an extreme marine environment, is beneficial for increasing innate immune response and enhancing resistance against A. hydrophila in vitro. Copyright © 2018. Published by Elsevier Ltd.

Genetic Diversity and Genome Wide Association Study of β-Glucan Content in Tetraploid Wheat Grains

PubMed Central

Marcotuli, Ilaria; Houston, Kelly; Schwerdt, Julian G.; Waugh, Robbie; Fincher, Geoffrey B.; Burton, Rachel A.; Blanco, Antonio; Gadaleta, Agata

2016-01-01

Non-starch polysaccharides (NSPs) have many health benefits, including immunomodulatory activity, lowering serum cholesterol, a faecal bulking effect, enhanced absorption of certain minerals, prebiotic effects and the amelioration of type II diabetes. The principal components of the NSP in cereal grains are (1,3;1,4)-β-glucans and arabinoxylans. Although (1,3;1,4)-β-glucan (hereafter called β-glucan) is not the most representative component of wheat cell walls, it is one of the most important types of soluble fibre in terms of its proven beneficial effects on human health. In the present work we explored the genetic variability of β-glucan content in grains from a tetraploid wheat collection that had been genotyped with a 90k-iSelect array, and combined this data to carry out an association analysis. The β-glucan content, expressed as a percentage w/w of grain dry weight, ranged from 0.18% to 0.89% across the collection. Our analysis identified seven genomic regions associated with β-glucan, located on chromosomes 1A, 2A (two), 2B, 5B and 7A (two), confirming the quantitative nature of this trait. Analysis of marker trait associations (MTAs) in syntenic regions of several grass species revealed putative candidate genes that might influence β-glucan levels in the endosperm, possibly via their participation in carbon partitioning. These include the glycosyl hydrolases endo-β-(1,4)-glucanase (cellulase), β-amylase, (1,4)-β-xylan endohydrolase, xylanase inhibitor protein I, isoamylase and the glycosyl transferase starch synthase II. PMID:27045166

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

NASA Astrophysics Data System (ADS)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

Localization and Characterization of alpha-Glucosidase Activity in Brettanomyces lambicus.

PubMed

Kumara, H M; De Cort, S; Verachtert, H

1993-08-01

Brettanomyces lambicus was isolated and identified from a typical overattenuating Belgian lambic beer and exhibited extracellular and intracellular alpha-glucosidase activities. Production of the intracellular enzyme was higher than production of the extracellular enzyme, and localization studies showed that the intracellular alpha-glucosidase is mostly soluble and partially cell wall bound. Both intracellular and extracellular enzymes were purified by ammonium sulfate precipitation, gel filtration (Sephadex G-150, Sephadex G-200, Ultrogel AcA-44), and ion-exchange chromatography (sulfopropyl-Sephadex C-50, (carboxymethyl-Sephadex C-50). The intracellular alpha-glucosidase exhibited optimum activity at 39 degrees C and pH 6.2. The extracellular enzyme exhibited optimum catalytic activity at 40 degrees C and pH 6.0. The molecular masses of purified intracellular and extracellular alpha-glucosidases, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, were 72,500 and 77,250, respectively. For both enzymes there was a decrease in the rate of hydrolysis with an increase in the degree of polymerization, and both enzymes hydrolyzed dextrins isolated from lambic wort (degrees of polymerization, 3 to 9 and more than 9). The K(m) values for p-nitrophenyl-alpha-d-glucopyranoside, maltose, and maltotriose for the intracellular enzyme were 0.9, 3.4, and 3.7 mM, respectively. The K(i) values for both enzymes were between 28.5 and 57 muM for acarbose and between 7.45 and 15.7 mM for Tris. These enzymes are probably involved in the overattenuation of spontaneously fermented lambic beer.

Enzyme exposure in the British baking industry.

PubMed

Elms, J; Robinson, E; Mason, H; Iqbal, S; Garrod, A; Evans, G S

2006-06-01

Enzymes are commonly used in the baking industry, as they can improve dough quality and texture and lengthen the shelf life of the final product. There is little published information highlighting exposure to enzymes (other than fungal alpha-amylase) in the baking industry, therefore the purpose of this study was to identify antibodies and develop assays for the measurement of a variety of such enzymes in samples of airborne flour dust. Polyclonal antibodies to bacterial amylase, glucose oxidase and amyloglucosidase were identified and developed into ELISA assays. The assays showed limited cross-reactivity with other enzymes commonly used in the baking industry. We measured levels of airborne enzymes in 195 personal air samples taken from a sample of 55 craft baking establishments. We were able to detect amyloglucosidase in 9% (16/184) of the samples, fungal alpha-amylase in 6% (11/171), bacterial alpha-amylase in 7% (13/195). However, we were unable to detect glucose oxidase in any of the samples. Measurements for protease enzymes were not carried out. Median levels in detectable samples of amyloglucosidase, fungal alpha-amylase and bacterial amylase were similar at 10.3, 5.3 and 5.9 ng/m(3), respectively. These figures represent the total enzyme protein (active and inactive) measured. There are few data in the literature regarding sensitization and exposure-response relationships to these enzymes, and indeed there is often a lack of information within the industry as to the precise enzyme content of particular baking ingredients. As a precautionary measure, all enzymes are regarded as having the potential to cause respiratory sensitization. Consequently, exposures need to be controlled to as low a level as reasonably practicable, and future investigation may highlight the importance of measuring a variety of enzyme exposures and standardizing these methodologies to inform approaches to adequate control.

Chemically engineered sulfated glucans from rice bran exert strong antiviral activity at the stage of viral entry.

PubMed

Ray, Bimalendu; Hutterer, Corina; Bandyopadhyay, Shruti S; Ghosh, Kanika; Chatterjee, Udipta R; Ray, Sayani; Zeitträger, Isabel; Wagner, Sabrina; Marschall, Manfred

2013-12-27

Attachment and entry of many viruses are mediated by their affinity for polysaccharides present on the surface of target cells. In this paper, we demonstrate that sulfated glucans isolated from rice (Oryza sativa) can be utilized as experimental drugs exerting strong antiviral activity. In particular, oleum-DMF-based extraction is described as a procedure for the generation of chemically engineered glucans from commercially available rice bran. The one-step procedure has the potential to provide a spectrum of related glucans with varying molecular masses and modifications, including sulfation. The sulfated glucans P444, P445, and P446 possess increased antiviral activity compared to a previously described glucan (S1G). P444, P445, and P446 were highly active against human cytomegalovirus (HCMV), moderately active against other members of the family Herpesviridae, while not active against unrelated viruses. Specific experimentation with HCMV-infected cells provided evidence that antiviral activity was based on inhibition of viral entry and that inhibition occurred in the absence of drug-induced cytotoxicity. These findings underline the high potential of sulfated glucans for antiviral research and drug development. In addition, the procedure described for the efficient transformation of glucan hydroxy groups to sulfate groups may be similarly beneficial for the chemical alteration of other natural products.

Enzymology and structure of the GH13_31 glucan 1,6-α-glucosidase that confers isomaltooligosaccharide utilization in the probiotic Lactobacillus acidophilus NCFM.

PubMed

Møller, Marie S; Fredslund, Folmer; Majumder, Avishek; Nakai, Hiroyuki; Poulsen, Jens-Christian N; Lo Leggio, Leila; Svensson, Birte; Abou Hachem, Maher

2012-08-01

Isomaltooligosaccharides (IMO) have been suggested as promising prebiotics that stimulate the growth of probiotic bacteria. Genomes of probiotic lactobacilli from the acidophilus group, as represented by Lactobacillus acidophilus NCFM, encode α-1,6 glucosidases of the family GH13_31 (glycoside hydrolase family 13 subfamily 31) that confer degradation of IMO. These genes reside frequently within maltooligosaccharide utilization operons, which include an ATP-binding cassette transporter and α-glucan active enzymes, e.g., maltogenic amylases and maltose phosphorylases, and they also occur separated from any carbohydrate transport or catabolism genes on the genomes of some acidophilus complex members, as in L. acidophilus NCFM. Besides the isolated locus encoding a GH13_31 enzyme, the ABC transporter and another GH13 in the maltooligosaccharide operon were induced in response to IMO or maltotetraose, as determined by reverse transcription-PCR (RT-PCR) transcriptional analysis, suggesting coregulation of α-1,6- and α-1,4-glucooligosaccharide utilization loci in L. acidophilus NCFM. The L. acidophilus NCFM GH13_31 (LaGH13_31) was produced recombinantly and shown to be a glucan 1,6-α-glucosidase active on IMO and dextran and product-inhibited by glucose. The catalytic efficiency of LaGH13_31 on dextran and the dextran/panose (trisaccharide) efficiency ratio were the highest reported for this class of enzymes, suggesting higher affinity at distal substrate binding sites. The crystal structure of LaGH13_31 was determined to a resolution of 2.05 Å and revealed additional substrate contacts at the +2 subsite in LaGH13_31 compared to the GH13_31 from Streptococcus mutans (SmGH13_31), providing a possible structural rationale to the relatively high affinity for dextran. A comprehensive phylogenetic and activity motif analysis mapped IMO utilization enzymes from gut microbiota to rationalize preferential utilization of IMO by gut residents.

Enzymology and Structure of the GH13_31 Glucan 1,6-α-Glucosidase That Confers Isomaltooligosaccharide Utilization in the Probiotic Lactobacillus acidophilus NCFM

PubMed Central

Møller, Marie S.; Fredslund, Folmer; Majumder, Avishek; Nakai, Hiroyuki; Poulsen, Jens-Christian N.; Lo Leggio, Leila; Svensson, Birte

2012-01-01

Isomaltooligosaccharides (IMO) have been suggested as promising prebiotics that stimulate the growth of probiotic bacteria. Genomes of probiotic lactobacilli from the acidophilus group, as represented by Lactobacillus acidophilus NCFM, encode α-1,6 glucosidases of the family GH13_31 (glycoside hydrolase family 13 subfamily 31) that confer degradation of IMO. These genes reside frequently within maltooligosaccharide utilization operons, which include an ATP-binding cassette transporter and α-glucan active enzymes, e.g., maltogenic amylases and maltose phosphorylases, and they also occur separated from any carbohydrate transport or catabolism genes on the genomes of some acidophilus complex members, as in L. acidophilus NCFM. Besides the isolated locus encoding a GH13_31 enzyme, the ABC transporter and another GH13 in the maltooligosaccharide operon were induced in response to IMO or maltotetraose, as determined by reverse transcription-PCR (RT-PCR) transcriptional analysis, suggesting coregulation of α-1,6- and α-1,4-glucooligosaccharide utilization loci in L. acidophilus NCFM. The L. acidophilus NCFM GH13_31 (LaGH13_31) was produced recombinantly and shown to be a glucan 1,6-α-glucosidase active on IMO and dextran and product-inhibited by glucose. The catalytic efficiency of LaGH13_31 on dextran and the dextran/panose (trisaccharide) efficiency ratio were the highest reported for this class of enzymes, suggesting higher affinity at distal substrate binding sites. The crystal structure of LaGH13_31 was determined to a resolution of 2.05 Å and revealed additional substrate contacts at the +2 subsite in LaGH13_31 compared to the GH13_31 from Streptococcus mutans (SmGH13_31), providing a possible structural rationale to the relatively high affinity for dextran. A comprehensive phylogenetic and activity motif analysis mapped IMO utilization enzymes from gut microbiota to rationalize preferential utilization of IMO by gut residents. PMID:22685275

21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.

Code of Federal Regulations, 2014 CFR

2014-04-01

... HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.145 Alpha-Galactosidase derived from... following conditions: (a) The food additive is the enzyme alpha-galactosidase and the mycelia of the microorganism Mortierella vinaceae var. raffinoseutilizer which produces the enzyme. (b) The nonpathogenic...

Test performance of blood beta-glucan for Pneumocystis jirovecii pneumonia in patients with AIDS and respiratory symptoms.

PubMed

Wood, Brian R; Komarow, Lauren; Zolopa, Andrew R; Finkelman, Malcolm A; Powderly, William G; Sax, Paul E

2013-03-27

The objective of this study was to define the test characteristics of plasma beta-glucan for diagnosis of Pneumocystis jirovecii pneumonia (PCP) in AIDS patients with respiratory symptoms. Analysis of baseline blood samples in a randomized strategy study of patients with acute opportunistic infections, limited to participants with respiratory symptoms. Participants in the 282-person ACTG A5164 trial had baseline plasma samples assayed for beta-glucan testing. As part of A5164 trial, two study investigators independently adjudicated the diagnosis of PCP. Respiratory symptoms were identified by investigators from a list of all signs and symptoms with an onset or resolution in the 21 days prior to or 14 days following study entry. Beta-glucan was defined as positive if at least 80 pg/ml and negative if less than 80 pg/ml. Of 252 study participants with a beta-glucan result, 159 had at least one respiratory symptom, 139 of whom had a diagnosis of PCP. The sensitivity of beta-glucan for PCP in participants with respiratory symptoms was 92.8% [95% confidence interval (CI) 87.2-96.5], and specificity 75.0% (95% CI 50.9-91.3). Among 134 individuals with positive beta-glucan and respiratory symptoms, 129 had PCP, for a positive predictive value of 96.3% (95% CI 91.5-98.8). Fifteen of 25 patients with a normal beta-glucan did not have PCP, for a negative predictive value of 60% (95% CI 38.7-78.9). Elevated plasma beta-glucan has a high predictive value for diagnosis of PCP in AIDS patients with respiratory symptoms. We propose an algorithm for the use of beta-glucan as a diagnostic tool on the basis of the pretest probability of PCP in such patients.

Varying Effects of Different β-Glucans on the Maturation of Porcine Monocyte-Derived Dendritic Cells ▿

PubMed Central

Sonck, Eva; Devriendt, Bert; Goddeeris, Bruno; Cox, Eric

2011-01-01

β-Glucans are well known for their immunomodulatory capacities in humans and mice. For this reason, together with the European ban on growth-promoting antibiotics, β-glucans are intensively used in pig feed. However, as shown in the present study, there is much variation in the stimulatory capacities of β-glucans from different sources. Since dendritic cells (DCs) are the first cells that are encountered after an antigen is taken up by the intestinal epithelial cell barrier, we decided to investigate the effect of two concentrations (5 and 10 μg/ml) of five commercial β-glucan preparations, differing in structure and source, on porcine monocyte-derived dendritic cells (MoDCs). Although all β-glucans gave rise to a significant reduction of the phagocytic activity of DCs, only Macrogard induced a significant phenotypic maturation. In addition to Macrogard, zymosan, another β-glucan derived from Saccharomyces cerevisiae, and curdlan also significantly improved the T-cell-stimulatory capacity of MoDCs. Most interesting, however, is the cytokine secretion profile of curdlan-stimulated MoDCs, since only curdlan induced significant higher expression levels of interleukin-1β (IL-1β), IL-6, IL-10, and IL-12/IL-23p40. Since the cytokine profile of DCs influences the outcome of the ensuing immune response and thus may prove valuable in intestinal immunity, a careful choice is necessary when β-glucans are used as dietary supplement. PMID:21752950

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

PubMed

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

PubMed

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

The Effects of Orally Administered Beta-Glucan on Innate Immune Responses in Humans, a Randomized Open-Label Intervention Pilot-Study

PubMed Central

Leentjens, Jenneke; Quintin, Jessica; Gerretsen, Jelle; Kox, Matthijs; Pickkers, Peter; Netea, Mihai G.

2014-01-01

Rationale To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use. Methods We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10) or the control group (n = 5). Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity. Results β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan. Conclusion The present study does not support the use of oral β-glucan to enhance innate immune responses in humans. Trial Registration ClinicalTrials.gov NCT01727895 PMID:25268806

Prophylactic effects of humic acid-glucan combination against experimental liver injury

PubMed Central

Vetvicka, Vaclav; Garcia-Mina, Jose Maria; Yvin, Jean-Claude

2015-01-01

Aim: Despite intensive research, liver diseases represent a significant health problem and current medicine does not offer a substance able to significantly inhibit the hepatotoxicity leading to various stages of liver disease. Based on our previously published studies showing the protective effects of a glucan-humic acid (HA) combination, we focused on the hypothesis that the combination of these two natural molecules can offer prophylactic protection against experimentally induced hepatotoxicity. Materials and Methods: Lipopolysaccharide, carbon tetrachloride, and ethanol were used to experimentally damage the liver. Levels of aspartate aminotransferase, alanine transaminase, alkaline phosphatase, glutathione, superoxide dismutase, and malondialdehyde, known to correspond to the liver damage, were assayed. Results: Using three different hepatotoxins, we found that in all cases, some samples of HA and most of all the glucan-HA combination, offer strong protection against liver damage. Conclusion: Glucan-HA combination is a promising agent for use in liver protection. PMID:26401416

Barley and oat beta-glucan content measured by calcofluor fluorescence in a microplate assay

USDA-ARS?s Scientific Manuscript database

Beta-glucan levels in grains, particularly barley and oats, are receiving increased interest in part due to their recognized benefits to human health. While a number of methods to determine grain beta-glucan levels are available, each suffers from significant drawbacks for routine implementation. ...

