Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
NASA Astrophysics Data System (ADS)
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Schmidt, Daniel; MacKinnon, Roderick
2008-12-09
Voltage-dependent K(+) (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K(+) channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane.
Schmidt, Daniel; MacKinnon, Roderick
2008-01-01
Voltage-dependent K+ (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K+ channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane. PMID:19050073
Voltage Dependence of a Neuromodulator-Activated Ionic Current.
Gray, Michael; Golowasch, Jorge
2016-01-01
The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca(2+), but that, in conditions of low Ca(2+), calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca(2+)/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR.
Ultrasteep Voltage Dependence in a Membrane Channel
NASA Astrophysics Data System (ADS)
Mangan, Patrick S.; Colombini, Marco
1987-07-01
A mechanism for regulating voltage-gated channels is presented. The treatment amplifies the effect of the applied membrane potential resulting in a dramatic increase in the channel's voltage dependence. Addition of a large polyvalent anion to the medium bathing a phospholipid bilayer containing the voltage-dependent channel from the mitochondrial outer membrane, VDAC, induced up to a 12-fold increase in the channel's voltage sensitivity. The highest polyvalent anion concentration tested resulted in an e-fold conductance change for a 0.36-mV change in membrane potential. On the low end, a concentration of 2 μ M resulted in a 50% increase in VDAC voltage dependence. A mechanism based on polyvalent anion accumulation in the access resistance region at the mouth of the pore is consistent with all findings. Perhaps the voltage dependence of voltage-gated channels is amplified in vivo by polyvalent ions. If so, the control of excitable phenomena may be under much finer regulation than that provided by membrane potential alone.
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.
Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio
2016-11-17
Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.
Lee, Seok-Yong; Banerjee, Anirban; MacKinnon, Roderick
2009-03-03
Voltage-dependent K(+) (Kv) channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors), which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing
2014-07-01
Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Voltage-dependent formation of gramicidin channels in lipid bilayers.
Sandblom, J; Galvanovskis, J; Jilderos, B
2001-01-01
The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Barnat, E. V.; Miller, P. A.; Hebner, G. A.; ...
2007-05-16
In this paper, the radial distribution of the measured voltage drop across a sheath formed between a 300mm electrode and an argon plasma discharge is shown to depend on the excitation radio frequency, under constant power and pressure conditions. At a lower frequency of 13.56MHz, the voltage drop across the sheath is uniform across the 300mm electrode, while at higher frequencies of 60 and 162MHz the voltage drop becomes radially nonuniform. Finally, the magnitude and spatial extent of the nonuniformity become greater with increasing frequency.
The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.
Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin
2017-08-01
Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.
Pinto, Bernardo I.; García, Isaac E.; Pupo, Amaury; Retamal, Mauricio A.; Martínez, Agustín D.; Latorre, Ramón; González, Carlos
2016-01-01
Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. PMID:27143357
Keum, Dongil; Kim, Dong-Il; Suh, Byung-Chang
2016-01-01
Voltage-sensing phosphatases (VSPs) are homologs of phosphatase and tensin homolog (PTEN), a phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] 3-phosphatase. However, VSPs have a wider range of substrates, cleaving 3-phosphate from PI(3,4)P2 and probably PI(3,4,5)P3 as well as 5-phosphate from phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and PI(3,4,5)P3 in response to membrane depolarization. Recent proposals say these reactions have differing voltage dependence. Using Förster resonance energy transfer probes specific for different PIs in living cells with zebrafish VSP, we quantitate both voltage-dependent 5- and 3-phosphatase subreactions against endogenous substrates. These activities become apparent with different voltage thresholds, voltage sensitivities, and catalytic rates. As an analytical tool, we refine a kinetic model that includes the endogenous pools of phosphoinositides, endogenous phosphatase and kinase reactions connecting them, and four exogenous voltage-dependent 5- and 3-phosphatase subreactions of VSP. We show that apparent voltage threshold differences for seeing effects of the 5- and 3-phosphatase activities in cells are not due to different intrinsic voltage dependence of these reactions. Rather, the reactions have a common voltage dependence, and apparent differences arise only because each VSP subreaction has a different absolute catalytic rate that begins to surpass the respective endogenous enzyme activities at different voltages. For zebrafish VSP, our modeling revealed that 3-phosphatase activity against PI(3,4,5)P3 is 55-fold slower than 5-phosphatase activity against PI(4,5)P2; thus, PI(4,5)P2 generated more slowly from dephosphorylating PI(3,4,5)P3 might never accumulate. When 5-phosphatase activity was counteracted by coexpression of a phosphatidylinositol 4-phosphate 5-kinase, there was accumulation of PI(4,5)P2 in parallel to PI(3,4,5)P3 dephosphorylation
Pinto, Bernardo I; García, Isaac E; Pupo, Amaury; Retamal, Mauricio A; Martínez, Agustín D; Latorre, Ramón; González, Carlos
2016-07-22
Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Voltage-dependent conformational changes in connexin channels.
Bargiello, Thaddeus A; Tang, Qingxiu; Oh, Seunghoon; Kwon, Taekyung
2012-08-01
Channels formed by connexins display two distinct types of voltage-dependent gating, termed V(j)- or fast-gating and loop- or slow-gating. Recent studies, using metal bridge formation and chemical cross-linking have identified a region within the channel pore that contributes to the formation of the loop-gate permeability barrier. The conformational changes are remarkably large, reducing the channel pore diameter from 15 to 20Å to less than 4Å. Surprisingly, the largest conformational change occurs in the most stable region of the channel pore, the 3(10) or parahelix formed by amino acids in the 42-51 segment. The data provide a set of positional constraints that can be used to model the structure of the loop-gate closed state. Less is known about the conformation of the V(j)-gate closed state. There appear to be two different mechanisms; one in which conformational changes in channel structure are linked to a voltage sensor contained in the N-terminus of Cx26 and Cx32 and a second in which the C-terminus of Cx43 and Cx40 may act either as a gating particle to block the channel pore or alternatively to stabilize the closed state. The later mechanism utilizes the same domains as implicated in effecting pH gating of Cx43 channels. It is unclear if the two V(j)-gating mechanisms are related or if they represent different gating mechanisms that operate separately in different subsets of connexin channels. A model of the V(j)-closed state of Cx26 hemichannel that is based on the X-ray structure of Cx26 and electron crystallographic structures of a Cx26 mutation suggests that the permeability barrier for V(j)-gating is formed exclusively by the N-terminus, but recent information suggests that this conformation may not represent a voltage-closed state. Closed state models are considered from a thermodynamic perspective based on information from the 3.5Å Cx26 crystal structure and molecular dynamics (MD) simulations. The applications of computational and experimental
Voltage-dependent blockade of muscle Na+ channels by guanidinium toxins
1984-01-01
Na+ channels from rat muscle plasma membrane vesicles were inserted into neutral planar phospholipid bilayers and were activated by batrachotoxin. Single channel blocking events induced by the addition of various guanidinium toxins were analyzed to derive the rates of channel-toxin association and dissociation. Blocking by tetrodotoxin, saxitoxin, and six natural saxitoxin derivatives containing sulfate or hydroxyl groups were studied. Although the binding affinities vary over 2,000-fold, all of the toxins exhibit identical voltage dependence of the blocking reactions, regardless of the toxin's net charge. The results suggest that the voltage dependence of toxin binding is due to a voltage-dependent conformational equilibrium of the toxin receptor, rather than to direct entry of the charged toxin molecule into the applied transmembrane electric field. PMID:6096479
Voltage and frequency dependence of prestin-associated charge transfer
Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.
2009-01-01
Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917
Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating
Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar
2012-01-01
The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342
Frequency Dependence of Low-Voltage Electrowetting Investigated by Impedance Spectroscopy.
Li, Ying-Jia; Cahill, Brian P
2017-11-14
An electrowetting-on-dielectric (EWOD) electrode was developed that facilitates the use of low alternating voltages (≤5 V AC ). This allows online investigation of the frequency dependence of electrowetting by means of impedance spectroscopy. The EWOD electrode is based on a dielectric bilayer consisting of an anodic tantalum pentoxide (Ta 2 O 5 ) thin film (d = 59.35 nm) with a high relative permittivity (ε d = 26.3) and a self-assembled hydrophobic silane monolayer. The frequency dependence of electrowetting was studied using an aqueous μL-sized sessile droplet on the planar EWOD electrode in oil. Experiments using electrochemical impedance spectroscopy and optical imaging indicate the frequency dependence of all three variables in the Young-Lippmann equation: the voltage drop across the dielectric layers, capacitance per unit area, and contact angle under voltage. The electrowetting behavior induced by AC voltages is shown to be well described by the Young-Lippmann equation for AC applications below a frequency threshold. Moreover, the dielectric layers act as a capacitor and the stored electrostatic potential energy is revealed to only partially contribute to the electrowetting.
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Structural Mechanism of Voltage-Dependent Gating in an Isolated Voltage-Sensing Domain
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos; Hulse, Raymond E.; Roux, Benoit; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-01-01
SUMMARY The transduction of transmembrane electric fields into protein motion plays an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSD) carry out these functions through reorientations of S4 helix with discrete gating charges. Here, crystal structures of the VSD from Ci-VSP were determined in both, active (Up) and resting (Down) conformations. The S4 undergoes a ~5 Å displacement along its main axis accompanied by a ~60o rotation, consistent with the helix-screw gating mechanism. This movement is stabilized by a change in countercharge partners in helices S1 and S3, generating an estimated net charge transfer of ~1 eo. Gating charges move relative to a “hydrophobic gasket” that electrically divides intra and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent cellular activities. PMID:24487958
Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process
NASA Astrophysics Data System (ADS)
Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.
1988-08-01
Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.
Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors.
Heras, Francisco J H; Anderson, John; Laughlin, Simon B; Niven, Jeremy E
2017-04-01
Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K + conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. © 2017 The Author(s).
Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors
2017-01-01
Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K+ conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. PMID:28381642
NASA Astrophysics Data System (ADS)
Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim
2018-04-01
In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.
Crebanine inhibits voltage-dependent Na+ current in guinea-pig ventricular myocytes.
Xiao-Shan, He; Qing, Lin; Yun-Shu, Ma; Ze-Pu, Yu
2014-01-01
To study the effects of crebanine on voltage-gated Na(+) channels in cardiac tissues. Single ventricular myocytes were enzymatically dissociated from adult guinea-pig heart. Voltage-dependent Na(+) current was recorded using the whole cell voltage-clamp technique. Crebanine reversibly inhibited Na(+) current with an IC50 value of 0.283 mmol·L(-1) (95% confidence range: 0.248-0.318 mmol·L(-1)). Crebanine at 0.262 mmol·L(-1) caused a negative shift (about 12 mV) in the voltage-dependence of steady-state inactivation of Na(+) current, and retarded its recovery from inactivation, but did not affect its activation curve. In addition to blocking other voltage-gated ion channels, crebanine blocked Na(+) channels in guinea-pig ventricular myocytes. Crebanine acted as an inactivation stabilizer of Na(+) channels in cardiac tissues. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A
2018-02-21
Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.
Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating
Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.
1997-01-01
A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena
White, William E.
2013-01-01
Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698
Models of Voltage-Dependent Conformational Changes in NaChBac Channels
Shafrir, Yinon; Durell, Stewart R.; Guy, H. Robert
2008-01-01
Models of the transmembrane region of the NaChBac channel were developed in two open/inactivated and several closed conformations. Homology models of NaChBac were developed using crystal structures of Kv1.2 and a Kv1.2/2.1 chimera as templates for open conformations, and MlotiK and KcsA channels as templates for closed conformations. Multiple molecular-dynamic simulations were performed to refine and evaluate these models. A striking difference between the S4 structures of the Kv1.2-like open models and MlotiK-like closed models is the secondary structure. In the open model, the first part of S4 forms an α-helix, and the last part forms a 310 helix, whereas in the closed model, the first part of S4 forms a 310 helix, and the last part forms an α-helix. A conformational change that involves this type of transition in secondary structure should be voltage-dependent. However, this transition alone is not sufficient to account for the large gating charge movement reported for NaChBac channels and for experimental results in other voltage-gated channels. To increase the magnitude of the motion of S4, we developed another model of an open/inactivated conformation, in which S4 is displaced farther outward, and a number of closed models in which S4 is displaced farther inward. A helical screw motion for the α-helical part of S4 and a simple axial translation for the 310 portion were used to develop models of these additional conformations. In our models, four positively charged residues of S4 moved outwardly during activation, across a transition barrier formed by highly conserved hydrophobic residues on S1, S2, and S3. The S4 movement was coupled to an opening of the activation gate formed by S6 through interactions with the segment linking S4 to S5. Consistencies of our models with experimental studies of NaChBac and Kv channels are discussed. PMID:18641074
Bio-inspired voltage-dependent calcium channel blockers.
Yang, Tingting; He, Lin-Ling; Chen, Ming; Fang, Kun; Colecraft, Henry M
2013-01-01
Ca(2+) influx via voltage-dependent CaV1/CaV2 channels couples electrical signals to biological responses in excitable cells. CaV1/CaV2 channel blockers have broad biotechnological and therapeutic applications. Here we report a general method for developing novel genetically encoded calcium channel blockers inspired by Rem, a small G-protein that constitutively inhibits CaV1/CaV2 channels. We show that diverse cytosolic proteins (CaVβ, 14-3-3, calmodulin and CaMKII) that bind pore-forming α1-subunits can be converted into calcium channel blockers with tunable selectivity, kinetics and potency, simply by anchoring them to the plasma membrane. We term this method 'channel inactivation induced by membrane-tethering of an associated protein' (ChIMP). ChIMP is potentially extendable to small-molecule drug discovery, as engineering FK506-binding protein into intracellular sites within CaV1.2-α1C permits heterodimerization-initiated channel inhibition with rapamycin. The results reveal a universal method for developing novel calcium channel blockers that may be extended to develop probes for a broad cohort of unrelated ion channels.
NASA Astrophysics Data System (ADS)
Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.
2018-04-01
Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.
Admittance Spectroscopy in CZTSSe: Metastability Behavior and Voltage Dependent Defect Study
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koeper, Mark J.; Hages, Charles J.; Li, Jian V.
2016-11-21
Admittance spectroscopy has been performed on a CZTSSe device with a carrier injection pretreatment and under electronically relaxed conditions to demonstrate metastability behavior. We show that the measurements with the carrier injection pretreatment demonstrate two admittance signatures while the relaxed measurement demonstrates only one admittance signature with a different activation energy. Additionally, voltage dependent admittance spectroscopy was performed using the carrier injection pretreatment method at each of the applied voltage bias. The activation energies of the two admittance signatures were calculated and are shown to be independent of the voltage bias.
Zhao, Juan; Blunck, Rikard
2016-10-06
Domains in macromolecular complexes are often considered structurally and functionally conserved while energetically coupled to each other. In the modular voltage-gated ion channels the central ion-conducting pore is surrounded by four voltage sensing domains (VSDs). Here, the energetic coupling is mediated by interactions between the S4-S5 linker, covalently linking the domains, and the proximal C-terminus. In order to characterize the intrinsic gating of the voltage sensing domain in the absence of the pore domain, the Shaker Kv channel was truncated after the fourth transmembrane helix S4 (Shaker-iVSD). Shaker-iVSD showed significantly altered gating kinetics and formed a cation-selective ion channel with a strong preference for protons. Ion conduction in Shaker-iVSD developed despite identical primary sequence, indicating an allosteric influence of the pore domain. Shaker-iVSD also displays pronounced 'relaxation'. Closing of the pore correlates with entry into relaxation suggesting that the two processes are energetically related.
Purification and Characterization of Two Voltage-Dependent Anion Channel Isoforms from Plant Seeds1
Abrecht, Helge; Wattiez, Ruddy; Ruysschaert, Jean-Marie; Homblé, Fabrice
2000-01-01
Mitochondria were isolated from imbibed seeds of lentil (Lens culinaris) and Phaseolus vulgaris. We copurified two voltage-dependent anion channel from detergent solubilized mitochondria in a single purification step using hydroxyapatite. The two isoforms from P. vulgaris were separated by chromatofocusing chromatography in 4 m urea without any loss of channel activity. Channel activity of each isoform was characterized upon reconstitution into diphytanoyl phosphatidylcholine planar lipid bilayers. Both isoforms form large conductance channels that are slightly anion selective and display cation selective substates. PMID:11080295
Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.
Held, Katharina; Voets, Thomas; Vriens, Joris
2016-01-01
Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.
Low driving voltage simplified tandem organic light-emitting devices by using exciplex-forming hosts
NASA Astrophysics Data System (ADS)
Zhou, Dong-Ying; Cui, Lin-Song; Zhang, Ying-Jie; Liao, Liang-Sheng; Aziz, Hany
2014-10-01
Tandem organic light-emitting devices (OLEDs), i.e., OLEDs containing multiple electroluminescence (EL) units that are vertically stacked, are attracting significant interest because of their ability to realize high current efficiency and long operational lifetime. However, stacking multiple EL units in tandem OLEDs increases driving voltage and complicates fabrication process relative to their standard single unit counterparts. In this paper, we demonstrate low driving voltage tandem OLEDs via utilizing exciplex-forming hosts in the EL units instead of conventional host materials. The use of exciplex-forming hosts reduces the charge injection barriers and the trapping of charges on guest molecules, resulting in the lower driving voltage. The use of exciplex-forming hosts also allows using fewer layers, hence simpler EL configuration which is beneficial for reducing the fabrication complexity of tandem OLEDs.
Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe
2011-07-29
Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channelmore » expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.« less
Zhao, Juan; Blunck, Rikard
2016-01-01
Domains in macromolecular complexes are often considered structurally and functionally conserved while energetically coupled to each other. In the modular voltage-gated ion channels the central ion-conducting pore is surrounded by four voltage sensing domains (VSDs). Here, the energetic coupling is mediated by interactions between the S4-S5 linker, covalently linking the domains, and the proximal C-terminus. In order to characterize the intrinsic gating of the voltage sensing domain in the absence of the pore domain, the Shaker Kv channel was truncated after the fourth transmembrane helix S4 (Shaker-iVSD). Shaker-iVSD showed significantly altered gating kinetics and formed a cation-selective ion channel with a strong preference for protons. Ion conduction in Shaker-iVSD developed despite identical primary sequence, indicating an allosteric influence of the pore domain. Shaker-iVSD also displays pronounced 'relaxation'. Closing of the pore correlates with entry into relaxation suggesting that the two processes are energetically related. DOI: http://dx.doi.org/10.7554/eLife.18130.001 PMID:27710769
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Kim, Jong Beom; Lee, Dong Ryeol
2018-04-01
We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.
Breathing of voltage dependent anion channel as revealed by the fractal property of its gating
NASA Astrophysics Data System (ADS)
Manna, Smarajit; Banerjee, Jyotirmoy; Ghosh, Subhendu
2007-12-01
The gating of voltage dependent anion channel (VDAC) depends on the movement of voltage sensors in the transmembrane region, but the actual mechanism is still not well understood. With a view to understand the phenomenon we have analyzed the current recordings of VDAC in lipid bilayer membrane (BLM) and found that the data show self-similarity and fractal characteristics. We look for the microscopic and molecular basis of fractal behavior of gating of VDAC. A model describing the oscillatory dynamics of voltage sensors of VDAC in the transmembrane region under applied potential has been proposed which gives rise to the aforesaid fractal behavior.
Low-Voltage Continuous Electrospinning Patterning.
Li, Xia; Li, Zhaoying; Wang, Liyun; Ma, Guokun; Meng, Fanlong; Pritchard, Robyn H; Gill, Elisabeth L; Liu, Ye; Huang, Yan Yan Shery
2016-11-30
Electrospinning is a versatile technique for the construction of microfibrous and nanofibrous structures with considerable potential in applications ranging from textile manufacturing to tissue engineering scaffolds. In the simplest form, electrospinning uses a high voltage of tens of thousands volts to draw out ultrafine polymer fibers over a large distance. However, the high voltage limits the flexible combination of material selection, deposition substrate, and control of patterns. Prior studies show that by performing electrospinning with a well-defined "near-field" condition, the operation voltage can be decreased to the kilovolt range, and further enable more precise patterning of fibril structures on a planar surface. In this work, by using solution dependent "initiators", we demonstrate a further lowering of voltage with an ultralow voltage continuous electrospinning patterning (LEP) technique, which reduces the applied voltage threshold to as low as 50 V, simultaneously permitting direct fiber patterning. The versatility of LEP is shown using a wide range of combination of polymer and solvent systems for thermoplastics and biopolymers. Novel functionalities are also incorporated when a low voltage mode is used in place of a high voltage mode, such as direct printing of living bacteria; the construction of suspended single fibers and membrane networks. The LEP technique reported here should open up new avenues in the patterning of bioelements and free-form nano- to microscale fibrous structures.
Myosin light chain kinase controls voltage-dependent calcium channels in vascular smooth muscle.
Martinsen, A; Schakman, O; Yerna, X; Dessy, C; Morel, N
2014-07-01
The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7 decreases arginine vasopressin (AVP)-induced Ca(2+) influx in rat aorta. This study was designed to investigate whether MLCK is involved in Ca(2+) regulation in resistance artery smooth muscle cell, which plays a major role in the control of blood pressure. As ML compounds were shown to have off-target effects, MLCK was downregulated by transfection with a small interfering RNA targeting MLCK (MLCK-siRNA) in rat small resistance mesenteric artery (RMA) and in the rat embryonic aortic cell line A7r5. Noradrenaline-induced contraction and Ca(2+) signal were significantly depressed in MLCK-siRNA compared to scramble-siRNA-transfected RMA. Contraction and Ca(2+) signal induced by high KCl and voltage-activated Ca(2+) current were also significantly decreased in MLCK-siRNA-transfected RMA, suggesting that MLCK depletion modifies voltage-operated Ca(2+) channels. KCl- and AVP-induced Ca(2+) signals and voltage-activated Ca(2+) current were decreased in MLCK-depleted A7r5 cells. Eventually, real-time quantitative PCR analysis indicated that in A7r5, MLCK controlled mRNA expression of CaV1.2 (L-type) and CaV3.1 (T-type) voltage-dependent Ca(2+) channels. Our results suggest that MLCK controls the transcription of voltage-dependent Ca(2+) channels in vascular smooth muscle cells.
Transfer of Kv3.1 voltage sensor features to the isolated Ci-VSP voltage-sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Knöpfel, Thomas
2012-08-22
Membrane proteins that respond to changes in transmembrane voltage are critical in regulating the function of living cells. The voltage-sensing domains (VSDs) of voltage-gated ion channels are extensively studied to elucidate voltage-sensing mechanisms, and yet many aspects of their structure-function relationship remain elusive. Here, we transplanted homologous amino acid motifs from the tetrameric voltage-activated potassium channel Kv3.1 to the monomeric VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP) to explore which portions of Kv3.1 subunits depend on the tetrameric structure of Kv channels and which properties of Kv3.1 can be transferred to the monomeric Ci-VSP scaffold. By attaching fluorescent proteins to these chimeric VSDs, we obtained an optical readout to establish membrane trafficking and kinetics of voltage-dependent structural rearrangements. We found that motifs extending from 10 to roughly 100 amino acids can be readily transplanted from Kv3.1 into Ci-VSP to form engineered VSDs that efficiently incorporate into the plasma membrane and sense voltage. Some of the functional features of these engineered VSDs are reminiscent of Kv3.1 channels, indicating that these properties do not require interactions between Kv subunits or between the voltage sensing and the pore domains of Kv channels. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi
2017-11-01
A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Kuzmin, Yuriy; Tkach, Vasyl V; Vaughan, Jefferson A
2005-11-01
Rhabdias kongmongthaensis sp. n. is described based on specimens found in the lungs of the tree frog Polypedates leucomystax (Gravenhorst) (Amphibia: Rhacophoridae) from Kanchanaburi Province, western Thailand. The new species is similar to two North-American species, Rhabdias ranae and R. americanus, by presence of two lateral pseudolabia, each with two inner submedian protuberances. R. kongmongthaensis differs from both species by relative length and shape of the tail, and by its distribution and host specificity. Presence of lateral pseudolabia distinguishes the new species from the geographically closest Rhabdias species as well as from those parasitizing other rhacophorid frogs.
Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP
Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.
2010-01-01
In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128
A Voltage Dependent Non-Inactivating Na+ Channel Activated during Apoptosis in Xenopus Oocytes
Englund, Ulrika H.; Gertow, Jens; Kågedal, Katarina; Elinder, Fredrik
2014-01-01
Ion channels in the plasma membrane are important for the apoptotic process. Different types of voltage-gated ion channels are up-regulated early in the apoptotic process and block of these channels prevents or delays apoptosis. In the present investigation we examined whether ion channels are up-regulated in oocytes from the frog Xenopus laevis during apoptosis. The two-electrode voltage-clamp technique was used to record endogenous ion currents in the oocytes. During staurosporine-induced apoptosis a voltage-dependent Na+ current increased three-fold. This current was activated at voltages more positive than 0 mV (midpoint of the open-probability curve was +55 mV) and showed almost no sign of inactivation during a 1-s pulse. The current was resistant to the Na+-channel blockers tetrodotoxin (1 µM) and amiloride (10 µM), while the Ca2+-channel blocker verapamil (50 µM) in the bath solution completely blocked the current. The intracellular Na+ concentration increased in staurosporine-treated oocytes, but could be prevented by replacing extracellular Na+ whith either K+ or Choline+. Prevention of this influx of Na+ also prevented the STS-induced up-regulation of the caspase-3 activity, suggesting that the intracellular Na+ increase is required to induce apoptosis. Taken together, we have found that a voltage dependent Na+ channel is up-regulated during apoptosis and that influx of Na+ is a crucial step in the apoptotic process in Xenopus oocytes. PMID:24586320
Cloning and functional expression of a plant voltage-dependent chloride channel.
Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C
1996-01-01
Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442
Cherny, Vladimir V.; DeCoursey, Thomas E.
1999-01-01
Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017
Evolutionarily conserved intracellular gate of voltage-dependent sodium channels
NASA Astrophysics Data System (ADS)
Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron
2014-03-01
Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily.
Park, Won Sun; Son, Youn Kyoung; Ko, Eun A; Ko, Jae-Hong; Lee, Hyang Ae; Park, Kyoung Sun; Earm, Yung E
2005-06-17
We examined the effects of the protein kinase C (PKC) inhibitor, bisindolylmaleimide (BIM) (I), on voltage-dependent K+ (K(V)) channels in rabbit coronary arterial smooth muscle cells using whole-cell patch clamp technique. BIM (I) reversibly and dose-dependently inhibited the K(V) currents with an apparent Kd value of 0.27 microM. The inhibition of the K(V) current by BIM (I) was highly voltage-dependent between -30 and +10 mV (voltage range of channel activation), and the additive inhibition of the K(V) current by BIM (I) was voltage-dependence in the full activation voltage range. The rate constants of association and dissociation for BIM (I) were 18.4 microM(-1) s(-1) and 4.7 s(-1), respectively. BIM (I) had no effect on the steady-state activation and inactivation of K(V) channels. BIM (I) caused use-dependent inhibition of K(V) current, which was consistent with the slow recovery from inactivation in the presence of BIM (I) (recovery time constants were 856.95 +/- 282.6 ms for control, and 1806.38 +/- 110.0 ms for 300 nM BIM (I)). ATP-sensitive K+ (K(ATP)), inward rectifier K+ (K(IR)), Ca2+-activated K+ (BK(Ca)) channels, which regulate the membrane potential and arterial tone, were not affected by BIM (I). The PKC inhibitor, chelerythrine, and protein kinase A (PKA) inhibitor, PKA-IP, had little effect on the K(V) current and did not significantly alter the inhibitory effects of BIM (I) on the K(V) current. These results suggest that BIM (I) inhibits K(V) channels in a phosphorylation-independent, and voltage-, time- and use-dependent manner.
Voltage-dependent calcium-permeable channels in the plasma membrane of a higher plant cell.
Thuleau, P; Ward, J M; Ranjeva, R; Schroeder, J I
1994-07-01
Numerous biological assays and pharmacological studies on various higher plant tissues have led to the suggestion that voltage-dependent plasma membrane Ca2+ channels play prominent roles in initiating signal transduction processes during plant growth and development. However, to date no direct evidence has been obtained for the existence of such depolarization-activated Ca2+ channels in the plasma membrane of higher plant cells. Carrot suspension cells (Daucus carota L.) provide a well-suited system to determine whether voltage-dependent Ca2+ channels are present in the plasma membrane of higher plants and to characterize the properties of putative Ca2+ channels. It is known that both depolarization, caused by raising extracellular K+, and exposure to fungal toxins or oligogalacturonides induce Ca2+ influx into carrot cells. By direct application of patch-clamp techniques to isolated carrot protoplasts, we show here that depolarization of the plasma membrane positive to -135 mV activates Ca(2+)-permeable channels. These voltage-dependent ion channels were more permeable to Ca2+ than K+, while displaying large permeabilities to Ba2+ and Mg2+ ions. Ca(2+)-permeable channels showed slow and reversible inactivation. The single-channel conductance was 13 pS in 40 mM CaCl2. These data provide direct evidence for the existence of voltage-dependent Ca2+ channels in the plasma membrane of a higher plant cell and point to physiological mechanisms for plant Ca2+ channel regulation. The depolarization-activated Ca(2+)-permeable channels identified here could constitute a regulated pathway for Ca2+ influx in response to physiologically occurring stimulus-induced depolarizations in higher plant cells.
New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.
Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy
2004-10-01
We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.
Firth, Amy L.; Remillard, Carmelle V.; Platoshyn, Oleksandr; Fantozzi, Ivana; Ko, Eun A.; Yuan, Jason X.-J.
2011-01-01
The activity of voltage-gated ion channels is critical for the maintenance of cellular membrane potential and generation of action potentials. In turn, membrane potential regulates cellular ion homeostasis, triggering the opening and closing of ion channels in the plasma membrane and, thus, enabling ion transport across the membrane. Such transmembrane ion fluxes are important for excitation–contraction coupling in pulmonary artery smooth muscle cells (PASMC). Families of voltage-dependent cation channels known to be present in PASMC include voltage-gated K+ (Kv) channels, voltage-dependent Ca2+-activated K+ (Kca) channels, L- and T- type voltage-dependent Ca2+ channels, voltage-gated Na+ channels and voltage-gated proton channels. When cells are dialyzed with Ca2+-free K+- solutions, depolarization elicits four components of 4-aminopyridine (4-AP)-sensitive Kvcurrents based on the kinetics of current activation and inactivation. In cell-attached membrane patches, depolarization elicits a wide range of single-channel K+ currents, with conductances ranging between 6 and 290 pS. Macroscopic 4-AP-sensitive Kv currents and iberiotoxin-sensitive Kca currents are also observed. Transcripts of (a) two Na+ channel α-subunit genes (SCN5A and SCN6A), (b) six Ca2+ channel α–subunit genes (α1A, α1B, α1X, α1D, α1Eand α1G) and many regulatory subunits (α2δ1, β1-4, and γ6), (c) 22 Kv channel α–subunit genes (Kv1.1 - Kv1.7, Kv1.10, Kv2.1, Kv3.1, Kv3.3, Kv3.4, Kv4.1, Kv4.2, Kv5.1, Kv 6.1-Kv6.3, Kv9.1, Kv9.3, Kv10.1 and Kv11.1) and three Kv channel β-subunit genes (Kvβ1-3) and (d) four Kca channel α–subunit genes (Sloα1 and SK2-SK4) and four Kca channel β-subunit genes (Kcaβ1-4) have been detected in PASMC. Tetrodotoxin-sensitive and rapidly inactivating Na+ currents have been recorded with properties similar to those in cardiac myocytes. In the presence of 20 mM external Ca2+, membrane depolarization from a holding potential of -100 mV elicits a rapidly
NASA Technical Reports Server (NTRS)
Obenschain, A. F.; Faith, T. J.
1973-01-01
Emperical equations have been derived from measurements of solar cell photovoltaic characteristics relating light generated current, IL, and open circuit voltage, VO, to cell temperature, T, intensity of illumination, W, and 1 Mev electron fluence, phi both 2 ohm-cm and 10 ohm-cm cells were tested. The temperature dependency of IL is similar for both resistivities at 140mw/sq cm; at high temperature the coefficient varies with fluence as phi 0.18, while at low temperatures the coefficient is relatively independent of fluence. Fluence dependent degration causes a decrease in IL at a rate proportional to phi 0.153 for both resistivities. At all intensities other than 560 mw/sq cm, a linear dependence of IL on illumination was found. The temperature coefficient of voltage was, to a good approximation, independent of both temperature and illumination for both resistivities. Illumination dependence of VOC was logarithmic, while the decrease with fluence of VOC varied as phi 0.25 for both resistivities.
NASA Astrophysics Data System (ADS)
Janssen, Paul; Wouters, Steinar H. W.; Cox, Matthijs; Koopmans, Bert
2013-11-01
In recent years, it was discovered that the current through an organic semiconductor, sandwiched between two non-magnetic electrodes, can be changed significantly by applying a small magnetic field. This surprisingly large magnetoresistance effect, often dubbed as organic magnetoresistance (OMAR), has puzzled the young field of organic spintronics during the last decade. Here, we present a detailed study on the voltage and temperature dependence of OMAR, aiming to unravel the lineshapes of the magnetic field effects and thereby gain a deeper fundamental understanding of the underlying microscopic mechanism. Using a full quantitative analysis of the lineshapes, we are able to extract all linewidth parameters and the voltage and temperature dependencies are explained with a recently proposed trion mechanism. Moreover, explicit microscopic simulations show a qualitative agreement to the experimental results.
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
NASA Astrophysics Data System (ADS)
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
The voltage-dependent anion channel as a biological transistor: theoretical considerations.
Lemeshko, V V; Lemeshko, S V
2004-07-01
The voltage-dependent anion channel (VDAC) is a porin of the mitochondrial outer membrane with a bell-shaped permeability-voltage characteristic. This porin restricts the flow of negatively charged metabolites at certain non-zero voltages, and thus might regulate their flux across the mitochondrial outer membrane. Here, we have developed a mathematical model illustrating the possibility of interaction between two steady-state fluxes of negatively charged metabolites circulating across the VDAC in a membrane. The fluxes interact by contributing to generation of the membrane electrical potential with subsequent closure of the VDAC. The model predicts that the VDAC might function as a single-molecule biological transistor and amplifier, because according to the obtained calculations a small change in the flux of one pair of different negatively charged metabolites causes a significant modulation of a more powerful flux of another pair of negatively charged metabolites circulating across the same membrane with the VDAC. Such transistor-like behavior of the VDAC in the mitochondrial outer membrane might be an important principle of the cell energy metabolism regulation under some physiological conditions.
Low-Voltage Electrowetting on a Lipid Bilayer Formed on Hafnium Oxide
2011-06-01
currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES...exceeding 10 V [9-10]. Here we report the development of electrowetting systems that do not contain solid organic dielectrics such as fluoropolymers, but...and the effective thickness ( T : :) of the bilayer in response to applied voltage are plotted in Fig. 3(b). The capacitance per area increased with
DiFranco, Marino; Capote, Joana; Quiñonez, Marbella; Vergara, Julio L
2007-12-01
Two hybrid voltage-sensing systems based on fluorescence resonance energy transfer (FRET) were used to record membrane potential changes in the transverse tubular system (TTS) and surface membranes of adult mice skeletal muscle fibers. Farnesylated EGFP or ECFP (EGFP-F and ECFP-F) were used as immobile FRET donors, and either non-fluorescent (dipicrylamine [DPA]) or fluorescent (oxonol dye DiBAC(4)(5)) lipophilic anions were used as mobile energy acceptors. Flexor digitorum brevis (FDB) muscles were transfected by in vivo electroporation with pEGFP-F and pECFP-F. Farnesylated fluorescent proteins were efficiently expressed in the TTS and surface membranes. Voltage-dependent optical signals resulting from resonance energy transfer from fluorescent proteins to DPA were named QRET transients, to distinguish them from FRET transients recorded using DiBAC(4)(5). The peak DeltaF/F of QRET transients elicited by action potential stimulation is twice larger in fibers expressing ECFP-F as those with EGFP-F (7.1% vs. 3.6%). These data provide a unique experimental demonstration of the importance of the spectral overlap in FRET. The voltage sensitivity of QRET and FRET signals was demonstrated to correspond to the voltage-dependent translocation of the charged acceptors, which manifest as nonlinear components in current records. For DPA, both electrical and QRET data were predicted by radial cable model simulations in which the maximal time constant of charge translocation was 0.6 ms. FRET signals recorded in response to action potentials in fibers stained with DiBAC(4)(5) exhibit DeltaF/F amplitudes as large as 28%, but their rising phase was slower than those of QRET signals. Model simulations require a time constant for charge translocation of 1.6 ms in order to predict current and FRET data. Our results provide the basis for the potential use of lipophilic ions as tools to test for fast voltage-dependent conformational changes of membrane proteins in the TTS.
Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing
NASA Technical Reports Server (NTRS)
Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.
2013-01-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the
Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui
2018-01-01
Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Vaccaro, S. R.
2011-09-01
The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.
Structure of the human voltage-dependent anion channel
Bayrhuber, Monika; Meins, Thomas; Habeck, Michael; Becker, Stefan; Giller, Karin; Villinger, Saskia; Vonrhein, Clemens; Griesinger, Christian; Zweckstetter, Markus; Zeth, Kornelius
2008-01-01
The voltage-dependent anion channel (VDAC), also known as mitochondrial porin, is the most abundant protein in the mitochondrial outer membrane (MOM). VDAC is the channel known to guide the metabolic flux across the MOM and plays a key role in mitochondrially induced apoptosis. Here, we present the 3D structure of human VDAC1, which was solved conjointly by NMR spectroscopy and x-ray crystallography. Human VDAC1 (hVDAC1) adopts a β-barrel architecture composed of 19 β-strands with an α-helix located horizontally midway within the pore. Bioinformatic analysis indicates that this channel architecture is common to all VDAC proteins and is adopted by the general import pore TOM40 of mammals, which is also located in the MOM. PMID:18832158
Keceli, Batu; Kubo, Yoshihiro
2014-01-01
P2X2 is an extracellular ATP-gated cation channel which has a voltage-dependent gating property even though it lacks a canonical voltage sensor. It is a trimer in which each subunit has two transmembrane helices and a large extracellular domain. The three inter-subunit ATP binding sites are linked to the pore forming transmembrane (TM) domains by β-strands. We analysed structural rearrangements of the linker strands between the ATP binding site and TM domains upon ligand binding and voltage change, electrophysiologically in Xenopus oocytes, using mutants carrying engineered thiol-modifiable cysteine residues. (1) We demonstrated that the double mutant D315C&I67C (at β-14 and β-1, respectively) shows a 2- to 4-fold increase in current amplitude after treatment with a reducing reagent, dithiothreitol (DTT). Application of the thiol-reactive metal Cd2+ induced current decline due to bond formation between D315C and I67C. This effect was not observed in wild type (WT) or in single point mutants. (2) Cd2+-induced current decline was analysed in hyperpolarized and depolarized conditions with different pulse protocols, and also in the presence and absence of ATP. (3) Current decline induced by Cd2+ could be clearly observed in the presence of ATP, but was not clear in the absence of ATP, showing a state-dependent modification. (4) In the presence of ATP, Cd2+ modification was significantly faster in hyperpolarized than in depolarized conditions, showing voltage-dependent structural rearrangements of the linker strands. (5) Experiments using tandem trimeric constructs (TTCs) with controlled number and position of mutations in the trimer showed that the bridging by Cd2+ between 315 and 67 was not intra- but inter-subunit. (6) Finally, we performed similar analyses of a pore mutant T339S, which makes the channel activation voltage insensitive. Cd2+ modification rates of T339S were similar in hyperpolarized and depolarized conditions. Taking these results together, we
Calibration of Voltage Transformers and High- Voltage Capacitors at NIST
Anderson, William E.
1989-01-01
The National Institute of Standards and Technology (NIST) calibration service for voltage transformers and high-voltage capacitors is described. The service for voltage transformers provides measurements of ratio correction factors and phase angles at primary voltages up to 170 kV and secondary voltages as low as 10 V at 60 Hz. Calibrations at frequencies from 50–400 Hz are available over a more limited voltage range. The service for high-voltage capacitors provides measurements of capacitance and dissipation factor at applied voltages ranging from 100 V to 170 kV at 60 Hz depending on the nominal capacitance. Calibrations over a reduced voltage range at other frequencies are also available. As in the case with voltage transformers, these voltage constraints are determined by the facilities at NIST. PMID:28053409
Crystal Structure of a Mammalian Voltage-Dependent Shaker Family K+ Channel
NASA Astrophysics Data System (ADS)
Long, Stephen B.; Campbell, Ernest B.; MacKinnon, Roderick
2005-08-01
Voltage-dependent potassium ion (K+) channels (Kv channels) conduct K+ ions across the cell membrane in response to changes in the membrane voltage, thereby regulating neuronal excitability by modulating the shape and frequency of action potentials. Here we report the crystal structure, at a resolution of 2.9 angstroms, of a mammalian Kv channel, Kv1.2, which is a member of the Shaker K+ channel family. This structure is in complex with an oxido-reductase β subunit of the kind that can regulate mammalian Kv channels in their native cell environment. The activation gate of the pore is open. Large side portals communicate between the pore and the cytoplasm. Electrostatic properties of the side portals and positions of the T1 domain and β subunit are consistent with electrophysiological studies of inactivation gating and with the possibility of K+ channel regulation by the β subunit.
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-01-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4–S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4–S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules. PMID:25818916
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A
2015-03-30
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
NASA Astrophysics Data System (ADS)
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Raman, I M; Trussell, L O
1995-01-01
We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330
NASA Astrophysics Data System (ADS)
Cheng, Xin-Bing; Liu, Jin-Liang; Zhang, Hong-Bo; Feng, Jia-Huai; Qian, Bao-Liang
2010-07-01
The Blumlein pulse forming line (BPFL) consisting of an inner coaxial pulse forming line (PFL) and an outer coaxial PFL is widely used in the field of pulsed power, especially for intense electron-beam accelerators (IEBA). The output voltage waveform determines the quality and characteristics of the output beam current of the IEBA. Comparing with the conventional BPFL, an IEBA based on a helical type BPFL can increase the duration of the output voltage in the same geometrical volume. However, for the helical type BPFL, the voltage waveform on a matched load may be distorted which influences the electron-beam quality. In this paper, an IEBA based on helical type BPFL is studied theoretically. Based on telegrapher equations of the BPFL, a formula for the output voltage of IEBA is obtained when the transition section is taken into account, where the transition section is between the middle cylinder of BPFL and the load. From the theoretical analysis, it is found that the wave impedance and transit time of the transition section influence considerably the main pulse voltage waveform at the load, a step is formed in front of the main pulse, and a sharp spike is also formed at the end of the main pulse. In order to get a well-shaped square waveform at the load and to improve the electron-beam quality of such an accelerator, the wave impedance of the transition section should be equal to that of the inner PFL of helical type BPFL and the transit time of the transition section should be designed as short as possible. Experiments performed on an IEBA with the helical type BPFL show reasonable agreement with theoretical analysis.
Biphasic Effect of Nitric Oxide on the Cardiac Voltage-dependent Anion Channel
Cheng, Qunli; Sedlic, Filip; Pravdic, Danijel; Bosnjak, Zeljko J.; Kwok, Wai-Meng
2010-01-01
Nitric oxide (NO˙) effects on the cardiac mitochondrial voltage-dependent anion channel (VDAC) are unknown. The effects of exogenous NO˙ on VDAC purified from rat hearts were investigated in this study. When incorporated into lipid bilayers, VDAC was inhibited directly by an NO˙ donor, PAPA NONOate, in a concentration-dependent biphasic manner. This was prevented by an NO˙ scavenger, PTIO. The effect paralleled that of NO˙ in delaying the opening of the mitochondrial permeability transition (PT) pore. These biphasic effects on the cardiac VDAC and the PT pore reveal a tandem impact of NO˙ on the two mitochondrial entities. PMID:21156174
Fernandes, A P; Báo, S N
1998-08-01
Ultrastructural cytochemical techniques were used for the localization of phosphatases in spermatid and spermatozoon, as well as in Sertoli cells of Odontophrynus cultripes (Amphibia, Anura, Leptodactylidae). Acid phosphatase was found in the acrosome. Thiamine pyrophosphatase was observed in the Golgi cisternae and in the tail spermatozoon surface. Glucose-6-phosphatase was located in the membrane complex of the acrosomal region. Already, in the Sertoli cells acid phosphatase was located in the lysosomes and glucose-6-phosphatase was observed in association with the endoplasmic reticulum and Golgi complex. These observations support the idea that various phosphatases may play some role in spermatid differentiation and in the interactions germ cells--Sertoli cells during spermiogenesis process.