Lactate signalling regulates fungal β-glucan masking and immune evasion

PubMed Central

Ballou, Elizabeth R.; Avelar, Gabriela M.; Childers, Delma S.; Mackie, Joanna; Bain, Judith M.; Wagener, Jeanette; Kastora, Stavroula L.; Panea, Mirela D.; Hardison, Sarah E.; Walker, Louise A.; Erwig, Lars P.; Munro, Carol A.; Gow, Neil A.R.; Brown, Gordon D.; MacCallum, Donna M.; Brown, Alistair J.P.

2017-01-01

Summary Paragraph As they proliferate, fungi expose antigens at their cell surface that are potent stimulators of the innate immune response, and yet the commensal fungus Candida albicans is able to colonize immuno-competent individuals. We show that C. albicans may evade immune detection by presenting a moving immunological target. We report that the exposure of β-glucan, a key Pathogen Associated Molecular Pattern (PAMP) located at the cell surface of C. albicans and other pathogenic Candida species, is modulated in response to changes in carbon source. Exposure to lactate induces β-glucan masking in C. albicans via a signaling pathway that has recruited an evolutionarily conserved receptor (Gpr1) and transcriptional factor (Crz1) from other well-characterized pathways. In response to lactate, these regulators control the expression of cell wall related genes that contribute to β-glucan masking. This represents the first description of active PAMP masking by a Candida species, a process that reduces the visibility of the fungus to the immune system. PMID:27941860

Dectin-1 is required for β-glucan recognition and control of fungal infection

PubMed Central

Taylor, Philip R; Tsoni, S Vicky; Willment, Janet A; Dennehy, Kevin M; Rosas, Marcela; Findon, Helen; Haynes, Ken; Steele, Chad; Botto, Marina; Gordon, Siamon; Brown, Gordon D

2007-01-01

β-Glucan is one of the most abundant polysaccharides in fungal pathogens, yet its importance in antifungal immunity is unclear. Here we show that deficiency of dectin-1, the myeloid receptor for β-glucan, rendered mice susceptible to infection with Candida albicans. Dectin-1-deficient leukocytes demonstrated significantly impaired responses to fungi even in the presence of opsonins. Impaired leukocyte responses were manifested in vivo by reduced inflammatory cell recruitment after fungal infection, resulting in substantially increased fungal burdens and enhanced fungal dissemination. Our results establish a fundamental function for β-glucan recognition by dectin-1 in antifungal immunity and demonstrate a signaling non–Toll-like pattern-recognition receptor required for the induction of protective immune responses. PMID:17159984

Rapid optimization of enzyme mixtures for deconstruction of diverse pretreatment/biomass feedstock combinations.

PubMed

Banerjee, Goutami; Car, Suzana; Scott-Craig, John S; Borrusch, Melissa S; Walton, Jonathan D

2010-10-12

Enzymes for plant cell wall deconstruction are a major cost in the production of ethanol from lignocellulosic biomass. The goal of this research was to develop optimized synthetic mixtures of enzymes for multiple pretreatment/substrate combinations using our high-throughput biomass digestion platform, GENPLAT, which combines robotic liquid handling, statistical experimental design and automated Glc and Xyl assays. Proportions of six core fungal enzymes (CBH1, CBH2, EG1, β-glucosidase, a GH10 endo-β1,4-xylanase, and β-xylosidase) were optimized at a fixed enzyme loading of 15 mg/g glucan for release of Glc and Xyl from all combinations of five biomass feedstocks (corn stover, switchgrass, Miscanthus, dried distillers' grains plus solubles [DDGS] and poplar) subjected to three alkaline pretreatments (AFEX, dilute base [0.25% NaOH] and alkaline peroxide [AP]). A 16-component mixture comprising the core set plus 10 accessory enzymes was optimized for three pretreatment/substrate combinations. Results were compared to the performance of two commercial enzymes (Accellerase 1000 and Spezyme CP) at the same protein loadings. When analyzed with GENPLAT, corn stover gave the highest yields of Glc with commercial enzymes and with the core set with all pretreatments, whereas corn stover, switchgrass and Miscanthus gave comparable Xyl yields. With commercial enzymes and with the core set, yields of Glc and Xyl were highest for grass stovers pretreated by AP compared to AFEX or dilute base. Corn stover, switchgrass and DDGS pretreated with AFEX and digested with the core set required a higher proportion of endo-β1,4-xylanase (EX3) and a lower proportion of endo-β1,4-glucanase (EG1) compared to the same materials pretreated with dilute base or AP. An optimized enzyme mixture containing 16 components (by addition of α-glucuronidase, a GH11 endoxylanase [EX2], Cel5A, Cel61A, Cip1, Cip2, β-mannanase, amyloglucosidase, α-arabinosidase, and Cel12A to the core set) was

One-step production of immobilized alpha-amylase in recombinant Escherichia coli.

PubMed

Rasiah, Indira A; Rehm, Bernd H A

2009-04-01

Industrial enzymes are often immobilized via chemical cross-linking onto solid supports to enhance stability and facilitate repeated use in bioreactors. For starch-degrading enzymes, immobilization usually places constraints on enzymatic conversion due to the limited diffusion of the macromolecular substrate through available supports. This study describes the one-step immobilization of a highly thermostable alpha-amylase (BLA) from Bacillus licheniformis and its functional display on the surface of polyester beads inside engineered Escherichia coli. An optimized BLA variant (Termamyl) was N-terminally fused to the polyester granule-forming enzyme PhaC of Cupriavidus necator. The fusion protein lacking the signal sequence mediated formation of stable polyester beads exhibiting alpha-amylase activity. The alpha-amylase beads were assessed with respect to alpha-amylase activity, which was demonstrated qualitatively and quantitatively. The immobilized alpha-amylase showed Michaelis-Menten enzyme kinetics exerting a V(max) of about 506 mU/mg of bead protein with a K(m) of about 5 microM, consistent with that of free alpha-amylase. The stability of the enzyme at 85 degrees C and the capacity for repeated usage in a starch liquefaction process were also demonstrated. In addition, structural integrity and functionality of the beads at extremes of pH and temperature, demonstrating their suitability for industrial use, were confirmed by electron microscopy and protein/enzyme analysis. This study proposes a novel, cost-effective method for the production of immobilized alpha-amylase in a single step by using the polyester granules forming protein PhaC as a fusion partner in engineered E. coli.

Human dipeptidyl peptidase III acts as a post-proline-cleaving enzyme on endomorphins.

PubMed

Barsun, Marina; Jajcanin, Nina; Vukelić, Bojana; Spoljarić, Jasminka; Abramić, Marija

2007-03-01

Dipeptidyl peptidase III (DPP III) is a zinc exopeptidase with an implied role in the mammalian pain-modulatory system owing to its high affinity for enkephalins and localisation in the superficial laminae of the spinal cord dorsal horn. Our study revealed that this human enzyme hydrolyses opioid peptides belonging to three new groups, endomorphins, hemorphins and exorphins. The enzymatic hydrolysis products of endomorphin-1 were separated and quantified by capillary electrophoresis and the kinetic parameters were determined for human DPP III and rat DPP IV. Both peptidases cleave endomorphin-1 at comparable rates, with liberation of the N-terminal Tyr-Pro. This is the first evidence of DPP III acting as an endomorphin-cleaving enzyme.

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

USDA-ARS?s Scientific Manuscript database

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Characterization of a New β(1–3)-Glucan Branching Activity of Aspergillus fumigatus

PubMed Central

Gastebois, Amandine; Mouyna, Isabelle; Simenel, Catherine; Clavaud, Cécile; Coddeville, Bernadette; Delepierre, Muriel; Latgé, Jean-Paul; Fontaine, Thierry

2010-01-01

A new HPLC method was developed to separate linear from β(1–6)-branched β(1–3)-glucooligosaccharides. This methodology has permitted the isolation of the first fungal β(1–6)/β(1–3)-glucan branching transglycosidase using a cell wall autolysate of Aspergillus fumigatus (Af). The encoding gene, AfBGT2 is an ortholog of AfBGT1, another transglycosidase of A. fumigatus previously analyzed (Mouyna, I., Hartland, R. P., Fontaine, T., Diaquin, M., Simenel, C., Delepierre, M., Henrissat, B., and Latgé, J. P. (1998) Microbiology 144, 3171–3180). Both enzymes release laminaribiose from the reducing end of a β(1–3)-linked oligosaccharide and transfer the remaining chain to another molecule of the original substrate. The AfBgt1p transfer occurs at C-6 of the non-reducing end group of the acceptor, creating a kinked β(1–3;1–6) linear molecule. The AfBgt2p transfer takes place at the C-6 of an internal group of the acceptor, resulting in a β(1–3)-linked product with a β(1–6)-linked side branch. The single Afbgt2 mutant and the double Afbgt1/Afbgt2 mutant in A. fumigatus did not display any cell wall phenotype showing that these activities were not responsible for the construction of the branched β(1–3)-glucans of the cell wall. PMID:19948732

The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System

PubMed Central

Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

2018-01-01

β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents. PMID:29755450

The Complexity of Fungal β-Glucan in Health and Disease: Effects on the Mononuclear Phagocyte System.

PubMed

Camilli, Giorgio; Tabouret, Guillaume; Quintin, Jessica

2018-01-01

β-glucan, the most abundant fungal cell wall polysaccharide, has gained much attention from the scientific community in the last few decades for its fascinating but not yet fully understood immunobiology. Study of this molecule has been motivated by its importance as a pathogen-associated molecular pattern upon fungal infection as well as by its promising clinical utility as biological response modifier for the treatment of cancer and infectious diseases. Its immune effect is attributed to the ability to bind to different receptors expressed on the cell surface of phagocytic and cytotoxic innate immune cells, including monocytes, macrophages, neutrophils, and natural killer cells. The characteristics of the immune responses generated depend on the cell types and receptors involved. Size and biochemical composition of β-glucans isolated from different sources affect their immunomodulatory properties. The variety of studies using crude extracts of fungal cell wall rather than purified β-glucans renders data difficult to interpret. A better understanding of the mechanisms of purified fungal β-glucan recognition, downstream signaling pathways, and subsequent immune regulation activated, is, therefore, essential not only to develop new antifungal therapy but also to evaluate β-glucan as a putative anti-infective and antitumor mediator. Here, we briefly review the complexity of interactions between fungal β-glucans and mononuclear phagocytes during fungal infections. Furthermore, we discuss and present available studies suggesting how different fungal β-glucans exhibit antitumor and antimicrobial activities by modulating the biologic responses of mononuclear phagocytes, which make them potential candidates as therapeutic agents.

Enzyme-polymer composites with high biocatalytic activity and stability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jungbae; Kosto, Timothy J.; Manimala, Joseph C.

2004-08-22

We have applied vacuum-spraying and electrospinning to incorporate an enzyme into a polymer matrix, creating a novel and highly active biocatalytic composite. As a unique technical approach, enzymes were co-dissolved in toluene with polymers, and the solvent was then rapidly removed by injecting the mixture into a vacuum chamber or by electrospinning. Subsequent crosslinking of the enzyme with glutaraldehyde resulted in stable entrapped enzyme within the polymeric matrices. For example, an amorphous composite of alpha-chymotrypsin and polyethylene showed no significant loss of enzymatic activity in aqueous buffer for one month. Nanofibers of alpha-chymotrypsin and polystyrene also showed no decrease inmore » activity for more than two weeks. The normalized activity of amorphous composite in organic solvents was 3-13 times higher than that of native alpha-chymotrypsin. The activity of nanofibers was 5-7 times higher than that of amorphous composite in aqueous buffer solution. The composites of alpha-chymotrypsin and polymers demonstrate the feasibility of obtaining a wide variety of active and stable biocatalytic materials with many combinations of enzymes and polymers.« less

Parallel beta/alpha-barrels of alpha-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase versus the barrel of beta-amylase: evolutionary distance is a reflection of unrelated sequences.

PubMed

Janecek, S

1994-10-17

The structures of functionally related beta/alpha-barrel starch hydrolases, alpha-amylase, beta-amylase, cyclodextrin glycosyltransferase and oligo-1,6-glucosidase, are discussed, their mutual sequence similarities being emphasized. Since these enzymes (except for beta-amylase) along with the predicted set of more than ten beta/alpha-barrels from the alpha-amylase enzyme superfamily fulfil the criteria characteristic of the products of divergent evolution, their unrooted distance tree is presented.

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

PubMed

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Effect of salivary gland adenocarcinoma cell-derived alpha-N-acetylgalactosaminidase on the bioactivity of macrophage activating factor.

PubMed

Matsuura, Takashi; Uematsu, Takashi; Yamaoka, Minoru; Furusawa, Kiyofumi

2004-03-01

The aim of this study was to clarify the effects of alpha-N-acetylgalactosaminidase (alpha-NaGalase) produced by human salivary gland adenocarcinoma (SGA) cells on the bioactivity of macrophage-activating factor (GcMAF). High exo-alpha-NaGalase activity was detected in the SGA cell line HSG. HSG alpha-NaGalase had both exo- and endo-enzyme activities, cleaving the Gal-GalNAc and GalNAc residues linked to Thr/Ser but not releasing the [NeuAc2-6]GalNac residue. Furthermore, GcMAF enzymatically prepared from the Gc protein enhanced the superoxide-generation capacity and phagocytic activity of monocytes/macrophages. However, GcMAF treated with purified alpha-NaGalase did not exhibit these effects. Thus, HSG possesses the capacity to produce larger quantities of alpha-NaGalase, which inactivates GcMAF produced from Gc protein, resulting in reduced phagocytic activity and superoxide-generation capacity of monocytes/macrophages. The present data strongly suggest that HSG alpha-NaGalase acts as an immunodeficiency factor in cancer patients.

Interactions between meat proteins and barley (Hordeum spp.) β-glucan within a reduced-fat breakfast sausage system.

PubMed

Morin, L A; Temelli, F; McMullen, L

2004-11-01

Barley β-glucan, a soluble fibre component with health benefits, has the potential to be used as a fat replacer in meat systems. Interactions between meat proteins and β-glucan gum were examined in reduced-fat (12%, w/w) sausages formulated with β-glucan at 0.3% (w/w) (0.3β-gl) and 0.8% (w/w) (0.8β-gl) levels, as well as high- and reduced-fat controls. Cooking loss results indicated that β-glucan gum held more water in cooked sausages than control gum (carboxymethyl cellulose), due to its ability to form a tighter network within the protein matrix, as shown by scanning electron microscopy. In a raw system, β-glucan gum was not as effective at retaining moisture as a stable protein network, formed by heating. Differential scanning calorimetry results showed that sausages with a higher gum to protein ratio required additional energy for protein denaturation to occur. Findings indicate that β-glucan gum increases the amount of moisture held in a cooked meat protein system, due to the physical entrapment of water, when compared to the high-fat control, but is similar to the reduced-fat formulation with added water.

Cellulose Microfibril Formation by Surface-Tethered Cellulose Synthase Enzymes.

PubMed

Basu, Snehasish; Omadjela, Okako; Gaddes, David; Tadigadapa, Srinivas; Zimmer, Jochen; Catchmark, Jeffrey M

2016-02-23

Cellulose microfibrils are pseudocrystalline arrays of cellulose chains that are synthesized by cellulose synthases. The enzymes are organized into large membrane-embedded complexes in which each enzyme likely synthesizes and secretes a β-(1→4) glucan. The relationship between the organization of the enzymes in these complexes and cellulose crystallization has not been explored. To better understand this relationship, we used atomic force microscopy to visualize cellulose microfibril formation from nickel-film-immobilized bacterial cellulose synthase enzymes (BcsA-Bs), which in standard solution only form amorphous cellulose from monomeric BcsA-B complexes. Fourier transform infrared spectroscopy and X-ray diffraction techniques show that surface-tethered BcsA-Bs synthesize highly crystalline cellulose II in the presence of UDP-Glc, the allosteric activator cyclic-di-GMP, as well as magnesium. The cellulose II cross section/diameter and the crystal size and crystallinity depend on the surface density of tethered enzymes as well as the overall concentration of substrates. Our results provide the correlation between cellulose microfibril formation and the spatial organization of cellulose synthases.

Barley β-glucan increases fecal bile acid excretion and short chain fatty acid levels in mildly hypercholesterolemic individuals.

PubMed

Thandapilly, Sijo J; Ndou, Saymore P; Wang, Yanan; Nyachoti, Charles M; Ames, Nancy P

2018-06-20

The cholesterol-lowering effect of barley β-glucan has been proposed to be the result of a pleiotropic effect, which involves several biological mechanisms such as gut fermentation, inhibition of intestinal cholesterol absorption and increased bile acid excretion and its synthesis. However, one of the recent studies from our laboratory indicated that increased bile acid excretion and subsequent increase in its synthesis, but not the inhibition of cholesterol absorption or synthesis might be responsible for the cholesterol-lowering effect of barley β-glucan. Accordingly, the primary objective of the present study was to investigate the concentration of bile acids (BA), neutral sterols (NS) and short chain fatty acids (SCFA) excreted through the feces by mildly hypercholesterolemic subjects who consumed diets containing barley β-glucan with varying molecular weights (MW) and concentrations. In a controlled, four phase, crossover trial, 30 mildly hypercholesterolemic but otherwise healthy subjects were randomly assigned to receive breakfast containing 3 g high MW (HMW), 5 g low MW (LMW), 3 g LMW barley β-glucan or a control diet for 5 weeks. The concentrations of BA, NS and SCFA in the feces were measured at the end of each treatment phase. Compared to the other treatment groups, 3 g day-1 HMW barley β-glucan consumption resulted in increased lithocholic acid (LCA) excretion (P < 0.001) but not LMW β-glucan, even at the high dose of 5 g day-1. Increased fermentability of fibre was also evident from a significant increase in fecal total SCFA concentrations in response to the 3 g HMW β-glucan diet compared to the 3 g LMW barley β-glucan and control diet (P = 0.0015). In summary, the current results validate our previous report on the role of fecal bile acid excretion in cholesterol lowering through the consumption of barley β-glucan. In addition, increased SCFA concentrations indicate that an increase in β-glucan molecular weight promotes hindgut fermentation

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction.

PubMed

Muñoz, Javier; Cortés, Juan Carlos G; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M Belén; Martins, Ivone M; Pérez, Pilar; Ribas, Juan Carlos

2013-10-28

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells.

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

PubMed Central

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

β-Glucans inhibit intracellular growth of Mycobacterium bovis BCG but not virulent Mycobacterium tuberculosis in human macrophages

PubMed Central

Morris, Jessica D.; Rajaram, Murugesan V.S.; Schlesinger, Larry S.

2014-01-01

The yeast polysaccharide, β-glucan, has been shown to promote both anti-microbial and anti-tumor activities through its interaction with macrophages. Here we analyzed the effects of an insoluble whole glucan particle (WGP), a 1,3/1,6-β-glucan from Saccharomyces cerevisiae, and a soluble poly-1-6-β-d-glucopyranosyl-1-3-β-d-glucopyranose (PGG), a hydrolytic product of WGP, on the anti-microbial response of human macrophages against mycobacterial infection. Treatment of macrophages with WGP and PGG significantly decreased cell association and intracellular growth of Mycobacterium bovis BCG, but not Mycobacterium tuberculosis (M.tb) when compared to untreated controls. We characterized the influence of β-glucans on the generation of macrophage oxidative products and pro-inflammatory cytokines, two important anti-microbial defense mechanisms. WGP but not PGG treatment enhanced the oxidative response of macrophages as determined by the 2′,7′-dichlorofluorescin (DCF) assay. WGP treatment also induced macrophages to produce pro-inflammatory cytokines. The β-glucan receptor, Dectin-1, was found to be involved in the WGP-induced macrophage oxidative burst and intracellular growth inhibition of M. bovis BCG. This report indicates that although some forms of β-glucan are able to stimulate the respiratory burst and cytokine production in human macrophages, and exhibit antimicrobial properties against M. bovis BCG, the β-glucans tested here did not inhibit growth of M.tb within human macrophages. PMID:21762773

Aphanomyces euteiches cell wall fractions containing novel glucan-chitosaccharides induce defense genes and nuclear calcium oscillations in the plant host Medicago truncatula.

PubMed

Nars, Amaury; Lafitte, Claude; Chabaud, Mireille; Drouillard, Sophie; Mélida, Hugo; Danoun, Saïda; Le Costaouëc, Tinaig; Rey, Thomas; Benedetti, Julie; Bulone, Vincent; Barker, David George; Bono, Jean-Jacques; Dumas, Bernard; Jacquet, Christophe; Heux, Laurent; Fliegmann, Judith; Bottin, Arnaud

2013-01-01

N-acetylglucosamine-based saccharides (chitosaccharides) are components of microbial cell walls and act as molecular signals during host-microbe interactions. In the legume plant Medicago truncatula, the perception of lipochitooligosaccharide signals produced by symbiotic rhizobia and arbuscular mycorrhizal fungi involves the Nod Factor Perception (NFP) lysin motif receptor-like protein and leads to the activation of the so-called common symbiotic pathway. In rice and Arabidopsis, lysin motif receptors are involved in the perception of chitooligosaccharides released by pathogenic fungi, resulting in the activation of plant immunity. Here we report the structural characterization of atypical chitosaccharides from the oomycete pathogen Aphanomyces euteiches, and their biological activity on the host Medicago truncatula. Using a combination of biochemical and biophysical approaches, we show that these chitosaccharides are linked to β-1,6-glucans, and contain a β-(1,3;1,4)-glucan backbone whose β-1,3-linked glucose units are substituted on their C-6 carbon by either glucose or N-acetylglucosamine residues. This is the first description of this type of structural motif in eukaryotic cell walls. Glucan-chitosaccharide fractions of A. euteiches induced the expression of defense marker genes in Medicago truncatula seedlings independently from the presence of a functional Nod Factor Perception protein. Furthermore, one of the glucan-chitosaccharide fractions elicited calcium oscillations in the nucleus of root cells. In contrast to the asymmetric oscillatory calcium spiking induced by symbiotic lipochitooligosaccharides, this response depends neither on the Nod Factor Perception protein nor on the common symbiotic pathway. These findings open new perspectives in oomycete cell wall biology and elicitor recognition and signaling in legumes.

Aphanomyces euteiches Cell Wall Fractions Containing Novel Glucan-Chitosaccharides Induce Defense Genes and Nuclear Calcium Oscillations in the Plant Host Medicago truncatula

PubMed Central

Nars, Amaury; Lafitte, Claude; Chabaud, Mireille; Drouillard, Sophie; Mélida, Hugo; Danoun, Saïda; Le Costaouëc, Tinaig; Rey, Thomas; Benedetti, Julie; Bulone, Vincent; Barker, David George; Bono, Jean-Jacques; Dumas, Bernard; Jacquet, Christophe; Heux, Laurent; Fliegmann, Judith; Bottin, Arnaud

2013-01-01

N-acetylglucosamine-based saccharides (chitosaccharides) are components of microbial cell walls and act as molecular signals during host-microbe interactions. In the legume plant Medicago truncatula, the perception of lipochitooligosaccharide signals produced by symbiotic rhizobia and arbuscular mycorrhizal fungi involves the Nod Factor Perception (NFP) lysin motif receptor-like protein and leads to the activation of the so-called common symbiotic pathway. In rice and Arabidopsis, lysin motif receptors are involved in the perception of chitooligosaccharides released by pathogenic fungi, resulting in the activation of plant immunity. Here we report the structural characterization of atypical chitosaccharides from the oomycete pathogen Aphanomyces euteiches, and their biological activity on the host Medicago truncatula. Using a combination of biochemical and biophysical approaches, we show that these chitosaccharides are linked to β-1,6-glucans, and contain a β-(1,3;1,4)-glucan backbone whose β-1,3-linked glucose units are substituted on their C-6 carbon by either glucose or N-acetylglucosamine residues. This is the first description of this type of structural motif in eukaryotic cell walls. Glucan-chitosaccharide fractions of A. euteiches induced the expression of defense marker genes in Medicago truncatula seedlings independently from the presence of a functional Nod Factor Perception protein. Furthermore, one of the glucan-chitosaccharide fractions elicited calcium oscillations in the nucleus of root cells. In contrast to the asymmetric oscillatory calcium spiking induced by symbiotic lipochitooligosaccharides, this response depends neither on the Nod Factor Perception protein nor on the common symbiotic pathway. These findings open new perspectives in oomycete cell wall biology and elicitor recognition and signaling in legumes. PMID:24086432

Properties of Streptococcus mutans Grown in a Synthetic Medium: Binding of Glucosyltransferase and In Vitro Adherence, and Binding of Dextran/Glucan and Glycoprotein and Agglutination

PubMed Central

Wu-Yuan, Christine D.; Tai, Stella; Slade, Hutton D.

1979-01-01

The influence of culture media on various properties of Streptococcus mutans was investigated. Strains of S. mutans (serotypes c, d, f, and g) were grown in a complex medium (Todd-Hewitt broth [THB]) or a synthetic medium (SYN). The SYN cells, in contrast to THB cells, did not bind extracellular glucosyltransferase and did not produce in vitro adherence. Both types of cells possessed constitutive levels of glucosyltransferase. B13 cells grown in SYN plus invertase-treated glucose possessed the same level of constitutive enzyme as THB cells. In contrast to THB cells, the SYN cells of seven serotype strains did not agglutinate upon the addition of high-molecular-weight dextran/glucan. Significant quantities of lower-molecular-weight (2 × 104 or 7 × 104) dextran and B13 glucan were bound by SYN cells. SYN cells agglutinated weakly in anti-glucan serum (titers, 0 to 16), whereas THB cells possessed titers of 32 to 256. Evidence for the existence of a second binding site in agglutination which does not possess a glucan-like polymer has been obtained. B13 cells grown in invertase-treated THB agglutinated to the same degree as normal THB cells. The nature of this site is unknown. SYN cells possess the type-specific polysaccharide antigen. B13 cells did not bind from THB a glycoprotein which reacts with antisera to the A, B, or T blood group antigens or which allows agglutination upon the addition of dextran. The results demonstrate that S. mutans grown in a chemically defined medium possesse markedly different biochemical and biological activities than cells grown in a complex organic medium. PMID:457252

Effective production of biologically active water-soluble β-1,3-glucan by a coupled system of Agrobacterium sp. and Trichoderma harzianum.

PubMed

Liang, Ying; Zhu, Li; Gao, Minjie; Wu, Jianrong; Zhan, Xiaobei

2018-05-28

Water-soluble β-1,3-glucan (w-glucan) prepared from curdlan is reported to possess various bioactive and medicinal properties. To develop an efficient and cost-effective microbial fermentation method for the direct production of w-glucan, a coupled fermentation system of Agrobacterium sp. and Trichoderma harzianum (CFS-AT) was established. The effects of Tween-80, glucose flow rate, and the use of a dissolved oxygen (DO) control strategy on w-glucan production were assessed. The addition of 10 g L -1 Tween-80 to the CFS-AT enhanced w-glucan production, presumably by loosening the curdlan ultrastructure and increasing the efficiency of curdlan hydrolysis. A two-stage glucose and DO control strategy was optimal for w-glucan production. At the T. harzianum cell growth stage, the optimal glucose flow rate and agitation speed were 2.0 g L -1 hr -1 and 600 rpm, respectively, and at the w-glucan production stage, they were 0.5 g L -1 hr -1 and 400 rpm, respectively. W-glucan production reached 17.31 g L -1 , with a degree of polymerization of 19-25. Furthermore, w-glucan at high concentrations exhibited anti-tumor activity against MCF-7, HepG2, and Hela cancer cells in vitro. This study provides a novel, cost-effective, eco-friendly, and efficient microbial fermentation method for the direct production of biologically active w-glucan.

Study of the role of epididymal alpha-glucosidase in the fertility of male rats by the administration of the enzyme inhibitor castanospermine.

PubMed

Yeung, C H; Cooper, T G

1994-11-01

The activity of epididymal alpha-glucosidase in adult rats was rapidly suppressed to histochemically undetectable levels within 2 days by the continuous release of the enzyme inhibitor castanospermine via a peritoneal osmotic pump at a rate of 100-200 nmol h-1. It was established that mating activities overnight depleted 72% of the spermatozoa in the distal cauda, which was replenished in 2 days, and that fertility began to decline 3 weeks after efferent duct ligation. Male rats of proven mating proficiency and fertility were treated with castanospermine, or buffered saline as control, for up to 30 days and enzyme inhibition was confirmed at the end of treatment by histochemistry. Fertility was normal at the first mating test on day 7, significantly decreased at the second mating on day 9, but recovered in a stepwise manner at subsequent matings on days 12 and 14. Delaying the third mating until day 25 did not sustain the transient subfertility. However, prolonging sperm storage in the distal cauda epididymides and preventing replenishment with freshly matured spermatozoa, by efferent duct ligation for 14 days performed on day 15 during castanospermine administration, caused a decrease in fertility and a change in the kinematics of epididymal spermatozoa of the castanospermine-treated group. In control rats, binding of epididymal spermatozoa to Vicia faba, a lectin specific for glucose and glucosamine, and mannose and mannosamine residues, decreased from the proximal caput to the distal corpus coincident with the increase in alpha-glucosidase activity on the epithelial brush border. Lectin binding then increased in the cauda where enzyme activity was absent. However, castanospermine treatment did not significantly alter this binding profile. The findings suggest that epididymal alpha-glucosidase does not play a crucial role in the development of sperm fertilizing capacity, but may be involved in the preparation of spermatozoa for storage.

Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur

Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

Comprehensive functional characterization of the Glycoside Hydrolase Family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification

DOE PAGES

Nelson, Cassandra E.; Attia, Mohamed A.; Rogowski, Artur; ...

2017-10-20

Here, lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1!3)/β(1!4) mixed-linkage glucan (MLG), and β(1!3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active Enzymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach we have delineated the physiological roles of the four C. japonicus Glycoside Hydrolase Family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activitymore » profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1!3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1!3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species.« less

Prevalence of sensitization to 'improver' enzymes in UK supermarket bakers.

PubMed

Jones, M; Welch, J; Turvey, J; Cannon, J; Clark, P; Szram, J; Cullinan, P

2016-07-01

Supermarket bakers are exposed not only to flour and alpha-amylase but also to other 'improver' enzymes, the nature of which is usually shrouded by commercial sensitivity. We aimed to determine the prevalence of sensitization to 'improver' enzymes in UK supermarket bakers. We examined the prevalence of sensitization to enzymes in 300 bakers, employed by one of two large supermarket bakeries, who had declared work-related respiratory symptoms during routine health surveillance. Sensitization was determined using radioallergosorbent assay to eight individual enzymes contained in the specific 'improver' mix used by each supermarket. The prevalence of sensitization to 'improver' enzymes ranged from 5% to 15%. Sensitization was far more likely if the baker was sensitized also to either flour or alpha-amylase. The prevalence of sensitization to an 'improver' enzyme did not appear to be related to the concentration of that enzyme in the mix. We report substantial rates of sensitization to enzymes other than alpha-amylase in UK supermarket bakers; in only a small proportion of bakers was there evidence of sensitization to 'improver mix' enzymes without sensitization to either alpha-amylase or flour. The clinical significance of these findings needs further investigation, but our findings indicate that specific sensitization in symptomatic bakers may not be identified without consideration of a wide range of workplace antigens. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Cloning and expression of an alpha-1,3-glucanase gene from Bacillus circulans KA-304: the enzyme participates in protoplast formation of Schizophyllum commune.