Stress-dependent voltage offsets from polymer insulators used in rock mechanics and material testing
NASA Astrophysics Data System (ADS)
Carlson, G. G.; Dahlgren, R.; Vanderbilt, V. C.; Johnston, M. J.; Dunson, C.; Gray, A.; Freund, F.
2013-12-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics, material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In many experimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has been qualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent during high-impedance measurements if not mitigated. However even when following best practices, a force-dependent voltage signal still remains and its behavior is explored in this presentation. In this experiment two thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternately between three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testing machine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming the relative dielectric permittivity of PE is ~2.3. The outer two aluminum bars were connected to the LO input of the electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed to be a linear function of the baseline voltage for a given change in applied force. For a periodically applied force of 66.7 kN the voltage
Rosenkranz, J. Amiel
2012-01-01
The amygdala has a fundamental role in driving affective behaviors in response to sensory cues. To accomplish this, neurons of the lateral nucleus (LAT) must integrate a large number of synaptic inputs. A wide range of factors influence synaptic integration, including membrane potential, voltage-gated ion channels and GABAergic inhibition. However, little is known about how these factors modulate integration of synaptic inputs in LAT neurons in vivo. The purpose of this study was to determine the voltage-dependent factors that modify in vivo integration of synaptic inputs in the soma of LAT neurons. In vivo intracellular recordings from anesthetized rats were used to measure post-synaptic potentials (PSPs) and clusters of PSPs across a range of membrane potentials. These studies found that the relationship between membrane potential and PSP clusters was sublinear, due to a reduction of cluster amplitude and area at depolarized membrane potentials. In combination with intracellular delivery of pharmacological agents, it was found that the voltage-dependent suppression of PSP clusters was sensitive to tetraethylammonium (TEA), but not cesium or a blocker of fast GABAergic inhibition. These findings indicate that integration of PSPs in LAT neurons in vivo is strongly modified by somatic membrane potential, likely through voltage-dependent TEA-sensitive potassium channels. Conditions that lead to a shift in membrane potential, or a modulation of the number or function of these ion channels will lead to a more uniform capacity for integration across voltages, and perhaps greatly facilitate amygdala-dependent behaviors. PMID:22989917
Badenhorst, Werner; Hanekom, Tania; Hanekom, Johan J
2016-12-01
This study presents the development of an alternative noise current term and novel voltage-dependent current noise algorithm for conductance-based stochastic auditory nerve fibre (ANF) models. ANFs are known to have significant variance in threshold stimulus which affects temporal characteristics such as latency. This variance is primarily caused by the stochastic behaviour or microscopic fluctuations of the node of Ranvier's voltage-dependent sodium channels of which the intensity is a function of membrane voltage. Though easy to implement and low in computational cost, existing current noise models have two deficiencies: it is independent of membrane voltage, and it is unable to inherently determine the noise intensity required to produce in vivo measured discharge probability functions. The proposed algorithm overcomes these deficiencies while maintaining its low computational cost and ease of implementation compared to other conductance and Markovian-based stochastic models. The algorithm is applied to a Hodgkin-Huxley-based compartmental cat ANF model and validated via comparison of the threshold probability and latency distributions to measured cat ANF data. Simulation results show the algorithm's adherence to in vivo stochastic fibre characteristics such as an exponential relationship between the membrane noise and transmembrane voltage, a negative linear relationship between the log of the relative spread of the discharge probability and the log of the fibre diameter and a decrease in latency with an increase in stimulus intensity.
Adhesive curing through low-voltage activation
Ping, Jianfeng; Gao, Feng; Chen, Jian Lin; Webster, Richard D.; Steele, Terry W. J.
2015-01-01
Instant curing adhesives typically fall within three categories, being activated by either light (photocuring), heat (thermocuring) or chemical means. These curing strategies limit applications to specific substrates and can only be activated under certain conditions. Here we present the development of an instant curing adhesive through low-voltage activation. The electrocuring adhesive is synthesized by grafting carbene precursors on polyamidoamine dendrimers and dissolving in aqueous solvents to form viscous gels. The electrocuring adhesives are activated at −2 V versus Ag/AgCl, allowing tunable crosslinking within the dendrimer matrix and on both electrode surfaces. As the applied voltage discontinued, crosslinking immediately terminated. Thus, crosslinking initiation and propagation are observed to be voltage and time dependent, enabling tuning of both material properties and adhesive strength. The electrocuring adhesive has immediate implications in manufacturing and development of implantable bioadhesives. PMID:26282730
Bennekou, Poul; Barksmann, Trine L; Jensen, Lars R; Kristensen, Berit I; Christophersen, Palle
2004-05-01
Suspension of intact human red cells in media with low chloride and sodium concentrations (isotonic sucrose substitution) results in strongly inside positive membrane potentials, which activate the voltage-dependent non-selective cation (NSVDC) channel. By systematic variation of the initial Nernst potentials for chloride (degree of ion substitution) as well as the chloride conductance (block by NS1652), and by exploiting the interplay between the Ca(2+)-permeable NSVDC channel, the Ca(2+)-activated K+ channel (the Gárdos channel) and the Ca(2+)-pump, a graded activation of the NSVDC channel was achieved. Under these conditions, it was shown that the NSVDC channels exist in two states of activation depending on the initial conditions for the activation. The hysteretic behaviour, which in patch clamp experiments has been found for the individual channel unit, is thus retained at the cellular level and can be demonstrated with red cells in suspension.
Ye, Q; Heck, G L; DeSimone, J A
1993-07-01
1. Voltage-clamp and current-clamp data were obtained from a circumscribed region of the anterior rat lingual epithelium while simultaneously monitoring the afferent, stimulus-evoked, neural response from the same receptive field. 2. Chorda tympani (CT) responses at constant Na(+)-salt concentration were enhanced by submucosa negative voltage clamp and suppressed by positive voltage clamp. The complete CT response profile, including the time course of adaptation, was not uniquely determined by NaCl concentration alone. The response could be reproduced at different NaCl concentrations by applying a compensating voltage. 3. The form of the concentration and voltage dependence of the CT response indicates that the complete stimulus energy is the Na+ electrochemical potential difference across receptor cell apical membranes, and not Na+ concentration alone. This is the underlying principal behind the equivalence of chemical and electric taste for Na+ salts. 4. CT responses to sodium gluconate (25 and 200 mM) and 25 mM NaCl produced amiloride-insensitive components (AIC) of low magnitude. NaCl at 200 mM produced a significantly larger AIC. The AIC was voltage-clamp independent. The relative magnitude of the AIC was positively correlated with the transepithelial conductance of each salt. This suggests that the large AIC for 200 mM NaCl results from its relatively high permeability through the paracellular pathway. 5. Analysis of the CT response under voltage clamp revealed two anion effects on Na(+)-salt taste, both of which act through the paracellular shunt. 1) Anions modify the transepithelial potential (TP) across tight junctions and thereby modulate the cell receptor potential. This anion effect can be eliminated by voltage clamping the TP. 2) Sufficiently mobile anions facilitate electroneutral diffusion of Na+ salts through tight junctions. This effect is observed especially when Cl- is the anion and when the stimulus concentration favors NaCl influx, allowing Na
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Amarillo, Yimy; De Santiago-Castillo, Jose A; Dougherty, Kevin; Maffie, Jonathon; Kwon, Elaine; Covarrubias, Manuel; Rudy, Bernardo
2008-04-15
Kv4 channels mediate most of the somatodendritic subthreshold operating A-type current (I(SA)) in neurons. This current plays essential roles in the regulation of spike timing, repetitive firing, dendritic integration and plasticity. Neuronal Kv4 channels are thought to be ternary complexes of Kv4 pore-forming subunits and two types of accessory proteins, Kv channel interacting proteins (KChIPs) and the dipeptidyl-peptidase-like proteins (DPPLs) DPPX (DPP6) and DPP10. In heterologous cells, ternary Kv4 channels exhibit inactivation that slows down with increasing depolarization. Here, we compared the voltage dependence of the inactivation rate of channels expressed in heterologous mammalian cells by Kv4.2 proteins with that of channels containing Kv4.2 and KChIP1, Kv4.2 and DPPX-S, or Kv4.2, KChIP1 and DPPX-S, and found that the relation between inactivation rate and membrane potential is distinct for these four conditions. Moreover, recordings from native neurons showed that the inactivation kinetics of the I(SA) in cerebellar granule neurons has voltage dependence that is remarkably similar to that of ternary Kv4 channels containing KChIP1 and DPPX-S proteins in heterologous cells. The fact that this complex and unique behaviour (among A-type K(+) currents) is observed in both the native current and the current expressed in heterologous cells by the ternary complex containing Kv4, DPPX and KChIP proteins supports the hypothesis that somatically recorded native Kv4 channels in neurons include both types of accessory protein. Furthermore, quantitative global kinetic modelling showed that preferential closed-state inactivation and a weakly voltage-dependent opening step can explain the slowing of the inactivation rate with increasing depolarization. Therefore, it is likely that preferential closed-state inactivation is the physiological mechanism that regulates the activity of both ternary Kv4 channel complexes and native I(SA)-mediating channels.
Post-translational cleavage of Hv1 in human sperm tunes pH- and voltage-dependent gating.
Berger, Thomas K; Fußhöller, David M; Goodwin, Normann; Bönigk, Wolfgang; Müller, Astrid; Dokani Khesroshahi, Nasim; Brenker, Christoph; Wachten, Dagmar; Krause, Eberhard; Kaupp, U Benjamin; Strünker, Timo
2017-03-01
In human sperm, proton flux across the membrane is controlled by the voltage-gated proton channel Hv1. We show that sperm harbour both Hv1 and an N-terminally cleaved isoform termed Hv1Sper. The pH-control of Hv1Sper and Hv1 is distinctively different. Hv1Sper and Hv1 can form heterodimers that combine features of both constituents. Cleavage and heterodimerization of Hv1 might represent an adaptation to the specific requirements of pH control in sperm. In human sperm, the voltage-gated proton channel Hv1 controls the flux of protons across the flagellar membrane. Here, we show that sperm harbour Hv1 and a shorter isoform, termed Hv1Sper. Hv1Sper is generated from Hv1 by removal of 68 amino acids from the N-terminus by post-translational proteolytic cleavage. The pH-dependent gating of the channel isoforms is distinctly different. In both Hv1 and Hv1Sper, the conductance-voltage relationship is determined by the pH difference across the membrane (∆pH). However, simultaneous changes in intracellular and extracellular pH that leave ΔpH constant strongly shift the activation curve of Hv1Sper but not that of Hv1, demonstrating that cleavage of the N-terminus tunes pH sensing in Hv1. Moreover, we show that Hv1 and Hv1Sper assemble as heterodimers that combine features of both constituents. We suggest that cleavage and heterodimerization of Hv1 represents an adaptation to the specific requirements of pH control in sperm. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.
Singh, Anamika; Gebhart, Mathias; Fritsch, Reinhard; Sinnegger-Brauns, Martina J; Poggiani, Chiara; Hoda, Jean-Charles; Engel, Jutta; Romanin, Christoph; Striessnig, Jörg; Koschak, Alexandra
2008-07-25
Low voltage activation of Ca(V)1.3 L-type Ca(2+) channels controls excitability in sensory cells and central neurons as well as sinoatrial node pacemaking. Ca(V)1.3-mediated pacemaking determines neuronal vulnerability of dopaminergic striatal neurons affected in Parkinson disease. We have previously found that in Ca(V)1.4 L-type Ca(2+) channels, activation, voltage, and calcium-dependent inactivation are controlled by an intrinsic distal C-terminal modulator. Because alternative splicing in the Ca(V)1.3 alpha1 subunit C terminus gives rise to a long (Ca(V)1.3(42)) and a short form (Ca(V)1.3(42A)), we investigated if a C-terminal modulatory mechanism also controls Ca(V)1.3 gating. The biophysical properties of both splice variants were compared after heterologous expression together with beta3 and alpha2delta1 subunits in HEK-293 cells. Activation of calcium current through Ca(V)1.3(42A) channels was more pronounced at negative voltages, and inactivation was faster because of enhanced calcium-dependent inactivation. By investigating several Ca(V)1.3 channel truncations, we restricted the modulator activity to the last 116 amino acids of the C terminus. The resulting Ca(V)1.3(DeltaC116) channels showed gating properties similar to Ca(V)1.3(42A) that were reverted by co-expression of the corresponding C-terminal peptide C(116). Fluorescence resonance energy transfer experiments confirmed an intramolecular protein interaction in the C terminus of Ca(V)1.3 channels that also modulates calmodulin binding. These experiments revealed a novel mechanism of channel modulation enabling cells to tightly control Ca(V)1.3 channel activity by alternative splicing. The absence of the C-terminal modulator in short splice forms facilitates Ca(V)1.3 channel activation at lower voltages expected to favor Ca(V)1.3 activity at threshold voltages as required for modulation of neuronal firing behavior and sinoatrial node pacemaking.
Low-power low-voltage superior-order curvature corrected voltage reference
NASA Astrophysics Data System (ADS)
Popa, Cosmin
2010-06-01
A complementary metal oxide semiconductor (CMOS) voltage reference with a logarithmic curvature-correction will be presented. The first-order compensation is realised using an original offset voltage follower (OVF) block as a proportional to absolute temperature (PTAT) voltage generator, with the advantages of reducing the silicon area and of increasing accuracy by replacing matched resistors with matched transistors. The new logarithmic curvature-correction technique will be implemented using an asymmetric differential amplifier (ADA) block for compensating the logarithmic temperature dependent term from the first-order compensated voltage reference. In order to increase the circuit accuracy, an original temperature-dependent current generator will be designed for computing the exact type of the implemented curvature-correction. The relatively small complexity of the current squarer allows an important increasing of the circuit accuracy that could be achieved by increasing the current generator complexity. As a result of operating most of the MOS transistors in weak inversion, the original proposed voltage reference could be valuable for low-power applications. The circuit is implemented in 0.35 μm CMOS technology and consumes only 60μA for t = 25°C, being supplied at the minimal supply voltage V DD = 1.75V. The temperature coefficient of the reference voltage is 8.7 ppm/°C, while the line sensitivity is 0.75 mV/V for a supply voltage between 1.75 V and 7 V.
Alnima, Teba; Scheffers, Ingrid; De Leeuw, Peter W; Winkens, Bjorn; Jongen-Vancraybex, Heidi; Tordoir, Jan H M; Schmidli, Jürg; Mohaupt, Markus G; Allemann, Yves; Kroon, Abraham A
2012-08-01
Chronic carotid baroreflex stimulation (Rheos system) has been shown to effectively reduce blood pressure in patients with resistant hypertension. Upon acute stimulation blood pressure also falls as a function of voltage. the aim of this study is to evaluate whether this voltage-dependent blood pressure decrease is preserved after long-term carotid baroreflex stimulation. Forty-five patients implanted with Rheos underwent a voltage response test (VRT) before the start of carotid baroreflex activation (1m), as well as after 4 (4m) and 13 months (13 m) of device implantation. After switching off the device for 10 min (0 V), we started the VRT by increasing voltage from 1 to 6 V, by 1-V steps every 5 min. Blood pressure and heart rate were measured at the end of every step. At 1m, mean blood pressure was 178/101 mmHg at 0 V and fell to 142/83 mmHg at 6 V. Heart rate fell from 75 to 65 beats/min. At 4m and 13 m mean blood pressure was significantly lower compared to 1m when VRT started at 0 V (170/96 and 161/93 mmHg, respectively). However, pattern of blood pressure decrease during VRT was comparable with this at 1m. Maximum SBP reduction during VRT did not change with long-term therapy. Acute voltage-dependent blood pressure and heart rate decrease with electrical baroreflex stimulation is preserved after at least 1 year of continuous activation in patients with resistant hypertension. This indicates that response adaptation and nerve fatigue are very unlikely in long-term carotid baroreflex activation.
Na+/Ca2+ exchange in cardiac myocytes. Effect of ouabain on voltage dependence.
Lee, H C; Clusin, W T
1987-02-01
Sarcolemmal sodium/calcium exchange activity was examined in individual chick embryonic myocardial cell aggregates that were loaded with quin 2. The baseline [Ca2+]i was 68 +/- 4 nM (n = 29). Abrupt superfusion with sodium-free lithium solution produced a fourfold increase in steady-state [Ca2+]i to 290 +/- 19 nM, which was reversible upon sodium restitution. Other methods of increasing [Ca2+]i such as KCl-depolarization or caffeine produced a dose-dependent increase in quin 2 fluorescence, accompanied by sustained contracture. The [Ca2+]i increase in zero sodium was linear, and its half-time (t1/2) of 15.1 +/- 0.1 s was similar to that of the sodium-free contracture (t1/2 = 14.4 +/- 0.5 s) under the same conditions. The sodium-dependent [Ca2+]i increase was not significantly greater when potassium served as the sodium substitute instead of lithium. This suggests that sodium/calcium exchange has little voltage dependence in this situation. However, in aggregates pretreated with ouabain (2.5 microM), the [Ca2+]i increase was almost threefold greater with potassium than with lithium (P less than 0.007). Ouabain therefore potentiated the effect of membrane potential on calcium influx. We propose that elevation of [Na2+]i is a prerequisite for voltage dependence of the sodium/calcium exchange under the conditions studied. Sodium loading will then drastically increase calcium influx during the action potential while inducing an outward membrane current that could accelerate repolarization.
Time and voltage dependences of nanoscale dielectric constant modulation on indium tin oxide films
NASA Astrophysics Data System (ADS)
Li, Liang; Hao, Haoyue; Zhao, Hua
2017-01-01
The modulation of indium tin oxide (ITO) films through surface charge accumulation plays an important role in many different applications. In order to elaborately study the modulation, we measured the dielectric constant of the modulated layer through examining the excitation of surface plasmon polaritons. Charges were pumped on the surfaces of ITO films through applying high voltage in appropriate directions. Experiments unveiled that the dielectric constant of the modulated layer had large variation along with the nanoscale charge accumulation. Corresponding numerical results were worked out through combining Drude model and Mayadas-Shatzkes model. Based on the above results, we deduced the time and voltage dependences of accumulated charge density, which revealed a long-time charge accumulation process.
Piacentino, V; Dipla, K; Gaughan, J P; Houser, S R
2000-03-15
1. Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. 2. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3',5'-monophosphate (cAMP) in the pipette or in the presence of the beta-adrenergic agonist isoproterenol (isoprenaline; ISO). 3. The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. 4. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (VŁ = -57.8 +/- 0.49 mV). 5. ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. 6. The voltage-contraction relationship in 200 microM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. 7. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis.
Piacentino, Valentino; Dipla, Konstantina; Gaughan, John P; Houser, Steven R
2000-01-01
Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 °C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3′,5′-monophosphate (cAMP) in the pipette or in the presence of the β-adrenergic agonist isoproterenol (isoprenaline; ISO). The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (V½ =−57·8 ± 0·49 mV). ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. The voltage-contraction relationship in 200 μM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis. PMID:10718736
Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles
Shirokov, Roman E.
2018-01-01
Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371
Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung
2018-01-01
Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use
Sakata, Souhei; Okamura, Yasushi
2014-01-01
The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor. PMID:24277865
Sakata, Souhei; Okamura, Yasushi
2014-03-01
The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor.
Cantrell, A R; Scheuer, T; Catterall, W A
1999-07-01
Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.
Temperature dependence of the enhanced inverse spin Hall voltage in Pt/Antiferromagnetic/ Y3Fe5O12
NASA Astrophysics Data System (ADS)
Brangham, J. T.; Lee, A. J.; Cheng, Y.; Yu, S. S.; Dunsiger, S. R.; Page, M. R.; Hammel, P. C.; Yang, F. Y.
The generation, propagation, and detection of spin currents are of intense interest in the field of spintronics. Spin current generation by FMR spin pumping using Y3Fe5O12 (YIG) and spin current detection by the inverse spin Hall effect (ISHE) in metals such as Pt have been well studied. This is due to YIG's exceptionally low damping and insulating behavior and the large spin Hall angle of Pt. Previously, our group showed that the ISHE voltages are significantly enhanced by adding a thin intermediate layer of an antiferromagnet (AFM) between Pt and YIG at room temperature. Recent theoretical work predicts a mechanism for this enhancement as well as the temperature dependence of the ISHE voltages of metal/AFM/YIG trilayers. The predictions show a maximum in the ISHE voltages for these systems near the magnetic phase transition temperature of the AFM. Here we present experimental results showing the temperature dependence for Pt/AFM/YIG structures with various AFMs. DOE Grant No. DE-SC0001304.
NASA Astrophysics Data System (ADS)
Lu, J. P.; Cao, G. P.; Quan, G. F.; Wang, C.; Zhuang, J. J.; Song, R. G.
2018-01-01
Micro-arc oxidation (MAO) coatings on KBM10 magnesium alloy were prepared in an electrolyte system with sodium silicate, potassium hydroxide, sodium tungstate, and citric acid. The effects of voltage on the microstructure and corrosion resistance of MAO coatings were studied using stereoscopic microscopy, scanning electron microscopy, x-ray diffraction, scratch tests, potentiodynamic polarization, and electrochemical impedance spectroscopy. The results showed that the roughness of the MAO coatings, diameter, and number of pores increase with the increase in voltage. The coating formed at the voltage of 350 V exhibited the best adhesive strength when evaluated by the automatic scratch tester. The coatings were mainly composed of MgO, MgWO4, and Mg2SiO4, and the content of Mg2SiO4 increased with the increase in voltage. The corrosion resistance of MAO coatings could be improved by changing the applied voltage, and the best corrosion resistance of MAO coating was observed at the voltage of 350 V.
Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam
NASA Astrophysics Data System (ADS)
Andreev, Andrey
2005-10-01
The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Power conditioning using dynamic voltage restorers under different voltage sag types
Saeed, Ahmed M.; Abdel Aleem, Shady H.E.; Ibrahim, Ahmed M.; Balci, Murat E.; El-Zahab, Essam E.A.
2015-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type. PMID:26843975
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boudier, J.L.; Jover, E.; Cau, P.
1988-05-01
Alpha-scorpion toxins bind specifically to the voltage-sensitive sodium channel in excitable membranes, and binding is potential-dependent. The radioiodinated toxin II from the scorpion Androctonus australis Hector (alpha ScTx) was used to localize voltage-sensitive sodium channels on the presynaptic side of mouse neuromuscular junctions (NMJ) by autoradiography using both light and electron microscopy. Silver grain localization was analyzed by the cross-fire method. At the light-microscopic level, grain density over NMJ appeared 6-8x higher than over nonjunctional muscle membrane. The specificity of labeling was verified by competition/displacement with an excess of native alpha ScTx. Labeling was also inhibited by incubation in depolarizingmore » conditions, showing its potential-dependence. At the electron-microscopic level, analysis showed that voltage-sensitive sodium channels labeled with alpha ScTx were almost exclusively localized on membranes, as expected. Due to washout after incubation, appreciable numbers of binding sites were not found on the postsynaptic membranes. However, on the presynaptic side, alpha ScTx-labeled voltage-sensitive sodium channels were localized on the membrane of non-myelin-forming Schwann cells covering NMJ. The axonal presynaptic membrane was not labeled. These results show that voltage-sensitive sodium channels are present on glial cells in vivo, as already demonstrated in vitro. It is proposed that these glial channels could be indirectly involved in the ionic homeostasis of the axonal environment.« less
Tetrodotoxin-sensitive, voltage-dependent sodium currents in hair cells from the alligator cochlea.
Evans, M G; Fuchs, P A
1987-10-01
We have used whole-cell patch clamp techniques to record from tall hair cells isolated from the apical half of the alligator cochlea. Some of these cells gave action potentials in response to depolarizing current injections. When the same cells were voltage clamped, large transient inward currents followed by smaller outward currents were seen in response to depolarizing steps. We studied the transient inward current after the outward current had been blocked by external tetraethylammonium (20 mM) or by replacing internal potassium with cesium. It was found to be a sodium current because it was abolished by either replacing external sodium with choline or by external application of tetrodotoxin (100 nM). The sodium current showed voltage-dependent activation and inactivation. Most of the spiking hair cells came from the apex of the cochlea, where they would be subject to low-frequency mechanical stimulation in vivo.
Ludwig, Carmen F.; Ullrich, Florian; Leisle, Lilia; Stauber, Tobias; Jentsch, Thomas J.
2013-01-01
CLC anion transporters form dimers that function either as Cl− channels or as electrogenic Cl−/H+ exchangers. CLC channels display two different types of “gates,” “protopore” gates that open and close the two pores of a CLC dimer independently of each other and common gates that act on both pores simultaneously. ClC-7/Ostm1 is a lysosomal 2Cl−/1H+ exchanger that is slowly activated by depolarization. This gating process is drastically accelerated by many CLCN7 mutations underlying human osteopetrosis. Making use of some of these mutants, we now investigate whether slow voltage activation of plasma membrane-targeted ClC-7/Ostm1 involves protopore or common gates. Voltage activation of wild-type ClC-7 subunits was accelerated by co-expressing an excess of ClC-7 subunits carrying an accelerating mutation together with a point mutation rendering these subunits transport-deficient. Conversely, voltage activation of a fast ClC-7 mutant could be slowed by co-expressing an excess of a transport-deficient mutant. These effects did not depend on whether the accelerating mutation localized to the transmembrane part or to cytoplasmic cystathionine-β-synthase (CBS) domains of ClC-7. Combining accelerating mutations in the same subunit did not speed up gating further. No currents were observed when ClC-7 was truncated after the last intramembrane helix. Currents and slow gating were restored when the C terminus was co-expressed by itself or fused to the C terminus of the β-subunit Ostm1. We conclude that common gating underlies the slow voltage activation of ClC-7. It depends on the CBS domain-containing C terminus that does not require covalent binding to the membrane domain of ClC-7. PMID:23983121
D242N, a KV7.1 LQTS mutation uncovers a key residue for IKs voltage dependence.
Moreno, Cristina; Oliveras, Anna; Bartolucci, Chiara; Muñoz, Carmen; de la Cruz, Alicia; Peraza, Diego A; Gimeno, Juan R; Martín-Martínez, Mercedes; Severi, Stefano; Felipe, Antonio; Lambiase, Pier D; Gonzalez, Teresa; Valenzuela, Carmen
2017-09-01
K V 7.1 and KCNE1 co-assemble to give rise to the I Ks current, one of the most important repolarizing currents of the cardiac action potential. Its relevance is underscored by the identification of >500 mutations in K V 7.1 and, at least, 36 in KCNE1, that cause Long QT Syndrome (LQTS). The aim of this study was to characterize the biophysical and cellular consequences of the D242N K V 7.1 mutation associated with the LQTS. The mutation is located in the S4 transmembrane segment, within the voltage sensor of the K V 7.1 channel, disrupting the conserved charge balance of this region. Perforated patch-clamp experiments show that, unexpectedly, the mutation did not disrupt the voltage-dependent activation but it removed the inactivation and slowed the activation kinetics of D242N K V 7.1 channels. Biotinylation of cell-surface protein and co-immunoprecipitation experiments revealed that neither plasma membrane targeting nor co-assembly between K V 7.1 and KCNE1 was altered by the mutation. However, the association of D242N K V 7.1 with KCNE1 strongly shifted the voltage dependence of activation to more depolarized potentials (+50mV), hindering I Ks current at physiologically relevant membrane potentials. Both functional and computational analysis suggest that the clinical phenotype of the LQTS patients carrying the D242N mutation is due to impaired action potential adaptation to exercise and, in particular, to increase in heart rate. Moreover, our data identify D242 aminoacidic position as a potential residue involved in the KCNE1-mediated regulation of the voltage dependence of activation of the K V 7.1 channel. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Baier, Fabian; Gruber, Edith; Spangl, Bernhard; Zaller, Johann G.
2016-04-01
Herbicides based on the active ingredient glyphosate are frequently applied in agriculture, horticulture and private gardens all over the world. Recently, leaching of glyphosate or its metabolite (AMPA) into water bodies inhabited by amphibians has been reported. However, very little is known about non-target effects of these herbicides on amphibians and even less is known to what extent different temperatures might alter these effects. Using climate chambers, we investigated the effects of the glyphosate-based herbicide Roundup PowerFlex® (480 g L-1 glyphosate, formulated as 588 g L-1 potassium salt) on the larval development of Common toads (Bufo bufo L.; Amphibia: Anura) under different temperature regimes (15°C vs. 20°C). We established five herbicide concentrations: 0, 1.5, 3, 4 mg acid equivalent L-1 and a 4 mg a.e. L-1 pulse treatment (totally three applications of 1.5, 1.5 and another 1 mg a.e. L-1) at each temperature in a full-factorial design. Each treatment combination was replicated five times, the experiment ran for 24 days. Results showed a highly significant effect of temperature on body length and body width but no effect of herbicide concentration on these growth parameters. Moreover, highly significant interactions between herbicide and temperature on body length and body width were observed suggesting that herbicides had different effects on different temperatures. In conclusion, although Roundup PowerFlex® at the tested concentrations appeared to have no acute toxicity to larvae of Common toads, the observed effects on tadpole morphology will potentially affect competitive interactions in spawning ponds of amphibia. Our findings of herbicide x temperature interactions might become more prevalent when human-induced climate change will lead to more extreme temperatures.
Schmid, M; Feichtinger, W; Steinlein, C; Rupprecht, A; Haaf, T; Kaiser, H
2002-01-01
Highly differentiated, heteromorphic ZZ female symbol /ZW male symbol sex chromosomes were found in the karyotypes of the neotropical leptodactylid frogs Eleutherodactylus euphronides and E. shrevei. The W chromosomes are the largest heterochromatic, female-specific chromosomes so far discovered in the class Amphibia. The analyses of the banding patterns with AT- and GC base-pair specific fluorochromes show that the constitutive heterochromatin in the giant W chromosomes consists of various categories of repetitive DNA sequences. The W chromosomes of both species are similar in size, morphology and banding patterns, whereas their Z chromosomes exhibit conspicuous differences. In the cell nuclei of female animals, the W chromosomes form very prominent chromatin bodies (W chromatin). DNA flow cytometric measurements demonstrate clear differences in the DNA content of male and female erythrocytes caused by the giant W chromosome, and also shows that these Eleutherodactylus genomes are among the smallest of all amphibian genomes. The importance of the heteromorphic ZW sex chromosomes for the study of Z-linked genes, the similarities and differences of the two karyotypes, and the significance of the exceptionally small genomes are discussed. Copyright 2002 S. Karger AG, Basel
Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W
2016-02-01
Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.
Lima, Pedro A; Vicente, M Inês; Alves, Frederico M; Dionísio, José C; Costa, Pedro F
2008-04-01
A role in the control of excitability has been attributed to insulin via modulation of potassium (K(+)) currents. To investigate insulin modulatory effects on voltage-activated potassium currents in a neuronal cell line with origin in the sympathetic system, we performed whole-cell voltage-clamp recordings in differentiated N1E-115 neuroblastoma cells. Two main voltage-activated K(+) currents were identified: (a) a relatively fast inactivating current (I(fast) - time constant 50-300 ms); (b) a slow delayed rectifying K(+) current (I(slow) - time constant 1-4 s). The kinetics of inactivation of I(fast), rather than I(slow), showed clear voltage dependence. I(fast) and I(slow) exhibited different activation and inactivation dependence for voltage, and have different but nevertheless high sensitivities to tetraethylammonium, 4-aminopyridine and quinidine. In differentiated cells - rather than in non-differentiated cells - application of up to 300 nm insulin reduced I(slow) only (IC(50) = 6.7 nm), whereas at higher concentrations I(fast) was also affected (IC(50) = 7.7 microm). The insulin inhibitory effect is not due to a change in the activation or inactivation current-voltage profiles, and the time-dependent inactivation is also not altered; this is not likely to be a result of activation of the insulin-growth-factor-1 (IGF1) receptors, as application of IGF1 did not result in significant current alteration. Results suggest that the current sensitive to low concentrations of insulin is mediated by erg-like channels. Similar observations concerning the insulin inhibitory effect on slow voltage-activated K(+) currents were also made in isolated rat hippocampal pyramidal neurons, suggesting a widespread neuromodulator role of insulin on K(+) channels.
Voltage-Gated Lipid Ion Channels
Blicher, Andreas; Heimburg, Thomas
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times. PMID:23823188
Geibel, Sven; Lörinczi, Èva; Bamberg, Ernst; Friedrich, Thomas
2013-01-01
The light-driven proton pump bacteriorhodopsin (BR) from Halobacterium salinarum is tightly regulated by the [H+] gradient and transmembrane potential. BR exhibits optoelectric properties, since spectral changes during the photocycle are kinetically controlled by voltage, which predestines BR for optical storage or processing devices. BR mutants with prolonged lifetime of the blue-shifted M intermediate would be advantageous, but the optoelectric properties of such mutants are still elusive. Using expression in Xenopus oocytes and two-electrode voltage-clamping, we analyzed photocurrents of BR mutants with kinetically destabilized (F171C, F219L) or stabilized (D96N, D96G) M intermediate in response to green light (to probe H+ pumping) and blue laser flashes (to probe accumulation/decay of M). These mutants have divergent M lifetimes. As for BR-WT, this strictly correlates with the voltage dependence of H+ pumping. BR-F171C and BR-F219L showed photocurrents similar to BR-WT. Yet, BR-F171C showed a weaker voltage dependence of proton pumping. For both mutants, blue laser flashes applied during and after green-light illumination showed reduced M accumulation and shorter M lifetime. In contrast, BR-D96G and BR-D96N exhibited small photocurrents, with nonlinear current-voltage curves, which increased strongly in the presence of azide. Blue laser flashes showed heavy M accumulation and prolonged M lifetime, which accounts for the strongly reduced H+ pumping rate. Hyperpolarizing potentials augmented these effects. The combination of M-stabilizing and -destabilizing mutations in BR-D96G/F171C/F219L (BR-tri) shows that disruption of the primary proton donor Asp-96 is fatal for BR as a proton pump. Mechanistically, M destabilizing mutations cannot compensate for the disruption of Asp-96. Accordingly, BR-tri and BR-D96G photocurrents were similar. However, BR-tri showed negative blue laser flash-induced currents even without actinic green light, indicating that Schiff base
NASA Astrophysics Data System (ADS)
Huang, Fobao; Peng, Yingquan; Xu, Kun; Lv, Wenli; Xu, Sunan; Wang, Ying; Tang, Ying; Wei, Yi; Yang, Yuhuan; Liu, Guohan
2017-05-01
Built-in voltage (V bi) and charge carrier mobility are essential parameters of organic diodes, such as organic photodiodes, organic light-emitting diodes and organic solar cells. The existing methods for charge carrier mobility measurement require either expensive equipment, or stringent sample preparation. We demonstrate a method that simultaneously determines the V bi and charge carrier mobility in organic photodiodes and solar cells from incident light intensity dependent current-voltage characteristics. The V bi is determined from the saturation open-circuit voltage, while the charge carrier mobility from the space-charge limited photocurrent. The V bi for organic diodes, ‘ITO/copper phthalocyanine (CuPc)/2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline (BCP)/Al’, ‘ITO/ lead phthalocyanine (PbPc)/BCP/Al’, ‘ITO/CuPc/C60/BCP/Al’, and ‘ITO/PbPc/C60/BCP/Al’, were measured to be 0.583 ± 0.019, 0.458 ± 0.002, 0.605 ± 0.009 and 0.538 ± 0.004 V, respectively; the hole mobility of CuPc and PbPc thin films were measured to be (1.383 ± 0.367) × 10-6 cm2 V-1 s-1 and (3.675 ± 0.887) × 10-6 cm2 V-1 s-1, respectively. The measured values for V bi and carrier mobility coincide with related experimental results reported in other literature.
Voltage-dependent gating and gating charge measurements in the Kv1.2 potassium channel
Ishida, Itzel G.; Rangel-Yescas, Gisela E.; Carrasco-Zanini, Julia
2015-01-01
Much has been learned about the voltage sensors of ion channels since the x-ray structure of the mammalian voltage-gated potassium channel Kv1.2 was published in 2005. High resolution structural data of a Kv channel enabled the structural interpretation of numerous electrophysiological findings collected in various ion channels, most notably Shaker, and permitted the development of meticulous computational simulations of the activation mechanism. The fundamental premise for the structural interpretation of functional measurements from Shaker is that this channel and Kv1.2 have the same characteristics, such that correlation of data from both channels would be a trivial task. We tested these assumptions by measuring Kv1.2 voltage-dependent gating and charge per channel. We found that the Kv1.2 gating charge is near 10 elementary charges (eo), ∼25% less than the well-established 13–14 eo in Shaker. Next, we neutralized positive residues in the Kv1.2 S4 transmembrane segment to investigate the cause of the reduction of the gating charge and found that, whereas replacing R1 with glutamine decreased voltage sensitivity to ∼50% of the wild-type channel value, mutation of the subsequent arginines had a much smaller effect. These data are in marked contrast to the effects of charge neutralization in Shaker, where removal of the first four basic residues reduces the gating charge by roughly the same amount. In light of these differences, we propose that the voltage-sensing domains (VSDs) of Kv1.2 and Shaker might undergo the same physical movement, but the septum that separates the aqueous crevices in the VSD of Kv1.2 might be thicker than Shaker’s, accounting for the smaller Kv1.2 gating charge. PMID:25779871
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free
NASA Astrophysics Data System (ADS)
Fulmek, P. L.; Haumer, P.; Wenzl, F. P.; Nemitz, W.; Nicolics, J.
2017-03-01
Estimating the junction temperature and its dynamic behavior in dependence of various operating conditions is an important issue, since these properties influence the optical characteristics as well as the aging processes of a light-emitting diode (LED). Particularly for high-power LEDs and pulsed operation, the dynamic behavior and the resulting thermal cycles are of interest. The forward voltage method relies on the existence of a time-independent unique triple of forward-voltage, forward-current, and junction temperature. These three figures should as well uniquely define the optical output power and spectrum, as well as the loss power of the LED, which is responsible for an increase of the junction temperature. From transient FEM-simulations one may expect an increase of the temperature of the active semiconductor layer of some 1/10 K within the first 10 μs. Most of the well-established techniques for junction temperature measurement via forward voltage method evaluate the measurement data several dozens of microseconds after switching on or switching off and estimate the junction temperature by extrapolation towards the time of switching. In contrast, the authors developed a measurement procedure with the focus on the first microseconds after switching. Besides a fast data acquisition system, a precise control of the switching process is required, i.e. a precisely defined current pulse amplitude with fast rise-time and negligible transient by-effects. We start with a short description of the measurement setup and the newly developed control algorithm for the generation of short current pulses. The thermal characterization of the LED chip during the measurement procedures is accomplished by an IR thermography system and transient finite element simulations. The same experimental setup is used to investigate the optical properties of the LED in an Ulbricht-sphere. Our experiments are performed on InGaN LED chips mounted on an Al based insulated metal substrate
NASA Technical Reports Server (NTRS)
Ruitberg, A. P.; Young, K. M. (Inventor)
1985-01-01
A high voltage power supply is formed by three discrete circuits energized by a battery to provide a plurality of concurrent output signals floating at a high output voltage on the order of several tens of kilovolts. In the first two circuits, the regulator stages are pulse width modulated and include adjustable ressistances for varying the duty cycles of pulse trains provided to corresponding oscillator stages while the third regulator stage includes an adjustable resistance for varying the amplitude of a steady signal provided to a third oscillator stage. In the first circuit, the oscillator, formed by a constant current drive network and a tuned resonant network included a step up transformer, is coupled to a second step up transformer which, in turn, supplies an amplified sinusoidal signal to a parallel pair of complementary poled rectifying, voltage multiplier stages to generate the high output voltage.
Structural basis for the inhibition of voltage-dependent K+ channel by gating modifier toxin
Ozawa, Shin-ichiro; Kimura, Tomomi; Nozaki, Tomohiro; Harada, Hitomi; Shimada, Ichio; Osawa, Masanori
2015-01-01
Voltage-dependent K+ (Kv) channels play crucial roles in nerve and muscle action potentials. Voltage-sensing domains (VSDs) of Kv channels sense changes in the transmembrane potential, regulating the K+-permeability across the membrane. Gating modifier toxins, which have been used for the functional analyses of Kv channels, inhibit Kv channels by binding to VSD. However, the structural basis for the inhibition remains elusive. Here, fluorescence and NMR analyses of the interaction between VSD derived from KvAP channel and its gating modifier toxin, VSTx1, indicate that VSTx1 recognizes VSD under depolarized condition. We identified the VSD-binding residues of VSTx1 and their proximal residues of VSD by the cross-saturation (CS) and amino acid selective CS experiments, which enabled to build a docking model of the complex. These results provide structural basis for the specific binding and inhibition of Kv channels by gating modifier toxins. PMID:26382304
Effect of an N-terminus deletion on voltage-dependent gating of the ClC-2 chloride channel
Varela, Diego; Niemeyer, María Isabel; Cid, L Pablo; Sepúlveda, Francisco V
2002-01-01
ClC-2, a chloride channel widely expressed in mammalian tissues, is activated by hyperpolarisation and extracellular acidification. Deletion of amino acids 16–61 in rat ClC-2 abolishes voltage and pH dependence in two-electrode voltage-clamp experiments in amphibian oocytes. These results have been interpreted in terms of a ball-and-chain type of mechanism in which the N-terminus would behave as a ball that is removed from an inactivating site upon hyperpolarisation. We now report whole-cell patch-clamp measurements in mammalian cells showing hyperpolarization-activation of rClC-2Δ16–61 differing only in presenting faster opening and closing kinetics than rClC-2. The lack of time and voltage dependence observed previously was reproduced, however, in nystatin-perforated patch experiments. The behaviour of wild-type rClC-2 did not differ between conventional and nystatin-perforated patches. Similar results were obtained with ClC-2 from guinea-pig. One possible explanation of the results is that some diffusible component is able to lock the channel in an open state but does so only to the mutated channel. Alternative explanations involving the osmotic state of the cell and cytoskeleton structure are also considered. Low extracellular pH activates the wild-type channel but not rClC-2Δ16–61 when expressed in oocytes, a result that had been interpreted to suggest that protons affect the ball-and-chain mechanism. In our experiments no difference was seen in the effect of extracellular pH upon rClC-2 and rClC-2Δ16–61 in either recording configuration, suggesting that protons act independently from possible effects of the N-terminus on gating. Our observations of voltage-dependent gating of the N-terminal deleted ClC-2 are an argument against a ball-and-chain mechanism for this channel. PMID:12381811
Hysteresis in voltage-gated channels.
Villalba-Galea, Carlos A
2017-03-04
Ion channels constitute a superfamily of membrane proteins found in all living creatures. Their activity allows fast translocation of ions across the plasma membrane down the ion's transmembrane electrochemical gradient, resulting in a difference in electrical potential across the plasma membrane, known as the membrane potential. A group within this superfamily, namely voltage-gated channels, displays activity that is sensitive to the membrane potential. The activity of voltage-gated channels is controlled by the membrane potential, while the membrane potential is changed by these channels' activity. This interplay produces variations in the membrane potential that have evolved into electrical signals in many organisms. These signals are essential for numerous biological processes, including neuronal activity, insulin release, muscle contraction, fertilization and many others. In recent years, the activity of the voltage-gated channels has been observed not to follow a simple relationship with the membrane potential. Instead, it has been shown that the activity of voltage-gated channel displays hysteresis. In fact, a growing number of evidence have demonstrated that the voltage dependence of channel activity is dynamically modulated by activity itself. In spite of the great impact that this property can have on electrical signaling, hysteresis in voltage-gated channels is often overlooked. Addressing this issue, this review provides examples of voltage-gated ion channels displaying hysteretic behavior. Further, this review will discuss how Dynamic Voltage Dependence in voltage-gated channels can have a physiological role in electrical signaling. Furthermore, this review will elaborate on the current thoughts on the mechanism underlying hysteresis in voltage-gated channels.