PubMed

Yano, Shigekazu; Wakayama, Mamoru; Tachiki, Takashi

2006-07-01

A culture filtrate of Bacillus circulans KA-304 grown on a cell-wall preparation of Schizophyllum commune has an activity to form protoplasts from S. commune mycelia, and a combination of alpha-1,3-glucanase and chitinase I, which were isolated from the filtrate, brings about the protoplast-forming activity. The gene of alpha-1,3-glucanase was cloned from B. circulans KA-304. It consists of 3,879 nucleotides, which encodes 1,293 amino acids including a putative signal peptide (31 amino acid residues), and the molecular weight of alpha-1,3-glucanase without the putative signal peptide was calculated to be 132,184. The deduced amino acid sequence of alpha-1,3-glucanase of B. circulans KA-304 showed approximately 80% similarity to that of mutanase (alpha-1,3-glucanase) of Bacillus sp. RM1, but no significant similarity to those of fungal mutanases. The recombinant alpha-1,3-glucanase was expressed in Escherichia coli Rosetta-gami B (DE 3), and significant alpha-1,3-glucanase activity was detected in the cell-free extract of the organism treated with isopropyl-beta-D-thiogalactopyranoside. The recombinant alpha-1,3-glucanase showed protoplast-forming activity when the enzyme was combined with chitinase I.

Membrane pore architecture of the CslF6 protein controls (1-3,1-4)-β-glucan structure.

PubMed

Jobling, Stephen A

2015-06-01

The cereal cell wall polysaccharide (1-3,1-4)-β-glucan is a linear polymer of glucose containing both β1-3 and β1-4 bonds. The structure of (1-3,1-4)-β-glucan varies between different cereals and during plant growth and development, but little is known about how this is controlled. The cellulose synthase-like CslF6 protein is an integral membrane protein and a major component of the (1-3,1-4)-β-glucan synthase. I show that a single amino acid within the predicted transmembrane pore domain of CslF6 controls (1-3,1-4)-β-glucan structure. A new mechanism for the control of the polysaccharide structure is proposed where membrane pore architecture and the translocation of the growing polysaccharide across the membrane control how the acceptor glucan is coordinated at the active site and thus the proportion of β1-3 and β1-4 bonds within the polysaccharide.

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

Probiotic activity of lignocellulosic enzyme as bioactivator for rice husk degradation

NASA Astrophysics Data System (ADS)

Lamid, Mirni; Al-Arif, Anam; Warsito, Sunaryo Hadi

2017-02-01

The utilization of lignocellulosic enzyme will increase nutritional value of rice husk. Cellulase consists of C1 (β-1, 4-glucan cellobiohydrolase or exo-β-1,4glucanase), Cc (endo-β-1,4-glucanase) and component and cellobiose (β-glucocidase). Hemicellulase enzyme consists of endo-β-1,4-xilanase, β-xilosidase, α-L arabinofuranosidase, α-D-glukuronidaseand asetil xilan esterase. This research aimed to study the activity of lignocellulosic enzyme, produced by cows in their rumen, which can be used as a bioactivator in rice husk degradation. This research resulted G6 and G7 bacteria, producing xylanase and cellulase with the activity of 0.004 U mL-1 and 0.021 U mL-1; 0.003 ( U mL-1) and 0.026 (U mL-1) respectively.

Accurate Quantification of Laminarin in Marine Organic Matter with Enzymes from Marine Microbes.

PubMed

Becker, Stefan; Scheffel, André; Polz, Martin F; Hehemann, Jan-Hendrik

2017-05-01

Marine algae produce a variety of glycans, which fulfill diverse biological functions and fuel the carbon and energy demands of heterotrophic microbes. A common approach to analysis of marine organic matter uses acid to hydrolyze the glycans into measurable monosaccharides. The monosaccharides may be derived from different glycans that are built with the same monosaccharides, however, and this approach does not distinguish between glycans in natural samples. Here we use enzymes to digest selectively and thereby quantify laminarin in particulate organic matter. Environmental metaproteome data revealed carbohydrate-active enzymes from marine flavobacteria as tools for selective hydrolysis of the algal β-glucan laminarin. The enzymes digested laminarin into glucose and oligosaccharides, which we measured with standard methods to establish the amounts of laminarin in the samples. We cloned, expressed, purified, and characterized three new glycoside hydrolases (GHs) of Formosa bacteria: two are endo-β-1,3-glucanases, of the GH16 and GH17 families, and the other is a GH30 exo-β-1,6-glucanase. Formosa sp. nov strain Hel1_33_131 GH30 (FbGH30) removed the β-1,6-glucose side chains, and Formosa agariphila GH17A (FaGH17A) and FaGH16A hydrolyzed the β-1,3-glucose backbone of laminarin. Specificity profiling with a library of glucan oligosaccharides and polysaccharides revealed that FaGH17A and FbGH30 were highly specific enzymes, while FaGH16A also hydrolyzed mixed-linked glucans with β-1,4-glucose. Therefore, we chose the more specific FaGH17A and FbGH30 to quantify laminarin in two cultured diatoms, namely, Thalassiosira weissflogii and Thalassiosira pseudonana , and in seawater samples from the North Sea and the Arctic Ocean. Combined, these results demonstrate the potential of enzymes for faster, stereospecific, and sequence-specific analysis of select glycans in marine organic matter. IMPORTANCE Marine algae synthesize substantial amounts of the glucose polymer

Plant-derived antifungal agent poacic acid targets β-1,3-glucan

DOE PAGES

Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; ...

2015-03-09

A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole.more » The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. In conclusion, the discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates.« less

Plant-derived antifungal agent poacic acid targets β-1,3-glucan

PubMed Central

Piotrowski, Jeff S.; Okada, Hiroki; Lu, Fachuang; Li, Sheena C.; Hinchman, Li; Ranjan, Ashish; Smith, Damon L.; Higbee, Alan J.; Ulbrich, Arne; Coon, Joshua J.; Deshpande, Raamesh; Bukhman, Yury V.; McIlwain, Sean; Ong, Irene M.; Myers, Chad L.; Boone, Charles; Landick, Robert; Ralph, John; Kabbage, Mehdi; Ohya, Yoshikazu

2015-01-01

A rise in resistance to current antifungals necessitates strategies to identify alternative sources of effective fungicides. We report the discovery of poacic acid, a potent antifungal compound found in lignocellulosic hydrolysates of grasses. Chemical genomics using Saccharomyces cerevisiae showed that loss of cell wall synthesis and maintenance genes conferred increased sensitivity to poacic acid. Morphological analysis revealed that cells treated with poacic acid behaved similarly to cells treated with other cell wall-targeting drugs and mutants with deletions in genes involved in processes related to cell wall biogenesis. Poacic acid causes rapid cell lysis and is synergistic with caspofungin and fluconazole. The cellular target was identified; poacic acid localized to the cell wall and inhibited β-1,3-glucan synthesis in vivo and in vitro, apparently by directly binding β-1,3-glucan. Through its activity on the glucan layer, poacic acid inhibits growth of the fungi Sclerotinia sclerotiorum and Alternaria solani as well as the oomycete Phytophthora sojae. A single application of poacic acid to leaves infected with the broad-range fungal pathogen S. sclerotiorum substantially reduced lesion development. The discovery of poacic acid as a natural antifungal agent targeting β-1,3-glucan highlights the potential side use of products generated in the processing of renewable biomass toward biofuels as a source of valuable bioactive compounds and further clarifies the nature and mechanism of fermentation inhibitors found in lignocellulosic hydrolysates. PMID:25775513

Interaction between chitosan and its related enzymes: A review.

PubMed

Shinya, Shoko; Fukamizo, Tamo

2017-11-01

Chitosan-related enzymes including chitosanases, exo-β-glucosaminidases, and enzymes having chitosan-binding modules recognize ligands through electrostatic interactions between the acidic amino acids in proteins and amino groups of chitosan polysaccharides. However, in GH8 chitosanases, several aromatic residues are also involved in substrate recognition through stacking interactions, and these enzymes consequently hydrolyze β-1,4-glucan as well as chitosan. The binding grooves of these chitosanases are extended and opened at both ends of the grooves, so that the enzymes can clamp a long chitosan polysaccharide. The association/dissociation of positively charged glucosamine residues to/from the binding pocket of a GH2 exo-β-glucosaminidase controls the p K a of the catalytic acid, thereby maintaining the high catalytic potency of the enzyme. In contrast to chitosanases, chitosan-binding modules only accommodate a couple of glucosamine residues, predominantly recognizing the non-reducing end glucosamine residue of chitosan by electrostatic interactions and a hydrogen-bonding network. These structural findings on chitosan-related enzymes may contribute to future applications for the efficient conversion of the chitin/chitosan biomass. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

NASA Astrophysics Data System (ADS)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

PubMed

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

PubMed Central

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Alkaline peroxide pretreatment of corn stover: effects of biomass, peroxide, and enzyme loading and composition on yields of glucose and xylose

PubMed Central

2011-01-01

Background Pretreatment is a critical step in the conversion of lignocellulose to fermentable sugars. Although many pretreatment processes are currently under investigation, none of them are entirely satisfactory in regard to effectiveness, cost, or environmental impact. The use of hydrogen peroxide at pH 11.5 (alkaline hydrogen peroxide (AHP)) was shown by Gould and coworkers to be an effective pretreatment of grass stovers and other plant materials in the context of animal nutrition and ethanol production. Our earlier experiments indicated that AHP performed well when compared against two other alkaline pretreatments. Here, we explored several key parameters to test the potential of AHP for further improvement relevant to lignocellulosic ethanol production. Results The effects of biomass loading, hydrogen peroxide loading, residence time, and pH control were tested in combination with subsequent digestion with a commercial enzyme preparation, optimized mixtures of four commercial enzymes, or optimized synthetic mixtures of pure enzymes. AHP pretreatment was performed at room temperature (23°C) and atmospheric pressure, and after AHP pretreatment the biomass was neutralized with HCl but not washed before enzyme digestion. Standard enzyme digestion conditions were 0.2% glucan loading, 15 mg protein/g glucan, and 48 h digestion at 50°C. Higher pretreatment biomass loadings (10% to 20%) gave higher monomeric glucose (Glc) and xylose (Xyl) yields than the 2% loading used in earlier studies. An H2O2 loading of 0.25 g/g biomass was almost as effective as 0.5 g/g, but 0.125 g/g was significantly less effective. Optimized mixtures of four commercial enzymes substantially increased post-AHP-pretreatment enzymatic hydrolysis yields at all H2O2 concentrations compared to any single commercial enzyme. At a pretreatment biomass loading of 10% and an H2O2 loading of 0.5 g/g biomass, an optimized commercial mixture at total protein loadings of 8 or 15 mg/g glucan gave

Enhanced Release of Immunostimulating β-1,3- Glucan by Autodigestion of the Lingzhi Medicinal Mushroom, Ganoderma lingzhi (Agaricomycetes).

PubMed

Ishimoto, Yuina; Ishibashi, Ken-Ichi; Yamanaka, Daisuke; Adachi, Yoshiyuki; Ito, Hisatomi; Igami, Kentaro; Miyazaki, Toshitsugu; Ohno, Naohito

2017-01-01

Ganoderma lingzhi is a widely used medicinal mushroom that has antioxidative effects, ameliorates insulin resistance, and improves quality of life in patients with metabolic syndrome. Potentiation of immunity is also a major function of G. lingzhi, and this has been applied in patients with cancer. Supplementing G. lingzhi into foods reduced the metastasis of cancer cells. β-l,3-glucan is an important bioactive component of G. lingzhi. In this study we enhanced the solubilization ofimmunostimulating β-l,3-glucan by autodigestion of G. lingzhi. Fruiting bodies of G. lingzhi were disrupted and suspended in distilled water, then autodigested at 37°C for 24 hours. The resulting suspension was dried by spray drying. To assess the solubilization of β-l,3-glucan by autodigestion, cold and hot water extracts and sodium hydroxide extracts of G. lingzhi were prepared with and without autodigestion. Sodium hydroxide extracts were neutralized and dialyzed against distilled water. The resulting soluble and precipitated fractions were collected. Chemical, biochemical, and immunochemical characteristics of the extracts were compared. The yields of cold water extracts of autodigested and native G. lingzhi were significantly lower than the other extracts. Glucose was the major sugar component of the hot water extract, cold alkali extract (CAS), and the cold hydroxide extract insoluble in neutral aqueous condition (CASP) of the autodigested and native G. lingzhi. Nuclear magnetic resonance analysis revealed branched β-glucans in the hot water extract and CAS of the autodigested and native G. lingzhi. By contrast, the CASP of the autodigested and native G. lingzhi comprised mainly mixtures of linear α-l,3-glucans and linear β-l,3-glucans. Immunostimulation by β-l,3-glucan was examined by limulus factor G activation, dectin-1 binding, and anti-β-glucan antibody binding. Comparing relative activity, immunostimulating β-l,3-glucan was detected in the hot water extract, rather

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

PubMed Central

Soto, Ernesto R.; O'Connell, Olivia; Dikengil, Fusun; Peters, Paul J.; Clapham, Paul R.

2016-01-01

Glucan particles (GPs) are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae). The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles) encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles. PMID:27965897

NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6)-glucan from Aureobasidium pullulans.

PubMed

Kono, Hiroyuki; Kondo, Nobuhiro; Hirabayashi, Katsuki; Ogata, Makoto; Totani, Kazuhide; Ikematsu, Shinya; Osada, Mitsumasa

2017-10-15

An unambiguous structural characterization of the water-soluble Aureobasidium pullulans β-(1→3, 1→6)-glucan is yet to be achieved, although this β-(1→3, 1→6)-glucan is expected to exhibit excellent biofunctional properties. Thus, we herein report the elucidation of the primary structure of the A. pullulans β-(1→3, 1→6)-glucan using nuclear magnetic resonance spectroscopy, followed by comparison of the obtained structure with that of schizophyllan (SPG). Structural characterization of the A. pullulans β-(1→3, 1→6)-glucan revealed that the structural units are a β-(1→3)-d-glucan backbone with four β-(1→6)-d-glucosyl side branching units every six residues. In addition, circular dichroism spectroscopic analysis revealed that the β-(1→3, 1→6)-glucan interacted with polyadenylic acid (poly(A)) chains in DMSO solution to form a complex similar to that obtained in the complexation of SPG/poly(A). This finding indicates that β-(1→3, 1→6)-glucan forms a triple-helical conformation in aqueous solution but exhibits a random coil structure in DMSO solution, which is similar to the behavior of SPG. Copyright © 2017 Elsevier Ltd. All rights reserved.

Quantitative evaluation of 1,3,1,6 β-D-glucan contents in wild-growing species of edible Polish mushrooms

PubMed

Mirończuk-Chodakowska, Iwona; Witkowska, Anna Maria; Zujko, Małgorzata Elżbieta; Terlikowska, Katarzyna Maria

Macrofungal β-glucans are mainly represented by compounds with β-1,3- and β-1,6 glycosidic bonds. They have been shown to have immunomodulatory, anticancer, and antioxidant properties. Although there are many reports on the bioactivity and structure of fungal glucans, studies on the quantitative assessment of these compounds are sparse. The aim of the study was to determine total β-glucans and 1,3-1,6-β-D-glucan contents in selected species of wild-growing edible Polish mushrooms. Eight species of wild-growing edible mushrooms Boletus pinophilus, Hydnum repandum, Craterellus cornucopioides, Suillus variegatus, Suillus granulatus, Gyroporus cyanescens, Tricholomopsis rutilans, and Auricularia auricula-judae and one species of cultivated mushroom for comparison purposes Agaricus bisporus, were analyzed. Quantitative analysis of 1,3-1,6-β-D-glucans was done using a colorimetric method in accordance with Nitschke et al. Mean total β-glucan content varied from 13.5 g/100 g dry mass in A. bisporus (portobello variety) to 40.9 g/100 g dry mass in T. rutilans. Mean 1,3-1,6-β-D-glucan content in the analyzed fruiting bodies ranged from 3.9 g/100 g dry mass in Agaricus bisporus (cremini) to 16.8 g/100 g dry mass in Auricularia auricula-judae (wood ear). The following mushrooms demonstrated the greatest percentage of 1,3-1,6-β-D-glucan contents in relation to the total β-glucan content: Gyroporus cyanescens (54%), Suillus granulatus (49.8%), Auricularia auricula-judae (47.9%), and Suillus variegatus (40.6%). Among the analyzed species, wild-growing mushrooms had a generally higher average 1,3-1,6-β-Dglucan content compared with cultivated mushrooms such as A. bisporus. The highest average content of these polysaccharides was observed in medicinal mushroom Auricularia auricula-judae. Comparable 1,3-1,6-β-D-glucan content, in relation to this mushroom species, was found in Gyroporus cyanescens, Suillus granulatus and Suillus variegatus, which points to the

Role of protein conformational mobility in enzyme catalysis: acylation of alpha-chymotrypsin by specific peptide substrates.

PubMed

Hengge, Alvan C; Stein, Ross L

2004-01-27

To probe the mechanistic origins of convex Eyring plots that have been observed for alpha-chymotrypsin (alpha-CT)-catalyzed hydrolysis of specific p-nitroanilide substrates [Case, A., and Stein, R. L. (2003) Biochemistry 42, 3335-3348], we determined the temperature-dependence of (15)N-kinetic isotope effects for the alpha-CT-catalyzed hydrolysis of N-succinyl-Phe p-nitroanilide (Suc-Phe-pNA). To provide an interpretational context for these enzymatic isotope effects, we also determined 15N-KIE for alkaline hydrolysis of p-nitroacetanilide. In 0.002 and 2 N hydroxide (30 degrees C), 15N-KIE values are 1.035 and 0.995 (+/-0.001), respectively, and are consistent with the reported [HO-]-dependent change in rate-limiting step from leaving group departure from an anionic tetrahedral intermediate in dilute base, to hydroxide attack in concentrated base. For the alpha-CT-catalyzed hydrolysis of Suc-Phe-pNA, 15N-KIE is on kc/Km and thus reflects structural features of transition states for all reaction steps up to and including acylation of the active site serine. The isotope effect at 35 degrees C is 1.014 (+/-0.001) and suggests that in the transition state for this reaction, departure of leaving group from the tetrahedral intermediate is well advanced. Significantly, 15N-KIE does not vary over the temperature range 5-45 degrees C. This result eliminates one of the competing hypotheses for the convex Eyring plot observed for this reaction, that is, a temperature-dependent change in rate-limiting step within the chemical manifold of acylation, but supports a mechanism in which an isomerization of enzyme conformation is coupled to active site chemistry. We finally suggest that the near absolute temperature-independence of 15N-KIE may point to a unique transition state for this process.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

PubMed Central

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Pulmonary α-1,3-Glucan-Specific IgA-Secreting B Cells Suppress the Development of Cockroach Allergy1

PubMed Central

Patel, Preeyam S.; King, R. Glenn; Kearney, John F.

2016-01-01

There is a higher incidence of allergic conditions among children living in industrialized countries than those in developing regions. One explanation for this is reduced neonatal exposure to microbes and the consequent lack of immune stimulation. Sensitivity to cockroach allergen is highly correlated with the development of severe asthma. In this study, we determined that an antibody to microbial α-1,3-glucan binds an Enterobacter species and cockroach allergen. Neonatal, but not adult, mice immunized with this α-1,3-glucan-bearing Enterobacter (MK7) are protected against cockroach allergy. Following exposure to cockroach allergen, α-1,3-glucan-specific IgA-secreting cells are present in the lungs of mice immunized with MK7 as neonates, but not in the lungs of those immunized as adults. Mice that are unable to generate anti-α-1,3-glucan IgA antibodies were immunized with MK7 as neonates and were no longer protected against cockroach allergy. Thus, neonatal, but not adult, exposure to α-1,3-glucan results in suppressed development of cockroach allergy via pulmonary α-1,3-glucan-specific IgA-secreting cells. PMID:27581173

Effect of natural flocculants on purity and properties of β-glucan extracted from barley and oat.

PubMed

Kurek, Marcin Andrzej; Karp, Sabina; Stelmasiak, Adrian; Pieczykolan, Ewelina; Juszczyk, Karolina; Rieder, Anne

2018-05-15

In this study, β-glucan was extracted from wholegrain oat and barley flours by a novel extraction and purification method employing natural flocculants (chitosan, guar gum and gelatin). The use of flocculants decreased the total amount of extracted gum, which was highest in control samples (9.07 and 7.9% for oat and barley, respectively). The β-glucan specific yield, however, increased with the use of chitosan and guar gum, which were able to remove protein and ash impurities resulting in gums with a higher purity.The highest concentration of chitosan (0.6 %) resulted in gums with the highest β-glucan content (82.0 ± 0.23 and 79.0 ± 0.19 for barley and oat, respectively) and highest β-glucan specific yield (96.9 and 93.3 % for oat and barley, respectively). Explanation is in R&D section. The use of gelatin was not successful. All gum samples had a high content of total dietary fiber (>74%) and a high water holding capacity (4.6-7.4 g/g), but differed in apparent viscosity, which was highest for the oat sample extracted with 0.6% chitosan. This sample also showed the highest β-glucan molecular weight among the oat samples, which were in general 10-fold higher than for the barley samples. Among the barley samples, β-glucan molecular weight was highest for the control. Copyright © 2018 Elsevier Ltd. All rights reserved.

β-1,3-Glucans are components of brown seaweed (Phaeophyceae) cell walls.

PubMed

Raimundo, Sandra Cristina; Pattathil, Sivakumar; Eberhard, Stefan; Hahn, Michael G; Popper, Zoë A

2017-03-01

LAMP is a cell wall-directed monoclonal antibody (mAb) that recognizes a β-(1,3)-glucan epitope. It has primarily been used in the immunolocalization of callose in vascular plant cell wall research. It was generated against a brown seaweed storage polysaccharide, laminarin, although it has not often been applied in algal research. We conducted in vitro (glycome profiling of cell wall extracts) and in situ (immunolabeling of sections) studies on the brown seaweeds Fucus vesiculosus (Fucales) and Laminaria digitata (Laminariales). Although glycome profiling did not give a positive signal with the LAMP mAb, this antibody clearly detected the presence of the β-(1,3)-glucan in situ, showing that this epitope is a constituent of these brown algal cell walls. In F. vesiculosus, the β-(1,3)-glucan epitope was present throughout the cell walls in all thallus parts; in L. digitata, the epitope was restricted to the sieve plates of the conductive elements. The sieve plate walls also stained with aniline blue, a fluorochrome used as a probe for callose. Enzymatic digestion with an endo-β-(1,3)-glucanase removed the ability of the LAMP mAb to label the cell walls. Thus, β-(1,3)-glucans are structural polysaccharides of F. vesiculosus cell walls and are integral components of the sieve plates in these brown seaweeds, reminiscent of plant callose.

Supplementation of a high-carbohydrate breakfast with barley beta-glucan improves postprandial glycaemic response for meals but not beverages.

PubMed

Poppitt, Sally D; van Drunen, Jenneke D E; McGill, Anne-Thea; Mulvey, Tom B; Leahy, Fiona E

2007-01-01

There is growing support for the protective role of soluble fibre in type II diabetes. Soluble fibre beta-glucan found in cereal products including oats and barley may be the active component. There is evidence of postprandial blunting of blood glucose and insulin responses to dietary carbohydrates when oat soluble fibre is supplemented into the diet but few trials have been carried out using natural barley or enriched barley beta-glucan products. The aim of this trial was to investigate the postprandial effect of a highly enriched barley beta -glucan product on blood glucose, insulin and lipids when given with a high-CHO food and a high-CHO drink. 18 lean, healthy men completed a 4 treatment intervention trial comprising (i) high-CHO(food control), (ii) high-CHO(food+fibre), (iii) high-CHO(drink control), (iv) high-CHO(drink+fibre) where a 10g dose of barley beta-glucan fibre supplement (Cerogen) containing 6.31g beta-glucan was added to food and drink controls. There was an increase of glucose and insulin following all 4 treatments. Addition of the beta -glucan supplement significantly blunted the glycaemic and insulinaemic responses on the food (p<0.05) but not drink (p>0.05) treatments when compared to controls. The high-CHO breakfasts decreased total, LDL- and HDL-cholesterol from baseline to 60 mins postprandially but there were no differential effects of beta-glucan treatment on circulating lipids. We conclude that a high dose barley beta-glucan supplement can improve glucose control when added to a high-CHO starchy food, probably due to increased gastro-intestinal viscosity, but not when added to a high-CHO beverage where rapid absorption combined with decreased beta-glucan concentration and viscosity may obviate this mechanism.

Dendritic Cell Activation by Glucan Isolated from Umbilicaria Esculenta

PubMed Central

Kim, Hyung Sook; Kim, Jee Youn; Lee, Hong Kyung; Kim, Moo Sung; Lee, Sang Rin; Kang, Jong Soon; Kim, Hwan Mook; Lee, Kyung-Ae; Hong, Jin Tae; Kim, Youngsoo

2010-01-01

Background Lichen-derived glucans have been known to stimulate the functions of immune cells. However, immunostimulatory activity of glucan obtained from edible lichen, Umbilicaria esculenta, has not been reported. Thus we evaluated the phenotype and functional maturation of dendritic cells (DCs) following treatment of extracted glucan (PUE). Methods The phenotypic and functional maturation of PUE-treated DCs was assessed by flow cytometric analysis and cytokine production, respectively. PUE-treated DCs was also used for mixed leukocyte reaction to evaluate T cell-priming capacity. Finally we detected the activation of MAPK and NF-κB by immunoblot. Results Phenotypic maturation of DCs was shown by the elevated expressions of CD40, CD80, CD86, and MHC class I/II molecules. Functional activation of DCs was proved by increased cytokine production of IL-12, IL-1β, TNF-α, and IFN-α/β, decreased endocytosis, and enhanced proliferation of allogenic T cells. Polymyxin B, specific inhibitor of lipopolysaccharide (LPS), did not affect PUE activity, which suggested that PUE was free of LPS contamination. As a mechanism of action, PUE increased phosphorylation of ERK, JNK, and p38 MAPKs, and enhanced nuclear translocation of NF-κB p50/p65 in DCs. Conclusion These results indicate that PUE induced DC maturation via MAPK and NF-κB signaling pathways. PMID:21286379

Alpha-amylase from the Hyperthermophilic Archaeon Thermococcus thioreducens

NASA Technical Reports Server (NTRS)

Bernhardsdotter, E. C. M. J.; Pusey, M. L.; Ng, M. L.; Garriott, O. K.

2003-01-01

Extremophiles are microorganisms that thrive in, from an anthropocentric view, extreme environments such as hot springs. The ability of survival at extreme conditions has rendered enzymes from extremophiles to be of interest in industrial applications. One approach to producing these extremozymes entails the expression of the enzyme-encoding gene in a mesophilic host such as E.coli. This method has been employed in the effort to produce an alpha-amylase from a hyperthermophile (an organism that displays optimal growth above 80 C) isolated from a hydrothermal vent at the Rainbow vent site in the Atlantic Ocean. alpha-amylases catalyze the hydrolysis of starch to produce smaller sugars and constitute a class of industrial enzymes having approximately 25% of the enzyme market. One application for thermostable alpha-amylases is the starch liquefaction process in which starch is converted into fructose and glucose syrups. The a-amylase encoding gene from the hyperthermophile Thermococcus thioreducens was cloned and sequenced, revealing high similarity with other archaeal hyperthermophilic a-amylases. The gene encoding the mature protein was expressed in E.coli. Initial characterization of this enzyme has revealed an optimal amylolytic activity between 85-90 C and around pH 5.3-6.0.

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

PubMed

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

β-(1 → 3)-Glucanolytic yeasts from Brazilian grape microbiota: production and characterization of β-glucanolytic enzymes by Aureobasidium pullulans 1WA1 cultivated on fungal Mycelium.

PubMed

Bauermeister, Anelize; Amador, Ismael R; Pretti, Carla P; Giese, Ellen C; Oliveira, André L M

2015-01-14

A total of 95 yeast strains were isolated from the microbiota of different grapes collected at vineyards in southern Brazil. The yeasts were screened for β-(1 → 3)-glucanases using a newly developed zymogram method that relies upon the appearance of clearance zones around growing colonies cultured on agar–botryosphaeran medium and also by submerged fermentation on nutrient medium containing botryosphaeran, a (1 → 3),(1 → 6)-β-d-glucan. Among 14 β-(1 → 3)-glucanase-positive yeasts identified, four strains produced the highest β-glucanolytic activities and were evaluated for enzyme production on cellobiose, botryosphaeran, and mycelial biomass from Botryosphaeria rhodina (MAMB-05). Yeast strain 1WA1 produced the highest β-(1 → 3)-glucanase and β-glucosidase activities and was identified by molecular characterization as Aureobasidium pullulans. The physicochemical properties of the crude β-glucanolytic enzyme preparation were characterized, and the preparation was used to hydrolyze several β-d-glucans (laminarin, botryosphaeran, lasiodiplodan, pustulan, and curdlan). The production and physicochemical properties of the β-glucanolytic preparation enable its potential applications in wine enology and production of prebiotics through hydrolysis of β-d-glucans.

Crosslinked Enzyme Aggregates in Hierarchically-Ordered Mesoporous Silica: A Simple and Effective Method for Enzyme Stabilization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Moon Il; Kim, Jungbae; Lee, Jinwoo

2007-02-01

alpha-chymotrypsin (CT) and lipase (LP) were immobilized in hierarchically-ordered mesocellular mesoporous silica (HMMS) in a simple but effective way for the enzyme stabilization, which was achieved by the enzyme adsorption followed by glutaraldehyde (GA) crosslinking. This resulted in the formation of nanometer scale crosslinked enzyme aggregates (CLEAs) entrapped in the mesocellular pores of HMMS (37 nm), which did not leach out of HMMS through narrow mesoporous channels (13 nm). CLEA of alpha-chymotrypsin (CLEA-CT) in HMMS showed a high enzyme loading capacity and significantly increased enzyme stability. No activity decrease of CLEA-CT was observed for two weeks under even rigorously shakingmore » condition, while adsorbed CT in HMMS and free CT showed a rapid inactivation due to the enzyme leaching and presumably autolysis, respectively. With the CLEA-CT in HMMS, however, there was no tryptic digestion observed suggesting that the CLEA-CT is not susceptible to autolysis. Moreover, CLEA of lipase (CLEA-LP) in HMMS retained 30% specific activity of free lipase with greatly enhanced stability. This work demonstrates that HMMS can be efficiently employed as host materials for enzyme immobilization leading to highly enhanced stability of the immobilized enzymes with high enzyme loading and activity.« less

Extremely thermophilic microorganisms for biomass conversion: status and prospects.

PubMed

Blumer-Schuette, Sara E; Kataeva, Irina; Westpheling, Janet; Adams, Michael Ww; Kelly, Robert M

2008-06-01

Many microorganisms that grow at elevated temperatures are able to utilize a variety of carbohydrates pertinent to the conversion of lignocellulosic biomass to bioenergy. The range of substrates utilized depends on growth temperature optimum and biotope. Hyperthermophilic marine archaea (T(opt)>or=80 degrees C) utilize alpha- and beta-linked glucans, such as starch, barley glucan, laminarin, and chitin, while hyperthermophilic marine bacteria (T(opt)>or=80 degrees C) utilize the same glucans as well as hemicellulose, such as xylans and mannans. However, none of these organisms are able to efficiently utilize crystalline cellulose. Among the thermophiles, this ability is limited to a few terrestrial bacteria with upper temperature limits for growth near 75 degrees C. Deconstruction of crystalline cellulose by these extreme thermophiles is achieved by 'free' primary cellulases, which are distinct from those typically associated with large multi-enzyme complexes known as cellulosomes. These primary cellulases also differ from the endoglucanases (referred to here as 'secondary cellulases') reported from marine hyperthermophiles that show only weak activity toward cellulose. Many extremely thermophilic enzymes implicated in the deconstruction of lignocellulose can be identified in genome sequences, and many more promising biocatalysts probably remain annotated as 'hypothetical proteins'. Characterization of these enzymes will require intensive effort but is likely to generate new opportunities for the use of renewable resources as biofuels.

Neurospora crassa 1,3-α-glucan synthase, AGS-1, is required for cell wall biosynthesis during macroconidia development

PubMed Central

Fu, Ci; Tanaka, Asuma

2014-01-01

The Neurospora crassa genome encodes two 1,3-α-glucan synthases. One of these 1,3-α-glucan synthase genes, ags-1, was shown to be required for the synthesis of 1,3-α-glucan in the aerial hyphae and macroconidia cell walls. 1,3-α-Glucan was found in the conidia cell wall, but was absent from the vegetative hyphae cell wall. Deletion of ags-1 affected conidial development. Δags-1 produced only 5 % as many conidia as the WT and most of the conidia produced by Δags-1 were not viable. The ags-1 upstream regulatory elements were shown to direct cell-type-specific expression of red fluorescent protein in conidia and aerial hyphae. A haemagglutinin-tagged AGS-1 was found to be expressed in aerial hyphae and conidia. The research showed that 1,3-α-glucan is an aerial hyphae and conidia cell wall component, and is required for normal conidial differentiation. PMID:24847001

Effect of barley β-glucan addition as a fat replacer on muffin quality.