Hysteresis in voltage-gated channels
2017-01-01
ABSTRACT Ion channels constitute a superfamily of membrane proteins found in all living creatures. Their activity allows fast translocation of ions across the plasma membrane down the ion's transmembrane electrochemical gradient, resulting in a difference in electrical potential across the plasma membrane, known as the membrane potential. A group within this superfamily, namely voltage-gated channels, displays activity that is sensitive to the membrane potential. The activity of voltage-gated channels is controlled by the membrane potential, while the membrane potential is changed by these channels' activity. This interplay produces variations in the membrane potential that have evolved into electrical signals in many organisms. These signals are essential for numerous biological processes, including neuronal activity, insulin release, muscle contraction, fertilization and many others. In recent years, the activity of the voltage-gated channels has been observed not to follow a simple relationship with the membrane potential. Instead, it has been shown that the activity of voltage-gated channel displays hysteresis. In fact, a growing number of evidence have demonstrated that the voltage dependence of channel activity is dynamically modulated by activity itself. In spite of the great impact that this property can have on electrical signaling, hysteresis in voltage-gated channels is often overlooked. Addressing this issue, this review provides examples of voltage-gated ion channels displaying hysteretic behavior. Further, this review will discuss how Dynamic Voltage Dependence in voltage-gated channels can have a physiological role in electrical signaling. Furthermore, this review will elaborate on the current thoughts on the mechanism underlying hysteresis in voltage-gated channels. PMID:27689426
NASA Astrophysics Data System (ADS)
Jia, Yun-Peng; Zhao, Bao; Yang, Fei; Wu, Yu; Zhou, Xuan; Li, Zhe; Tan, Jian
2015-12-01
The temperature dependences of forward voltage drop (VF) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (EC-0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested VF results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. Project supported by the Doctoral Fund of Ministry of Education of China (Grant No. 20111103120016) and the State Grid Corporation of China Program of Science and Technology, China (Grant No. 5455DW140003).
Coarse Grained Model for Exploring Voltage Dependent Ion Channels
Dryga, Anatoly; Chakrabarty, Suman; Vicatos, Spyridon; Warshel, Arieh
2011-01-01
The relationship between the membrane voltage and the gating of voltage activated ion channels and other systems have been a problem of great current interest. Unfortunately, reliable molecular simulations of external voltage effects present a major challenge, since meaningful converging microscopic simulations are not yet available and macroscopic treatments involve major uncertainties in terms of the dielectric used and other key features. This work extends our coarse grained (CG) model to simulations of membrane/protein systems under external potential. Special attention has been devoted to a consistent modeling of the effect of external potential due to the electrodes, emphasizing semimacroscopic description of the electrolytes in the solution regions between the membranes and the electrodes, as well as the coupling between the combined potential from the electrodes and electrolytes, and the protein ionization states. We also provide a clear connection to microscopic treatment of the electrolytes and thus can explore possible conceptual problems that are hard to resolve by other current approaches. For example, we obtain a clear description of the charge distribution in the entire electrolyte system, including near the electrodes in membrane/electrodes systems (where continuum models do not seem to provide the relevant results). Furthermore, the present treatment provides an insight on the distribution of the electrolyte charges before and after equilibration across the membrane, and thus on the nature of the gating charge. The different aspects of the model have been carefully validated by considering problems ranging for the simple Debye-Huckel, Gouy-Chapman models to the evaluation of the electrolyte distribution between two electrodes, as well as the effect of extending the simulation system by periodic replicas. Overall the clear connection to microscopic descriptions combined with the power of the CG modeling seems to offer a powerful tool for exploring
Barksmann, Trine L; Kristensen, Berit I; Christophersen, Palle; Bennekou, Poul
2004-01-01
The activation and pharmacological modulation of the nonselective voltage-dependent cation (NSVDC) channel from human erythrocytes were studied. Basic channel activation was achieved by suspending red cells in a low Cl(-) Ringer (2 mM), where a positive membrane potential (V(m) = E(Cl)) immediately developed. Voltage- and time-dependent activation of the NSVDC channel occurred, reaching a cation conductance (g+) of 1.5-2.0 microS cm(-2). In the presence of the classical Gárdos channel blocker clotrimazole (0-50 microM), activation occurred faster, and g+ saturated dose-dependently (EC50 = 14 microM) at a value of about 4 microS cm(-2). The clotrimazole analogues TRAM-34, econazole, and miconazole also stimulated the channel, whereas the chemically more distant Gárdos channel inhibitors nitrendipine and cetiedil had no effects. Although the potency for modulation of the NSVDC channel is much lower than the IC50 value for Gárdos channel inhibition, clotrimazole (and its analogues) constitutes the first chemical class of positive modulators of the NSVDC channel. This may be an important pharmacological "fingerprint" in the identification of the cloned equivalent of the erythrocyte channel.
ERIC Educational Resources Information Center
Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah
2012-01-01
The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…
A voltage-dependent chloride channel fine-tunes photosynthesis in plants
Herdean, Andrei; Teardo, Enrico; Nilsson, Anders K.; Pfeil, Bernard E.; Johansson, Oskar N.; Ünnep, Renáta; Nagy, Gergely; Zsiros, Ottó; Dana, Somnath; Solymosi, Katalin; Garab, Győző; Szabó, Ildikó; Spetea, Cornelia; Lundin, Björn
2016-01-01
In natural habitats, plants frequently experience rapid changes in the intensity of sunlight. To cope with these changes and maximize growth, plants adjust photosynthetic light utilization in electron transport and photoprotective mechanisms. This involves a proton motive force (PMF) across the thylakoid membrane, postulated to be affected by unknown anion (Cl−) channels. Here we report that a bestrophin-like protein from Arabidopsis thaliana functions as a voltage-dependent Cl− channel in electrophysiological experiments. AtVCCN1 localizes to the thylakoid membrane, and fine-tunes PMF by anion influx into the lumen during illumination, adjusting electron transport and the photoprotective mechanisms. The activity of AtVCCN1 accelerates the activation of photoprotective mechanisms on sudden shifts to high light. Our results reveal that AtVCCN1, a member of a conserved anion channel family, acts as an early component in the rapid adjustment of photosynthesis in variable light environments. PMID:27216227
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chida, K.; Yamauchi, Y.; Arakawa, T.
2013-12-04
We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.
Voltage-gated proton (H(v)1) channels, a singular voltage sensing domain.
Castillo, Karen; Pupo, Amaury; Baez-Nieto, David; Contreras, Gustavo F; Morera, Francisco J; Neely, Alan; Latorre, Ramon; Gonzalez, Carlos
2015-11-14
The main role of voltage-gated proton channels (Hv1) is to extrude protons from the intracellular milieu when, mediated by different cellular processes, the H(+) concentration increases. Hv1 are exquisitely selective for protons and their structure is homologous to the voltage sensing domain (VSD) of other voltage-gated ion channels like sodium, potassium, and calcium channels. In clear contrast to the classical voltage-dependent channels, Hv1 lacks a pore domain and thus permeation necessarily occurs through the voltage sensing domain. Hv1 channels are activated by depolarizing voltages, and increases in internal proton concentration. It has been proposed that local conformational changes of the transmembrane segment S4, driven by depolarization, trigger the molecular rearrangements that open Hv1. However, it is still unclear how the electromechanical coupling is achieved between the VSD and the potential pore, allowing the proton flux from the intracellular to the extracellular side. Here we provide a revised view of voltage activation in Hv1 channels, offering a comparative scenario with other voltage sensing channels domains. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
SABRE modification to a higher voltage high impedance inductive voltage adder (IVA)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mazarakis, M.G.; Smith, D.L.; Poukey, J.W.
The SABRE accelerator was originally designed to operate as low impedance voltage adder with 40-ohm maximum output impedance in negative polarity operation and approximately 20 ohm in positive polarity. Because of the low impedance and higher than expected energy losses in the pulse forming network, the operating input cavity voltage is of the order of 800 kV which limits the total output voltage to {approximately} 8 MV for negative polarity and 5 to 6 MV for positive polarity. The modifications presented here aim to increase the output voltage in both polarities. A new high impedance central electrode was designed capablemore » of operating both in negative and positive polarities, and the number of pulse forming lines feeding the inductively isolated cavities was reduced to half. These modifications were recently tested in positive polarity. An increase in the total accelerating voltage from 5.5 MV to 9 MV was observed while stressing all components to the level required to achieve 12 MV in negative polarity. In these experiments only 65% of the usual operating intermediate store capacitor voltage was necessary (1.7 MV instead of 2.6 MV). Currently, the device is reconfigured for negative polarity tests. The cavities are rotated by 180{degree} and a 17-inch spool is added at the base of the cantilevered center electrode (cathode electrode). Positive and negative polarity results are presented and compared with simulations.« less
Resurgent current of voltage-gated Na+ channels
Lewis, Amanda H; Raman, Indira M
2014-01-01
Resurgent Na+ current results from a distinctive form of Na+ channel gating, originally identified in cerebellar Purkinje neurons. In these neurons, the tetrodotoxin-sensitive voltage-gated Na+ channels responsible for action potential firing have specialized mechanisms that reduce the likelihood that they accumulate in fast inactivated states, thereby shortening refractory periods and permitting rapid, repetitive, and/or burst firing. Under voltage clamp, step depolarizations evoke transient Na+ currents that rapidly activate and quickly decay, and step repolarizations elicit slower channel reopening, or a ‘resurgent’ current. The generation of resurgent current depends on a factor in the Na+ channel complex, probably a subunit such as NaVβ4 (Scn4b), which blocks open Na+ channels at positive voltages, competing with the fast inactivation gate, and unblocks at negative voltages, permitting recovery from an open channel block along with a flow of current. Following its initial discovery, resurgent Na+ current has been found in nearly 20 types of neurons. Emerging research suggests that resurgent current is preferentially increased in a variety of clinical conditions associated with altered cellular excitability. Here we review the biophysical, molecular and structural mechanisms of resurgent current and their relation to the normal functions of excitable cells as well as pathophysiology. PMID:25172941
NASA Astrophysics Data System (ADS)
Xiong, Fei; Zhang, Hui; Yang, Sheng'an; Li, Dongqi; Zhang, Zheng; Chen, Qingming
2015-08-01
Large laser-induced thermoelectric voltages (LITVs) are measured in the electron-doped Nd2- x Ce x CuO4 thin films grown on the vicinal-cut SrTiO3 substrates by pulsed laser deposition. The dependence of LITV signals upon the doping carrier density is investigated by changing the Ce content of the films. The optimum Ce dopant corresponding to the largest voltage is found and is attributed to the two-dimensional transport behaviors of the localized electrons. The shorter laser irradiation always induces the larger voltage signals in samples with richer Ce content, suggesting the optimum dopant level is sensitive to the wavelength of excitation source. Thus, the behaviors of LITV signals are resulted from both effects of the anisotropic thermoelectric transport and the optical properties of the thin films. The doping dependence related with an anisotropic charge transport may come from the change in carrier density and the modification in energy band configuration.
Jia, Zhanfeng; Jia, Yueqin; Liu, Boyi; Zhao, Zhiying; Jia, Qingzhong; Liang, Huiling; Zhang, Hailin
2008-08-01
Voltage-gated sodium channels play a crucial role in the initiation and propagation of neuronal action potentials. Genistein, an isoflavone phytoestrogen, has long been used as a broad-spectrum inhibitor of protein tyrosine kinases (PTK). In addition, genistein-induced modulation of ion channels has been described previously in the literature. In this study, we investigated the effect of genistein on voltage-gated sodium channels in rat superior cervical ganglia (SCG) neurons. The results show that genistein inhibits Na(+) currents in a concentration-dependent manner, with a concentration of half-maximal effect (IC(50)) at 9.1 +/- 0.9 microM. Genistein positively shifted the voltage dependence of activation but did not affect inactivation of the Na(+) current. The inactive genistein analog daidzein also inhibited Na(+) currents, but was less effective than genistein. The IC(50) for daidzein-induced inhibition was 20.7 +/- 0.1 microM. Vanadate, an inhibitor of protein tyrosine phosphatases, partially but significantly reversed genistein-induced inhibition of Na(+) currents. Other protein tyrosine kinase antagonists such as tyrphostin 23, an erbstatin analog, and PP2 all had small but significant inhibitory effects on Na(+) currents. Among all active and inactive tyrosine kinase inhibitors tested, genistein was the most potent inhibitor of Na(+) currents. These results suggest that genistein inhibits Na(+) currents in rat SCG neurons through two distinct mechanisms: protein tyrosine kinase-independent, and protein tyrosine kinase-dependent mechanisms. Furthermore, the Src kinase family may be involved in the basal phosphorylation of the Na(+) channel.
Voltage-dependent calcium channel involvement in NMDA-induced activation of NOS.
Alagarsamy, S; Johnson, K M
1995-11-13
We have previously shown that N-methyl-D-aspartate (NMDA) increases nitric oxide synthase (NOS) activity in rat frontal cortex; however, the actual mechanism of this activation has not been addressed. Tetrodotoxin (TTX; 0.05 microM) inhibited NMDA-activated NOS, suggesting that TTX-sensitive Na+ channels are interposed between the NMDA receptors and the NOS cellular compartment. The NMDA response was also blocked by voltage-dependent Ca2+ channel (VDCC) blockers including Cd2+, Co2+, funnel web spider toxin (FTX) and omega-Aga IVa, but not by nifedipine or omega-conotoxin. These data suggest that Ca2+ flux through P- and/or Q-type VDCC subsequent to NMDA-induced depolarization may be at least as important for NOS activation as Ca2+ entry through the NMDA receptor.
Belugin, Sergei; Mifflin, Steve
2005-12-01
Whole cell patch-clamp measurements were made in neurons enzymatically dispersed from the nucleus of the solitary tract (NTS) to determine if alterations occur in voltage-dependent potassium channels from rats made hypertensive (HT) by unilateral nephrectomy/renal wrap for 4 wk. Some rats had the fluorescent tracer DiA applied to the aortic nerve before the experiment to identify NTS neurons receiving monosynaptic baroreceptor afferent inputs. Mean arterial pressure (MAP) was greater in 4-wk HT (165 +/- 5 mmHg, n = 26, P < 0.001) rats compared with normotensive (NT) rats (109 +/- 3 mmHg measured in 10 of 69 rats). Transient outward currents (TOCs) were observed in 67-82% of NTS neurons from NT and HT rats. At activation voltages from -10 to +10 mV, TOCs were significantly less in HT neurons compared with those observed in NT neurons (P < 0.001). There were no differences in the voltage-dependent activation kinetics, the voltage dependence of steady-state inactivation, and the rise and decay time constants of the TOCs comparing neurons isolated from NT and HT rats. The 4-aminopyridine-sensitive component of the TOC was significantly less in neurons from HT compared with NT rats (P < 0.001), whereas steady-state outward currents, whether or not sensitive to 4-aminopyridine or tetraethylammonium, were not different. Delayed excitation, studied under current clamp, was observed in 60-80% of NTS neurons from NT and HT rats and was not different comparing neurons from NT and HT rats. However, examination of the subset of NTS neurons exhibiting somatic DiA fluorescence revealed that DiA-labeled neurons from HT rats had a significantly shorter duration delayed excitation (n = 8 cells, P = 0.022) than DiA-labeled neurons from NT rats (n = 7 cells). Neurons with delayed excitation from HT rats had a significantly broader first action potential (AP) and a slower maximal downstroke velocity of repolarization compared with NT neurons with delayed excitation (P = 0.016 and P = 0
Power-MOSFET Voltage Regulator
NASA Technical Reports Server (NTRS)
Miller, W. N.; Gray, O. E.
1982-01-01
Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.
Current-voltage characteristics and transition voltage spectroscopy of individual redox proteins.
Artés, Juan M; López-Martínez, Montserrat; Giraudet, Arnaud; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau
2012-12-19
Understanding how molecular conductance depends on voltage is essential for characterizing molecular electronics devices. We reproducibly measured current-voltage characteristics of individual redox-active proteins by scanning tunneling microscopy under potentiostatic control in both tunneling and wired configurations. From these results, transition voltage spectroscopy (TVS) data for individual redox molecules can be calculated and analyzed statistically, adding a new dimension to conductance measurements. The transition voltage (TV) is discussed in terms of the two-step electron transfer (ET) mechanism. Azurin displays the lowest TV measured to date (0.4 V), consistent with the previously reported distance decay factor. This low TV may be advantageous for fabricating and operating molecular electronic devices for different applications. Our measurements show that TVS is a helpful tool for single-molecule ET measurements and suggest a mechanism for gating of ET between partner redox proteins.
Memristor-integrated voltage-stabilizing supercapacitor system.
Liu, Bin; Liu, Boyang; Wang, Xianfu; Wu, Xinghui; Zhao, Wenning; Xu, Zhimou; Chen, Di; Shen, Guozhen
2014-08-06
Voltage-stabilized supercapacitors: A single supercapacitor formed with PCBM/Pt/IPS nanorod-array electrodes is designed and delivers enhanced areal capacitance, capacitance retention, and excellent electrical stability under bending, while a significant voltage-decrease is observed during the discharging process. Once integrated with the memristor, the memristor-integrated supercapacitor systems deliver an extremely low voltage-drop, indicating greatly enhanced voltage-stabilizing features. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.
2016-03-01
Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.
Voltage dependence of acetylcholine receptor channel gating in rat myoballs
1992-01-01
Whole-cell currents from nicotinic acetylcholine receptor (AChR) channels were studied in rat myoballs using a light-activated agonist to determine the voltage dependence of the macroscopic opening and closing rate constants. Myoballs were bathed in a solution containing a low concentration of the inactive isomer of the photoisomerizable azobenzene derivative, cis-Bis-Q. A light flash was then presented to produce a known concentration jump of agonist, trans-Bis-Q, across a wide range of membrane potentials in symmetrical solutions (NaCl or CsCl on both sides) or asymmetrical solutions (NaCl in the bath and CsCl in the pipette). At the low agonist concentration used in this study, the reciprocal of the macroscopic time constants gives an unambiguous measure of the effective closing rate. It showed an exponential decrease with membrane hyperpolarization between +20 and - 100 mV, but tended to level off at more depolarized and at more hyperpolarized membrane potentials. The relative effective opening rate was derived from the steady-state conductance, the single-channel conductance, and the apparent closing rate; it decreased sharply in the depolarizing region and tended to level off and then turn up in the hyperpolarizing region. The two effective rate constants were shown to depend on the first, second, and third power of membrane potential. PMID:1460456
Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A
2001-01-05
Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.
Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.
Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf
2006-03-01
We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.
Subthreshold voltage noise of rat neocortical pyramidal neurones
Jacobson, Gilad A; Diba, Kamran; Yaron-Jakoubovitch, Anat; Oz, Yasmin; Koch, Christof; Segev, Idan; Yarom, Yosef
2005-01-01
Neurones are noisy elements. Noise arises from both intrinsic and extrinsic sources, and manifests itself as fluctuations in the membrane potential. These fluctuations limit the accuracy of a neurone's output but have also been suggested to play a computational role. We present a detailed study of the amplitude and spectrum of voltage noise recorded at the soma of layer IV–V pyramidal neurones in slices taken from rat neocortex. The dependence of the noise on holding potential, synaptic activity and Na+ conductance is systematically analysed. We demonstrate that voltage noise increases non-linearly as the cell depolarizes (from a standard deviation (s.d.) of 0.19 mV at −75 mV to an s.d. of 0.54 mV at −55 mV). The increase in voltage noise is accompanied by an increase in the cell impedance, due to voltage dependence of Na+ conductance. The impedance increase accounts for the majority (70%) of the voltage noise increase. The increase in voltage noise and impedance is restricted to the low-frequency range (0.2–2 Hz). At the high frequency range (5–100 Hz) the voltage noise is dominated by synaptic activity. In our slice preparation, synaptic noise has little effect on the cell impedance. A minimal model reproduces qualitatively these data. Our results imply that ion channel noise contributes significantly to membrane voltage fluctuations at the subthreshold voltage range, and that Na+ conductance plays a key role in determining the amplitude of this noise by acting as a voltage-dependent amplifier of low-frequency transients. PMID:15695244
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feller, D.J.; Talvenheimo, J.A.; Catterall, W.A.
1985-09-25
Purified sodium channels incorporated into phosphatidylcholine (PC) vesicles mediate neurotoxin-activated SSNa influx but do not bind the alpha-scorpion toxin from Leiurus quinquestriatus (LqTx) with high affinity. Addition of phosphatidylethanolamine (PE) or phosphatidylserine to the reconstitution mixture restores high affinity LqTx binding with KD = 1.9 nM for PC/PE vesicles at -90 mV and 36 degrees C in sucrose-substituted medium. Other lipids tested were markedly less effective. The binding of LqTx in vesicles of PC/PE (65:35) is sensitive to both the membrane potential formed by sodium gradients across the reconstituted vesicle membrane and the cation concentration in the extravesicular medium. Bindingmore » of LqTx is reduced 3- to 4-fold upon depolarization to 0 mV from -50 to -60 mV in experiments in which (Na+)out/(Na+)in is varied by changing (Na+)in or (Na+)out at constant extravesicular ionic strength. It is concluded that the purified sodium channel contains the receptor site for LqTx in functional form and that restoration of high affinity, voltage-dependent binding of LqTx by the purified sodium channel requires an appropriate ratio of PC to PE and/or phosphatidylserine in the vesicle membrane.« less
DeCoursey, Thomas E.
2014-01-01
Voltage-gated proton channels, HV1, have vaulted from the realm of the esoteric into the forefront of a central question facing ion channel biophysicists, namely the mechanism by which voltage-dependent gating occurs. This transformation is the result of several factors. Identification of the gene in 2006 revealed that proton channels are homologues of the voltage-sensing domain of most other voltage-gated ion channels. Unique, or at least eccentric, properties of proton channels include dimeric architecture with dual conduction pathways, perfect proton selectivity, a single-channel conductance ~103 smaller than most ion channels, voltage-dependent gating that is strongly modulated by the pH gradient, ΔpH, and potent inhibition by Zn2+ (in many species) but an absence of other potent inhibitors. The recent identification of HV1 in three unicellular marine plankton species has dramatically expanded the phylogenetic family tree. Interest in proton channels in their own right has increased as important physiological roles have been identified in many cells. Proton channels trigger the bioluminescent flash of dinoflagellates, facilitate calcification by coccolithophores, regulate pH-dependent processes in eggs and sperm during fertilization, secrete acid to control the pH of airway fluids, facilitate histamine secretion by basophils, and play a signaling role in facilitating B-cell receptor mediated responses in B lymphocytes. The most elaborate and best-established functions occur in phagocytes, where proton channels optimize the activity of NADPH oxidase, an important producer of reactive oxygen species. Proton efflux mediated by HV1 balances the charge translocated across the membrane by electrons through NADPH oxidase, minimizes changes in cytoplasmic and phagosomal pH, limits osmotic swelling of the phagosome, and provides substrate H+ for the production of H2O2 and HOCl, reactive oxygen species crucial to killing pathogens. PMID:23798303
Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A
2017-05-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.
Fernández-Trillo, Jorge; Bharill, Shashank; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y.
2017-01-01
Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4–S5 linker). However, our recent work on channels disrupted in the S4–S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of KV10.1 revealed that the S4–S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use “split” channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in KV10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4–S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4–S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. PMID:28360219
Vacher, Helene; Trimmer, James S.
2012-01-01
Voltage-gated ion channels are a diverse family of signaling proteins that mediate rapid electrical signaling events. Among these, voltage-gated potassium or Kv channels are the most diverse, in part due to the large number of principal (or α) subunits and auxiliary subunits that can assemble in different combinations to generate Kv channel complexes with distinct structures and functions. The diversity of Kv channels underlies much of the variability in the active properties between different mammalian central neurons, and the dynamic changes that lead to experience-dependent plasticity in intrinsic excitability. Recent studies have revealed that Kv channel α subunits and auxiliary subunits are extensively phosphorylated, contributing to additional structural and functional diversity. Here we highlight recent studies that show that auxiliary subunits exert some of their profound effects on dendritic Kv4 and axonal Kv1 channels through phosphorylation-dependent mechanisms, either due to phosphorylation on the auxiliary subunit itself, or by influencing the extent and/or impact of α subunit phosphorylation. The complex effects of auxiliary subunits and phosphorylation provide a potent mechanism to generate additional diversity in the structure and function of Kv4 and Kv1 channels, as well as allowing for dynamic reversible regulation of these important ion channels. PMID:21822597
NASA Astrophysics Data System (ADS)
Leung, Kevin
2015-03-01
Electrochemical reactions at electrode/electrolyte interfaces are critically dependent on the total electrochemical potential or voltage. In this presentation, we briefly review ab initio molecular dynamics (AIMD)-based estimate of voltages on graphite basal and edge planes, and then apply similar concepts to solid-solid interfaces relevant to lithium ion and Li-air batteries. Thin solid films on electrode surfaces, whether naturally occuring during power cycling (e.g., undesirable lithium carbonate on Li-air cathodes) or are artificially introduced, can undergo electrochemical reactions as the applied voltage varies. Here the onset of oxidation of lithium carbonate and other oxide thin films on model gold electrode surfaces is correlated with the electronic structure in the presence/absence of solvent molecules. Our predictions help determine whether oxidation first occurs at the electrode-thin film or electrolyte-thin film interface. Finally, we will critically compare the voltage estimate methodology used in the fuel cell community with the lithium cohesive energy calibration method broadly applied in the battery community, and discuss why they may yield different predictions. This work was supported by Nanostructures for Electrical Energy Storage (NEES), an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences under Award Number DESC0001160. Sandia National Laboratories is a multiprogram laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Deparment of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.
NASA Astrophysics Data System (ADS)
Ghosh, P.; Bhowmik, R. N.; Das, M. R.; Mitra, P.
2017-04-01
We have studied the grain size dependent electrical conductivity, dielectric relaxation and magnetic field dependent current voltage (I - V) characteristics of nickel ferrite (NiFe2O4) . The material has been synthesized by sol-gel self-combustion technique, followed by ball milling at room temperature in air environment to control the grain size. The material has been characterized using X-ray diffraction (refined with MAUD software analysis) and Transmission electron microscopy. Impedance spectroscopy and I - V characteristics in the presence of variable magnetic fields have confirmed the increase of resistivity for the fine powdered samples (grain size 5.17±0.6 nm), resulted from ball milling of the chemical routed sample. Activation energy of the material for electrical charge hopping process has increased with the decrease of grain size by mechanical milling of chemical routed sample. The I - V curves showed many highly non-linear and irreversible electrical features, e.g., I - V loop and bi-stable electronic states (low resistance state-LRS and high resistance state-HRS) on cycling the electrical bias voltage direction during I-V curve measurement. The electrical dc resistance for the chemically routed (without milled) sample in HRS (∼3.4876×104 Ω) at 20 V in presence of magnetic field 10 kOe has enhanced to ∼3.4152×105 Ω for the 10 h milled sample. The samples exhibited an unusual negative differential resistance (NDR) effect that gradually decreased on decreasing the grain size of the material. The magneto-resistance of the samples at room temperature has been found substantially large (∼25-65%). The control of electrical charge transport properties under magnetic field, as observed in the present ferrimagnetic material, indicate the magneto-electric coupling in the materials and the results could be useful in spintronics applications.
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
Zhang, J; Loew, L M; Davidson, R M
1996-01-01
Kinetics of voltage-gated ionic channels fundamentally reflect the response of the channels to local electric fields. In this report cell-attached patch-clamp studies reveal that the voltage-dependent activation rate of sodium channels residing in the growth cone membrane differs from that of soma sodium channels in differentiating N1E-115 neuroblastoma cells. Because other electrophysiological properties of these channels do not differ, this finding may be a reflection of the difference in intramembrane electric field in these two regions of the cell. This represents a new mechanism for channels to attain a range of activities both within and between cells. PMID:8913589
Zhang, J; Loew, L M; Davidson, R M
1996-11-01
Kinetics of voltage-gated ionic channels fundamentally reflect the response of the channels to local electric fields. In this report cell-attached patch-clamp studies reveal that the voltage-dependent activation rate of sodium channels residing in the growth cone membrane differs from that of soma sodium channels in differentiating N1E-115 neuroblastoma cells. Because other electrophysiological properties of these channels do not differ, this finding may be a reflection of the difference in intramembrane electric field in these two regions of the cell. This represents a new mechanism for channels to attain a range of activities both within and between cells.
The effects of ion gun beam voltage on the electrical characteristics of NbCN/PbBi edge junctions
NASA Technical Reports Server (NTRS)
Lichtenberger, A. W.; Feldman, M. J.; Mattauch, R. J.; Cukauskas, E. J.
1989-01-01
The authors have succeeded in fabricating high-quality submicron NbCN edge junctions using a technique which is commonly used to make Nb edge junctions. A modified commercial ion gun was used to cut an edge in SiO2/NbCN films partially covered with photoresist. An insulating barrier was then formed on the exposed edge by reactive ion beam oxidation, and a counterelectrode of PbBi was deposited. The electrical quality of the resulting junctions was found to be strongly influenced by the ion beam acceleration voltages used to cut the edge and to oxidize it. For low ion beam voltages, the junction quality parameter was as high as Vm = 55 mV (measured at 3 mV), but higher ion beam voltages yielded strikingly poorer quality junctions. In light of the small coherence length of NbN, the dependence of the electrical characteristics on ion beam voltage is presumably due to mechanical damage of the NbCN surface. In contrast, for similar ion beam voltages, no such dependence was found for Nb edge junctions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mikhailovskii, V., E-mail: v.mikhailovskii@spbu.ru; IRC for Nanotechnology, Research Park, St.-Petersburg State University; Petrov, Yu.
2016-06-17
The drastic enhancement of backscattered electrons (BSE) yield from nanostructured thin metal film which exceeded well the one from massive metal was observed at accelerating voltages below 400 V. The dependences of BSE signal from nanostructured gold film on accelerating voltage and on retarding grid potential applied to BSE detector were investigated. It was shown that enhanced BSE signal was formed by inelastic scattered electrons coming from the gaps between nanoparticles. A tentative explanation of the mechanism of BSE signal enhancement was suggested.
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
Sheets, Michael F; Chen, Tiehua; Hanck, Dorothy A
2013-10-15
To determine the roles of the individual S4 segments in domains I and II to activation and inactivation kinetics of sodium current (INa) in NaV1.5, we used a tethered biotin and avidin approach after a site-directed cysteine substitution was made in the second outermost Arg in each S4 (DI-R2C and DII-R2C). We first determined the fraction of gating charge contributed by the individual S4's to maximal gating current (Qmax), and found that the outermost Arg residue in each S4 contributed ∼19% to Qmax with minimal contributions by other arginines. Stabilization of the S4's in DI-R2C and DII-R2C was confirmed by measuring the expected reduction in Qmax. In DI-R2C, stabilization resulted in a decrease in peak INa of ∼45%, while its peak current-voltage (I-V) and voltage-dependent Na channel availability (SSI) curves were nearly unchanged from wild type (WT). In contrast, stabilization of the DII-R2C enhanced activation with a negative shift in the peak I-V relationship by -7 mV and a larger -17 mV shift in the voltage-dependent SSI curve. Furthermore, its INa decay time constants and time-to-peak INa became more rapid than WT. An explanation for these results is that the depolarized conformation of DII-S4, but not DI-S4, affects the receptor for the inactivation particle formed by the interdomain linker between DIII and IV. In addition, the leftward shifts of both activation and inactivation and the decrease in Gmax after stabilization of the DII-S4 support previous studies that showed β-scorpion toxins trap the voltage sensor of DII in an activated conformation.
Measuring Multi-Megavolt Diode Voltages
NASA Astrophysics Data System (ADS)
Pereira, N. R.; Swanekamp, S. B.; Weber, B. V.; Commisso, R. J.; Hinshelwood, D. D.; Stephanakis, S. J.
2002-12-01
The voltage in high-power diodes can be determined by measuring the Compton electrons generated by the diode's bremsstrahlung radiation. This technique is implemented with a Compton-Hall (C-H) voltmeter that collimates the bremsstrahlung onto a Compton target and bends the emitted Compton electron orbits off to the side with an applied magnetic field off to Si pin diode detectors. Voltage is determined from the ratio of the Compton electron dose to the forward x-ray dose. The instrument's calibration and response are determined from coupled electron/photon transport calculations. The applicable voltage range is tuned by adjusting the position of the electron detector relative to the Compton target or by varying the magnetic field strength. The instrument was used to obtain time-dependent voltage measurements for a pinched-beam diode whose voltage is enhanced by an upstream opening switch. In this case, plasmas and vacuum electron flow from the opening switch make it difficult to determine the voltage accurately from electrical measurements. The C-H voltmeter gives voltages that are significantly higher than those obtained from electrical measurements but are consistent with measurements of peak voltage based on nuclear activation of boron-nitride targets.
The voltage dependence of NADPH oxidase reveals why phagocytes need proton channels
NASA Astrophysics Data System (ADS)
DeCoursey, Thomas E.; Morgan, Deri; Cherny, Vladimir V.
2003-04-01
The enzyme NADPH oxidase in phagocytes is important in the body's defence against microbes: it produces superoxide anions (O2-, precursors to bactericidal reactive oxygen species). Electrons move from intracellular NADPH, across a chain comprising FAD (flavin adenine dinucleotide) and two haems, to reduce extracellular O2 to O2-. NADPH oxidase is electrogenic, generating electron current (Ie) that is measurable under voltage-clamp conditions. Here we report the complete current-voltage relationship of NADPH oxidase, the first such measurement of a plasma membrane electron transporter. We find that Ie is voltage-independent from -100mV to >0mV, but is steeply inhibited by further depolarization, and is abolished at about +190mV. It was proposed that H+ efflux mediated by voltage-gated proton channels compensates Ie, because Zn2+ and Cd2+ inhibit both H+ currents and O2- production. Here we show that COS-7 cells transfected with four NADPH oxidase components, but lacking H+ channels, produce O2- in the presence of Zn2+ concentrations that inhibit O2- production in neutrophils and eosinophils. Zn2+ does not inhibit NADPH oxidase directly, but through effects on H+ channels. H+ channels optimize NADPH oxidase function by preventing membrane depolarization to inhibitory voltages.
NASA Astrophysics Data System (ADS)
Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.
2013-11-01
As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.
Artero, C; Martì, E; Biffo, S; Mulatero, B; Andreone, C; Margolis, F L; Fasolo, A
1991-09-16
The pattern of distribution of carnosine-like immunoreactivity and its relation to glial fibrillary acidic protein immunoreactivity have been studied in two lizards (Gallotia galloti and Tarentola delalandii) and in two anuran amphibians (Rana esculenta and Xenopus laevis) using immunocytochemical techniques. Biochemical data obtained by paper electrophoresis show that the dipeptides carnosine and homocarnosine are both present in the brain of all the species examined. In the central nervous system of both anurans and reptilians, carnosine immunoreactivity is localized in glial cells. An important species difference is, however, seen in the olfactory system since primary olfactory neurons and their processes extending to the olfactory bulb are carnosine positive in reptiles, whereas they are not immunostained in anurans. Thus, the cellular distribution of carnosine immunoreactivity in reptilians is very similar to that observed in birds and mammals and is distinct from that seen in amphibia.
NASA Astrophysics Data System (ADS)
Banerjee, J.; Verma, M. K.; Manna, S.; Ghosh, S.
2006-02-01
Noise profile of Voltage Dependent Anion Channel (VDAC) is investigated in open channel state. Single-channel currents through VDAC from mitochondria of rat brain reconstituted into a planar lipid bilayer are recorded under different voltage clamped conditions across the membrane. Power spectrum analysis of current indicates power law noise of 1/f nature. Moreover, this 1/f nature of the open channel noise is seen throughout the range of applied membrane potential from -30 to +30 mV. It is being proposed that 1/f noise in open ion channel arises out of obstruction in the passage of ions across the membrane. The process is recognised as a phenomenon of self-organized criticality (SOC) like sandpile avalanche and other physical systems. Based on SOC it has been theoretically established that the system of ion channel follows power law noise as observed in our experiments. We also show that the first-time return probability of current fluctuations obeys a power law distribution.
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
[Development of residual voltage testing equipment].
Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng
2014-07-01
For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.
Niemeyer, María Isabel; Cid, L Pablo; Yusef, Yamil R; Briones, Rodolfo; Sepúlveda, Francisco V
2009-01-01
The ClC transport protein family comprises both Cl− ion channel and H+/Cl− and H+/NO3− exchanger members. Structural studies on a bacterial ClC transporter reveal a pore obstructed at its external opening by a glutamate side-chain which acts as a gate for Cl− passage and in addition serves as a staging post for H+ exchange. This same conserved glutamate acts as a gate to regulate Cl− flow in ClC channels. The activity of ClC-2, a genuine Cl− channel, has a biphasic response to extracellular pH with activation by moderate acidification followed by abrupt channel closure at pH values lower than ∼7. We have now investigated the molecular basis of this complex gating behaviour. First, we identify a sensor that couples extracellular acidification to complete closure of the channel. This is extracellularly-facing histidine 532 at the N-terminus of transmembrane helix Q whose neutralisation leads to channel closure in a cooperative manner. We go on to show that acidification-dependent activation of ClC-2 is voltage dependent and probably mediated by protonation of pore gate glutamate 207. Intracellular Cl− acts as a voltage-independent modulator, as though regulating the pKa of the protonatable residue. Our results suggest that voltage dependence of ClC-2 is given by hyperpolarisation-dependent penetration of protons from the extracellular side to neutralise the glutamate gate deep within the channel, which allows Cl− efflux. This is reminiscent of a partial exchanger cycle, suggesting that the ClC-2 channel evolved from its transporter counterparts. PMID:19153159
Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik
2018-05-01
Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Electronic circuit for measuring series connected electrochemical cell voltages
Ashtiani, Cyrus N.; Stuart, Thomas A.
2000-01-01
An electronic circuit for measuring voltage signals in an energy storage device is disclosed. The electronic circuit includes a plurality of energy storage cells forming the energy storage device. A voltage divider circuit is connected to at least one of the energy storage cells. A current regulating circuit is provided for regulating the current through the voltage divider circuit. A voltage measurement node is associated with the voltage divider circuit for producing a voltage signal which is proportional to the voltage across the energy storage cell.
S3b amino acid residues do not shuttle across the bilayer in voltage-dependent Shaker K+ channels
Gonzalez, Carlos; Morera, Francisco J.; Rosenmann, Eduardo; Alvarez, Osvaldo; Latorre, Ramon
2005-01-01
In voltage-dependent channels, positive charges contained within the S4 domain are the voltage-sensing elements. The “voltage-sensor paddle” gating mechanism proposed for the KvAP K+ channel has been the subject of intense discussion regarding its general applicability to the family of voltage-gated channels. In this model, the voltage sensor composed of the S3b and the S4 segment shuttles across the lipid bilayer during channel activation. Guided by this mechanism, we assessed here the accessibility of residues in the S3 segment of the Shaker K+ channel by using cysteine-scanning mutagenesis. Mutants expressed robust K+ currents in Xenopus oocytes and reacted with methanethiosulfonate ethyltrimethylammonium in both closed and open conformations of the channel. Because Shaker has a long S3–S4 linker segment, we generated a deletion mutant with only three residues to emulate the KvAP structure. In this short linker mutant, all of the tested residues in the S3b were accessible to methanethiosulfonate ethyltrimethylammonium in both closed and open conformations. Because the S3b moves together with the S4 domain in the paddle model, we tested the effects of deleting two negative charges or adding a positive charge to this region of the channel. We found that altering the S3b net charge does not modify the total gating charge involved in channel activation. We conclude that the S3b segment is always exposed to the external milieu of the Shaker K+ channel. Our results are incompatible with any model involving a large membrane displacement of segment S3b. PMID:15774578
Mustaqima, Millaty; Yoo, Pilsun; Huang, Wei; Lee, Bo Wha; Liu, Chunli
2015-01-01
We report the preparation of (111) preferentially oriented CoFe2O4 thin films on Pt(111)/TiO2/SiO2/Si substrates using a spin-coating process. The post-annealing conditions and film thickness were varied for cobalt ferrite (CFO) thin films, and Pt/CFO/Pt structures were prepared to investigate the resistance switching behaviors. Our results showed that resistance switching without a forming process is preferred to obtain less fluctuation in the set voltage, which can be regulated directly from the preparation conditions of the CFO thin films. Therefore, instead of thicker film, CFO thin films deposited by two times spin-coating with a thickness about 100 nm gave stable resistance switching with the most stable set voltage. Since the forming process and the large variation in set voltage have been considered as serious obstacles for the practical application of resistance switching for non-volatile memory devices, our results could provide meaningful insights in improving the performance of ferrite material-based resistance switching memory devices.
Voltage-Clamp Studies on Uterine Smooth Muscle
Anderson, Nels C.
1969-01-01
These studies have developed and tested an experimental approach to the study of membrane ionic conductance mechanisms in strips of uterine smooth muscle. The experimental and theoretical basis for applying the double sucrose-gap technique is described along with the limitations of this system. Nonpropagating membrane action potentials were produced in response to depolarizing current pulses under current-clamp conditions. The stepwise change of membrane potential under voltage-clamp conditions resulted in a family of ionic currents with voltage- and time-dependent characteristics. In sodium-free solution the peak transient current decreased and its equilibrium potential shifted along the voltage axis toward a more negative internal potential. These studies indicate a sodium-dependent, regenerative excitation mechanism. PMID:5796366
Cryogenic temperature dependence of the voltage transfer characteristics of CMOS inverters
NASA Astrophysics Data System (ADS)
Deen, M. J.
1988-08-01
The voltage transfer characteristics of CMOS inverters have been studied in detail as a function of temperature between 77 and 300 K and supply voltages between 2 and 20 V. The logic levels, maximum gain, unity gain points, noise margins and other parameters, such as ( VH - VL), all showed a marked improvement as the temperature was lowered. In particular, for one inverter with a supply of 5 V, the maximum gain increased from 57 to 105, ( VIH - VIL) decreased from 0.50 to 0.28 V and ( VH - VL) increased from 4.46 to 4.75 V on decreasing the temperature from 300 to 77 K. For all the inverters, these and other parameters showed a smooth monotonic improvement as the temperature was lowered. These and the other results obtained can be qualitatively explained as due to an increase in the absolute values in the threshold voltages of the PMOS and NMOS transistors and to an increase in the carrier mobility as the temperature was lowered.
NASA Astrophysics Data System (ADS)
Rangel-Kuoppa, Victor-Tapio; Reentilä, Outi; Sopanen, Markku; Lipsanen, Harri
2011-12-01
The temperature dependent current-voltage (IVT) measurements on Au Schottky barrier diodes made on intrinsically p-type GaAs1-xNx were carried out. Three samples with small N content (x = 0.5%, 0.7% and 1%) were studied. The temperature range was 10-320 K. All contacts were found to be of Schottky type. The ideality factor and the apparent barrier height calculated by using thermionic emission (TE) theory show a strong temperature dependence. The current voltage (IV) curves are fitted based on the TE theory, yielding a zero-bias carrier height (ΦB0) and a ideality factor (n) that decrease and increase with decreasing temperature, respectively. The linear fitting of ΦB0 vs n and its subsequent evaluation for n = 1 give a zero-bias ΦB0 in the order of 0.35-0.4 eV. From the reverse-bias IV study, it is found that the experimental carrier density (NA) values increase with increasing temperature and are in agreement with the intrinsic carrier concentration for GaAs.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E
2016-06-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms
Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred
2016-01-01
Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular
Process dependency on threshold voltage of GaN MOSFET on AlGaN/GaN heterostructure
NASA Astrophysics Data System (ADS)
Wang, Qingpeng; Jiang, Ying; Miyashita, Takahiro; Motoyama, Shin-ichi; Li, Liuan; Wang, Dejun; Ohno, Yasuo; Ao, Jin-Ping
2014-09-01
GaN metal-oxide-semiconductor field-effect transistors (MOSFETs) with recessed gate on AlGaN/GaN heterostructure are reported in which the drain and source ohmic contacts were fabricated on the AlGaN/GaN heterostructure and the electron channel was formed on the GaN buffer layer by removing the AlGaN barrier layer. Negative threshold voltages were commonly observed in all devices. To investigate the reasons of the negative threshold voltages, different oxide thickness, etching gas and bias power of inductively-coupled plasma (ICP) system were utilized in the fabrication process of the GaN MOSFETs. It is found that positive charges of around 1 × 1012 q/cm2 exist near the interface at the just threshold condition in both silane- and tetraethylorthosilicate (TEOS)-based devices. It is also found that the threshold voltages do not obviously change with the different etching gas (SiCl4, BCl3 and two-step etching of SiCl4/Cl2) at the same ICP bias power level (20-25 W) and will become deeper when higher bias power is used in the dry recess process which may be related to the much serious ion bombardment damage. Furthermore, X-ray photoelectron spectroscopy (XPS) experiments were done to investigate the surface conditions. It is found that N 1s peaks become lower with higher bias power of the dry etching process. Also, silicon contamination was found and could be removed by HNO3/HF solution. It indicates that the nitrogen vacancies are mainly responsible for the negative threshold voltages rather than the silicon contamination. It demonstrates that optimization of the ICP recess conditions and improvement of the surface condition are still necessary to realize enhancement-mode GaN MOSFETs on AlGaN/GaN heterostructure.
NASA Astrophysics Data System (ADS)
Zhang, Wenxu; Peng, Bin; Han, Fangbin; Wang, Qiuru; Soh, Wee Tee; Ong, Chong Kim; Zhang, Wanli
2016-03-01
We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.
von Stein, Richard T.