PubMed

Onacik-Gür, Sylwia; Żbikowska, Anna; Kapler, Ewa; Kowalska, Hanna

2016-01-01

The aim of this study was to perform the partial replacement of bakery fat with barley β-glucan in muffins and to determine its effect on the physical properties of products. Most shortenings used in the industry are solid fats rich in saturated fatty acids and often trans fatty isomers, which are nutritionally unfavorable. Dough and baked muffins were used as the research material. Five muffin recipes were prepared: control (K0%) with 16% fat content in the total dough weight, with fat content decreased by 10% (PG10%), 15% (PG15%), 20% (PG20%) and 25% (PG25%). β-glucan was used as a fat replacer in the 1:4 ratio. The parameters determining the physical characteristics and sensory attributes were measured, compared and statistically analyzed using a principal component analysis (PCA) method. Although the partial replacement of shortening with barley β-glucan is possible, it may negatively influence the physical properties of dough (aeration) and baked products (volume, density). It has been observed that increasing the content of this fat replacer enlarges the pores of the crumb. The textural properties of muffins with a fat content decreased by 20% are most similar to the control. Moreover, it has been shown that the overall sensory quality goes down when the amount of fat replacer in the muffin recipe is increased. However, adding β-glucan to products in which fat content was decreased by 10% did not influence significantly the typical taste. Despite the adverse effect of β-glucan on the physical and sensorial properties, it was found to be reasonable to use it even in small amounts (up to 10%) to increase the nutritional value of products.

Enzyme replacement therapy for Fabry disease: lessons from two alpha-galactosidase A orphan products and one FDA approval.

PubMed

Desnick, Robert J

2004-07-01

Two virtually identical products have been developed for enzyme replacement therapy for the treatment of Fabry disease, which is a rare and debilitating genetic disease caused by decreased activity of the lysosomal enzyme alpha-galactosidase A. Lack of this enzyme results in progressive tissue accumulation of globotriaosylceramide (GL-3), resulting in life-threatening renal, cardiac and cerebrovascular complications. Both enzyme replacement products, agalsidase alfa (Replagal; Transkaryotic Therapies, Cambridge, MA, USA) and agalsidase beta (Fabrazyme; Genzyme Corporation, Cambridge, MA, USA), were approved by the European Agency for the Evaluation of Medicinal Products in 2001; agalsidase alfa at a recommended dose of 0.2 mg/kg and agalsidase beta at a recommended dose of 1 mg/kg. In the US, however, orphan drug laws dictated that only one of these products could be approved. In April 2003, after a rigorous evaluation of both products by the US FDA, this approval was granted to agalsidase beta. This decision reflected clinical trial design, how dosages were determined, antibody effects and the ability of each product to demonstrate either clinical efficacy or reduction of tissue storage of GL-3 in major organs of pathology when administered at the recommended dosage. The process also highlighted important issues in the evaluation of drugs to treat life-threatening genetic diseases for which the pathological basis is well-defined.

alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

PubMed

Berg, Thomas; Hopwood, John J

2002-03-16

alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

GENPLAT: an Automated Platform for Biomass Enzyme Discovery and Cocktail Optimization

PubMed Central

Walton, Jonathan; Banerjee, Goutami; Car, Suzana

2011-01-01

The high cost of enzymes for biomass deconstruction is a major impediment to the economic conversion of lignocellulosic feedstocks to liquid transportation fuels such as ethanol. We have developed an integrated high throughput platform, called GENPLAT, for the discovery and development of novel enzymes and enzyme cocktails for the release of sugars from diverse pretreatment/biomass combinations. GENPLAT comprises four elements: individual pure enzymes, statistical design of experiments, robotic pipeting of biomass slurries and enzymes, and automated colorimeteric determination of released Glc and Xyl. Individual enzymes are produced by expression in Pichia pastoris or Trichoderma reesei, or by chromatographic purification from commercial cocktails or from extracts of novel microorganisms. Simplex lattice (fractional factorial) mixture models are designed using commercial Design of Experiment statistical software. Enzyme mixtures of high complexity are constructed using robotic pipeting into a 96-well format. The measurement of released Glc and Xyl is automated using enzyme-linked colorimetric assays. Optimized enzyme mixtures containing as many as 16 components have been tested on a variety of feedstock and pretreatment combinations. GENPLAT is adaptable to mixtures of pure enzymes, mixtures of commercial products (e.g., Accellerase 1000 and Novozyme 188), extracts of novel microbes, or combinations thereof. To make and test mixtures of ˜10 pure enzymes requires less than 100 μg of each protein and fewer than 100 total reactions, when operated at a final total loading of 15 mg protein/g glucan. We use enzymes from several sources. Enzymes can be purified from natural sources such as fungal cultures (e.g., Aspergillus niger, Cochliobolus carbonum, and Galerina marginata), or they can be made by expression of the encoding genes (obtained from the increasing number of microbial genome sequences) in hosts such as E. coli, Pichia pastoris, or a filamentous fungus such

GENPLAT: an automated platform for biomass enzyme discovery and cocktail optimization.

PubMed

Walton, Jonathan; Banerjee, Goutami; Car, Suzana

2011-10-24

The high cost of enzymes for biomass deconstruction is a major impediment to the economic conversion of lignocellulosic feedstocks to liquid transportation fuels such as ethanol. We have developed an integrated high throughput platform, called GENPLAT, for the discovery and development of novel enzymes and enzyme cocktails for the release of sugars from diverse pretreatment/biomass combinations. GENPLAT comprises four elements: individual pure enzymes, statistical design of experiments, robotic pipeting of biomass slurries and enzymes, and automated colorimeteric determination of released Glc and Xyl. Individual enzymes are produced by expression in Pichia pastoris or Trichoderma reesei, or by chromatographic purification from commercial cocktails or from extracts of novel microorganisms. Simplex lattice (fractional factorial) mixture models are designed using commercial Design of Experiment statistical software. Enzyme mixtures of high complexity are constructed using robotic pipeting into a 96-well format. The measurement of released Glc and Xyl is automated using enzyme-linked colorimetric assays. Optimized enzyme mixtures containing as many as 16 components have been tested on a variety of feedstock and pretreatment combinations. GENPLAT is adaptable to mixtures of pure enzymes, mixtures of commercial products (e.g., Accellerase 1000 and Novozyme 188), extracts of novel microbes, or combinations thereof. To make and test mixtures of ˜10 pure enzymes requires less than 100 μg of each protein and fewer than 100 total reactions, when operated at a final total loading of 15 mg protein/g glucan. We use enzymes from several sources. Enzymes can be purified from natural sources such as fungal cultures (e.g., Aspergillus niger, Cochliobolus carbonum, and Galerina marginata), or they can be made by expression of the encoding genes (obtained from the increasing number of microbial genome sequences) in hosts such as E. coli, Pichia pastoris, or a filamentous fungus such

Dectin-1 Activation by a Natural Product β-Glucan Converts Immunosuppressive Macrophages into an M1-like Phenotype

PubMed Central

Liu, Min; Luo, Fengling; Ding, Chuanlin; Albeituni, Sabrin; Hu, Xiaoling; Ma, Yunfeng; Cai, Yihua; McNally, Lacey; Sanders, Mary Ann; Jain, Dharamvir; Kloecker, Goetz; Bousamra, Michael; Zhang, Huang-ge; Higashi, Richard M.; Lane, Andrew N.; Fan, Teresa W-M.; Yan, Jun

2015-01-01

Tumor-associated macrophages (TAM) with an M2-like phenotype have been linked to tumor-elicited inflammation, immunosuppression, and resistance to chemotherapies in cancer, thus representing an attractive target for an effective cancer immunotherapy. Here, we demonstrate that particulate yeast-derived β-glucan, a natural polysaccharide compound, converts polarized M2 macrophages or immunosuppressive TAM into an M1-like phenotype with potent immuno-stimulating activity. This process is associated with macrophage metabolic reprograming with enhanced glycolysis, krebs cycle and glutamine utilization. In addition, particulate β-glucan converts immunosuppressive TAM via the C-type lectin receptor dectin-1-induced Syk-Card9-Erk pathway. Further in vivo studies show that oral particulate β-glucan treatment significantly delays tumor growth, which is associated with in vivo TAM phenotype conversion and enhanced effector T cell activation. Mice injected with particulate β-glucan-treated TAM mixed with tumor cells have significantly reduced tumor burden with less blood vascular vessels compared to those with TAM plus tumor cell injection. In addition, macrophage depletion significantly reduced the therapeutic efficacy of particulate β-glucan in tumor-bearing mice. These findings have established a new paradigm for macrophage polarization and immunosuppressive TAM conversion and shed the light on the action mode of β-glucan treatment in cancer. PMID:26453753

Serum (1 → 3) β-D-glucan assay for discrimination between Pneumocystis jirovecii pneumonia and colonization.

PubMed

Tasaka, Sadatomo; Kobayashi, Seiki; Yagi, Kazuma; Asami, Takahiro; Namkoong, Ho; Yamasawa, Wakako; Ishii, Makoto; Hasegawa, Naoki; Betsuyaku, Tomoko

2014-11-01

Polymerase chain reaction (PCR) technique is being increasingly used for the microbiological diagnosis of Pneumocystis pneumonia (PCP). As PCR is highly sensitive, it can be positive even in a patient with Pneumocystis colonization. In this study, we evaluated whether the β-d-glucan assay could be used to differentiate between PCP and Pneumocystis jirovecii colonization in immunocompromised patients with pulmonary infiltrates. We retrospectively evaluated data from 166 consecutive patients who underwent bronchoalveolar lavage for the diagnosis of PCP. Serum levels of β-d-glucan in the negative, colonization, probable PCP, and definite PCP groups were 20.2 ± 6.3, 48.8 ± 15.9, 89.9 ± 20.2, 224.9 ± 25.9 pg/mL, respectively. The β-D-glucan levels in the definite PCP group were significantly higher than those in the other 3 groups (p < 0.001). Serum β-d-glucan levels in patients with either definite or probable PCP (173.1 ± 18.8 pg/mL) were significantly greater than those in patients with colonization who had positive PCR results but improved without anti-PCP treatment (p < 0.002). The cut-off level for discrimination was estimated to be 33.5 pg/mL, with which the positive predictive value was 0.925. These results indicate that β-D-glucan is a useful marker to differentiate between PCP and Pneumocystis colonization. A positive β-D-glucan assay result might be a good indication to begin anti-PCP treatment. Copyright © 2014. Published by Elsevier Ltd.

Comprehensive functional characterization of the glycoside hydrolase family 3 enzymes from Cellvibrio japonicus reveals unique metabolic roles in biomass saccharification.

PubMed

Nelson, Cassandra E; Attia, Mohamed A; Rogowski, Artur; Morland, Carl; Brumer, Harry; Gardner, Jeffrey G

2017-12-01

Lignocellulose degradation is central to the carbon cycle and renewable biotechnologies. The xyloglucan (XyG), β(1→3)/β(1→4) mixed-linkage glucan (MLG) and β(1→3) glucan components of lignocellulose represent significant carbohydrate energy sources for saprophytic microorganisms. The bacterium Cellvibrio japonicus has a robust capacity for plant polysaccharide degradation, due to a genome encoding a large contingent of Carbohydrate-Active enZymes (CAZymes), many of whose specific functions remain unknown. Using a comprehensive genetic and biochemical approach, we have delineated the physiological roles of the four C. japonicus glycoside hydrolase family 3 (GH3) members on diverse β-glucans. Despite high protein sequence similarity and partially overlapping activity profiles on disaccharides, these β-glucosidases are not functionally equivalent. Bgl3A has a major role in MLG and sophorose utilization, and supports β(1→3) glucan utilization, while Bgl3B underpins cellulose utilization and supports MLG utilization. Bgl3C drives β(1→3) glucan utilization. Finally, Bgl3D is the crucial β-glucosidase for XyG utilization. This study not only sheds the light on the metabolic machinery of C. japonicus, but also expands the repertoire of characterized CAZymes for future deployment in biotechnological applications. In particular, the precise functional analysis provided here serves as a reference for informed bioinformatics on the genomes of other Cellvibrio and related species. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Potent, selective, orally bioavailable inhibitors of tumor necrosis factor-alpha converting enzyme (TACE): discovery of indole, benzofuran, imidazopyridine and pyrazolopyridine P1' substituents.

PubMed

Lu, Zhonghui; Ott, Gregory R; Anand, Rajan; Liu, Rui-Qin; Covington, Maryanne B; Vaddi, Krishna; Qian, Mingxin; Newton, Robert C; Christ, David D; Trzaskos, James; Duan, James J-W

2008-03-15

Potent and selective inhibitors of tumor necrosis factor-alpha converting enzyme (TACE) were discovered with several new heterocyclic P1' groups in conjunction with cyclic beta-amino hydroxamic acid scaffolds. Among them, the pyrazolopyridine provided the best overall profile when combined with tetrahydropyran beta-amino hydroxamic acid scaffold. Specifically, inhibitor 49 showed IC(50) value of 1 nM against porcine TACE and 170 nM in the suppression of LPS-induced TNF-alpha of human whole blood. Compound 49 also displayed excellent selectivity over a wide panel of MMPs as well as excellent oral bioavailability (F%>90%) in rat n-in-1 PK studies.

An Amylase-Like Protein, AmyD, Is the Major Negative Regulator for α-Glucan Synthesis in Aspergillus nidulans during the Asexual Life Cycle.

PubMed

He, Xiaoxiao; Li, Shengnan; Kaminskyj, Susan

2017-03-27

α-Glucan affects fungal cell-cell interactions and is important for the virulence of pathogenic fungi. Interfering with production of α-glucan could help to prevent fungal infection. In our previous study, we reported that an amylase-like protein, AmyD, could repress α-glucan accumulation in Aspergillus nidulans . However, the underlying molecular mechanism was not clear. Here, we examined the localization of AmyD and found it was a membrane-associated protein. We studied AmyD function in α-glucan degradation, as well as with other predicted amylase-like proteins and three annotated α-glucanases. AmyC and AmyE share a substantial sequence identity with AmyD, however, neither affects α-glucan synthesis. In contrast, AgnB and MutA (but not AgnE) are functional α-glucanases that also repress α-glucan accumulation. Nevertheless, the functions of AmyD and these glucanases were independent from each other. The dynamics of α-glucan accumulation showed different patterns between the AmyD overexpression strain and the α-glucanase overexpression strains, suggesting AmyD may not be involved in the α-glucan degradation process. These results suggest the function of AmyD is to directly suppress α-glucan synthesis, but not to facilitate its degradation.

Fluorescence microplate readers as an alternative to flow injection analysis for determination of wort beta-glucan

USDA-ARS?s Scientific Manuscript database

Wort beta-glucan concentration is a critical malting quality parameter used to identify and avoid potential brewhouse filtration problems. ASBC method Wort-18 is widely used in malt analysis laboratories and brewhouses to measure wort beta-glucan levels. However, the chemistry underlying the method...

Molecular Genetic Analysis of Glucan Branching Enzymes from Plants and Bacteria in Arabidopsis Reveals Marked Differences in Their Functions and Capacity to Mediate Starch Granule Formation1[OPEN

PubMed Central

Lu, Kuan-Jen; Streb, Sebastian; Meier, Florence; Pfister, Barbara; Zeeman, Samuel C.

2015-01-01

The major component of starch is the branched glucan amylopectin, the branching pattern of which is one of the key factors determining its ability to form semicrystalline starch granules. Here, we investigated the functions of different branching enzyme (BE) types by expressing proteins from maize (Zea mays BE2a), potato (Solanum tuberosum BE1), and Escherichia coli (glycogen BE [EcGLGB]) in Arabidopsis (Arabidopsis thaliana) mutant plants that are deficient in their endogenous BEs and therefore, cannot make starch. The expression of each of these three BE types restored starch biosynthesis to differing degrees. Full complementation was achieved using the class II BE ZmBE2a, which is most similar to the two endogenous Arabidopsis isoforms. Expression of the class I BE from potato, StBE1, resulted in partial complementation and high amylose starch. Expression of the glycogen BE EcGLGB restored only minimal amounts of starch production, which had unusual chain length distribution, branch point distribution, and granule morphology. Nevertheless, each type of BE together with the starch synthases and debranching enyzmes were able to create crystallization-competent amylopectin polymers. These data add to the knowledge of how the properties of the BE influence the final composition of starch and fine structure of amylopectin. PMID:26358415

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

PubMed

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

NASA Astrophysics Data System (ADS)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Effect of pH on subunit association and heat protection of soybean alpha-galactosidase

NASA Technical Reports Server (NTRS)

Porter, J. E.; Sarikaya, A.; Herrmann, K. M.; Ladisch, M. R.; Mitchell, C. A. (Principal Investigator)

1992-01-01

Soybeans contain the enzyme alpha-galactosidase, which hydrolyzes alpha-1, 6 linkages in stachyose and raffinose to give sucrose and galactose. We have found that galactose, a competitive product inhibitor of alpha-galactosidase, strongly promotes the heat stability of the tetrameric form of the enzyme at pH 4.0 and at temperatures of up to 70 degrees C for 60 min. Stachyose and raffinose also protect alpha-galactosidase from denaturation at pH 4.0 although to a lesser extent. Glucose and mannose have little effect. At pH 7.0 the enzyme is a monomer, and galactose has no effect on the heat stability of the enzyme. In the absence of heat protection of the enzyme by added sugars, a series deactivation mechanism was found to describe the deactivation data. In comparison, a unimolecular, non-first order deactivation model applies at pH 4.0, where heat protection effects were observed. At a temperature above 60 degrees C, simple deactivation is a suitable model. The results suggest that alpha-galactosidase conformation and heat stability are directly related.