2012-01-01
Sodium channel inhibitor (SCI) insecticides selectively target voltage-gated sodium (Nav) channels in the slow-inactivated state by binding at or near the local anesthetic receptor within the sodium channel pore. Metaflumizone is a new insecticide for the treatment of fleas on domesticated pets and has recently been reported to block insect sodium channels in the slow-inactivated state, thereby implying that it is also a member of the SCI class. Using the two-electrode voltage-clamp technique, we examined metaflumizone inhibition of rat Nav1.4 sodium channels expressed in Xenopus laevis oocytes. Metaflumizone selectively inhibited Nav1.4 channels at potentials that promoted slow inactivation and shifted the voltage dependence of slow inactivation in the direction of hyperpolarization. Metaflumizone perfusion at a hyperpolarized holding potential also shifted the conductance-voltage curve for activation in the direction of depolarization and antagonized use-dependent lidocaine inhibition of fast-inactivated sodium channels, actions not previously observed with other SCI insecticides. We expressed mutated Nav1.4/F1579A and Nav1.4/Y1586A channels to investigate whether metaflumizone shares the domain IV segment S6 (DIV-S6) binding determinants identified for other SCI insecticides. Consistent with previous investigations of SCI insecticides on rat Nav1.4 channels, the F1579A mutation reduced sensitivity to block by metaflumizone, whereas the Y1586A mutation paradoxically increased the sensitivity to metaflumizone. We conclude that metaflumizone selectively inhibits slow-inactivated Nav1.4 channels and shares DIV-S6 binding determinants with other SCI insecticides and therapeutic drugs. However, our results suggest that metaflumizone interacts with resting and fast-inactivated channels in a manner that is distinct from other compounds in this insecticide class. PMID:22127519
Origin of the transition voltage in gold-vacuum-gold atomic junctions.
Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin
2013-01-18
The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.
Structures of closed and open states of a voltage-gated sodium channel
Lenaeus, Michael J.; Gamal El-Din, Tamer M.; Ramanadane, Karthik; Pomès, Régis; Zheng, Ning; Catterall, William A.
2017-01-01
Bacterial voltage-gated sodium channels (BacNavs) serve as models of their vertebrate counterparts. BacNavs contain conserved voltage-sensing and pore-forming domains, but they are homotetramers of four identical subunits, rather than pseudotetramers of four homologous domains. Here, we present structures of two NaVAb mutants that capture tightly closed and open states at a resolution of 2.8–3.2 Å. Introduction of two humanizing mutations in the S6 segment (NaVAb/FY: T206F and V213Y) generates a persistently closed form of the activation gate in which the intracellular ends of the four S6 segments are drawn tightly together to block ion permeation completely. This construct also revealed the complete structure of the four-helix bundle that forms the C-terminal domain. In contrast, truncation of the C-terminal 40 residues in NavAb/1–226 captures the activation gate in an open conformation, revealing the open state of a BacNav with intact voltage sensors. Comparing these structures illustrates the full range of motion of the activation gate, from closed with its orifice fully occluded to open with an orifice of ∼10 Å. Molecular dynamics and free-energy simulations confirm designation of NaVAb/1–226 as an open state that allows permeation of hydrated Na+, and these results also support a hydrophobic gating mechanism for control of ion permeation. These two structures allow completion of a closed–open–inactivated conformational cycle in a single voltage-gated sodium channel and give insight into the structural basis for state-dependent binding of sodium channel-blocking drugs. PMID:28348242
Current–voltage characteristics of manganite–titanite perovskite junctions
Ifland, Benedikt; Peretzki, Patrick; Kressdorf, Birte; Saring, Philipp; Kelling, Andreas; Seibt, Michael
2015-01-01
Summary After a general introduction into the Shockley theory of current voltage (J–V) characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1− yNbyO3, y = 0.002 and p-doped Pr1− xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC) in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER) effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface. PMID:26199851
Current-voltage characteristics of manganite-titanite perovskite junctions.
Ifland, Benedikt; Peretzki, Patrick; Kressdorf, Birte; Saring, Philipp; Kelling, Andreas; Seibt, Michael; Jooss, Christian
2015-01-01
After a general introduction into the Shockley theory of current voltage (J-V) characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite-titanate p-n heterojunctions made of n-doped SrTi1- y Nb y O3, y = 0.002 and p-doped Pr1- x Ca x MnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC) in a thin cross plane lamella of the junction. In the J-V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER) effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron-polaron hole-polaron pair generation and separation at the interface.
Signal transduction in light–oxygen–voltage receptors lacking the adduct-forming cysteine residue
Yee, Estella F.; Diensthuber, Ralph P.; Vaidya, Anand T.; Borbat, Peter P.; Engelhard, Christopher; Freed, Jack H.; Bittl, Robert; Möglich, Andreas; Crane, Brian R.
2015-01-01
Light–oxygen–voltage (LOV) receptors sense blue light through the photochemical generation of a covalent adduct between a flavin-nucleotide chromophore and a strictly conserved cysteine residue. Here we show that, after cysteine removal, the circadian-clock LOV-protein Vivid still undergoes light-induced dimerization and signalling because of flavin photoreduction to the neutral semiquinone (NSQ). Similarly, photoreduction of the engineered LOV histidine kinase YF1 to the NSQ modulates activity and downstream effects on gene expression. Signal transduction in both proteins hence hinges on flavin protonation, which is common to both the cysteinyl adduct and the NSQ. This general mechanism is also conserved by natural cysteine-less, LOV-like regulators that respond to chemical or photoreduction of their flavin cofactors. As LOV proteins can react to light even when devoid of the adduct-forming cysteine, modern LOV photoreceptors may have arisen from ancestral redox-active flavoproteins. The ability to tune LOV reactivity through photoreduction may have important implications for LOV mechanism and optogenetic applications. PMID:26648256
Syntactic Dependencies and Verbal Inflection: Complementisers and Verbal Forms in Standard Arabic
ERIC Educational Resources Information Center
Saeed, Feras
2015-01-01
This paper investigates the syntactic dependency between complementisers and verbal forms in Standard Arabic and provides a new analysis of this dependency. The imperfective verb in this language surfaces with three different forms, where each form is indicated by a different suffixal marker attached to the end of the verb as (-u), (-a), or (-Ø).…
NASA Astrophysics Data System (ADS)
Wang, Ming-Tsong; Hsu, De-Cheng; Juan, Pi-Chun; Wang, Y. L.; Lee, Joseph Ya-min
2010-09-01
Metal-oxide-semiconductor capacitors and n-channel metal-oxide-semiconductor field-effect transistors with La2O3 gate dielectric were fabricated. The positive bias temperature instability was studied. The degradation of threshold voltage (ΔVT) showed an exponential dependence on the stress time in the temperature range from 25 to 75 °C. The degradation of subthreshold slope (ΔS) and gate leakage (IG) with stress voltage was also measured. The degradation of VT is attributed to the oxide trap charges Qot. The extracted activation energy of 0.2 eV is related to a degradation dominated by the release of atomic hydrogen in La2O3 thin films.
Histidine168 is crucial for ΔpH-dependent gating of the human voltage-gated proton channel, hHV1.
Cherny, Vladimir V; Morgan, Deri; Thomas, Sarah; Smith, Susan M E; DeCoursey, Thomas E
2018-05-09
We recently identified a voltage-gated proton channel gene in the snail Helisoma trivolvis , HtH V 1, and determined its electrophysiological properties. Consistent with early studies of proton currents in snail neurons, HtH V 1 opens rapidly, but it unexpectedly exhibits uniquely defective sensitivity to intracellular pH (pH i ). The H + conductance ( g H )- V relationship in the voltage-gated proton channel (H V 1) from other species shifts 40 mV when either pH i or pH o (extracellular pH) is changed by 1 unit. This property, called ΔpH-dependent gating, is crucial to the functions of H V 1 in many species and in numerous human tissues. The HtH V 1 channel exhibits normal pH o dependence but anomalously weak pH i dependence. In this study, we show that a single point mutation in human hH V 1-changing His 168 to Gln 168 , the corresponding residue in HtH V 1-compromises the pH i dependence of gating in the human channel so that it recapitulates the HtH V 1 response. This location was previously identified as a contributor to the rapid gating kinetics of H V 1 in Strongylocentrotus purpuratus His 168 mutation in human H V 1 accelerates activation but accounts for only a fraction of the species difference. H168Q, H168S, or H168T mutants exhibit normal pH o dependence, but changing pH i shifts the g H - V relationship on average by <20 mV/unit. Thus, His 168 is critical to pH i sensing in hH V 1. His 168 , located at the inner end of the pore on the S3 transmembrane helix, is the first residue identified in H V 1 that significantly impairs pH sensing when mutated. Because pH o dependence remains intact, the selective erosion of pH i dependence supports the idea that there are distinct internal and external pH sensors. Although His 168 may itself be a pH i sensor, the converse mutation, Q229H, does not normalize the pH i sensitivity of the HtH V 1 channel. We hypothesize that the imidazole group of His 168 interacts with nearby Phe 165 or other parts of hH V 1 to
Coupling between the Voltage-sensing and Pore Domains in a Voltage-gated Potassium Channel
Schow, Eric V.; Freites, J. Alfredo; Nizkorodov, Alex; White, Stephen H.; Tobias, Douglas J.
2012-01-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence. PMID:22425907
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
NASA Astrophysics Data System (ADS)
Lau, Carus H. Y.; King, Glenn F.; Mobli, Mehdi
2016-09-01
Voltage-sensor domains (VSDs) are modular transmembrane domains of voltage-gated ion channels that respond to changes in membrane potential by undergoing conformational changes that are coupled to gating of the ion-conducting pore. Most spider-venom peptides function as gating modifiers by binding to the VSDs of voltage-gated channels and trapping them in a closed or open state. To understand the molecular basis underlying this mode of action, we used nuclear magnetic resonance to delineate the atomic details of the interaction between the VSD of the voltage-gated potassium channel KvAP and the spider-venom peptide VSTx1. Our data reveal that the toxin interacts with residues in an aqueous cleft formed between the extracellular S1-S2 and S3-S4 loops of the VSD whilst maintaining lipid interactions in the gaps formed between the S1-S4 and S2-S3 helices. The resulting network of interactions increases the energetic barrier to the conformational changes required for channel gating, and we propose that this is the mechanism by which gating modifier toxins inhibit voltage-gated ion channels.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June
2017-01-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition. PMID:29093633
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.
Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer
2013-09-01
Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.
De Pinto, Vito; Messina, Angela; Accardi, Rosita; Aiello, Rita; Guarino, Francesca; Tomasello, Marianna Flora; Tommasino, Massimo; Tasco, Gianluca; Casadio, Rita; Benz, Roland; De Giorgi, Francesca; Ichas, François; Baker, Mark; Lawen, Alfons
2003-03-01
Mitochondrial porin or VDAC (Voltage Dependent Anion selective Channels) was identified for the first time in 1976, on the basis of the evolutionary similarity between the gram negative and mitochondrial outer membranes. Since this achievement VDAC has been extensively investigated: its functional features have been sharply defined upon reconstitution in artificial membranes and its sequence has been determined in many genomes. Unfortunately the tertiary structure has not yet been solved, mainly because it proved to be very difficult to get suitable crystals. Despite this established knowledge, in the last few years this protein has attracted renewed interest. There are two main reasons for this interest: the discovery, in most eukaryotes, of a family of genes encoding VDAC isoforms and the claims of VDAC involvement in the intrinsic pathway of apoptosis and in particular in the mechanism of cytochrome c release from mitochondria. We can affirm that nowadays the eukaryotic porin (or VDAC) is studied in a more general cellular contest, looking at the interactions and integration with other molecules, since VDAC is in a crucial position in the cell, forming the main interface between the mitochondrial and the cellular metabolisms. In this minireview we will briefly focus our attention onto the following topics: 1) recent advances about the structure of VDAC; 2) the VDAC-related multigene families; 3) the presence, targeting and function of VDAC in various cell membranes.
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
Chen, Qiusong; Jia, Weiyao; Chen, Lixiang; Yuan, De; Zou, Yue; Xiong, Zuhong
2016-01-01
Lowering the driving voltage of organic light-emitting diodes (OLEDs) is an important approach to reduce their energy consumption. We have fabricated a series of bifunctional devices (OLEDs and photovoltaics) using rubrene and fullerene (C60) as the active layer, in which the electroluminescence threshold voltage(~1.1 V) was half the value of the bandgap of rubrene. Magneto-electroluminescence (MEL) response of planner heterojunction diodes exhibited a small increase in response to a low magnetic field strength (<20 mT); however, a very large decay was observed at a high magnetic field strength (>20 mT). When a hole-transport layer with a low mobility was included in these devices, the MEL response reversed in shape, and simultaneously, the EL threshold voltage became larger than the bandgap voltage. When bulk heterojunction device was examined, the amplitude of MEL curves presented an anomalous voltage-dependence. Following an analysis of the MEL responses of these devices, we proposed that the EL of half-bandgap-voltage device originated from bimolecular triplet-triplet annihilation in the rubrene film, rather than from singlet excitons that formed via an interface auger recombination. This work provides critical insight into the mechanisms of OLED emission and will help advance the applications of bifunctional devices. PMID:27142285
High Voltage Insulation Technology
NASA Astrophysics Data System (ADS)
Scherb, V.; Rogalla, K.; Gollor, M.
2008-09-01
In preparation of new Electronic Power Conditioners (EPC's) for Travelling Wave Tub Amplifiers (TWTA's) on telecom satellites a study for the development of new high voltage insulation technology is performed. The initiative is mandatory to allow compact designs and to enable higher operating voltages. In a first task a market analysis was performed, comparing different materials with respect to their properties and processes. A hierarchy of selection criteria was established and finally five material candidates (4 Epoxy resins and 1 Polyurethane resin) were selected to be further investigated in the test program. Samples for the test program were designed to represent core elements of an EPC, the high voltage transformer and Printed Circuit Boards of the high voltage section. All five materials were assessed in the practical work flow of the potting process and electrical, mechanical, thermal and lifetime testing was performed. Although the lifetime tests results were overlayed by a larges scatter, finally two candidates have been identified for use in a subsequent qualification program. This activity forms part of element 5 of the ESA ARTES Programme.
NASA Astrophysics Data System (ADS)
Qi, Xiao-Hua; Yan, Hui-Jie; Yang, Liang; Hua, Yue; Ren, Chun-Sheng
2017-08-01
In this work, a driven voltage consisting of AC high voltage with a superimposed positive pulse bias voltage ("AC+ Positive pulse bias" voltage) is adopted to study the performance of a surface dielectric barrier discharge plasma actuator under atmospheric conditions. To compare the performance of the actuator driven by single-AC voltage and "AC+ Positive pulse bias" voltage, the actuator-induced thrust force and power consumption are measured as a function of the applied AC voltage, and the measured results indicate that the thrust force can be promoted significantly after superimposing the positive pulse bias voltage. The physical mechanism behind the thrust force changes is analyzed by measuring the optical properties, electrical characteristics, and surface potential distribution. Experimental results indicate that the glow-like discharge in the AC voltage half-cycle, next to the cycle where a bias voltage pulse has been applied, is enhanced after applying the positive pulse bias voltage, and this perhaps is the main reason for the thrust force increase. Moreover, surface potential measurement results reveal that the spatial electric field formed by the surface charge accumulation after positive pulse discharge can significantly affect the applied external electric field, and this perhaps can be responsible for the experimental phenomenon that the decrease of thrust force is delayed by pulse bias voltage action after the filament discharge occurs in the glow-like discharge region. The schlieren images further verify that the actuator-induced airflow velocity increases with the positive pulse voltage.
High-frequency voltage oscillations in cultured astrocytes
Fleischer, Wiebke; Theiss, Stephan; Slotta, Johannes; Holland, Christine; Schnitzler, Alfons
2015-01-01
Because of their close interaction with neuronal physiology, astrocytes can modulate brain function in multiple ways. Here, we demonstrate a yet unknown astrocytic phenomenon: Astrocytes cultured on microelectrode arrays (MEAs) exhibited extracellular voltage fluctuations in a broad frequency spectrum (100–600 Hz) after electrical stimulation. These aperiodic high-frequency oscillations (HFOs) could last several seconds and did not spread across the MEA. The voltage-gated calcium channel antagonist cilnidipine dose-dependently decreased the power of the oscillations. While intracellular calcium was pivotal, incubation with bafilomycin A1 showed that vesicular release of transmitters played only a minor role in the emergence of HFOs. Gap junctions and volume-regulated anionic channels had just as little functional impact, which was demonstrated by the addition of carbenoxolone (100 μmol/L) and NPPB (100 μmol/L). Hyperpolarization with low potassium in the extracellular solution (2 mmol/L) dramatically raised oscillation power. A similar effect was seen when we added extra sodium (+50 mmol/L) or if we replaced it with NMDG+ (50 mmol/L). The purinergic receptor antagonist PPADS suppressed the oscillation power, while the agonist ATP (100 μmol/L) had only an increasing effect when the bath solution pH was slightly lowered to pH 7.2. From these observations, we conclude that astrocytic voltage oscillations are triggered by activation of voltage-gated calcium channels and driven by a downstream influx of cations through channels that are permeable for large ions such as NMDG+. Most likely candidates are subtypes of pore-forming P2X channels with a low affinity for ATP. PMID:25969464
Voltage Sensor Inactivation in Potassium Channels
Bähring, Robert; Barghaan, Jan; Westermeier, Regina; Wollberg, Jessica
2012-01-01
In voltage-gated potassium (Kv) channels membrane depolarization causes movement of a voltage sensor domain. This conformational change of the protein is transmitted to the pore domain and eventually leads to pore opening. However, the voltage sensor domain may interact with two distinct gates in the pore domain: the activation gate (A-gate), involving the cytoplasmic S6 bundle crossing, and the pore gate (P-gate), located externally in the selectivity filter. How the voltage sensor moves and how tightly it interacts with these two gates on its way to adopt a relaxed conformation when the membrane is depolarized may critically determine the mode of Kv channel inactivation. In certain Kv channels, voltage sensor movement leads to a tight interaction with the P-gate, which may cause conformational changes that render the selectivity filter non-conductive (“P/C-type inactivation”). Other Kv channels may preferably undergo inactivation from pre-open closed-states during voltage sensor movement, because the voltage sensor temporarily uncouples from the A-gate. For this behavior, known as “preferential” closed-state inactivation, we introduce the term “A/C-type inactivation”. Mechanistically, P/C- and A/C-type inactivation represent two forms of “voltage sensor inactivation.” PMID:22654758
Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.
Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung
2017-03-01
The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.
An open circuit voltage decay system for performing injection dependent lifetime spectroscopy
NASA Astrophysics Data System (ADS)
Lacouture, Shelby; Schrock, James; Hirsch, Emily; Bayne, Stephen; O'Brien, Heather; Ogunniyi, Aderinto A.
2017-09-01
Of all of the material parameters associated with a semiconductor, the carrier lifetime is by far the most complex and dynamic, being a function of the dominant recombination mechanism, the equilibrium number of carriers, the perturbations in carriers (e.g., carrier injection), and the temperature, to name the most prominent variables. The carrier lifetime is one of the most important parameters in bipolar devices, greatly affecting conductivity modulation, on-state voltage, and reverse recovery. Carrier lifetime is also a useful metric for device fabrication process control and material quality. As it is such a dynamic quantity, carrier lifetime cannot be quoted in a general range such as mobility; it must be measured. The following describes a stand-alone, wide-injection range open circuit voltage decay system with unique lifetime extraction algorithms. The system is initially used along with various lifetime spectroscopy techniques to extract fundamental recombination parameters from a commercial high-voltage PIN diode.
Optical Voltage Sensing Using DNA Origami
2018-01-01
We explore the potential of DNA nanotechnology for developing novel optical voltage sensing nanodevices that convert a local change of electric potential into optical signals. As a proof-of-concept of the sensing mechanism, we assembled voltage responsive DNA origami structures labeled with a single pair of FRET dyes. The DNA structures were reversibly immobilized on a nanocapillary tip and underwent controlled structural changes upon application of an electric field. The applied field was monitored through a change in FRET efficiency. By exchanging the position of a single dye, we could tune the voltage sensitivity of our DNA origami structure, demonstrating the flexibility and versatility of our approach. The experimental studies were complemented by coarse-grained simulations that characterized voltage-dependent elastic deformation of the DNA nanostructures and the associated change in the distance between the FRET pair. Our work opens a novel pathway for determining the mechanical properties of DNA origami structures and highlights potential applications of dynamic DNA nanostructures as voltage sensors. PMID:29430924
Molle, Virginie; Saint, Nathalie; Campagna, Sylvie; Kremer, Laurent; Lea, Edward; Draper, Philip; Molle, Gérard
2006-08-01
Mycobacteria are characterized by an unusual cell wall that controls nutrient and small hydrophilic compound permeability. Porin-like proteins are necessary to ensure the transport of molecules into the cell. Here, we investigated the pore-forming properties of OmpATb, a porin from Mycobacterium tuberculosis, in lipid bilayers. Multi-channel experiments showed an asymmetric behaviour with channel closures at negative critical voltages (Vc) and a strong decrease in Vc at acidic pH. Single-channel experiments gave conductance values of about 850 +/- 80 pS in 1 M KCl and displayed a weak cationic selectivity in 4-8 pH range. The production and characterization of a series of truncated OmpATb proteins, showed that the central domain (OmpATb73-220) was sufficient to induce the ion channel properties of the native protein in lipid bilayers, i.e. asymmetric insertion, pH-dependent voltage closure, cationic selectivity and similar conductance values in 1 M KCl. Western blot analysis suggests that the presence of OmpATb is only restricted to certain pathogenic species. Therefore, the propensity of channels of native OmpATb to close at low pH may represent an intrinsic property allowing pathogenic mycobacteria to adapt and survive to mildly acidic conditions, such as those encountered within the macrophage phagosome.
Asymmetric injection and distribution of space charges in propylene carbonate under impulse voltage
NASA Astrophysics Data System (ADS)
Sima, Wenxia; Chen, Qiulin; Sun, Potao; Yang, Ming; Guo, Hongda; Ye, Lian
2018-05-01
Space charge can distort the electric field in high voltage stressed liquid dielectrics and lead to breakdown. Observing the evolution of space charge in real time and determining the influencing factors are of considerable significance. The spatio-temporal evolution of space charge in propylene carbonate, which is very complex under impulse voltage, was measured in this study through the time-continuous Kerr electro-optic field mapping measurement. We found that the injection charge from a brass electrode displayed an asymmetric effect; that is, the negative charge injection near the cathode lags behind the positive charge injection near the anode. Physical mechanisms, including charge generation and drift, are analyzed, and a voltage-dependent saturated drift rectification model was established to explain the interesting phenomena. Mutual validation of models and our measurement data indicated that a barrier layer, which is similar to metal-semiconductor contact, was formed in the contact interface between the electrode and propylene carbonate and played an important role in the space charge injection.
Neely, Alan; Hidalgo, Patricia
2014-01-01
Openings of high-voltage-activated (HVA) calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, HVA calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1) associated with four additional polypeptide chains β, α2, δ, and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of HVA calcium channels. PMID:24917826
NASA Astrophysics Data System (ADS)
Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.
In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.
Takahashi, Izumi; Yoshino, Masami
2015-10-01
In this study, we examined the functional coupling between Na(+)-activated potassium (KNa) channels and Na(+) influx through voltage-dependent Na(+) channels in Kenyon cells isolated from the mushroom body of the cricket Gryllus bimaculatus. Single-channel activity of KNa channels was recorded with the cell-attached patch configuration. The open probability (Po) of KNa channels increased with increasing Na(+) concentration in a bath solution, whereas it decreased by the substitution of Na(+) with an equimolar concentration of Li(+). The Po of KNa channels was also found to be reduced by bath application of a high concentration of TTX (1 μM) and riluzole (100 μM), which inhibits both fast (INaf) and persistent (INaP) Na(+) currents, whereas it was unaffected by a low concentration of TTX (10 nM), which selectively blocks INaf. Bath application of Cd(2+) at a low concentration (50 μM), as an inhibitor of INaP, also decreased the Po of KNa channels. Conversely, bath application of the inorganic Ca(2+)-channel blockers Co(2+) and Ni(2+) at high concentrations (500 μM) had little effect on the Po of KNa channels, although Cd(2+) (500 μM) reduced the Po of KNa channels. Perforated whole cell clamp analysis further indicated the presence of sustained outward currents for which amplitude was dependent on the amount of Na(+) influx. Taken together, these results indicate that KNa channels could be activated by Na(+) influx passing through voltage-dependent persistent Na(+) channels. The functional significance of this coupling mechanism was discussed in relation to the membrane excitability of Kenyon cells and its possible role in the formation of long-term memory. Copyright © 2015 the American Physiological Society.
Low voltage arc formation in railguns
Hawke, R.S.
1985-08-05
A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.
Low voltage arc formation in railguns
Hawke, Ronald S.
1987-01-01
A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.
Low voltage arc formation in railguns
Hawke, R.S.
1987-11-17
A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile. 2 figs.
Thermoelectric spin voltage in graphene
NASA Astrophysics Data System (ADS)
Sierra, Juan F.; Neumann, Ingmar; Cuppens, Jo; Raes, Bart; Costache, Marius V.; Valenzuela, Sergio O.
2018-02-01
In recent years, new spin-dependent thermal effects have been discovered in ferromagnets, stimulating a growing interest in spin caloritronics, a field that exploits the interaction between spin and heat currents1,2. Amongst the most intriguing phenomena is the spin Seebeck effect3-5, in which a thermal gradient gives rise to spin currents that are detected through the inverse spin Hall effect6-8. Non-magnetic materials such as graphene are also relevant for spin caloritronics, thanks to efficient spin transport9-11, energy-dependent carrier mobility and unique density of states12,13. Here, we propose and demonstrate that a carrier thermal gradient in a graphene lateral spin valve can lead to a large increase of the spin voltage near to the graphene charge neutrality point. Such an increase results from a thermoelectric spin voltage, which is analogous to the voltage in a thermocouple and that can be enhanced by the presence of hot carriers generated by an applied current14-17. These results could prove crucial to drive graphene spintronic devices and, in particular, to sustain pure spin signals with thermal gradients and to tune the remote spin accumulation by varying the spin-injection bias.
Voltage collapse in complex power grids
Simpson-Porco, John W.; Dörfler, Florian; Bullo, Francesco
2016-01-01
A large-scale power grid's ability to transfer energy from producers to consumers is constrained by both the network structure and the nonlinear physics of power flow. Violations of these constraints have been observed to result in voltage collapse blackouts, where nodal voltages slowly decline before precipitously falling. However, methods to test for voltage collapse are dominantly simulation-based, offering little theoretical insight into how grid structure influences stability margins. For a simplified power flow model, here we derive a closed-form condition under which a power network is safe from voltage collapse. The condition combines the complex structure of the network with the reactive power demands of loads to produce a node-by-node measure of grid stress, a prediction of the largest nodal voltage deviation, and an estimate of the distance to collapse. We extensively test our predictions on large-scale systems, highlighting how our condition can be leveraged to increase grid stability margins. PMID:26887284
Amodeo, Giuseppe Federico; Scorciapino, Mariano Andrea; Messina, Angela; De Pinto, Vito; Ceccarelli, Matteo
2014-01-01
Voltage Dependent Anion-selective Channels (VDACs) are pore-forming proteins located in the outer mitochondrial membrane. They are responsible for the access of ions and energetic metabolites into the inner membrane transport systems. Three VDAC isoforms exist in mammalian, but their specific role is unknown. In this work we have performed extensive (overall ∼5 µs) Molecular Dynamics (MD) simulations of the human VDAC isoforms to detect structural and conformational variations among them, possibly related to specific functional roles of these proteins. Secondary structure analysis of the N-terminal domain shows a high similarity among the three human isoforms of VDAC but with a different plasticity. In particular, the N-terminal domain of the hVDAC1 is characterized by a higher plasticity, with a ∼20% occurrence for the 'unstructured' conformation throughout the folded segment, while hVDAC2, containing a peculiar extension of 11 amino acids at the N-terminal end, presents an additional 310-helical folded portion comprising residues 10' to 3, adhering to the barrel wall. The N-terminal sequences of hVDAC isoforms are predicted to have a low flexibility, with possible consequences in the dynamics of the human VDACs. Clear differences were found between hVDAC1 and hVDAC3 against hVDAC2: a significantly modified dynamics with possible important consequence on the voltage-gating mechanism. Charge distribution inside and at the mouth of the pore is responsible for a different preferential localization of ions with opposite charge and provide a valuable rationale for hVDAC1 and hVDAC3 having a Cl-/K+ selectivity ratio of 1.8, whereas hVDAC2 of 1.4. Our conclusion is that hVDAC isoforms, despite sharing a similar scaffold, have modified working features and a biological work is now requested to give evidence to the described dissimilarities.
Microwave integrated circuit for Josephson voltage standards
NASA Technical Reports Server (NTRS)
Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)
1980-01-01
A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.
Voltage Gating of Shaker K+ Channels
Rodríguez, Beatriz M.; Sigg, Daniel; Bezanilla, Francisco
1998-01-01
Ionic (Ii) and gating currents (Ig) from noninactivating Shaker H4 K+ channels were recorded with the cut-open oocyte voltage clamp and macropatch techniques. Steady state and kinetic properties were studied in the temperature range 2–22°C. The time course of Ii elicited by large depolarizations consists of an initial delay followed by an exponential rise with two kinetic components. The main Ii component is highly temperature dependent (Q10 > 4) and mildly voltage dependent, having a valence times the fraction of electric field (z) of 0.2–0.3 eo. The Ig On response obtained between −60 and 20 mV consists of a rising phase followed by a decay with fast and slow kinetic components. The main Ig component of decay is highly temperature dependent (Q10 > 4) and has a z between 1.6 and 2.8 eo in the voltage range from −60 to −10 mV, and ∼0.45 eo at more depolarized potentials. After a pulse to 0 mV, a variable recovery period at −50 mV reactivates the gating charge with a high temperature dependence (Q10 > 4). In contrast, the reactivation occurring between −90 and −50 mV has a Q10 = 1.2. Fluctuation analysis of ionic currents reveals that the open probability decreases 20% between 18 and 8°C and the unitary conductance has a low temperature dependence with a Q10 of 1.44. Plots of conductance and gating charge displacement are displaced to the left along the voltage axis when the temperature is decreased. The temperature data suggests that activation consists of a series of early steps with low enthalpic and negative entropic changes, followed by at least one step with high enthalpic and positive entropic changes, leading to final transition to the open state, which has a negative entropic change. PMID:9689029
Hosaka, Toshiaki; Okazaki, Masateru; Kimura-Someya, Tomomi; Ishizuka-Katsura, Yoshiko; Ito, Kaori; Yokoyama, Shigeyuki; Dodo, Kosuke; Sodeoka, Mikiko; Shirouzu, Mikako
2017-09-01
Voltage-dependent anion channel 1 (VDAC1), which is located in the outer mitochondrial membrane, plays important roles in various cellular processes. For example, oligomerization of VDAC1 is involved in the release of cytochrome c to the cytoplasm, leading to apoptosis. However, it is unknown how VDAC1 oligomerization occurs in the membrane. In the present study, we determined high-resolution crystal structures of oligomeric human VDAC1 (hVDAC1) prepared by using an Escherichia coli cell-free protein synthesis system, which avoided the need for denaturation and refolding of the protein. Broad-range screening using a bicelle crystallization method produced crystals in space groups C222 and P22 1 2 1 , which diffracted to a resolution of 3.10 and 3.15 Å, respectively. Each crystal contained two hVDAC1 protomers in the asymmetric unit. Dimer within the asymmetrical unit of the crystal in space group C222 were oriented parallel, whereas those of the crystal in space group P22 1 2 1 were oriented anti-parallel. From a model of the crystal in space group C222, which we constructed by using crystal symmetry operators, a heptameric structure with eight patterns of interaction between protomers, including hydrophobic interactions with β-strands, hydrophilic interactions with loop regions, and protein-lipid interactions, was observed. It is possible that by having multiple patterns of interaction, VDAC1 can form homo- or hetero-oligomers not only with other VDAC1 protomers but also with other proteins such as VDAC2, VDAC3 and apoptosis-regulating proteins in the Bcl-2 family. © 2017 The Protein Society.
Meng, Ge; Wu, Ning; Zhang, Cheng; Su, Rui-Bin; Lu, Xin-Qiang; Liu, Yin; Yun, Liu-Hong; Zheng, Jian-Quan; Li, Jin
2008-05-31
ZC88 is a novel non-peptide N-type voltage-sensitive calcium channel blocker synthesized by our institute. In the present study, the oral analgesic activity of ZC88 in animal models of acute and neuropathic pain, and functional interactions between ZC88 and morphine in terms of analgesia, tolerance and dependence were investigated. In mice acetic acid writhing tests, ZC88 (10-80 mg/kg) administered by oral route showed significant antinociceptive effects in a dose-dependent manner. The ED50 values of ZC88 were 14.5 and 14.3 mg/kg in male and female mice, respectively. In sciatic nerve chronic constriction injury rats, mechanical allodynia was ameliorated by oral administration of ZC88 at doses of 14, 28 and 56 mg/kg, suggesting ZC88 relieved allodynic response of neuropathic pain. When concurrently administered with morphine, ZC88 (20-80 mg/kg) dose-dependently potentiated morphine analgesia and attenuated morphine analgesic tolerance in hot-plate tests. ZC88 also prevented chronic exposure to morphine-induced physical dependence and withdrawal, but not morphine-induced psychological dependence in conditioned place preference model. These results suggested that ZC88, a new non-peptide N-type calcium channel blocker, had notable oral analgesia and anti-allodynia for acute and neuropathic pain. ZC88 might be used in pain relief by either application alone or in combination with opioids because it enhanced morphine analgesia while prevented morphine-induced tolerance and physical dependence.
Thomas, M M; Puligandla, P S; Dunn, S M
1994-01-28
Synaptosomal preparations from rat cerebral cortex have been used in stopped-flow fluorescence studies to measure rapid changes in intrasynaptosomal calcium concentrations upon depolarization. Synaptosomes were loaded with the fluorescent calcium chelating dye, Fura-2, by incubation with the membrane permeant acetoxymethyl ester derivative. Depolarization by elevated external K+ concentration resulted in a rapid increase in cytoplasmic Ca2+ as measured by a quench in Fura-2 fluorescence when excited at 390 nm. The fluorescence change could be reasonably fit by a single exponential process with an apparent rate of 10-15 s-1 and the magnitude of the response was voltage-dependent, increasing with increasing external K+ over the range of 5-30 mM. The observed quench was blocked by micromolar concentrations of the inorganic calcium channel blockers, Cd2+, Co2+ and La3+. Nimodipine, a dihydropyridine which blocks L-type calcium channels, inhibited only 10-15% of the flux response while nitrendipine had no consistent effect. omega-Conotoxin GVIA, a blocker of N-type channels in many species, had only a small inhibitory effect at high (1-10 microM) concentrations. The response was, however, inhibited by pre-incubation of the synaptosomes with venom of the funnel web spider. Agelenopsis aperta (0.1-300 micrograms/ml). Inhibition was observed with both a purified polyamine fraction (FTX) from the venom (IC50 = 4 nl/ml) and a purified peptide toxin, omega-AgaIVA (IC50 = 30 nM). These results indicate that voltage-dependent Ca2+ uptake by mammalian nerve terminals is mediated primarily by channels that are insensitive to dihydropyridines and omega-conotoxin GVIA but are sensitive to components of funnel web spider venom.
Functional diversity of voltage-sensing phosphatases in two urodele amphibians.
Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi
2014-07-16
Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Kariev, Alisher M.; Green, Michael E.
2015-01-01
The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R→C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is –SH (reactive form –S−); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain –OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations. PMID:25588216
Kariev, Alisher M; Green, Michael E
2015-01-12
The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R → C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is -SH (reactive form -S-); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain -OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations.
Kulanbaewa, F F; Sekova, V Yu; Isakova, E P; Deryabina, Y I; Nikolaev, A V
2016-09-01
This article presents the characteristics of the highly inducible promoter of the gene encoding the mitochondrial porin, the voltage-dependent anion channel (VDAC). This promoter is recommended for use in new genetic constructs both in basic research for assessing the adaptive strategy of lower eukaryotes under adverse conditions and in designing new highly competitive transformants producing economically important compounds (proteins, lipids, and organic acids) on its basis.
A common pathway for charge transport through voltage-sensing domains.
Chanda, Baron; Bezanilla, Francisco
2008-02-07
Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.
NASA Astrophysics Data System (ADS)
Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong
2017-08-01
This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.
Guzmán-Grenfell, Alberto Martín; González-Martínez, Marco T
2004-01-01
Progesterone induces calcium influx and acrosomal exocytosis in human sperm. Pharmacologic evidence suggests that voltage-dependent calcium channels (VDCCs) are involved. In this study, membrane potential (Vm) and intracellular calcium concentration ([Ca(2+)](i)) were monitored simultaneously to assess the effect of VDCC gating on the calcium influx triggered by progesterone. Holding the Vm to values that maintained VDCCs in a deactivated (-71 mV) closed state inhibited the calcium influx induced by progesterone by approximately 40%. At this Vm, the acrosomal reaction induced by progesterone, but not by A23187, was inhibited. However, when the Vm was held at -15 mV (which maintains VDCCs in an inactivated closed state), the progesterone-induced calcium influx was stimulated. Furthermore, the progesterone and voltage-dependent calcium influxes were additive. These findings indicate that progesterone does not produce VDCC gating in human sperm.
Füll, Yvonne; Seebohm, Guiscard; Lerche, Holger; Maljevic, Snezana
2013-06-01
The voltage-gated potassium channels KV7.2 and KV7.3 (KCNQ2/3 genes) play an important role in regulating neuronal excitability. More than 50 KCNQ2/3 mutations have been identified to cause an inherited form of epilepsy in newborns. For two of those (E119G and S122L) found in the S1-S2 region of KV7.2, we previously showed a decreased channel availability mainly at action potential subthreshold voltages caused by a slight depolarizing shift of the activation curve. Interestingly, recent studies revealed that a threonine residue within the S1-S2 loop, highly conserved among different classes of KV channels, is crucial for both their function and surface expression. To investigate the functional role of the homologous threonine residues in KV7.2 (T114) and KV7.3 (T144) channels, we replaced them with alanine and examined the electrophysiological properties using heterologous expression in CHO cells and whole cell patch clamping. Channels comprising mutant subunits yielded decreased potassium currents with slowed activation and accelerated deactivation kinetics. However, the most striking effect was a depolarizing shift in the voltage dependence of activation reaching +30 mV upon co-expression of both mutant subunits. Potential interactions of T114 within the channel were analyzed by creating a 3D homology model of KV7.2 in an open state suggesting that this residue plays a central role in the formation of a stable interface between the S1-S2 and the S5 segment helices. This could be the explanation why substitution of the conserved threonine in KV7.2 and KV7.3 channels destabilizes the open and favors the closed state of these channels.
Structure of the voltage-gated K⁺ channel Eag1 reveals an alternative voltage sensing mechanism.
Whicher, Jonathan R; MacKinnon, Roderick
2016-08-12
Voltage-gated potassium (K(v)) channels are gated by the movement of the transmembrane voltage sensor, which is coupled, through the helical S4-S5 linker, to the potassium pore. We determined the single-particle cryo-electron microscopy structure of mammalian K(v)10.1, or Eag1, bound to the channel inhibitor calmodulin, at 3.78 angstrom resolution. Unlike previous K(v) structures, the S4-S5 linker of Eag1 is a five-residue loop and the transmembrane segments are not domain swapped, which suggest an alternative mechanism of voltage-dependent gating. Additionally, the structure and position of the S4-S5 linker allow calmodulin to bind to the intracellular domains and to close the potassium pore, independent of voltage-sensor position. The structure reveals an alternative gating mechanism for K(v) channels and provides a template to further understand the gating properties of Eag1 and related channels. Copyright © 2016, American Association for the Advancement of Science.
Capacitively coupled RF voltage probe having optimized flux linkage
Moore, James A.; Sparks, Dennis O.
1999-02-02
An RF sensor having a novel current sensing probe and a voltage sensing probe to measure voltage and current. The current sensor is disposed in a transmission line to link all of the flux generated by the flowing current in order to obtain an accurate measurement. The voltage sensor is a flat plate which operates as a capacitive plate to sense voltage on a center conductor of the transmission line, in which the measured voltage is obtained across a resistance leg of a R-C differentiator circuit formed by the characteristic impedance of a connecting transmission line and a capacitance of the plate, which is positioned proximal to the center conductor.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Two Components of Voltage-Dependent Inactivation in Cav1.2 Channels Revealed by Its Gating Currents
Ferreira, Gonzalo; Ríos, Eduardo; Reyes, Nicolás
2003-01-01
Voltage-dependent inactivation (VDI) was studied through its effects on the voltage sensor in Cav1.2 channels expressed in tsA 201 cells. Two kinetically distinct phases of VDI in onset and recovery suggest the presence of dual VDI processes. Upon increasing duration of conditioning depolarizations, the half-distribution potential (V1/2) of intramembranous mobile charge was negatively shifted as a sum of two exponential terms, with time constants 0.5 s and 4 s, and relative amplitudes near 50% each. This kinetics behavior was consistent with that of increment of maximal charge related to inactivation (Qn). Recovery from inactivation was also accompanied by a reduction of Qn that varied with recovery time as a sum of two exponentials. The amplitudes of corresponding exponential terms were strongly correlated in onset and recovery, indicating that channels recover rapidly from fast VDI and slowly from slow VDI. Similar to charge “immobilization,” the charge moved in the repolarization (OFF) transient became slower during onset of fast VDI. Slow VDI had, instead, hallmarks of interconversion of charge. Confirming the mechanistic duality, fast VDI virtually disappeared when Li+ carried the current. A nine-state model with parallel fast and slow inactivation pathways from the open state reproduces most of the observations. PMID:12770874
Signaling complexes of voltage-gated calcium channels
Turner, Ray W; Anderson, Dustin
2011-01-01
Voltage-gated calcium channels are key mediators of depolarization induced calcium entry into electrically excitable cells. There is increasing evidence that voltage-gated calcium channels, like many other types of ionic channels, do not operate in isolation, but instead form complexes with signaling molecules, G protein coupled receptors, and other types of ion channels. Furthermore, there appears to be bidirectional signaling within these protein complexes, thus allowing not only for efficient translation of calcium signals into cellular responses, but also for tight control of calcium entry per se. In this review, we will focus predominantly on signaling complexes between G protein-coupled receptors and high voltage activated calcium channels, and on complexes of voltage-gated calcium channels and members of the potassium channel superfamily. PMID:21832880
High-voltage subnanosecond dielectric breakdown
NASA Astrophysics Data System (ADS)
Mankowski, John Jerome
Current interests in ultrawideband radar sources are in the microwave regime, which correspond to voltage pulse risetimes less than a nanosecond. Some new sources, including the Phillips Laboratory Hindenberg series of hydrogen gas switched pulsers use hydrogen at hundreds of atmospheres of pressure in the switch. Unfortunately, the published data of electrical breakdown of gas and liquid media at these time lengths are relatively scarce. A study was conducted on the electrical breakdown properties of liquid and gas dielectrics at subnanosecond and nanoseconds. Two separate voltage sources with pulse risetimes less than 400 ps were developed. Diagnostic probes were designed and tested for their capability of detecting high voltage pulses at these fast risetimes. A thorough investigation into E-field strengths of liquid and gas dielectrics at breakdown times ranging from 0.4 to 5 ns was performed. The voltage polarity dependence on breakdown strength is observed. Streak camera images of streamer formation were taken. The effect of ultraviolet radiation, incident upon the gap, on statistical lag time was determined.
Nagaev, K E
2001-04-02
The shot noise in long diffusive superconductor-normal-metal-superconductor contacts is calculated using the semiclassical approach. At low frequencies and for purely elastic scattering, the voltage dependence of the noise is of the form S(I) = (4Delta+2eV)/3R. The electron-electron scattering suppresses the noise at small voltages resulting in vanishing noise yet infinite dS(I)/dV at V = 0. The distribution function of electrons consists of a series of steps, and the frequency dependence of noise exhibits peculiarities at omega = neV, omega = neV-2Delta, and omega = 2Delta-neV for integer n.
Spontaneous voltage and current fluctuations in tissue cultured mouse dorsal root ganglion cells.