Cloning and characterization of an alpha-glucuronidase from a mixed microbial population

USDA-ARS?s Scientific Manuscript database

Alpha-Glucuronidase enzymes play an essential role in the full enzymatic hydrolysis of hemicellulose. Up to this point, all genes encoding alpha-glucuronidase enzymes have been cloned from individual, pure culture strains. Using a high-throughput screening strategy, we have isolated the first alph...

Protection against Experimental Cryptococcosis following Vaccination with Glucan Particles Containing Cryptococcus Alkaline Extracts.

PubMed

Specht, Charles A; Lee, Chrono K; Huang, Haibin; Tipper, Donald J; Shen, Zu T; Lodge, Jennifer K; Leszyk, John; Ostroff, Gary R; Levitz, Stuart M

2015-12-22

A vaccine capable of protecting at-risk persons against infections due to Cryptococcus neoformans and Cryptococcus gattii could reduce the substantial global burden of human cryptococcosis. Vaccine development has been hampered though, by lack of knowledge as to which antigens are immunoprotective and the need for an effective vaccine delivery system. We made alkaline extracts from mutant cryptococcal strains that lacked capsule or chitosan. The extracts were then packaged into glucan particles (GPs), which are purified Saccharomyces cerevisiae cell walls composed primarily of β-1,3-glucans. Subcutaneous vaccination with the GP-based vaccines provided significant protection against subsequent pulmonary infection with highly virulent strains of C. neoformans and C. gattii. The alkaline extract derived from the acapsular strain was analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS), and the most abundant proteins were identified. Separation of the alkaline extract by size exclusion chromatography revealed fractions that conferred protection when loaded in GP-based vaccines. Robust Th1- and Th17-biased CD4(+) T cell recall responses were observed in the lungs of vaccinated and infected mice. Thus, our preclinical studies have indicated promising cryptococcal vaccine candidates in alkaline extracts delivered in GPs. Ongoing studies are directed at identifying the individual components of the extracts that confer protection and thus would be promising candidates for a human vaccine. The encapsulated yeast Cryptococcus neoformans and its closely related sister species, Cryptococcus gattii, are major causes of morbidity and mortality, particularly in immunocompromised persons. This study reports on the preclinical development of vaccines to protect at-risk populations from cryptococcosis. Antigens were extracted from Cryptococcus by treatment with an alkaline solution. The extracted antigens were then packaged into glucan particles, which are hollow

Characteristics of β-glucan extracted from raw and germinated foxtail (Setaria italica) and kodo (Paspalum scrobiculatum) millets.

PubMed

Sharma, Seema; Saxena, Dharmesh C; Riar, Charanjit S

2018-06-22

β-glucan extracted from raw and germinated foxtail and kodo millets were evaluated for its functional, rheological and in vitro antioxidant characteristics. The in vitro activity determined in terms of diphenyl-p-picryl hydrazy (DPPH) radical scavenging activity and Ferric reducing antioxidant power (FRAP) activity was found higher in germinated kodo millet (78.74%, 48.98%) compared to foxtail millet (34.96%, 38.67%), respectively. Water binding capacity and swelling power of β-glucan extract of foxtail millet increased from 2.88 g/g to 3.06 g/g and 1.32 g/g to 1.67 g/g and that of kodo millet from 3.45 to 3.99 g/g and 2.54 to 2.99 g/g, respectively, after germination. There was a significant improvement in foaming capacity and stability of β-glucan after germination. The 'n' values were less than unity indicated that β-glucan extracts behaved pseudo-plastic like material. The storage modus (G') of β-glucan extracts of germinated kodo millet was higher than foxtail millets, as well as overall higher than the loss modulus (G″) indicating a dominantly viscoelastic behaviour and stability. Peak tanδ was lower for germinated foxtail millet compared to kodo millet indicating more stable gel of the former. Therefore, improvements in the functional as well rheological properties of β-glucan could be exploited in food and pharmaceutical industries. Copyright © 2018. Published by Elsevier B.V.

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

PubMed Central

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

De facto molecular weight distributions of glucans by size-exclusion chromatography combined with mass/molar-detection of fluorescence labeled terminal hemiacetals.

PubMed

Praznik, Werner; Huber, Anton

2005-09-25

A major capability of polysaccharides in aqueous media is their tendency for aggregation and dynamic formation of supermolecular structures. Even extended dissolution processes will not eliminate these structures which dominate many analytical approaches, in particular absolute molecular weight determinations referring to light scattering data. An alternative approach for determination of de facto molecular weight for glucans with free terminal hemiacetal functionality (reducing end group) has been adjusted from carbohydrates for midrange and high-dp glucans: quantitative and stabilized labeling as aminopyridyl-derivatives (AP-glucans) and subsequent analysis of SEC-separated elution profiles based on simultaneously monitored mass and molar fractions by refractive index and fluorescence detection. SEC-DRI/FL of AP-glucans proved as an appropriate approach for determination of de facto molecular weight of constituting glucan molecules even in the presence of supermolecular structures for non-branched (pullulan), branched (dextran), narrow distributed and broad distributed and for mixes of compact and loose packed polymer coils (starch glucan hydrolizate).

Microbial nitrilases: versatile, spiral forming, industrial enzymes.

PubMed

Thuku, R N; Brady, D; Benedik, M J; Sewell, B T

2009-03-01

The nitrilases are enzymes that convert nitriles to the corresponding acid and ammonia. They are members of a superfamily, which includes amidases and occur in both prokaryotes and eukaryotes. The superfamily is characterized by having a homodimeric building block with a alpha beta beta alpha-alpha beta beta alpha sandwich fold and an active site containing four positionally conserved residues: cys, glu, glu and lys. Their high chemical specificity and frequent enantioselectivity makes them attractive biocatalysts for the production of fine chemicals and pharmaceutical intermediates. Nitrilases are also used in the treatment of toxic industrial effluent and cyanide remediation. The superfamily enzymes have been visualized as dimers, tetramers, hexamers, octamers, tetradecamers, octadecamers and variable length helices, but all nitrilase oligomers have the same basic dimer interface. Moreover, in the case of the octamers, tetradecamers, octadecamers and the helices, common principles of subunit association apply. While the range of industrially interesting reactions catalysed by this enzyme class continues to increase, research efforts are still hampered by the lack of a high resolution microbial nitrilase structure which can provide insights into their specificity, enantioselectivity and the mechanism of catalysis. This review provides an overview of the current progress in elucidation of structure and function in this enzyme class and emphasizes insights that may lead to further biotechnological applications.

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

PubMed

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

(1→6)- and (1→3)(1→6)-β-glucans from Lasiodiplodia theobromae MMBJ: Structural characterization and pro-inflammatory activity.

PubMed

Oliveira, Kassandra S M; Di Bastiani, Mirela; Cordeiro, Lucimara M C; Costa, Mírian F; Toledo, Karina A; Iacomini, Marcello; Babosa, Aneli M; Dekker, Robert F H; Nascimento, Valéria M G

2015-11-20

The chemical composition and structural characterization of exopolysaccharides from the fungus Lasiodiplodia theobromae MMBJ are described, and the immunomodulatory activity of a purified β-glucan was evaluated. L. theobromae MMBJ produced three different β-glucans. One, fraction PEPS, was a branched (1→3)(1→6)-β-glucan and was insoluble in cold water. The other two, fractions SEPS-005R and SEPS-10E, were characterized as linear (1→6)-β-glucans with molar mass of 1.8×10(6)Da and 7.0×10(3)Da, respectively. From a total of 2.2g/L of EPS produced by L. theobromae through submerged fermentation, 1.5g/L (67%) was of the branched (1→3)(1→6)-β-glucan, while 25% (w/w) were linear (1→6)-β-glucans. Tests conducted with macrophages showed that the high molar mass (1→6)-β-glucan fraction (SEPS-005R) induced a pro-inflammatory response pattern. Copyright © 2015 Elsevier Ltd. All rights reserved.

Chemical constituents of Cichorium intybus and their inhibitory effects against urease and alpha-chymotrypsin enzymes.

PubMed

Saied, Sumayya; Shah, Shazia; Ali, Zulfiqar; Khan, Ajmal; Marasini, Bishnu P; Choudhary, Muhammad Iqbal

2011-08-01

Phytochemical investigation of the aerial parts of Cichorium intybus L. resulted in the isolation and identification of two new natural metabolites, 2,6-di[but-3(E)-en-2-onyl]naphthalene (1), and 3,3',4,4'-tetrahydroxychalcone (2), along with nine known compounds. Their structures were determined by spectroscopic techniques including 1D and 2D NMR. The known compounds were identified as scopoletin (3), 4-hydroxyphenylacetic acid (4), 3-hydroxy-4-methoxybenzoic acid (5), 4,4'-dihydroxychalcone (6), 6,7-dihydroxycoumarine (7), 1-triacontanol (8), lupeol (9), beta-sitosterol (10), and beta-sitosterol-3-O-beta-glucopyranoside (11). Compounds 4-6 and 8 are reported for the first time from C. intybus. Compounds 2 and 3 showed weak inhibitory activities against urease and alpha-chymotrypsin enzymes, respectively.

Kinetics of improved 1,4-alpha-D-glucan glucohydrolase biosynthesis from a newly isolated Aspergillus oryzae IIB-6 and parameter significance analysis by 2-factorial design.

PubMed

Fatima, Bilqees; Ali, Sikander

2012-01-01

Sixteen different mould cultures viz. Aspergillus, Alternaria, Arthroderma, Trichoderma, Fusarium, Penicillium, Rhizopus and Chochliobolus were isolated from the soil samples of Qatar by serial dilution method. The preliminary screening of isolates was done by selecting initial colonies showing relatively bigger zones of starch hydrolysis on nutrient agar plates. The isolates were then subjected to secondary screening by submerged fermentation (SmF). The 1,4-α-D-glucan glucohydrolase (GGH) activity ranged from 1.906-12.675 U/ml/min. The product yield was analysed in dependence of mycelial morphology, biomass level and protein content. The isolate Aspergillus oryzae llB-6 which gave maximum enzyme production was incubated in M3 medium containing 20 g/l starch, 10 g/l lactose, 8.5 g/l yeast extract, 6 g/l corn steep liquor (CSL), 1.2 g/l MgSO4.7H2O, 1.3 g/l NH4Cl, 0.6 g/l CaCl2.2H2O, pH 5 at 30±2°C and 200 rpm. On the basis of kinetic variables, notably Qp (0.058±0.01(a) U/g/h), Yp/s (0.308±0.03(ab) U/g) and qp (0.210±0.032(abc) U/g fungal biomass/h), A. oryzae IIB-6 was found to be a hyper producer of GGH (LSD 0.0345) compared to A. kawachii IIB-2. A noticeable enhancement in enzyme activity of over 30% was observed (13.917±1.01 U/ml/min) when the process parameters viz. cultural conditions (pH 5, incubation period 72 h) and nutritional requirements (6 g/l CSL, 9.5 g/l yeast extract, 10 g/l starch, 20 g/l lactose) were further optimized using a 2-factorial Plackett-Burman design. The model terms were found to be highly significant (HS, p≤0.05), indicating the potential utility of the culture (dof~3).

Functional Analysis of the α-1,3-Glucan Synthase Genes agsA and agsB in Aspergillus nidulans: AgsB Is the Major α-1,3-Glucan Synthase in This Fungus

PubMed Central

Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu

2013-01-01

Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and 13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species. PMID:23365684

Elongated phytoglycogen chain length in transgenic rice endosperm expressing active starch synthase IIa affects the altered solubility and crystallinity of the storage α-glucan

PubMed Central

Fujita, Naoko; Toyosawa, Yoshiko; Utsumi, Yoshinori

2012-01-01

The relationship between the solubility, crystallinity, and length of the unit chains of plant storage α-glucan was investigated by manipulating the chain length of α-glucans accumulated in a rice mutant. Transgenic lines were produced by introducing a cDNA for starch synthase IIa (SSIIa) from an indica cultivar (SSIIa I, coding for active SSIIa) into an isoamylase1 (ISA1)-deficient mutant (isa1) that was derived from a japonica cultivar (bearing inactive SSIIa proteins). The water-soluble fraction accounted for >95% of the total α-glucan in the isa1 mutant, whereas it was only 35–70% in the transgenic SSIIa I /isa1 lines. Thus, the α-glucans from the SSIIa I /isa1 lines were fractionated into soluble and insoluble fractions prior to the following characterizations. X-ray diffraction analysis revealed a weak B-type crystallinity for the α-glucans of the insoluble fraction, while no crystallinity was confirmed for α-glucans in isa1. Concerning the degree of polymerization (DP) ≤30, the chain lengths of these α-glucans differed significantly in the order of SSIIa I /isa1 insoluble > SSIIa I /isa1 soluble > α-glucans in isa1. The amount of long chains with DP ≥33 was higher in the insoluble fraction α-glucans than in the other two α-glucans. No difference was observed in the chain length distributions of the β-amylase limit dextrins among these α-glucans. These results suggest that in the SSIIa I /isa1 transgenic lines, the unit chains of α-glucans were elongated by SSIIaI, whereas the expression of SSIIaI did not affect the branch positions. Thus, the observed insolubility and crystallinity of the insoluble fraction can be attributed to the elongated length of the outer chains due to SSIIaI. PMID:23048127

Interleukin-1 and Interferon-γ Orchestrate β-Glucan-Activated Human Dendritic Cell Programming via IκB-ζ Modulation

PubMed Central

Cardone, Marco; Dzutsev, Amiran K.; Li, Hongchuan; Riteau, Nicolas; Gerosa, Franca; Shenderov, Kevin; Winkler-Pickett, Robin; Provezza, Lisa; Riboldi, Elena; Leighty, Robert M.; Orr, Selinda J.; Steinhagen, Folkert; Wewers, Mark D.; Sher, Alan; Anderson, Stephen K.; Goldszmid, Romina; McVicar, Daniel W.

2014-01-01

Recognition of microbial components via innate receptors including the C-type lectin receptor Dectin-1, together with the inflammatory environment, programs dendritic cells (DCs) to orchestrate the magnitude and type of adaptive immune responses. The exposure to β-glucan, a known Dectin-1 agonist and component of fungi, yeasts, and certain immune support supplements, activates DCs to induce T helper (Th)17 cells that are essential against fungal pathogens and extracellular bacteria but may trigger inflammatory pathology or autoimmune diseases. However, the exact mechanisms of DC programming by β-glucan have not yet been fully elucidated. Using a gene expression/perturbation approach, we demonstrate that in human DCs β-glucan transcriptionally activates via an interleukin (IL)-1- and inflammasome-mediated positive feedback late-induced genes that bridge innate and adaptive immunity. We report that in addition to its known ability to directly prime T cells toward the Th17 lineage, IL-1 by promoting the transcriptional cofactor inhibitor of κB-ζ (IκB-ζ) also programs β-glucan-exposed DCs to express cell adhesion and migration mediators, antimicrobial molecules, and Th17-polarizing factors. Interferon (IFN)-γ interferes with the IL-1/IκB-ζ axis in β-glucan-activated DCs and promotes T cell-mediated immune responses with increased release of IFN-γ and IL-22, and diminished production of IL-17. Thus, our results identify IL-1 and IFN-γ as regulators of DC programming by β-glucan. These molecular networks provide new insights into the regulation of the Th17 response as well as new targets for the modulation of immune responses to β-glucan-containing microorganisms. PMID:25474109

Anticonvulsant properties of alpha, gamma, and alpha, gamma-substituted gamma-butyrolactones.