Mathers, D A; Barker, J L
1984-02-13
Fetal mouse dorsal root ganglion (DRG) neurons were maintained in primary dissociated cell culture for periods of 7 days to 3 months. Intracellular recordings from these cells revealed the presence of spontaneous subthreshold potentials in 101/177 neurons studied. When measured at the resting membrane potential, these spontaneous voltage events took two forms: (a) high frequency potential fluctuations several millivolts in peak-to-peak amplitude and (b) small, discrete hyperpolarizations. Neurons exhibiting either type of event were designated as 'active' DRG cells. No spontaneous potentials were seen in DRG cells hyperpolarized to membrane voltages more negative than -64 +/- 11.5 mV (n = 5 cells). Under voltage-clamp conditions, the subthreshold potentials of active DRG cells were replaced by fluctuations in outward current. The power spectral density, S(f) of these current fluctuations was approximated by an equation of the form S(f) = (S(o)/[1 + (f/fc) alpha] where 2 less than or equal to a less than or equal to 3 and the half-power frequency fc = 11.3 +/- 3.1 Hz at 23 degrees C (n = 17 cells). The spontaneous voltage fluctuations of active DRG cells were abolished in Ca2+-free saline, and of the divalent metal cations Sr2+, Mg2+, Ba2+, Co2+ and Mn2+, only Sr2+ could substitute for Ca2+ in the maintenance of this activity. Tetraethylammonium ions (1-10 mM) reversibly blocked the spontaneous potentials, while caffeine (10 mM) increased the frequency of these events. The spontaneous voltage fluctuations were not dependent on the presence of spinal cord neurons in the culture plate, and they were also observed in cultured DRG cells derived from adult mice.
Zhong, Guoqiang; Akoum, Nazem; Appadurai, Daniel A.; Hayrapetyan, Volodya; Ahmed, Osman; Martinez, Agustin D.; Beyer, Eric C.; Moreno, Alonso P.
2017-01-01
In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2) is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj) for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge) of the crossing molecules. PMID:28611680
Zhong, Guoqiang; Akoum, Nazem; Appadurai, Daniel A; Hayrapetyan, Volodya; Ahmed, Osman; Martinez, Agustin D; Beyer, Eric C; Moreno, Alonso P
2017-01-01
In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2) is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj) for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge) of the crossing molecules.
Field-Polarity-Dependent Domain Growth in Epitaxial BaTiO 3 Films
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roth, Robert; Guo, Er-Jia; Rafique, Mohsin
The growth of circular tip-induced domains has been studied in epitaxial BaTiO 3 (BTO) films as a function of writing voltage and time using piezoresponse force microscopy (PFM). While abundant for Pb(Zr,Ti)O 3 (PZT) films, such studies are rare for BTO. Strong relaxation of written domains is observed in the form of reduction of the PFM amplitude inside the area of written domains which occurs additionally to a decrease of the domain radius. The domain wall velocity observed for negative tip voltage is systematically smaller than that for positive tip voltage. Based on maps of the positive and negative switchingmore » fields, the effective driving field for both polarities has been estimated. The polarity-dependent effective field cannot account for the different velocities, indicating a polarity-dependent mobility of the domain walls.« less
Field-Polarity-Dependent Domain Growth in Epitaxial BaTiO 3 Films
Roth, Robert; Guo, Er-Jia; Rafique, Mohsin; ...
2018-03-23
The growth of circular tip-induced domains has been studied in epitaxial BaTiO 3 (BTO) films as a function of writing voltage and time using piezoresponse force microscopy (PFM). While abundant for Pb(Zr,Ti)O 3 (PZT) films, such studies are rare for BTO. Strong relaxation of written domains is observed in the form of reduction of the PFM amplitude inside the area of written domains which occurs additionally to a decrease of the domain radius. The domain wall velocity observed for negative tip voltage is systematically smaller than that for positive tip voltage. Based on maps of the positive and negative switchingmore » fields, the effective driving field for both polarities has been estimated. The polarity-dependent effective field cannot account for the different velocities, indicating a polarity-dependent mobility of the domain walls.« less
Interfacial morphology of low-voltage anodic aluminium oxide
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Naiping; Dongcinn, Xuecheng; He, Xueying
X-ray reflectivity (XRR) and neutron reflectivity (NR), as well as ultra-smallangle X-ray scattering (USAXS), are used to examine the in-plane and surfacenormal structure of anodic films formed on aluminium alloy AA2024 and pure aluminium. Aluminium and alloy films up to 3500 A thick were deposited on Si wafers by electron beam evaporation of ingots. Porous anodic aluminium oxide (AAO) films are formed by polarizing at constant voltage up to 20 V noble to the open circuit potential. The voltage sweet spot (5 V) appropriate for constant-voltage anodization of such thin films was determined for both alloy and pure Al. Inmore » addition, a new concurrent voltage- and current-control protocol was developed to prepare films with larger pores (voltages higher than 5 V), but formed at a controlled current so that pore growth is slow enough to avoid stripping the aluminium substrate layer. USAXS shows that the pore size and interpore spacing are fixed in the first 10 s after initiation of anodization. Pores then grow linearly in time, at constant radius and interpore spacing. Using a combination of XRR and NR, the film density and degree of hydration of the films were determined from the ratio of scattering length densities. Assuming a chemical formula Al2O3xH2O, it was found that x varies from 0.29 for the native oxide to 1.29 for AAO grown at 20 V under concurrent voltage and current control. The average AAO film density of the porous film at the air surface is 2.45 (20) g cm3. The density of the barrier layer at the metal interface is 2.9 (4) g cm3, which indicates that this layer is also quite porous« less
Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks
NASA Technical Reports Server (NTRS)
Teverovsky, Alexander
2014-01-01
Time dependence of absorption voltages (V(sub abs)) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on V(sub abs)), cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on V(sub abs)), are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks.
Solutions for transients in arbitrarily branching cables: III. Voltage clamp problems.
Major, G
1993-07-01
Branched cable voltage recording and voltage clamp analytical solutions derived in two previous papers are used to explore practical issues concerning voltage clamp. Single exponentials can be fitted reasonably well to the decay phase of clamped synaptic currents, although they contain many underlying components. The effective time constant depends on the fit interval. The smoothing effects on synaptic clamp currents of dendritic cables and series resistance are explored with a single cylinder + soma model, for inputs with different time courses. "Soma" and "cable" charging currents cannot be separated easily when the soma is much smaller than the dendrites. Subtractive soma capacitance compensation and series resistance compensation are discussed. In a hippocampal CA1 pyramidal neurone model, voltage control at most dendritic sites is extremely poor. Parameter dependencies are illustrated. The effects of series resistance compound those of dendritic cables and depend on the "effective capacitance" of the cell. Plausible combinations of parameters can cause order-of-magnitude distortions to clamp current waveform measures of simulated Schaeffer collateral inputs. These voltage clamp problems are unlikely to be solved by the use of switch clamp methods.
Ruscic, Katarina J.; Miceli, Francesco; Villalba-Galea, Carlos A.; Dai, Hui; Mishina, Yukiko; Bezanilla, Francisco; Goldstein, Steve A. N.
2013-01-01
Human IKs channels activate slowly with the onset of cardiac action potentials to repolarize the myocardium. IKs channels are composed of KCNQ1 (Q1) pore-forming subunits that carry S4 voltage-sensor segments and KCNE1 (E1) accessory subunits. Together, Q1 and E1 subunits recapitulate the conductive and kinetic properties of IKs. How E1 modulates Q1 has been unclear. Investigators have variously posited that E1 slows the movement of S4 segments, slows opening and closing of the conduction pore, or modifies both aspects of electromechanical coupling. Here, we show that Q1 gating current can be resolved in the absence of E1, but not in its presence, consistent with slowed movement of the voltage sensor. E1 was directly demonstrated to slow S4 movement with a fluorescent probe on the Q1 voltage sensor. Direct correlation of the kinetics of S4 motion and ionic current indicated that slowing of sensor movement by E1 was both necessary and sufficient to determine the slow-activation time course of IKs. PMID:23359697
Gonzalez-Gronow, Mario; Cuchacovich, Miguel; Francos, Rina; Cuchacovich, Stephanie; Fernandez, Maria del Pilar; Blanco, Angel; Bowers, Edith V.; Kaczowka, Steven; Pizzo, Salvatore V.
2010-01-01
Autistic children show elevated serum levels of autoantibodies to several proteins essential for the function of normal brains. The voltage-dependent anion channel, VDAC, and hexokinase-I, a VDAC protective ligand, were identified as targets of this autoimmunity in autistic children. These autoantibodies were purified using immunoaffinity chromatographic techniques. Both antibodies induce apoptosis of cultured human neuroblastoma cells. Because VDAC and hexokinase-I are essential for brain protection from ischemic damage, the presence of these autoantibodies suggests a possible causal role in the neurologic pathogenesis of autism. PMID:20576296
Superstrate sub-cell voltage-matched multijunction solar cells
Mascarenhas, Angelo; Alberi, Kirstin
2016-03-15
Voltage-matched thin film multijunction solar cell and methods of producing cells having upper CdTe pn junction layers formed on a transparent substrate which in the completed device is operatively positioned in a superstate configuration. The solar cell also includes a lower pn junction formed independently of the CdTe pn junction and an insulating layer between CdTe and lower pn junctions. The voltage-matched thin film multijunction solar cells further include a parallel connection between the CdTe pn junction and lower pn junctions to form a two-terminal photonic device. Methods of fabricating devices from independently produced upper CdTe junction layers and lower junction layers are also disclosed.
Bergman, C; Bergman, J
1985-01-01
The kinetics and voltage dependence of asparagine (Asn)-induced depolarization in endoderm cells from Xenopus laevis embryos were analysed using current-clamp techniques. The depolarization is assumed to reflect the activation of an amino acid membrane carrier; it is accompanied by a slight increase in membrane resistance and cannot be explained by only the electrogenic character of the Asn carrier. It is proposed that the Asn depolarization arises, at least in part, from the decrease of the permeability ratio PK/PNa indirectly associated with the Na-coupled amino acid uptake. At room temperature (20-23 degrees C) the Asn response develops according to a single exponential function whose time constant is correlated with the final level of depolarization. Both amplitude and rise time of the depolarization are sensitive to variations of membrane potential and changes in Asn or Na external concentrations. Lowering the temperature decreases the amplitude of the Asn depolarization and increases its rise time with a Q10 factor of two; the kinetics remain of the Michaelis-Menten type, with a marked decrease in delta Emax and no change in Km. When the holding potential is altered by depolarizing and hyperpolarizing currents, the Asn response varies according to a bell-shaped characteristic presenting an optimum near the normal resting level. Membrane depolarizations induced by Na/K-pump inhibitors or high external K concentrations reduce the size of the Asn response; repolarizing the cell by current injection does not reverse the inhibitory effect of external K ions. Hyperpolarizing the membrane with a K-free Ringer solution increases the amplitude of the Asn response. In all these cases a decrease in delta Emax accounts for the apparent voltage sensitivity of the carrier mechanism. When induced by alterations of [K]o, an additional change in Km is observed, suggesting a K/Na-competitive inhibition of the Asn carrier. The results are discussed in terms of the amino acid
Philosophy of voltage-gated proton channels
DeCoursey, Thomas E.; Hosler, Jonathan
2014-01-01
In this review, voltage-gated proton channels are considered from a mainly teleological perspective. Why do proton channels exist? What good are they? Why did they go to such lengths to develop several unique hallmark properties such as extreme selectivity and ΔpH-dependent gating? Why is their current so minuscule? How do they manage to be so selective? What is the basis for our belief that they conduct H+ and not OH–? Why do they exist in many species as dimers when the monomeric form seems to work quite well? It is hoped that pondering these questions will provide an introduction to these channels and a way to logically organize their peculiar properties as well as to understand how they are able to carry out some of their better-established biological functions. PMID:24352668
Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks
NASA Technical Reports Server (NTRS)
Teverovsky, Alexander
2016-01-01
Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.
The sliding-helix voltage sensor
Peyser, Alexander; Nonner, Wolfgang
2012-01-01
The voltage sensor (VS) domain of voltage-gated ion channels underlies electrical excitability of living cells. We simulate a mesoscale model of the VS domain to determine the functional consequences of some of its physical elements. Our mesoscale model is based on VS charges, linear dielectrics and whole-body motion, applied to an S4 ‘sliding helix’. The electrostatics under voltage-clamped boundary conditions are solved consistently using a boundary element method. Based on electrostatic configurational energy, statistical-mechanical expectations of the experimentally observable relation between displaced charge and membrane voltage are predicted. Consequences of the model are investigated for variations of: S4 configuration (α- and 310-helical), countercharge alignment with S4 charges, protein polarizability, geometry of the gating canal, screening of S4 charges by the baths, and fixed charges located at the bath interfaces. The sliding helix VS domain has an inherent electrostatic stability in the explored parameter space: countercharges present in the region of weak dielectric always retain an equivalent S4 charge in that region but allow sliding movements displacing 3 to 4 e0. That movement is sensitive to small energy variations (< 2kT) along the path dependent on a number of electrostatic parameters tested in our simulations. These simulations show how the slope of the relation between displaced charge and voltage could be tuned in a channel. PMID:22907204
Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.
Elinder, Fredrik; Liin, Sara I
2017-01-01
Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.
Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels
Elinder, Fredrik; Liin, Sara I.
2017-01-01
Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076
Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.
Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C
2010-10-01
Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Low voltage to high voltage level shifter and related methods
NASA Technical Reports Server (NTRS)
Mentze, Erik J. (Inventor); Buck, Kevin M. (Inventor); Hess, Herbert L. (Inventor); Cox, David F. (Inventor)
2006-01-01
A shifter circuit comprises a high and low voltage buffer stages and an output buffer stage. The high voltage buffer stage comprises multiple transistors arranged in a transistor stack having a plurality of intermediate nodes connecting individual transistors along the stack. The transistor stack is connected between a voltage level being shifted to and an input voltage. An inverter of this stage comprises multiple inputs and an output. Inverter inputs are connected to a respective intermediate node of the transistor stack. The low voltage buffer stage has an input connected to the input voltage and an output, and is operably connected to the high voltage buffer stage. The low voltage buffer stage is connected between a voltage level being shifted away from and a lower voltage. The output buffer stage is driven by the outputs of the high voltage buffer stage inverter and the low voltage buffer stage.
Ionic Dependence of Reversal Voltage of the Light Response in Limulus Ventral Photoreceptors
Brown, J. E.; Mote, M. I.
1974-01-01
The light-induced current as measured using a voltage clamp (holding voltage at resting potential) is attenuated when sodium ions in the bathing solution, Nao, are replaced by Tris, choline, or Li or when NaCl is replaced by sucrose. After replacement of NaCl by sucrose, the reversal voltage, V rev, for the light response becomes more negative. In this case, the slope of the V rev vs. log Nao near Nao = 425 mM is approximately 55 mV/decade increase of Nao (mean for 13 cells). The slope decreases at lower values of Nao. Choline is not impermeant and partially substitutes for Na; the slope of V rev vs. log Nao is 20 mV/decade (mean for three cells). V rev does not change when Na is replaced by Li. Decreases in the bath concentrations of Ca, Mg, Cl, or K do not affect V rev. When Nao = 212 mM, V rev becomes more positive when Ko is increased. Thus, light induces a change in membrane permeability to Na and probably also to K. PMID:4817353
Tadjibaeva, G; Sabirov, R; Tomita, T
2000-08-25
Flammutoxin, a 31-kDa cardiotoxic and cytolytic protein from the edible mushroom Flammulina velutipes, has been shown to assemble into a pore-forming annular oligomer with outer and inner diameters of 10 and 5 nm on the target cells [Tomita et al., Biochem. J. 333 (1998) 129-137]. Here we studied electrophysiological properties of flammutoxin channels using planar lipid bilayer technique, and found that flammutoxin formed two types of moderately cation-selective, voltage-gated channels with smaller and larger current amplitudes (1-4.5 pA and 20-30 pA, respectively, at 20 mV) in the lipid bilayers composed of phospholipid and cholesterol. The larger-conductance single channel showed the properties of a wide water-filled pore such as a linear relationship between channel conductance and salt concentration of the bathing solution. The functional diameter of the larger-conductance channel was estimated to be 4-5 nm by measuring the current conductance in the presence of polyethylene glycols of various sizes. In contrast, the smaller-conductance single channels showed a non-linear current to voltage curve and a saturating conductance to increasing salt concentration. These results suggest that the larger-conductance channel of flammutoxin corresponds to the hemolytic pore complex, while the smaller-conductance channel may reflect the intermediate state(s) of the assembling toxin.
Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter
NASA Technical Reports Server (NTRS)
Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.;
2012-01-01
At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.
Study of the Dependence on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter
NASA Technical Reports Server (NTRS)
Bandler, Simon
2011-01-01
At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in the AC bias configuration. For x-ray photons at 6keV the AC biased pixel shows a best energy resolution of 3.7eV, which is about a factor of 2 worse than the energy resolution observed in identical DC-biased pixels. To better understand the reasons of this discrepancy, we investigated the detector performance as a function of temperature, bias working point and applied magnetic field. A strong periodic dependence of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recent weak-link behaviour observed inTES microcalorimeters.
2013-01-01
Utilizing semiconductor nanowires for (opto)electronics requires exact knowledge of their current–voltage properties. We report accurate on-top imaging and I–V characterization of individual as-grown nanowires, using a subnanometer resolution scanning tunneling microscope with no need for additional microscopy tools, thus allowing versatile application. We form Ohmic contacts to InP and InAs nanowires without any sample processing, followed by quantitative measurements of diameter dependent I–V properties with a very small spread in measured values compared to standard techniques. PMID:24059470
Timm, Rainer; Persson, Olof; Engberg, David L J; Fian, Alexander; Webb, James L; Wallentin, Jesper; Jönsson, Andreas; Borgström, Magnus T; Samuelson, Lars; Mikkelsen, Anders
2013-11-13
Utilizing semiconductor nanowires for (opto)electronics requires exact knowledge of their current-voltage properties. We report accurate on-top imaging and I-V characterization of individual as-grown nanowires, using a subnanometer resolution scanning tunneling microscope with no need for additional microscopy tools, thus allowing versatile application. We form Ohmic contacts to InP and InAs nanowires without any sample processing, followed by quantitative measurements of diameter dependent I-V properties with a very small spread in measured values compared to standard techniques.
Current State of Theoretical and Experimental Studies of the Voltage-Dependent Anion Channel (VDAC)
Noskov, Sergei Yu.; Rostovtseva, Tatiana K.; Chamberlin, Adam C.; Teijido, Oscar; Jiang, Wei; Bezrukov, Sergey M.
2016-01-01
Voltage-dependent anion channel (VDAC), the major channel of the mitochondrial outer membrane provides a controlled pathway for respiratory metabolites in and out of the mitochondria. In spite of the wealth of experimental data from structural, biochemical, and biophysical investigations, the exact mechanisms governing selective ion and metabolite transport, especially the role of titratable charged residues and interactions with soluble cytosolic proteins, remain hotly debated in the field. The computational advances hold a promise to provide a much sought-after solution to many of the scientific disputes around solute and ion transport through VDAC and hence, across the mitochondrial outer membrane. In this review, we examine how Molecular Dynamics, Free Energy, and Brownian Dynamics simulations of the large β-barrel channel, VDAC, advanced our understanding. We will provide a short overview of non-conventional techniques and also discuss examples of how the modeling excursions into VDAC biophysics prospectively aid experimental efforts. PMID:26940625
NASA Astrophysics Data System (ADS)
Toledo-Aral, Juan J.; Moss, Brenda L.; He, Zhi-Jun; Koszowski, Adam G.; Whisenand, Teri; Levinson, Simon R.; Wolf, John J.; Silos-Santiago, Inmaculada; Halegoua, Simon; Mandel, Gail
1997-02-01
Membrane excitability in different tissues is due, in large part, to the selective expression of distinct genes encoding the voltage-dependent sodium channel. Although the predominant sodium channels in brain, skeletal muscle, and cardiac muscle have been identified, the major sodium channel types responsible for excitability within the peripheral nervous system have remained elusive. We now describe the deduced primary structure of a sodium channel, peripheral nerve type 1 (PN1), which is expressed at high levels throughout the peripheral nervous system and is targeted to nerve terminals of cultured dorsal root ganglion neurons. Studies using cultured PC12 cells indicate that both expression and targeting of PN1 is induced by treatment of the cells with nerve growth factor. The preferential localization suggests that the PN1 sodium channel plays a specific role in nerve excitability.
Nonlinear antiferroelectric-like capacitance-voltage curves in ferroelectric BiFeO3 thin films
NASA Astrophysics Data System (ADS)
Jiang, A. Q.; Zhang, D. W.; Tang, T. A.
2013-07-01
The ferroelectric capacitance is usually nonlinear against increasing/decreasing voltage in sweeping time longer than 1 s and achieves a maximum value at around a coercive voltage within each loop. With the improved short-pulse measurements, we estimated the differential capacitance of ferroelectric Au/BiFeO3/LaNiO3/SrTiO3 thin-film capacitors from a nanosecond discharging current induced by a delta voltage after a stressing voltage pulse with widths of 500 ns-50 ms. With the shortening of the voltage sweeping time, we clearly observed two capacitance maxima from each branch of a capacitance-voltage (C-V) loop, reminiscent of an antiferroelectric behavior. After transformation of nanosecond domain switching current transients under pulses into polarization-voltage hysteresis loops, we further measured time dependent polarization retention as well as imprint in the range of 100 ns-1 s. Both positive and negative polarizations decay exponentially at characteristic times of 2.25 and 198 μs, suggesting the coexistence of preferred domains pointing to top and bottom electrodes in most epitaxial films. This exponential time dependence is similar to the dielectric degradation under a dc voltage, and the polarization retention can be improved through long-time opposite voltage stressing. With this improvement, the additional antiferroelectric-like dielectric maximum within each branch of a C-V loop disappears. This experiment provides the strong evidence of the effect of time-dependent charge injection on polarization retention and dielectric degradation.
Application of Microsecond Voltage Pulses for Water Disinfection by Diaphragm Electric Discharge
NASA Astrophysics Data System (ADS)
Kakaurov, S. V.; Suvorov, I. F.; Yudin, A. S.; Solovyova, T. L.; Kuznetsova, N. S.
2015-11-01
The paper presents the dependence of copper and silver ions formation on the duration of voltage pulses of diaphragm electric discharge and on the pH of treated liquid medium. Knowing it allows one to create an automatic control system to control bactericidal agent's parameters obtained in diaphragm electric discharge reactor. The current-voltage characteristic of the reactor with a horizontal to the diaphragm membrane water flow powered from the author's custom pulse voltage source is also presented. The results of studies of the power consumption of diaphragm electric discharge depending on temperature of the treated liquid medium are given.
Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie
2014-01-01
Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.
Tunneling contact IGZO TFTs with reduced saturation voltages
NASA Astrophysics Data System (ADS)
Wang, Longyan; Sun, Yin; Zhang, Xintong; Zhang, Lining; Zhang, Shengdong; Chan, Mansun
2017-04-01
We report a tunneling contact indium-gallium-zinc oxide (IGZO) thin film transistor (TFT) with a graphene interlayer technique in this paper. A Schottky junction is realized between a metal and IGZO with a graphene interlayer, leading to a quantum tunneling of the TFT transport in saturation regions. This tunneling contact enables a significant reduction in the saturation drain voltage Vdsat compared to that of the thermionic emission TFTs, which is usually equal to the gate voltage minus their threshold voltages. Measured temperature independences of the subthreshold swing confirm a transition from the thermionic emission to quantum tunneling transports depending on the gate bias voltages in the proposed device. The tunneling contact TFTs with the graphene interlayer have implications to reduce the power consumptions of certain applications such as the active matrix OLED display.
NASA Astrophysics Data System (ADS)
Gülnahar, Murat
2014-12-01
In this study, the current-voltage (I-V) and capacitance-voltage (C-V) measurements of an Au/4H-SiC Schottky diode are characterized as a function of the temperature in 50-300 K temperature range. The experimental parameters such as ideality factor and apparent barrier height presents to be strongly temperature dependent, that is, the ideality factor increases and the apparent barrier height decreases with decreasing temperature, whereas the barrier height values increase with the temperature for C-V data. Likewise, the Richardson plot deviates at low temperatures. These anomaly behaviors observed for Au/4H-SiC are attributed to Schottky barrier inhomogeneities. The barrier anomaly which relates to interface of Au/4H-SiC is also confirmed by the C-V measurements versus the frequency measured in 300 K and it is interpreted by both Tung's lateral inhomogeneity model and multi-Gaussian distribution approach. The values of the weighting coefficients, standard deviations and mean barrier height are calculated for each distribution region of Au/4H-SiC using the multi-Gaussian distribution approach. In addition, the total effective area of the patches NAe is obtained at separate temperatures and as a result, it is expressed that the low barrier regions influence meaningfully to the current transport at the junction. The homogeneous barrier height value is calculated from the correlation between the ideality factor and barrier height and it is noted that the values of standard deviation from ideality factor versus q/3kT curve are in close agreement with the values obtained from the barrier height versus q/2kT variation. As a result, it can be concluded that the temperature dependent electrical characteristics of Au/4H-SiC can be successfully commented on the basis of the thermionic emission theory with both models.
Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin
2013-09-01
We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped
Methods for improving solar cell open circuit voltage
Jordan, John F.; Singh, Vijay P.
1979-01-01
A method for producing a solar cell having an increased open circuit voltage. A layer of cadmium sulfide (CdS) produced by a chemical spray technique and having residual chlorides is exposed to a flow of hydrogen sulfide (H.sub.2 S) heated to a temperature of 400.degree.-600.degree. C. The residual chlorides are reduced and any remaining CdCl.sub.2 is converted to CdS. A heterojunction is formed over the CdS and electrodes are formed. Application of chromium as the positive electrode results in a further increase in the open circuit voltage available from the H.sub.2 S-treated solar cell.
Conformational changes in the M2 muscarinic receptor induced by membrane voltage and agonist binding
Navarro-Polanco, Ricardo A; Galindo, Eloy G Moreno; Ferrer-Villada, Tania; Arias, Marcelo; Rigby, J Ryan; Sánchez-Chapula, José A; Tristani-Firouzi, Martin
2011-01-01
Abstract The ability to sense transmembrane voltage is a central feature of many membrane proteins, most notably voltage-gated ion channels. Gating current measurements provide valuable information on protein conformational changes induced by voltage. The recent observation that muscarinic G-protein-coupled receptors (GPCRs) generate gating currents confirms their intrinsic capacity to sense the membrane electrical field. Here, we studied the effect of voltage on agonist activation of M2 muscarinic receptors (M2R) in atrial myocytes and how agonist binding alters M2R gating currents. Membrane depolarization decreased the potency of acetylcholine (ACh), but increased the potency and efficacy of pilocarpine (Pilo), as measured by ACh-activated K+ current, IKACh. Voltage-induced conformational changes in M2R were modified in a ligand-selective manner: ACh reduced gating charge displacement while Pilo increased the amount of charge displaced. Thus, these ligands manifest opposite voltage-dependent IKACh modulation and exert opposite effects on M2R gating charge displacement. Finally, mutations in the putative ligand binding site perturbed the movement of the M2R voltage sensor. Our data suggest that changes in voltage induce conformational changes in the ligand binding site that alter the agonist–receptor interaction in a ligand-dependent manner. Voltage-dependent GPCR modulation has important implications for cellular signalling in excitable tissues. Gating current measurement allows for the tracking of subtle conformational changes in the receptor that accompany agonist binding and changes in membrane voltage. PMID:21282291
Marcoux, Curtis M; Clarke, Stephen E; Nesse, William H; Longtin, Andre; Maler, Leonard
2016-01-01
Encoding behaviorally relevant stimuli in a noisy background is critical for animals to survive in their natural environment. We identify core biophysical and synaptic mechanisms that permit the encoding of low-frequency signals in pyramidal neurons of the weakly electric fish Apteronotus leptorhynchus, an animal that can accurately encode even miniscule amplitude modulations of its self-generated electric field. We demonstrate that slow NMDA receptor (NMDA-R)-mediated excitatory postsynaptic potentials (EPSPs) are able to summate over many interspike intervals (ISIs) of the primary electrosensory afferents (EAs), effectively eliminating the baseline EA ISI correlations from the pyramidal cell input. Together with a dynamic balance of NMDA-R and GABA-A-R currents, this permits stimulus-evoked changes in EA spiking to be transmitted efficiently to target electrosensory lobe (ELL) pyramidal cells, for encoding low-frequency signals. Interestingly, AMPA-R activity is depressed and appears to play a negligible role in the generation of action potentials. Instead, we hypothesize that cell-intrinsic voltage-dependent membrane noise supports the encoding of perithreshold sensory input; this noise drives a significant proportion of pyramidal cell spikes. Together, these mechanisms may be sufficient for the ELL to encode signals near the threshold of behavioral detection. Copyright © 2016 the American Physiological Society.
Addition and subtraction of spin pumping voltages in magnetic hybrid structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azevedo, A., E-mail: aac@df.ufpe.br; Alves Santos, O.; Cunha, R. O.
2014-04-14
We report an investigation of the spin pumping voltage generated in bilayers of ferromagnetic/normal metal in which the ferromagnetic layer is yttrium iron garnet or Permalloy and the normal-metal layer is Pt or Ta. We also investigated a special case in which the voltage is detected in single layer of Permalloy under ferromagnetic resonance condition. It is shown that the spin pumping voltage generated in metallic bilayers have contributions from both layers and the resulting voltage depends on the relative signs of charge currents generated by the inverse spin Hall effect. For instance, the spin pumping voltage generated in Tamore » has the same sign as the one generate in single layer of Permalloy, but contrary to the voltage generated in Pt. When the voltage is measured in shunted metallic bilayers, the resulting voltage can be a sum or a subtraction of the voltages generated in both layers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carpenter, Gary D.; El-Essawy, Wael; Ferreira, Alexandre Peixoto
2016-04-26
A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing formed from two portions that mechanically close around the wire and that contain the current and voltage sensors. The current sensor is a ferrite cylinder formed from at least three portions that form the cylindermore » when the sensor is closed around the wire with a hall effect sensor disposed in a gap between two of the ferrite portions along the circumference to measure current. A capacitive plate or wire is disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.« less
A compact 100 kV high voltage glycol capacitor.
Wang, Langning; Liu, Jinliang; Feng, Jiahuai
2015-01-01
A high voltage capacitor is described in this paper. The capacitor uses glycerol as energy storage medium, has a large capacitance close to 1 nF, can hold off voltages of up to 100 kV for μs charging time. Allowing for low inductance, the capacitor electrode is designed as coaxial structure, which is different from the common structure of the ceramic capacitor. With a steady capacitance at different frequencies and a high hold-off voltage of up to 100 kV, the glycol capacitor design provides a potential substitute for the ceramic capacitors in pulse-forming network modulator to generate high voltage pulses with a width longer than 100 ns.
Hansen, U P; Gradmann, D; Sanders, D; Slayman, C L
1981-01-01
This paper develops a simple reaction-kinetic model to describe electrogenic pumping and co- (or counter-) transport of ions. It uses the standard steady-state approach for cyclic enzyme- or carrier-mediated transport, but does not assume rate-limitation by any particular reaction step. Voltage-dependence is introduced, after the suggestion of Läuger and Stark (Biochim. Biophys. Acta 211:458-466, 1970), via a symmetric Eyring barrier, in which the charge-transit reaction constants are written as k12 = ko12 exp(zF delta psi/2RT) and k21 = ko21 exp(-zF delta psi/2RT). For interpretation of current-voltage relationships, all voltage-independent reaction steps are lumped together, so the model in its simplest form can be described as a pseudo-2-state model. It is characterized by the two voltage-dependent reaction constants, two lumped voltage-independent reaction constants (k12, k21), and two reserve factors (ri, ro) which formally take account of carrier states that are indistinguishable in the current-voltage (I-V) analysis. The model generates a wide range of I-V relationships, depending on the relative magnitudes of the four reaction constants, sufficient to describe essentially all I-V datas now available on "active" ion-transport systems. Algebraic and numerical analysis of the reserve factors, by means of expanded pseudo-3-, 4-, and 5-state models, shows them to be bounded and not large for most combinations of reaction constants in the lumped pathway. The most important exception to this rule occurs when carrier decharging immediately follows charge transit of the membrane and is very fast relative to other constituent voltage-independent reactions. Such a circumstance generates kinetic equivalence of chemical and electrical gradients, thus providing a consistent definition of ion-motive forces (e.g., proton-motive force, PMF). With appropriate restrictions, it also yields both linear and log-linear relationships between net transport velocity and either
Jacobson, Stephen C.; Ramsey, J. Michael
2000-01-01
A microfabricated device and method for proportioning and mixing electrokinetically manipulated biological or chemical materials is disclosed. The microfabricated device mixes a plurality of materials in volumetric proportions controlled by the electrical resistances of tributary reagent channels through which the materials are transported. The microchip includes two or more tributary reagent channels combining at one or more junctions to form one or more mixing channels. By varying the geometries of the channels (length, cross section, etc.), a plurality of reagent materials can be mixed at a junction such that the proportions of the reagent materials in the mixing channel depend on a ratio of the channel geometries and material properties. Such an approach facilitates voltage division on the microchip without relying on external wiring schemes and voltage division techniques external to the microchip. Microchannel designs that provide the necessary voltage division to accomplish electrokinetic valving operations using a single voltage source and a switch are also described. In addition, microchannel designs that accomplish fluidic operation utilizing a minimal number of fluidic reservoirs are disclosed.
Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter.
Gottardi, L; Adams, J; Bailey, C; Bandler, S; Bruijn, M; Chervenak, J; Eckart, M; Finkbeiner, F; den Hartog, R; Hoevers, H; Kelley, R; Kilbourne, C; de Korte, P; van der Kuur, J; Lindeman, M; Porter, F; Sadlier, J; Smith, S
At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Δ E FWHM =3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterised the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.
Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio
2010-01-01
Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499
NASA Astrophysics Data System (ADS)
Yang, G.; Stark, B. H.; Burrow, S. G.; Hollis, S. J.
2014-11-01
This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up.
MLKL forms disulfide bond-dependent amyloid-like polymers to induce necroptosis
Liu, Shuzhen; Liu, Hua; Johnston, Andrea; Hanna-Addams, Sarah; Reynoso, Eduardo; Xiang, Yougui
2017-01-01
Mixed-lineage kinase domain-like protein (MLKL) is essential for TNF-α–induced necroptosis. How MLKL promotes cell death is still under debate. Here we report that MLKL forms SDS-resistant, disulfide bond-dependent polymers during necroptosis in both human and mouse cells. MLKL polymers are independent of receptor-interacting protein kinase 1 and 3 (RIPK1/RIPK3) fibers. Large MLKL polymers are more than 2 million Da and are resistant to proteinase K digestion. MLKL polymers are fibers 5 nm in diameter under electron microscopy. Furthermore, the recombinant N-terminal domain of MLKL forms amyloid-like fibers and binds Congo red dye. MLKL mutants that cannot form polymers also fail to induce necroptosis efficiently. Finally, the compound necrosulfonamide conjugates cysteine 86 of human MLKL and blocks MLKL polymer formation and subsequent cell death. These results demonstrate that disulfide bond-dependent, amyloid-like MLKL polymers are necessary and sufficient to induce necroptosis. PMID:28827318
MLKL forms disulfide bond-dependent amyloid-like polymers to induce necroptosis.
Liu, Shuzhen; Liu, Hua; Johnston, Andrea; Hanna-Addams, Sarah; Reynoso, Eduardo; Xiang, Yougui; Wang, Zhigao
2017-09-05
Mixed-lineage kinase domain-like protein (MLKL) is essential for TNF-α-induced necroptosis. How MLKL promotes cell death is still under debate. Here we report that MLKL forms SDS-resistant, disulfide bond-dependent polymers during necroptosis in both human and mouse cells. MLKL polymers are independent of receptor-interacting protein kinase 1 and 3 (RIPK1/RIPK3) fibers. Large MLKL polymers are more than 2 million Da and are resistant to proteinase K digestion. MLKL polymers are fibers 5 nm in diameter under electron microscopy. Furthermore, the recombinant N-terminal domain of MLKL forms amyloid-like fibers and binds Congo red dye. MLKL mutants that cannot form polymers also fail to induce necroptosis efficiently. Finally, the compound necrosulfonamide conjugates cysteine 86 of human MLKL and blocks MLKL polymer formation and subsequent cell death. These results demonstrate that disulfide bond-dependent, amyloid-like MLKL polymers are necessary and sufficient to induce necroptosis.
Improved Control of Charging Voltage for Li-Ion Battery
NASA Technical Reports Server (NTRS)
Timmerman, Paul; Bugga, Ratnakumar
2006-01-01
The protocol for charging a lithium-ion battery would be modified, according to a proposal, to compensate for the internal voltage drop (charging current internal resistance of the battery). The essence of the modification is to provide for measurement of the internal voltage drop and to increase the terminal-voltage setting by the amount of the internal voltage drop. Ordinarily, a lithium-ion battery is charged at constant current until its terminal voltage attains a set value equal to the nominal full-charge potential. The set value is chosen carefully so as not to exceed the lithium-plating potential, because plated lithium in metallic form constitutes a hazard. When the battery is charged at low temperature, the internal voltage drop is considerable because the electrical conductivity of the battery electrolyte is low at low temperature. Charging the battery at high current at any temperature also gives rise to a high internal voltage drop. In some cases, the internal voltage drop can be as high as 1 volt per cell. Because the voltage available for charging is less than the terminal voltage by the amount of the internal voltage drop, the battery is not fully charged (see figure), even when the terminal voltage reaches the set value. In the modified protocol, the charging current would be periodically interrupted so that the zero-current battery-terminal voltage indicative of the state of charge could be measured. The terminal voltage would also be measured at full charging current. The difference between the full-current and zero-current voltages would equal the internal voltage drop. The set value of terminal voltage would then be increased beyond the nominal full-charge potential by the amount of the internal voltage drop. This adjustment would be performed repeatedly, in real time, so that the voltage setting would track variations in the internal voltage drop to afford full charge without risk of lithium plating. If the charging current and voltage settings
Voltage-sensing phosphatase modulation by a C2 domain
Castle, Paul M.; Zolman, Kevin D.; Kohout, Susy C.
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan, Pengfei; Zheng, Jianming; Kuppan, Saravanan
2015-11-10
Immersion of a solid into liquid often leads to the modification of both the structure and chemistry of surface of the solid, which subsequently affects the chemical and physical properties of the system. For the case of the rechargeable lithium ion battery, such a surface modification is termed as solid electrolyte interphase (SEI) layer, which has been perceived to play critical role for the stable operation of the batteries. However, the structure and chemical composition of SEI layer and its spatial distribution and dependence on the battery operating condition remain unclear. By using aberration corrected scanning transmission electron microscopy coupledmore » with ultra-high sensitive energy dispersive x-ray spectroscopy, we probed the structure and chemistry of SEI layer on several high voltage cathodes. We show that layer-structured cathodes, when cycled at a high cut off voltage, can form a P-rich SEI layer on their surface, which is a direct evidence of Li-salt (LiPF6) decomposition. Our systematical investigations indicate such cathode/Li-salt side reaction shows strong dependence on structure of the cathode materials, operating voltage and temperature, indicating the feasibility of SEI engineering. These findings provide us valuable insights into the complex interface between the high-voltage cathode and the electrolyte.« less
29 CFR 4.155 - Employee coverage does not depend on form of employment contract.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 29 Labor 1 2013-07-01 2013-07-01 false Employee coverage does not depend on form of employment... Employee coverage does not depend on form of employment contract. The Act, in section 8(b), makes it plain... contractual relationship that may be alleged to exist between the contractor or subcontractor and such persons...
29 CFR 4.155 - Employee coverage does not depend on form of employment contract.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 29 Labor 1 2014-07-01 2013-07-01 true Employee coverage does not depend on form of employment... Employee coverage does not depend on form of employment contract. The Act, in section 8(b), makes it plain... contractual relationship that may be alleged to exist between the contractor or subcontractor and such persons...
29 CFR 4.155 - Employee coverage does not depend on form of employment contract.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 29 Labor 1 2011-07-01 2011-07-01 false Employee coverage does not depend on form of employment... Employee coverage does not depend on form of employment contract. The Act, in section 8(b), makes it plain... contractual relationship that may be alleged to exist between the contractor or subcontractor and such persons...
29 CFR 4.155 - Employee coverage does not depend on form of employment contract.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 29 Labor 1 2012-07-01 2012-07-01 false Employee coverage does not depend on form of employment... Employee coverage does not depend on form of employment contract. The Act, in section 8(b), makes it plain... contractual relationship that may be alleged to exist between the contractor or subcontractor and such persons...
29 CFR 4.155 - Employee coverage does not depend on form of employment contract.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Employee coverage does not depend on form of employment... Employee coverage does not depend on form of employment contract. The Act, in section 8(b), makes it plain... contractual relationship that may be alleged to exist between the contractor or subcontractor and such persons...
Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions
Freites, J. Alfredo; Tobias, Douglas J.
2015-01-01
Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na+, K+, Ca2+, and H+ selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1–S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here. PMID:25972106
Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.
Freites, J Alfredo; Tobias, Douglas J
2015-06-01
Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.
Zito, G.V.
1959-04-21
This patent relates to high voltage supply circuits adapted for providing operating voltages for GeigerMueller counter tubes, and is especially directed to an arrangement for maintaining uniform voltage under changing conditions of operation. In the usual power supply arrangement for counter tubes the counter voltage is taken from across the power supply output capacitor. If the count rate exceeds the current delivering capaciiy of the capacitor, the capacitor voltage will drop, decreasing the counter voltage. The present invention provides a multivibrator which has its output voltage controlled by a signal proportional to the counting rate. As the counting rate increases beyond the current delivering capacity of the capacitor, the rectified voltage output from the multivibrator is increased to maintain uniform counter voltage.
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811
Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar
2014-01-01
The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.
Unfolding of a temperature-sensitive domain controls voltage-gated channel activation
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A.; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S.; Minor, Daniel L.
2016-01-01
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNaV) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNaV CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNaV CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNaV voltage dependencies, and demonstrate that a discrete domain can encode the temperature dependent response of a channel. PMID:26919429
[Conserved motifs in voltage sensing proteins].
Wang, Chang-He; Xie, Zhen-Li; Lv, Jian-Wei; Yu, Zhi-Dan; Shao, Shu-Li
2012-08-25
This paper was aimed to study conserved motifs of voltage sensing proteins (VSPs) and establish a voltage sensing model. All VSPs were collected from the Uniprot database using a comprehensive keyword search followed by manual curation, and the results indicated that there are only two types of known VSPs, voltage gated ion channels and voltage dependent phosphatases. All the VSPs have a common domain of four helical transmembrane segments (TMS, S1-S4), which constitute the voltage sensing module of the VSPs. The S1 segment was shown to be responsible for membrane targeting and insertion of these proteins, while S2-S4 segments, which can sense membrane potential, for protein properties. Conserved motifs/residues and their functional significance of each TMS were identified using profile-to-profile sequence alignments. Conserved motifs in these four segments are strikingly similar for all VSPs, especially, the conserved motif [RK]-X(2)-R-X(2)-R-X(2)-[RK] was presented in all the S4 segments, with positively charged arginine (R) alternating with two hydrophobic or uncharged residues. Movement of these arginines across the membrane electric field is the core mechanism by which the VSPs detect changes in membrane potential. The negatively charged aspartate (D) in the S3 segment is universally conserved in all the VSPs, suggesting that the aspartate residue may be involved in voltage sensing properties of VSPs as well as the electrostatic interactions with the positively charged residues in the S4 segment, which may enhance the thermodynamic stability of the S4 segments in plasma membrane.
Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio
2011-01-01
Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.
Reproducible and controllable induction voltage adder for scaled beam experiments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakai, Yasuo; Nakajima, Mitsuo; Horioka, Kazuhiko
2016-08-15
A reproducible and controllable induction adder was developed using solid-state switching devices and Finemet cores for scaled beam compression experiments. A gate controlled MOSFET circuit was developed for the controllable voltage driver. The MOSFET circuit drove the induction adder at low magnetization levels of the cores which enabled us to form reproducible modulation voltages with jitter less than 0.3 ns. Preliminary beam compression experiments indicated that the induction adder can improve the reproducibility of modulation voltages and advance the beam physics experiments.
de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco
2018-03-01
Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.
NASA Astrophysics Data System (ADS)
Koster, L. Jan A.; Mihailetchi, Valentin D.; Ramaker, Robert; Xie, Hangxing; Blom, Paul W. M.
2006-04-01
The open-circuit voltage (Voc) of polymer/fullerene bulk heterojunction solar cells is investigated as a function of light intensity for different temperatures. The observed photogenerated current and V oc are at variance with classical p-n junctionbased models. The influence of light intensity and recombination strength on V oc is consistently explained by a model based on the notion that the quasi-Fermi levels are constant throughout the device, including both drift and diffusion of charge carriers. The light intensity dependence of the short-circuit current density (J sc) is also addressed. A typical feature of polymer/fullerene based solar cells is that Jsc does not scale exactly linearly with light intensity (I). Instead, a power law relationship is found given by Jsc~ Iα, where α ranges from 0.9 to 1. In a number of reports this deviation from unity is attributed to the occurrence of bimolecular recombination. We demonstrate that the dependence of the photocurrent in bulk heterojunction solar cells is governed by the build-up of space charge in the device. The occurrence of space-charge stems from the difference in charge carrier mobility of electrons and holes. In blends of poly(3-hexylthiophene) and 6,6- phenyl C61-butyric acid methyl ester this mobility difference can be tuned in between one and three orders of magnitude, depending on the annealing conditions. This allows us to experimentally verify the relation between space charge build-up and intensity dependence of Jsc. Model calculations confirm that bimolecular recombination leads only to a typical loss of 1% of all free charge carriers at Jsc for these devices. Therefore, bimolecular recombination plays only a minor role as compared to the effect of space charge in the intensity dependence of J sc.
Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks
NASA Technical Reports Server (NTRS)
Teverovsky, Alexander A.
2014-01-01
Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.
Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks
NASA Technical Reports Server (NTRS)
Teverovsky, Alexander A.
2016-01-01
Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.
The allosteric site regulates the voltage sensitivity of muscarinic receptors.
Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas
2018-01-01
Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.
Transmembrane voltage potential controls embryonic eye patterning in Xenopus laevis
Pai, Vaibhav P.; Aw, Sherry; Shomrat, Tal; Lemire, Joan M.; Levin, Michael
2012-01-01
Uncovering the molecular mechanisms of eye development is crucial for understanding the embryonic morphogenesis of complex structures, as well as for the establishment of novel biomedical approaches to address birth defects and injuries of the visual system. Here, we characterize change in transmembrane voltage potential (Vmem) as a novel biophysical signal for eye induction in Xenopus laevis. During normal embryogenesis, a striking hyperpolarization demarcates a specific cluster of cells in the anterior neural field. Depolarizing the dorsal lineages in which these cells reside results in malformed eyes. Manipulating Vmem of non-eye cells induces well-formed ectopic eyes that are morphologically and histologically similar to endogenous eyes. Remarkably, such ectopic eyes can be induced far outside the anterior neural field. A Ca2+ channel-dependent pathway transduces the Vmem signal and regulates patterning of eye field transcription factors. These data reveal a new, instructive role for membrane voltage during embryogenesis and demonstrate that Vmem is a crucial upstream signal in eye development. Learning to control bioelectric initiators of organogenesis offers significant insight into birth defects that affect the eye and might have significant implications for regenerative approaches to ocular diseases. PMID:22159581
Equilibrium Fluctuation Relations for Voltage Coupling in Membrane Proteins
Kim, Ilsoo; Warshel, Arieh
2015-01-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the reaction coordinate of “voltage coupling”, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference at zero membrane potential (i.e., between the two “non-equilibrium” conformational states) is shown to be equivalent to the free energy difference between the two “equilibrium” conformational states along the one-dimensional reaction coordinate of voltage coupling. Furthermore, the requirement that the application of linear response approximation to the free energy functions (free energies) of voltage coupling should satisfy the general free energy relations, yields a novel expression for the gating charge in terms of other experimentally measurable quantities. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the movement of a unit charge within the membrane under the influence of an external potential, using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus–type voltage dependent free energy parabolas for the two conformational states, which allow for quantitative estimations of an equilibrium free energy difference, a free energy of barrier, and the voltage dependency of channel activation (Q-V curve) for the unit charge movement. In addition, our analysis offers a quantitative rationale for the correlation between the free
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Xingshu; Alam, Muhammad Ashraful; Raguse, John
2015-10-15
In this paper, we develop a physics-based compact model for copper indium gallium diselenide (CIGS) and cadmium telluride (CdTe) heterojunction solar cells that attributes the failure of superposition to voltage-dependent carrier collection in the absorber layer, and interprets light-enhanced reverse breakdown as a consequence of tunneling-assisted Poole-Frenkel conduction. The temperature dependence of the model is validated against both simulation and experimental data for the entire range of bias conditions. The model can be used to characterize device parameters, optimize new designs, and most importantly, predict performance and reliability of solar panels including the effects of self-heating and reverse breakdown duemore » to partial-shading degradation.« less
Induced Voltage in an Open Wire
NASA Astrophysics Data System (ADS)
Morawetz, K.; Gilbert, M.; Trupp, A.
2017-07-01
A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.
Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET
Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K.; Craik, David J.; Kent, Stephen B. H.; French, Robert J.; Bezanilla, Francisco; Correa, Ana M.
2017-01-01
Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating. PMID:28202723
Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET.
Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K; Craik, David J; Kent, Stephen B H; French, Robert J; Bezanilla, Francisco; Correa, Ana M
2017-03-07
Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating.
Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160
NASA Astrophysics Data System (ADS)
Meier, F.
2012-05-01
Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
Voltage-gated calcium flux mediates Escherichia coli mechanosensation
Weekley, R. Andrew; Dodd, Benjamin J. T.
2017-01-01
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli, including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings. PMID:28808010
The voltage threshold for arcing for solar cells in Leo - Flight and ground test results
NASA Technical Reports Server (NTRS)
Ferguson, Dale C.
1986-01-01
Ground and flight results of solar cell arcing in low earth orbit (LEO) conditions are compared and interpreted. It is shown that an apparent voltage threshold for arcing may be produced by a storage power law dependence of arc rate on voltage, combined with a limited observation time. The change in this apparent threshold with plasma density is a reflection of the density dependence of the arc rate. A nearly linear dependence of arc rate on density is inferred from the data. A real voltage threshold for arcing for 2 by 2 cm solar cells may exist however, independent of plasma density, near -230 V relative to the plasma. Here, arc rates may change by more than an order of magnitude for a change of only 30 V in array potential. For 5.9 by 5.9 solar cells, the voltage dependence of the arc rate is steeper, and the data are insufficient to indicate the existence of an arcing increased by an atomic oxygen plasma, as is found in LEO, and by arcing from the backs of welded-through substrates.
The voltage threshold for arcing for solar cells in LEO: Flight and ground test results
NASA Technical Reports Server (NTRS)
Ferguson, D. C.
1986-01-01
Ground and flight results of solar cell arcing in low Earth orbit (LEO) conditions are compared and interpreted. It is shown that an apparent voltage threshold for arcing may be produced by a strong power law dependence of arc rate on voltage, combined with a limited observation time. The change in this apparent threshold with plasma density is a reflection of the density dependence of the arc rate. A nearly linear dependence of arc rate on density is inferred from the data. A real voltage threshold for arcing for 2 by 2 cm solar cells may exist however, independent of plasma density, near -230 V relative to the plasma. Here, arc rates may change by more than an order of magnitude for a change of only 30 V in array potential. For 5.9 by 5.9 solar cells, the voltage dependence of the arc rate is steeper, and the data are insufficient to indicate the existence of an arcing increased by an atomic oxygen plasma, as is found in LEO, and by arcing from the backs of welded-through substrates.
Mechanisms Responsible for ω-Pore Currents in Cav Calcium Channel Voltage-Sensing Domains.
Monteleone, Stefania; Lieb, Andreas; Pinggera, Alexandra; Negro, Giulia; Fuchs, Julian E; Hofer, Florian; Striessnig, Jörg; Tuluc, Petronel; Liedl, Klaus R
2017-10-03
Mutations of positively charged amino acids in the S4 transmembrane segment of a voltage-gated ion channel form ion-conducting pathways through the voltage-sensing domain, named ω-current. Here, we used structure modeling and MD simulations to predict pathogenic ω-currents in Ca V 1.1 and Ca V 1.3 Ca 2+ channels bearing several S4 charge mutations. Our modeling predicts that mutations of Ca V 1.1-R1 (R528H/G, R897S) or Ca V 1.1-R2 (R900S, R1239H) linked to hypokalemic periodic paralysis type 1 and of Ca V 1.3-R3 (R990H) identified in aldosterone-producing adenomas conducts ω-currents in resting state, but not during voltage-sensing domain activation. The mechanism responsible for the ω-current and its amplitude depend on the number of charges in S4, the position of the mutated S4 charge and countercharges, and the nature of the replacing amino acid. Functional characterization validates the modeling prediction showing that Ca V 1.3-R990H channels conduct ω-currents at hyperpolarizing potentials, but not upon membrane depolarization compared with wild-type channels. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase
Frezza, Ludivine; Sandtner, Walter
2013-01-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing. PMID:24127524
Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.
Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco
2013-11-01
Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.
Inhibitory effects of magnolol on voltage-gated Na+ and K+ channels of NG108-15 cells.
Gong, Chi-Li; Wong, Kar-Lok; Cheng, Ka-Shun; Kuo, Chang-Shin; Chao, Chia-Chia; Tsai, Min-Fan; Leung, Yuk-Man
2012-05-05
Magnolol, a polyphenolic compound isolated from Houpu, a Chinese herb from the bark of Magnolia officinalis, has been reported to have in vitro and in vivo neuroprotective effects. In spite of these reported beneficial effects, studies on the direct impact of magnolol on neuronal ion channels have been scarce. Whether magnolol affects voltage-gated Na(+) channels (VGSC) and voltage-gated K(+) (Kv) channels is unknown. Using the whole-cell voltage-clamp method, we studied the effects of magnolol on voltage-gated ion channels in neuronal NG108-15 cells. Magnolol inhibited VGSC channels with mild state-dependence (IC(50) of 15 and 30 μM, at holding potentials of -70 and -100 mV, respectively). No frequency-dependence was observed in magnolol block. Magnolol caused a left-shift of 18 mV in the steady-state inactivation curve but did not affect the voltage-dependence of activation. Magnolol inhibited Kv channels with an IC(50) of 21 μM, and it caused a 20-mV left-shift in the steady-state inactivation curve without affecting the voltage-dependence of activation. In conclusion, magnolol is an inhibitor of both VGSC and Kv channels and these inhibitory effects may in part contribute to some of the reported neuroprotective effects of magnolol. Copyright © 2012 Elsevier B.V. All rights reserved.
Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J
2017-04-20
Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.
Zhang, Min; Takano, Tetsuo; Liu, Shenkui; Zhang, Xinxin
2015-05-08
Voltage-dependent anion channels (VDACs) are conserved mitochondrial outer membrane proteins. A yeast two-hybrid screen identified interaction between Arabidopsis VDAC3 and the chloroplast protein thioredoxin m2 (AtTrx m2). This was confirmed via pull-down assay. A bimolecular fluorescence complementation assay located the interaction in mitochondria. AtVDAC3 and AtTrx m2 transcripts were expressed in multiple tissues and up-regulated by abiotic stress. Under NaCl stress, AtVDAC3 overexpression inhibited growth and increased H2O2 accumulation, while AtTrx m2 overexpression conferred resistance to NaCl and reduced H2O2. Results indicate that both AtVDAC3 and AtTrx m2 are involved in ROS signaling and play opposite roles in NaCl stress response. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka
2014-02-01
Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR -Vbias) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR -Vbias for Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR -Vbias measurements. The profile of SR-Vbias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.
Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.
Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L
2016-02-25
Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.
Child-Langmuir flow with periodically varying anode voltage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rokhlenko, A.
Using the Lagrangian technique, we study settled Child-Langmuir flows in a one dimensional planar diodes whose anode voltages periodically vary around given positive values. Our goal is to find analytically if the average currents in these systems can exceed the famous Child-Langmuir limit found for the stationary current a long time ago. The main result of our study is that in a periodic quasi-stationary regime the average current can be larger than the Child-Langmuir maximum even by 50% compared with its adiabatic average value. The cathode current in this case has the form of rectangular pulses which are formed bymore » a very special triangular voltage modulation. This regime, i.e., periodicity, shape of pulses, and their amplitude, needs to be carefully chosen for the best performance.« less
Modulation of the reaction cycle of the Na+:Ca2+, K+ exchanger.
Vedovato, Natascia; Rispoli, Giorgio
2007-09-01
Ca(2+) concentration in retinal photoreceptor rod outer segment (OS) strongly affects the generator potential kinetics and the receptor light adaptation. The response to intense light stimuli delivered in the dark produce potential changes exceeding 40 mV: since the Ca(2+) extrusion in the OS is entirely controlled by the Na(+):Ca(2+), K(+) exchanger, it is important to assess how the exchanger ion transport rate is affected by the voltage and, in general, by intracellular factors. It is indeed known that the cardiac Na(+):Ca(2+) exchanger is regulated by Mg-ATP via a still unknown metabolic pathway. In the present work, the Na(+):Ca(2+), K(+) exchanger regulation was investigated in isolated OS, recorded in whole-cell configuration, using ionic conditions that activated maximally the exchanger in both forward and reverse mode. In all species examined (amphibia: Rana esculenta and Ambystoma mexicanum; reptilia: Gecko gecko), the forward (reverse) exchange current increased about linearly for negative (positive) voltages and exhibited outward (inward) rectification for positive (negative) voltages. Since hyperpolarisation increases Ca(2+) extrusion rate, the recovery of the dark level of Ca(2+) (and, in turn, of the generator potential) after intense light stimuli results accelerated. Mg-ATP increased the size of forward and reverse exchange current by a factor of approximately 2.3 and approximately 2.6, respectively, without modifying their voltage dependence. This indicates that Mg-ATP regulates the number of active exchanger sites and/or the exchanger turnover number, although via an unknown mechanism.
Carvacrol modulates voltage-gated sodium channels kinetics in dorsal root ganglia.
Joca, Humberto Cavalcante; Vieira, Daiana Cardoso Oliveira; Vasconcelos, Aliny Perreira; Araújo, Demetrius Antônio Machado; Cruz, Jader Santos
2015-06-05
Recent studies have shown that many of plant-derived compounds interact with specific ion channels and thereby modulate many sensing mechanisms, such as nociception. The monoterpenoid carvacrol (5-isopropyl-2-methylphenol) has an anti-nociceptive effect related to a reduction in neuronal excitability and voltage-gated Na(+) channels (NaV) inhibition in peripheral neurons. However, the detailed mechanisms of carvacrol-induced inhibition of neuronal NaV remain elusive. This study explores the interaction between carvacrol and NaV in isolated dorsal root ganglia neurons. Carvacrol reduced the total voltage-gated Na(+) current and tetrodotoxin-resistant (TTX-R) Na(+) current component in a concentration-dependent manner. Carvacrol accelerates current inactivation and induced a negative-shift in voltage-dependence of steady-state fast inactivation in total and TTX-R Na(+) current. Furthermore, carvacrol slowed the recovery from inactivation. Carvacrol provoked a leftward shift in both the voltage-dependence of steady-state inactivation and activation of the TTX-R Na(+) current component. In addition, carvacrol-induced inhibition of TTX-R Na(+) current was enhanced by an increase in stimulation frequency and when neurons were pre-conditioned with long depolarization pulse (5s at -50 mV). Taken all results together, we herein demonstrated that carvacrol affects NaV gating properties. The present findings would help to explain the mechanisms underlying the analgesic activity of carvacrol. Copyright © 2015 Elsevier B.V. All rights reserved.
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
High voltage bushing having weathershed and surrounding stress relief collar
Cookson, Alan H.
1981-01-01
A high voltage electric bushing comprises a hollow elongated dielectric weathershed which encloses a high voltage conductor. A collar formed of high voltage dielectric material is positioned over the weathershed and is bonded thereto by an interface material which precludes moisture-like contaminants from entering between the bonded portions. The collar is substantially thicker than the adjacent weathershed which it surrounds, providing relief of the electric stresses which would otherwise appear on the outer surface of the weathershed. The collar may include a conductive ring or capacitive foil to further relieve electric stresses experienced by the bushing.
Miceli, Francesco; Vargas, Ernesto; Bezanilla, Francisco; Taglialatela, Maurizio
2012-03-21
Changes in voltage-dependent gating represent a common pathogenetic mechanism for genetically inherited channelopathies, such as benign familial neonatal seizures or peripheral nerve hyperexcitability caused by mutations in neuronal K(v)7.2 channels. Mutation-induced changes in channel voltage dependence are most often inferred from macroscopic current measurements, a technique unable to provide a detailed assessment of the structural rearrangements underlying channel gating behavior; by contrast, gating currents directly measure voltage-sensor displacement during voltage-dependent gating. In this work, we describe macroscopic and gating current measurements, together with molecular modeling and molecular-dynamics simulations, from channels carrying mutations responsible for benign familial neonatal seizures and/or peripheral nerve hyperexcitability; K(v)7.4 channels, highly related to K(v)7.2 channels both functionally and structurally, were used for these experiments. The data obtained showed that mutations affecting charged residues located in the more distal portion of S(4) decrease the stability of the open state and the active voltage-sensing domain configuration but do not directly participate in voltage sensing, whereas mutations affecting a residue (R4) located more proximally in S(4) caused activation of gating-pore currents at depolarized potentials. These results reveal that distinct molecular mechanisms underlie the altered gating behavior of channels carrying disease-causing mutations at different voltage-sensing domain locations, thereby expanding our current view of the pathogenesis of neuronal hyperexcitability diseases. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Erxleben, Christian; Rathmayer, Werner
1997-01-01
Single-channel currents through calcium channels in muscle of a marine crustacean, the isopod Idotea baltica, were investigated in cell-attached patches. Inward barium currents were strongly voltage-dependent, and the channels were closed at the cell's resting membrane potential. The open probability (Po) increased e-fold for an 8.2 mV (±2.4, n = 13) depolarization. Channel openings were mainly brief (<0.3 ms) and evenly distributed throughout 100-ms pulses. Averaged, quasimacroscopic currents showed fast activation and deactivation and did not inactivate during 100-ms test pulses. Similarly, channel activity persisted at steadily depolarized holding potentials. With 200 mM Ba2+ as charge carrier, the average slope conductance from the unitary currents between +30 and +80 mV, was 20 pS (±2.6, n = 12). The proportion of long openings, which were very infrequent under control conditions, was greatly increased by preincubation of the muscle fibers with the calcium channel agonist, the dihydropyridine Bay K8644 (10–100 μM). Properties of these currents resemble those through the L-type calcium channels of mammalian nerve, smooth muscle, and cardiac muscle cells. PMID:9089439
Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH
Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Paulais, Marc
2016-01-01
ClC-K2, a member of the ClC family of Cl− channels and transporters, forms the major basolateral Cl− conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl− absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl−, and Ca2+ on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca2+ strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl− has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl−/HCO3− exchange in type B intercalated cells. PMID:27574292
Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH.
Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Lourdel, Stéphane; Teulon, Jacques; Paulais, Marc
2016-09-01
ClC-K2, a member of the ClC family of Cl(-) channels and transporters, forms the major basolateral Cl(-) conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl(-) absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl(-), and Ca(2+) on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca(2+) strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl(-) has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl(-)/HCO3 (-) exchange in type B intercalated cells. © 2016 Pinelli et al.
Operation of a sub-terahertz CW gyrotron with an extremely low voltage
NASA Astrophysics Data System (ADS)
Bratman, V. L.; Fedotov, A. E.; Fokin, A. P.; Glyavin, M. Yu.; Manuilov, V. N.; Osharin, I. V.
2017-11-01
Decreasing the operating voltage for medium-power sub-terahertz gyrotrons aimed at industrial and scientific applications is highly attractive, since it allows size and cost reduction of the tubes and power supply units. In this paper, we examine such an opportunity both numerically and experimentally for the fundamental cyclotron resonance operation of an existing gyrotron initially designed for operation at the second cyclotron harmonic with a relatively high voltage. Simulations predict that output power higher than 10 W can be produced at the fundamental harmonic at voltages less than 2 kV. To form a low-voltage helical electron beam with a sufficiently large pitch-factor, a positive voltage was applied to the first anode of the gyrotron three-electrode magnetron-injection gun with a negative voltage at the cathode. CW gyrotron operation at voltages down to 1.5 kV has been demonstrated at a frequency about of 256 GHz.
An electrostatic potassium channel opener targeting the final voltage sensor transition
Börjesson, Sara I.
2011-01-01
Free polyunsaturated fatty acids (PUFAs) modulate the voltage dependence of voltage-gated ion channels. As an important consequence thereof, PUFAs can suppress epileptic seizures and cardiac arrhythmia. However, molecular details for the interaction between PUFA and ion channels are not well understood. In this study, we have localized the site of action for PUFAs on the voltage-gated Shaker K channel by introducing positive charges on the channel surface, which potentiated the PUFA effect. Furthermore, we found that PUFA mainly affects the final voltage sensor movement, which is closely linked to channel opening, and that specific charges at the extracellular end of the voltage sensor are critical for the PUFA effect. Because different voltage-gated K channels have different charge profiles, this implies channel-specific PUFA effects. The identified site and the pharmacological mechanism will potentially be very useful in future drug design of small-molecule compounds specifically targeting neuronal and cardiac excitability. PMID:21624947
Voltage current characteristics of type III superconductors
NASA Astrophysics Data System (ADS)
Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.
1980-06-01
An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.
Novel voltage signal at proximity-induced superconducting transition temperature in gold nanowires
NASA Astrophysics Data System (ADS)
Wang, Jian; Tang, JunXiong; Wang, ZiQiao; Sun, Yi; Sun, QingFeng; Chan, Moses H. W.
2018-08-01
We observed a novel voltage peak in the proximity-induced superconducting gold (Au) nanowire while cooling the sample through the superconducting transition temperature. The voltage peak turned dip during warming. The voltage peak or dip was found to originate respectively from the emergence or vanishing of the proximity-induced superconductivity in the Au nanowire. The amplitude of the voltage signal depends on the temperature scanning rate, and it cannot be detected when the temperature is changed slower than 0.03 K/min. This transient feature suggests the non-equilibrium property of the effect. Ginzburg-Landau model clarified the voltage peak by considering the emergence of Cooper pairs of relatively lower free energy in superconducting W contact and the non-equilibrium diffusion of Cooper pairs and quasiparticles.
Sodium efflux from voltage clamped squid giant axons.
Landowne, D
1977-01-01
1. The efflux of radioactive sodium was measured from squid axons during simultaneous voltage clamp experiments such that it was possible to determine the efflux of sodium associated with a measured voltage clamp current. 2. The extra efflux of sodium associated with voltage clamp pulses increased linearly with the magnitude of the depolarization above 40 mV. A 100 mV pulse of sufficient duration to produce all of the sodium current increased the rate constant of efflux by about 10(-6). 3. Application of 100 nM tetrodotoxin eliminated the sodium current and the extra efflux of radioactive sodium. 4. Cooling the axon increased the extra efflux/voltage clamp pulse slightly with a Q10 of 1/1-1. On the same axons cooling increased the integral of the sodium current with a Q10 of 1/1-4. 5. Replacing external sodium with Tris, dextrose or Mg-mannitol reduced the extra efflux of sodium by about 50%. The inward sodium current was replaced with an outward current as expected. 6. Replacing external sodium with lithium also reduced the extra efflux by about 50% but the currents seen in lithium were slightly larger than those in sodium. 7. The effect of replacing external sodium was not voltage dependent. Cooling reduced the effect so that there was less reduction of efflux on switching to Tris ASW in the cold than in the warm. 8. The extra efflux of sodium into sodium-free ASW is approximately the same as the integral of the sodium current. Adding external sodium produces a deviation from the independence principle such that there is more exchange of sodium than predicted. Such a deviation from prediction was noted by Hodgkin & Huxley (1952c). 9. Using the equations of Hodgkin & Huxley (1952c) modified to include the deviation from independence reported in this paper and its temperature dependence, one can predict the temperature dependence of the sodium efflux associated with action potentials and obtain much better agreement than is possibly without these phenomena. 10
Voltage Quench Dynamics of a Kondo System.
Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel
2016-01-22
We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.
Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki
2004-03-22
DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics
Single Event Transients in Low Voltage Dropout (LVDO) Voltage Regulators
NASA Technical Reports Server (NTRS)
LaBel, K.; Karsh, J.; Pursley, S.; Kleyner, I.; Katz, R.; Poivey, C.; Kim, H.; Seidleck, C.
2006-01-01
This viewgraph presentation reviews the use of Low Voltage Dropout (LVDO) Voltage Regulators in environments where heavy ion induced Single Event Transients are a concern to the designers.Included in the presentation are results of tests of voltage regulators.
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018
NASA Astrophysics Data System (ADS)
Yang, Jie; Hu, Jiangtao; Zhu, Min; Zhao, Yan; Chen, Haibiao; Pan, Feng
2017-10-01
A new hierarchically porous carbon has been synthesized with self-template of silica phase from a commercial silicone resin by pyrolysis and subsequent NaOH activation. The obtained carbon materials achieve an ultrahigh specific surface area (2896 m2 g-1) with abundant mesopores. The C800 sample demonstrates excellent performance in supercapacitors, with a high capacitance of 322 F g-1 at 0.5 A g-1 and outstanding rate capability (182 F g-1 at 100 A g-1) in a three-electrode system using 6.0 mol L-1 KOH electrolyte. The energy density is improved by widening the voltage window using 1.0 mol L-1 alkali metal nitrate solutions (LiNO3, NaNO3, KNO3) in which the strong solvation of alkali metal cations and nitrate anions effectively reduce the activity of water. In a symmetric supercapacitor, the maximum operating voltage is essentially restricted by the potential of positive electrode and the total capacitance is dominated by the capacitance of the anion at the positive electrode. The symmetric supercapacitors based on C800 deliver a high energy density of 22.4 Wh kg-1 at a power density of 0.23 kW kg-1 in 1.0 mol L-1 LiNO3 with a voltage of 1.8 V and long-term stability with a retention of 89.87% after 10000 cycles.
Von Eschen, R.L.; Scheele, P.F.
1962-04-24
A transistorized voltage regulator which provides very close voitage regulation up to about 180 deg F is described. A diode in the positive line provides a constant voltage drop from the input to a regulating transistor emitter. An amplifier is coupled to the positive line through a resistor and is connected between a difference circuit and the regulating transistor base which is negative due to the difference in voltage drop across thc diode and the resistor so that a change in the regulator output causes the amplifier to increase or decrease the base voltage and current and incrcase or decrease the transistor impedance to return the regulator output to normal. (AEC)
Kim, Seong K; Khodorov, Sergey; Chen, Chien-Ting; Kim, Sangtae; Lubomirsky, Igor
2013-06-14
A new model based on a linear diffusion equation is proposed to explain the current-voltage characteristics of blocking grain boundaries in Y-doped CeO2 in particular. One can also expect that the model can be applicable to the ionic conductors with blocking grain boundaries, in general. The model considers an infinitely long chain of identical grains separated by grain boundaries, which are treated as regions in which depletion layers of mobile ions are formed due to trapping of immobile charges that do not depend on the applied voltage as well as temperature. The model assumes that (1) the grain boundaries do not represent physical blocking layers, which implies that if there is a second phase at the grain boundaries, then it is too thin to impede ion diffusion and (2) the ions follow Boltzmann distribution throughout the materials. Despite its simplicity, the model successfully reproduces the "power law": current proportional to voltage power n and illustrated with the experimental example of Y-doped ceria. The model also correctly predicts that the product nT, where T is the temperature in K, is constant and is proportional to the grain boundary potential as long as the charge at the grain boundaries remains trapped. The latter allows its direct determination from the current-voltage characteristics and promises considerable simplification in the analysis of the electrical characteristics of the grain boundaries with respect to the models currently in use.
Pulsed voltage electrospray ion source and method for preventing analyte electrolysis
Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN
2011-12-27
An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.
Extension algorithm for generic low-voltage networks
NASA Astrophysics Data System (ADS)
Marwitz, S.; Olk, C.
2018-02-01
Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating
Dürr, Katharina L.; Tavraz, Neslihan N.; Friedrich, Thomas
2012-01-01
Whereas electrogenic partial reactions of the Na,K-ATPase have been studied in depth, much less is known about the influence of the membrane potential on the electroneutrally operating gastric H,K-ATPase. In this work, we investigated site-specifically fluorescence-labeled H,K-ATPase expressed in Xenopus oocytes by voltage clamp fluorometry to monitor the voltage-dependent distribution between E1P and E2P states and measured Rb+ uptake under various ionic and pH conditions. The steady-state E1P/E2P distribution, as indicated by the voltage-dependent fluorescence amplitudes and the Rb+ uptake activity were highly sensitive to small changes in intracellular pH, whereas even large extracellular pH changes affected neither the E1P/E2P distribution nor transport activity. Notably, intracellular acidification by approximately 0.5 pH units shifted V0.5, the voltage, at which the E1P/E2P ratio is 50∶50, by −100 mV. This was paralleled by an approximately two-fold acceleration of the forward rate constant of the E1P→E2P transition and a similar increase in the rate of steady-state cation transport. The temperature dependence of Rb+ uptake yielded an activation energy of ∼90 kJ/mol, suggesting that ion transport is rate-limited by a major conformational transition. The pronounced sensitivity towards intracellular pH suggests that proton uptake from the cytoplasmic side controls the level of phosphoenzyme entering the E1P→E2P conformational transition, thus limiting ion transport of the gastric H,K-ATPase. These findings highlight the significance of cellular mechanisms contributing to increased proton availability in the cytoplasm of gastric parietal cells. Furthermore, we show that extracellular Na+ profoundly alters the voltage-dependent E1P/E2P distribution indicating that Na+ ions can act as surrogates for protons regarding the E2P→E1P transition. The complexity of the intra- and extracellular cation effects can be rationalized by a kinetic model suggesting
NASA Astrophysics Data System (ADS)
Yandong, Yu; Shuzhen, Kuang; Jie, Li
2015-09-01
The influence of applied voltage and film-formation time on the microstructure and corrosion resistance of coatings formed on a Mg-Zn-Zr-Ca novel bio-magnesium alloy has been investigated by micro-arc oxidation (MAO) treatment. Phase composition and microstructure of as-coated samples were analyzed by the x-ray diffraction, energy dispersive x-ray spectroscopy and scanning electron microscopy. And the porosity and average of micro-pore aperture of the surface on ceramic coatings were analyzed by general image software. Corrosion microstructure of as-coated samples was caught by a microscope digital camera. The long-term corrosion resistance of as-coated samples was tested in simulated body fluid for 30 days. The results showed that the milky white smooth ceramic coating formed on the Mg-Zn-Zr-Ca novel bio-magnesium alloy was a compound of MgO, Mg2SiO4 and MgSiO3, and its corrosion resistance was significantly improved compared with that of the magnesium substrate. In addition, when the MAO applied voltage were 450 V and 500 V and film-formation time were 9 min and 11 min, the surface micro-morphology and the corrosion resistance of as-coated samples were relatively improved. The results provided a theoretical foundation for the application of the Mg-Zn-Zr-Ca novel bio-magnesium alloy in biomedicine.
Modulation of BK channel voltage gating by different auxiliary β subunits
Contreras, Gustavo F.; Neely, Alan; Alvarez, Osvaldo; Gonzalez, Carlos; Latorre, Ramon
2012-01-01
Calcium- and voltage-activated potassium channels (BK) are regulated by a multiplicity of signals. The prevailing view is that different BK gating mechanisms converge to determine channel opening and that these gating mechanisms are allosterically coupled. In most instances the pore forming α subunit of BK is associated with one of four alternative β subunits that appear to target specific gating mechanisms to regulate the channel activity. In particular, β1 stabilizes the active configuration of the BK voltage sensor having a large effect on BK Ca2+ sensitivity. To determine the extent to which β subunits regulate the BK voltage sensor, we measured gating currents induced by the pore-forming BK α subunit alone and with the different β subunits expressed in Xenopus oocytes (β1, β2IR, β3b, and β4). We found that β1, β2, and β4 stabilize the BK voltage sensor in the active conformation. β3 has no effect on voltage sensor equilibrium. In addition, β4 decreases the apparent number of charges per voltage sensor. The decrease in the charge associated with the voltage sensor in α β4 channels explains most of their biophysical properties. For channels composed of the α subunit alone, gating charge increases slowly with pulse duration as expected if a significant fraction of this charge develops with a time course comparable to that of K+ current activation. In the presence of β1, β2, and β4 this slow component develops in advance of and much more rapidly than ion current activation, suggesting that BK channel opening proceeds in two steps. PMID:23112204
Voltage-Rectified Current and Fluid Flow in Conical Nanopores.
Lan, Wen-Jie; Edwards, Martin A; Luo, Long; Perera, Rukshan T; Wu, Xiaojian; Martin, Charles R; White, Henry S
2016-11-15
Ion current rectification (ICR) refers to the asymmetric potential-dependent rate of the passage of solution ions through a nanopore, giving rise to electrical current-voltage characteristics that mimic those of a solid-state electrical diode. Since the discovery of ICR in quartz nanopipettes two decades ago, synthetic nanopores and nanochannels of various geometries, fabricated in membranes and on wafers, have been extensively investigated to understand fundamental aspects of ion transport in highly confined geometries. It is now generally accepted that ICR requires an asymmetric electrical double layer within the nanopore, producing an accumulation or depletion of charge-carrying ions at opposite voltage polarities. Our research groups have recently explored how the voltage-dependent ion distributions and ICR within nanopores can induce novel nanoscale flow phenomena that have applications in understanding ionics in porous materials used in energy storage devices, chemical sensing, and low-cost electrical pumping of fluids. In this Account, we review our most recent investigations on this topic, based on experiments using conical nanopores (10-300 nm tip opening) fabricated in thin glass, mica, and polymer membranes. Measurable fluid flow in nanopores can be induced either using external pressure forces, electrically via electroosmotic forces, or by a combination of these two forces. We demonstrate that pressure-driven flow can greatly alter the electrical properties of nanopores and, vice versa, that the nonlinear electrical properties of conical nanopores can impart novel and useful flow phenomena. Electroosmotic flow (EOF), which depends on the magnitude of the ion fluxes within the double layer of the nanopore, is strongly coupled to the accumulation/depletion of ions. Thus, the same underlying cause of ICR also leads to EOF rectification, i.e., unequal flows occurring for the same voltage but opposite polarities. EOF rectification can be used to electrically
Gupta, Rajeev
2017-09-02
The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value < 0.5 for JNK3 phosphorylated VDAC at both positive and negative voltage. It is proposed that 1/f 1 power law in native VDAC open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.
Simple programmable voltage reference for low frequency noise measurements
NASA Astrophysics Data System (ADS)
Ivanov, V. E.; Chye, En Un
2018-05-01
The paper presents a circuit design of a low-noise voltage reference based on an electric double-layer capacitor, a microcontroller and a general purpose DAC. A large capacitance value (1F and more) makes it possible to create low-pass filter with a large time constant, effectively reducing low-frequency noise beyond its bandwidth. Choosing the optimum value of the resistor in the RC filter, one can achieve the best ratio between the transient time, the deviation of the output voltage from the set point and the minimum noise cut-off frequency. As experiments have shown, the spectral density of the voltage at a frequency of 1 kHz does not exceed 1.2 nV/√Hz the maximum deviation of the output voltage from the predetermined does not exceed 1.4 % and depends on the holding time of the previous value. Subsequently, this error is reduced to a constant value and can be compensated.
Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor
Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko
2013-01-01
In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752
A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.
Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas
2016-02-25
Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
1996-01-01
Under a Lewis Research Center Small Business Innovation Research contract, SRICO, Inc. developed a fiber optic voltage sensor to measure voltage in electronic systems in spacecraft. The sensor uses glass and light to sense and transmit electricity, and is relatively safe and accurate. SRICO then commercialized the sensor for measurement of electric field and voltage in applications such as electric power systems and hazardous environments, lightning detection, and fiber optic communication systems.
NASA Astrophysics Data System (ADS)
Bhojawala, V. M.; Vakharia, D. P.
2017-12-01
This investigation provides an accurate prediction of static pull-in voltage for clamped-clamped micro/nano beams based on distributed model. The Euler-Bernoulli beam theory is used adapting geometric non-linearity of beam, internal (residual) stress, van der Waals force, distributed electrostatic force and fringing field effects for deriving governing differential equation. The Galerkin discretisation method is used to make reduced-order model of the governing differential equation. A regime plot is presented in the current work for determining the number of modes required in reduced-order model to obtain completely converged pull-in voltage for micro/nano beams. A closed-form relation is developed based on the relationship obtained from curve fitting of pull-in instability plots and subsequent non-linear regression for the proposed relation. The output of regression analysis provides Chi-square (χ 2) tolerance value equals to 1 × 10-9, adjusted R-square value equals to 0.999 29 and P-value equals to zero, these statistical parameters indicate the convergence of non-linear fit, accuracy of fitted data and significance of the proposed model respectively. The closed-form equation is validated using available data of experimental and numerical results. The relative maximum error of 4.08% in comparison to several available experimental and numerical data proves the reliability of the proposed closed-form equation.
Temme, Stephanie J; Bell, Ryan Z; Fisher, Grace L; Murphy, Geoffrey G
2016-01-01
L-type voltage-gated calcium channels (LVGCCs) have been implicated in various forms of learning, memory, and synaptic plasticity. Within the hippocampus, the LVGCC subtype, Ca V 1.2 is prominently expressed throughout the dentate gyrus. Despite the apparent high levels of Ca V 1.2 expression in the dentate gyrus, the role of Ca V 1.2 in hippocampal- and dentate gyrus-associated forms of learning remain unknown. To address this question, we examined alternate forms of hippocampal-dependent associative and spatial memory in mice lacking the mouse ortholog of CACNA1C ( Cacna1c ), which encodes Ca V 1.2, with dentate gyrus function implicated in difficult forms of each task. We found that while the deletion of Ca V 1.2 did not impair the acquisition of fear of a conditioned context, mice lacking Ca V 1.2 exhibited deficits in the ability to discriminate between two contexts, one in which the mice were conditioned and one in which they were not. Similarly, Ca V 1.2 knock-out mice exhibited normal acquisition and recall of the location of the hidden platform in a standard Morris water maze, but were unable to form a memory of the platform location when the task was made more difficult by restricting the number of available spatial cues. Within the dentate gyrus, pan-neuronal deletion of Ca V 1.2 resulted in decreased cell proliferation and the numbers of doublecortin-positive adult-born neurons, implicating Ca V 1.2 in adult neurogenesis. These results suggest that Ca V 1.2 is important for dentate gyrus-associated tasks and may mediate these forms of learning via a role in adult neurogenesis and cell proliferation within the dentate gyrus.
Listening to membrane potential: photoacoustic voltage-sensitive dye recording.
Zhang, Haichong K; Yan, Ping; Kang, Jeeun; Abou, Diane S; Le, Hanh N D; Jha, Abhinav K; Thorek, Daniel L J; Kang, Jin U; Rahmim, Arman; Wong, Dean F; Boctor, Emad M; Loew, Leslie M
2017-04-01
Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.
Listening to membrane potential: photoacoustic voltage-sensitive dye recording
NASA Astrophysics Data System (ADS)
Zhang, Haichong K.; Yan, Ping; Kang, Jeeun; Abou, Diane S.; Le, Hanh N. D.; Jha, Abhinav K.; Thorek, Daniel L. J.; Kang, Jin U.; Rahmim, Arman; Wong, Dean F.; Boctor, Emad M.; Loew, Leslie M.
2017-04-01
Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna
2013-03-01
The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.
A Novel Voltage Sensor in the Orthosteric Binding Site of the M2 Muscarinic Receptor.
Barchad-Avitzur, Ofra; Priest, Michael F; Dekel, Noa; Bezanilla, Francisco; Parnas, Hanna; Ben-Chaim, Yair
2016-10-04
G protein-coupled receptors (GPCRs) mediate many signal transduction processes in the body. The discovery that these receptors are voltage-sensitive has changed our understanding of their behavior. The M2 muscarinic acetylcholine receptor (M2R) was found to exhibit depolarization-induced charge movement-associated currents, implying that this prototypical GPCR possesses a voltage sensor. However, the typical domain that serves as a voltage sensor in voltage-gated channels is not present in GPCRs, making the search for the voltage sensor in the latter challenging. Here, we examine the M2R and describe a voltage sensor that is comprised of tyrosine residues. This voltage sensor is crucial for the voltage dependence of agonist binding to the receptor. The tyrosine-based voltage sensor discovered here constitutes a noncanonical by which membrane proteins may sense voltage. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen
2015-10-21
The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Köhler, K.; Pletschen, W.; Godejohann, B.
2015-11-28
Admittance–voltage profiling of Al{sub x}Ga{sub 1−x}N/GaN heterostructures was used to determine the frequency dependent capacitance and conductance of FET devices in the frequency range from 50 Hz to 1 MHz. The nominally undoped low pressure metal-organic vapor-phase epitaxy structures were grown with an Al-content of 30%. An additional 1 nm thick AlN interlayer was placed in one structure before the Al{sub 0.3}Ga{sub 0.7}N layer growth. For frequencies below 10{sup 8} Hz it is convenient to use equivalent circuits to represent electric or dielectric properties of a material, a method widely used, for example, in impedance spectroscopy. We want to emphasize the relation betweenmore » frequency dependent admittance–voltage profiling and the corresponding equivalent circuits to the complex dielectric function. Debye and Drude models are used for the description of the frequency dependent admittance profiles in a range of depletion onset of the two-dimensional electron gas. Capacitance- and conductance-frequency profiles are fitted in the entire measured range by combining both models. Based on our results, we see contributions to the two-dimensional electron gas for our samples from surface states (80%) as well as from background doping in the Al{sub 0.3}Ga{sub 0.7}N barriers (20%). The specific resistance of the layers below the gate is above 10{sup 5} Ω cm for both samples and increases with increasing negative bias, i.e., the layers below the gate are essentially depleted. We propose that the resistance due to free charge carriers, determined by the Drude model, is located between gate and drain and, because of the AlN interlayer, the resistance is lowered by a factor of about 30 if compared to the sample without an AlN layer.« less
Charge movement in gating-locked HCN channels reveals weak coupling of voltage sensors and gate.
Ryu, Sujung; Yellen, Gary
2012-11-01
HCN (hyperpolarization-activated cyclic nucleotide gated) pacemaker channels have an architecture similar to that of voltage-gated K(+) channels, but they open with the opposite voltage dependence. HCN channels use essentially the same positively charged voltage sensors and intracellular activation gates as K(+) channels, but apparently these two components are coupled differently. In this study, we examine the energetics of coupling between the voltage sensor and the pore by using cysteine mutant channels for which low concentrations of Cd(2+) ions freeze the open-closed gating machinery but still allow the sensors to move. We were able to lock mutant channels either into open or into closed states by the application of Cd(2+) and measure the effect on voltage sensor movement. Cd(2+) did not immobilize the gating charge, as expected for strict coupling, but rather it produced shifts in the voltage dependence of voltage sensor charge movement, consistent with its effect of confining transitions to either closed or open states. From the magnitude of the Cd(2+)-induced shifts, we estimate that each voltage sensor produces a roughly three- to sevenfold effect on the open-closed equilibrium, corresponding to a coupling energy of ∼1.3-2 kT per sensor. Such coupling is not only opposite in sign to the coupling in K(+) channels, but also much weaker.
Kostic, Sandra; Pan, Bin; Guo, Yuan; Yu, Hongwei; Sapunar, Damir; Kwok, Wai-Meng; Hudmon, Andy; Wu, Hsiang-En; Hogan, Quinn H
2014-09-01
Calcium/calmodulin-dependent protein kinase II (CaMKII) is recognized as a key element in encoding depolarization activity of excitable cells into facilitated voltage-gated Ca(2+) channel (VGCC) function. Less is known about the participation of CaMKII in regulating VGCCs in resting cells. We examined constitutive CaMKII control of Ca(2+) currents in peripheral sensory neurons acutely isolated from dorsal root ganglia (DRGs) of adult rats. The small molecule CaMKII inhibitor KN-93 (1.0μM) reduced depolarization-induced ICa by 16-30% in excess of the effects produced by the inactive homolog KN-92. The specificity of CaMKII inhibition on VGCC function was shown by the efficacy of the selective CaMKII blocking peptide autocamtide-2-related inhibitory peptide in a membrane-permeable myristoylated form, which also reduced VGCC current in resting neurons. Loss of VGCC currents is primarily due to reduced N-type current, as application of mAIP selectively reduced N-type current by approximately 30%, and prior N-type current inhibition eliminated the effect of mAIP on VGCCs, while prior block of L-type channels did not reduce the effect of mAIP on total ICa. T-type currents were not affected by mAIP in resting DRG neurons. Transduction of sensory neurons in vivo by DRG injection of an adeno-associated virus expressing AIP also resulted in a loss of N-type currents. Together, these findings reveal a novel molecular adaptation whereby sensory neurons retain CaMKII support of VGCCs despite remaining quiescent. Published by Elsevier Inc.
Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan
High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio andmore » good memory retention.« less
NASA Astrophysics Data System (ADS)
Hoch, David H.; Romero-Mira, Miryam; Ehrlich, Barbara E.; Finkelstein, Alan; Dasgupta, Bibhuti R.; Simpson, Lance L.