PubMed

Klunk, W E; Covey, D F; Ferrendelli, J A

1982-09-01

Derivatives of gamma-butyrolactone (GBL) substituted on the alpha- and/or gamma-positions were synthesized and tested for their effects on behavior in mice, on the electroencephalographs and blood pressure of paralyzed-ventilated guinea pigs, and on electrical activity of incubated hippocampal slices. Several compounds, including alpha-ethyl-alpha-methyl GBL (alpha-EMGBL), alpha, alpha-dimethyl GBL, alpha, gamma-diethyl-alpha, gamma-dimethyl GBL, and gamma-ethyl-gamma-methyl GBL, prevented seizures induced by pentylenetetrazol, beta-ethyl-beta-methyl-gamma-butyrolactone (beta-EMGBL), picrotoxin, or all three compounds in mice and guinea pigs but had no effect on seizures induced by maximal electroshock or bicuculline. Neither gamma-hydroxybutyrate (GHB) nor alpha-isopropylidine GBL had any anticonvulsant activity. The anticonvulsant alpha-substituted compounds had a potent hypotensive effect and antagonized the hypertensive effect of beta-EMGBL, alpha-EMGBL was tested in incubated hippocampal slices and was found to depress basal activity and antagonize excitation induced by beta-EMGBL. These results demonstrate that alpha-alkyl-substituted GBL and, to a lesser extent, gamma-substituted derivatives are anticonvulsant agents and that their effects are strikingly different from those of GHB or beta-alkyl-substituted GBLs, which are epileptogenic. Possibly beta- and alpha-substituted GBLs act at the same site as agonists and antagonists, respectively.

Reduced vacuolar β-1,3-glucan synthesis affects carbohydrate metabolism as well as plastid homeostasis and structure in Phaeodactylum tricornutum.

PubMed

Huang, Weichao; Haferkamp, Ilka; Lepetit, Bernard; Molchanova, Mariia; Hou, Shengwei; Jeblick, Wolfgang; Río Bártulos, Carolina; Kroth, Peter G

2018-05-01

The β-1,3-glucan chrysolaminarin is the main storage polysaccharide of diatoms. In contrast to plants and green algae, diatoms and most other algal groups do not accumulate storage polysaccharides in their plastids. The diatom Phaeodactylum tricornutum possesses only a single gene encoding a putative β-1,3-glucan synthase ( Pt BGS). Here, we characterize this enzyme by expressing GFP fusion proteins in P. tricornutum and by creating and investigating corresponding gene silencing mutants. We demonstrate that Pt BGS is a vacuolar protein located in the tonoplast. Metabolite analyses of two mutant strains with reduced amounts of Pt BGS reveal a reduction in their chrysolaminarin content and an increase of soluble sugars and lipids. This indicates that carbohydrates are shunted into alternative pathways when chrysolaminarin production is impaired. The mutant strains show reduced growth and lower photosynthetic capacities, while possessing higher photoprotective abilities than WT cells. Interestingly, a strong reduction in Pt BGS expression also results in aberrations of the usually very regular thylakoid membrane patterns, including increased thylakoid thickness, reduced numbers of thylakoids per plastid, and increased numbers of lamellae per thylakoid stack. Our data demonstrate the complex intertwinement of carbohydrate storage in the vacuoles with carbohydrate metabolism, photosynthetic homeostasis, and plastid morphology.

Purification and biochemical characterization of a thermostable extracellular glucoamylase produced by the thermotolerant fungus Paecilomyces variotii.

PubMed

Michelin, Michele; Ruller, Roberto; Ward, Richard J; Moraes, Luiz Alberto B; Jorge, João A; Terenzi, Héctor F; Polizeli, Maria de Lourdes T M

2008-01-01

An extracellular glucoamylase produced by Paecilomyces variotii was purified using DEAE-cellulose ion exchange chromatography and Sephadex G-100 gel filtration. The purified protein migrated as a single band in 7% PAGE and 8% SDS-PAGE. The estimated molecular mass was 86.5 kDa (SDS-PAGE). Optima of temperature and pH were 55 degrees C and 5.0, respectively. In the absence of substrate the purified glucoamylase was stable for 1 h at 50 and 55 degrees C, with a t (50) of 45 min at 60 degrees C. The substrate contributed to protect the enzyme against thermal denaturation. The enzyme was mainly activated by manganese metal ions. The glucoamylase produced by P. variotii preferentially hydrolyzed amylopectin, glycogen and starch, and to a lesser extent malto-oligossacarides and amylose. Sucrose, p-nitrophenyl alpha-D-maltoside, methyl-alpha-D-glucopyranoside, pullulan, alpha- and beta-cyclodextrin, and trehalose were not hydrolyzed. After 24 h, the products of starch hydrolysis, analyzed by thin layer chromatography, showed only glucose. The circular dichroism spectrum showed a protein rich in alpha-helix. The sequence of amino acids of the purified enzyme VVTDSFR appears similar to glucoamylases purified from Talaromyces emersonii and with the precursor of the glucoamylase from Aspergillus oryzae. These results suggested the character of the enzyme studied as a glucoamylase (1,4-alpha-D-glucan glucohydrolase).

Three dimensional structural studies of alpha-N-acetylgalactosaminidase (alpha-NAGA) in alpha-NAGA deficiency (Kanzaki disease): different gene mutations cause peculiar structural changes in alpha-NAGAs resulting in different substrate specificities and clinical phenotypes.

PubMed

Kanekura, Takuro; Sakuraba, Hitoshi; Matsuzawa, Fumiko; Aikawa, Seiichi; Doi, Hirofumi; Hirabayashi, Yoshio; Yoshii, Noriko; Fukushige, Tomoko; Kanzaki, Tamotsu

2005-01-01

Kanzaki disease (OMIM#104170) is attributable to a deficiency in alpha-N-acetylgalactosaminidase (alpha-NAGA; E.C.3.2.1.49), which hydrolyzes GalNAcalpha1-O-Ser/Thr. Missense mutations, R329W or R329Q were identified in two Japanese Kanzaki patients. Although they are on the same codon, the clinical manifestation was more severe in R329W because an amino acid substitution led to protein instability resulting in structural change, which is greater in R329W than in R329Q. To examine whether the different clinical phenotypes are attributable to the two mutations. Plasma alpha-NAGA activity and urinary excreted glycopeptides were measured and three-dimensional models of human alpha-NAGA and its complexes with GalNAcalpha1-O-Ser and GalNAcalpha1-O-Thr were constructed by homology modeling. Residual enzyme activity was significantly higher in the R329Q- than the R329W mutant (0.022+/-0.005 versus 0.005+/-0.001 nmol/h/ml: p<0.05); the urinary ratios of GalNAcalpha1-O-Ser:GalNAcalpha1-O-Thr were 2:10 and 8:10, respectively. GalNAcalpha1-O-Ser/Thr fit tightly in a narrow space of the active site pocket of alpha-NAGA. GalNAcalpha1-O-Thr requires a larger space to associate with alpha-NAGA because of the side chain (CH3) of the threonine residue. Our findings suggest that the association of alpha-NAGA with its substrates is strongly affected by the amino acid substitution at R329 and that the association with GalNAcalpha1-O-Thr is more highly susceptible to structural changes. The residual mutant enzyme in R329W could not associate with GalNAcalpha1-O-Thr and GalNAcalpha1-O-Ser. However, the residual mutant enzyme in R329Q catalyzed GalNAcalpha1-O-Ser to some extent. Therefore, the urinary ratio of GalNAcalpha1-O-Ser:GalNAcalpha1-O-Thr was lower and the clinical phenotype was milder in the R329Q mutation. Structural analysis revealed biochemical and phenotypic differences in these Kanzaki patients with the R329Q and R329W mutation.

Effect of alpha lipoic acid on leukotriene A4 hydrolase.

PubMed

Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario

2017-03-15

Leukotriene A 4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A 4 to leukotriene B 4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B 4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B 4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A 4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A 4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A 4 hydrolase using in vivo models. Copyright © 2017 Elsevier B.V. All rights reserved.

The lysosomal enzyme alpha-Galactosidase A is deficient in Parkinson's disease brain in association with the pathologic accumulation of alpha-synuclein.

PubMed

Nelson, Michael P; Boutin, Michel; Tse, Tonia E; Lu, Hailin; Haley, Emily D; Ouyang, Xiaosen; Zhang, Jianhua; Auray-Blais, Christiane; Shacka, John J

2018-02-01

The aberrant accumulation of alpha-synuclein (α-syn) is believed to contribute to the onset and pathogenesis of Parkinson's disease (PD). The autophagy-lysosome pathway (ALP) is responsible for the high capacity clearance of α-syn. ALP dysfunction is documented in PD and pre-clinical evidence suggests that inhibiting the ALP promotes the pathological accumulation of α-syn. We previously identified the pathological accumulation of α-syn in the brains of mice deficient for the soluble lysosomal enzyme alpha-Galactosidase A (α-Gal A), a member of the glycosphingolipid metabolism pathway. In the present study, we quantified α-Gal A activity and levels of its glycosphingolipid metabolites in postmortem temporal cortex specimens from control individuals and in PD individuals staged with respect to α-syn containing Lewy body pathology. In late-state PD temporal cortex we observed significant decreases in α-Gal A activity and the 46kDa "active" species of α-Gal A as determined respectively by fluorometric activity assay and western blot analysis. These decreases in α-Gal A activity/levels correlated significantly with increased α-syn phosphorylated at serine 129 (p129S-α-syn) that was maximal in late-stage PD temporal cortex. Mass spectrometric analysis of 29 different isoforms of globotriaosylceramide (Gb 3 ), a substrate of α-Gal A indicated no significant differences with respect to different stages of PD temporal cortex. However, significant correlations were observed between increased levels of several Gb 3 isoforms and with decreased α-Gal A activity and/or increased p129S-α-syn. Deacylated Gb 3 (globotriaosylsphingosine or lyso-Gb 3 ) was also analyzed in PD brain tissue but was below the limit of detection of 20pmol/g. Analysis of other lysosomal enzymes revealed a significant decrease in activity for the lysosomal aspartic acid protease cathepsin D but not for glucocerebrosidase (GCase) or cathepsin B in late-stage PD temporal cortex. However, a

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

PubMed

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

PubMed Central

Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

2015-01-01

B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

Crystal Structure of 4,6-α-Glucanotransferase Supports Diet-Driven Evolution of GH70 Enzymes from α-Amylases in Oral Bacteria.

PubMed

Bai, Yuxiang; Gangoiti, Joana; Dijkstra, Bauke W; Dijkhuizen, Lubbert; Pijning, Tjaard

2017-02-07

Food processing and refining has dramatically changed the human diet, but little is known about whether this affected the evolution of enzymes in human microbiota. We present evidence that glycoside hydrolase family 70 (GH70) glucansucrases from lactobacilli, synthesizing α-glucan-type extracellular polysaccharides from sucrose, likely evolved from GH13 starch-acting α-amylases, via GH70 4,6-α-glucanotransferases. The crystal structure of a 4,6-α-glucanotransferase explains the mode of action and unique product specificity of these enzymes. While the α-amylase substrate-binding scaffold is retained, active-site loops adapted to favor transglycosylation over hydrolysis; the structure also gives clues as to how 4,6-α-glucanotransferases may have evolved further toward sucrose utilization instead of starch. Further supported by genomic, phylogenetic, and in vivo studies, we propose that dietary changes involving starch (and starch derivatives) and sucrose intake were critical factors during the evolution of 4,6-α-GTs and glucansucrases from α-amylases, allowing oral bacteria to produce extracellular polymers that contribute to biofilm formation from different substrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

21 CFR 866.5080 - Alpha-1-antichymotrypsin immunological test system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... immunochemical techniques alpha-1-antichymotrypsin (a protein) in serum, other body fluids, and tissues. Alpha-1-antichymotrypsin helps protect tissues against proteolytic (protein-splitting) enzymes released during infection...

Probing the substrate specificity of Golgi alpha-mannosidase II by use of synthetic oligosaccharides and a catalytic nucleophile mutant.

PubMed

Zhong, Wei; Kuntz, Douglas A; Ember, Brian; Singh, Harminder; Moremen, Kelley W; Rose, David R; Boons, Geert-Jan

2008-07-16

Inhibition of Golgi alpha-mannosidase II (GMII), which acts late in the N-glycan processing pathway, provides a route to blocking cancer-induced changes in cell surface oligosaccharide structures. To probe the substrate requirements of GMII, oligosaccharides were synthesized that contained an alpha(1,3)- or alpha(1,6)-linked 1-thiomannoside. Surprisingly, these oligosaccharides were not observed in X-ray crystal structures of native Drosophila GMII (dGMII). However, a mutant enzyme in which the catalytic nucleophilic aspartate was changed to alanine (D204A) allowed visualization of soaked oligosaccharides and led to the identification of the binding site for the alpha(1,3)-linked mannoside of the natural substrate. These studies also indicate that the conformational change of the bound mannoside to a high-energy B 2,5 conformation is facilitated by steric hindrance from, and the formation of strong hydrogen bonds to, Asp204. The observation that 1-thio-linked mannosides are not well tolerated by the catalytic site of dGMII led to the synthesis of a pentasaccharide containing the alpha(1,6)-linked Man of the natural substrate and the beta(1,2)-linked GlcNAc moiety proposed to be accommodated by the extended binding site of the enzyme. A cocrystal structure of this compound with the D204A enzyme revealed the molecular interactions with the beta(1,2)-linked GlcNAc. The structure is consistent with the approximately 80-fold preference of dGMII for the cleavage of substrates containing a nonreducing beta(1,2)-linked GlcNAc. By contrast, the lysosomal mannosidase lacks an equivalent GlcNAc binding site and kinetic analysis indicates oligomannoside substrates without non-reducing-terminal GlcNAc modifications are preferred, suggesting that selective inhibitors for GMII could exploit the additional binding specificity of the GlcNAc binding site.

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

PubMed

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

PubMed

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Host-pathogen interactions. XV. Fungal glucans which elicit phytoalexin accumulation in soybean also elicit the accumulation of phytoalexins in other plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cline, K.; Wade, M.; Albersheim, P.

1978-01-01

A ..beta..-glucan isolated from the mycelial walls of Phytophthora megasperma var. sojae and a glucan purified from yeast extract stimulate the accumulation of phytoalexins in red kidney bean, Phaseolus vulgaris, and stimulate the accumulation of the phytoalexin, rishitin, in potato tubers, Solanum tuberosum. Treatment of kidney bean cotyledons with the glucan elicitors resulted in the accumulation of at least five fungistatic compounds. These compounds migrate during thin layer chromatography identically to the fungistatic compounds which accumulate in kidney beans which have been inoculated with Colletotrichum lindemuthianum, a fungal pathogen of kidney beans. Potatoes accumulate as much as 29 micrograms ofmore » rishitin per gram fresh weight following exposure to the glucan from Phytophthora megasperma va. sojae and as much as 19.5 micrograms of rishitin per gram fresh weight following exposure to yeast glucan.« less

Fungi, β-glucan, and bacteria in nasal lavage of greenhouse workers and their relation to occupational exposure.

PubMed

Madsen, Anne Mette; Tendal, Kira; Thilsing, Trine; Frederiksen, Margit W; Baelum, Jesper; Hansen, Jørgen V

2013-10-01

The nose and mouth are the first regions of the respiratory tract in contact with airborne microorganisms. Occupational exposures to airborne microorganisms are associated with inflammation and different symptoms of the airways. The purpose of this study is to investigate the relation between occupational exposure to fungi, β-glucan, and bacteria and contents of fungi, β-glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n = 135) were taken Monday morning and Thursday at noon and personal exposure to inhalable bioaerosols was measured during a working day. The content of fungi and β-glucan in NAL of men was affected by their exposure to fungi and β-glucan. The content of fungi, β-glucan, and bacteria in NAL was higher Thursday at noon than Monday morning. The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, β-glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of β-glucan per fungal spore was found in NAL than in the air. This indicates that mainly the larger fungal spores or pollen grains deposit in the nose. The difference between genders and the fact that the content of fungi in NAL was significantly affected by the exposure indicate that the two genders are affected by the same exposure level differently.

Blood (1→3)-β-D-Glucan as a Diagnostic Test for HIV-Related Pneumocystis jirovecii Pneumonia

PubMed Central