1985-03-01
The heavy chains of both botulinum neurotoxin type B and tetanus toxin form channels in planar bilayer membranes. These channels have pH-dependent and voltage-dependent properties that are remarkably similar to those previously described for diphtheria toxin. Selectivity experiments with anions and cations show that the channels formed by the heavy chains of all three toxins are large; thus, these channels could serve as ``tunnel proteins'' for translocation of active peptide fragments. These findings support the hypothesis that the active fragments of botulinum neurotoxin and tetanus toxin, like that of diphtheria toxin, are translocated across the membranes of acidic vesicles.
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, Gregory K.; Renak, Todd W.
1999-01-01
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam's polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured.
Viscoelastic performance of dielectric elastomer subject to different voltage stimulation
NASA Astrophysics Data System (ADS)
Sheng, Junjie; Zhang, Yuqing; Liu, Lei; Li, Bo; Chen, Hualing
2017-04-01
Dielectric elastomer (DE) is capable of giant deformation subject to an electric field, and demonstrates significant advantages in the potentially application of soft machines with muscle-like characteristics. Due to an inherent property of all macromolecular materials, DE exhibits strong viscoelastic properties. Viscoelasticity could cause a time-dependent deformation and lower the response speed and energy conversion efficiency of DE based actuators, thus strongly affect its electromechanical performance and applications. Combining with the rheological model of viscoelastic relaxation, the viscoelastic performance of a VHB membrane in a circular actuator configuration undergoing separately constant, ramp and sinusoidal voltages are analyzed both theoretically and experimentally. The theoretical results indicated that DE could attain a big deformation under a small constant voltage with a longer time or under a big voltage with a shorter time. The model also showed that a higher critical stretch could be achieved by applying ramping voltage with a lower rate and the stretch magnitude under sinusoidal voltage is much larger at a relatively low frequency. Finally, experiments were designed to validate the simulation and show well consistent with the simulation results.
Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo
2012-10-16
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.
Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP
Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo
2013-01-01
The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304
Droege, T.F.
1989-12-19
A high voltage DC power supply having a first series resistor at the output for limiting current in the event of a short-circuited output, a second series resistor for sensing the magnitude of output current, and a voltage divider circuit for providing a source of feedback voltage for use in voltage regulation is disclosed. The voltage divider circuit is coupled to the second series resistor so as to compensate the feedback voltage for a voltage drop across the first series resistor. The power supply also includes a pulse-width modulated control circuit, having dual clock signals, which is responsive to both the feedback voltage and a command voltage, and also includes voltage and current measuring circuits responsive to the feedback voltage and the voltage developed across the second series resistor respectively. 7 figs.
Droege, Thomas F.
1989-01-01
A high voltage DC power supply having a first series resistor at the output for limiting current in the event of a short-circuited output, a second series resistor for sensing the magnitude of output current, and a voltage divider circuit for providing a source of feedback voltage for use in voltage regulation is disclosed. The voltage divider circuit is coupled to the second series resistor so as to compensate the feedback voltage for a voltage drop across the first series resistor. The power supply also includes a pulse-width modulated control circuit, having dual clock signals, which is responsive to both the feedback voltage and a command voltage, and also includes voltage and current measuring circuits responsive to the feedback voltage and the voltage developed across the second series resistor respectively.
High voltage pulse ignition of mercury discharge hollow cathodes
NASA Technical Reports Server (NTRS)
Wintucky, E. G.
1973-01-01
A high voltage pulse generated by a capacitor discharge into a step-up transformer has been demonstrated capable of consistently igniting hollow cathode mercury discharges at propellant flows and heater power levels much below those required by conventional cathode starting. Results are presented for 3.2-mm diameter enclosed and open keeper cathodes. Starting characteristics are shown to depend on keeper voltage, mercury flow rate, heater power, keeper orifice size, emissive materials, and electrode to which the pulse is applied. This starting technique has been used to start a cathode over 10,000 times without any degradation of starting capability. The starting reliability, propellant and power savings offered by the high voltage pulse start should favorably impact performance of electron bombardment thrusters in missions requiring many on-off duty cycles.
Large Magnetoresistance at High Bias Voltage in Double-layer Organic Spin Valves
NASA Astrophysics Data System (ADS)
Subedi, R. C.; Liang, S. H.; Geng, R.; Zhang, Q. T.; Lou, L.; Wang, J.; Han, X. F.; Nguyen, T. D.
We report studies of magnetoresistance (MR) in double-layer organic spin valves (DOSV) using tris (8-hydroxyquinolinato) aluminum (Alq3) spacers. The device exhibits three distinct resistance levels depending on the relative magnetizations of the ferromagnetic electrodes. We observed a much weaker bias voltage dependence of MR in the device compared to that in the conventional organic spin valve (OSV). The MR magnitude reduces by the factor of two at 0.7 V bias voltage in the DOSV compared to 0.02 V in the conventional OSV. Remarkably, the MR magnitude reaches 0.3% at 6 V bias in the DOSVs, the largest MR response ever reported in OSVs at this bias. Our finding may have a significant impact on achieving high efficient bipolar OSVs strictly performed at high voltages. University of Georgia start-up fund, Ministry of Education, Singapore, National Natural Science Foundation of China.
The voltage-sensing domain of a phosphatase gates the pore of a potassium channel
Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L.; Thiel, Gerhard
2013-01-01
The modular architecture of voltage-gated K+ (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates KvSynth1, a functional voltage-gated, outwardly rectifying K+ channel. KvSynth1 displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V1/2 = +56 mV; z of ∼1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains. PMID:23440279
DOE Office of Scientific and Technical Information (OSTI.GOV)
Altuhov, V. I., E-mail: altukhovv@mail.ru; Kasyanenko, I. S.; Sankin, A. V.
2016-09-15
A simple but nonlinear model of the defect density at a metal–semiconductor interface, when a Schottky barrier is formed by surface defects states localized at the interface, is developed. It is shown that taking the nonlinear dependence of the Fermi level on the defect density into account leads to a Schottky barrier increase by 15–25%. The calculated barrier heights are used to analyze the current–voltage characteristics of n-M/p-(SiC){sub 1–x}(AlN){sub x} structures. The results of calculations are compared to experimental data.
Mechanism of Small Current Generation under Impulse Voltage Applications in Vacuum
NASA Astrophysics Data System (ADS)
Aoki, Keita; Yasukawa, Hideaki; Kojima, Hiroki; Homma, Mitsutaka; Shioiri, Tetsu; Okubo, Hitoshi
Small discharge not to accompany breakdown can occur under high electric field in vacuum, however the mechanism is not well clarified. We have found that the current of small discharge decreases with repeated voltage applications, and leads to electrode conditioning effect of raising withstand voltage. The inception of the current is delayed with the decrease of current, and the inception time and waveform change by gap length. On the other hand, under low vacuum condition, the current increases and reaches saturation with repeated voltage applications. From these discussions, we concluded that the generating process of small current depended on the adsorption and absorption gas of electrodes.
Martin, Edward J [Virginia Beach, VA
2008-01-15
A voltage verification unit and method for determining the absence of potentially dangerous potentials within a power supply enclosure without Mode 2 work is disclosed. With this device and method, a qualified worker, following a relatively simple protocol that involves a function test (hot, cold, hot) of the voltage verification unit before Lock Out/Tag Out and, and once the Lock Out/Tag Out is completed, testing or "trying" by simply reading a display on the voltage verification unit can be accomplished without exposure of the operator to the interior of the voltage supply enclosure. According to a preferred embodiment, the voltage verification unit includes test leads to allow diagnostics with other meters, without the necessity of accessing potentially dangerous bus bars or the like.
Fernandez, Fernando R.; Malerba, Paola; White, John A.
2015-01-01
The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971
Fernandez, Fernando R; Malerba, Paola; White, John A
2015-04-01
The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances.
High voltage switch triggered by a laser-photocathode subsystem
Chen, Ping; Lundquist, Martin L.; Yu, David U. L.
2013-01-08
A spark gap switch for controlling the output of a high voltage pulse from a high voltage source, for example, a capacitor bank or a pulse forming network, to an external load such as a high gradient electron gun, laser, pulsed power accelerator or wide band radar. The combination of a UV laser and a high vacuum quartz cell, in which a photocathode and an anode are installed, is utilized as triggering devices to switch the spark gap from a non-conducting state to a conducting state with low delay and low jitter.
Electro-optic voltage sensor for sensing voltage in an E-field
Woods, G.K.; Renak, T.W.
1999-04-06
A miniature electro-optic voltage sensor system capable of accurate operation at high voltages is disclosed. The system employs a transmitter, a sensor disposed adjacent to but out of direct electrical contact with a conductor on which the voltage is to be measured, a detector, and a signal processor. The transmitter produces a beam of electromagnetic radiation which is routed into the sensor where the beam undergoes the Pockels electro-optic effect. The electro-optic effect causes phase shifting in the beam, which is in turn converted to a pair of independent beams, from which the voltage of a system based on its E-field is determined when the two beams are normalized by the signal processor. The sensor converts the beam by splitting the beam in accordance with the axes of the beam`s polarization state (an ellipse whose ellipticity varies between -1 and +1 in proportion to voltage) into at least two AM signals. These AM signals are fed into a signal processor and processed to determine the voltage between a ground conductor and the conductor on which voltage is being measured. 18 figs.
Current-voltage characteristics in organic field-effect transistors. Effect of interface dipoles
NASA Astrophysics Data System (ADS)
Sworakowski, Juliusz
2015-07-01
The role of polar molecules present at dielectric/semiconductor interfaces of organic field-effect transistors (OFETs) has been assessed employing the electrostatic model put forward in a recently published paper (Sworakowski et al., 2014). The interface dipoles create dipolar traps in the surface region of the semiconductor, their depths decreasing with the distance from the interface. This feature results in appearance of mobility gradients in the direction perpendicular to the dielectric/semiconductor interface, manifesting themselves in modification of the shapes of current-voltage characteristics. The effect may account for differences in carrier mobilities determined from the same experimental data using methods scanning different ranges of channel thicknesses (e.g., transconductances vs. transfer characteristics), differences between turn-on voltages and threshold voltages, and gate voltage dependence of mobility.
Device for monitoring cell voltage
Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE
2012-08-21
A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.
Voltage-Gated Channel Mechanosensitivity: Fact or Friction?
Morris, Catherine E.
2011-01-01
The heart is a continually active pulsatile fluid pump. It generates appropriate forces by precisely timed and spaced engagement of its contractile machinery. Largely, it makes its own control signals, the most crucial of which are precisely timed and spaced fluxes of ions across the sarcolemma, achieved by the timely opening and closing of diverse voltage-gated channels (VGC). VGCs have four voltage sensors around a central ion-selective pore that opens and closes under the influence of membrane voltage. Operation of any VGC is secondarily tuned by the mechanical state (i.e., structure) of the bilayer in which it is embedded. Rates of opening and closing, in other words, vary with bilayer structure. Thus, in the intensely mechanical environment of the myocardium and its vasculature, VGCs kinetics might be routinely modulated by reversible and irreversible nano-scale changes in bilayer structure. If subtle bilayer deformations are routine in the pumping heart, VGCs could be subtly transducing bilayer mechanical signals, thereby tuning cardiac rhythmicity, collectively contributing to mechano-electric feedback. Reversible bilayer deformations would be expected with changing shear flows and tissue distension, while irreversible bilayer restructuring occurs with ischemia, inflammation, membrane remodeling, etc. I suggest that tools now available could be deployed to help probe whether/how the inherent mechanosensitivity of VGCs – an attribute substantially reflecting the dependence of voltage sensor stability on bilayer structure – contributes to cardiac rhythmicity. Chief among these tools are voltage sensor toxins (whose inhibitory efficacy varies with the mechanical state of bilayer) and arrhythmia-inducing VGC mutants with distinctive mechano-phenotypes. PMID:21660289
Switch contact device for interrupting high current, high voltage, AC and DC circuits
Via, Lester C.; Witherspoon, F. Douglas; Ryan, John M.
2005-01-04
A high voltage switch contact structure capable of interrupting high voltage, high current AC and DC circuits. The contact structure confines the arc created when contacts open to the thin area between two insulating surfaces in intimate contact. This forces the arc into the shape of a thin sheet which loses heat energy far more rapidly than an arc column having a circular cross-section. These high heat losses require a dramatic increase in the voltage required to maintain the arc, thus extinguishing it when the required voltage exceeds the available voltage. The arc extinguishing process with this invention is not dependent on the occurrence of a current zero crossing and, consequently, is capable of rapidly interrupting both AC and DC circuits. The contact structure achieves its high performance without the use of sulfur hexafluoride.
Voltage controlled Bi-mode resistive switching effects in MnO2 based devices
NASA Astrophysics Data System (ADS)
Hu, P.; Wu, S. X.; Wang, G. L.; Li, H. W.; Li, D.; Li, S. W.
2018-01-01
In this paper, the voltage induced bi-mode resistive switching behavior of an MnO2 thin film based device was studied. The device showed prominent bipolar resistive switching behavior with good reproducibility and high endurance. In addition, complementary resistive switching characteristics can be observed by extending the voltage bias during voltage sweep operations. The electrical measurement data and fitting results indicate that the oxygen vacancies act as defects to form a conductive path, which is connective or disrupted to realize a low resistive state or a high resistive state. Changing the sweep voltage can tune the oxygen vacancies distribution, which will achieve complementary resistive switching.
Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2
NASA Astrophysics Data System (ADS)
Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi
2018-04-01
Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.
Moderately nonlinear diffuse-charge dynamics under an ac voltage.
Stout, Robert F; Khair, Aditya S
2015-09-01
The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.
Uchitel, O D; Protti, D A; Sanchez, V; Cherksey, B D; Sugimori, M; Llinás, R
1992-01-01
We have studied the effect of the purified toxin from the funnel-web spider venom (FTX) and its synthetic analog (sFTX) on transmitter release and presynaptic currents at the mouse neuromuscular junction. FTX specifically blocks the omega-conotoxin- and dihydropyridine-insensitive P-type voltage-dependent Ca2+ channel (VDCC) in cerebellar Purkinje cells. Mammalian neuromuscular transmission, which is insensitive to N- or L-type Ca2+ channel blockers, was effectively abolished by FTX and sFTX. These substances blocked the muscle contraction and the neurotransmitter release evoked by nerve stimulation. Moreover, presynaptic Ca2+ currents recorded extracellularly from the interior of the perineural sheaths of nerves innervating the mouse levator auris muscle were specifically blocked by both natural toxin and synthetic analogue. In a parallel set of experiments, K(+)-induced Ca45 uptake by brain synaptosomes was also shown to be blocked or greatly diminished by FTX and sFTX. These results indicate that the predominant VDCC in the motor nerve terminals, and possibly in a significant percentage of brain synapses, is the P-type channel. Images PMID:1348859
Uchitel, O D; Protti, D A; Sanchez, V; Cherksey, B D; Sugimori, M; Llinás, R
1992-04-15
We have studied the effect of the purified toxin from the funnel-web spider venom (FTX) and its synthetic analog (sFTX) on transmitter release and presynaptic currents at the mouse neuromuscular junction. FTX specifically blocks the omega-conotoxin- and dihydropyridine-insensitive P-type voltage-dependent Ca2+ channel (VDCC) in cerebellar Purkinje cells. Mammalian neuromuscular transmission, which is insensitive to N- or L-type Ca2+ channel blockers, was effectively abolished by FTX and sFTX. These substances blocked the muscle contraction and the neurotransmitter release evoked by nerve stimulation. Moreover, presynaptic Ca2+ currents recorded extracellularly from the interior of the perineural sheaths of nerves innervating the mouse levator auris muscle were specifically blocked by both natural toxin and synthetic analogue. In a parallel set of experiments, K(+)-induced Ca45 uptake by brain synaptosomes was also shown to be blocked or greatly diminished by FTX and sFTX. These results indicate that the predominant VDCC in the motor nerve terminals, and possibly in a significant percentage of brain synapses, is the P-type channel.
The effect of external visible light on the breakdown voltage of a long discharge tube
NASA Astrophysics Data System (ADS)
Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.
2016-06-01
The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.
Transient sodium current at subthreshold voltages: activation by EPSP waveforms
Carter, Brett C.; Giessel, Andrew J.; Sabatini, Bernardo L.; Bean, Bruce P.
2012-01-01
Summary Tetrodotoxin (TTX)-sensitive sodium channels carry large transient currents during action potentials and also “persistent” sodium current, a non-inactivating TTX-sensitive current present at subthreshold voltages. We examined gating of subthreshold sodium current in dissociated cerebellar Purkinje neurons and hippocampal CA1 neurons, studied at 37 °C with near-physiological ionic conditions. Unexpectedly, in both cell types small voltage steps at subthreshold voltages activated a substantial component of transient sodium current as well as persistent current. Subthreshold EPSP-like waveforms also activated a large component of transient sodium current, but IPSP-like waveforms engaged primarily persistent sodium current with only a small additional transient component. Activation of transient as well as persistent sodium current at subthreshold voltages produces amplification of EPSPs that is sensitive to the rate of depolarization and can help account for the dependence of spike threshold on depolarization rate, as previously observed in vivo. PMID:22998875
Static current-voltage characteristics for radio-frequency induction discharge
DOE Office of Scientific and Technical Information (OSTI.GOV)
Budyansky, A.; Zykov, A.
1995-12-31
The aim of this work was to obtain experimentally such characteristic of Radio-Frequency Induction Discharge (RFID) that can play the role of its current-voltage characteristic (CVC) and to explain the nature of current and voltage jumps arising in RF coils at exciting of discharge. Experiments were made in quartz 5.5, 11, 20 cm diam tubes with outer RF coil at pressures 10--100 mTorr, at frequency 13.56 MHz and discharge power to 500 W. In case of outer coil as analogue of discharge voltage it`s convenient to use the value of the RF voltage U{sub R}, induced around outer perimeter ofmore » discharge tube. It is evident that current and voltage jumps arising at exciting of discharge are due to low output resistance of standard generators and negative slope of initial part of CVC. Three sets of such dependencies for different pressures were obtained for each diameter of tubes. The influence of different metal electrodes placed into discharge volume on CVC`s shape has been studied also. Experimental results can explain the behavior of HFI discharge as a load of RF generator and give data for calculation of RF circuit.« less
Flexible $$I_{Q}\\!\\!-\\!\\!V$$ Scheme of a DFIG for Rapid Voltage Regulation of a Wind Power Plant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jinho; Muljadi, Eduard; Park, Jung -Wook
This paper proposes a flexible reactive current-to-voltage (I Q-V) scheme of a doubly-fed induction generator (DFIG) for the rapid voltage regulation of a wind power plant (WPP). In the proposed scheme, the WPP controller dispatches different voltage set points to the DFIGs depending on their rotor voltage margins. The DFIGs inject different reactive power with the flexible I Q-V schemes implemented in the rotor-side and grid-side converters. The I Q-V characteristic, which consists of the gain and width of a linear band and I Q capability, varies with time depending on the I Q capability of the converters and amore » voltage dip at the point of interconnection (POI). To increase the I Q capability during a fault, the active current is reduced in proportion to a voltage dip. If the I Q capability and/or the POI voltage dip are large, the I Q-V gain is set to be high, thereby providing rapid voltage regulation. To avoid an overvoltage after the fault clearance, a rapid I Q reduction scheme is implemented in the WPP and DFIG controllers. The performance of the proposed flexible scheme was verified under scenarios with various disturbances. In conclusion, the proposed scheme can help increase wind power penetration without jeopardizing voltage stability.« less
Flexible $$I_{Q}\\!\\!-\\!\\!V$$ Scheme of a DFIG for Rapid Voltage Regulation of a Wind Power Plant
Kim, Jinho; Muljadi, Eduard; Park, Jung -Wook; ...
2017-04-28
This paper proposes a flexible reactive current-to-voltage (I Q-V) scheme of a doubly-fed induction generator (DFIG) for the rapid voltage regulation of a wind power plant (WPP). In the proposed scheme, the WPP controller dispatches different voltage set points to the DFIGs depending on their rotor voltage margins. The DFIGs inject different reactive power with the flexible I Q-V schemes implemented in the rotor-side and grid-side converters. The I Q-V characteristic, which consists of the gain and width of a linear band and I Q capability, varies with time depending on the I Q capability of the converters and amore » voltage dip at the point of interconnection (POI). To increase the I Q capability during a fault, the active current is reduced in proportion to a voltage dip. If the I Q capability and/or the POI voltage dip are large, the I Q-V gain is set to be high, thereby providing rapid voltage regulation. To avoid an overvoltage after the fault clearance, a rapid I Q reduction scheme is implemented in the WPP and DFIG controllers. The performance of the proposed flexible scheme was verified under scenarios with various disturbances. In conclusion, the proposed scheme can help increase wind power penetration without jeopardizing voltage stability.« less
Excimer laser annealing for low-voltage power MOSFET
NASA Astrophysics Data System (ADS)
Chen, Yi; Okada, Tatsuya; Noguchi, Takashi; Mazzamuto, Fulvio; Huet, Karim
2016-08-01
Excimer laser annealing of lumped beam was performed to form the P-base junction for high-performance low-voltage-power MOSFET. An equivalent shallow-junction structure for the P-base junction with a uniform impurity distribution is realized by adopting excimer laser annealing (ELA). The impurity distribution in the P-base junction can be controlled precisely by the irradiated pulse energy density and the number of shots of excimer laser. High impurity activation for the shallow junction has been confirmed in the melted phase. The application of the laser annealing technology in the fabrication process of a practical low-voltage trench gate MOSFET was also examined.
NASA Astrophysics Data System (ADS)
Kakehata, Masayuki; Yashiro, Hidehiko; Oyane, Ayako; Ito, Atsuo; Torizuka, Kenji
2016-03-01
Three-mol% yttria-stabilized tetragonal zirconia polycrystal (3Y-TZP) is a fine engineering ceramic that offers high fracture resistance and flexural strength. Thus, it is often applied in mechanical components and medical implants. The surface roughness can be controlled to improve the device characters in some applications. Ultrashort pulse lasers can form laser-induced periodic surface structures (LIPSS) on 3Y-TZP, which have never been investigated in detail. Therefore, this paper reports the formation and characteristics of LIPSS formed on 3Y-TZP, focusing on the pulsewidth dependence. The LIPSS was formed by a Ti:sapphire chirped-pulse amplification system, which generates 810 nmcentered 80-fs pulses at a 570 Hz repetition rate. The measured ablation threshold peak fluence was ~1.5 J/cm2 and the LIPSS was formed at the peak fluence of 2.7-7.7 J/cm2. For linearly polarized pulses, the lines of the LIPSS were oriented parallel to the polarization direction, and their period was comparable to or larger than the center wavelength of the laser. These characteristics differ from the reported characteristics of LIPSS on metals and dielectrics. The pulsewidth dependence of the ablation and LIPSS was investigated for different pulsewidths and signs of chirp. Under the investigated fluence condition, the LIPSS period increased with increasing pulsewidth for both signs of chirp. Similar pulsewidth dependencies were observed for circularly polarized pulses.
A voltage-division-type low-jitter self-triggered repetition-rate switch.
Su, Jian-Cang; Zeng, Bo; Gao, Peng-Cheng; Li, Rui; Wu, Xiao-Long; Zhao, Liang
2016-10-01
A voltage-division-type (V/N) low-jitter self-triggered multi-stage switch is put forward. It comprises of a triggered corona gap, several quasi-uniform-field gaps, and an inversion inductor. When the corona gap is in the stage of self-breakdown, the multi-stage gaps are triggered and the switch is closed via an over-voltage. This type of V/N switch has the advantage of compact structure since the auxiliary components like the gas-blowing system and the triggered system are eliminated from the whole system. It also has advantages such as low breakdown jitter and high energy efficiency. The dependence of the self-triggered voltage on the over-voltage factor and the switch operating voltage is deduced. A switch of this type is designed and fabricated and experiments to research its characteristics are conducted. The results show that this switch can operate on a voltage of 1 MV at 50 Hz and can generate 1000 successive pulses with a jitter as low as 3% and an energy efficiency as high as 90%. This V/N switch can work under a high repetition rate with a long lifetime.
Effect of voltage waveform on dielectric barrier discharge ozone production efficiency
NASA Astrophysics Data System (ADS)
Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.
2012-03-01
Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.
Gigantic transverse voltage induced via off-diagonal thermoelectric effect in CaxCoO2 thin films
NASA Astrophysics Data System (ADS)
Takahashi, Kouhei; Kanno, Tsutomu; Sakai, Akihiro; Adachi, Hideaki; Yamada, Yuka
2010-07-01
Gigantic transverse voltages exceeding several tens volt have been observed in CaxCoO2 thin films with tilted c-axis orientation upon illumination of nanosecond laser pulses. The voltage signals were highly anisotropic within the film surface showing close relation with the c-axis tilt direction. The magnitude and the decay time of the voltage strongly depended on the film thickness. These results confirm that the large laser-induced voltage originates from a phenomenon termed the off-diagonal thermoelectric effect, by which a film out-of-plane temperature gradient leads to generation of a film in-plane voltage.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J
2008-11-01
External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.
Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.
2008-01-01
External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222
Dual patch voltage clamp study of low membrane resistance astrocytes in situ.
Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min
2014-03-17
Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.
Voltage-spike analysis for a free-running parallel inverter
NASA Technical Reports Server (NTRS)
Lee, F. C. Y.; Wilson, T. G.
1974-01-01
Unwanted and sometimes damaging high-amplitude voltage spikes occur during each half cycle in many transistor saturable-core inverters at the moment when the core saturates and the transistors switch. The analysis shows that spikes are an intrinsic characteristic of certain types of inverters even with negligible leakage inductance and purely resistive load. The small but unavoidable after-saturation inductance of the saturable-core transformer plays an essential role in creating these undesired thigh-voltage spikes. State-plane analysis provides insight into the complex interaction between core and transistors, and shows the circuit parameters upon which the magnitude of these spikes depends.
High voltage pulse ignition of mercury discharge hollow cathodes
NASA Technical Reports Server (NTRS)
Wintucky, E. G.
1973-01-01
A high voltage pulse generated by a capacitor discharge into a step-up transformer has been demonstrated capable of consistently igniting hollow cathode mercury discharges at propellant flows and heater power levels much below those required by conventional cathode starting. Results are presented for 3.2-mm diameter enclosed and open keeper cathodes. Starting characteristics are shown to depend on keeper voltage, mercury flow rate, heater power, keeper orifice size, emissive materials, and electrode to which the pulse is applied. This starting technique has been used to start a cathode over 10,000 times without any degradation of starting capability.
Differential effect of brief electrical stimulation on voltage-gated potassium channels.
Cameron, Morven A; Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H; Morley, John W
2017-05-01
Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (Na V channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (K V channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different K V -channel subtypes. Computational modeling reveals substantial differences in the response of specific K V -channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different K V -channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that K V -channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (K V channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between K V channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or
Differential effect of brief electrical stimulation on voltage-gated potassium channels
Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H.; Morley, John W.
2017-01-01
Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (NaV channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (KV channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different KV-channel subtypes. Computational modeling reveals substantial differences in the response of specific KV-channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different KV-channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that KV-channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (KV channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between KV channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Hongliang; Hong, Da Hye; Kim, Han Sol
We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivationmore » curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.« less
Sakata, Souhei; Hossain, Md. Israil; Okamura, Yasushi
2011-01-01
Abstract The voltage sensing phosphatase Ci-VSP is composed of a voltage sensor domain (VSD) and a cytoplasmic phosphatase domain. Upon membrane depolarization, movement of the VSD triggers the enzyme's phosphatase activity. To gain further insight into its operating mechanism, we studied the PI(4,5)P2 phosphatase activity of Ci-VSP expressed in Xenopus oocytes over the entire range of VSD motion by assessing the activity of coexpressed Kir2.1 channels or the fluorescence signal from a pleckstrin homology domain fused with green fluorescent protein (GFP) (PHPLC-GFP). Both assays showed greater phosphatase activity at 125 mV than at 75 mV, which corresponds to ‘sensing’ charges that were 90% and 75% of maximum, respectively. On the other hand, the activity at 160 mV (corresponding to 98% of the maximum ‘sensing’ charge) was indistinguishable from that at 125 mV. Modelling the kinetics of the PHPLC-GFP fluorescence revealed that its time course was dependent on both the level of Ci-VSP expression and the diffusion of PHPLC-GFP beneath the plasma membrane. Enzyme activity was calculated by fitting the time course of PHPLC-GFP fluorescence into the model. The voltage dependence of the enzyme activity was superimposable on the Q–V curve, which is consistent with the idea that the enzyme activity is tightly coupled to VSD movement over the entire range of membrane potentials that elicit VSD movement. PMID:21486809
Operation of a voltage source converter at increased utility voltage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaura, V.; Blasko, V.
1997-01-01
The operation of a voltage source converter (VSC) with regeneration capability, controllable power factor, and low distortion of utility currents is analyzed at increased utility voltage. Increase in the utility voltage causes a VSC to saturate and enter a nonlinear mode of operation. To operate under elevated utility, two steps are taken: (1) a pulse width modulation (PWM) algorithm is implemented which extends the linear region of operation by 15% and (2) a PWM saturation regulator is used to control the reactive current at higher utility voltages. The PWM algorithm reduces the switching losses by at least 33% and themore » effect of blanking time by one-third. All analytical results are experimentally verified on a 100 kW three-phase VSC.« less
Enoki, Ryosuke; Oda, Yoshiaki; Mieda, Michihiro; Ono, Daisuke; Honma, Sato; Honma, Ken-ichi
2017-01-01
The suprachiasmatic nucleus (SCN), the master circadian clock, contains a network composed of multiple types of neurons which are thought to form a hierarchical and multioscillator system. The molecular clock machinery in SCN neurons drives membrane excitability and sends time cue signals to various brain regions and peripheral organs. However, how and at what time of the day these neurons transmit output signals remain largely unknown. Here, we successfully visualized circadian voltage rhythms optically for many days using a genetically encoded voltage sensor, ArcLightD. Unexpectedly, the voltage rhythms are synchronized across the entire SCN network of cultured slices, whereas simultaneously recorded Ca2+ rhythms are topologically specific to the dorsal and ventral regions. We further found that the temporal order of these two rhythms is cell-type specific: The Ca2+ rhythms phase-lead the voltage rhythms in AVP neurons but Ca2+ and voltage rhythms are nearly in phase in VIP neurons. We confirmed that circadian firing rhythms are also synchronous and are coupled with the voltage rhythms. These results indicate that SCN networks with asynchronous Ca2+ rhythms produce coherent voltage rhythms. PMID:28270612
NASA Astrophysics Data System (ADS)
Woellner, Cristiano F.; Freire, José A.; Guide, Michele; Nguyen, Thuc-Quyen
2011-08-01
We develop a simple continuum model for the current voltage characteristics of a material as measured by the conducting atomic force microscopy, including space charge effects. We address the effect of the point contact on the magnitude of the current and on the transition voltages between the different current regimes by comparing these with the corresponding expressions obtained with planar electrodes.
Rankin, Richard; Kotter, Dale
1994-01-01
An optical voltage reference for providing an alternative to a battery source. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function.
McCormack, A L; Day, N C; Craig, P J; Smith, W; Beattie, R E; Volsen, S G
1997-08-01
The molecular, structural and functional characterisation of ion channels in the CNS forms an area of intense investigation in current brain research. For strategic and logistical reasons, rodents have historically been the species of choice for these studies. The examination of human CNS tissues generally presents the investigator with specific challenges that are often less problematic in animal studies, e.g. post-mortem delay/agonal status, and thus both the experimental design and techniques must be manipulated accordingly. Since much pharmaceutical interest is currently focused on neuronal ion channels, the examination of their expression in human brain material is of particular importance. We describe here the details of methods that we have developed and used successfully in the study of the expression of voltage-dependent calcium channels (VDCCs) in human CNS tissues. Presynaptic neuronal VDCCs control neurotransmitter release and are important new drug targets. They are composed of three subunits, alpha 1, beta and alpha 2/delta and multiple gene classes of each protein have been identified. Little is known, however, about the distribution of neuronal VDCCs in the human central nervous system, although initial studies have been performed in rat and rabbit.
High voltage isolation transformer
NASA Astrophysics Data System (ADS)
Clatterbuck, C. H.; Ruitberg, A. P.
1985-04-01
A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.
High voltage isolation transformer
NASA Technical Reports Server (NTRS)
Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)
1985-01-01
A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.
NASA Astrophysics Data System (ADS)
KInacI, BarIş; Özçelik, Süleyman
2013-06-01
The capacitance-voltage-temperature ( C- V- T) and the conductance/angular frequency-voltage-temperature ( G/ω- V- T) characteristics of Au/TiO2(rutile)/ n-Si Schottky barrier diodes (SBDs) were investigated over the temperature range from 200 K to 380 K by considering the series resistance effect. Titanium dioxide (TiO2) was deposited on n-type silicon (Si) substrate using a direct-current (DC) magnetron sputtering system at 200°C. To improve the crystal quality, the deposited film was annealed at 900°C to promote a phase transition from the amorphous to rutile phase. The C -2 versus V plots gave a straight line in the reverse-bias region. The main electrical parameters, such as the doping concentration ( N D), Fermi energy level ( E F), depletion layer width ( W D), barrier height ( ф CV), and series resistance ( R S), of Au/TiO2(rutile)/ n-Si SBDs were calculated from the C- V- T and the G/ω- V- T characteristics. The obtained results show that ф CV, R S, and W D values decrease, while E F and N D values increase, with increasing temperature.
Physical Theory of Voltage Fade in Lithium- and Manganese-Rich Transition Metal Oxides
Rinaldo, Steven G.; Gallagher, Kevin G.; Long, Brandon R.; ...
2015-03-04
Lithium- and manganese-rich (LMR) transition metal oxide cathodes are of interest for lithium-ion battery applications due to their increased energy density and decreased cost. However, the advantages in energy density and cost are offset, in part, due to the phenomena of voltage fade. Specifically, the voltage profiles (voltage as a function of capacity) of LMR cathodes transform from a high energy configuration to a lower energy configuration as they are repeatedly charged (Li removed) and discharged (Li inserted). Here, we propose a physical model of voltage fade that accounts for the emergence of a low voltage Li phase due tomore » the introduction of transition metal ion defects within a parent Li phase. The phenomenological model was re-cast in a general form and experimental LMR charge profiles were de-convoluted to extract the evolutionary behavior of various components of LMR capacitance profiles. Evolution of the voltage fade component was found to follow a universal growth curve with a maximal voltage fade capacity of ≈ 20% of the initial total capacity.« less
KCNE1 divides the voltage sensor movement in KCNQ1/KCNE1 channels into two steps
NASA Astrophysics Data System (ADS)
Barro-Soria, Rene; Rebolledo, Santiago; Liin, Sara I.; Perez, Marta E.; Sampson, Kevin J.; Kass, Robert S.; Larsson, H. Peter
2014-04-01
The functional properties of KCNQ1 channels are highly dependent on associated KCNE-β subunits. Mutations in KCNQ1 or KCNE subunits can cause congenital channelopathies, such as deafness, cardiac arrhythmias and epilepsy. The mechanism by which KCNE1-β subunits slow the kinetics of KCNQ1 channels is a matter of current controversy. Here we show that KCNQ1/KCNE1 channel activation occurs in two steps: first, mutually independent voltage sensor movements in the four KCNQ1 subunits generate the main gating charge movement and underlie the initial delay in the activation time course of KCNQ1/KCNE1 currents. Second, a slower and concerted conformational change of all four voltage sensors and the gate, which opens the KCNQ1/KCNE1 channel. Our data show that KCNE1 divides the voltage sensor movement into two steps with widely different voltage dependences and kinetics. The two voltage sensor steps in KCNQ1/KCNE1 channels can be pharmacologically isolated and further separated by a disease-causing mutation.
Stray voltage and milk quality: a review.
Reinemann, Douglas J
2012-07-01
If animal contact voltage reaches sufficient levels, animals coming into contact with grounded devices may receive a mild electric shock that can cause a behavioral response. At voltage levels that are just perceptible to the animal, behaviors indicative of perception (eg, flinches) may result with little change in normal routines. At higher exposure levels, avoidance behaviors may result. The direct effect of animal contact with electrical current can range from: • Mild behavioral reactions indicative of sensation, to • Involuntary muscle contraction, or twitching, to • Intense behavioral responses indicative of pain. The indirect effects of these behaviors can vary considerably depending on the specifics of the contact location, level of current flow, body pathway, frequency of occurrence, and many other factors related to the daily activities of animals. There are several common situations of concern in animal environments: • Animals avoiding certain exposure locations, which may result in: X Reduced water intake if exposure is required for animals to access watering devices, X Reduced feed intake if exposure is required for animals to accesses feeding devices or locations. • Difficulty of moving or handling animals in areas of voltage/current exposure• The physiologic implications of the release of stress hormones produced by contact with painful stimuli. The severity of response will depend on the amount of electrical current (measured in milliamps) flowing through the animal’s body, the pathway it takes through the body, and the sensitivity of the individual animal. The results of the combined current dose-response experiments, voltage exposure response experiments, and measurements of body and contact resistances is consistent with the lowest (worst case) cow + contact resistance as low as 500 as estimated by Lefcourt that may occur in some unusual situations on farms (firm application of the muzzle to a wet metallic watering device and hoof
NASA Technical Reports Server (NTRS)
Manzella, David; Jacobson, David; Jankovsky, Robert
2001-01-01
A 2.3 kW stationary plasma thruster designed to operate at high voltage was tested at discharge voltages between 300 and 1250 V. Discharge specific impulses between 1600 and 3700 sec were demonstrated with thrust between 40 and 145 mN. Test data indicated that discharge voltage can be optimized for maximum discharge efficiency. The optimum discharge voltage was between 500 and 700 V for the various anode mass flow rates considered. The effect of operating voltage on optimal magnet field strength was investigated. The effect of cathode flow rate on thruster efficiency was considered for an 800 V discharge.
Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions
Sung, Uhna; Sepehri-Rad, Masoud; Piao, Hong Hua; Jin, Lei; Hughes, Thomas; Cohen, Lawrence B.; Baker, Bradley J.
2015-01-01
FRET (Förster Resonance Energy Transfer)-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP) voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different “Nabi1” constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms) and signal decay (~3 ms). We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP) and mRuby2 (acceptor FP) to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz. PMID:26587834
Modulation of voltage-gated channel currents by harmaline and harmane.
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2005-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.
Modulation of voltage-gated channel currents by harmaline and harmane
Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich
2004-01-01
Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABAA receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (ICa(V)), sodium- (INa(V)) and potassium (IK(V))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced ICa(V), INa(V) and IK(V) concentration-dependent (10–500 μM) over the voltage range tested. ICa(V) was reduced with an IC50 of 100.6 μM for harmaline and by a significantly lower concentration of 75.8 μM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 μM for both substances. The steady state of inhibition of ICa(V) by harmaline or harmane was reached within several minutes. The action was not use dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (ICa(L+N)), while the transient voltage-gated calcium channel current (ICa(T)) was only partially affected. We conclude that harmaline and harmane are modulators of ICa(V) in vitro. This might be related to their neuroprotective effects. PMID:15644868
A multi-functional high voltage experiment apparatus for vacuum surface flashover switch research.
Zeng, Bo; Su, Jian-cang; Cheng, Jie; Wu, Xiao-long; Li, Rui; Zhao, Liang; Fang, Jin-peng; Wang, Li-min
2015-04-01
A multifunctional high voltage apparatus for experimental researches on surface flashover switch and high voltage insulation in vacuum has been developed. The apparatus is composed of five parts: pulse generating unit, axial field unit, radial field unit, and two switch units. Microsecond damped ringing pulse with peak-to-peak voltage 800 kV or unipolar pulse with maximum voltage 830 kV is generated, forming transient axial or radial electrical field. Different pulse waveforms and field distributions make up six experimental configurations in all. Based on this apparatus, preliminary experiments on vacuum surface flashover switch with different flashover dielectric materials have been conducted in the axial field unit, and nanosecond pulse is generated in the radial field unit which makes a pulse transmission line in the experiment. Basic work parameters of this kind of switch such as lifetime, breakdown voltage are obtained.
Rankin, R.; Kotter, D.
1994-04-26
An optical voltage reference for providing an alternative to a battery source is described. The optical reference apparatus provides a temperature stable, high precision, isolated voltage reference through the use of optical isolation techniques to eliminate current and impedance coupling errors. Pulse rate frequency modulation is employed to eliminate errors in the optical transmission link while phase-lock feedback is employed to stabilize the frequency to voltage transfer function. 2 figures.
Vivas, Oscar; Arenas, Isabel; García, David E
2012-06-01
Neurotransmitters and hormones regulate Ca(V)2.2 channels through a voltage-independent pathway which is not well understood. It has been suggested that this voltage-independent inhibition is constant at all membrane voltages. However, changes in the percent of voltage-independent inhibition of Ca(V)2.2 have not been tested within a physiological voltage range. Here, we used a double-pulse protocol to isolate the voltage-independent inhibition of Ca(V)2.2 channels induced by noradrenaline in rat superior cervical ganglion neurons. To assess changes in the percent of the voltage-independent inhibition, the activation voltage of the channels was tested between -40 and +40 mV. We found that the percent of voltage-independent inhibition induced by noradrenaline changed with the activation voltage used. In addition, voltage-independent inhibition induced by oxo-M, a muscarinic agonist, exhibited the same dependence on activation voltage, which supports that this pattern is not exclusive for adrenergic activation. Our results suggested that voltage-independent inhibition of Ca(V)2.2 channels depends on the activation voltage of the channel in a physiological voltage range. This may have relevant implications in the understanding of the mechanism involved in voltage-independent inhibition.
Leipold, Enrico; Borges, Adolfo
2012-01-01
Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487
Internal voltage control of hydrogen-oxygen fuel cells: Feasibility study
NASA Technical Reports Server (NTRS)
Prokopius, P. R.
1975-01-01
An experimental study was conducted to assess the feasibility of internal voltage regulation of fuel cell systems. Two methods were tested. In one, reactant partial pressure was used as the voltage control parameter and in the other reactant total pressure was used for control. Both techniques were breadboarded and tested on a single alkaline-electrolyte fuel cell. Both methods were found to be possible forms of regulation, however, of the two the total pressure technique would be more efficient, simpler to apply and would provide better transient characteristics.
NASA Astrophysics Data System (ADS)
Pan, Jie; Cheng, Yang-Tse; Qi, Yue
2015-04-01
Understanding the ionic conduction in solid electrolytes in contact with electrodes is vitally important to many applications, such as lithium ion batteries. The problem is complex because both the internal properties of the materials (e.g., electronic structure) and the characteristics of the externally contacting phases (e.g., voltage of the electrode) affect defect formation and transport. In this paper, we developed a method based on density functional theory to study the physics of defects in a solid electrolyte in equilibrium with an external environment. This method was then applied to predict the ionic conduction in lithium fluoride (LiF), in contact with different electrodes which serve as reservoirs with adjustable Li chemical potential (μLi) for defect formation. LiF was chosen because it is a major component in the solid electrolyte interphase (SEI) formed on lithium ion battery electrodes. Seventeen possible native defects with their relevant charge states in LiF were investigated to determine the dominant defect types on various electrodes. The diffusion barrier of dominant defects was calculated by the climbed nudged elastic band method. The ionic conductivity was then obtained from the concentration and mobility of defects using the Nernst-Einstein relationship. Three regions for defect formation were identified as a function of μLi: (1) intrinsic, (2) transitional, and (3) p -type region. In the intrinsic region (high μLi, typical for LiF on the negative electrode), the main defects are Schottky pairs and in the p -type region (low μLi, typical for LiF on the positive electrode) are Li ion vacancies. The ionic conductivity is calculated to be approximately 10-31Scm-1 when LiF is in contact with a negative electrode but it can increase to 10-12Scm-1 on a positive electrode. This insight suggests that divalent cation (e.g., Mg2+) doping is necessary to improve Li ion transport through the engineered LiF coating, especially for LiF on negative
Enhanced Response Time of Electrowetting Lenses with Shaped Input Voltage Functions.
Supekar, Omkar D; Zohrabi, Mo; Gopinath, Juliet T; Bright, Victor M
2017-05-16
Adaptive optical lenses based on the electrowetting principle are being rapidly implemented in many applications, such as microscopy, remote sensing, displays, and optical communication. To characterize the response of these electrowetting lenses, the dependence upon direct current (DC) driving voltage functions was investigated in a low-viscosity liquid system. Cylindrical lenses with inner diameters of 2.45 and 3.95 mm were used to characterize the dynamic behavior of the liquids under DC voltage electrowetting actuation. With the increase of the rise time of the input exponential driving voltage, the originally underdamped system response can be damped, enabling a smooth response from the lens. We experimentally determined the optimal rise times for the fastest response from the lenses. We have also performed numerical simulations of the lens actuation with input exponential driving voltage to understand the variation in the dynamics of the liquid-liquid interface with various input rise times. We further enhanced the response time of the devices by shaping the input voltage function with multiple exponential rise times. For the 3.95 mm inner diameter lens, we achieved a response time improvement of 29% when compared to the fastest response obtained using single-exponential driving voltage. The technique shows great promise for applications that require fast response times.
Automatic voltage imbalance detector
Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.
1984-01-01
A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.
Voltage Control of Antiferromagnetic Phases at Near-Terahertz Frequencies
NASA Astrophysics Data System (ADS)
Barra, Anthony; Domann, John; Kim, Ki Wook; Carman, Greg
2018-03-01
A method to control antiferromagnetism using voltage-induced strain is proposed and theoretically examined. Voltage-induced magnetoelastic anisotropy is shown to provide sufficient torque to switch an antiferromagnetic domain 90° either from out of plane to in plane or between in-plane axes. Numerical results indicate that strain-mediated antiferromagnetic switching can occur in an 80-nm nanopatterned disk at frequencies approaching 1 THz but that the switching speed heavily depends on the system's mechanical design. Furthermore, the energy cost to induce magnetic switching is only 450 aJ, indicating that magnetoelastic control of antiferromagnetism is substantially more energy efficient than other approaches.
Extended forms of the second law for general time-dependent stochastic processes.
Ge, Hao
2009-08-01
The second law of thermodynamics represents a universal principle applicable to all natural processes, physical systems, and engineering devices. Hatano and Sasa have recently put forward an extended form of the second law for transitions between nonequilibrium stationary states [Phys. Rev. Lett. 86, 3463 (2001)]. In this paper we further extend this form to an instantaneous interpretation, which is satisfied by quite general time-dependent stochastic processes including master-equation models and Langevin dynamics without the requirements of the stationarity for the initial and final states. The theory is applied to several thermodynamic processes, and its consistence with the classical thermodynamics is shown.
The Voltage Boost Enabled by Luminescence Extraction in Solar Cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ganapati, Vidya; Steiner, Myles A.; Yablonovitch, Eli
A new physical principle has emerged to produce record voltages and efficiencies in photovoltaic cells, 'luminescence extraction.' This is exemplified by the mantra 'a good solar cell should also be a good LED.' Luminescence extraction is the escape of internal photons out of the front surface of a solar cell. Basic thermodynamics says that the voltage boost should be related to concentration ratio, C, of a resource by ..delta..V=(kT/q)ln{C}. In light trapping, (i.e. when the solar cell is textured and has a perfect back mirror) the concentration ratio of photons C={4n2}, so one would expect a voltage boost of ..delta..V=kTmore » ln{4n2} over a solar cell with no texture and zero back reflectivity, where n is the refractive index. Nevertheless, there has been ambiguity over the voltage benefit to be expected from perfect luminescence extraction. Do we gain an open circuit voltage boost of ..delta..V=(kT/q)ln{n2}, ..delta..V=(kT/q)ln{2n2}, or ..delta..V=(kT/q)ln{4n2}? What is responsible for this voltage ambiguity ..delta..V=(kT/q)ln{4}=36mVolts? We show that different results come about, depending on whether the photovoltaic cell is optically thin or thick to its internal luminescence. In realistic intermediate cases of optical thickness the voltage boost falls in between; ln{n2}q..delta..V/kT)<;ln{4n2}.« less
Gating of the designed trimeric/tetrameric voltage-gated H+ channel
Fujiwara, Yuichiro; Kurokawa, Tatsuki; Takeshita, Kohei; Nakagawa, Atsushi; Larsson, H Peter; Okamura, Yasushi
2013-01-01
The voltage-gated H+ channel functions as a dimer, a configuration that is different from standard tetrameric voltage-gated channels. Each channel protomer has its own permeation pathway. The C-terminal coiled-coil domain has been shown to be necessary for both dimerization and cooperative gating in the two channel protomers. Here we report the gating cooperativity in trimeric and tetrameric Hv channels engineered by altering the hydrophobic core sequence of the coiled-coil assembly domain. Trimeric and tetrameric channels exhibited more rapid and less sigmoidal kinetics of activation of H+ permeation than dimeric channels, suggesting that some channel protomers in trimers and tetramers failed to produce gating cooperativity observed in wild-type dimers. Multimerization of trimer and tetramer channels were confirmed by the biochemical analysis of proteins, including crystallography. These findings indicate that the voltage-gated H+ channel is optimally designed as a dimeric channel on a solid foundation of the sequence pattern of the coiled-coil core, with efficient cooperative gating that ensures sustained and steep voltage-dependent H+ conductance in blood cells. PMID:23165764
Current collection by high voltage anodes in near ionospheric conditions
NASA Technical Reports Server (NTRS)
Antoniades, John A.; Greaves, Rod G.; Boyd, D. A.; Ellis, R.
1990-01-01
The authors experimentally identified three distinct regimes with large differences in current collection in the presence of neutrals and weak magnetic fields. In magnetic field/anode voltage space the three regions are separated by very sharp transition boundaries. The authors performed a series of laboratory experiments to study the dependence of the region boundaries on several parameters, such as the ambient neutral density, plasma density, magnetic field strength, applied anode voltage, voltage pulsewidth, chamber material, chamber size and anode radius. The three observed regimes are: classical magnetic field limited collection; stable medium current toroidal discharge; and large scale, high current space glow discharge. There is as much as several orders of magnitude of difference in the amount of collected current upon any boundary crossing, particularly if one enters the space glow regime. They measured some of the properties of the plasma generated by the breakdown that is present in regimes II and III in the vicinity of the anode including the sheath modified electrostatic potential, I-V characteristics at high voltage as well as the local plasma density.
Reduced voltage sensitivity in a K+-channel voltage sensor by electric field remodeling
González-Pérez, Vivian; Stack, Katherine; Boric, Katica; Naranjo, David
2010-01-01
Propagation of the nerve impulse relies on the extreme voltage sensitivity of Na+ and K+ channels. The transmembrane movement of four arginine residues, located at the fourth transmembrane segment (S4), in each of their four voltage-sensing domains is mostly responsible for the translocation of 12 to 13 eo across the transmembrane electric field. Inserting additional positively charged residues between the voltage-sensing arginines in S4 would, in principle, increase voltage sensitivity. Here we show that either positively or negatively charged residues added between the two most external sensing arginines of S4 decreased voltage sensitivity of a Shaker voltage-gated K+-channel by up to ≈50%. The replacement of Val363 with a charged residue displaced inwardly the external boundaries of the electric field by at least 6 Å, leaving the most external arginine of S4 constitutively exposed to the extracellular space and permanently excluded from the electric field. Both the physical trajectory of S4 and its electromechanical coupling to open the pore gate seemed unchanged. We propose that the separation between the first two sensing charges at resting is comparable to the thickness of the low dielectric transmembrane barrier they must cross. Thus, at most a single sensing arginine side chain could be found within the field. The conserved hydrophobic nature of the residues located between the voltage-sensing arginines in S4 may shape the electric field geometry for optimal voltage sensitivity in voltage-gated ion channels. PMID:20194763
Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron
2012-02-14
Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.
Yang, Zhilai; Wang, Jin-Hui
2013-12-01
The spike propagation on nerve axons, like synaptic transmission, is essential to ensure neuronal communication. The secure propagation of sequential spikes toward axonal terminals has been challenged in the neurons with a high firing rate, such as cerebellar Purkinje cells. The shortfall of spike propagation makes some digital spikes disappearing at axonal terminals, such that the elucidation of the mechanisms underlying spike propagation reliability is crucial to find the strategy of preventing loss of neuronal codes. As the spike propagation failure is influenced by the membrane potentials, this process is likely caused by altering the functional status of voltage-gated sodium channels (VGSC). We examined this hypothesis in Purkinje cells by using pair-recordings at their somata and axonal blebs in cerebellar slices. The reliability of spike propagation was deteriorated by elevating spike frequency. The frequency-dependent reliability of spike propagation was attenuated by inactivating VGSCs and improved by removing their inactivation. Thus, the functional status of axonal VGSCs influences the reliability of spike propagation.
An inherent curvature-compensated voltage reference using non-linearity of gate coupling coefficient
NASA Astrophysics Data System (ADS)
Hande, Vinayak; Shojaei Baghini, Maryam
2015-08-01
A novel current-mode voltage reference circuit which is capable of generating sub-1 V output voltage is presented. The proposed architecture exhibits the inherent curvature compensation ability. The curvature compensation is achieved by utilizing the non-linear behavior of gate coupling coefficient to compensate non-linear temperature dependence of base-emitter voltage. We have also utilized the developments in CMOS process to reduce power and area consumption. The proposed voltage reference is analyzed theoretically and compared with other existing methods. The circuit is designed and simulated in 180 nm mixed-mode CMOS UMC technology which gives a reference level of 246 mV. The minimum required supply voltage is 1 V with maximum current drawn of 9.24 μA. A temperature coefficient of 9 ppm/°C is achieved over -25 to 125 °C temperature range. The reference voltage varies by ±11 mV across process corners. The reference circuit shows the line sensitivity of 0.9 mV/V with area consumption of 100 × 110 μm2
Lin, Tzu Yu; Lu, Cheng Wei; Huang, Shu-Kuei
2013-01-01
Abstract This study investigated the effects and possible mechanism of ferulic acid, a naturally occurring phenolic compound, on endogenous glutamate release in the nerve terminals of the cerebral cortex in rats. Results show that ferulic acid inhibited the release of glutamate evoked by the K+ channel blocker 4-aminopyridine (4-AP). The effect of ferulic acid on the evoked glutamate release was prevented by chelating the extracellular Ca2+ ions, but was insensitive to the glutamate transporter inhibitor DL-threo-beta-benzyl-oxyaspartate. Ferulic acid suppressed the depolarization-induced increase in a cytosolic-free Ca2+ concentration, but did not alter 4-AP–mediated depolarization. Furthermore, the effect of ferulic acid on evoked glutamate release was abolished by blocking the Cav2.2 (N-type) and Cav2.1 (P/Q-type) channels, but not by blocking ryanodine receptors or mitochondrial Na+/Ca2+ exchange. These results show that ferulic acid inhibits glutamate release from cortical synaptosomes in rats through the suppression of presynaptic voltage-dependent Ca2+ entry. PMID:23342970
Phosphatidic acid modulation of Kv channel voltage sensor function.
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-10-06
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid.
Phosphatidic acid modulation of Kv channel voltage sensor function
Hite, Richard K; Butterwick, Joel A; MacKinnon, Roderick
2014-01-01
Membrane phospholipids can function as potent regulators of ion channel function. This study uncovers and investigates the effect of phosphatidic acid on Kv channel gating. Using the method of reconstitution into planar lipid bilayers, in which protein and lipid components are defined and controlled, we characterize two effects of phosphatidic acid. The first is a non-specific electrostatic influence on activation mediated by electric charge density on the extracellular and intracellular membrane surfaces. The second is specific to the presence of a primary phosphate group, acts only through the intracellular membrane leaflet and depends on the presence of a particular arginine residue in the voltage sensor. Intracellular phosphatidic acid accounts for a nearly 50 mV shift in the midpoint of the activation curve in a direction consistent with stabilization of the voltage sensor's closed conformation. These findings support a novel mechanism of voltage sensor regulation by the signaling lipid phosphatidic acid. DOI: http://dx.doi.org/10.7554/eLife.04366.001 PMID:25285449
Yang, Jingsong; Xiao, Lifen; He, Wei; Fan, Jiangwei; Chen, Zhongxue; Ai, Xinping; Yang, Hanxi; Cao, Yuliang
2016-07-27
The effect of the cutoff voltages on the working voltage decay and cyclability of the lithium-rich manganese-based layered cathode (LRMO) was investigated by electrochemical measurements, electrochemical impedance spectroscopy, ex situ X-ray diffraction, transmission electron microscopy, and energy dispersive spectroscopy line scan technologies. It was found that both lower (2.0 V) and upper (4.8 V) cutoff voltages cause severe voltage decay with cycling due to formation of the spinel phase and migration of the transition metals inside the particles. Appropriate cutoff voltage between 2.8 and 4.4 V can effectively inhibit structural variation as the electrode demonstrates 92% capacity retention and indiscernible working voltage decay over 430 cycles. The results also show that phase transformation not only on high charge voltage but also on low discharge voltage should be addressed to obtain highly stable LRMO materials.
Goldschen-Ohm, Marcel P.; Capes, Deborah L.; Oelstrom, Kevin M.; Chanda, Baron
2013-01-01
Voltage-dependent Na+ channels are crucial for electrical signalling in excitable cells. Membrane depolarization initiates asynchronous movements in four non-identical voltage-sensing domains of the Na+ channel. It remains unclear to what extent this structural asymmetry influences pore gating as compared with outwardly rectifying K+ channels, where channel opening results from a final concerted transition of symmetric pore gates. Here we combine single channel recordings, cysteine accessibility and voltage clamp fluorimetry to probe the relationships between voltage sensors and pore conformations in an inactivation deficient Nav1.4 channel. We observe three distinct conductance levels such that DI-III voltage sensor activation is kinetically correlated with formation of a fully open pore, whereas DIV voltage sensor movement underlies formation of a distinct subconducting pore conformation preceding inactivation in wild-type channels. Our experiments reveal that pore gating in sodium channels involves multiple transitions driven by asynchronous movements of voltage sensors. These findings shed new light on the mechanism of coupling between activation and fast inactivation in voltage-gated sodium channels. PMID:23322038
Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon
2014-01-01
Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597
Electrical probe characteristic recovery by measuring only one time-dependent parameter
NASA Astrophysics Data System (ADS)
Costin, C.; Popa, G.; Anita, V.
2016-03-01
Two straightforward methods for recovering the current-voltage characteristic of an electrical probe are proposed. Basically, they consist of replacing the usual power supply from the probe circuit with a capacitor which can be charged or discharged by the probe current drained from the plasma. The experiment requires the registration of only one time-dependent electrical parameter, either the probe current or the probe voltage. The corresponding time-dependence of the second parameter, the probe voltage, or the probe current, respectively, can be calculated using an integral or a differential relation and the current-voltage characteristic of the probe can be obtained.
NASA Astrophysics Data System (ADS)
Sadeghzadeh, Sadegh; Farshad Mir Saeed Ghazi, Seyyed
2018-03-01
Piezoelectric Nanogenerator (PENG) is one of the novel energy harvester systems that recently, has been a subject of interest for researchers. By the use of nanogenerators, it’s possible to harvest different forms of energy in the environment like mechanical vibrations and generate electricity. The structure of a PENG consists of vertical arrays of nanowires between two electrodes. In this paper, dynamic analysis of a PENG is studied numerically. The modified couple stress theory which includes one length scale material parameter is used to study the size-dependent behavior of PENGs. Then, by application of a complete form of linear hybrid piezoelectric—pyroelectric equations, and using the Euler-Bernoulli beam model, the equations of motion has been derived. Generalized Differential Quadrature (GDQ) method was employed to solve the equations of motion. The effect of damping ratio, temperature rise, excitation frequency and length scale parameter was studied. It was found that the PENG voltage maximizes at the resonant frequency of nanowire. The temperature rise has a significant effect on PENG’s efficiency. When temperature increases about 10 {{K}}, the maximum voltage increases about 26%. Increasing the damping ratio, the maximum voltage decreases gradually.
Regulation of the Output Voltage of an Inverter in Case of Load Variation
NASA Astrophysics Data System (ADS)
Diouri, Omar; Errahimi, Fatima; Es-Sbai, Najia
2018-05-01
In a DC/AC photovoltaic application, the stability of the output voltage of the inverter plays a very important role in the electrical systems. Such a photovoltaic system is constituted by an inverter, which makes it possible to convert the continuous energy to the alternative energy used in systems which operate under a voltage of 230V. The output of this inverter can be connected to a single load or more, at which time a second load is added in parallel with the first load. In this case, it proves a voltage drop at the output of the inverter. This problem influences the proper functioning of the electrical loads. Therefore, our contribution is to give a solution to this by compensating this voltage drop using a boost converter at the input of the inverter. This boost converter will play the role of the compensator that will provide the necessary voltage to the inverter in order to increase the voltage across the loads. But the use of this boost without controlling it is not enough because it generates a voltage that depends on the duty cycle of the control signal. To stabilize the output voltage of the inverter, we used a Proportional, Integral, and Derivative control (PID), which makes it possible to generate the necessary control signal for the voltage boost in order to have a good regulation of the output voltage of the inverter. Finally, we have solved the problem of the voltage drop even though there is loads variation.
Identification of an HV 1 voltage-gated proton channel in insects.
Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris
2016-04-01
The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.
Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda
2015-12-25
The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.
Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R
2018-03-24
Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to
Shah, Niyathi Hegde; Aizenman, Elias
2013-01-01
Voltage-gated potassium (Kv) channels are widely expressed in the central and peripheral nervous system, and are crucial mediators of neuronal excitability. Importantly, these channels also actively participate in cellular and molecular signaling pathways that regulate the life and death of neurons. Injury-mediated increased K+ efflux through Kv2.1 channels promotes neuronal apoptosis, contributing to widespread neuronal loss in neurodegenerative disorders such as Alzheimer’s disease and stroke. In contrast, some forms of neuronal activity can dramatically alter Kv2.1 channel phosphorylation levels and influence their localization. These changes are normally accompanied by modifications in channel voltage-dependence, which may be neuroprotective within the context of ischemic injury. Kv1 and Kv7 channel dysfunction leads to neuronal hyperexcitability that critically contributes to the pathophysiology of human clinical disorders such as episodic ataxia and epilepsy. This review summarizes the neurotoxic, neuroprotective, and neuroregulatory roles of Kv channels, and highlights the consequences of Kv channel dysfunction on neuronal physiology. The studies described in this review thus underscore the importance of normal Kv channel function in neurons, and emphasize the therapeutic potential of targeting Kv channels in the treatment of a wide range of neurological diseases. PMID:24323720
Size-dependent variation in plant form.
Niklas, Karl J; Cobb, Edward D
2017-09-11
The study of organic form has a long and distinguished history going at least as far back as Aristotle's Historia Anima¯lium, wherein he identified five basic biological processes that define the forms of animals (metabolism, temperature regulation, information processing, embryo development, and inheritance). Unfortunately, all of Aristotle's writings about plant forms are lost. We know of them only indirectly from his student Theophrastus's companion books, collectively called Historia Plantarum, wherein plant forms are categorized into annual herbs, herbaceous perennials, shrubs, and trees. The study of plant forms did not truly begin until the romantic poet and naturalist Goethe proposed the concept of a hypothetical 'Plant Archetype', declared "Alles ist Blatt", and first coined the word morphologie, which inspired the French anatomist Cuvier (who established the field of comparative morphology), the English naturalist Darwin (who saw his theory of evolution reinforced by it), and the Scottish mathematician D'Arcy Thompson (who attempted to quantify it). Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Dultsev, Fedor N.; Mik, Ivan A.; Dubtsov, Sergei N.; Dultseva, Galina G.
2014-11-01
We describe the new procedure developed to determine the functional groups on the surface of nanoparticles formed in photonucleation of furfural, one of the aldehydes generated during forest fire events. The procedure is based on the detection of nanoparticle rupture from chemically modified surface of the quartz crystal microbalance oscillating in the thickness shear mode under voltage sweep. The rupture force is determined from the voltage at which the rupture occurs. It depends on particle mass and on the affinity of the surface functional groups of the particle to the groups that are present on the modified QCM surface. It was demonstrated with the amine modification of the surface that the nanoparticles formed in furfural photonucleation contain carbonyl and carboxyl groups. The applicability of the method for the investigation of functional groups on the surface of the nanoparticles of atmospheric aerosol is demonstrated.
Adaptive Hierarchical Voltage Control of a DFIG-Based Wind Power Plant for a Grid Fault
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jinho; Muljadi, Eduard; Park, Jung-Wook
This paper proposes an adaptive hierarchical voltage control scheme of a doubly-fed induction generator (DFIG)-based wind power plant (WPP) that can secure more reserve of reactive power (Q) in the WPP against a grid fault. To achieve this, each DFIG controller employs an adaptive reactive power to voltage (Q-V) characteristic. The proposed adaptive Q-V characteristic is temporally modified depending on the available Q capability of a DFIG; it is dependent on the distance from a DFIG to the point of common coupling (PCC). The proposed characteristic secures more Q reserve in the WPP than the fixed one. Furthermore, it allowsmore » DFIGs to promptly inject up to the Q limit, thereby improving the PCC voltage support. To avert an overvoltage after the fault clearance, washout filters are implemented in the WPP and DFIG controllers; they can prevent a surplus Q injection after the fault clearance by eliminating the accumulated values in the proportional-integral controllers of both controllers during the fault. Test results demonstrate that the scheme can improve the voltage support capability during the fault and suppress transient overvoltage after the fault clearance under scenarios of various system and fault conditions; therefore, it helps ensure grid resilience by supporting the voltage stability.« less
Over-voltage protection system and method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chi, Song; Dong, Dong; Lai, Rixin
An over-voltage protection system includes an electronic valve connected across two terminals of a circuit and an over-voltage detection circuit connected across one of the plurality of semiconductor devices for detecting an over-voltage across the circuit. The electronic valve includes a plurality of semiconductor devices connected in series. The over-voltage detection circuit includes a voltage divider circuit connected to a break-over diode in a way to provide a representative low voltage to the break-over diode and an optocoupler configured to receive a current from the break-over diode when the representative low voltage exceeds a threshold voltage of the break-over diodemore » indicating an over-voltage condition. The representative low voltage provided to the break-over diode represents a voltage across the one semiconductor device. A plurality of self-powered gate drive circuits are connected to the plurality of semiconductor devices, wherein the plurality of self-powered gate drive circuits receive over-voltage triggering pulses from the optocoupler during the over-voltage condition and switch on the plurality of semiconductor devices to bypass the circuit.« less
Kim, Diana H; Verdino, Ralph J
To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS V<5mm in all limb leads and <10mm in all precordial leads. The diagnostic use of ECGs with low voltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and <10mm in all precordial leads were collected. Associated clinical conditions were determined from clinical data, echocardiograms, and chest radiographs. Low precordial voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Khan, Motiur Rahman; Rao, K. S. R. Koteswara; Menon, R.
2017-05-01
Temperature dependent current-voltage measurements have been performed on poly(3-methylthiophene) based devices in metal/polymer/metal geometry in temperature range 90-300 K. Space charge limited current (SCLC) controlled by exponentially distributed traps is observed at all the measured temperatures at intermediate voltage range. At higher voltages, trap-free SCLC is observed at 90 K only while slope less than 2 is observed at higher temperatures which is quiet unusual in polymer devices. Impedance measurements were performed at different bias voltages. The unusual behavior observed in current-voltage characteristics is explained by Cole-Cole plot which gives the signature of interface dipole on electrode/polymer interface. Two relaxation mechanisms are obtained from the real part of impedance vs frequency spectra which confirms the interface related phenomena in the device
NASA Astrophysics Data System (ADS)
Bhattacharjee, N.; Horowitz, L. F.; Folch, A.
2016-10-01
Concerns over biosafety, cost, and carrying capacity of viral vectors have accelerated research into physical techniques for gene delivery such as electroporation and mechanoporation. Advances in microfabrication have made it possible to create high electric fields over microscales, resulting in more efficient DNA delivery and higher cell viability. Continuous-flow microfluidic methods are typically more suitable for cellular therapies where a large number of cells need to be transfected under sterile conditions. However, the existing continuous-flow designs used to generate multiple pulses either require expensive peripherals such as high-voltage (>400 V) sources or function generators, or result in reduced cell viability due to the proximity of the cells to the electrodes. In this paper, we report a continuous-flow microfluidic device whose channel geometry reduces instrumentation demands and minimizes cellular toxicity. Our design can generate multiple pulses of high DC electric field strength using significantly lower voltages (15-60 V) than previous designs. The cells flow along a serpentine channel that repeatedly flips the cells between a cathode and an anode at high throughput. The cells must flow through a constriction each time they pass from an anode to a cathode, exposing them to high electric field strength for short durations of time (the "pulse-width"). A conductive biocompatible poly-aniline hydrogel network formed in situ is used to apply the DC voltage without bringing the metal electrodes close to the cells, further sheltering cells from the already low voltage electrodes. The device was used to electroporate multiple cell lines using electric field strengths between 700 and 800 V/cm with transfection efficiencies superior than previous flow-through designs.
Bhattacharjee, N; Horowitz, L F; Folch, A
2016-10-17
Concerns over biosafety, cost, and carrying capacity of viral vectors have accelerated research into physical techniques for gene delivery such as electroporation and mechanoporation. Advances in microfabrication have made it possible to create high electric fields over microscales, resulting in more efficient DNA delivery and higher cell viability. Continuous-flow microfluidic methods are typically more suitable for cellular therapies where a large number of cells need to be transfected under sterile conditions. However, the existing continuous-flow designs used to generate multiple pulses either require expensive peripherals such as high-voltage (>400 V) sources or function generators, or result in reduced cell viability due to the proximity of the cells to the electrodes. In this paper, we report a continuous-flow microfluidic device whose channel geometry reduces instrumentation demands and minimizes cellular toxicity. Our design can generate multiple pulses of high DC electric field strength using significantly lower voltages (15-60 V) than previous designs. The cells flow along a serpentine channel that repeatedly flips the cells between a cathode and an anode at high throughput. The cells must flow through a constriction each time they pass from an anode to a cathode, exposing them to high electric field strength for short durations of time (the "pulse-width"). A conductive biocompatible poly-aniline hydrogel network formed in situ is used to apply the DC voltage without bringing the metal electrodes close to the cells, further sheltering cells from the already low voltage electrodes. The device was used to electroporate multiple cell lines using electric field strengths between 700 and 800 V/cm with transfection efficiencies superior than previous flow-through designs.
Non-scaling behavior of electroosmotic flow in voltage-gated nanopores
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lian, Cheng; Gallegos, Alejandro; Liu, Honglai
2017-01-01
Ionic size effects and electrostatic correlations result in the non-monotonic dependence of the electrical conductivity on the pore size. For ion transport at a high gating voltage, the conductivity oscillates with the pore size due to a significant overlap of the electric double layers.
Influence of a MoOx interlayer on the open-circuit voltage in organic photovoltaic cells
NASA Astrophysics Data System (ADS)
Zou, Yunlong; Holmes, Russell J.
2013-07-01
Metal-oxides have been used as interlayers at the anode-organic interface in organic photovoltaic cells (OPVs) to increase the open-circuit voltage (VOC). We examine the role of MoOx in determining the maximum VOC in a planar heterojunction OPV and find that the interlayer strongly affects the temperature dependence of VOC. Boron subphthalocyanine chloride (SubPc)-C60 OPVs that contain no interlayer show a maximum VOC of 1.2 V at low temperature, while those with MoOx show no saturation, reaching VOC > 1.4 V. We propose that the MoOx-SubPc interface forms a Schottky junction that provides an additional contribution to VOC at low temperature.
Vivas, Oscar; Moreno, Claudia M; Santana, Luis F; Hille, Bertil
2017-01-01
CaV-channel dependent activation of BK channels is critical for feedback control of both calcium influx and cell excitability. Here we addressed the functional and spatial interaction between BK and CaV1.3 channels, unique CaV1 channels that activate at low voltages. We found that when BK and CaV1.3 channels were co-expressed in the same cell, BK channels started activating near −50 mV, ~30 mV more negative than for activation of co-expressed BK and high-voltage activated CaV2.2 channels. In addition, single-molecule localization microscopy revealed striking clusters of CaV1.3 channels surrounding clusters of BK channels and forming a multi-channel complex both in a heterologous system and in rat hippocampal and sympathetic neurons. We propose that this spatial arrangement allows tight tracking between local BK channel activation and the gating of CaV1.3 channels at quite negative membrane potentials, facilitating the regulation of neuronal excitability at voltages close to the threshold to fire action potentials. DOI: http://dx.doi.org/10.7554/eLife.28029.001 PMID:28665272
Erxleben, C; Hermann, A
2001-03-16
Invertebrate skeletal muscle contraction is regulated by calcium influx through voltage-dependent calcium channels in the sarcolemmal membrane. In present study we investigated the effects of nitric oxide (NO) donors on calcium currents of single skeletal muscle fibres from the marine isopod, Idotea baltica, using two-electrode voltage clamp recording techniques. The NO donors, S-nitrosocysteine, S-nitroso-N-acetyl-penicillamine or hydroxylamine reversibly increased calcium inward currents in a time dependent manner. The increase of the current was prevented by methylene blue. Our experiments suggest that NO increases calcium inward currents. NO, by acting on calcium ion channels in the sarcolemmal membrane, therefore, may directly be involved in the modulation of muscle contraction.
Weiss, T; Erxleben, C; Rathmayer, W
2001-01-01
A single fibre preparation from the extensor muscle of a marine isopod crustacean is described which allows the analysis of membrane currents and simultaneously recorded contractions under two-electrode voltage-clamp conditions. We show that there are three main depolarisation-gated currents, two are outward and carried by K+, the third is an inward Ca2+ current, I(Ca). Normally, the K+ currents which can be isolated by using K+ channel blockers, mask I(Ca). I(Ca) activates at potentials more positive than -40 mV, is maximal around 0 mV, and shows strong inactivation at higher depolarisation. Inactivation depends on current rather than voltage. Ba2+, Sr2+ and Mg2+ can substitute for Ca2+. Ba2+ currents are about 80% larger than Ca2+ currents and inactivate little. The properties of I(Ca) characterise it as a high threshold L-type current. The outward current consists primarily of a fast, transient A current, I(K(A)) and a maintained, delayed rectifier current, I(K(V)). In some fibres, a small Ca2+-dependent K+ current is also present. I(K(A)) activates fast at depolarisation above -45 mV, shows pronounced inactivation and is almost completely inactivated at holding potentials more positive than -40 mV. I(K(A)) is half-maximally blocked by 70 microM 4-aminopyridine (4-AP), and 70 mM tetraethylammonium (TEA). I(K(V)) activates more slowly, at about -30 mV, and shows no inactivation. It is half-maximally blocked by 2 mM TEA but rather insensitive to 4-AP. Physiologically, the two K+ currents prevent all-or-nothing action potentials and determine the graded amplitude of active electrical responses and associated contractions. Tension development depends on and is correlated with depolarisation-induced Ca2+ influx mediated by I(Ca). The voltage dependence of peak tension corresponds directly to the voltage dependence of the integrated I(Ca). The threshold potential for contraction is at about -38 mV. Peak tension increases with increasing voltage steps, reaches maximum
Silverman, William R; Bannister, John P A; Papazian, Diane M
2004-11-01
In ether-a-go-go K+ channels, voltage-dependent activation is modulated by ion binding to a site located in an extracellular-facing crevice between transmembrane segments S2 and S3 in the voltage sensor. We find that acidic residues D278 in S2 and D327 in S3 are able to coordinate a variety of divalent cations, including Mg2+, Mn2+, and Ni2+, which have qualitatively similar functional effects, but different half-maximal effective concentrations. Our data indicate that ions binding to individual voltage sensors in the tetrameric channel act without cooperativity to modulate activation gating. We have taken advantage of the unique phenotype of Ni2+ in the D274A channel, which contains a mutation of a nonbinding site residue, to demonstrate that ions can access the binding site from the extracellular solution when the voltage sensor is in the resting conformation. Our results are difficult to reconcile with the x-ray structure of the KvAP K+ channel, in which the binding site residues are widely separated, and with the hydrophobic paddle model for voltage-dependent activation, in which the voltage sensor domain, including the S3-S4 loop, is near the cytoplasmic side of the membrane in the closed channel.
Evidence of low injection efficiency for implanted p-emitters in bipolar 4H-SiC high-voltage diodes
NASA Astrophysics Data System (ADS)
Matthus, Christian D.; Huerner, Andreas; Erlbacher, Tobias; Bauer, Anton J.; Frey, Lothar
2018-06-01
In this study, the influence of the emitter efficiency on the forward current-voltage characteristics, especially the conductivity modulation of bipolar SiC-diodes was analyzed. It was determined that the emitter efficiency of p-emitters formed by ion implantation is significantly lower compared to p-emitters formed by epitaxy. In contrast to comparable studies, experimental approach was arranged that the influence of the quality of the drift-layer or the thickness of the emitter on the conductivity modulation could be excluded for the fabricated bipolar SiC-diodes of this work. Thus, it can be established that the lower emitter injection efficiency is mainly caused by the reduced electron lifetime in p-emitters formed by ion implantation. Therefore, a significant enhancement of the electron lifetime in implanted p-emitters is mandatory for e.g. SiC-MPS-diodes where the functionality of the devices depends significantly on the injection efficiency.
Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function
Nicholson, Graham M.; Lewis, Richard J.
2006-01-01
Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.
[Histochemical characteristics of the secretory cells of gastric glands compared].
Shubich, M G; Mogil'naia, G M; Dudetskiĭ, V I; Bogatyr', L Ia
1978-02-01
The work is dedicated to complex histological studies of the secreting cells in the gastric fundal glands, in their comparative aspect. In the representatives of Amphibia, Reptilians and birds, histochemical differentiation of oxyntopeptic cells was demonstrated to be independent on the peculiarities of the animal nutrition. In mammals, histochemical characteristic of the carbohydrate component in the glandular secreting cells depends on the type of nutrition.
Method for voltage-gated protein fractionation
Hatch, Anson [Tracy, CA; Singh, Anup K [Danville, CA
2012-04-24
We report unique findings on the voltage dependence of protein exclusion from the pores of nanoporous polymer exclusion membranes. The pores are small enough that proteins are excluded from passage with low applied electric fields, but increasing the field enables proteins to pass through. The requisite field necessary for a change in exclusion is protein-specific with a correlation to protein size. The field-dependence of exclusion is important to consider for preconcentration applications. The ability to selectively gate proteins at exclusion membranes is also a promising means for manipulating and characterizing proteins. We show that field-gated exclusion can be used to selectively remove proteins from a mixture, or to selectively trap protein at one exclusion membrane in a series.
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching
NASA Astrophysics Data System (ADS)
Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest
2017-09-01
A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k = 2) at 1 MHz and 0.5 part in 106 (k = 2) at 100 kHz is within reach.
Growth behavior of anodic porous alumina formed in malic acid solution
NASA Astrophysics Data System (ADS)
Kikuchi, Tatsuya; Yamamoto, Tsuyoshi; Suzuki, Ryosuke O.
2013-11-01
The growth behavior of anodic porous alumina formed on aluminum by anodizing in malic acid solutions was investigated. High-purity aluminum plates were electropolished in CH3COOH/HClO4 solutions and then anodized in 0.5 M malic acid solutions at 293 K and constant cell voltages of 200-350 V. The anodic porous alumina grew on the aluminum substrate at voltages of 200-250 V, and a black, burned oxide film was formed at higher voltages. The nanopores of the anodic oxide were only formed at grain boundaries of the aluminum substrate during the initial stage of anodizing, and then the growth region extended to the entire aluminum surface as the anodizing time increased. The anodic porous alumina with several defects was formed by anodizing in malic acid solution at 250 V, and oxide cells were approximately 300-800 nm in diameter.
Self-aligned photolithography for the fabrication of fully transparent high-voltage devices
NASA Astrophysics Data System (ADS)
Zhang, Yonghui; Mei, Zengxia; Huo, Wenxing; Wang, Tao; Liang, Huili; Du, Xiaolong
2018-05-01
High-voltage devices, working in the range of hundreds of volts, are indispensable elements in the driving or readout circuits for various kinds of displays, integrated microelectromechanical systems and x-ray imaging sensors. However, the device performances are found hardly uniform or repeatable due to the misalignment issue, which are extremely common for offset drain high-voltage devices. To resolve this issue, this article reports a set of self-aligned photolithography technology for the fabrication of high-voltage devices. High-performance fully-transparent high-voltage thin film transistors, diodes and logic inverters are successfully fabricated with this technology. Unlike other self-aligned routes, opaque masks are introduced on the backside of the transparent substrate to facilitate proximity exposure method. The photolithography process is simulated and analyzed with technology computer aided design simulation to explain the working principle of the proximity exposure method. The substrate thickness is found to be vital for the implementation of this technology based on both simulation and experimental results. The electrical performance of high-voltage devices is dependent on the offset length, which can be delicately modulated by changing the exposure dose. The presented self-aligned photolithography technology is proved to be feasible in high-voltage circuits, demonstrating its huge potential in practical industrial applications.
Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli
2016-01-01
Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007
Coordinated Voltage Control of Transformer Taps on account of Hierarchical Structure in Power System
NASA Astrophysics Data System (ADS)
Nakachi, Yoshiki; Kato, Satoshi; Ukai, Hiroyuki
Participation of distributed generators (DG), such as wind turbines, co-generation system etc., is natural trend from ecological point of view and will increase more and more. The outputs of these DGs mainly depend on weather condition but don't correspond to the changes of electrical load demand necessarily. On the other hand, due to the deregulation of electric power market, the power flow in power system will uncertainly vary with several power transactions. Thus, complex power flow by DGs or transactions will cause the voltage deviation. It will be difficult to sustain the voltage quality by using the conventional voltage/reactive power control in near future. In this paper, in order to avoid such a voltage deviation and to decrease the frequency of transformer tap actions, the coordinated voltage control scheme of transformer taps on account of hierarchical structure in power system is proposed. In the proposed scheme, integral of voltage deviation at each layer bus is applied to decide the timing of each transformer tap action. It is confirmed by some numerical simulations that the proposed scheme is able to respond to every conditions on voltage deviation.
Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.
Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin
2013-08-06
Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.
Targeting mechanisms of high voltage-activated Ca2+ channels.
Herlitze, Stefan; Xie, Mian; Han, Jing; Hümmer, Alexander; Melnik-Martinez, Katya V; Moreno, Rosa L; Mark, Melanie D
2003-12-01
Functional voltage-dependent Ca2+ channel complexes are assembled by three to four subunits: alpha1, beta, alpha2delta subunits (C. Leveque et al., 1994, J. Biol Chem. 269, 6306-6312; M. W. McEnery et al., 1991, Proc. Natl. Acad. Sci. U.S.A. 88, 11095-11099) and at least in muscle cells also y subunits (B. M. Curtis and W. A. Catterall, 1984, Biochemistry 23, 2113-2118). Ca2+ channels mediate the voltage-dependent Ca2+ influx in subcellular compartments, triggering such diverse processes as neurotransmitter release, dendritic action potentials, excitation-contraction, and excitation-transcription coupling. The targeting of biophysically defined Ca2+ channel complexes to the correct subcellular structures is, thus, critical to proper cell and physiological functioning. Despite their importance, surprisingly little is known about the targeting mechanisms by which Ca2+ channel complexes are transported to their site of function. Here we summarize what we know about the targeting of Ca2+ channel complexes through the cell to the plasma membrane and subcellular structures.
High voltage variable diameter insulator
Vanacek, D.L.; Pike, C.D.
1982-07-13
A high voltage feedthrough assembly having a tubular insulator extending between the ground plane ring and the high voltage ring. The insulator is made of Pyrex and decreases in diameter from the ground plane ring to the high voltage ring, producing equipotential lines almost perpendicular to the wall of the insulator to optimize the voltage-holding capability of the feedthrough assembly.
Adaptive Q–V Scheme for the Voltage Control of a DFIG-Based Wind Power Plant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jinho; Seok, Jul-Ki; Muljadi, Eduard
Wind generators within a wind power plant (WPP) will produce different amounts of active power because of the wake effect, and therefore, they have different reactive power capabilities. This paper proposes an adaptive reactive power to the voltage (Q-V) scheme for the voltage control of a doubly fed induction generator (DFIG)-based WPP. In the proposed scheme, the WPP controller uses a voltage control mode and sends a voltage error signal to each DFIG. The DFIG controller also employs a voltage control mode utilizing the adaptive Q-V characteristics depending on the reactive power capability such that a DFIG with a largermore » reactive power capability will inject more reactive power to ensure fast voltage recovery. Test results indicate that the proposed scheme can recover the voltage within a short time, even for a grid fault with a small short-circuit ratio, by making use of the available reactive power of a WPP and differentiating the reactive power injection in proportion to the reactive power capability. This will, therefore, help to reduce the additional reactive power and ensure fast voltage recovery.« less
Thermal characterization of GaN-based laser diodes by forward-voltage method
NASA Astrophysics Data System (ADS)
Feng, M. X.; Zhang, S. M.; Jiang, D. S.; Liu, J. P.; Wang, H.; Zeng, C.; Li, Z. C.; Wang, H. B.; Wang, F.; Yang, H.
2012-05-01
An expression of the relation between junction temperature and forward voltage common for both GaN-based laser diodes (LDs) and light emitting diodes is derived. By the expression, the junction temperature of GaN-based LDs emitting at 405 nm was measured at different injection current and compared with the result of micro-Raman spectroscopy, showing that the expression is reasonable. In addition, the activation energy of Mg in AlGaN/GaN superlattice layers is obtained based on the temperature dependence of forward voltage.
Voltage balanced multilevel voltage source converter system
Peng, Fang Zheng; Lai, Jih-Sheng
1997-01-01
A voltage balanced multilevel converter for high power AC applications such as adjustable speed motor drives and back-to-back DC intertie of adjacent power systems. This converter provides a multilevel rectifier, a multilevel inverter, and a DC link between the rectifier and the inverter allowing voltage balancing between each of the voltage levels within the multilevel converter. The rectifier is equipped with at least one phase leg and a source input node for each of the phases. The rectifier is further equipped with a plurality of rectifier DC output nodes. The inverter is equipped with at least one phase leg and a load output node for each of the phases. The inverter is further equipped with a plurality of inverter DC input nodes. The DC link is equipped with a plurality of rectifier charging means and a plurality of inverter discharging means. The plurality of rectifier charging means are connected in series with one of the rectifier charging means disposed between and connected in an operable relationship with each adjacent pair of rectifier DC output nodes. The plurality of inverter discharging means are connected in series with one of the inverter discharging means disposed between and connected in an operable relationship with each adjacent pair of inverter DC input nodes. Each of said rectifier DC output nodes are individually electrically connected to the respective inverter DC input nodes. By this means, each of the rectifier DC output nodes and each of the inverter DC input nodes are voltage balanced by the respective charging and discharging of the rectifier charging means and the inverter discharging means.
Voltage balanced multilevel voltage source converter system
Peng, F.Z.; Lai, J.S.
1997-07-01
Disclosed is a voltage balanced multilevel converter for high power AC applications such as adjustable speed motor drives and back-to-back DC intertie of adjacent power systems. This converter provides a multilevel rectifier, a multilevel inverter, and a DC link between the rectifier and the inverter allowing voltage balancing between each of the voltage levels within the multilevel converter. The rectifier is equipped with at least one phase leg and a source input node for each of the phases. The rectifier is further equipped with a plurality of rectifier DC output nodes. The inverter is equipped with at least one phase leg and a load output node for each of the phases. The inverter is further equipped with a plurality of inverter DC input nodes. The DC link is equipped with a plurality of rectifier charging means and a plurality of inverter discharging means. The plurality of rectifier charging means are connected in series with one of the rectifier charging means disposed between and connected in an operable relationship with each adjacent pair of rectifier DC output nodes. The plurality of inverter discharging means are connected in series with one of the inverter discharging means disposed between and connected in an operable relationship with each adjacent pair of inverter DC input nodes. Each of said rectifier DC output nodes are individually electrically connected to the respective inverter DC input nodes. By this means, each of the rectifier DC output nodes and each of the inverter DC input nodes are voltage balanced by the respective charging and discharging of the rectifier charging means and the inverter discharging means. 15 figs.
Two-photon voltage imaging using a genetically encoded voltage indicator
Akemann, Walther; Sasaki, Mari; Mutoh, Hiroki; Imamura, Takeshi; Honkura, Naoki; Knöpfel, Thomas
2013-01-01
Voltage-sensitive fluorescent proteins (VSFPs) are a family of genetically-encoded voltage indicators (GEVIs) reporting membrane voltage fluctuation from genetically-targeted cells in cell cultures to whole brains in awake mice as demonstrated earlier using 1-photon (1P) fluorescence excitation imaging. However, in-vivo 1P imaging captures optical signals only from superficial layers and does not optically resolve single neurons. Two-photon excitation (2P) imaging, on the other hand, has not yet been convincingly applied to GEVI experiments. Here we show that 2P imaging of VSFP Butterfly 1.2 expresssing pyramidal neurons in layer 2/3 reports optical membrane voltage in brain slices consistent with 1P imaging but with a 2–3 larger ΔR/R value. 2P imaging of mouse cortex in-vivo achieved cellular resolution throughout layer 2/3. In somatosensory cortex we recorded sensory responses to single whisker deflections in anesthetized mice at full frame video rate. Our results demonstrate the feasibility of GEVI-based functional 2P imaging in mouse cortex. PMID:23868559
Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.
2011-01-01
In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494